EP1014977A1 - Diagnosis of migraine with aura, depression and anxiety from allelic variations in dopaminergic genes - Google Patents

Abstract

The invention provides methods of diagnosing a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety. Diagnosis entails detecting a variant form of one or more dopaminergic genes, such as DRD1, DRD2, DRD3 and DAT. Methods of screening for therapeutic agents effective to treat the syndrome and methods of treatment are also provided.

Description

DIAGNOSIS OF MIGRAINE WITH AURA, DEPRESSION

AND ANXIETY FROM ALLELIC VARIATIONS

IN DOPAMINERGIC GENES

CROSS REFERENCE TO RELATED APPLICATIONS This application derives priority from 60/024,399, filed August 22, 1996 and 60/036,091, filed January 17, 1997, which are incorporated by reference in their entirety for all purposes.

TECHNICAL FIELD

The present invention relates generally to the diagnosis and treatment of a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety.

BACKGROUND

Migraine headaches are a type of vascular headaches. Migraine headaches are characterized in part as recurrent attacks of headaches, with or without associated visual and gastrointestinal disturbances. Symptoms of migraine headaches usually follow a pattern in each patient. Attacks may be daily or only once in several months. Untreated attacks may last for hours or even days. Nausea, vomiting, photophobia and sonophobia are common. The extremities can become cold and cyanosed, and the patient can become irritable and seek seclusion. In the United States alone, approximately 18 million females and 5.7 million males have been estimated to suffer from severe migraine annually. Migraines are believed to be a leading cause of lost time^' from the workplace. A classification of migraines based on patient symptoms has been proposed by the Committee on the Classification of Headache of the International Headache Society, Cephalalgia 8:1-96 (1988). The committee proposes that migraines be classified a migraine without aura (formerly known as common migraine) , migraine with aura (formerly known as classic migraine) and hemiplegic migraine (formerly known as complicated migraine) . Migraine with aura and migraine without aura are the two most frequent forms of migraine. A locus for familial hemiplegic migraine has been reported to occur on chromosome 19, Joutel et al . , Mature Genetics 5, 40-45 (1993); Joutel et al . , Am. J. Hum . Genet . 55, 1166-1172 (1994).; Ophoff et al . Genomicε 22, 21-26 (1994); Elliott et al . , Ann. Neurol . 39, 100-106 (1996)). However, the genetic bases and corresponding biochemical mechanisms underlying other forms of migraine disease, such as migraine with aura and migraine without aura, have not been reported and it is unknown whether the different types of migraine are different in kind or only in degree.

At present no specific genetic or biochemical tests are available for the positive diagnosis of migraine with or without aura. Diagnosis and treatment is presently based solely on patient self-reporting and symptom description. Although a wide variety of agents, such as anti-inflammatory drugs, ergots, 5-HT-j receptor agonists and antiemetics, have been reported to have some benefit for treatment of migraine, their use is complicated by the clinical heterogeneity associated with migraine, side effects of drugs, and the limitations of patient reporting (Caviness et al . , N . Engl . J . Med . 302, 446-450 (1980); Wilkinson, Cephalalgia 3, 61-67 (1983); Peatfield, Handbook of Clinical Neurology (ed Rose Raven Press, New York, 1986) pp. 173-216; Welch, N .E.J . M . 329, 1476-1483 (1993); Peroutka, The Pharmacological Basis of Therapeutics (eds. Hardman et al., McGraw-Hill, New York, 1996) pp. 487-502. For example, there have been several reports that antiemetics such as domperidone, prochlorperzine, and metoclopramide have beneficial effects in some migraine patients. However, because the subtype of migraine patient in which such drugs may be effective is not known and because possible side effects of these drugs mitigate against administration without a clear expectation of benefit, these drugs have not been widely administered and have not been approved by the FDA for treatment of migraine. Thus, it has been concluded that, at present, migraine is neither efficiently diagnosed nor managed (Cephalalgia 8, 96 (1988)). Similarities exist between the epidemiological characteristics of migraine, anxiety and depression (Robins et al., Arch. Gen . Psychiatry 41:949-958(1984); Stewart et al., JAMA 267:64-69 (1992); Rasmussen & Eisen, J Clin Psychiatry 55:5-14 (1994); Kessler et al., Arch. Gen . Psych . 51:8-19 (1994), Marazziti et al., Biol . Psychiatr . 31:125-129 (1995). All three disorders afflict approximately 10 to 25% of the general population at some point in life and are approximately twice as common in females than males. Prophylactic medications for all three disorders have a subacute onset of action, requiring 3 to 6 weeks of therapy to measure clinical improvement.

Identification of inheritance pattern (s) and genetic bases for migraine, depression and anxiety would greatly facilitate the diagnosis and treatment of these diseases. The present invention fulfills this and other needs.

SUMMARY OF THE INVENTION In one aspect, the invention is directed to methods of diagnosing a patient for susceptibility to a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety. The methods entail detecting a variant allele of one or more dopaminergic genes in the patient. Dopaminergic genes correlated with the syndrome include DRDl, DRD2 , DRD3 and DAT. For example, the presence of homozygous Al alleles of the DRD2 Ncol Al gene indicates increased susceptibility to the syndrome relative to the presence of heterozygous A1/A2 alleles, and the presence of heterozygous A1/A2 alleles indicates increased susceptibility relative to the presence of ho ozygous A2/A2 alleles. In some methods, variant alleles are detected in two or more of the DRDl, DRD2 , DRD3 and DAT, and risk factors associated with the presence of each variant allele detected are combined to indicate susceptibility to the syndrome.

The invention further provides methods of treating a patient suffering from the syndrome described above. The patient is administered a therapeutically effective amount of an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT. Some such agents lack specific binding to DRD4 and/or DRD5. Exemplary agents are shown in Table 1. Some agents are incapable of permeating the blood-brain barrier. Agents can be administered intravenously, orally or intramuscularly. Agents can be administered therapeutically or prophylactically. Patients amenable to treatment with such methods include those suffering from migraine with aura and having homozygous DRD2 Ncol Al alleles.

In another aspect, the invention provides methods of screening for a drug effective to treat the syndrome described above. Such drugs are screened by determining their capacity to antagonize binding of dopamine to a dopaminergic receptor or DAT. Optionally, such drugs can be screened for lack of specific binding to DRD4 and/or DRD5.

In another aspect, the invention provides for the use of an agent that antagonizes binding of dopamine to DRDl, DRD2, DRD3 and/or DAT for the manufacture of a medicament for use in the treatment of a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety in patients having a variant allele of one or more dopaminergic genes. Such dopaminergic genes include DRDl, DRD2 , DRD3 and DAT. Some suitable agents are listed in Table 1. For some agents, the blood-brain barrier is impermeable to passage of the agent. Some agents antagonize DRDl, DRD2 , DRD3 and/or DAT without binding to DRD4 or DRD5. In some uses, the variant allele is DRD2 Ncol Al. The presence of homozygous Al alleles indicates increased susceptibility to the syndrome relative to the presence of heterozygous A1/A2 alleles, and the presence of heterozygous A1/A2 alleles indicates increased susceptibility relative to the presence of homozygous A2/A2 alleles. Thus, a patient having homozygous DRD2 Ncol Al alleles has a relatively high susceptibility to the syndrome. In some patients, the syndrome is manifested by symptoms of migraine with aura. In some of the uses, the medicament is administered intravenously, orally or intramuscularly. In some uses noted above, the medicament is administered prophylactically .

In another aspect, the invention provides methods for determining the suitability of a patient suffering from a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety for treatment with an agent that antagonizes binding of dopamine to DRDl, DRD2, DRD3 and/or DAT. The methods entail detecting a variant allele of one or more dopaminergic genes in the patient. Some exemplary agents are listed in Table 1. For some agents, the blood-brain barrier is impermeable to passage of the agent. Some agents antagonize DRDl, DRD2, DRD3 and/or DAT without binding to DRD4 or DRD5. Such dopaminergic genes include DRDl, DRD2, DRD3 and DAT. In some methods, the variant allele is DRD2 Ncol Al and the presence of homozygous Al alleles indicates increased suitability relative to the presence of heterozygous A1/A2 alleles, and the presence of heterozygous A1/A2 alleles indicates increased susceptibility relative to the presence of homozygous A1/A2 alleles. Thus, a patient having homozygous DRD2 Ncol Al alleles has a relatively high susceptibility to the syndrome. In some patients, the syndrome is manifested by symptoms of migraine with aura. In some methods, the agent is administered intravenously, orally or intramuscularly.

The invention further provides for use of an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT for the manufacture of a medicament for therapy. In such uses, a patient is diagnosed for susceptibility to a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety by a method comprising the step of detecting a variant allele of one or more dopaminergic genes in the patient. Often, the one or more dopaminergic genes for which a variant allele is detected are selected from DRDl, DRD2 , DRD3 and/or DAT. In some such uses, the variant allele is DRD2 Ncol Al and the presence of homozygous Al alleles indicates increased susceptibility to the syndrome relative to the presence of heterozygous A1/A2 alleles, and the presence of heterozygous A1/A2 alleles indicates increased susceptibility relative to the presence of homozygous A2/A2 alleles. Thus, a patient having homozygous DRD2 Ncol Al alleles has a relatively high susceptibility to the syndrome. In some patients, the syndrome is manifested by symptoms of migraine with aura. After diagnosis of the patient, if appropriate, a therapeutically effective amount of an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT is then administered to the patient. Some exemplary agents are listed in Table 1. For some agents, the blood-brain barrier is impermeable to passage of the agent. Some agents antagonize DRDl, DRD2 , DRD3 and/or DAT without binding to DRD4 or DRD5 In some of the above uses, the agent is administered intravenously, orally or intramuscularly. In some uses, the agent is administered prophylactically.

The invention further provides diagnostic agents (e.g. , allele-specific probes and primers) , for detecting a variant allele of one or more dopaminergic genes for use in therapy, prophylaxis or diagnosis. Such dopaminergic genes can be selected from DRDl, DRD2 , DRD3 and DAT. For example, some diagnostic reagents are used to detect the Ncol Al allele of DRD2.

The invention further provides agents, such as any of those described above, for use in therapy, prophylaxis or diagnosis of a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety. The invention further provides for use of such agent in the therapy, prophylaxis or diagnosis of migraine with aura.

The invention further provides for the use of an agent for detecting a variant allele of one or more dopaminergic genes for the manufacture of a diagnostic for use in therapy, prophylaxis or diagnosis. Preferred dopaminergic genes are selected from DRDl, DRD2 , DRD3 and DAT. For example, a suitable variant allele is DRD2 Ncol Al. The diagnostic is typically used in the therapy, prophylaxis or diagnosis of a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety. Further, the diagnostic can be used in the therapy, prophylaxis or diagnosis of migraine with aura. The invention further provides for the use of an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT for the manufacture of a medicament for use in the treatment of a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety associated with the presence of a variant allele of one or more dopaminergic genes. In some such uses, a variant allele is present in one or more dopaminergic genes selected from DRDl, DRD2, DRD3 and DAT. In some such uses, the variant allele is DRD2 Ncol Al and the presence of homozygous Al alleles indicates increased susceptibility to the syndrome relative to the presence of heterozygous A1/A2 alleles, and the presence of heterozygous A1/A2 alleles indicates increased susceptibility relative to the presence of homozygous A2/A2 alleles. Thus, a patient having homozygous DRD2 Ncol Al alleles has a relatively high susceptibility to the syndrome. In some patients, the syndrome is manifested by symptoms of migraine with aura. Some exemplary agents are listed in Table 1. For some agents, the blood-brain barrier is impermeable to passage of the agent. Some agents antagonize DRDl, DRD2, DRD3 and/or DAT without binding to DRD4 or DRD5. In some uses, the agent is administered intravenously, orally or intramuscularly. In some uses, the agent is administered prophylactically. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1A-1D show the percentage of individuals having migraine with aura for different DRDl, DRD2, DRD3 and DAT alleles. Figure 2 shows a risk factor analysis of migraine with aura.

DETAILED DESCRIPTION I. General

The present invention provides methods of diagnosing and treating a syndrome (mada) characterized by symptoms of, or susceptibility to, migraine with aura, depression and/or anxiety, and resulting, at least in part, from variation in one or more dopaminergic genes. These methods are premised in part on the insight that variations in the dopaminergic genes DRDl, DRD2 , DRD3 and DAT are associated with increased susceptibility to migraine with aura, depression and/or anxiety. DRDl, DRD2 and DRD3 are three of five G proteincoupled receptors (DRD1-DRD5) for which dopamine appears to be the primary neurotransmitter . O'Dowd et al., "Dopamine Receptors," in Handbook of Receptors and Channels (ed. Peroutka, CRC Press, Boca Raton, 1994) . DRDl is encoded by an intronless gene (Dearry et al . , Nature 347:72-76 (1990); Zhou et al . , Nature 347:76-80 (1990); Sunahara et al . , Nature 347:80-83 (1990)) and is expressed most abundantly in the caudate, nucleus accumbens and olfactory tubercle. DRDl receptors are thought to act as pre-synaptic autoreceptors modulating neurotransmitter release. The DRD2 gene has a length of about 270 kb, including six introns, the first of which accounts for about 200 kb of the gene. A cDNA sequence of 2500 bp has been reported, which includes some flanking sequences. Grandy et al., Proc . Natl . Acad . Sci . 86, 9762-9766 (1989) . DRD2s are localized in numerous anatomical locations that are believed to play a major role in the pathogenesis of migraine. The highest density of DRD2s are in the substantia nigra and basal ganglia. In the substantia nigra, the DRD2s act as presynaptic autoreceptors which modulate dopamine release (Mengod et al . _f Neurochem . Int . 20, 33S-43S (1992)). In addition, dopamine receptors have been located directly in vascular beds (e.g. , on cerebral arteries) that are believed to be critical in the pathogenesis of migraine. For example, dopamine receptors have been localized to pial vessels (Oudart et al . , Arch . Int . Pharmacodyn . 252, 196-209 (1981); Edvinsson et al . , Br. J . Pharmac . 85, 403-410 (1985)) the site of neurogenic inflammation that is believed to play a major role in the headache component of migraine (Moskowitz, Trends Pharmacol . Sci . 13, 307-311 (1992)). DRD2s are also located in the peripheral and/or central sympathetic nervous system. DRD2s are also located on presynaptic noradrenergic sympathetic ganglia, where they act to inhibit the release from the sympathetic nerve terminals (Clark et al . , Acta Endocrine . , Suppl . 216 88, 75-81 (1978); Ziegler et al . , Clin . Pharmacol . Ther . 25, 137-142

(1979); Mercuro, Eur . J . Clin . Pharmacol . 27, 671-675 (1985); Montastruc et al . Eur . J . Pharmacol . 166, 511-514 (1989) ) .

The DRD3 gene has a high degree of sequence identity with the DRD2 gene (O'Dowd et al . , Handbook of Receptors and Channels : G Protein-coupled Receptors (ed Peroutka, S.J.) 95-123 (CRC Press, Boca Raton, 1994); Sokoloff et al . , Nature 347:146-151 (1990)). Like DRD2 , the DRD3 receptor acts as both a postsynaptic receptor and an autoreceptor which inhibits dopamine release (Tang et al . , J . Pharmacol . Exp. Ther . 270:475-476 (1994)). Expression of DRD3 has been localized to the limbic areas of the brain (Mengod et al . , Neurochem . Int . 20:33S-43S (1992); Sokoloff et al . , Nature 347:146-151 (1990)) suggesting that it may be associated with cognitive, emotional and endocrine functions. Most drugs that interact with DRD2 also interact with similar affinity with DRD3 (Sokoloff et al . , Nature 347:146-151 (1990)). However, the density of expressed DRD3 receptors is low, estimated at about 1% of that of DRD2 (Accili et al . , Proc . Nat . Acad . Sci . 93:1945-1949 (1996)).

The dopamine transporter (DAT) gene is a key regulatory protein in the dopamine pathway that modulates the amount of dopamine release and re-uptake (Shimada et al . , Science 254:576-577 (1991)).

Variant alleles of the dopaminergic genes DRDl, DRD2 , DRD3 and DAT probably cause increased susceptibility to migraine with aura, depression and/or anxiety as a result of increased dopaminergic transmission. The proposed role of dopaminergic genes in migraine with aura is consistent with several clinical features of the disease. For example, nausea and/or vomiting are common features of migraine in which dopamine stimulation is likely. Gastrokinetic changes, hypotension and other autonomic nervous system changes are additional migraine symptoms that are consistent with disturbances in dopaminergic neurotransmission. The proposed mechanism is also consistent with previous reports of exaggerated autonomic responses to dopamine agonists in migraine patients. For example, apo orphine has been reported to induce symptoms of migraine, as well as the associated phenomenon of nausea, vomiting, yawning, hypotension and syncope (DelZompo et al., Headache 35, 222-224 (1995)).

II. Analysis of Polymorphisms in Dopaminergic Genes

The methods of diagnosis and treatment described below usually require knowledge of the genotype of an individual with respect to polymorphisms in the genes DRDl, DRD2, DRD3 , and/or DAT. Exemplary polymorphisms within each of these genes that correlate with migraine with aura, depression and/or anxiety are described in the Examples, as are methods for their detection. Specifically, these polymorphisms include: an A to G polymorphism in the 5' untranslated region of DRDl having alleles designated Bl and B2 as described by Cichon et al . , Hum . Hoi . Genet . 3:209-209 (1994); a C to T polymorphism at codon 313 of DRD2 having alleles designated Ncol Al and Ncol A2 (Sarker et al . , Genomics 11:8-14 (1991)); an A to G substitution 25 bp downstream from the start codon in DRD3 having alleles designated Al and A2 (Rietschel et al . , Psychiatr. Res . 46:253-259 (1993)); and a polymorphic 40 bp repeat in the 3' untranslated region of DAT having alleles designated 9 and 10 (Vandenbergh et al., Genomics 14:1104-1106 (1992)). It is expected that the DRD2 TaqI Al allele (Noble, Science & Hedicine 3, 52-61 (1996)), which is known to be in linkage disequilibrium with DRD2 Ncol Al, can be used in diagnostic methods in a similar manner to DRD2 Ncol Al.

Other variant forms of the DRDl, DRD2 , DRD3 and DAT genes that correlate with migraine with aura, anxiety and/or depression can be identified as follows. The first step is to identify additional polymorphic sites within one of these genes. Such polymorphic sites can be identified either by comparative sequencing of these genes in a population of individuals or from the published literature and databases. For example, several additional polymorphic sites in the DRD2 gene have been published including TaqlB within intron 2, Fokl B at position 1105, HphI at position 3208, C311S at position 3413, Ncol at position 3420 and TaqlA within the 3' untranslated region. (Residues in genomic DNA are assigned the same number as the corresponding nucleotide in cDNA when the two are maximally aligned, and nucleotides in the cDNA are numbered according to the convention of Dal Toso, EHBO J. 8, 4025-4034 (1989)).

Having identified the location of a polymorphism and the nature of its polymorphic forms, a correlation is performed between type of polymorphic form and presence or absence of migraine with aura, depression, and/or anxiety in a population. Optionally, the correlation can be determined with respect to combinations of two or more polymorphisms within the same gene. For example, individuals having the Ncol Al allele are subdivided into two classes respectively having Al and A2 alleles of the Fokl polymorphism. Thus, for example, one can determine whether the Ncol Al/ Fokl Al genotype correlates significantly more strongly with migraine with aura than the Ncol Al/Fokl A2 genotype. Variant genes can be detected, for example, by sequencing, allele-specific amplification (Gibbs, Nucleic Acid Res . 17, 12427-12448 (1989)), restriction enzyme analysis, allele-specific probe hybridization assays (Saiki et al., Nature 324, 163-166 (1986)) or singlestranded conformational analysis (Orita et al., Proc. Natl . Acad . Sci . 86, 2766-2770 (1989)). For example, the Ncol Al and A2 alleles can be distinguished by Ncol digestion. Only the A2 allele is cut. Reagents used for detecting variant alleles, such as allele specific probes and primers can be packaged as diagnostic reagents. The diagnostic reagents can bear labels indicating their suitability for use in diagnosis of the mada syndrome or a symptom thereof.

.X L Susceptibility Analysis The present data indicate that analysis of DRDl,

DRD2, DRD3 and/or DAT gene in a patient can be used as a measure of susceptibility to migraine with aura, depression and/or anxiety. For example, detection of one or both copies of the Ncol Al allele of DRD2 indicates increased susceptibility to migraine with aura, depression and/or anxiety in the patient, and detection of both copies indicates increased susceptibility relative to one copy. Detection of one or both copies of DRDl Bl indicates increased risk of migraine with aura relative to homozygous DRDl B2. Detection of homozygous DRD3 A2 indicates increased risk of migraine with aura relative to homozygous or heterozygous DRD3 Al. Detection of homozygous DAT 10 indicates increased risk of migraine with aura relative to heterozygous DAT 10/9 and probably 9/9 genotype, although the latter occurs with insufficient frequency to have been included in the present analysis.

Although the probability of an individual having any one variant allele developing the mada syndrome is low (no more than 20%) , the individual probabilities combine in an additive fashion. The presence of each variant allele associated with the mada syndrome can be assigned a risk factor related to the probability, as discussed in the Examples. Fig. 2 shows the percentage of individuals having migraine with aura as a function of number of risk factors present. It can be seen that no individuals without any dopaminergic risk factor have symptoms of the mada syndrome and about 75% of individuals with all five dopaminergic risk factors have symptoms of the mada syndrome. Individuals with 1-4 risk factors show intermediate frequencies of symptoms of the mada syndrome in relation to the number of risk factors present. There are probably other genes besides the dopaminergic genes described above having variant forms associated with risk of the mada syndrome. The existence of variant forms of such genes can be detected and correlated with probabilities of susceptibility to the syndrome in similar fashion to the analysis of dopaminergic genes. Combined statistical analysis of dopaminergic genes with other genes still further increases the predictive value of the diagnosis.

The analysis is useful in identifying a subset of patients having a common genetic basis giving rise to the mada syndrome. Such patients are amenable to treatment with antagonists of dopaminergic genes as discussed below. Treatment with such antagonists may be ineffective in other patients, who exhibit similar symptoms to patients with the syndrome, but due to a different genetic basis. This analysis is also useful in distinguishing migraine with aura from migraine without aura, and others diseases, such as stroke, which may present with similar symptoms. That is, a patient with a high number of risk factors for the mada syndrome is more at risk for migraine with aura than for migraine without aura or stroke. IV. Methods of Treatment

The invention further provides methods of treating patients suffering from, or susceptible to, the mada syndrome. In these methods, a patient having or susceptible to symptoms of migraine with aura, depression and or anxiety is treated with a therapeutically effective dose of an antagonist to one or more of the dopaminergic genes DRDl, DRD2 , DRD3 and DAT. Such a dose is sufficient to prevent, arrest or detectably relieve symptoms of migraine with aura, depression and/or anxiety. The dose can be administered prophylactically or therapeutically. The dose can also be administered to pediatric or handicapped patients but who are unable to articulate their symptoms but are known to have variant forms of one or more variant forms of the dopaminergic genes associated with the disease.

In general, the stronger the binding of an antagonist to the dopaminergic protein, the greater the efficacy. Buproprion (2-tert-butylamino-3 • - chloropropiophenone hydroxide) manufactured by Glaxo

Wellcome is an example of a DAT antagonist. A list of DRD2 antagonists and appropriate dosages is provided in Table 1. Many of these antagonists also bind to other dopaminergic receptors, particular DRD3 and DRD4, which are most closely related to DRD2. DRD2 antagonists include phenothiazines (chlorpromazine, fluphenazine, prochlorperazine, promethazine, thioridazine and trifluoperazine) , butyrophenomes (droperidol, haloperidol, pimozide, spiperone) , thioxanthines (chlorprothixene, thiothixene) and other drugs, such as clozapine. Some antagonists are capable of crossing the blood-brain barrier and therefore capable of antagonizing both central and peripheral dopaminergic receptors. Other antagonists such as domperidone do not cross the blood-brain barrier and therefore antagonize only peripheral receptors. Some agents such as domperidone, metoclopramide, chlorpromazine, prochloperazine and flunarazine have previously been reported to have some value in treating some migraine patients. However, the mechanism of action was not known, not was it appreciated that the agents are most appropriate for administration to the subset of migraine patients having migraine with aura and variant forms of one or more of the dopaminergic genes DRDl, DRD2 , DRD3 , DRD4 and DAT.

Antagonists can be used to manufacture medicaments for use in treatment of the syndrome. Antagonists can be mixed with a pharmaceutical carrier, which can be any compatible, non-toxic substance suitable to deliver the antagonist to the patient. Sterile water, alcohol, fats, waxes, and inert solids can be used as the carrier. Pharmaceutically-acceptable adjuvants, buffering agents, dispersing agents, and the like, can also be incorporated into the pharmaceutical compositions. The concentration of the active agent in the pharmaceutical composition can vary widely, i.e., from less than about 0.1% by weight, usually being at least about 1% by weight to as much as 20% by weight or more. Medicaments can be administered intravenously, intramuscularly, subcutaneously, intranasally, cutaneously, via suppository, by inhalation or orally. Methods for preparing parenterally administrable compositions are described in more detail in, for example, Remington ' s Pharmaceutical Science (15th ed. , Mack Publishing Company, Easton, Pennsylvania, 1980) (incorporated by reference in its entirety for all purposes) .

For oral administration, the active ingredient can be administered in solid dosage forms, such as capsules, tablets, and powders, or in liquid dosage forms, such as elixirs, syrups, and suspensions. Active component (s) can be encapsulated in gelatin capsules together with inactive ingredients and powdered carriers, such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcum, magnesium carbonate and the like. Examples of additional inactive ingredients that may be added to provide desirable color, taste, stability, buffering capacity, dispersion or other known desirable features are red iron oxide, silica gel, sodium lauryl sulfate, titanium dioxide, edible white ink and the like. Similar diluents can be used to make compressed tablets . Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric-coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.

-L, Screening Drugs

The invention further provides methods of screening for novel antagonists of DRDl, DRD2 , DRD3 and/or DAT for treatment of the syndrome. Potential agents are screened for specific binding (Kd < μM) to human DRDl, DRD2 , DRD3 or DAT, optionally in competition with dopamine. Preferred agents bind with a Kd less than 10 nM and can therefore usually be used at a dose of about 10 mg/patient. Receptor binding assays can be performed as described by Ison & Peroutka, Cancer Treatment Reports 70, 637 (1986); Peroutka & Snyder, Am . J . Psychiatry 137, 12 (1980) using cloned and expressed human receptors or human receptors located in post-mortem human tissues. Some agents are screened for lack of specific binding to at least one of dopaminergic receptors DRD4 or DRD5. The agents can also be screened for lack of specific binding to other receptors to minimize side effects. For example, lack of binding to the -adrenergic receptor minimizes orthostatic hypotensive side-effects.

Preferred agents have a serum half-life of about 24 hr and can reach peak plasma levels within about 15-60 min of administration. EXAMPLES

Correlations Between Miσraine with Aura and Dopaminergic ££I1££

This example describes analysis of allelic variants within all five dopamine receptor genes (DRDl, DRD2, DRD3, DRD4 and DRD5) and the DAT gene in control, migraine without aura (MO) and MWA individuals.

A. METHODS

1. subjects Subjects were identified for this study by physician referral. Individuals were evaluated using the diagnostic criteria for MO and MWA established by the International Headache Society (Cephalalgia 8, 1-96 (1988)). The lifetime presence or absence was determined for each of the criteria in the IHS definition of migraine. Interviews were conducted by physicians, nurses and/or trained interviewers. All interviewers were trained by the present inventor in the use of the IHS criteria and all clinical data were reviewed by the same neurologist. Control group individuals did not meet IHS criteria for migraine (based on direct interview) and were predominantly unaffected spouses of the individuals with migraine. Informed consent was obtained and DNA samples collected. All clinical data were obtained independently of the genotypic data. The average age of the study participants is 53 ± 1 years. No variation was observed between the 3 study groups in terms of age, sex or ethnic origin.

2. Genotypinα A total of 246 DNA samples from unrelated individuals, who were 35 years of age or older, were analyzed (115 control individuals; 77 MO individuals; 54 MWA individuals) . Genomic DNA was isolated using the Puregene DNA isolation kit (Gentra Systems, Research Triangle Park, North Carolina) . Genotypes were scored independently by two individuals blinded to the clinical status. 3. DRDl . DRD2 , DRD3 anc? DRD5 DRDl, DRD2, DRD3 and DRD5 were amplified as follows. Briefly, 40 ng of genomic DNA was amplified in 10 μL of a solution containing lx Perkin Elmer PCR amplification buffer, 400 μM each dNTP, 0.5 U TagrGold polymerase

(Perkin Elmer, Foster City, CA) and 1 μM primers. The enzyme was activated with an initial incubation at 94°C for 10 minutes, followed by 14 cycles of amplification with denaturation at 94°C for 20 seconds, annealing at 63°C for 1 minute, elongation at 72°C for 30 seconds with a decrease of 0.5°C and 3 seconds for each annealing step, and an additional 40 cycles of denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds and elongation at 72°C for 1 minute. After amplification, 10 uL of a solution containing 2x restriction enzyme buffer and 4 U of the appropriate restriction enzyme were added directly to the amplification reaction and incubated at 37°C for greater than 4 hours. Digested products were separated on 1.5% SFR agarose gels (Amresco, Solon, OH) . Primers used for amplification of each marker, restriction enzymes used to distinguish genotypes and the expected sizes of each allele are listed in Table 2.

1MLΪ 2

ALLELE IDENTIFICATION METHODS

TGTGGTGTAGGGAACGGCCTGAG CTTCCTGGAGGTCACGΠCTCAAGG

4 . DRD4

DRD4 genotypes were assessed by amplifying 50 ng of genomic DNA in 10 μL of lx ThermoPol buffer (New England Biolabs) , 400 uM dNTP, 1 uM of each primer (see Table 2) and 0.2 U Vent (exo^") Polymerase. Amplification consisted of 35 cycles of denaturation at 98 °C for l minute and annealing/elongation at 70 °C for 5 minutes. Amplification products were analyzed on 1.2% agarose gels.

5. DAT. DAT genotypes were assessed by amplifying 40 ng of genomic DNA in the presence of 0.5 μM of fluorescence- labelled dUTP (Applied Biosystems, Foster City, CA) . Reactions progressed through 35 cycles of denaturation at 94 °C for 1 minute and annealing/elongation at 72 °C for 1 minute. Amplified products were analyzed on an ABI 373 sequencer using a 6% polyacrylamide gel. Analysis was performed as described previously (Vandenbergh et al . , Hoi . Brain Res . 15, 161-166 (1992)); Doucette-Stamm et al. Genet . Epidemiol . 12, 303-308 (1995)).

B. RESULTS

1. DRDl 5' UTR B and B2 Allele Frequencies An A to G polymorphism has been described in the 5 ' untranslated region of the DRDl gene (Cichon et al., Hum . Hoi . Genet . 3, 209-209 (1994)). In the current dataset (n = 246 individuals) , the DRDl Bl allele frequency is 0.37 and the B2 allele frequency is 0.63. These values are similar to the DRDl Bl and B2 allele frequencies reported in Caucasians (id.). In the overall dataset, 16% of individuals have the Bl/Bl genotype, 41% have the B1/B2 genotype and 43% display the B2/B2 genotype.

An association of MWA and the DRDl Bl allele is apparent in an analysis of genotype distributions (Table 3) . No significant difference is observed in the genotypic distribution between the control group and individuals with MO. The B2/B2 genotype in the dataset is significantly less frequent in individuals with MWA (28%) than in control individuals and individuals with MO (Chi-square = 6.28; p < 0.006). MWA is observed in 14% of the B2/B2 individuals, 26% of the B1/B2 individuals and 31% of the Bl/Bl individuals (Figure 1A) . T-AP- E ?

DOPAMINE Dl RECEPTOR POLYMORPHISM FREQUENCIES IN A SAMPLE OF 246 INDIVIDUALS

Genotypes Allele Frequencies

B1/B1 (%l B1 /B2 <%l B2/B2 1%) B1 B2

Control* (n « 115) 16 (13%) 45 139%) 55 (48%) 0.33 0.67

MO Subjects (n- 77) 12 (16%) 30 (39%) 35 145%) 0.35 0.65

MWA Subjects (n = 64) 12 (22%) 27 (50%) 15 <28%l 0.47 .53^O"^o'

TOTAL In = 2461 39 (16%l 102 (41 %l 105 (43%l 0.37 0.63

* Ch riii--ssqquuaarere ^• «* 66..7711 ((pp << 00..0011)) vvss.. ccoonnttrrooll ggrroouupp

* "C :hii--ιsαquuaarare == 33..9911 I (Dp << 00..0022)) vvss.. MMOO α grroouupp

* Chl-tquare ■ 6.75 (p < 0.009) vs. the combined control and MO group

The DRDl Bl and B2 allele frequencies were also determined in each subgroup of subjects. Similar allele frequencies are observed in both the control group and individuals with M0. By contrast, individuals with MWA have a significantly greater frequency of the DRD2 Bl allele (0.47) than either the control group (Chi-square = 6.71; p < 0.01) or individuals with M0 (Chi-square = 3.91; p < 0.02) .

2. DRD2 iVcoI Al and A2 Allele Frequencies A C to T polymorphism, resulting in a silent mutation at amino acid 313, has been described in the DRD2 gene (Sarkar et al . , Genomics 11, 8-14 (1991).). In the current dataset, the DRD2 Ncol Al allele frequency is 0.73 and the A2 allele frequency is 0.27. These values are similar to the DRD2 Wcol allele frequencies reported in the North American population (id.). In the overall dataset, 54% of individuals have the Al/Al genotype, 37% have the A1/A2 genotype and 8% display the A2/A2 genotype.

An association of MWA and the DRD2 Al allele is apparent in an analysis of genotype distributions (Table 4) . No significant difference is observed in the genotypic distribution between the control group and individuals with MO. The Al/Al genotype in the dataset is significantly more frequent in individuals with MWA (69%) than in control individuals and individuals with M0 (Chi-square = 5.50; p < 0.01). MWA is observed in 5% of the A2/A2 individuals, 17% of the A1/A2 individuals and 28% of the Al/Al individuals (Figure 1A) . TABLE 4

DOPAMINE D2 RECEPTOR Ncol POLYMORPHISM FREQUENCIES IN A SAMPLE OF 246 INDIVIDUALS

Qβnotypes Allele Frequencies

A1/A1 (%) A1/A2 (%] A2/A2 (%l A1 A2

Controls (n» 115) 57 (50%) 48 (42%) 10 (9%) 0.70 0.30

MO Subjects (π = 77) 40 (52%) 28 (36%) 9 (12%) 0.70 0.30

MWA Subjects <n= 54) 37 (69%) 16 (30% 1 ( 2%) 0.83 0.17' " '

TOTAL In = 246! 134 (54 %l 92 (37%) 20 ( 8%l 0.73 0.27 * Chi-square = 6.45 (p < 0.01) VB. control group

^• 'Chi-square ^•* 5.99 Ip < 0.01) vs. MO group # Chi-square *-. 7.28 (p < 0.007) vs. the combined control and MO group

The DRD2 Ncol A allele frequencies were also determined in each subgroup of subjects (Table 5) . Similar allele frequencies were observed in both the control group and individuals with MO. By contrast, individuals with migraine with aura had a significantly greater frequency of the DRD2 Al allele (0.83) than either the control group or individuals with migraine without aura.

3. DRD3 Al and A2 Allele Frequencies

A polymorphism resulting in a glycine to serine substitution at position 9 in the Ν-terminal part of the DRD3 receptor was analyzed (Lannfelt et al . , Psychiatr. Genet . 2 , 249-256 (1992)). The polymorphism consists of a A to G substitution which is 25 bp downstream from the start codon, creating a restriction site for Ball. This polymorphism has been hypothesized to play a role in receptor insertion into the cell membrane (Rietschel et al . , Psychiatr. Res . 46, 253-259 (1993). In the overall dataset, the DRD3 Al allele frequency is 0.62 and the A2 allele frequency is 0.37. These values are similar to the DRD3 allele frequencies reported in previous studies (id.). In the overall dataset, 37% of individuals have the Al/Al genotype, 50% have the A1/A2 genotype and 12% display the A2/A2 genotype.

No significant difference was observed in the genotypic distribution between the control group and individuals with MO (Table 5) . However, the DRD3 A2/A2 genotype in the dataset is significantly more frequent in individuals with MWA (20%) than in control individuals and individuals with MO (Chi-square = 4.32; p < 0.02). MWA is observed in 22% of the Al/Al individuals, 19% of the A1/A2 individuals and 37% of the A2/A2 individuals (Figure IC) . The DRD3 A2 allele frequencies is increased in MWA compared to both control and MO individuals. However, this difference does not reach statistical significance.

TABLE 5

DOPAMINE D3 RECEPTOR POLYMORPHISM FREQUENCIES IN A SAMPLE OF 246 INDIVIDUALS

Genotyp es Allele Frequencies

A1/A1 (%) A1/Λ2 (%> A2/A2 (%l Al A2

Coπtroli (n = 115) 45 (39%) 58 (50%) 12 (10%) 0.64 0.36

MO Subject! (n = 77) 27 (35%) 43 (56%) 7 (9%) 0.63 0.37

MWA Subject* In = 54) 20 (37%) 23 (43%) 1 1 (20%)' 0.58 0.42

TOTAL In = 2461 92 (37%) 124 (5-Jttl 30 (12%) 0.63 0.37

Chi-square s 4.32 (p < 0.02) vs. the combined control and M0 group

4. D D4 Allele Frequencies The DRD4 gene contains a 48-bp sequence in the third cytoplasmic loop of the receptor that ranges from 2- to 8-fold repeat units (Van Tol et al . , Nature 358, 149-152 (1992) . In the current dataset, genotypes were obtained on 238 of the 246 individuals. The observed allele frequency distribution is similar to the DRD4 allele frequencies reported in the North American population (id.): 2 repeats (n = 38; 0.08 allele frequency), 3 repeats (n = 26; 0.05), 4 repeats (n = 310; 0.65), 5 repeats (n = 1; < 0.01) and 7 repeats (n = 101; 0.21). In the current dataset, 106 individuals (45%) display the most common genotype (i.e., 4/4) whereas 91 individuals (38%) have at least one 7 allele (Table 6).

TABLE 6

DOPAMINE D4 RECEPTOR POLYMORPHISM FREQUENCIES IN A SAMPLE OF 238 INDIVIDUALS

Genotypes Allele Frequencies

7 allele 4, 7 7 allele

Dresent (%) oenotvDe 1%) absent 1%) 4 allele 7 allele

Controls (n « 1 10l 38 (35%) 30 (27%) 72 (65%) 0.70 0.18

M0 Subjects In = 75) 34 (45%) 20 (27%) 41 (55%) 0.57 0.27

MWA Subject* In = 63) 19 (36%) 13 (25%) 34 (64%) 0.65 0.20

TOTAL In = 2381 91 (38%l 63 127%) 147 I62%1 0.65 P.21

No significant difference is observed in the genotypic distribution between the control group, individuals with MO and individuals with MWA (data on the most common genotypes are summarized in Table 6) . MWA is observed in 21% of individuals with a 7 allele and 23% of individuals without a 7 allele. Similar allele frequencies are observed in the control group, individuals with MO and individuals with MWA (Table 6) .

5. DRD5 Al and A2 Allele Frequencies

In the current dataset, the DRD5 Al allele frequency is 0.68 and the A2 allele frequency is 0.32. These values are similar to the DRD5 allele frequencies reported in the North American population (So meret al., Hum . Genet . 92, 633-634 (1993)). In the overall dataset, 47% of individuals have the Al/Al genotype, 43% have the A1/A2 genotype and 10% display the A2/A2 genotype. No significant difference was observed in the genotypic distribution between the control group, individuals with MO and individuals with MWA (Table 7) . MWA is observed in 22% of the Al/Al individuals, 23% of the A1/A2 individuals and 16% of the A2/A2 individuals. Similar allele frequencies are observed in the control group, individuals with MO and individuals with MWA (Table 7) .

IΔBLE_Z. DOPAMINE D5 RECEPTOR POLYMORPHISM FREQUENCIES

IN A SAMPLE OF 246 INDIVIDUALS

Genotypes Allele Frequencies

Al/Al (%) A1/A2 (%) A2/A2 (%) Al A2

Controls (n=115) 58 (50%) 45 (39%) 12 (10%) 0.70 0.30

M0 Subjects (n=77) 32 (4₂%) 36 (47%) 9 (12%) 0.65 0.35

MWA Subjects (n=54) 26 (48%) ₂4 (44%) 4 C%) 0.70 0.30

TOTAL (n=246) 116 (47%) 105 14-?*) 25 (10%) 0.66 0.32

6. DAT 9 and 10 Allele Frequencies A polymorphic 40 bp repeat in the 3' untranslated region as been identified in the DAT gene (Vandenbergh et al., Genomics 14, 1104-1106 (1992)). In the overall dataset, the DAT 9 allele frequency is 0.22, the 10 allele frequency is 0.77 and more rare alleles have a frequency of 0.01. These values are similar to the DAT allele frequencies reported in previous studies (id.). In the overall dataset, 35% of individuals have the 9/10 genotype and 59% display the 10/10 genotype. The less frequent DAT genotypes polymorphisms are as follows: 9/9 (n = 11), 1/2 (n = 2) and 2/8 (n=l) . Since only 14 individuals (5.7%) have these less frequent genotypes, these individuals were not analyzed independently in the present study.

No significant difference was observed in the genotypic distribution between the control group and individuals with MO. An association of MWA and the 10/10 genotypes is observed in the present study (Table 8) . MWA is observed in 13% of the 9/10 individuals and 25% of the 10/10 individuals (Figure ID). The 10/10 genotype frequency is significantly higher in the MWA group (69%) in comparison to the 9/10 genotype frequency in the control subjects (38%; Chi-square = 4.46; p < 0.02) and to the MO group (40%; Chi-square = 4.41; p < 0.02). A higher level of statistical significance is observed when the 10/10 genotype frequency in the MWA group is compared to the 9/10 genotype in the combined control and MO groups (39%; Chi-square = 6.46; p < 0.006).

TABLE 8

DOPAMINE TRANSPORTER POLYMORPHISM FREQUENCIES IN A SAMPLE OF 246 INDIVIDUALS

Genotypes Allele Frequencies

9/10 (*) 10/10 (%) other (%) 9 10

Controls (n=115) 44 (38 ) 65 (57%) 6 I 5%) 0.22 0.7Θ

MO Subjects (n=77) 31 (40%) 44 (57%) 2 ( 3%) 0.22 0.77

MWA Subjects (n=5 ) 11 (₂0%) 37 (69%r- ^•" 6 (11%) 0.21 0.79

TOTAL (n=243) 86 l?5*l ,. 146 IS?*) 14 ( 6%) 0.2? 0.78

* Chi-square = 4.46 (p < 0.02) vs. control group ** Chi-square = 4.41 (p < 0.02) vs. MO group

# Chi-square = 6.46 (p < 0.006) vs. combined control and MO group

7. Allelic "Risk Factor" Assessment Risk factor analysis has proven to be an important approach to the assessment and management of cardiovascular disease (Kannel, Hosp. Pract . 25, 119-130 (1990); Wilson, Am. J . Hy pert ens . 7, 7S-12S (1994); Hancock, Scientific American Hedicine (eds Dale, D. C. & Federman, D. D.) 1-12 (Scientific American, Inc., New York, 1995) . Applying the principles of risk factor analysis to MWA, an analysis of the data was performed based on the allelic variants which showed independent associations with MWA. The goal of this analysis was to determine if additive and/or synergistic effects exist between the dopaminergic genes in terms of MWA.

Based on the data in the present study, 5 specific allelic "risk factors" were identified that were associated independently with an increased susceptibility to MWA compared to alternative genotypes at the same molecular location within the dopaminergic genes: the DRDl Bl/Bl or B1/B2 genotype, the DRD2 Al/Al genotype, the DRD2 A1/A2 genotype, the DRD3 A2/A2 genotype and the DAT 10/10 genotype. Although the strength of the associations varied amongst the different genes, an initial attempt to develop a "risk factor" profile for MWA assigned equal weight to each allelic "risk factor" with a single exception: the DRD2 Al allele. Individuals with the DRD2 Al/Al genotype were assigned a risk factor of "2" since the frequency of MWA appeared to be related to the number DRD2 Al alleles present in an individual (Table

4). The number of allelic "risk factors" were determined for each individual in the present study (i.e., 0-5 dopaminergic allelic "risk factors" per individual) . The frequency of MWA was then determined in each allelic "risk factor" group. As summarized in Figure 2, MWA was present in 0% of individuals (n = 6) with 0 "risk factors", 11% of individuals (n = 19) with 1 "risk factor", 14% of individuals (n = 69) with 2 "risk factors", 18% of individuals (n = 92), with 3 "risk factors", 39% of individuals (n = 56) with 4 "risk factors" and 75% of individuals (n = 4) with all 5 dopaminergic allelic "risk factors".

Finally, MWA frequency was determined in individuals with 0, 1 or 2 allelic "risk factors" vs. individuals with 4 or 5 allelic "risk factors". Individuals with 4 or 5 allelic "risk factors" have a significantly greater (Chi- square = 16.67; p < 0.00002) incidence of MWA (42%) than individuals with 0,1 or 2 allelic "risk factors" (13%).

II. Association Between Comorbid Migraine. Anxiety and Depression and DRD2 Ncol Alleles

In epide iological studies, a clinical diagnosis of migraine significantly increases the risk of comorbid anxiety and depression. However, because all of these diseases are probably multifactorial, the fact that a specific genetic locus may correlate with one of these symptoms does not necessarily imply that it correlates with others. This example tests whether variant forms of dopaminergic genes correlate with depression and anxiety as well as with migraine with aura.

A. METHODS

The data described in this study are derived from a clinical genetic relational database that was developed initially for the genetic analysis of migraine Peroutka & Howell, Towards Higraine 2000 , (Amsterdam, Elsevier Science B.V. , 1996), pp. 35-48. Potential subjects were identified by physician or self-referral. Subjects were evaluated using a semi-structured interview for migraine. Migraine evaluations were conducted by a neurologist and/or trained interviewer. The lifetime presence or absence was determined for each of the criteria in the International Headache Society (IHS) definition of migraine with (MWA) (Cephalalgia 8, 1-96 (1988) .

A semi-structured interview based on the Structured Clinical Interview for DSM-III-R (SCID) (Spitzer et al., .Arch Gen Psychiatr 1992;49:624-629), modified to include the criteria of the Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV) (Diagnostic and Statistical Hanual of Hental Disorders . Vol. 4. (Washington, DC, American Psychiatric Association, 1994) , pp. pp. 317-391 and 393-444) was used to evaluate anxiety and depressive disorders in the same individuals interviewed for migraine. The interview included questions that were appropriate to establish a DSM-IV-based diagnosis of generalized anxiety disorder (GAD) , phobias, panic attacks, panic disorder, obsessive-compulsive disorder (OCD) and major depression. Interviews were performed by physicians or trained psychiatric nurses. Diagnoses required the concurrence of at least 3 physicians.

Genomic DNA was isolated using the Puregene DNA isolation kit (Gentra Systems, Research Triangle Park, North Carolina) . Genotyping of the DRD2 Ncol polymorphism was performed using previously described primers (Sarkar et al., Genomics 11,8-14 (1991). Briefly, 40 ng of genomic DNA was amplified in 10 uL of a solution containing lx Perkin Elmer PCR amplification buffer, 400 uM each dNTP, 0.5 U TagGold polymerase

(Perkin Elmer, Foster City, CA) and 1 uM primers DRD2.35 (ATCCTGCAGCCATGG) and DRD2.38 (ATTGTCCGGCTTTACC) . The enzyme was activated with an initial incubation at 94°C for 10 minutes, followed by 14 cycles of amplification with denaturation at 94°C for 20 seconds, annealing at

63°C for 1 minute, elongation at 72°C for 30 seconds with a decrease of 0.5°C and 3 seconds for each annealing step, and an additional 40 cycles of denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds and elongation at 72°C for 1 minute. After amplification, 10 uL of a solution containing 2x NEB4 buffer and 2 U Ncol (New England Biolabs, Beverly, MA) were added directly to the amplification reaction and incubated at 37°C for greater than 4 hours. The digested products were separated on a 1.2% agarose SFR gel (Amresco, Solon, OH). Analysis of the genotype was performed by two individuals blinded to the clinical status.

B. RESULTS

1. Clinical characteristics of individuals in the present study

Direct diagnostic interviews were completed on all individuals in the present study (n = 242) . A diagnosis was made only if the individual met DSM or IHS criteria for the disorders listed in Table 9. If a clear clinical diagnosis could not be made, the subject was not included in any further statistical analyses for that particular disorder. For each of the conditions analyzed, a diagnosis was made in at least 98% of the individuals. In the overall dataset, 55% (134/242) of individuals were diagnosed with at least one of the clinical disorders analyzed. As shown in Table 9, anxiety disorders are the most common diagnosis, being present in 46% (122/242) of the current dataset. Major depression is the single most common diagnosis (i.e., 38%) amongst the group of analyzed disorders in the present study. The incidences of panic attacks (31%) and phobia (29%) are similar. MWA is present in 21% of the individuals. Panic disorder, GAD and OCD are present in less than 20% of the current study group.

TABLE 9

INCIDENCE OF MIGRAINE WITH AURA, ANXIETY DISORDERSAND MAJOR DEPRESSION

IN THE INDIVIDUALS (n=242) IN THE PRESENT STUDY

The clinical diagnoses were based on DSM criteria for the anxiety disorders and major depression and on IHS criteria for MWA. If a clear diagnosis could not be made, the individual was "not diagnosed" and was not included in further statistical analyses for the disorder.

Affected Unaffected Not diagnosed

MWA, anxiety or depression 55% 45% 0%

Any anxiety disorder 46% 54% 0%

Major Depression 38% 61 % 1 %

Panic Attacks 31 % 68% 1 %

Phobia 29% 69% 2%

Migraine with Aura 21 % 79% 0%

Panic Disorder 19% 81 % 1 %

Generalized Anxiety Disorder 17% 81 % 2%

Obsessive ComDulβive Disorder 14% 8Θ% 0%

2. Frequency of neuropsychiatric disorders based on DRD2 Nco I genotypes

The incidences of the various clinical diagnoses based on DRD2 Ncol genotypes is provided in Table 10. A present or past history of MWA, anxiety disorders or major depression is present in 69% of the Al/Al individuals, 53% of the A1/A2 individuals and 22% of the A2/A2 individuals. The incidence of any of these neuropsychiatric diagnoses is significantly higher in the Al/Al individuals when compared to either the A1/A2 individuals (Chi-square=6.53 ; p < 0.005), A2/A2 individuals (Chi-square=15.29; p < 0.00005), or the combined A2/any group of individuals (Chi-square=12.72; p < 0.0002) .

TABLE 10

INCIDENCE OF MIGRAINE WITH AURA, ANXIETY DISORDERS AND

MAJOR DEPRESSION IN THE CURRENT DATABASE

BASED ON DRD2 Ncol GENOTYPES

A1/A1 A1/A2 A 2/ A 2 Chi- square analysia

(π = 1311 In = 93) ln = 18l A1/A1 VS . A2/anv D value

MWA. anxiety or depression 69% 53% 22% 12.72 0.0002

Any anxiety disorder 54% 41 % 17% 7.20 0.004

Generalized Anxiety Disorder 23% 11 % 1 1 % 6.1 1 0.007

Major Dap. 45% 33% 17% 5.18 0.01

Panic Attacks 38% 26% 17% 4.96 0.01

Migraine with Aura 26% 17% 6% 4.09 0.02

Phobia 34% 27% 1 1 % 2.60 0.05

Panic Disorder 22% 16% 1 1 % 1.45 n.s.

Obsessive ComDulslvβ Disorder 14% 16% 0% 0.01 n.s.

The presence of an anxiety disorder is significantly more frequent in the Al/Al individuals than in either the A1/A2 individuals (Chi-square=3.87 ; p < 0.02), A2/A2 individuals (Chi-square=8.92 p < 0.001), or the combined A2/any group of individuals (Chi-square=7.20; p < 0.004). A similar pattern in seen with GAD. Major depression, panic attacks, MWA and phobia are also all increased significantly in the Al/Al vs. A2/any individuals (Table 10) . Although both panic disorder and OCD are more frequent in the Al/Al vs. A2/any individuals, the difference does nor reach statistical significance. However, OCD is more frequent in the Al/Al individuals than in the A2/A2 individuals (Chi-square=2.84; p < 0.05).

3. D D2 Nco I allele frequencies in neuropsychiatric disorders in the current study

DRD2 iVcol allele frequencies were determined in individuals based on the presence or absence of the neuropsychiatric disorders analyzed in the present study. In individuals with MWA, anxiety disorders and/or major depression, the Al allele frequency is 0.80 and the A2 allele frequency is 0.20. In individuals who have none of these neuropsychiatric disorders, the Al allele frequency is 0.63 and the A2 allele frequency is 0.37. The difference in the DRD2 Ncol Al allele frequencies between these two groups of individuals is highly significant (Chi-square=17.13; p < 0.00002).

Table 11

DRD2 Ncol ALLELE FREQUENCIES IN INDIVIDUALS WITH

OR WITHOUT MIGRAINE WITH AURA, ANXIETY DISORDERS

OR MAJOR DEPRESSION IN THE PRESENT STUDY

ΔJ Δ2 Chi-square BL-valiifi MWA, anxiety and/or depression 0.80 0.20 17.13 0.00002

No MWA, anxiety or depression 0.63 0.37

In conclusion, the present data indicate that MWA, anxiety disorders and major depression are comorbidly associated with allelic variations in the DRD2 gene. As a result, some manifestations of these diseases may constitute a distinct clinical syndrome resulting from a single underlying genetic variation. The clinical recognition that all three disorders are associated with the same genetic variant has significant diagnostic and therapeutic implications.

The foregoing description of the preferred embodiments of the present invention has been presented for purposes of illustration and description. They are not intended to be exhaustive or to limit the invention to the precise form disclosed, and many modifications and variations are possible in light of the above teaching. All publications and patent applications cited herein are incorporated by reference in their entirety to the same extent as if each individual publication or patent application was specifically and individually so denoted. TABLE 1

SPECTRA BIOMEDICAL, INC. DRD2 Development Program

DRUG BRAND INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY

NAME AFFINITY RECEPTORS EFFECTS: CONTACT PERSON J

SED/HYPOTENSION

EPS OTHER

Clinically Effective DRD2 Anti-Migraine Drugs m haloperidol Haldol psychosis 2-20 mg 4 alpha — 14 +/+ McNeil Tourette's ADHD PO IM 5HT2 = 45 + + + +

I σ domperidone Motilium 10-30 mg 6 alpha = 74 Janssen (Europe) 03

CΛ (Europe) PO prochlorperazine Compazine psychosis 10 mg 7 alpha = 200 generic anxiety PO IM (SKB)

33 antiemetic ΓV PR to chlorpromazine Thorazine psychosis 200-800 mg 25 alpha = 4 + + +/+ + + generic anxiety PO IM 5HT2 = 19 + + (SKB) antiemetic IV PR

MDI hiccups flunarizine Sibelium 10-20 mg 110 Janssen (Europe) (Europe) PO

IV metoclopramide Reg Ian GE reflux 10 mg 160 alpha 10,000 generic (Robins) antiemetic PO IM gastric stasis rv

TABLE 1

SPECTRA BIOMEDICAL, INC. DRD2 Development Program

DRUG BRAND INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY

NAME AFFINITY RECEPTORS EFFECTS: CONTACT PERSON

SED/HYPOTENSION

EPS OTHER chlorprothixene Taractin psychosis 50-400 mg 8 + + +/+ + Roche PO IM + + rv thioridazine Mellaril psychosis 150-600 mg 63 alpha = 7 + + + + + + Sandoz anxiety /depression PO 5HT2 = 63 + loxapine Loxitane psychosis 60-100 mg 100 +/+ Lederle PO IM + + rv I

•co molindone Moban psychosis 5-250 mg 150 + + + Gate Pharmaceuticals zzc rπ PO + + m promethazine Phenergan antiemetic 25 mg 240 " + + +/+ + + " generic (Wyeth

3D cr PO IM Ayerst) rv co clozapine Clozaril psychosis 150-450 mg 380 alpha = 20 + + +/+ + + Sandoz PO 5HT2 = 29 0 agranulocytosis seizures trimetho- Tigan antiemetic 200-250 mg 640 generic (SKB) benzamide mesoridazine Serentil psychosis EtOH 75-300 mg + + +/+ + Boehringer Ingelheim abuse PO IM +

"Psychoneurotic IV manifestations"

TABLE 1

SPECTRA BIOMEDICAL, INC. DRD2 Development Program

DRUG BRAND INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY

NAME AFFINITY RECEPTORS EFFECTS: CONTACT PERSON

SED/HYPOTENSION

EPS OTHER ziprasidone Phase ID psychosis 40-120 mg 5-HT2A ant (lOx Pfizer (CP-88059) depression PO D2)

(half-life = 5-HT2C ant 4 hours) 5-HT1D ant 5-HT1A agonist perospirone Phase m psychosis 5-HT2 ant Sumitomo

30 rπ iloperidone Phase IH psychosis 110 alpha =0.4 HMR (HP-873) 5-HT2A=6 I

5-HT2c-=43 U I

5-HT6=31 co 5-HT7=22 re m m setoperone Phase in psychosis 5-HT2 ant RW Johnson

AD-5423 Phase II psychosis 15 5HT2=8 Dainippon mazepertine Phase II psychosis <3 5-HT1A agonist RW Johnson to < 3 alpha 1 ant < 3

D3 ant bro erguride Phase II psychosis 5-HT1A agonist Schering AG Lynn BotheUo

1192U90 Phase π psychosis 5-HT2 ant Glaxo Wellcome 5-HT1A agonist carvotroline Phase 1 psychosis 200 mg 5-HT2 ant Wyeth Ayerst Jim Barrett raciopride preclinical 3 Schering Plough

TABLE 1

SPECTRA BIOMEDICAL, INC. DRD2 Development Program

DRUG BRAND INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY

NAME AFFINITY RECEPTORS EFFECTS: CONTACT PERSON

SED/HYPOTENSION

EPS OTHER zalospirone preclinical American Home Products Jim Barrett

remoxipride preclinical 110 Astra cyclic benzamides preclinical psychosis 5-HT2 ant Glaxo 5-HT1A agonist Wellcome I

P 706-A preclinical psychosis 5-HT2 ant Hoechst A.G. I

C 5 m p-9662 preclinical psychosis 5-HT2 ant Hoechst-Roussell ocaperidone preclinical psychosis antiemetic 1-2 mg/day 5-HT2 ant Janssen

30 zz

LEK-882 preclinical psychosis 5-HT2 ant LEK Pharmaceuticals 5-HT1A ant Dl agonist

EMD-56551 preclinical anxiety 5-HTla agonist Merck KGaA

EMD-67478 preclinical anxiety 5-HTla agonist Merck KGaA

EMD-77697 preclinical psychosis anxiety 5-HTla agonist Merck KGaA

NNC-22-0031 preclinical psychosis 5-HT3 ant Novo Nordisk A S alpha 1 ant

ORG-10490 preclinical psychosis 5-HT ant Organon

ORG-20223 preclinical psychosis 5-HTla agonist Organon ||

TABLE 1

SPECTRA BIOMEDICAL, INC. DRD2 Development Program

DRUG BRAND INDICATIONS DOSE DRD2 OTHER MaAJOR SIDE COMPANY NAME AFFINITY RECEPTORS EFFECTS: CONTACT PERSON

SED/HYPOTENSION

EPS OTHER

0PC-14597 preclinical Otsuka

S- 16924 preclinical psychosis 5-HTlA ant Servier 5-HT2 ant D4 ant

DU-29894 preclinical psychosis 5-HT1 A agonist Solvay Duphar

30 m umespirone preclinical psychosis 5-HT1A agonist Solvay Duphar

SM- 13496 preclinical psychosis 5-HT2 ant Sumitomo σ 0 co SM-9018 preclinical psychosis Sumitomo ^•«

I

SDZ-MAR-327 preclinical psychosis 5-HT1A agonist Tsububa 5-HT2 ant Dl agonist

ZD-3638 preclinical psychosis 5-HT2 ant Zeneca

<P alentemol ? psychosis 5-HT2 ant Parmacia Upjohn

0RG-5222 suspended psychosis 5-HT ant Organon acetophenazine Tindal 40-120 mg ?

(? not in Us) PO amperoxide inactive psychosis Pharmacia Upjohn/Sandoz

HDC-912 preclinical psychosis Sandoz

Available for licensing

TABLE 1

SPECTRA BIOMEDICAL, INC. DRD2 Development Program

DRUG BRAND INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY

NAME AFFINITY RECEPTORS EFFECTS: CONTACT PERSON

SED/HYPOTENSION

EPS OTHER

ZZX3 czz

CO

Claims

WHAT IS CLAIMED IS:

1. A method of diagnosing a patient for susceptibility to a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety comprising detecting a variant allele of one or more dopaminergic genes in the patient .

2. The method of claim 1, wherein the one or more dopaminergic genes are selected from a group consisting of DRDl, DRD2 , DRD3 and DAT.

3. The method of claim 1, wherein the variant allele is DRD2 Ncol Al , and the presence of homozygous Al alleles indicates increased susceptibility to the syndrome relative to the presence of heterozygous A1/A2 alleles, and the presence of heterozygous A1/A2 alleles indicates increased susceptibility relative to the presence of homozygous A2/A2 alleles.

4. The method of claim 1, wherein the variant allele is DRDl Bl and the presence of homozygous or heterozygous Bl alleles indicates increased susceptibility to the syndrome relative to homozygous B2 alleles.

5. The method of claim 1, wherein the variant allele is DRD3 A2 and the presence of homozygous A2 alleles indicates increased susceptibility to the syndrome relative to homozygous Al alleles.

6. The method of claim 1, wherein the variant allele is DAT 10, and the presence of homozygous D10 alleles indicates increased susceptibility to the syndrome relative to heterozygous D10/D9 alleles.

7. The method of claim 2 , wherein variant alleles are detected in two or more of the DRDl, DRD2, DRD3 and DAT, and risk factors associated with the presence of each variant allele detected are combined to indicate susceptibility to the syndrome.

8. A method of treating a patient suffering from the syndrome of claim 1, comprising administering to the patient a therapeutically effective amount of an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT.

9. The method of claim 8, wherein the agent lacks specific binding to DRD4 and/or DRD5.

10. The method of claim 8, wherein the agent is any one of the agents shown in Table 1.

11. The method of claim 8, wherein the blood- brain barrier of the patient is impermeable to the agent.

12. The method of claim 8, wherein the agent is administered intravenously, orally or intramuscularly.

13. The method of claim 8, wherein the agent is administered prophylactically.

14. A method of treating a patient suffering from migraine with aura and having homozygous DRD2 Ncol Al alleles comprising administering to the patient a therapeutically effective amount of an agent that antagonizes binding of dopamine to DRD2.

15. The method of claim 14, further comprising determining that the patient has homozygous Ncol Al alleles.

16. A method of screening for a drug effective to treat the syndrome of claim 1, comprising determining the capacity of the drug to antagonize binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT.

17. The method of claim 16, wherein the drug lacks specific binding to DRD4 and/DRD5.

18. Use of an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT for the manufacture of a medicament for use in the treatment of a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety in patients having a variant allele of one or more dopaminergic genes.

19. The use according to claim 18, wherein the one or more dopaminergic genes are selected from DRDl, DRD2, DRD3 and DAT.

20. The use according to claim 18 or claim 19, wherein the variant allele is DRD2 Ncol Al and the presence of homozygous Al alleles indicates increased susceptibility to the syndrome relative to the presence of heterozygous A1/A2 alleles, and the presence of heterozygous A1/A2 alleles indicates increased susceptibility relative to the presence of homozygous A2/A2 alleles.

21. The use according to any of claims 18 to 20, wherein the syndrome is characterized by symptoms of migraine with aura.

22. The use according to any of claims 18-21, wherein the agent is any one of the agents shown in Table 1.

23. A method for determining the suitability of a patient suffering from a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety for treatment with an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT comprising the steps of detecting a variant allele of one or more dopaminergic genes in the patient.

24. The method according to claim 23, wherein the one or more dopaminergic genes are selected from DRDl, DRD2, DRD3 and DAT.

25. The method according to claim 23 or claim 24 , wherein the variant allele is DRD2 Ncol Al and the presence of homozygous Al alleles indicates increased suitability relative to the presence of heterozygous A1/A2 alleles, and the presence of heterozygous A1/A2 alleles indicates increased susceptibility relative to the presence of homozygous A1/A2 alleles.

26. The method according to any of claims 23 to 25, wherein the syndrome is migraine with aura.

27. The method according to any of claims 23 to 26, wherein the agent is any one of the agents shown in Table 1.

28. Use of an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT for the manufacture of a medicament for use in therapy, the therapy comprising the step of: a) diagnosing a patient for susceptibility to a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety by a method comprising the step of detecting a variant allele of one or more dopaminergic genes in the patient; optionally further comprising the step of b) administering to the patient a therapeutically effective amount of an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT.

29. The use according to claim 28, wherein the one or more dopaminergic genes are selected from DRDl, DRD2, DRD3 and/or DAT.

30. The use according to claim 28 or 29, wherein the variant allele is DRD2 Ncol Al and the presence of homozygous Al alleles indicates increased susceptibility to the syndrome relative to the presence of heterozygous A1/A2 alleles and the presence of heterozygous A1/A2 alleles indicates increased susceptibility relative to the presence of homozygous A2/A2 alleles.

31. The use according to any of claims 28 to 30, wherein the syndrome is migraine with aura.

32. The use according to any of claims 28 to 31, wherein the agent is any one of the agents shown in Table 1.

33. A diagnostic agent for detecting a variant allele of one or more dopaminergic genes for use in therapy, prophylaxis or diagnosis.

34. An agent according to claim 33, wherein the dopaminergic genes are selected from DRDl, DRD2, DRD3 and DAT.

35. An agent according to claim 33 or 34, wherein the variant allele is DRD2 Ncol Al .

36. An agent according to any of claims 33 to 35 for use in therapy, prophylaxis or diagnosis of a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety.

37. An agent according to any of claims 33 to 35 for use in therapy, prophylaxis or diagnosis of migraine with aura.

38. Use of an agent for detecting a variant allele of one or more dopaminergic genes for the manufacture of a diagnostic for use in therapy, prophylaxis or diagnosis .

39. Use according to claim 38, wherein the dopaminergic genes are selected from DRDl, DRD2 , DRD3 and DAT.

40. Use according to claim 38 or claim 39, wherein the variant allele is DRD2 Ncol Al .

41. Use according to any of claims 38 to 40 for therapy, prophylaxis or diagnosis of a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety.

42. Use according to any of claims 38 to 41, wherein the syndrome is characterized by symptoms of migraine with aura .

43. Use of an agent that antagonizes binding of dopamine to DRDl, DRD2 , DRD3 and/or DAT for the manufacture of a medicament for use in the treatment of a syndrome characterized by symptoms of migraine with aura, depression and/or anxiety associated with the presence of a variant allele of one or more dopaminergic genes .

44. The use according to claim 43, wherein the one or more dopaminergic genes are selected from DRDl, DRD2, DRD3 and DAT.

45. The use according to claim 43 or 44, wherein the variant allele is DRD2 Ncol Al and the presence of homozygous Al alleles indicates increased susceptibility to the syndrome relative to the presence of heterozygous A1/A2 alleles, and the presence of heterozygous Al /A2 alleles indicates increased susceptibility relative to the presence of homozygous A2/A2 alleles.

46. The use according to any of claims 43 to 45, wherein the variant allele is homozygous DRD2 Ncol Al.

47. The use according to any of claims 43 to 46, wherein the syndrome is characterized by symptoms of migraine with aura.

48. The use according to any of claims 43 to 47, wherein the agent is any one of the agents shown in Table 1.

49. The use according to any of claims 43 to 48, wherein the medicament is administered prophylactically.