EP1029062A1 - Inhibition of human immunodeficiency virus (hiv-1) replication - Google Patents

Abstract

The present invention is directed to an HIV-1-regulated antiviral system. The invention provides constructs and methods for transferring an antiviral enzyme into target cells, wherein the enzyme is under HIV-1 regulation. HIV-1 infection of the targeted cells causes the activation of the antiviral enzyme, and results in the inhibition of viral replication. The HIV-1 controlled antiviral approach can be combined with traditional chemotherapeutic approaches, permitting a significant reduction in antiviral drugs, with decreased side effects, and the maintenance of HIV-1 in a true latent state.

Description

INHIBITION OF HUMAN IMMUNODEFICIENCY VIRUS (HIV-n REPLICATION

Reference to Government Grants

The invention described herein was made, in part, in the course ot work suppoπed by United States Public Health Service Grant RO1-AI34765. The government has certain rights in this invention

Field of the Invention

This invention relates to intracellular immunization methods and compositions for inhibiting the replication of human virus (HIV), and for treating HIV infection and acquired immunodeficiency syndrome (AIDS)

Background of the Invention

A) HIV and AIDS

Human immunodeficiency virus (HIV) is the etiologic agent of acquired immunodeficiencN syndrome (AIDS ) Although much has been learned about the molecular characteristics of HIV and the progress of AIDS, the development of efficacious therapeutic or prophylactic treatment regimens has been beset with obstacles

B ) Treatment of HIV Intection and AIDS At the present time, there are no suitable vaccinations or cures for

HIV intection or AIDS Current strategies against HIV infection and AIDS. including nucleoside analogues and protease inhibitors, have limited effectiveness as evidenced by the evolution of resistant retroviral strains.

Until recently, the predominant treatment for HIV infection consisted of the 2' ,3'dideoxynucleoside analogues, which act as potent reverse transcriptase inhibitors. These compounds can significantly reduce the levels of

HIV virions in infected individuals, but, due to the low fidelity of HIV reverse transcriptase, can also aid in the selection of resistant viral strains.

The development of HIV protease inhibitors and nonnucleoside reverse transcriptase inhibitors expanded therapeutic options, permitting combination therapies which target multiple stages in the HIV life cycle. However, these anti-retroviral compounds have diverse side effects which often lead to complications and cessation of drug therapy. In addition, long-term studies have not been completed to assess the degree of retroviral mutation associated with combination therapies in vivo (Moyle et al. , Quart. J. Med. 86: 155-63 (1993)). Another difficulty with present methods is cost. Annual costs for the treatment of AIDS with triple combinations of reverse transcriptase and protease inhibitors are staggering, and such therapies may need to be continued indefinitely.

There is a need for additional therapeutic approaches which can control HIV infection, lower the effective dosage of antiviral drugs, decrease the associated toxicities, and reduce the development of resistant strains in HIV infected individuals.

C) Interferon and Interferon Inducible Genes

Interferons are hormone-like proteins involved in the defense mechanism of cells against viral infection and tumors. Type I interferons have the capacity to induce a series of antiviral gene products, through signal transduction pathways, which can interfere with viral infection. Included within the family of induced genes are three double-stranded RNA dependent enzymes: the 2' ,5'-oligoadenylate synthetase, adenosine deaminase. and the dsRNA-dependent, interferon-inducible protein kinase, PKR (Baglioni. Cell 17:255-264 (1979); Patterson et al . Virology 210:508-511 (1995)). The p68 protein kinase (PKR) and the 2' ,5'-oligoadenylate synthetase (2-5OAS)/RNase L pathways inhibit viral replication through the inhibition of protein synthesis and degradation of single stranded RNA, respectively.

A serine/threonine kinase, PKR (which has also been called DAI, p68, dsl, PI kinase, and PK_ds) has been highly conserved in evolution. Homologous enzymes are present in mammals, yeast, and plants (Chen et al. . Proc. Nad. Acad. Sci. USA 88:7729-7733 (1991); Kostura et al. , Mol. Cell Biol. 9: 1576-1586 (1989); Langland et al. , J. Biol. Chem. 271:4539-4544 (1996)). The human cDNA for PKR encodes a 2.5 kb RNA, which is translated into a 550 amino acid protein (Meurs et al. , Cell 62:379-390 (1990)). The binding of two molecules of this 68 kDa PKR about a single dsRNA molecule initiates an autophosphorylation event which is followed by phosphorylation of the subunit of eukaryotic initiation factor 2, preventing a GDP-for-GTP recycling reaction and leading to inhibition of protein synthesis initiation (Lee et al. , Virology 193: 1037-1041 ((1993); Matthews et al. , J. Virol. 65:5657-5662 (1991): Pathak et al . Mol. Cell Biol. 8:993-995 (1988)). Additional substrates for PKR phosphorylation, including Iκ-Bα. and the HIV-1 Tat transactivation proteins. have recently been identified (Brand etal. , J. Biol. Chem. 272:8388-8395 (1997); Maran et al , Science 265:789-792 (1994); McMillan et al . Virology 213:413- 424 (1995)). It has been repoπed that PKR can be activated in vitro by dsRNA structures located within the 3 ' untranslated mRNA region of human -tropomyosin (Davis et al . Proc. Nat I. Acad. Sci. USA 93:508-513 (1996)). Many eukaryotic viruses, including influenza virus, poliovirus,

Epstein-Barr virus, human T cell leukemia virus type I. adenovirus, and vaccinia virus, have developed strategies to down-regulate PKR protein and/or activity, demonstrating an evolutionary requirement to circumvent this antiviral system in order to efficiently replicate (Katze. Seminars Virol 4:259-268 (1993); Mathews et al . J. Virol 65:5657-5662 (1991); Mordechai et al. . Virology 206:913-922 (1995)). PKR has been demonstrated to effectively prevent infection of eukaryotic cells by encephalomyocarditis and vaccinia viruses (Lee et al.. Virology 193:1037-1041 (1993)).

HIV-1 has also devised strategies to interfere with the enzymatic activities of PKR. It has been reported that HIV-1 infection leads to a significant decline in the amount of intracellular PKR protein levels (Roy et al. , Science 247: 1216-1219 (1990)), and that HIV-1 TAR RNA has an optimal PKR activation concentration and conforms with a bell-shaped activation curve (Maitra et al. , Virology 204:823-827 (1994); Mathews. Seminars Virol. 4:247-257 (1993); Mordechai et al , Virology 206:913-922 (1995); Samuel, J. Biol. Chem. 268:7603-7306 (1993)).

The 2' , 5' - oligoadenylate synthetase (2-5OAS) is another interferon induced enzyme in the cellular dsRNA-dependent antiviral response. When activated by dsRNA, the 2-5OAS converts ATP into 2', 5' - oligoadenylate (2-5A). The 2-5A synthesized by 2-5OAS binds and activates ribonuclease L, which hydrolyzes both cellular and viral mRNA. In cells infected with HIV-1 , the level of 2-5 A is inversely correlated with HIV-1 virion production. In the initial stage of infection there is a transient activation of 2-5OAS. which leads to a strong increase in the level of 2-5 A. During later stages of infection HIV-1 virion production increases as 2-5 A levels decline. It has been reported that a high 2-5A level correlates with a low capacity of HIV infected cells to produce virus (Schroder et al , J. Biol Chem. 264:5669-73 (1989)), and that the production of HIV-1 can be inhibited by interferon, which is able to induce 2- 50AS (Ho et al . Lancet l(8429):602-04 (1985). It has also been reported that antisense RNA to 2-5OAS can result in the loss of protection by interferon from viral infection (DeBenedetti et al. , Proc. Natl. Acad. Sci USA 84:658-62 (1987)). D) Intracellular Immunization

Intracellular immunization is the regulated expression of a molecular species designed to interfere with and prevent viral replication. The concept and name "intracellular immunization" were proposed by David Baltimore in 1988 (Nature 335:395-396 (29 September 1988)). Baltimore proposed that cells could be genetically engineered to express a protein which would make them resistant to viral infection. Baltimore mentioned that, in the case of HIV, retroviral vectors could be used to transduce hematopoietic stem cells with the desired recombinant construct.

In order to be effective, a gene introduced for the purposes of intracellular immunization must be (i) stably expressed in sufficient quantities to interfere with viral replication, (ii) non-toxic to the cell, and (iii) transferred to the target cell population in a highly efficient, non-toxic manner (Wong et al , Curr. Top. Microbiol Immunol. 179: 159-174 (1992)).

In one application of intracellular immunization, the desired gene is introduced into cells under control of the HIV long terminal repeat (LTR). The hybrid gene can then be trans-activated by the Tat gene product or by HIV infection. The Tat protein acts on a cis-acting element of the HIV LTR. known as the TAR region, to increase expression from the LTR (Arva et al . Science 229:69-73 (1985)). The Tat protein is believed to regulate gene expression at both the transcriptional and translational levels. Initially, the majority of transcripts which are initiated from within an HIV-1 LTR are incomplete and the resulting RNA is prematurely short, with an average length of sixty to eighty ribonucleotides. The HIV-1 encoded 15 kDa Tat protein has been proposed to interact with this nascent short message and, in conjunction with cellular cofactors. bind to a stable RNA stem-loop structure within the HIV-1 LTR. TAR (Kashanchi et al . Nature (London) 367:295-299 (1994)). This proteimRNA interaction is thought to increase RNA elongation efficiency, leading to high-level production of full-length mRNAs (Foon et al. . J. Biol. Chem. 271:4201-4208 (1996); Mavankal et al , Proc. Natl. Acad. Sci. USA 93:2089-2094 (1996)). It has been reported that the Tat protein can induce uninfected quiescent T cells to become highly permissive for productive HIV-1 infection (Li et al.. Proc. Natl. Acad. Sci. USA 94:8116-20 (July 1997)). The Tat protein can also stimulate expression of heterologous genes placed 3' to a TAR region (Tong-Starksen et al. , Proc. Natl. Acad. Sci. USA 80:6845-49 (1987)), a property which can be exploited in intracellular immunization protocols.

U.S. Patent No. 5,554,528 is directed to constructs and methods of intracellular immunization in which a chimeric diphtheria toxin gene is placed under the regulatory control of an HIV LTR. The HIV-regulated toxin gene is stably introduced into HIV susceptible cells using a retroviral (or other) vector system, and transformed cells commit suicide in response to HIV infection. U.S. Patent No. 5,554,528 discloses a prophetic example in which SCID mice are reconstituted with peripheral blood monocytic cells or bone marrow cells which have been transfected with the HIV-regulated diphtheria toxin gene.

Bednarik et al. (Proc. Natl. Acad. Sci. USA 86:4958-4962 (July 1989)) have reported constructs and methods of intracellular immunization in which an a₂-interferon gene is placed under the regulatory control of an HIV-1 LTR. Retroviral vectors were used to introduce the HIV-regulated interferon gene into cells, and the transduced cells exhibited resistance to HIV infection.

Schroder et al (FASEB Journal 4:3124-3130 (October 1990); /« . J. Biochem. 24(l):55-63 (1992)) have reported constructs and methods of intracellular immunization in which a 2-50AS gene is placed under the regulatory control of an HIV-1 LTR. A plasmid vector was used to stably transfect HeLa- T4^~ cells with the HIV-regulated 2-50AS gene. Tat-induced activation of the LTR sequence within the HIV-1 LTR— 2-5 A synthetase plasmids led to a transient increase in 2-5OAS levels and activity, and a delay in the release of mature HIV-1 virions. There remains a great need for efficacious therapeutic and/or prophylactic treatment regimens for the control of HIV infection and AIDS.

Summary of the Invention

The present invention provides constructs and methods for stably introducing an antiviral enzyme into target cells, using a construct wherein antiviral gene expression is activated in the presence of an HIV trans-acting factor. Upon HIV infection of the target cells, antiviral gene expression is activated and viral replication is inhibited. This intracellular immunization approach can generate a reservoir of self-renewing cells which are unable to support HIV replication. The intracellular immunization approach can also be used in combination with other antiviral agents (single or multiple combinations of drugs such as nucleoside analogs and/or protease inhibitors), resulting in improved methods for prevention of and treatment for HIV infection and AIDS.

Activation of the antiviral enzyme PKR results in the death of HIV- 1 infected cells, thus preventing further viral replication and the subsequent infection of neighboring cells. The inventors constructed retroviral vectors capable of transferring a PKR coding region, under HIV-1 transcriptional regulation, into target Sup Tl lymphoblastoid cells. The target cells were then challenged with HIV- 1. HIV replication, as measured by syncytia formation, was inhibited up to 93 % in the transduced cells. The specific blockade of PKR activity, by treatment of the HIV-1 LTR— PKR cDNA transduced cell lines with the PKR inhibitor 2-aminopurine, reversed this antiviral effect. Whereas the expression and activity of PKR in untransduced SupTl cells and in parental vector transduced clones (N2-20P) were down-regulated 48 hours after HIV-1 infection. HIV-1 LTR— PKR cDNA transduced clones showed PKR expression through 96 hours post-infection, concomitant with maintenance of PKR autophosphorylation activity. One of the HIV-1 LTR— PKR cDNA transduced clones, when supplemented with 93 % less 3'-azido-3'-deoxythymidine than N2- 20P controls, reduced syncytia formation by 90% . The inventors have also shown that intracellular immunization using a 2-5 OAS gene can be used to control HIV infection.

One embodiment of the present invention provides a recombinant nucleic acid comprising: (a) a PKR coding region, and

(b) a regulatory element; wherein the PKR coding region and regulatory element are operatively linked such that PKR expression is activated in the presence of an HIV trans-acting factor. In a preferred embodiment the regulatory element comprises all or part of an HIV LTR. In another preferred embodiment the HIV trans-acting factor is an HIV Tat protein.

The invention further provides a vector comprising a recombinant nucleic acid according to the invention. In a preferred embodiment the vector is a viral vector. In a more preferred embodiment the vector is a retroviral vector. In a most preferred embodiment the vector comprises M-MuLV sequences. In some embodiments the retroviral vector has essentially the characteristics of pMEA105 or pMEAlOό.

The invention also provides a viral vector comprising: (a) a 2-50AS coding region, and (b) a regulatory element; wherein the 2-5OAS coding region and regulatory element are operatively linked such that 2-5OAS expression is activated in the presence of HIV trans-acting factors. In a preferred embodiment the regulatory element comprises all or part of an HIV LTR. In another preferred embodiment the HIV trans-acting factor is an HIV Tat protein. In a most preferred embodiment the viral vector comprises M-MuLV sequences . In some embodiments the viral vector comprises 5 ' and 3 ' M-MuLV LTRs and a neomycin resistance gene. In some embodiments the viral vector has essentially the characteristics of pMEA109 or pMEAHO. Another aspect of the invention is a cell comprising a nucleic acid according to the invention, or a cell which has been transduced or transformed with a viral vector according to the invention.

In a preferred embodiment the cell is a prokaryotic cell. In another preferred embodiment the cell is a eukaryotic cell. In some preferred embodiments the cell is a stem cell. In a most preferred embodiment the cell is a CD34-expressing cell. In some preferred embodiments the cell is a CD4- expressing cell. In some embodiments the cell is a retroviral packaging cell or a retroviral producer cell. In some embodiments the nucleic acid is stably integrated into the cellular genome in such a way that PKR expression is activated by HIV infection. In some embodiments the 2-50AS coding region and regulatory element are stably integrated into the cellular genome in such a way that the 2-5OAS expression is activated by HIV infection.

The invention also provides a method of inhibiting the replication of HIV comprising introducing a nucleic acid or a vector according to the invention into a cell which is susceptible to HIV infection. In a preferred embodiment a PKR coding region operatively linked to a regulatory element is stably integrated into the cellular genome, such that PKR expression is activated by HIV infection. In another preferred embodiment a 2-50AS coding region operatively linked to a regulatory element is stably integrated into the cellular genome, such that 2-5OAS expression is activated by HIV infection.

Another aspect of the invention is a method of inhibiting HIV replication in a patient in need of such treatment comprising introducing a nucleic acid or a vector according to the invention into cells from the patient. In a preferred embodiment at least one chemotherapeutic agent is also administered to the patient. In a more preferred embodiment the chemotherapeutic agent is selected from the group consisting of nucleoside analogs and protease inhibitors. In a most preferred embodiment the chemotherapeutic agent is AZT. In some embodiments the nucleic acid or vector is introduced into the cells ex vivo. In some embodiments the nucleic acid or vector is introduced into the cells in vivo. In some embodiments the nucleic acid or vector specifically targets stem cells. In a most preferred embodiment, the nucleic acid or vector specifically targets CD34-expressing cells. In some embodiments the nucleic acid or vector specifically targets CD4-expressing cells. In some embodiments of the method a PKR coding region operatively linked to a regulatory element is stably integrated into the cellular genome, such that PKR expression is activated by HIV infection. In some embodiments a 2-5OAS coding region operatively linked to a regulatory element is stably integrated into the cellular genome, such that 2- 5OAS expression is activated by HIV infection. The invention further constitutes a method of preventing HIV replication in a human host comprising introducing a nucleic acid or a vector according to the invention into cells from the host. In some embodiments the nucleic acid or vector is introduced into the cells ex vivo. In some embodiments the nucleic acid or vector is introduced into the cells in vivo. The invention also constitutes the use of a nucleic acid or a vector according to the invention for the preparation of a medicament to inhibit or prevent HIV replication in a patient or human host.

Other aspects and advantages of the present invention are described in the drawings and in the following detailed description of the preferred embodiments thereof.

Description of the Drawings

Figures 1A and IB show the construction and genomic integration of the HIV-1 LTR-PKR cDNA constructs. Figure 1A shows the HIV-I LTR— PKR cDNA— poly(A) sequence cloned in forward (pMEA105) and reverse (pMEA106) orientations into the pN2 retroviral vector. Figure IB shows the genomic integration of these constructs into the GP+envAml2 retroviral producer cell line. The location of Xbal sites in pN2 (N2-20), pMEA105 (105-10), and pMEA106 (106-4). and the size of the fragments which contain sequences complementary to the [^j2P]-neo probe are shown. The poly (A) sequence is depicted as an asterisk (*) 3' to the PKR cDNA sequence. Figure IC shows a Southern blot of Xbal digested genomic DNA from the indicated cell sources. Lanes 1-3: GP+envAml2 cells supplemented with 10, 1. and 0.1 ng pMEA106 (2681 bp); lane 4: N2-20 retroviral producing cells (3283 bp), lane 5: N2-20 transduced, G418 selected SupTl cells (3283 bp); lane 6: 106-4 retroviral producing cells (2681 bp); lane 7: 106-4 transduced, G418 selected SupTI cells (2681 bp). Arrows depict the migration of the expected 3283 and 2681 bp fragments. The migration of fragments from a lambda Hindlll digest is indicated.

Figure 2 shows a challenge of HIV- 1 LTR-PKR transduced SupTl cells with HIV-1 IIIB. Clones were infected with HIV-1 IIIB at an m.o.i. of 0.1 and syncytia were scored in quadruplicate at multiple dilutions. A single syncytia score was calculated as described in Example 5. A control in which HIV-1 was incubated with media alone prior to serial dilution and addition of SupTI indicator cells yielded no syncytia 96 hours after infection. The solid and open bars represent 0 and 10 mM 2-aminopurine, respectively. Results represent the mean ± S.E. of two independent experiments .

Figures 3A-3F show photographs (magnification x 100) of syncytia generated by HIV-1 IIIB infection. Transduced, selected clones (1 x 10" cells) were infected with HIV-1 IIIB for 2 h at a m.o.i. of 0.1. Cells were washed and replated at 5 x 10⁵ cells/ml in RPMI 1640 supplemented with 10% heat-inactivated FBS. Photographs were taken 96 hours p.i. with an Olympus inverted research microscope. Figure 3A = SupTl ; Figure 3B = N2-20P; Figure 3C = 105-10:27; Figure 3D = 105-10:239; Figure 3E = 106-4:560; Figure 3F = 106-4:582. Figures 4A-4F show a Western blot analysis of PKR expression during HIV-I IIIB infection. Protein levels of PKR were monitored by Western blot following HIV-1 infection at 24 h intervals. PKR was calculated to be 68 kDa as determined by migration alongside bovine serum albumin (65 kDa, contained within the rainbow molecular weight markers, Amersham). "U" denotes uninfected cells. Results are representative of two independent experiments. Figure 4A = SupTl; Figure 4B = N2-20P; Figure 4C = 105-10:27; Figure 4D = 105-10:239; Figure 4E = 106-4:560; Figure 4F = 106-4:582. Figures 5A and 5B show PKR autophosphorylation levels throughout HIV-1 IIIB infection in HIV-1 LTR-PKR cDNA transduced clones. Cells were collected at the indicated times after infection with HIV-I IIIB. Following protein extraction and immunoprecipitation, autophosphorylation assays were performed. Extracts were supplemented with 0 (Figure 5A) or 0.1 ._tg/ml (Figure 5B) of poly(rI)-poly(rC) during the enzymatic assay. Results were quantitated by analysis on a Fuji BAS2000 phosphorimager. For each sample, the bars from left to right represent 0. 24, 48. 72, and 96 hours postinfection, respectively.

Figure 6 shows NF-κB activation in HIV-1 LTR-PKR cDNA transduced clones infected with HIV-1 IIIB. Nuclear extracts from HIV-1 IIIB infected ( + ) and uninfected (-) SupTl cells were prepared 72 hours after infection. Five micrograms of nuclear extract protein were incubated with a 0.0375 pmole [γ-³²P] ATP end-labeled KB oligonucleotide probe and resolved on a non-denaturing 4% TBE acrylamide gel. Figure 7 shows treatment of HIV-I LTR-PKR cDNA transduced clones with 3' -azido-3' -deoxythymidine. Each clone (2 x 10^s cells) was incubated with the indicated concentration of AZT 1 hour prior to infection with HIV-1 IIIB. Forty-eight hours p.i. , the cells were serially diluted and 2 x 10⁵ SupTl indicator cells were added to each well. Syncytia scores were calculated 96 hours

p.i. ♦ = SupTl . ■ = N2-20P, ^A = 105-10:27, x = 105-10:239. ^τ =

106-4:560, • = 106-4:582. Results represent the mean ± S.E. of three independent experiments. Detailed Description of the Invention

The present invention relates to the discovery of constructs and methods for inhibiting the replication of HIV in a cell which is susceptible to HIV infection, and for the control of HIV infection and AIDS. The inventors placed the enzyme PKR under the transcriptional control of an essential HIV-1 transcriptional element and introduced this construct into HIV-1 receptive cells utilizing a Moloney murine leukemia virus (M-MuLV) retroviral-mediated shuttle system. SupTl lymphoblastoid cell lines transduced with the HIV-1 LTR-PKR cDNA constructs exhibited a significant decrease in syncytia formation when challenged with HIV-1 IIIB. In contrast to control cell lines, the protein and enzymatic levels of PKR in the transduced cell lines remained elevated following retroviral challenge. These results suggested an anti-HIV-1 therapeutic approach involving the supplementation of endogenous PKR levels produced via the interferon signaling pathway, with PKR protein produced from the HIV-1 induced Tat trans-activation of TAR. Under this approach the intracellular concentration of PKR would be increased in infected cells, thereby elevating the concentration of HIV-I TAR RNA required for PKR enzymatic inhibition.

A) Definitions The following definitions, of terms used throughout the specification, are intended as an aid to understanding the scope and practice of the present invention.

"Intracellular immunization" is a gene therapeutic approach to the treatment of viral infection, in which susceptible cells are genetically modified to express a product which interferes with infection or viral replication.

A "regulatory element" is any nucleic acid sequence which is capable of regulating gene expression.

"Operatively linked regulatory element" means that a polypeptide coding region is connected to a regulatory element in such a way that the regulatory element can permit expression of the polypeptide when appropriate molecules (such as activator proteins and polymerases) are present in a cell or cell free system.

"Gene expression" means the realization of genetic information encoded by a nucleic acid to produce a functional RNA or protein.

"Homology" means similarity of sequence reflecting a common evolutionary origin. Proteins are said to have homology, or similarity, if a substantial number of their amino acids are either (1) identical, or (2) characterized by conservative amino acid substitutions. "Conservative amino acid substitutions" are substitutions with an amino acid which has a related side chain R. Amino acids are typically classified into seven groups on the basis of the side chain R: (1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group.

"Substantial amino acid sequence homology" means an amino acid sequence homology greater than about 30 percent, preferably greater than about 60% , more preferably greater than about 80% , and most preferably greater than about 90 percent.

A "biologically active fragment" of a protein is a fragment derived from the protein which retains at least one biological activity of the protein.

A "biologically active derivative" of a protein is any analogue, variant, derivative, or mutant which is derived from the protein, which has substantial amino acid sequence homology with the protein, and which retains at least one biological property of the protein.

A "nucleic acid" is a polymeric compound comprised of covalently linked subunits called nucleotides. Nucleic acid includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may be single- stranded or double-stranded. DNA includes cDNA, genomic DNA, synthetic DNA, and semi-synthetic DNA.

A "recombinant nucleic acid" is a nucleic acid molecule in which sequences which are not contiguous in a native context are placed next to each other by experimental manipulation.

A "vector" is any means for the transfer of a nucleic acid into a host cell. The term vector includes both viral and nonviral means for introducing the nucleic acid into a prokaryotic cell in vitro, ex vivo, or in vivo. Non-viral vectors include but are not limited to plasmids, liposomes, electrically charged lipids (such as cytofectins), DNA-protein complexes, and biopolymers. Viral vectors include but are not limited to vectors derived from retrovirus, adeno- associated virus, pox viruses, baculovirus, vaccinia virus, herpes simplex virus, Epstein-Barr virus, adenovirus and hybrids of two or more viral vector types. In addition to an antiviral construct according to the invention, a vector may contain one or more regulatory regions, and/or selectable markers useful in selecting, measuring, and monitoring nucleic acid transfer results (transfer to which tissues, duration of expression, etc.).

The term "cell" includes higher eukaryotic cells such as mammalian cells, lower eukaryotic cells such as yeast cells, prokaryotic cells, and archaebacterial cells.

"Pharmaceutically acceptable carrier" includes diluents and fillers which are pharmaceutically acceptable for method of administration, are sterile, and may be aqueous or oleaginous suspensions formulated using suitable dispersing or wetting agents and suspending agents. The particular pharmaceutically acceptable carrier and the ratio of active compound to carrier are determined by the solubility and chemical properties of the composition, the particular mode of administration, and standard pharmaceutical practice.

B) Abbreviations

The following abbreviations are used in this specification. 2-5 A 2 ' ,5' -oligoadenylate

2-5OAS 2 ' ,5 '-oligoadenylate synthetase

AIDS acquired immunodeficiency syndrome

AZT 3 '-azido-3' deoxythymidine

DMEM Dulbecco's modified Eagle's medium

D10G media composed of 89% DMEM supplemented with 2 mM L-glutamine, 10% calf serum, and 1 % penicillin (10,000 units/ml)/streptomycin (10 mg/ml) antibiotic mixture

10 dsRNA double-stranded RNA eIF-2a a subunit of eukaryotic initiation factor 2

FACS fluorescence activated cell sorting

GEMSA gel electrophoretic mobility shift assay

HIV human immunodeficiency virus

15 HIV-1 human immunodeficiency virus, type one

HIV-2 human immunodeficiency virus, type two i.p. intraperitoneal injection

LTR long terminal repeat m.o.i. multiplicity of infection

20 M-MuLV Moloney murine leukemia virus

PBMC peripheral blood monocytic cells p.i. post infection

PKR dsRNA-dependent, IFN-inducible protein kinase

SCID severe combined immunodeficiency, characterized

25 by the loss of both T and B cell immunity

SDS sodium dodecyl sulfate

SDS-PAGE SDS-polyacrylamide gel electrophoresis

SIV simian immunodeficiency virus

TPA 12-O-tetradecanoylphorbol 13-acetate

30 VSV vesicular stomatitis virus C) Proteins

The constructs and methods according to the invention make use of nucleic acids encoding PKR or 2-50AS. The native human PKR and 2-5OAS genes, have been cloned and sequenced (Mory et al . J. Interferon Research 9:295-304 (1980); Wathelet etal. , FEBS Letters 196: 113-20 (1986); Meurs etal..

Cell 62:379-90 (1990)).

Different variants of a given protein may exist in nature. These variants may be allelic variations characterized by differences in the nucleotide sequences of the structural gene coding for the protein, or may involve differential splicing or post-translational modification. The skilled artisan can produce derivatives of a protein having single or multiple amino acid substitutions, deletions, additions, or replacements. These derivatives may include, ter alia: (a) derivatives in which one or more amino acid residues are substituted with conservative or non-conservative amino acids, (b) derivatives in which one or more amino acids are added to the protein, (c) derivatives in which one or more of the amino acids includes a substituent group, and (d) derivatives in which the protein is fused with another peptide. The techniques for obtaining these derivatives, including genetic (suppressions, deletions, mutations, etc.). chemical, and enzymatic techniques, are known to persons having ordinary skill in the art.

Biologically active fragments and biologically active derivatives of PKR and 2-5OAS are intended to be included within the scope of the invention.

D) Nucleic Acids The techniques of recombinant DNA technology are known to those of ordinary skill in the art. General methods for the cloning and expression of recombinant molecules are described in Maniatis (Molecular Cloning. Cold Spring Harbor Laboratories, 1982), and in Ausubel (Current Protocols in Molecular Biology. Wiley and sons, 1987). which are incorporated herein by reference.

E) Regulatory Elements

In the methods and constructs according to the invention, the PKR coding region or 2-5OAS coding region is operatively linked to a regulatory element such that the expression of PKR or 2-5OAS is activated in the presence of HIV trans-acting factors.

In a most preferred embodiment, the regulatory element comprises all or part of an HIV LTR and the HIV trans-acting factor is an HIV Tat protein. The full length HIV LTR as well as any fragments thereof which retain the ability to respond to trans-activation by the Tat protein are all intended to be encompassed by the invention.

Other regulatory elements can also be used in the methods and constructs of the invention. One example that may be mentioned is the Rev/RRE system.

The HIV Rev protein can trans-activate the expression of heterologous genes which contain the negative cis-acting repressive sequences (crs) and a correctly oriented Rev responsive element (RRE) (Rosen et al. . Proc. Natl. Acad. Sci. USA 85:2071-75 (1988)). It is further understood that the art may discover other regulatory elements and trans-activating factors which can facilitate the HIV-regulated expression of chimeric constructs. The skilled artisan can also add other known regulatory elements to mediate inducible gene expression, such as regulatory sequences which respond to an environmental signal such as heat, cold, or a chemical compound. F) Vectors and Methods of Gene Transfer

In a preferred embodiment of the invention, the protein coding region and regulatory element are introduced into a cell using a vector. In a most preferred embodiment, the protein coding region and regulatory element become stably integrated into the cellular genome.

Non-viral vectors may be transferred into cells using any of the methods known in the art, including calcium phosphate coprecipitation, lipofection (synthetic anionic and cationic liposomes), receptor-mediated gene delivery, naked DNA injection, electroporation and bioballistic or particle acceleration. Viral vectors may be transferred into cells using any method known in the art. including infection and transfection.

In a most preferred embodiment, a retroviral vector is used to introduce the protein coding region and regulatory element into a cell which is susceptible to HIV infection. Retroviruses are integrating viruses which generally infect dividing cells. The retrovirus genome includes two LTRs. an encapsidation sequence and three coding regions (gag, pol and env). The construction of recombinant retroviral vectors is known to those of skill in the art.

In recombinant retroviral vectors, the gag, pol, and env genes are generally deleted, in whole or in part, and replaced with a heterologous nucleic acid sequence of interest. These vectors can be constructed from different types of retrovirus, such as M-MuLV, MSV (murine Moloney sarcoma virus). HaSV (Harvey sarcoma virus), SNV (spleen necrosis virus), RSV (Rous sarcoma virus) and Friend virus. In general, in order to construct recombinant retroviruses containing a sequence according to the invention, a plasmid is constructed which contains the LTRs, the encapsidation sequence and the coding sequence. This construct is used to transfect a packaging cell line, which cell line is able to supply in trans the retroviral functions which are deficient in the plasmid. In general, the packaging cell lines are thus able to express the gag, pol and env genes. Such packaging cell lines have been described in the prior art. In particular the cell line PA317 (US 4,861 ,719), the PsiCRIP cell line (WO90/02806), and the GP+envAm-12 cell line (WO89/07150) may be mentioned. Recombinant retroviral vectors are purified by standard techniques known to those having ordinary skill in the art.

Retroviral vectors derived from lentiviruses such as HIV-1. HIV-2. and SIV can be used for delivery to nondividing cells. These viruses can be pseudotyped with the surface glycoproteins of other viruses, such as M-MuLV or vesicular stomatitis virus (VSV). The production of high titer HIV-1 pseudotyped with VSV glycoprotein has been disclosed by Bartz and Vodicka (Methods 12(4): 337-42 (August 1997)). and multiply attenuated lentiviral vectors have been disclosed by Zufferey et al. (Nature Biotechnology 15:871-75 (September 1997)). Such lentiviral vectors can infect nondividing cells, have a broad host range, and can be concentrated to high titers by ultracentrifugation. Chimeric adenoviral/retroviral vector systems can also be used to achieve efficient gene delivery and long term gene expression. A chimeric viral system in which adenoviral vectors are used to produce transient retroviral producer cells in vivo, such that progeny retroviral particles infect neighboring cells has been described by Feng et al. (Nature Biotechnology 15:866-70 (September 1997)).

M-MuLV can also be pseudotyped with HIV envelope glycoproteins to generate a retroviral vector with specificity for CD4-expressing cells, as disclosed by Schnierle et al. (Proc. Natl. Acad. Sci. USA 94:8640-45 (August 1997)).

G) Cells

The recombinant constructs according to the invention may be transferred into hematopoietic progenitor and stem cells or into differentiated cells which are susceptible to HIV infection. Stem cells are a special class of cells which have the capacity to replicate themselves as well as the capacity to generate lineage restricted progenitors which further differentiate and expand into specific lineages. Stem cells may be totipotent (germ line stem cells), pleuripotent (e.g. CD34 + hematopoietic stem cells), or unipotent (e.g. lymphoid progenitor cells).

In a preferred embodiment, the constructs are introduced into human hematopoietic progenitor and stem cells. These primitive cells, which can be isolated from sources including bone marrow, peripheral blood, and cord blood, are capable of giving rise to progeny in all hematopoietic lineages. By targeting pleuripotent stem cells, the introduction of an HIV-1 regulated antiviral enzyme such as PKR or 2-5 OAS only needs to be performed a single time to provide protection for differentiated cells receptive to macrophage-tropic and T- cell-tropic strains of HIV (Rana et al , J. of Virol. 71:3219-3227 (1997)).

Primitive human hematopoietic progenitors and stem cells are characterized, inter alia, by the expression of the CD34 cell surface glycoprotein. Methods of enriching for CD34^" cells using anti-CD34 antibodies, including immunosorption, immunomagnetic separation and fluorescence activated cell sorting (FACS), are known in the art. Cells expressing a specific CD34 subtype and/or cells expressing other lineage specific markers may be selected using similar techniques. Cells expressing nonlineage markers may be removed by immunomagnetic depletion, immunoadsorption, or FACS. Differential centrifugation methods may also be used, generally in combination with positive and negative antibody selection, to enrich for a desired cell population. The transfection of progenitor and stem cells with constructs according to the invention can generate a reservoir of immunocompetent HIV resistant cells which can differentiate into more mature components of the hematopoietic system, including CD4⁺ and macrophage descendants. It is important to select for high titer producers, as described in Example 3. and to transduce a large proportion of the target cells, in order to generate an adequate reservoir of resistant cells. Methods for isolating, identifying, separating, and culturing hematopoietic stem cells are disclosed in U.S. 5,635,387 and U.S. 5,643,741 which are incorporated herein by reference. Hematopoietic stem cells may be expanded in vitro, in the presence or absence of various cytokines, either before or after retroviral transduction. Methods and compositions for retroviral transduction of hematopoietic stem cells are disclosed in WO96/33281 which is incorporated herein by reference.

In another preferred embodiment, the constructs are introduced into more mature human hematopoietic cells which are already susceptible to infection by HIV. Because these differentiated cells have a finite life span, it may be necessary to repeat the introduction of HIV- 1 regulated antiviral constructs into targeted cells two or more (including many) times. In some embodiments, the antiviral constructs are introduced into both stem cells and differentiated cells.

HIV-1 infects T cells through CD4 and chemokine coreceptors.

CD4-expressing lymphocytes are the primary targets of HIV, and represent one of the main sources of viral replication. CD4⁺ cells may be selected from sources including peripheral blood monocytic cells, using anti-CD4 antibodies (for positive selection) and other antibodies (for negative selection) in methods including immunosorption, immunomagnetic separation, and FACS. The transfection of COX lymphocytes with constructs according to the invention can reduce the virus load in the peripheral blood and/or lymph nodes of patients infected with HIV.

H) Methods of Treatment Patient selection: The methods and constructs according to the present invention mediate the killing of HIV-infected cells, and therefore prevent the release of progeny virus and the spread of infection within a patient.

The methods and constructs according to the invention may be used to treat individuals who are already infected with HIV. This approach generates a reservoir of (otherwise susceptible) cells which are not susceptible to infection, and can prevent or ameliorate the symptoms associated with AIDS. The methods and constructs according to the invention are particularly useful for the treatment of HIV- 1 infected individuals who are resistant to one or more inhibitors of HIV protease and/or reverse transcriptase.

The methods and constructs according to the present invention may be used to treat uninfected individuals who are at high risk for HIV infection and AIDS, due to sexual conduct, intravenous drug use, medical condition, employment, or other significant risk. This approach can be used to prevent HIV infection as well as deleterious sequelae.

The recombinant constructs according to the invention may be transferred into human cells for clinical applications, using either ex vivo or in vivo approaches.

In the ex vivo approach, cells are removed from the patient. enriched, cultured, and infected or transfected with the recombinant construct, then reintroduced back into the patient. Methods for ex vivo gene therapy have been disclosed by Blaese et al. (Science 270:475-80 (1995)), Kohn et al (Nature Medicine 1(10): 1017-23 (October 1995)), and Ferrari et al. (Blood 80: 1120-24 (1992)). all of which are incorporated by reference. For ex vivo administration, cells are typically transduced at a multiplicity of infection (m.o.i.) of about 0.1 to about 100. preferably about 0.1 to about 10, and most preferably about 0.1 to about 1.0 infectious recombinant retroviral particles per cell. In some protocols 2-5 colony forming units (CFU) are used per target cell. Gene modified cells may be reintroduced into the patient by parenteral methods including intravenous infusion and direct injection into the bone marrow. Gene modified cells are reintroduced into the patient in a saline solution or other pharmaceutically acceptable carrier. The number of cells to be reintroduced depends on the purity of the cell population, but a typical dosage is in the range of about 10⁵ to about 10⁸ cells per kilogram of patient body weight. For example, when CD34⁺ cells are selected before ex vivo transduction. about 10⁶ to about 10⁸ cells are typically reintroduced into the patient. For more highly enriched cell populations, correspondingly fewer cells need to be reintroduced into the patient. Due to the differing antiviral potentials observed among different clones, a prescreening step to verify proper expression and activation of PKR in the presence of Tat protein may be incorporated into the gene therapeutic strategy.

In the in vivo approach, recombinant vectors are injected directly into the patient. The vectors are constructed so as to preferentially be incorporated into target (e.g. , CD34⁺ stem cells or CD4" lymphocytes) cells. For example, the pseudotyping of M-MuLV virus with truncated HIV envelope glycoproteins can generate a retroviral vector which specifically infects CD4 ^" cells (Schnierle et al . Proc. Natl. Acad. Sci. USA 94:8640-45 (August 1997)). For in vivo administration, about 10⁵ to about 10⁹ vectors are infused by a parenteral method such as intravenous infusion or direct injection into the bone marrow.

The methods and constructs according to the present invention can be used in combination with other antiviral drugs such as AZT, ddl. ddC, protease inhibitors, and combinations thereof. The intracellular immunization approach allows for a significant reduction in antiviral drugs, the maintenance of HIV-I in a true latent state while maintaining an intact immune system, and decreased side effects.

SCID mice which have been reconstituted with human cells are used as an animal model to study HIV infection and AIDS, and to optimize treatment protocols before their use in human subjects. SCID mice are reconstituted with peripheral blood monocytic cells or bone marrow cells transfected, using retroviral vectors, with the HIV-regulated constructs according to the invention. The animals are subsequently exposed to HIV and their susceptibility to infection is monitored. Examples

The following examples illustrate the invention. These examples are illustrative only, and do not limit the scope of the invention.

EXAMPLE 1

Materials and Methods

A) Oligonucleotides

The following oligonucleotides were used for the experiments described herein: ( 1 ) SEQ ID NO : l , HIV- 1 LTR p rimer

[5'-d(CTGGCTAGCTAGGGAAC)-3'] complementary to nucleotides 685 to 701 in pMEAOOl ;

(2) SEQ ID NO:2, polyA( l ) 65-mer

[5 ' d(CGATAGATCTAATAAAAGACCGCGGGCCCTTAAGGCCTTGTGT GTTGGTTTTTTGTGTGCTCGAG)-3'];

(3) SEQ ID NO:3, complementary polyA(2) 63-mer [5 ' -d(CTCGAGC AC AC AA A AAACCA AC AC AC AAGGCCTTAAGGGCCC GCGGTCTTTTATTAGATCTAT)-3 ' ] ; and

4) SEQ ID NO:4. sense probe oligonucleotide corresponding to the NF- B binding site 5'-ACAAGGGACTTTCCGCTGGGGACTTTCCA GGGA-3' .

B) Cell Culture and Virus Preparation

NIH/3T3 cells were obtained from the American Type Culture Collection (Rockville, MD). Molt4 cells chronically infected with HIV-1 IIIB (Molt 4 IIIB) and SupTl cells were obtained from the NIH AIDS Research Reference and Reagent Program, and were grown at 37^CC, 5 % C0₂ in RPMI 1640 (GIBCO) containing 10% heat-inactivated donor calf serum supplemented with 100 units/ml penicillin-streptomycin (RIO) (Biofluids, Inc.). The amphotrophic retroviral packaging cell line GP+envAml2 was provided by Dr. Arthur Bank (Columbia University, New York).

NIH/3T3 cells and the GP+envAml2 cell line were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% heat-inactivated calf serum supplemented with 2 mM glutamine and 100 units/ml penicillin- streptomycin (D10G). Culture supernatants from Molt4 IIIB cells were used as the source of infectious virus. The supernatant was cleared by centrifugation (500 x g. 5 min. 4°C) and stored in 10 ml aliquots at -70°C until use. HIV-1 IIIB titer was calculated by infection of SupTl cells, serial dilution, and scoring of syncytia formation in quadruplicate.

EXAMPLE 2 Construction of Plasmids Containing PKR cDNA

An HIV-1 LTR-PKR cDNA-ρoly(A) cassette was cloned in forward (pMEA105) and reverse (pMEA106) orientations into the pN2 retroviral vector, as illustrated in Figure 1A. This retroviral vector was chosen because it can be used to effect the stable integration of the HIV-1 LTR-PKR cDNA— poly(A) cassette into target cells, using replication-incompetent MMuLV particles. This retro viral-mediated intracellular immunization approach was designed to provide (i) an efficient and well-characterized delivery system, (ii) specificity in that the PKR cDNA constructs are transcribed and activated at high levels only upon HIV-1 infection, and (iii) a system which is tightly regulated and silent in uninfected cells due to its dependency on dsRNA for allosteric activation.

A) Construction of pMEAOOl

To construct pMEAOOl , the p68-pcDNAI/NEO plasmid (provided by Dr. Glen Barber, University of Washington, Seattle) containing the wild-type

PKR cDNA was amplified by standard bacterial culture protocols and digested with Hindlll, PstI, and Hhal to yield 36 fragments (Meurs etal. , Cell 62:379-390 (1990)). An 1826 nucleotide Hindlll/PstI fragment containing the wt PKR cDNA was purified using DEAE-cellulose. The pHIVαJFN plasmid (provided by Dr. Daniel P. Bednarik, Human Genome Sciences, Rockville, MD) was digested with Xhol and Hindlll, releasing a 727 bp fragment containing portions of the U3 and R regions and an additional 195 nucleotides of viral DNA located in the HIV-1 LTR. (Bednarik et al. , Proc. Natl. Acad. Sci. USA 86:4958-4962 (1989); Rosen et al . Cell 41:813-823 (1985): Sodroski et al . Science 225:381-385 (1984)).

To serve as the backbone plasmid, a pSP72 vector (Promega) was digested within its multiple cloning region with Xhol and PstI; the larger 2434 bp nucleotide fragment was isolated and a triple ligation was performed to create the plasmids which contain the HIV-1 LTR controlling the expression of wt PKR cDNA. Restriction mapping and DNA sequencing were utilized to identify bacterial colonies carrying the desired plasmid construct.

B) Construction of pMEAlOl The pMEAOOl plasmid was created without a downstream polyadenylation signal following the cDNA insert. Although a polyadenylation signal would be provided by the 3' MMuLV LTR to sequences cloned in the forward orientation, for efficient reverse orientation posttranscriptional processing prior, a synthetic 65-mer oligonucleotide, polyA(l), was synthesized to contain the upstream AATAAA polyadenylation signal, a 23 nucleotide spacer region, the downstream polyadenylation (GT)_n(T)_n sequences from rabbit β-globin mRNA. and an additional Xhol site at the 3 ' end (Chen et al. , Nucleic Acids Res. 12: 1767-1768 (1984); Gil et al . Cell 49:399-406 ( 1987); Levitt et al , Genes & Dev. 3: 1019-1025 (1989); McDevitt et al , EMBO J. 5:2907-2913 (1986)). When annealed with its complementary synthetic oligonucleotide [polyA(2)] , the 5 ' Clal overhang and a 3 ' blunt end permitted the opportunity for insertion into Clal/Hpal digests of pMEAOOl to create pMEAlOl . C) Construction of pMEA105 and pMEA106

The XhoI-HIV-I LTR- PKR cDNA-poly(A)-XhoI fragment was directly subcloned in two orientations into the pN2 vector. It has been reported that the host can use methylation patterns to inactivate transcription initiation from proviral inserts. The inappropriate expression of an antiproliferative gene by readthrough transcripts originating from the M-MuLV 5 ' LTR in constructs cloned in the forward orientation might precipitate this type of host repression (Bednarik et al . Proc. Natl Acad. Sci. USA 86:4958-4962 (1989)). Following ligation and transformation of DH5α cells and selection with 50 μg/ml ampicillin and 10 wg/ml tetracyciine, the pMEA105 and pMEA106 plasmids were isolated and analyzed by restriction mapping (Figure 1A). The region of the poly(A) site was sequenced for final confirmation of the plasmid identity.

EXAMPLE 3 Production of Retroviral Producer Cell Lines The plasmids constructed in Example 2 (encoding PKR under the control of an HIV LTR) were transferred into retroviral packaging cell lines in order to produce recombinant virus.

A) Transfection of GP+envAml2 cells

The GP+envAml2 cell line is a packaging cell line for the production of amphotropic retroviruses. The cell line was constructed by introducing gag and pol helper functions on one plasmid. and the env helper function on a separate plasmid. The cloned helper functions do not contain packaging signals or 3' -LTR sequences. The structure of the helper functions insures that replication competent viruses (RCRs. a major concern in the area of gene therapy) are not produced. Using this system, three independent recombination events would be required in order to generate replication competent virus. Followmg transfection of the plasmids by standard calcium-phosphate coprecipitation techniques (10 μg of plasmid per 2 x 10⁵ GP+envAml2 cells) for 12 h at 37°C, 5 % CO₂. the transfection media was aspirated and replaced with 5 ml fresh D10G Twelve hours later, the D10G was aspirated, the cells rinsed with 2 ml PBS, and aspirated again Trypsin solution (500 pi, 0 25 %) was added to each well followed by a 5 min incubation at 37°C, 5% CO₂ The cells were resuspended in 5 ml D10G and diluted to 10³ in D10G containing 1 mg/ml G418 Fourteen days later, coinciding with a complete loss of viability of mock-transfected controls as measured by Trypan blue exclusion, individual G418 resistant colonies were isolated by mini-trypsinization in cloning wells The isolated colonies were expanded for titenng and further characterization

B) Determination of recombinant retroviral titer by infection of NIH/3T3 cells NIH3T3 cells (1 x 10^"1) were seeded in individual 60 mm plates and permitted to adhere to the plate surface overnight at 37°C, 5 % C0 Infections were performed at multiple dilutions in duplicate Viral supernatants were harvested from nearly confluent G418-resιstant amphotrophic retroviral producer cells expanded in 100 mm² tissue culture plates and frozen at -70 °C The viral supernatants were thawed by incubation at 37 C with gentle agitation. placed on ice, and diluted up to 1 x 10 " in D10G containing 10 g/ml poiybrene The spent medium from the NIH/3T3 cell plates was aspirated and replaced with 500 ul of the appropriate viral supernatant dilution The p tes were incubated at 37 °C. 5 % C0₂ foi 2 hours with gentle rocking once every 20 minutes The media containing diluted virus was aspirated and 5 ml of D10G were added After 16 h incubation, this media was replaced with 5 ml of D10G containing 1 mg/ml G418 Viable colonies were scored 10 to 14 days later and the viral titer was calculated

Following calcium-phosphate mediated transfection of the pN2, pMEA105 and pMEA106 plasmids into GP+envAml2 cells, pooled G418-selected clones yielded titers of 10¹ - 10² cfu/ml as determined by the transduction of NIH/3T3 cells

The isolation of individual clones following plasmid transfection increased the titer of the retroviral producer cell lines The N2-20, 105-10, and 106-4 lines were titered at 1 7 ± 0 4 x 10³, 1 1 + O l X 10⁴. and 1 2 ± 0 4 \ 10³, respectively

EXAMPLE 4 Retroviral-Mediated Transduction of SupTl Cells

Sup Tl lymphoblastoid cells were transduced by cocultivation with the producer cell lines of Example 3

A) Retroviral -mediated Transduction

Producer cell lines N2-20, 105-10. and 106-4 (2 0 x lO³) were seeded into 100 mm² cell culture plate^1; -n a total volume of 10 ml D10G Twelve hours later, the media was aspirated, the cells were washed with 10 ml PBS. and 5 ml of D10G containing 1 x 10" SupTl cells and 4 ug/ml polybrene was added to the producer cells At 24 h intervals, an additional 5 ml of D10G containing 4 ^g/ml polybrene was added Ninety-six hours after the initiation ot the transduction, the cocultivation was terminated by gentle agitation and removal of the resuspended cells The producer cells were rinsed twice with PBS and the media/PBS suspensions were pooled Cells were centπfuged (350 x g, 4 C, 5 mm), washed with 10 ml PBS and resuspended in 3 ml of R10 containing 500 wg/ml G418 100 ul aliquots were seeded into ninety-six well tissue culture plates in duplicate Cells were serially-diluted up to 1 2187 m R10 containing 500 g/ml G418 Antibiotic selection of transduced cell lines typically required 14 days and was complete when all of the SupTI cells cocultured with the GP+envAml2 cell lines (negative control) were non-viable B) Southern blot analysis of genomic DNA

After trypsinization. approximately 5 x 10⁷ G418 selected, transduced cells and control cells were centrifuged (350 x g, 4°C. 15 min). Genomic DNA was isolated according to standard procedures. To create a neo specific probe common to all proviral inserts, the pN2 vector was digested with PstI and a 923 bp fragment was isolated and radiolabeled by denaturation and incubation in the presence of Klenow fragment, unlabeled nucleotides (30 μM each of dCTP, dGTP, and dATP), [ -^?2P]-dTTP (50 μCi, 3000 Ci/mmol), and reaction buffer containing 50 mM Tris-HCl (pH 8.0). 5 mM MgCl₂, 2 mM DTT. 200 mM HEPES (pH 6.6). and 5 A260 U/ml random hexadeoxyribonucleotides. A probe with a specific activity of 1.2 x 10⁹ dpm/μg was recovered. For the hybridization solution, 2 x 10^& dpm/ml hybridization buffer was utilized. Ten micrograms of genomic DNA from each clone was digested with Xbal. Positive controls consisted of genomic DNA from GP+envAml2 cells augmented with 10, 1. or 0.1 ng of pMEAlOό plasmid DNA. The digested genomic DNA was electrophoresed through a 0.8% agarose gel at 20 volts overnight and, following denaturation and neutralization, vacuum transferred to a nylon membrane at 80 lbs/inch² pressure for 1 hour The DNA was crosslinked to the nylon membrane with a UV Stratalinker. Following a 3 hour prehybridization, 2 x 10⁷ dpm of the neo probe was incubated with the blot at 68 ^CC overnight. The membrane was washed with varying concentrations of SSC and SDS, dried, and analyzed with a Fuji BAS2000 phosphor imager.

The integrated N2-20, 105-10. and 106-4 sequences with regions complementary to the neo probe are indicated in Figure IB. Southern blot analysis demonstrated the integration of the calcium-phosphate transfected plasmid DNA into the genomic DNA of the GP+envAml2 cells (pN2, pMEA106: Figure IC, lanes 4 and 6). In addition to generation of G418-resistant clones through the transduction of NIH/3T3 and SupTl cells via supernatant and co-cultivation procedures, respectively, integration of the provirus for N2-20 and 106-4 transduced SupTl cells following G418 selection was verified by Southern blot analysis (Figure IC, lanes 5 and 7).

C) Growth curve analysis of transduced G418 selected SupTl cells. Transduced SupTl cells and controls (1 x lO³) were seeded into twelve- well tissue culture plates in 2 ml RPMI 1640 media. One ml of RPMI 1640 was added after 4 days. Cell counts and viability were determined in duplicate by Trypan blue exclusion for up to 200 h after cell seeding. Viability exceeded 95 % .

Examination of the growth curve of the HIV-1 LTR-PKR cDNA transduced clones by Trypan blue exclusion revealed that total cell number did not differ significantly from SupTl and N2-20 controls up to 8 days after the initiation of the assay. Therefore, although PKR is constitutively expressed in the 106-4 reverse orientation clones in the absence of HIV-1 infection, it does not slow cell growth (Figure 4, panels e and f, uninfected).

EXAMPLE 5 Challenge of HIV-1 LTR-PKR Transduced SupTl Cells With HIV-1 IIIB

SupTl T lymphoblastoid cell lines were transduced such that PKR would be overexpressed following infection with HIV-I. HIV-1 replication was measured by syncytia formation. Syncytia are fused T lymphocytes, having multiple nuclei and sharing a common membrane, which result from HIV infection. The SupTl parental cell line (CD4+ T lymphocytes) provided a control for cellular PKR expression. The N2-20P clones (T cells transduced with neomycin selectable marker but not a PKR cDNA) provided a control for expression of cellular PKR and M-MuLV LTR driven retroviral transcripts without the HIV-1 LTR controlled PKR cDNA sequences.

A) HIV-1 infection of retrovirally transduced, G418 selected SupTl cells

Following determination of cell number and viability, transduced cells and SupTl controls were challenged with HIV-1 IIIB at a m.o.i. of 0.1 for 2 h at 37°C. 5% CO₂ with gentle agitation. The infected cells were washed with 5 volumes of RIO to remove unincorporated virus. An aliquot of 2 x lO⁵ infected cells/200 μl were seeded into the wells of a 96-well plate. Forty-eight hours post-infection (p.i.), the cells were serially-diluted through 1 :27, and 2 x lO⁵ SupTl indicator cells were added to each well (final volume = 300 μl). Syncytia were scored by microscopic examination 96 hours p.i.

A single syncytia score from triplicate assays was calculated by correcting for each dilution factor and averaging of the three values, i.e. a total of nine wells were scored to obtain a single syncytia score. Virus added to media alone, which was serially-diluted and mixed with indicator cells, yielded no syncytia. demonstrating the short halflife of the virion and that syncytia observed were not due to the direct infection of the indicator cells

When the HIV-1 LTR driven PKR cDNA retroviral-transduced SupTl clones were pooled during G418 selection, the reduction in syncytia formation averaged 20-30% compared to identical infections of the parental SupTl and the N2-20P transduced. G418-selected SupTl cell lines. Growth inhibitory effects are associated with even a low level of inappropriate PKR activation, and integration of the transduced construct near strong cis activation or repressor transcriptional elements could potentially modulate expression of PKR under HIV-1 LTR control, resulting in inappropriate expression or a loss of expression in the presence of Tat.

In contrast to pooled, transduced cells, individually selected clones obtained by limiting dilution exhibited more dramatic decreases in syncytia formation [Figures 2(a), 3. and 7]. HIV-1 challenge of the reverse-orientation clone. 106-4:560, resulted in the greatest decrease in syncytia formation (93 % ) compared with the N2-20P control (Figure 2, solid bars). Challenge of the 105-10:27. 105-10:239, and 106-4:582 clones with HIV-1 resulted in 54, 54. and 80% decreases in syncytia formation, respectively, compared with the N2-20P control [Figures 2 (solid bars) and 3] . The antiviral effect observed in the reverse orientation clones, 106-4:560 and 1064:582, was 84 and 56% greater. respectively, than that observed for the forward orientation clones, 105-10:27 and 105-10:239 (Figure 2, solid bars). Host-dependent hypermethylation of the CpG sites within the HIV-1 LTR has been reported to inactivate Tat-induced transcription and could have contributed to the differences observed in anti-HIV-1 activity between clonal lines transduced with identical retroviral constructs (Gutekunst et al , J. AIDS 6:541-549 (1993)). Gross rearrangements of integrated DNA, which have been reported with M-MuLV after a single round of replication, were not observed.

In agreement with inhibition of HIV- 1 induced syncytia formation, HIV-1 reverse transcriptase activity in SupTl and N2-20P control cells at 96 hours p.i. increased 3.6- and 4.0-fold over uninfected controls, while HIV-1 reverse transcriptase activity in all of the HIV-I LTR-PKR cDNA transduced cell lines increased by less than 1.9-fold. The inhibition of syncytia formation observed in the HIV-1 LTR-PKR cDNA transduced clones was reversed by treatment of the cells with 2-aminopurine prior to infection (Figure 2, open bars). There was a statistically significant difference in syncytia formation in the 105-10 and 106-4 clones (p < 0.003, 0.001 and p < 0.002, 0.00006, respectively) in the presence and absence of 2-aminopurine. but not in the SupTl controls (p < 0.090).

B) Reversibility of the anti-HIV-1 effect

The reversibility of the anti-HIV-1 effect observed in the HIV-1 LTR-PKR cDNA clones was demonstrated by treatment with 2-aminopurine prior to HIV-1 infection, as shown in Figure 2, open bars. The compond 2-aminopurine is an ATP analog that inhibits PKR autophosphorylation both in vitro and in vivo, but does not affect the dsRNA binding capacity of PKR (Hu et al , J. Interferon Res. 13:323-328 (1993)).

For studies examining the inhibition of PKR enzymatic activity by 2-aminopurine, triplicate assays were prepared by infection of 2 x lO^"1 cells in the presence or absence of 10 mM 2-aminopurine (added 1 hour prior to infection) with HIV-1 IIIB at a m.o.i. of 0.1. Twenty-four hours after infection, the infected cells were serially diluted up to 1 :27 and 2 x 10⁵ SupTl indicator cells were added to each well. Viability assays of SupTl cells treated with 10 mM 2-aminopurine in the absence of HIV-1 infection revealed a decrease in cell growth and an increase in cytotoxicity after prolonged incubation (91 % viable after 24 h, 54% viable after 48 h); 2-aminopurine-treated cells were therefore serially diluted at 24 hours p.i. to maintain viability. Ninety-six hours p.i. , syncytia formation was scored as described above.

Three of four clones demonstrated a statistically significant increase in syncytia formation in the presence of 2-aminopurine when compared to both SupTl and N2-20P controls (105-10:27: p < 0.00001 and 0.0008: 105-10:239: p < 0.004 and 0.03; 106-4:582: p < 0.002 and 0.01 ).

EXAMPLE 6 PKR Expression and Activity During HIV Infection

A) PKR expression during HIV-1 IIIB infection

Although PKR protein levels in SupTl and N2-20P controls were undetectable 72 h p.i. , Western blot analysis demonstrated that PKR expression was maintained through 96 h p.i. in the four HIV-1 LTR-PKR cDNA clones examined (Figure 4). Protein preparations were obtained by lysing suspension cells (2 x 10⁶ at the time of infection) with two cell volumes of NP-40 lysis buffer [20 mM HEPES (pH 7.5), 5 mM MgCl₂, 120 mM KC1. 10% glycerol, 0.5% NP-40] , Fifty micrograms of protein was separated by 10% SDS-PAGE. After equilibration in 25 mM Tris-HCl (pH 8.3), 192 mM glycine. 20% methanol for 20 minutes, the proteins were transferred to nitrocellulose for one hour at 25 volts at room temperature, using a BioRad Trans-Blot SD Semi-Dry Transfer cell. Following a 16 hour incubation in 7.6% dry skim milk blocking solution prepared in TBS-T [20 mM Tris-HCl (pH 7.6). 137 mM NaCl, 0.1 % polyoxyethylene-sorbitan monolaurate (Tween 20, Sigma)] on a slow shake at 4°C, the blot was rinsed 5 times (twice quickly, 1 x 15 min., 2 x 5 min) in a large volume of TBS-T on a slow shake at room temperature. The blot was then incubated with a 1 : 1000 dilution of rabbit polyclonal anti-PKR antibody in 15 ml of TBS-T for 1 hour. The polyclonal anti-PKR antibody was provided by Dr. Charles E. Samuel (University of California at Santa Barbara). The blot was removed from the antibody solution and washed with TBS-T as described above, then incubated for 1 hour with a 1 :2500 dilution of horseradish peroxidase-conjugated mouse anti-rabbit serum (Pierce) on a slow shake. Following washing with TBS-T, the blot was developed with a chemiluminescent solution (ECL, Amersham), following the instructions of the manufacturer. Exposures on X-OMAT film (Kodak) were developed and quantified utilizing image analysis software (Macintosh NIH Image program, version 1.60).

In the absence of HIV-1 infection, the two reverse orientation clones, 106-4:560 and 106-4:582, exhibited elevated PKR protein levels (3.4- and 3.3-fold, respectively) when compared with the N2-20P control (Figure 4. panels a. e. and f, uninfected cells). These clones exhibited normal rates of cellular proliferation, suggesting that PKR is in the inactive state. Increased PKR protein levels in the HIV-1 LTR-PKR cDNA transduced clones could also result from increased protein stability rather than increased expression levels.

The levels of PKR in the transduced clones were noticeably lower at 72 and 96 hours p.i. , perhaps due to lower levels of available Tat protein to drive the system from a lack of productive infection. The expression of chloramphenicol acetyltransferase under HIV-1 LTR control has been reported to be elevated 322- and 278-fold in HIV-I infected H9 and L8460D Jurkat cells, respectively (Sodroski et al. , Science 225:381-385 (1984); Thomis et al.. Proc. Natl. Acad. Sci. USA 89: 10837-10841 ( 1992)). The overexpression of PKR to these levels was not observed in the studies reported here, but such levels were not expected for several reasons. First, wild-type PKR protein overexpression in eukaryotic systems has proven difficult due to its antiproliferative and autoregulatory properties (London et al. , Proc. Natl Acad. Sci. USA 90:4616- 4620 (1993)). Second, high levels of cytoplasmic, enzymatically active PKR are not achievable because the quantities of eIF-2B are in limiting intracellular concentrations. When 30% of eIF-2α is modified to its phosphorylated state, all protein translation initiation is inhibited (Hershey, J. Biol Chem. 264: 20823-26 (1989)). Third, the levels of PKR mRNA in IFN-treated SupTl and HeLa cells as measured by RNase protection assays increased 4.5- and 5.8-fold, respectively, but the protein levels increased approximately 2-fold.

B) PKR autophosphorylation levels during HIV-1 IIIB infection in HIV-1 LTR-PKR cDNA transduced clones

NP-40 extracts (30 μg protein) prepared at the indicated times p.i. were diluted to a total volume of 300 μl with buffer A [20 mM Tris-HCl (pH 7.6), 50 mM KC1, 400 mM NaCl. 5 mM 2-mercaptoethanol. 1 % Triton X-100. 1 mM EDTA, lO μg/ml aprotinin, 0.2 mM PMSF, 20% (vol/vol) glycerol] . Ten u\ of anti-human PKR rabbit antiserum was added to each sample and the samples were incubated on ice for 60 minutes. Protein A Sepharose CL-4B (Phamacia) [50 μl of a 50% (vol/vol) suspension in buffer A] was added to each tube followed by incubation with continuous rotation for 30 minutes at 4 ^'C. The Sepharose was pelleted (420 x g, 4^UC, 5 min) and washed 4 times with 300 μl buffer B [20 mM Tris-HCl (pH 7.6). 100 mM KC1, 0.1 mM EDTA, 10 ug/ml aprotinin, 20% (vol/vol) glycerol] and twice with buffer C (buffer B with 2 mM MnCl₂ and 2 mM MgCl₂). Following removal of the last wash, the Sepharose was resuspended in 50 μl of buffer C containing 0 or 0.1 μg/ml poly(rI)-poly(rC) and 2.5 u \ [γ³²P]ATP ( > 7000 Ci/mmol). Samples were incubated for 10 min at 30°C. SDS sample buffer (4X) was added to each sample, and the samples were heated at 95°C for 3 minutes. Proteins were separated by 8.5% SDSPAGE and gels were dried and analyzed by autoradiography.

PKR autophosphorylation of the HIV-1 LTR-PKR cDNA transduced clones and controls was examined at 24 hour intervals following HIV-1 IIIB infection without or with 0.1 μg poly(rl)-poly(rC) (Figure 5). It has been reported that there is a direct relationship between the levels of PKR autophosphorylation and the quantity of eIF-2α phosphorylation (Mordechai et al. , Virology 206:913-22 (1995); Suhadolnik et al , Cancer Res. 43:5462-66 (1983)). PKR autophosphorylation levels in N2-20 extracts of untreated SupTl and N2-20P control lines were lower than that observed for the HIV-1 LTR-PKR cDNA clones. Addition of 0.1 μg/ml poly(rI)-poly(rC) shifted PKR activation levels to the right on the bell-shaped activation curve. Comparison of the 0.1 μg/ml poly(rl) poly(rC)-treated SupT 1 and N2-20P extracts with the corresponding untreated extracts revealed that most, if not all, of the PKR is inhibited. Clone 106-4:560 at 24 hours p.i. had increasing amounts of PKR autophosphorylation at 0, 0.1 , and 1.0 μg/ml poly(rI)-poly(rC) (243, 374, and 492 phosphorimager units, respectively). These results suggest that PKR is not inhibited by the intracellular concentration of TAR RNA resulting from the HIV-I infection. The presence of the HIV-1 LTR-PKR cDNA sequences prevents the inhibition of PKR activity observed in SupTl and N2-20P controls and contributes to the antiviral activity observed upon HIV-1 challenge.

C) NF-κB gel electrophoretic mobility shift assays

Nuclear extracts were prepared from HIV-1 infected and mock-infected clones (4 x 10° cells; m.o.i. = 0.1 ) at 72 hours p.i. as described (Schreiber et al . Nucleic Acids Res. 17:6419. (1989)). SupTl cells treated with 10 or 50 ng/ml 12-O-tetradecanoylphorbol 13-acetate (TPA) for 30 minutes were used as the positive control. Complementary, synthetic oligonucleotides corresponding to the NF-κB binding site (SEQ ID NO:4) were annealed and end-labeled with [γ-³²P]ATP utilizing T4 polynucleotide kinase. Specific activity of the probe was calculated to be 1.6 x 10⁸ dpm/μg. A gel electrophoretic mobility shift assay (GEMSA) was performed utilizing 5 μg of nuclear extract as described (Bachelerie etal. , Nature 350:709-12 (1991)). Specificity of NF-κB for its DNA oligonucleotide sequence was demonstrated by incubation of up to a 50-fold molar excess of the 65-mer poly(A) annealed oligonucleotides and through competition in the presence of a 40-fold molar excess of radioinert, annealed KB oligonucleotides added 20 minutes prior to incubation with the [³²P] -labeled probe. The capacity of PKR to phosphorylate Iκ-B was investigated by examination of NF-κB binding levels in nuclear extracts from the HIV-1 LTR-PKR cDNA transduced clones. Iκ-Bα is a cytoplasmic protein which complexes with NF-κB and acts to repress its transcriptional enhancer properties. Upon phosphorylation, Iκ-Bα undergoes a conformational change which releases NF-κB to translocate into the nucleus and transactivate promoter elements containing the KB binding site such as Iκ-B , NF-κB, IFN-β, cytokines. immunomodulators, and viral genes (Tzen et al. Ex. Cell Res. 211: 12-16 (1994)). Treatment of SupTl cells with the NF-κB activator TPA (50 ng/ml), resulted in 72 and 79% stimulation of p50:p65 and p50:p50 NF-κB DNA binding activity, respectively. The specificity of the GEMS A assay was demonstrated by competition for radioactive KB oligonucleotide binding with a 40- and 80-fold excess of radioinert oligonucleotide and an inability to abrogate binding in the presence of a 5- to 50-fold molar excess of a radioinert. unrelated DNA competitor. The levels of p50:p50 and p50:p65 NF- B DNA binding activity were not significantly modulated in the 105-10 and 106-4 transduced clones following infection with HIV-1 IIIB (Figure 6). These data suggest that PKR is not acting through this alternative pathway in SupTI cells to increase IFN-β levels, nor is transcription initiation from the HIV-1 LTR indirectly stimulated by PKR activation. The constitutive activity of NF-κB observed in the absence of infection by a mechanism unrelated to PKR may contribute to the ability of HIV-1 to replicate efficiently in this cell line through interactions with the multiple NF-κB binding sites located within the HIV-1 LTR (Nabel et al. . Nature (London) 326:711-713 (1987)). EXAMPLE 7

Inhibition of HIV-1 IIIB Infection in HIV-1 LTR-PKR cDNA Transduced Clones Treated With AZT

The intracellular immunization approach was used in combination with a traditional antiviral drug chemotherapeutic approach.

Control cells and the transduced clones were treated with the reverse transcriptase inhibitor. 3 '-azido-3 '-deoxythymidine (AZT) prior to HIV-1 infection to investigate a combinatory in vitro effect between the HIV-1 LTR driven PKR cDNA sequences and the AZT. AZT was added 1 hour prior to infection at a final concentration of 0, 5, 10. 50, 100. or 1000 nM.

A 90% inhibition of syncytia formation in the control N2-20P cells

(■) was achievable with a calculated 313.3 nM AZT (Figure 7). In contrast,

90% inhibition of syncytia formation in the 105-10:27 (^A ) and 105-10:239 ( x )

cell lines was achieved with a calculated 55.8 nM AZT, which is a decrease of 82% . The 106-582 (•) cell line required a calculated 23.3 nM AZT (a decrease of 93% ) for 90% syncytia inhibition. In contrast, syncytia formation in the

106-4:560 ( ^v ) cell line was reduced 93 % in the absence of AZT and was not

further enhanced by AZT supplementation.

EXAMPLE 8 Ability of HIV-1 LTR-PKR cDNA Clones to Inhibit Reactivation of HIV-1 in Latently Infected Cells

Cell lines containing integrated copies of the HIV provirus were used to demonstrate the ability of HIV-1 LTR-PKR cDNA clones to inhibit viral reactivation in a chronically infected system. ACH-2 is a lymphocytic cell line containing one copy of the HIV provirus in the genome (Pomerantz et al. , Cell 61: 1271-76 (1990)). Ul is a promonocytic cell line containing two integrated copies of the HIV provirus in the genome (Folks et al . Science 238:800-02 (1987)).

The chronically infected cell lines, ACH-2 and Ul , were transduced with the HIV-1 LTR-PKR cDNA constructs using the retroviral supernatants of the retroviral producer cell lines as described in Example 4. HIV expression was induced by treatment with tumor necrosis factor alpha (TNF- . 50 ng/ml) (Folks et al , Proc. Natl. Acad. Sci. USA 86:2365-68 (1989)). Cells were maintained in culture. The HIV-1 LTR-PKR cDNA-transduced Ul and ACH-2 inhibited HIV-1-induced syncytia formation 99% and 99%, respectively. Western analysis as described by Kon et al. {J. Biol. Chem. 271: 19983-90 (1996)) showed an increase in PKR expression through 96 hour post-induction in the transduced Ul cells.

EXAMPLE 9 Animal Model of AIDS SCID mice reconstituted with human peripheral blood monocytic cells (PBMC) are used as a model system (Markham et al.. J. Virol. 70(10):6947- 54 (Oct. 1996); Rizza et al , J. Virol. 70:7958-64 fNov. 1996)) to demonstrate the in vivo efficacy of the claimed methods and compositions, and to optimize treatment protocols before their use in human subjects. PBMC are obtained by hemapheresis from healthy HIV- seronegative donors, and purified by Ficoll-Paque density gradient contrifugation.

CB17 scid/scid mice (SCID mice) between 4 and 6 weeks of age are maintained under specific-pathogen-free conditions, with all food, water, and bedding being autoclaved before use. PBMC are transduced by cocultivation with recombinant virus producer lines, as described in Example 4, or by direct infection with a retroviral supernatant or a more concentrated retroviral preparation. Cells are selected for neomycin (G418) resistance, as in Example 3A. SCID mice are reconstituted by intraperitoneal (i.p.) injection of 2xl0⁷ transduced PBMC. Reconstituted (hu-PBL-SCID) mice are infected with HIV-1 strain IIIB at two hours, at eight days, or at two weeks after reconstitution. For infection, serial tenfold dilutions of 10⁵ to 10² tissue culture infective doses of HIV-1 are injected i.p. into the reconstituted mice. HIV infection is monitored over time by virus-specific PCR, by p24 assays, and by cocultivation assays using cells obtained by peritoneal lavage.

EXAMPLE 10 Intracellular Immunization Using a 2-5OAS Gene Previous studies have demonstrated that the level of 2-5A is inversely correlated with HIV-1 virion production: during the later stages of infection HIV-1 virion production increases as 2-5 A levels decline. Plasmid constructs placing the expression of the 40 kDa 2-5OAS cDNA under the control of the HIV-1 LTR were constructed and introduced into T lymphocytic cells via a retroviral delivery system. The cells were then challenged with HIV-1 strain IIIB.

The pMEA002 plasmid was used as a backbone vector upon which to build pMEA003, in which the cDNA encoding PKR was removed and replaced with a cDNA encoding 2-5OAS. The pMEA002 plasmid was digested with Hindlll then blunt ended by treatment with Klenow DNA polymerase in the presence of deoxynucleoside triphosphates. A subsequent digestion with EcoRl released the PKR cDNA from the 3127 bp blunt ended EcoRlpSP72-HIV-l LTR fragment, and this fragment was purified using DEAE cellulose. The 2-50AS cDNA was obtained from pNK04, which has been used for the expression of milligram quantities of 2-5OAS (Kon and Suhadolnik. J. Biol. Chem.271: 19983- 90 (1996)). The pNK04 DNA was digested with Ndel. filled in with Klenow fragment, and digested with EcoRl to release a 1242 bp fragment containing the entire 2-5OAS cDNA. This fragment was purified using DEAE-cellulose.

The purified cDNA and vector fragments were ligated together (via the EcoRl cohesive ends and blunt ends) to produce a 4374 bp fragment in which the Hindlll restriction site was regenerated The gation mixture was used to transform E coli DH5α cells DNA from 20 colonies was isolated using a plasmid DNA boiling min prep method Plasmid structure was analyzed by restriction analysis and by Sanger dideoxynucleotide sequencing, using T7, HIV- 1 LTR. and SP6 primers

In order to create the pMΕA103 vector. pMEA003 was digested with Hpal and Clal and the synthetic oligonucleotide containing the polyadenylation sequences utilized in the construction of the pMEAlOl was inserted downstream of the 2-50AS cDNA sequence The XhoI-HIV-1 LTR-2- 50AS-poly(A)-XhoI sequence was excised, purified, and inserted in the forward and reverse orientation into the Xhol site of pN2 to create pMEA109 and pMEAHO. respectively

The plasmids encoding 2-50AS under the control of an HIV LTR were transferred into retroviral packaging cell lines in order to generate retroviral producer cell lines and recombinant virus, using the methods described in Example 3 Recombinant retrovirus was transduced into T lymphocytic cells as described in Example 4. and the transduced cells were challenged with HIV-1 strain IIIB as described in Example 5

Several ot the transduced clones demonstrated a greater than 70% decrease in HIV-1 virion production compared to infected T lymphocytic controls as determined by syncytia scoring Several of these clones were selected for further characterization One clone, 109-20 5, has consistently demonstrated 90% inhibition of syncytia formation as well as prolonged expression of 2-50AS through 96 hours p I These studies indicate that intracellulai immunization using a 2-

50AS gene, alone or in combination with other chemotherapeutic agents, is a potential long term treatment for the control of HIV infection

All references discussed herein are incorporated by reference One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and, accordingly, reference should be made to the appended claims, rather than to the foregoing specification, as indicating the scope of the invention.

Claims

45 -

CLAIMS WE CLAIM

1 A recombinant nucleic acid comprising (a) a PKR coding region, and (b) a regulatory element, wherein the PKR coding region and regulatory element are operatively linked such that PKR expression is activated in the presence of an HIV trans-acting factor

2 The recombinant nucleic acid of claim 1 wherein the legulatory element comprises all or part ot an HIV LTR

3 The recombinant nucleic acid of claim 1 wherein the HIV trans-actmg factor is an HIV Tat protein

A vector comprising a nucleic acid according to any ot claims 1-3

The vector ot claim 4 wheiein said vector is a viral vector

The vector of claim 5 wherein said vector is a retroviral

\ ector

7 The retrov iral vectoi ot claim 6 wherein said vector comprises M-MuLV sequences

8 The retroviral vector of claim 7 wherein the vector has essentially the characteristics of pMEA105 or pMEA106

A cell comprising the nucleic acid of claim 1

10. The cell of claim 9 wherein said cell is a prokaryotic cell.

11. The cell of claim 9 wherein said cell is a eukaryotic cell.

12. The cell of claim 11 wherein said cell is a stem cell.

13. The cell of claim 12 wherein the cell is a CD34-expressing cell.

14. The cell of claim 11 wherein the cell is a CD4-expressing cell.

15. The cell of claim 9 wherein the cell is a retroviral packaging cell.

16. The cell of claim 9 wherein the cell is a retroviral producer cell.

17. A cell according to any of claims 11-14 wherein the nucleic acid is stably integrated into the cellular genome, and wherein PKR expression is activated by HIV infection.

18. A viral vector comprising:

(a) a 2 ' ,5 '-oligoadenylate synthetase coding region, and

(b) a regulatory element; wherein the 2' ,5 '-oligoadenylate synthetase coding region and regulatory element are operatively linked such that 2 ' ,5 '-oligoadenylate synthetase expression is activated in the presence of HIV trans-acting factors. 19 The viral vector of claim 18 wherein the regulatory element comprises all or part of an HIV LTR

20 The viral vector of claim 18 wherein the HIV trans-actmg factor is an HIV Tat protein

21 The vnal vector according to one of claims 18-20 wherein said vector is a retroviral vector

22 The retroviral vector of claim 21 wherein said vector comprises M-MuLV sequences

23 The retroviral vector of claim 22 wherein the vector has essentially the characteristics of pMEA109 or pMEAl 10

24 A cell which has been transduced or transformed with the viral vector of claim 18

25 The cell of claim 24 wherein said cell is a prokaryotic cell

26 The cell of claim 24 wherein said cell is a eukaryotic cell

27 The cell of claim 26 wherein said cell is a stem cell

28 The cell of claim 27 wherein the cell is a CD34- expressing cell

29 The cell ot claim 26 wherein the cell is a CD4-expressmg cell 30 The cell of claim 24 wherein the cell is a retroviral packaging cell

31 The cell of claim 24 wherein the cell is a retroviral producer cell

32 A cell according to any of claims 26-29 wherein the 2 ' ,5 ' - oligoadenylate synthetase coding region and regulatory element are stably integrated into the cellular genome, and wherein 2 ' ,5 '-oligoadenylate synthetase expression is activated by HIV infection

33 A method of inhibiting the replication of HIV comprising introducing a nucleic acid according to claim 1 or a vector according to one of claims 4 or 18 into a cell which is susceptible to HIV infection

34 The method according to claim 33 wherein a PKR coding region operatively linked to a regulatory element is stably integrated into the cellular genome, such that PKR expression is activated by HIV infection

35 The method according to claim 33 wherein a 2' .5 - oligoadenylate synthetase coding region operatively linked to a regulatory element is stablv integrated into the cellular genome, such that 2 ' ,5 '-oligoadenylate synthetase expression is activated by HIV infection

36 A method of inhibiting HIV replication in a patient in need of such treatment comprising introducing a nucleic acid according to claim 1 or a vector according to one of claims 4 or 18 into cells from the patient

37 The method of claim 36 wherein at least one chemotherapeutic agent is also administered to the patient 38 The method ot claim 37 wherein the chemotherapeutic agent is selected from the group consisting of nucleoside analogs and protease inhibitors

39 The method of claim 38 wherein the chemotherapeutic agent

40 The method of claim 36 wherein the nucleic acid or vector is introduced into the cells ex vivo

41 The method of claim 36 wherein the nucleic acid or vector is introduced into the cells in vivo

42 The method of claim 36 wherem the nucleic acid or vector specifically targets CD34-exρressιng cells

43 The method ot claim 36 wherein the nucleic acid or vector specifically targets CD4-expressιng cells

44 The method of any one of claims 36-43 wherein a PKR coding region operatively linked to a regulatory element is stably integrated into the cellular genome, such that PKR expression is activated by HIV infection

45 The method according to any of claims 36-43 wherein a 2' ,5'-ohgoadenylate synthetase coding region operatively linked to a regulatory element is stably integrated into the cellular genome, such that 2 ' .5 - oligoadenylate synthetase expression is activated by HIV infection 46 A method of preventing HIV replication in a human host comprising introducing a nucleic acid according to claim 1 or a vector according to one of claims 4 or 18 into cells from the host

47 The method of claim 46 wherein the nucleic acid or vector is introduced into the cells ex vivo

48 The method of claim 46 wherein the nucleic acid or vector is introduced into the cells in vivo

49 The method of claim 46 wherein the nucleic acid or vector specifically targets CD34-expressmg cells

50 The method of claim 46 wherein the nucleic acid or vector specifically targets CD4-expressιng cells