EP0962528A2 - Nucleic acids encoding acetylcholin-receptor subunits from insects - Google Patents

Nucleic acids encoding acetylcholin-receptor subunits from insects Download PDF

Info

Publication number
EP0962528A2
EP0962528A2 EP99107852A EP99107852A EP0962528A2 EP 0962528 A2 EP0962528 A2 EP 0962528A2 EP 99107852 A EP99107852 A EP 99107852A EP 99107852 A EP99107852 A EP 99107852A EP 0962528 A2 EP0962528 A2 EP 0962528A2
Authority
EP
European Patent Office
Prior art keywords
sequences
nucleic acid
seq
host cell
receptors
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99107852A
Other languages
German (de)
French (fr)
Other versions
EP0962528A3 (en
Inventor
Martin Dr. Adamczewski
Nadja Dr. Oellers
Thomas Dr. Schulte
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer CropScience AG
Original Assignee
Bayer AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer AG filed Critical Bayer AG
Publication of EP0962528A2 publication Critical patent/EP0962528A2/en
Publication of EP0962528A3 publication Critical patent/EP0962528A3/en
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571—Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)

Definitions

  • the invention particularly relates to nucleic acids for acetylcholine receptor subunits code from insects.
  • Nicotinic acetylcholine receptors are ligand-gated ion channels, one Play a role in neurotransmission in the animal kingdom.
  • the binding of acetylcholine or other agonists to the receptor causes a temporary opening of the channel and allows the flow of cations.
  • a receptor consists of five subunits grouped around a pore. Any of these Subunit is a protein that consists of an extracellular N-terminal part, followed by three transmembrane regions, an intracellular part, as well a fourth transmembrane region and a short extracellular C-terminal Part (Changeux et al. 1992).
  • Acetylcholine receptors have been well studied, especially in vertebrates. Based on their anatomical location and their functional properties (conduction properties of the channel, desensitization, sensitivity to agonists and antagonists, as well as to toxins such as ⁇ -bungarotoxin), three groups can be distinguished. The classification correlates with the molecular composition of the receptors. There are heterooligomeric receptors with the subunit composition ⁇ 2 ⁇ that occur in muscle (Noda et al. 1982, Claudio et al. 1983, Devillers-Thiery et al. 1983, Noda et al.
  • heterooligomeric receptors the subunits from the group ⁇ 2 - ⁇ 6 and ⁇ 2 - ⁇ 4, and which occur in the nervous system (Wada et al. 1988, Schoepfer et al. 1990, Cockcroft et al. 1991, Heinemann et al. 1997), as well as homooligomeric receptors that subunits of the group ⁇ 7 - ⁇ 9, and which also occur in the nervous system (Lindstrom et al. 1997, Elgoyhen et al. 1997). This division is also supported by considering the relationship of the gene sequences of the various subunits.
  • the sequences of functionally homologous subunits from different species are more similar than sequences from subunits from different groups but of the same species.
  • the muscular ⁇ subunit of the rat has 78% identical and 84% similar amino acids to that of the electrical skate Torpedo californica, but only 48% identity and 59% similarity to the ⁇ 2 subunit (heterooligomeric, neuronal) of the rat, and 36% identity and 45% similarity to the ⁇ 7 subunit (homooligomeric, neuronal) of the rat.
  • the gene sequences of all known acetylcholine receptor subunits are not only somewhat similar to one another, but also to those of some other ligand-controlled ion channels (e.g.
  • acetylcholine is the main excitatory neurotransmitter of the central one Nervous system. Accordingly, acetylcholine receptors can be prepared Detect central ganglia from insects electrophysiologically. Of the Detection succeeds at both post- and presynaptic nerve endings, as well as on the cell bodies of interneurons, motor neurons and modulatory Neurons (Breer et al. 1987, Buckingham et al. 1997). There are among the receptors those that are inhibited by a-bungarotoxin and those that are insensitive (Schleton et al. 1988). The acetylcholine receptors are also the molecular target important natural (e.g. nicotine) and synthetic insecticides (e.g. Chloronicotinyls).
  • tobacco e.g. nicotine
  • synthetic insecticides e.g. Chloronicotinyls
  • the present invention is therefore based in particular on the object
  • the new acetylcholine receptor subunits code from insects.
  • the degree of identity of the nucleic acid sequences is preferably determined using Help of the program GAP from the program package GCG, version 9.1 under standard settings (Devereux et al. 1984).
  • the present invention is based on the surprising finding that Insects have genes that are responsible for subunits, especially homooligomers Encode acetylcholine receptors.
  • the invention further relates to vectors which are at least one of the invention Contain nucleic acids.
  • the vectors can all be used in molecular biological Laboratories used plasmids, phasmids, cosmids, YACs or artificial chromosomes be used.
  • plasmids phasmids, cosmids, YACs or artificial chromosomes be used.
  • phasmids plasmids
  • cosmids chromosomes
  • nucleic acids can be expressed in suitable form Host cells are introduced.
  • prokaryotic are suitable as host cells Cells, preferably E. coli, as well as eukaryotic cells, preferably mammalian or Insect cells, further examples of suitable unicellular host cells are: Pseudomonas, Bacillus, Streptomyces, yeast, HEK-293, Schneider S2, CHO-, COS1-, COS7, cells, plant cells in cell culture and amphibian cells, in particular Oocytes.
  • the present invention also relates to the polypeptides derived from those of the invention Nucleic acids are encoded, as well as the acetylcholine receptors built from them, preferably homooligomeric acetylcholine receptors.
  • polypeptides derived from the nucleic acids according to the invention can be encoded, host cells that have at least one of the invention Contain nucleic acids, can be cultivated under suitable conditions. The desired polypeptides can then be removed from the cells or the Culture medium can be isolated.
  • the invention furthermore relates to antibodies which are specific to the above bind mentioned polypeptides or receptors.
  • Such antibodies are produced in the usual way.
  • such antibodies can be produced by injecting a substantially immune competent host with one for the Antibody production effective amount of an acetylcholine receptor polypeptide according to the invention or a fragment thereof and by subsequent extraction of this antibody.
  • an immortalized one can be used in a manner known per se Obtain cell line that produces monoclonal antibodies.
  • the antibodies can optionally labeled with a detection reagent, preferred examples for such a detection reagent are enzymes, radioactively labeled elements, fluorescent chemicals or biotin. Instead of the full antibody fragments can also be used which have the desired specific binding properties have.
  • the nucleic acids according to the invention can be used in particular for production transgenic invertebrates can be used. These can be used in test systems are based on a wild type expression of the invention Receptors or variants thereof based. Furthermore, all fall under this transgenic invertebrates, in which the modification of other genes or Gene control sequences (promoters) a change in the expression of receptors according to the invention or their variants occurs.
  • transgenic invertebrates in which the modification of other genes or Gene control sequences (promoters) a change in the expression of receptors according to the invention or their variants occurs.
  • the transgenic invertebrates are produced, for example, in Drosophila melanogaster gene transfer mediated by P element (Hay et al., 1997) or in Caenorhabditis elegans by transposon mediated gene transfer (e.g. by Tc1, Plasterk, 1996).
  • the invention thus also relates to transgenic invertebrates which have at least one of the nucleic acids according to the invention preferably contain transgenic invertebrates of the species Drosophila melanogaster or Caenorhabditis elegans, as well as their transgenic Progeny.
  • the transgenic invertebrates preferably contain those according to the invention Receptors in a form that differs from the wild type.
  • the nucleic acids according to the invention can be produced in the usual way become.
  • the nucleic acid molecules can be completely chemical be synthesized. You can also only use short pieces of the sequences according to the invention chemically synthesize and such oligonucleotides radioactive or with a Mark the fluorescent dye.
  • the labeled oligonucleotides can be used to cDNA libraries made from insect mRNA search. Clones to which the labeled oligonucleotides hybridize ("positive Clones ”) are selected to isolate the DNA in question. After the The characterization of the isolated DNA can be obtained in a simple manner nucleic acids according to the invention.
  • nucleic acids according to the invention can also be carried out by means of PCR methods Using chemically synthesized oligonucleotides.
  • nucleic acids according to the invention can be used for isolation and characterization of the regulatory regions that are naturally adjacent to the coding Region. Such regulatory regions are thus also subject of the present invention.
  • new active ingredients for the Crop protection e.g. Connections that act as modulators, especially as agonists or antagonists, the conduction properties of the Change acetylcholine receptors according to the invention.
  • This will be a recombinant DNA molecule comprising at least one nucleic acid molecule according to the invention in a suitable host cell is introduced.
  • the host cell is in the presence of a Compound or a sample comprising a plurality of compounds under Cultivated conditions that the expression of the receptors according to the invention allow.
  • a change in the receptor properties can - as in below Example 2 described - to be detected. This way it is possible to be insecticidal Find substances.
  • nucleic acids according to the invention also make it possible to find compounds that bind to the receptors of the invention. These can also be used as Insecticides can be applied to plants.
  • host cells that are the contain nucleic acids according to the invention and the corresponding receptors or Express polypeptides or the gene products themselves with a compound or a Mixture of compounds contacted under conditions that affect the interaction at least one connection with the host cells, the receptors or the allow individual polypeptides.
  • Regions can also be used to find genes which code for polypeptides which are involved in the construction of functionally similar acetylcholine receptors are involved in insects.
  • receptors are understood to be polypeptides which, in terms of amino acid sequence, differ from those described herein Polypeptides differ but have essentially the same functions to have.
  • Figure 1 shows the increase in intracellular calcium in genetically modified Cells according to Example 2 after administration of nicotine.
  • Cells were made with fura-2-acetoxymethyl ester (5 - 10 ⁇ M in serum-free minimal essential medium with 1 % Bovine serum albumin and 5 mM calcium chloride) loaded with N- (2-hydroxyethyl) piperazine-N '- (2-ethanesulfonic acid) (5 mM HEPES) buffered Tyrode solution washed and under a fluorescence microscope (Nikon Diaphot) alternately irradiated with light of the wavelength 340 nm and 380 nm.
  • a measuring point corresponds to a pair of video images at both wavelengths (exposure time 100 ms per image).
  • the time interval between two measuring points is 3 s.
  • Nicotine was taken from 8 images (measuring point 4.0) to a final concentration of 500 ⁇ M added and the series of measurements continued.
  • the fluorescence intensity of the Cells when irradiated with light of wavelength 380 nm were identified by the appropriate Intensity divided at 340 nm and thus the ratio ("ratio") formed.
  • the PCR parameters were as follows: Hva7-1 and Hva-7-2: 94 ° C, 2 mm; 35 times (94 ° C, 45 s; 50 ° C, 30 s; 72 ° C, 60 s) and Da7: 96 ° C, 2 min; 35 times (96 ° C, 45 s; 50 ° C, 30 s; 72 ° C, 60 s). This resulted in one in each agarose gel (1%) recognizable band of approx. 0.2 kb both with Drosophila cDNA and with Heliothis cDNA.
  • RNA for cDNA library I was from entire Heliothis virescens embryos (shortly before hatching) using a trizole reagent (Gibco BRL, according to information of the manufacturer) isolated.
  • the RNA for cDNA library II was extracted from entire Head ganglia from 500 Heliothis virescens larvae (stages 4-5) using Trizol reagent (Gibco BRL, according to the manufacturer) isolated. From these RNAs were now the poly A containing RNAs by purification using Dyna Beads 280 (Dynal) isolated.
  • RNAs containing poly A 5 ⁇ g were then used in the construction of the cDNA libraries I and II used with the ⁇ -ZAPExpress vector (cDNA Synthesis Kit, ZAP-cDNA Synthesis Kit and ZAP-cDNA Gigapack III Gold Cloning Kit, all Stratagene).
  • reverse transcriptase superscript (Gibco BRL) was used for cDNA synthesis a synthesis temperature of 45 ° C used. It was also on the aggregate radioactively labeled deoxynucleoside triphosphates are dispensed with.
  • the cDNAs not synthesized via the gel filtration medium contained in the kit, but fractionated over Size Sep 400 Spun Columns (Pharmacia).
  • the gene bank plasmids isolated Sequenced for identification using T3 and T7 primers (ABI Prism Dye Terminator Cycle Sequencing Kit, ABI, with ABI Prism 310 Genetic Analyzer). The Determination of the complete polynucleotide sequences in Hva7-1, Hva7-2 and Da7 was done by primer walking using cycle sequencing as order sequencing at the company Qiagen, Hilden.
  • the screening involved 10 6 phages from the Heliothis virescens embryo cDNA library (Library I). The first of three rounds of screening was done using ⁇ - 32 P labeled 228-11 DNA as a probe. The probe was hybridized to the filter in Quickhyb (Stratagene) at 68 ° C for one hour. The filters were then run twice in each case for 15 min at room temperature in 2 x SSC; 0.1% SDS and 2 times 30 min at 42 ° C in 0.1xSSC; Washed 0.1% SDS. Hybridized probes were detected by autoradiography with XR X-ray films (Kodak) using amplifying films (Amersham) at -80 ° C. overnight. The two further screening rounds were carried out using the DIG system (Boehringer Mannheim).
  • Clone 241-5 isolated in this screen contained an insert of 3630 bp.
  • This Insert (Hva7-1, SEQ ID NO: 3) has a longest open reading frame, which at Position 335 of the nucleic acid sequence shown begins and at position 1821 ends.
  • the polypeptide derived therefrom comprises 496 amino acids (SEQ ID NO: 4) and has a calculated molecular weight of 56.36 kD.
  • the screening involved 10 6 phages from the Heliothis virescens ganglia cDNA library (Library II). Dig labeled 228-8 DNA was used as the probe. The maximum stringency when washing the filters was: 0.1 x SSC; 0.1% SDS; 42 ° C; 2 x 15 min.
  • Clone 241-5 isolated in this screen contained an insert of 3630 bp.
  • This Insert (Hva7-2, SEQ ID NO: 5) has a longest open reading frame, which at Position 95 of the nucleic acid sequence shown begins and at position 1598 ends.
  • the polypeptide derived therefrom comprises 501 amino acids (SEQ ID NO: 6) and has a calculated molecular weight of 56.71 kD.
  • the sequence region from position 372 to position 2681 from SEQ ID NO: 1 was amplified by means of polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • deoxyoligonucleotides with the sequences GCGAATTCACCACCATGAAAAATGCACAACTG and CGAGACAATAATATGTGGTGCCTCGAG are used.
  • the Pfu polymerase from Stratagene was used as DNA polymerase according to the manufacturer's instructions.
  • the generated piece was digested with the restriction endonucleases Eco RI and Xho I and cloned into a vector PCDNA3.1 / Zeo (Invitrogen) which was also digested with Eco RI and XhoI.
  • the sequence region from position 335 to position 1822 from SEQ ID NO: 3 was amplified by means of polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • deoxyoligonucleotides with the sequences GCAAGCTTACCACCATGGGAGGTAGAGCTAGACGCTCGCAC and GCCTCGAGCGACACCATGATGTGTGGCGC are used.
  • the Pfu polymerase from Stratagene was used as DNA polymerase according to the manufacturer's instructions. After the amplification had taken place, the generated piece was digested with the restriction endonucleases HindIII and Xho I and cloned into a vector pcDNA3.1 / Zeo (Invitrogen), also digested with HindIII and XhoI.
  • the sequence region from position 95 to position 1597 from SEQ ID NO: 5 was amplified by means of polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • deoxyoligonucleotides with the sequences GCAAGCGCCGCTATGGCCCCTATGTTG and TTGCACGATGATATGCGGTGCCTCGAGCG are used.
  • the Pfu polymerase from Stratagene was used as DNA polymerase according to the manufacturer's instructions. After the amplification had taken place, the generated piece was digested with the restriction endonucleases HindIII and Xho I and cloned into a vector pcDNA3.1 / Zeo (Invitrogen), also digested with HindIII and XhoI.
  • the range from position 335 to position 1036 from SEQ ID NO: 3 (Hva7-1 / 5HT 3 chimera) and the range from position 95 to position 763 from SEQ ID NO: 5 (Hva7-2 / 5HT 3 chimera) fused with the region from position 778 to position 1521 from the mus muscle 5-HT 3 receptor cDNA (sequence in EMBL database: M774425).
  • the two fragments were then cloned into the pcDNA3.1 / Zeo vector using TA cloning (Invitrogen, according to the manufacturer). Constructs with the correct orientation of the two fragments in the vector were identified by sequencing with the T7 primer (Invitrogen).
  • HEK293 cells expressing the ⁇ subunit of an L-type Ca channel were in Dulbecco's Modified Eagles Medium and 10% fetal calf serum at 5% CO 2 and 20 ° C grown to 37 ° C. FuGENE 6 (Boehringer Mannheim GmbH, Mannheim, Germany) was used for the gene transfer according to the manufacturer's instructions. 24 h to 48 h after the gene transfer, the cells were sown in different densities in microtiter plates.
  • the changes in the intracellular calcium concentration were determined with Fura-2 measured.
  • a stock solution with 2 mM fura-2-acetoxymethyl ester (Sigma) in Dimethyl sulfoxide (DMSO) was concentrated to a final concentration of 5 - 10 ⁇ M serum-free minimal essential medium (MEM, Gibco) with 1% bovine serum albumin and diluted 5 mM calcium chloride.
  • the cells were in a microtiter sheet incubated in this solution for 45 to 60 min.
  • a series of video images (exposure time per image 100 ms) was paused by 3 seconds recorded and as digitized images in an image analysis computer saved (Leica, Quantimet 570). After taking 8 pictures (measuring point 4.0 in Fig. 1) nicotine was added to a final concentration of 500 uM, and the Series of measurements continued.
  • the fluorescence intensity of the cells when irradiated with light the wavelength of 380 nm was divided by the corresponding intensity at 340 nm and so a ratio is formed that shows the relative increase in calcium concentration represents (Grynkiewicz et al. 1985).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Neurology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Die Erfindung betrifft Nukleinsäuren, die für Acetylcholinrezeptor-Untereinheiten von Insekten kodieren, die entsprechenden Polypeptide, sowie Verfahren zum Auffinden neuer Wirkstoffe für den Pflanzenschutz.The invention relates to nucleic acids that code for acetylcholine receptor subunits of insects, the corresponding polypeptides, and methods for finding new active substances for crop protection.

Description

Die Erfindung betrifft insbesondere Nukleinsäuren, die für Acetylcholinrezeptor-Untereinheiten von Insekten kodieren.The invention particularly relates to nucleic acids for acetylcholine receptor subunits code from insects.

Nikotinische Acetylcholinrezeptoren sind ligandengesteuerte Ionenkanäle, die eine Rolle bei der Neurotransmission im Tierreich spielen. Die Bindung von Acetylcholin oder anderen Agonisten an den Rezeptor verursacht eine vorübergehende Öffnung des Kanals und gestattet den Durchstrom von Kationen. Man nimmt an, daß ein Rezeptor aus fünf Untereinheiten besteht, die sich um eine Pore gruppieren. Jede dieser Untereinheiten ist ein Protein, das aus einem extrazellulären N-terminalen Teil besteht, gefolgt von drei Transmembranregionen, einem intrazellulären Teil, sowie einer vierten Transmembranregion und einem kurzen extrazellulären C-terminalen Teil (Changeux et al. 1992).Nicotinic acetylcholine receptors are ligand-gated ion channels, one Play a role in neurotransmission in the animal kingdom. The binding of acetylcholine or other agonists to the receptor causes a temporary opening of the channel and allows the flow of cations. It is believed that a receptor consists of five subunits grouped around a pore. Any of these Subunit is a protein that consists of an extracellular N-terminal part, followed by three transmembrane regions, an intracellular part, as well a fourth transmembrane region and a short extracellular C-terminal Part (Changeux et al. 1992).

Acetylcholinrezeptoren sind vor allem in Wirbeltieren gut untersucht. Anhand ihrer anatomischen Lokalisierung und ihrer funktionellen Eigenschaften (Leitungseigenschaften des Kanals, Desensibilisierung, Sensitivität gegenüber Agonisten und Antagonisten, sowie gegenüber Toxinen wie z.B. α-Bungarotoxin) lassen sich hier drei Gruppen unterscheiden. Die Einteilung korreliert mit der molekularen Zusammensetzung der Rezeptoren. Es gibt heterooligomere Rezeptoren mit der Untereinheitenzusammensetzung α2βγδ, die im Muskel vorkommen (Noda et al. 1982, Claudio et al. 1983, Devillers-Thiery et al. 1983, Noda et al. 1983a, b), heterooligomere Rezeptoren, die Untereinheiten aus der Gruppe α2 - α6 und β2 - β4 enthalten, und die im Nervensystem vorkommen (Wada et al. 1988, Schoepfer et al. 1990, Cockcroft et al. 1991, Heinemann et al. 1997), sowie homooligomere Rezeptoren, die Untereinheiten aus der Gruppe α7 - α9 enthalten, und die ebenfalls im Nervensystem vorkommen (Lindstrom et al. 1997, Elgoyhen et al. 1997). Diese Einteilung wird auch durch eine Betrachtung der Verwandschaft der Gensequenzen der verschiedenen Untereinheiten gestützt. Typischerweise sind die Sequenzen funktionell homologer Untereinheiten verschiedener Spezies ähnlicher als Sequenzen von Untereinheiten aus verschiedenen Gruppen, aber der gleichen Spezies. So weist z.B. die muskuläre α-Untereinheit der Ratte 78 % identische und 84 % ähnliche Aminosäuren auf mit der des elektrischen Rochens Torpedo californica, aber nur 48 % Identität und 59 % Ahnlichkeit mit der α2-Untereinheit (heterooligomer, neuronal) der Ratte, und 36 % Identität und 45 % Ähnlichkeit mit der α7-Untereinheit (homooligomer, neuronal) der Ratte. Weiterhin sind die Gensequenzen aller bekannten Acetylcholinrezeptor-Untereinheitenen nicht nur untereinander in gewissem Maße ähnlich, sondern auch mit denen einiger anderer ligandengesteuerter lonenkanäle (z.B. den Serotoninrezeptoren vom Typ 5HT3, den GABA-gesteuerten Chloridkanälen, den Glycin-gesteuerten Chloridkanälen). Man geht daher davon aus, daß alle diese Rezeptoren von einem gemeinsamen Vorläufer abstammen und ordnet sie in eine Supergenfamilie ein (Ortells et al. 1995).Acetylcholine receptors have been well studied, especially in vertebrates. Based on their anatomical location and their functional properties (conduction properties of the channel, desensitization, sensitivity to agonists and antagonists, as well as to toxins such as α-bungarotoxin), three groups can be distinguished. The classification correlates with the molecular composition of the receptors. There are heterooligomeric receptors with the subunit composition α 2 βγδ that occur in muscle (Noda et al. 1982, Claudio et al. 1983, Devillers-Thiery et al. 1983, Noda et al. 1983a, b), heterooligomeric receptors, the subunits from the group α2 - α6 and β2 - β4, and which occur in the nervous system (Wada et al. 1988, Schoepfer et al. 1990, Cockcroft et al. 1991, Heinemann et al. 1997), as well as homooligomeric receptors that subunits of the group α7 - α9, and which also occur in the nervous system (Lindstrom et al. 1997, Elgoyhen et al. 1997). This division is also supported by considering the relationship of the gene sequences of the various subunits. Typically, the sequences of functionally homologous subunits from different species are more similar than sequences from subunits from different groups but of the same species. For example, the muscular α subunit of the rat has 78% identical and 84% similar amino acids to that of the electrical skate Torpedo californica, but only 48% identity and 59% similarity to the α2 subunit (heterooligomeric, neuronal) of the rat, and 36% identity and 45% similarity to the α7 subunit (homooligomeric, neuronal) of the rat. Furthermore, the gene sequences of all known acetylcholine receptor subunits are not only somewhat similar to one another, but also to those of some other ligand-controlled ion channels (e.g. the 5HT 3 serotonin receptors, the GABA-controlled chloride channels, the glycine-controlled chloride channels). It is therefore assumed that all of these receptors are derived from a common precursor and are classified in a supergene family (Ortells et al. 1995).

In Insekten ist Acetylcholin der wichtigste exzitatorische Neurotransmitter des zentralen Nervensystems. Dementsprechend lassen sich Acetylcholinrezeptoren an Präparaten zentraler Ganglien aus Insekten elektrophysiologisch nachweisen. Der Nachweis gelingt sowohl an post- als auch an präsynaptischen Nervenendigungen, sowie an den Zellkörpern von Interneuronen, Motorneuronen und modulatorischen Neuronen (Breer et al. 1987, Buckingham et al. 1997). Unter den Rezeptoren gibt es solche, die durch a-Bungarotoxin inhibiert werden, und solche, die insensitiv sind (Schloß et al. 1988). Die Acetylcholinrezeptoren sind außerdem der molekulare Angriffspunkt wichtiger natürlicher (z.B. Nikotin) und synthetischer Insektizide (z.B. Chloronikotinyle).In insects, acetylcholine is the main excitatory neurotransmitter of the central one Nervous system. Accordingly, acetylcholine receptors can be prepared Detect central ganglia from insects electrophysiologically. Of the Detection succeeds at both post- and presynaptic nerve endings, as well as on the cell bodies of interneurons, motor neurons and modulatory Neurons (Breer et al. 1987, Buckingham et al. 1997). There are among the receptors those that are inhibited by a-bungarotoxin and those that are insensitive (Schloß et al. 1988). The acetylcholine receptors are also the molecular target important natural (e.g. nicotine) and synthetic insecticides (e.g. Chloronicotinyls).

Die Gensequenz einer Anzahl von nikotinischen Acetylcholinrezeptoren der Insekten ist bereits bekannt. So sind in Drosophila melanogaster die Sequenzen fünf verschiedener Untereinheiten beschrieben (Bossy et al. 1988, Hermanns-Borgmeyer et al. 1986, Sawruk et al. 1990a, 1990b, Schulz et al. unveröffentlicht, EMBL accession number Y15593), in Locusta migratoria ebenfalls fünf (Stetzer et al. unveröffentlicht, EMBL accession numbers AJ000390 - AJ000393), in Schistocerca gregaria eine (Marshall et al. 1990), in Myzus persicae zwei (Sgard et al. unveröffentlicht, EMBL accession number X81887 und X81888), in Manduca sexta eine Sequenz (Eastham et al. 1997). Zudem ist eine Reihe von partiellen Gensequenzen aus Drosophila melanogaster als sog. expressed sequence tags charakterisiert worden (Genbank accession numbers AA540687, AA698155, AA697710, AA697326). Die hohe Ähnlichkeit einzelner Sequenzen mit solchen aus anderen Insekten legt nahe, daß es sich bei diesen Untereinheiten um fünktionelle Homologe handelt.The gene sequence of a number of insect nicotinic acetylcholine receptors is already known. The sequences in Drosophila melanogaster are five different Subunits are described (Bossy et al. 1988, Hermanns-Borgmeyer et al. 1986, Sawruk et al. 1990a, 1990b, Schulz et al. unpublished, EMBL accession number Y15593), also five in Locusta migratoria (unpublished by Stetzer et al., EMBL accession numbers AJ000390 - AJ000393), in Schistocerca gregaria a (Marshall et al. 1990), in Myzus persicae two (Sgard et al. Unpublished, EMBL accession number X81887 and X81888), a sequence in Manduca sexta (Eastham et al. 1997). In addition, a number of partial gene sequences are from Drosophila melanogaster have been characterized as so-called expressed sequence tags (Genbank accession numbers AA540687, AA698155, AA697710, AA697326). The high resemblance individual sequences with those from other insects suggests that it is these subunits are functional homologues.

Es ist von großer praktischer Bedeutung, beispielsweise für die Suche nach neuen Insektiziden, neue Untereinheiten von Acetylcholinrezeptoren aus Insekten bereitzustellen, wobei besonders solche von Interesse sind, die sich von den bekannten stärker unterscheiden, als dies zwischen funktionellen Homologen der Fall ist.It is of great practical importance, for example when looking for new ones Insecticides to provide new subunits of insect acetylcholine receptors, of particular interest are those that differ more strongly from the known ones differentiate than is the case between functional homologues.

Der vorliegenden Erfindung liegt somit insbesondere die Aufgabe zugrunde, Nukleinsäuren zur Verfügung zu stellen, die neue Acetylcholinrezeptor-Untereinheiten von Insekten kodieren.The present invention is therefore based in particular on the object To provide nucleic acids, the new acetylcholine receptor subunits code from insects.

Die Aufgabe wird gelöst durch die Bereitstellung von Nuldeinsäuren umfassend eine Sequenz ausgewählt aus

  • (a) den Sequenzen gemäß SEQ ID NO: 1, SEQ ID NO: 3 oder SEQ ID NO: 5,
  • (b) zumindest 14 Basenpaare langen Teilsequenzen der unter (a) definierten Sequenzen,
  • (c) Sequenzen, welche an die unter (a) definierten Sequenzen hybridisieren in 2 x SSC bei 60°C, bevorzugt in 0,5 x SSC bei 60°C, besonders bevorzugt in 0,2 x SSC bei 60°C (Sambrook et al. 1989),
  • (d) Sequenzen, welche eine zumindest 70 %ige Identität zu den unter (a) definierten Sequenzen zwischen Position 1295 und Position 2195 aus SEQ ID NO: 1 oder zwischen Position 432 und Position 1318 aus SEQ ID NO: 3 oder zwischen Position 154 und Position 1123 aus SEQ ID NO: 5 aufweisen,
  • (e) Sequenzen, welche zu den unter (a) definierten Sequenzen komplementär sind und
  • (f) Sequenzen, welche aufgrund der Degeneration des genetischen Codes für dieselbe Aminosäuresequenz kodieren wie die unter (a) bis (d) definierten Sequenzen.
    • The object is achieved by providing nucleic acids comprising a sequence selected from
  • (a) the sequences according to SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5,
  • (b) at least 14 base pairs long partial sequences of the sequences defined under (a),
  • (c) Sequences which hybridize to the sequences defined under (a) in 2 x SSC at 60 ° C, preferably in 0.5 x SSC at 60 ° C, particularly preferably in 0.2 x SSC at 60 ° C (Sambrook et al. 1989),
  • (d) Sequences which have at least 70% identity to the sequences defined under (a) between position 1295 and position 2195 from SEQ ID NO: 1 or between position 432 and position 1318 from SEQ ID NO: 3 or between position 154 and Have position 1123 from SEQ ID NO: 5,
  • (e) sequences which are complementary to the sequences defined under (a) and
  • (f) Sequences which code for the same amino acid sequence as the sequences defined under (a) to (d) due to the degeneration of the genetic code.

    • Der Grad der Identität der Nukleinsäuresequenzen wird vorzugsweise bestimmt mit Hilfe des Programms GAP aus dem Programmpaket GCG, Version 9.1 unter Standardeinstellungen (Devereux et al. 1984).The degree of identity of the nucleic acid sequences is preferably determined using Help of the program GAP from the program package GCG, version 9.1 under standard settings (Devereux et al. 1984).

    Die vorliegende Erfindung begründet sich auf den überraschenden Befund, daß Insekten Gene besitzen, die für Untereinheiten von insbesondere homooligomeren Acetylcholinrezeptoren kodieren.The present invention is based on the surprising finding that Insects have genes that are responsible for subunits, especially homooligomers Encode acetylcholine receptors.

    Gegenstand der Erfindung sind weiterhin Vektoren, die zumindest eine der erfindungsgemäßen Nukleinsäuren enthalten. Als Vektoren können alle in molekularbiologischen Laboratorien verwendete Plasmide, Phasmide, Cosmide, YACs oder künstliche Chromosomen verwendet werden. Für die Expression der erfindungsgemäßen Nukleinsäuren können diese mit üblichen regulatorischen Sequenzen verknüpft werden. Die Auswahl solcher regulatorischen Sequenzen ist davon abhängig, ob zur Expression pro- oder eukaryotische Zellen bzw. Zellfreie Systeme verwendet werden. Besonders bevorzugt als Expressionskontrollsequenz sind z.B. der frühe oder späte Promotor des SV40 oder des Adenovirus, des Cytomegalovirus, das lac-System, das trp-System, die Haupt-Operator- und Promotorregionen des Phagen lambda, die Kontrollregionen des fd-Hüllproteins, der Promotor der 3-Phosphoglyceratkinase, der Promotor der Sauren Phosphatase und der Promotor des α-Mating-Faktors der Hefe.The invention further relates to vectors which are at least one of the invention Contain nucleic acids. The vectors can all be used in molecular biological Laboratories used plasmids, phasmids, cosmids, YACs or artificial chromosomes be used. For the expression of the nucleic acids according to the invention these can be linked to common regulatory sequences. The selection of such regulatory sequences depends on whether for or expression eukaryotic cells or cell-free systems can be used. Particularly preferred as an expression control sequence are e.g. the early or late promoter of the SV40 or adenovirus, cytomegalovirus, the lac system, the trp system, the main operator and promoter regions of the phage lambda, the control regions of the fd coat protein, the promoter of 3-phosphoglycerate kinase, the promoter the acid phosphatase and the promoter of the yeast α-mating factor.

    Zur Expression der erfindungsgemäßen Nukleinsäuren können diese in geeignete Wirtszellen eingebracht werden. Als Wirtszellen eignen sich sowohl prokaryotische Zellen, vorzugsweise E.coli, als auch eukaryotische Zellen, vorzugsweise Säuger- oder Insektenzellen, Weitere Beispiele für geeignete einzellige Wirtzellen sind: Pseudomonas, Bacillus, Streptomyces, Hefen, HEK-293, Schneider S2, CHO-, COS1-, COS7-, Zellen, Pflanzenzellen in Zellkultur sowie Amphibienzellen, insbesondere Oocyten.To express the nucleic acids according to the invention, they can be expressed in suitable form Host cells are introduced. Both prokaryotic are suitable as host cells Cells, preferably E. coli, as well as eukaryotic cells, preferably mammalian or Insect cells, further examples of suitable unicellular host cells are: Pseudomonas, Bacillus, Streptomyces, yeast, HEK-293, Schneider S2, CHO-, COS1-, COS7, cells, plant cells in cell culture and amphibian cells, in particular Oocytes.

    Gegenstand der vorliegenden Erfindung sind auch die Polypeptide, die von den erfindungsgemäßen Nukleinsäuren kodiert werden, sowie die daraus aufgebauten Acetylcholinrezeptoren, bevorzugt homooligomere Acetylcholinrezeptoren.The present invention also relates to the polypeptides derived from those of the invention Nucleic acids are encoded, as well as the acetylcholine receptors built from them, preferably homooligomeric acetylcholine receptors.

    Zur Herstellung der Polypeptide, die von den erfindungsgemäßen Nukleinsäuren kodiert werden, können Wirtszellen, die zumindest eine der erfindungsgemäßen Nukleinsäuren enthalten, unter geeigneten Bedingungen kultiviert werden. Die gewünschten Polypeptide können danach auf übliche Weise aus den Zellen oder dem Kulturmedium isoliert werden.For the production of the polypeptides derived from the nucleic acids according to the invention can be encoded, host cells that have at least one of the invention Contain nucleic acids, can be cultivated under suitable conditions. The desired polypeptides can then be removed from the cells or the Culture medium can be isolated.

    Weiterhin sind Antikörper Gegenstand der Erfindung, die spezifisch an die vorstehend genannten Polypeptide bzw. Rezeptoren binden. Die Herstellung solcher Antikörper erfolgt auf die übliche Weise. Beispielsweise können solche Antikörper produziert werden durch die Injektion eines substantiell immunkompetenten Wirts mit einer für die Antikörperproduktion effektiven Menge eines erfindungsgemäßen Acetylcholinrezeptor-Polypeptids oder eines Fragments davon und durch nachfolgende Gewinnung dieses Antikörpers. Weiterhin läßt sich in an sich bekannter Weise eine immortalisierte Zellinie erhalten, die monoklonale Antikörper produziert. Die Antikörper können gegebenenfalls mit einem Nachweisreagenz markiert sein, Bevorzugte Beispiele für ein solches Nachweis-Reagenz sind Enzyme, radioaktiv markierte Elemente, fluoreszierende Chemikalien oder Biotin. Anstelle des vollständigen Antikörpers können auch Fragmente eingesetzt werden, die die gewünschten spezifischen Bindungseigenschaften besitzen.The invention furthermore relates to antibodies which are specific to the above bind mentioned polypeptides or receptors. Such antibodies are produced in the usual way. For example, such antibodies can be produced by injecting a substantially immune competent host with one for the Antibody production effective amount of an acetylcholine receptor polypeptide according to the invention or a fragment thereof and by subsequent extraction of this antibody. Furthermore, an immortalized one can be used in a manner known per se Obtain cell line that produces monoclonal antibodies. The antibodies can optionally labeled with a detection reagent, preferred examples for such a detection reagent are enzymes, radioactively labeled elements, fluorescent chemicals or biotin. Instead of the full antibody fragments can also be used which have the desired specific binding properties have.

    Die erfindungsgemäßen Nukleinsäuren können insbesondere zur Herstellung transgener Invertebraten verwendet werden. Diese können in Testsysteme eingesetzt werden, die auf einer vom Wildtyp abweichenden Expression der erfindungsgemäßen Rezeptoren oder Varianten hiervon basieren. Ferner fallen hierunter sämtliche transgenen Invertebraten, bei denen durch die Modifikation anderer Gene oder Genkontrollsequenzen (Promotoren) eine Veränderung der Expression der erfindungsgemäßen Rezeptoren oder deren Varianten eintritt.The nucleic acids according to the invention can be used in particular for production transgenic invertebrates can be used. These can be used in test systems are based on a wild type expression of the invention Receptors or variants thereof based. Furthermore, all fall under this transgenic invertebrates, in which the modification of other genes or Gene control sequences (promoters) a change in the expression of receptors according to the invention or their variants occurs.

    Die Herstellung der transgenen Invertebraten erfolgt beispielsweise in Drosophila melanogaster durch P-Element vermittelten Gentransfer (Hay et al., 1997) oder in Caenorhabditis elegans durch Transposon vermittelten Gentransfer (z.B. durch Tc1, Plasterk, 1996).The transgenic invertebrates are produced, for example, in Drosophila melanogaster gene transfer mediated by P element (Hay et al., 1997) or in Caenorhabditis elegans by transposon mediated gene transfer (e.g. by Tc1, Plasterk, 1996).

    Gegenstand der Erfindung sind somit auch transgene Invertebraten, die zumindest eine der erfindungsgemäßen Nukleinsäuren enthalten, vorzugsweise transgene Invertebraten der Arten Drosophila melanogaster oder Caenorhabditis elegans, sowie deren transgene Nachkommen. Vorzugsweise enthalten die transgenen Invertebraten die erfindungsgemäßen Rezeptoren in einer vom Wildtyp abweichenden Form.The invention thus also relates to transgenic invertebrates which have at least one of the nucleic acids according to the invention preferably contain transgenic invertebrates of the species Drosophila melanogaster or Caenorhabditis elegans, as well as their transgenic Progeny. The transgenic invertebrates preferably contain those according to the invention Receptors in a form that differs from the wild type.

    Die erfindungsgemäßen Nukleinsäuren können auf die übliche Weise hergestellt werden. Beispielsweise können die Nukleinsäuremoleküle vollständig chemisch synthetisiert werden. Man kann auch nur kurze Stücke der erfindungsgemäßen Sequenzen chemisch synthetisieren und solche Oligonukleotide radioaktiv oder mit einem Fluoreszenzfarbstoff markieren. Die markierten Oligonukleotide können verwendet werden, um ausgehend von Insekten-mRNA hergestellte cDNA-Banken zu durchsuchen. Klone, an die die markierten Oligonukleotide hybridisieren ("positive Klone"), werden zur Isolierung der betreffenden DNA ausgewählt. Nach der Charakterisierung der isolierten DNA erhält man auf einfache Weise die erfindungsgemäßen Nukleinsäuren.The nucleic acids according to the invention can be produced in the usual way become. For example, the nucleic acid molecules can be completely chemical be synthesized. You can also only use short pieces of the sequences according to the invention chemically synthesize and such oligonucleotides radioactive or with a Mark the fluorescent dye. The labeled oligonucleotides can be used to cDNA libraries made from insect mRNA search. Clones to which the labeled oligonucleotides hybridize ("positive Clones ") are selected to isolate the DNA in question. After the The characterization of the isolated DNA can be obtained in a simple manner nucleic acids according to the invention.

    Die erfindungsgemäßen Nukleinsäuren können auch mittels PCR-Verfahren unter Verwendung chemisch synthetisierter Oligonukleotide hergestellt werden.The nucleic acids according to the invention can also be carried out by means of PCR methods Using chemically synthesized oligonucleotides.

    Die erfindungsgemäßen Nukleinsäuren können zur Isolierung und Charakterisierung der regulatorischen Regionen, die natürlicherweise benachbart zu der kodierenden Region vorkommen, verwendet werden. Solche regulatorischen Regionen sind somit ebenfalls Gegenstand der vorliegenden Erfindung.The nucleic acids according to the invention can be used for isolation and characterization of the regulatory regions that are naturally adjacent to the coding Region. Such regulatory regions are thus also subject of the present invention.

    Mit Hilfe der erfindungsgemäßen Nukleinsäuren können neue Wirkstoffe für den Pflanzenschutz identifiziert werden, z.B. Verbindungen, welche als Modulatoren, insbesondere als Agonisten oder Antagonisten, die Leitungseigenschaften der erfindungsgemäßen Acetylcholinrezeptoren verändern. Dazu wird ein rekombinantes DNA-Molekül, das zumindest ein erfindungsgemäßes Nukleinsäuremolekül umfaßt, in eine geeignete Wirtszelle eingebracht. Die Wirtzelle wird in Gegenwart einer Verbindung oder einer Probe, welche eine Vielzahl von Verbindungen umfaßt, unter Bedingungen kultiviert, die die Expression der erfindungsgemäßen Rezeptoren erlauben. Eine Veränderung der Rezeptoreigenschaften kann - wie nachstehend in Beispiel 2 beschrieben - detektiert werden. Auf diese Weise ist es möglich, insektizide Substanzen aufzufinden.With the help of the nucleic acids according to the invention, new active ingredients for the Crop protection, e.g. Connections that act as modulators, especially as agonists or antagonists, the conduction properties of the Change acetylcholine receptors according to the invention. This will be a recombinant DNA molecule comprising at least one nucleic acid molecule according to the invention in a suitable host cell is introduced. The host cell is in the presence of a Compound or a sample comprising a plurality of compounds under Cultivated conditions that the expression of the receptors according to the invention allow. A change in the receptor properties can - as in below Example 2 described - to be detected. This way it is possible to be insecticidal Find substances.

    Die erfindungsgemäßen Nukleinsäuren ermöglichen auch das Auffinden von Verbindungen, die an die erfindungsgemäßen Rezeptoren binden. Diese können ebenfalls als Insektizide auf Pflanzen angewandt werden. Beispielsweise werden Wirtszellen, die die erfindungsgemäßen Nukleinsäuren enthalten und die entsprechenden Rezeptoren bzw. Polypeptide exprimieren oder die Genprodukte selbst mit einer Verbindung oder einem Gemisch von Verbindungen unter Bedingungen in Kontakt gebracht, die die Wechselwirkung zumindest einer Verbindung mit den Wirtszellen, den Rezeptoren oder den einzelnen Polypeptiden erlauben. The nucleic acids according to the invention also make it possible to find compounds that bind to the receptors of the invention. These can also be used as Insecticides can be applied to plants. For example, host cells that are the contain nucleic acids according to the invention and the corresponding receptors or Express polypeptides or the gene products themselves with a compound or a Mixture of compounds contacted under conditions that affect the interaction at least one connection with the host cells, the receptors or the allow individual polypeptides.

    Unter Verwendung von Wirtszellen oder transgenen Invertebraten, die die erfindungsgemäßen Nukleinsäuren enthalten, ist es auch möglich, Substanzen aufzufinden, welche die Expression der Rezeptoren verändern.Using host cells or transgenic invertebrates that the invention Contain nucleic acids, it is also possible to find substances which change the expression of the receptors.

    Die vorstehend beschriebenen erfindungsgemäßen Nukleinsäuren, Vektoren und regulatorischen Regionen können außerdem zum Auffinden von Genen verwendet werden, die für Polypeptide kodieren, welche am Aufbau von funktionell ähnlichen Acetylcholinrezeptoren in Insekten beteiligt sind. Unter funktionell ähnlichen Rezeptoren werden gemäß der vorliegenden Erfindung Rezeptoren verstanden, die Polypeptide umfassen, welche sich zwar hinsichtlich der Aminosäuresequenz von den hierin beschriebenen Polypeptiden unterscheiden, aber im wesentlichen dieselben Funktionen haben.The nucleic acids, vectors and regulatory according to the invention described above Regions can also be used to find genes which code for polypeptides which are involved in the construction of functionally similar acetylcholine receptors are involved in insects. Under functionally similar receptors According to the present invention, receptors are understood to be polypeptides which, in terms of amino acid sequence, differ from those described herein Polypeptides differ but have essentially the same functions to have.

    Erläuterungen zum Sequenzprotokoll und zu den Figuren:Explanations of the sequence listing and the figures:

  • SEQ ID NO: 1 zeigt die Nukleotidsequenz der isolierten Da7 cDNA, beginnend mit Position 1 und endend mit Position 2886. SEQ ID NO: 1 und SEQ ID NO: 2 zeigen ferner die Aminosäuresequenzen des von der Da7 cDNA Sequenz abgeleiteten Proteins.SEQ ID NO: 1 shows the nucleotide sequence of the isolated Da7 cDNA starting with Position 1 and ending with position 2886. Show SEQ ID NO: 1 and SEQ ID NO: 2 furthermore the amino acid sequences of the protein derived from the Da7 cDNA sequence.
  • SEQ ID NO: 3 zeigt die Nukleotidsequenz der isolierten Hva7-1 cDNA, beginnend mit Position 1 und endend mit Position 3700. SEQ ID NO: 3 und SEQ ID NO: 4 zeigen ferner die Aminosäuresequenzen des von der Hva7-1 cDNA Sequenz abgeleiteten Proteins.SEQ ID NO: 3 shows the nucleotide sequence of the isolated Hva7-1 cDNA starting with position 1 and ending with position 3700. Show SEQ ID NO: 3 and SEQ ID NO: 4 also the amino acid sequences derived from the Hva7-1 cDNA sequence Protein.
  • SEQ ID NO: 5 zeigt die Nukleotidsequenz der isolierten Hva7-2 cDNA, beginnend mit Position 1 und endend mit Position 3109. SEQ ID NO: 5 und SEQ ID NO: 6 zeigen ferner die Aminosäuresequenzen des von der Hva7-2 cDNA Sequenz abgeleiteten Proteins.SEQ ID NO: 5 shows the nucleotide sequence of the isolated Hva7-2 cDNA starting with position 1 and ending with position 3109. Show SEQ ID NO: 5 and SEQ ID NO: 6 also the amino acid sequences derived from the Hva7-2 cDNA sequence Protein.

    • Figur 1 zeigt den Anstieg des intrazellulären Calciums in gentechnisch veränderten Zellen gemäß Beispiel 2 nach Gabe von Nikotin. Zellen wurden mit Fura-2-acetoxymethylester (5 - 10 µM in serumfreiem Minimal Essentiellem Medium mit 1 % Rinderserumalbumin and 5 mM Calciumchlorid) beladen, mit N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (5 mM HEPES) gepufferter Tyrode-Lösung gewaschen und unter einem Fluoreszenzmikroskop (Nikon Diaphot) abwechselnd mit Licht der Wellenlänge 340 nm und 380 nm bestrahlt. Ein Meßpunkt entspricht einem Paar von Videobildern bei beiden Wellenlängen (Belichtungszeit pro Bild 100 ms). Der Zeitabstand von zwei Meßpunkten beträgt 3 s. Nach Aufnahme von 8 Bildern (Meßpunkt 4.0) wurde Nikotin auf eine Endkonzentration von 500 µM zugegeben, und die Meßreihe fortgesetzt. Die Fluoreszenzintensität der Zellen bei Bestrahlung mit Licht der Wellenlänge 380 nm wurde durch die entsprechende Intensität bei 340 nm geteilt und so das Verhältnis ("Ratio") gebildet. Figure 1 shows the increase in intracellular calcium in genetically modified Cells according to Example 2 after administration of nicotine. Cells were made with fura-2-acetoxymethyl ester (5 - 10 µM in serum-free minimal essential medium with 1 % Bovine serum albumin and 5 mM calcium chloride) loaded with N- (2-hydroxyethyl) piperazine-N '- (2-ethanesulfonic acid) (5 mM HEPES) buffered Tyrode solution washed and under a fluorescence microscope (Nikon Diaphot) alternately irradiated with light of the wavelength 340 nm and 380 nm. A measuring point corresponds to a pair of video images at both wavelengths (exposure time 100 ms per image). The time interval between two measuring points is 3 s. After admission Nicotine was taken from 8 images (measuring point 4.0) to a final concentration of 500 µM added and the series of measurements continued. The fluorescence intensity of the Cells when irradiated with light of wavelength 380 nm were identified by the appropriate Intensity divided at 340 nm and thus the ratio ("ratio") formed.

    Beispiele:Examples: Beispiel 1example 1 Isolierung der beschriebenen PolynukleotidsequenzenIsolation of the polynucleotide sequences described

    Die Manipulation von Polynukleotiden erfolgte nach Standardmethoden der rekombinanten DNA Technologie (Sambrook, et al., 1989). Die bioinformatische Bearbeitung von Nukleotid- und Proteinsequenzen erfolgten mit dem Programmpaket GCG Version 9.1 (GCG Genetics Computer Group, Inc., Madison Wisconsin, USA).Polynucleotides were manipulated using standard recombinant methods DNA technology (Sambrook, et al., 1989). Bioinformatics processing nucleotide and protein sequences were carried out with the GCG program package Version 9.1 (GCG Genetics Computer Group, Inc., Madison Wisconsin, USA).

    Partielle PolynukleotidsequenzenPartial polynucleotide sequences

    Aus Proteinsequenzen von Genen, bei denen ihre Fähigkeit homooligomere Acetylcholinrezeptoren auszubilden bekannt war, wurden durch Sequenzvergleiche ("Clustalw") Bereiche identifiziert, aus denen durch Rücktranslation der Codons degenerierte Oligonukleotide abgeleitet wurden. Insgesamt wurden 5 solcher Oligonukleotidpaare für die Polymerasekettenreaktion (PCR) ausgewählt. Nur eine Kombination (vide infra) ergab ein Produkt sowohl aus Heliothis-cDNA als auch aus Drosophila-cDNA.From protein sequences of genes in which their ability is homooligomeric acetylcholine receptors was known, were by sequence comparisons ("Clustalw") identified areas from which the codons degenerated by back-translation Oligonucleotides were derived. A total of 5 such oligonucleotide pairs selected for the polymerase chain reaction (PCR). Just a combination (vide infra) resulted in a product from both Heliothis cDNA and Drosophila cDNA.

    RNA wurde aus gesamten Heliothis virescens-Embryonen (kurz vor Schlupf) mittels Trizol-Reagenz (Gibco BRL, nach Angaben des Herstellers) isoliert. In gleicher Weise wurde mit Drosophila-Embryonen (24 h bei 25°C) verfahren. 10 µg dieser RNAs wurden in eine cDNA-Erststrangsynthese (Superscript Präamplifizierungssystem für die cDNA-Erststrangsynthese, Gibco BRL, nach Angaben des Herstellers, 45°C Reaktionstemperatur) eingesetzt.RNA was extracted from entire Heliothis virescens embryos (shortly before hatching) Trizol reagent (Gibco BRL, according to the manufacturer) isolated. In the same The procedure was carried out using Drosophila embryos (24 h at 25 ° C). 10 µg of this RNAs were used in a first strand cDNA synthesis (Superscript pre-amplification system for cDNA first strand synthesis, Gibco BRL, according to the manufacturer, 45 ° C reaction temperature) used.

    Anschließend wurden jeweils 1/100 der o.g. Erststrang-cDNA in eine Polymerasekettenreaktion (PCR) mit den Oligonukleotiden alpha7-1s: (5'-GAYGTIGAYGARAARAAYCA-3') und alpha7-2a: (5'-CYYTCRTCIGCRCTRTTRTA-3') eingesetzt (Taq DNA Polymerase, rekombinant, Gibco BRL). Die PCR-Parameter waren wie folgt: Hva7-1 und Hva-7-2: 94°C, 2 mm; 35 mal (94°C, 45 s; 50°C, 30 s; 72°C, 60 s) sowie Da7: 96°C, 2 min; 35 mal (96°C, 45 s; 50°C, 30 s; 72°C, 60 s). Hieraus ergab sich jeweils eine im Agarosegel (1 %) erkennbare Bande von ca. 0,2 kb sowohl bei Drosophila-cDNA als auch bei Heliothis-cDNA. Nach Subkionierung der DNA-Fragmente mittels SrfScript (Stratagene) und Bestimmung der DNA-Sequenz, zeigte sich, daß aus Heliothis-cDNA zwei verschiedene DNA-Fragmente amplifiziert worden waren; diese waren 228-11 = Hva7-1(partiell, mit 165 bp) und 228-8 = Hva7-2 (partiell, mit 171 bp). Aus Drosophila-cDNA wurde nur ein DNA-Fragment isoliert; dieses war 248-5 = Da7(partiell, mit 150 bp).Subsequently, 1/100 of the above First strand cDNA in a polymerase chain reaction (PCR) with the oligonucleotides alpha7-1s: (5'-GAYGTIGAYGARAARAAYCA-3 ') and alpha7-2a: (5'-CYYTCRTCIGCRCTRTTRTA-3 ') used (Taq DNA polymerase, recombinant, Gibco BRL). The PCR parameters were as follows: Hva7-1 and Hva-7-2: 94 ° C, 2 mm; 35 times (94 ° C, 45 s; 50 ° C, 30 s; 72 ° C, 60 s) and Da7: 96 ° C, 2 min; 35 times (96 ° C, 45 s; 50 ° C, 30 s; 72 ° C, 60 s). This resulted in one in each agarose gel (1%) recognizable band of approx. 0.2 kb both with Drosophila cDNA and with Heliothis cDNA. After sub-cloning the DNA fragments using SrfScript (Stratagene) and determination of the DNA sequence, it was found that Heliothis cDNA two different DNA fragments had been amplified; these goods 228-11 = Hva7-1 (partial, with 165 bp) and 228-8 = Hva7-2 (partial, with 171 bp). Only one DNA fragment was isolated from Drosophila cDNA; this was 248-5 = Da7 (partial, at 150 bp).

    Isolierung von poly A enthaltender RNA aus Heliothis virescens-Gewebe und Konstruktion der cDNA-BibliothekenIsolation of poly A containing RNA from Heliothis virescens tissue and construction of the cDNA libraries

    Die RNA für die cDNA-Bibliothek I wurde aus gesamten Heliothis virescens-Embryonen (kurz vor Schlupf) mittels Trizol-Reagenz (Gibco BRL, nach Angaben des Herstellers) isoliert. Die RNA für die cDNA-Bibliothek II wurde aus gesamten Kopfganglien von 500 Heliothis virescens-Larven (Stadien 4-5) mittels Trizol-Reagenz (Gibco BRL, nach Angaben des Herstellers) isoliert. Aus diesen RNAs wurden nun die poly A enthaltenden RNAs durch Reinigung über Dyna Beads 280 (Dynal) isoliert. 5 µg dieser poly A enthaltenden RNAs wurden anschließend in die Konstruktion der cDNA-Bibliotheken I und II mit dem λ-ZAPExpress Vektor eingesetzt (cDNA Synthesis Kit, ZAP-cDNA Synthesis Kit und ZAP-cDNA Gigapack III Gold Cloning Kit, alle Stratagene). In Abweichung von den Angaben des Herstellers wurde zur cDNA-Synthese die Reverse Transkriptase Superscript (Gibco BRL) bei einer Synthesetemperatur von 45°C verwendet. Außerdem wurde auf die Zugabe radioaktiv markierter Desoxynukleosidtriphosphate verzichtet. Desweiteren wurden die synthetisierten cDNAs nicht über das im Kit enthaltene Gelfiltrationsmedium, sondern über Size Sep 400 Spun Columns (Pharmacia) fraktioniert. The RNA for cDNA library I was from entire Heliothis virescens embryos (shortly before hatching) using a trizole reagent (Gibco BRL, according to information of the manufacturer) isolated. The RNA for cDNA library II was extracted from entire Head ganglia from 500 Heliothis virescens larvae (stages 4-5) using Trizol reagent (Gibco BRL, according to the manufacturer) isolated. From these RNAs were now the poly A containing RNAs by purification using Dyna Beads 280 (Dynal) isolated. 5 µg of these RNAs containing poly A were then used in the construction of the cDNA libraries I and II used with the λ-ZAPExpress vector (cDNA Synthesis Kit, ZAP-cDNA Synthesis Kit and ZAP-cDNA Gigapack III Gold Cloning Kit, all Stratagene). In deviation from the manufacturer's information reverse transcriptase superscript (Gibco BRL) was used for cDNA synthesis a synthesis temperature of 45 ° C used. It was also on the encore radioactively labeled deoxynucleoside triphosphates are dispensed with. Furthermore, were the cDNAs not synthesized via the gel filtration medium contained in the kit, but fractionated over Size Sep 400 Spun Columns (Pharmacia).

    Vollständige PolynukleotidsequenzenComplete polynucleotide sequences

    Mit Ausnahme der ersten Screening Runde bei der Isolierung des Hva7-1 Klons, erfolgten alle Screens mit Hilfe des DIG Systems (alle Reagenzien und Verbrauchsmaterialien Boehringer Mannheim, nach Angaben im "The DIG System User's Guide for Filter Hybridization", Boehringer Mannheim). Die eingesetzten DNA-Sonden wurden durch PCR mittels Digoxygenin markiertem dUTP präpariert, Die Hybridisierungen erfolgten in DIG Easy Hyb (Boehringer Mannheim) bei 42°C über Nacht. Der Nachweis markierter DNA auf Nylonmembranen geschah durch Chemolumineszenz (CDP-Star, Boehringer Mannheim) unter Verwendung von Röntgenfilmen (Hyperflim MP, Amersham). Die isolierten Genbankplasmide wurden zur Identifikation mittels T3 und T7 Primer ansequenziert (ABI Prism Dye Terminator Cycle Sequencing Kit, ABI, mit ABI Prism 310 Genetic Analyzer). Die Bestimmung der vollständigen Polynukleotidsequenzen in Hva7-1, Hva7-2 und Da7 erfolgte durch Primer Walking mittels Cycle Sequencing als Auftragssequenzierung bei der Firma Qiagen, Hilden.Except for the first round of screening in isolating the Hva7-1 clone, all screens were made using the DIG system (all reagents and consumables Boehringer Mannheim, according to information in "The DIG System User's Guide for Filter Hybridization ", Boehringer Mannheim). The DNA probes used were prepared by PCR using digoxygenin-labeled dUTP Hybridizations were carried out in DIG Easy Hyb (Boehringer Mannheim) at 42 ° C Night. Labeled DNA was detected on nylon membranes by Chemiluminescence (CDP-Star, Boehringer Mannheim) using X-ray films (Hyperflim MP, Amersham). The gene bank plasmids isolated Sequenced for identification using T3 and T7 primers (ABI Prism Dye Terminator Cycle Sequencing Kit, ABI, with ABI Prism 310 Genetic Analyzer). The Determination of the complete polynucleotide sequences in Hva7-1, Hva7-2 and Da7 was done by primer walking using cycle sequencing as order sequencing at the company Qiagen, Hilden.

    a. Isolierung des Da7 Klonsa. Isolation of the Da7 clone

    106 Phagen einer Drosophila melanogaster-cDNA-Bibliothek in λ Phagen (Canton-S embryo, 2-14 Stunden, in Uni-ZAP XR Vektor, Stratagene) wurden einem Screening mit DIG markiertem 248-5 als Sonde unterzogen (nach Angaben des Herstellers Stratagene). Die maximale Stringenz beim Waschen der Filter betrug: 0,2 x SSC; 0,1 % SDS; 42°C; 2 x 15 min. Es konnte ein Klon isoliert werden(Klon 432-1), dessen Insert eine Größe von 2940 bp aufwies (Da7, SEQ ID NO: 1). Der größte offene Leserahmen dieser Sequenz beginnt bei der Position 372 der dargestellten Sequenz und endet bei Position 1822. Das hieraus abgeleitete Polypeptid umfaßt 770 Aminosäuren (SEQ ID NO: 2) und besitzt ein errechnetes Molekulargewicht von 87,01 kD. 10 6 phages from a Drosophila melanogaster cDNA library in λ phages (Canton embryo, 2-14 hours, in Uni-ZAP XR vector, Stratagene) were screened with DIG-labeled 248-5 as probe (according to the manufacturer Stratagene). The maximum stringency when washing the filters was: 0.2 x SSC; 0.1% SDS; 42 ° C; 2 x 15 min. A clone could be isolated (clone 432-1), the insert of which had a size of 2940 bp (Da7, SEQ ID NO: 1). The largest open reading frame of this sequence begins at position 372 of the sequence shown and ends at position 1822. The polypeptide derived therefrom comprises 770 amino acids (SEQ ID NO: 2) and has a calculated molecular weight of 87.01 kD.

    b. Isolierung des Hva7-1 Klonsb. Isolation of the Hva7-1 clone

    In das Screening gingen 106 Phagen der Heliothis virescens-Embryo-cDNA-Bibliothek (Bibliothek I) ein. Die erste von drei Screening Runden fand unter Verwendung α-32P markierter 228-11 DNA als Sonde statt. Die Hybridisierung der Sonde an die Filter erfolgte in Quickhyb (Stratagene) bei 68°C für eine Stunde. Anschließend wurden die Filter zwei mal je 15 min bei Raumtemperatur in 2 x SSC; 0,1 %SDS und 2 mal je 30 min bei 42°C in 0,1xSSC; 0,1 % SDS gewaschen. Die Detektion hybridisierter Sonden erfolgte durch Autoradiographie mit XR Röntgenfilmen (Kodak) unter Verwendung von Verstärkerfolien (Amersham) bei -80°C über Nacht. Die zwei weiteren Screening Runden erfolgten unter Verwendung des DIG Systems (Boehringer Mannheim).The screening involved 10 6 phages from the Heliothis virescens embryo cDNA library (Library I). The first of three rounds of screening was done using α- 32 P labeled 228-11 DNA as a probe. The probe was hybridized to the filter in Quickhyb (Stratagene) at 68 ° C for one hour. The filters were then run twice in each case for 15 min at room temperature in 2 x SSC; 0.1% SDS and 2 times 30 min at 42 ° C in 0.1xSSC; Washed 0.1% SDS. Hybridized probes were detected by autoradiography with XR X-ray films (Kodak) using amplifying films (Amersham) at -80 ° C. overnight. The two further screening rounds were carried out using the DIG system (Boehringer Mannheim).

    Der in diesem Screen isolierte Klon 241-5 enthielt ein Insert von 3630 bp. Dieses Insert (Hva7-1, SEQ ID NO: 3) besitzt einen längsten offenen Leserahmen, der bei Position 335 der dargestellten Nukleinsäuresequenz beginnt und bei Position 1821 endet. Das hieraus abgeleitete Polypeptid umfaßt 496 Aminosäuren (SEQ ID NO: 4) und besitzt ein errechnetes Molekulargewicht von 56,36 kD.Clone 241-5 isolated in this screen contained an insert of 3630 bp. This Insert (Hva7-1, SEQ ID NO: 3) has a longest open reading frame, which at Position 335 of the nucleic acid sequence shown begins and at position 1821 ends. The polypeptide derived therefrom comprises 496 amino acids (SEQ ID NO: 4) and has a calculated molecular weight of 56.36 kD.

    c. Isolierung des Hva7-2 Klonsc. Isolation of the Hva7-2 clone

    In das Screening gingen 106 Phagen der Heliothis virescens-Ganglien-cDNA-Bibliothek (Bibliothek II) ein. Als Sonde wurde Dig markierte 228-8 DNA verwendet. Die maximale Stringenz beim Waschen der Filter betrug: 0,1 x SSC; 0,1% SDS; 42°C; 2 x 15 min.The screening involved 10 6 phages from the Heliothis virescens ganglia cDNA library (Library II). Dig labeled 228-8 DNA was used as the probe. The maximum stringency when washing the filters was: 0.1 x SSC; 0.1% SDS; 42 ° C; 2 x 15 min.

    Der in diesem Screen isolierte Klon 241-5 enthielt ein Insert von 3630 bp. Dieses Insert (Hva7-2, SEQ ID NO: 5) besitzt einen längsten offenen Leserahmen, der bei Position 95 der dargestellten Nukleinsäuresequenz beginnt und bei Position 1598 endet. Das hieraus abgeleitete Polypeptid umfaßt 501 Aminosäuren (SEQ ID NO: 6) und besitzt ein errechnetes Molekulargewicht von 56,71 kD. Clone 241-5 isolated in this screen contained an insert of 3630 bp. This Insert (Hva7-2, SEQ ID NO: 5) has a longest open reading frame, which at Position 95 of the nucleic acid sequence shown begins and at position 1598 ends. The polypeptide derived therefrom comprises 501 amino acids (SEQ ID NO: 6) and has a calculated molecular weight of 56.71 kD.

    Beispiel 2Example 2 Generierung der ExpressionskonstrukteGeneration of expression constructs a. Da7a. Da7

    Mittels Polymerasekettenreaktion (PCR) wurde der Sequenzbereich von Position 372 bis Position 2681 aus SEQ ID NO: 1 amplifiziert. Hierzu wurden Desoxyoligonukleotide mit den Sequenzen
    GCGAATTCACCACCATGAAAAATGCACAACTG sowie CGAGACAATAATATGTGGTGCCTCGAG verwendet. Als DNA-Polymerase wurde die Pfu-Polymerase von Stratagene nach Angaben des Herstellers verwendet. Nach erfolgter Amplifikation wurde das generierte Stück mit den Restriktionsendonukleasen Eco RI und Xho I verdaut und in einen ebenfalls Eco RI und XhoI verdauten Vektor pcDNA3.1/Zeo (Invitrogen) einkloniert.    The sequence region from position 372 to position 2681 from SEQ ID NO: 1 was amplified by means of polymerase chain reaction (PCR). For this purpose, deoxyoligonucleotides with the sequences
    GCGAATTCACCACCATGAAAAATGCACAACTG and CGAGACAATAATATGTGGTGCCTCGAG are used. The Pfu polymerase from Stratagene was used as DNA polymerase according to the manufacturer's instructions. After amplification, the generated piece was digested with the restriction endonucleases Eco RI and Xho I and cloned into a vector PCDNA3.1 / Zeo (Invitrogen) which was also digested with Eco RI and XhoI.

    b. Hva7-1b. Hva7-1

    Mittels Polymerasekettenreaktion (PCR) wurde der Sequenzbereich von Position 335 bis Position 1822 aus SEQ ID NO: 3 amplifiziert. Hierzu wurden Desoxyoligonukleotide mit den Sequenzen
    GCAAGCTTACCACCATGGGAGGTAGAGCTAGACGCTCGCAC sowie GCCTCGAGCGACACCATGATGTGTGGCGC verwendet. Als DNA-Polymerase wurde die Pfu-Polymerase von Stratagene nach Angaben des Herstellers verwendet. Nach erfolgter Amplifikation wurde das generierte Stück mit den Restriktionsendonukleasen HindIII und Xho I verdaut und in einen ebenfalls HindIII und XhoI verdauten Vektor pcDNA3.1/Zeo (Invitrogen) einkloniert.     The sequence region from position 335 to position 1822 from SEQ ID NO: 3 was amplified by means of polymerase chain reaction (PCR). For this purpose, deoxyoligonucleotides with the sequences
    GCAAGCTTACCACCATGGGAGGTAGAGCTAGACGCTCGCAC and GCCTCGAGCGACACCATGATGTGTGGCGC are used. The Pfu polymerase from Stratagene was used as DNA polymerase according to the manufacturer's instructions. After the amplification had taken place, the generated piece was digested with the restriction endonucleases HindIII and Xho I and cloned into a vector pcDNA3.1 / Zeo (Invitrogen), also digested with HindIII and XhoI.

    c. Hva7-2c. Hva7-2

    Mittels Polymerasekettenreaktion (PCR) wurde der Sequenzbereich von Position 95 bis Position 1597 aus SEQ ID NO: 5 amplifiziert. Hierzu wurden Desoxyoligonukleotide mit den Sequenzen
    GCAAGCGCCGCTATGGCCCCTATGTTG sowie TTGCACGATGATATGCGGTGCCTCGAGCG verwendet. Als DNA-Polymerase wurde die Pfu-Polymerase von Stratagene nach Angaben des Herstellers verwendet. Nach erfolgter Amplifikation wurde das generierte Stück mit den Restriktionsendonukleasen HindIII und Xho I verdaut und in einen ebenfalls HindIII und XhoI verdauten Vektor pcDNA3.1/Zeo (Invitrogen) einkloniert.    The sequence region from position 95 to position 1597 from SEQ ID NO: 5 was amplified by means of polymerase chain reaction (PCR). For this purpose, deoxyoligonucleotides with the sequences
    GCAAGCGCCGCTATGGCCCCTATGTTG and TTGCACGATGATATGCGGTGCCTCGAGCG are used. The Pfu polymerase from Stratagene was used as DNA polymerase according to the manufacturer's instructions. After the amplification had taken place, the generated piece was digested with the restriction endonucleases HindIII and Xho I and cloned into a vector pcDNA3.1 / Zeo (Invitrogen), also digested with HindIII and XhoI.

    d.Hva7-1 / 5HT3 sowie Hva7-2 / 5HT3 Chimärend.Hva7-1 / 5HT 3 and Hva7-2 / 5HT 3 chimeras

    Durch die Methode der Overlap Extension (Jespersen et al. 1997) wurde jeweils der Bereich von Position 335 bis Position 1036 aus SEQ ID NO: 3 (Hva7-1/5HT3 Chimäre) sowie der Bereich von Position 95 bis Position 763 aus SEQ ID NO: 5 (Hva7-2/5HT3 Chimäre) mit dem Bereich von Position 778 bis Position 1521 aus der Mus museulus 5-HT3 Rezeptor-cDNA (Sequenz in EMBL Datenbank: M774425) fusioniert. Die beiden Fragmente wurden anschließend mittels TA Cloning (Invitrogen, nach Angaben des Herstellers) in den pcDNA3.1/Zeo Vektor kloniert. Konstrukte mit korrekter Orientierung der beiden Fragmente im Vektor wurden durch Sequenzierung mit dem T7 Primer (Invitrogen) identifiziert.Using the overlap extension method (Jespersen et al. 1997), the range from position 335 to position 1036 from SEQ ID NO: 3 (Hva7-1 / 5HT 3 chimera) and the range from position 95 to position 763 from SEQ ID NO: 5 (Hva7-2 / 5HT 3 chimera) fused with the region from position 778 to position 1521 from the mus muscle 5-HT 3 receptor cDNA (sequence in EMBL database: M774425). The two fragments were then cloned into the pcDNA3.1 / Zeo vector using TA cloning (Invitrogen, according to the manufacturer). Constructs with the correct orientation of the two fragments in the vector were identified by sequencing with the T7 primer (Invitrogen).

    Zellkultur und GentransferCell culture and gene transfer

    HEK293-Zellen, die die α-Untereinheit eines L-Typ Ca-Kanals exprimieren (Zong et al. 1995, Stetzer et al. 1996), wurden in Dulbeccos Modified Eagles Medium und 10 % foetalem Kälberserum bei 5 % CO2 und 20°C bis 37°C kultiviert. Für den Gentransfer wurde FuGENE 6 (Boehringer Mannheim GmbH, Mannheim, Deutschland) nach Angaben des Herstellers verwendet. 24 h bis 48 h nach dem Gentransfer wurden die Zellen in verschiedenen Dichten in Mikrotiterplatten ausgesät. Gentechnisch veränderte Zellen wurden durch Wachstum in Dulbeccos Modified Eagles Medium und 10 % foetalem Kälberserum und 150 - 500 ug/ml Zeocin während 3 bis 4 Wochen selektioniert Resistente Einzelkione wurden wie unten beschrieben analysiert.HEK293 cells expressing the α subunit of an L-type Ca channel (Zong et al. 1995, Stetzer et al. 1996) were in Dulbecco's Modified Eagles Medium and 10% fetal calf serum at 5% CO 2 and 20 ° C grown to 37 ° C. FuGENE 6 (Boehringer Mannheim GmbH, Mannheim, Germany) was used for the gene transfer according to the manufacturer's instructions. 24 h to 48 h after the gene transfer, the cells were sown in different densities in microtiter plates. Genetically engineered cells were selected by growth in Dulbecco's Modified Eagles Medium and 10% Fetal Calf Serum and 150-500 µg / ml Zeocin for 3 to 4 weeks. Resistant single clones were analyzed as described below.

    Fura-2-MessungenFura-2 measurements

    Die Veränderungen der intrazellulären Calcium-Konzentration wurden mit Fura-2 gemessen. Eine Stammlösung mit 2 mM Fura-2-acetoxymethylester (Sigma) in Dimethylsulfoxid (DMSO) wurde auf eine Endkonzentration von 5 - 10 µM in serumfreiem Minimal Essentiellem Medium (MEM, Gibco) mit 1% Rinderserumalbumin and 5 mM Calciumchlorid verdünnt. Die Zellen wurden in einer Mikrotiterplane in dieser Lösung 45 bis 60 min lang inkubiert. Anschließend wurden die Zellen zweimal in N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (5 mM HEPES) gepufferter Tyrode-Lösung (HEPES-gepufferte Salzlösung mit 130 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 5 mM NaHCO3, 10 mM Glucose) gewaschen. 100 µl Tyrodepuffer wurde in die Vertiefungen der Mikrotiterplatte gegeben und die Zellen wurden unter einem Fluoreszenzmikroskop (Nikon Diaphot) abwechselnd mit Licht der Wellenlänge 340 nm und 380 nm bestrahlt. Eine Serie von Videobildern (Belichtungszeit pro Bild 100 ms) wurde mit Pausen von 3 Sekunden aufgenommen und als digitalisierte Bilder in einem Bildananlyse-Computer gespeichert (Leica, Quantimet 570). Nach Aufnahme von 8 Bildern (Meßpunkt 4.0 in Fig. 1) wurde Nikotin auf eine Endkonzentration von 500 µM zugegeben, und die Meßreihe fortgesetzt. Die Fluoreszenzintensität der Zellen bei Bestrahlung mit Licht der Wellenlänge 380 nm wurde durch die entsprechende Intensität bei 340 nm geteilt und so ein Verhältnis gebildet, das den relativen Anstieg der Calcium-Konzentration darstellt (Grynkiewicz et al. 1985). The changes in the intracellular calcium concentration were determined with Fura-2 measured. A stock solution with 2 mM fura-2-acetoxymethyl ester (Sigma) in Dimethyl sulfoxide (DMSO) was concentrated to a final concentration of 5 - 10 µM serum-free minimal essential medium (MEM, Gibco) with 1% bovine serum albumin and diluted 5 mM calcium chloride. The cells were in a microtiter sheet incubated in this solution for 45 to 60 min. Then the cells twice in N- (2-hydroxyethyl) piperazine-N '- (2-ethanesulfonic acid) (5 mM HEPES) buffered Tyrode solution (HEPES-buffered saline solution with 130 mM NaCl, 5mM KCl, 2mM CaCl2, 1mM MgCl2, 5mM NaHCO3, 10mM Glucose) washed. 100 µl of tyrode buffer was placed in the wells of the microtiter plate and the cells were examined under a fluorescence microscope (Nikon Diaphot) alternately irradiated with light of the wavelength 340 nm and 380 nm. A series of video images (exposure time per image 100 ms) was paused by 3 seconds recorded and as digitized images in an image analysis computer saved (Leica, Quantimet 570). After taking 8 pictures (measuring point 4.0 in Fig. 1) nicotine was added to a final concentration of 500 uM, and the Series of measurements continued. The fluorescence intensity of the cells when irradiated with light the wavelength of 380 nm was divided by the corresponding intensity at 340 nm and so a ratio is formed that shows the relative increase in calcium concentration represents (Grynkiewicz et al. 1985).

    Literatur:Literature:

  • Bossy et al. (1988) Conservation of neural nicotinic acetylcholine receptors from Drosophila to vertebrate central nervous systems, EMBO J. 7, 611-618
  • Breer et al. (1987) Molecular properties and functions of insect acetylcholine receptors, J. Insect Physiol. 33, 771-790
  • Buckingham et al. (1997) Imidacloprid actions on insect neuronal acetylcholine receptors, J.Exp. Biol. 200, 2685-2692
  • Changeux et al. (1992) The functional architecture of the nicotinic acetylcholine receptor explored by affinity labelling and site-directed mutagenesis, Quarterly Review of Biophysics 25, 395-432
  • Claudio et al. (1983) Nucleotide and deduced amino acid sequences of Torpedo californica acetylcholine receptor g subunit, Proc. Natl. Acad. Sci. USA 80, 1111-1115
  • Devereux et al. (1984), Nucleic Acids Researeh 12, 387
  • Devillers-Thiery et al. (1983) Complete mRNA coding sequence of the acetylcholine binding α-subunit of Torpedo marmorata acetylcholine receptor: a model for the transmembrane organization of the polypeptide chain, Proc. Natl. Acad. Sci. USA 80, 2067-2071
  • Elgoyhen et al. (1997) US Pat. No. 5,683,912
  • Eastham et al. (1998) Characterisation of a nicotinic acetylcholine receptor from the insect Manduca sexta, Eur. J. Neurosci 10, 879-889
  • Grynkiewicz et al. (1985) A new generation of Ca2+ indicators with greatly improved fluorescence properties, J Biol Chem. 260, 3440-3450
  • Hay et al. (1997), P element insertion-dependent gene activation in the Drosophila eye, Proceedings of The National Academy of Sciences of The United States of America 94 (10), 5195-5200
  • Hermans-Borgmeyer et al. (1986) Primary structure of a developmentally regulated nicotinic acetylcholine receptor protein from Drosophila EMBO J. 5, 1503-1508
  • Heinemann et al. (1997) US Pat. No 5,591,590
  • Jespersen et al. (1997) Efficient Non-PCR-Mediated Overlap Extension of PCR Fragments by Exonuclease "End Polishing", Biotechniques, 23, 48-52
  • Lindstrom et al. (1997) US Pat. No. 5,599,709
  • Marshall et al. (1990) Sequence and functional expression of a single a subunit of an insect nicotinic acetylcholine receptor, EMBO J. 9, 4391-4398
  • Noda et al. (1982), Primary structure of α-subunit precursor of Torpedo californica acetylcholine receptor deduced from cDNA sequence, Nature 299, 793-797
  • Noda et al. (1983a), Primary structures of β- and δ-subunit precursor of Torpedo califomica acetylcholine receptor deduced from cDNA sequences, Nature 301, 251-255
  • Noda et al. (1983b), Structural homology of Torpedo californica acetylcholine receptor subunits, Nature 302, 528-532
  • Ortells et al. (1995), Evolutionary history of the ligand-gated ion-channel superfamily of receptors, Trends in Neurosience 18, 121-127
  • Plasterk (1996), The Tc1/mariner transposon family, Transposable Elements/Current Topics in Microbiology and Immunology 204, 125-143
  • Sambrook et al. (1989), Molecular Cloning, A Laboratory Manual, 2nd ed. Cold Spring Harbour Press
  • Sawruk et al. (1990a), EMBO J. 9, 2671-2677 Heterogeneity of Drosophila nicotinic acetylcholine receptors: SAD, a novel developmentally regulated α-subunit
  • Sawruk et al. (1990b), SBD, a novel structural subunit of the Drosophila nicotinic acetylcholine receptor, shares its genomic localization with two a-subunits, FEBS Lett. 273, 177-181
  • Schloß et al. (1988), Neuronal acetylcholine receptors of Drosophila: the ARD protein is a component of a high-affinity α-bungarotoxin binding complex, EMBO J 7, 2889-2984
  • Stetzer et al. (1996) Stable expression in HEK-293 cells of the rat α3/β4 subtype of neuronal nicotinic acetylcholine receptor, FEBS Lett. 397, 39-44
  • Zong et al. (1995) On the regulation of the expressed L-type calcium channel by cAMP-dependent phosphorylation, Pflügers Arch. - Eur. J. Physiol. 430, 340-347.
    • Figure 00200001
    Figure 00210001
    Figure 00220001
    Figure 00230001
    Figure 00240001
    Figure 00250001
    Figure 00260001
    Figure 00270001
    Figure 00280001
    Figure 00290001
    Figure 00300001
    Figure 00310001
    Figure 00320001
    Figure 00330001
    Figure 00340001
    Figure 00350001
    Figure 00360001
    Figure 00370001
    Figure 00380001
    Figure 00390001
    Figure 00400001
  • Bossy et al. (1988) Conservation of neural nicotinic acetylcholine receptors from Drosophila to vertebrate central nervous systems, EMBO J. 7, 611-618
  • Breer et al. (1987) Molecular properties and functions of insect acetylcholine receptors, J. Insect Physiol. 33, 771-790
  • Buckingham et al. (1997) Imidacloprid actions on insect neuronal acetylcholine receptors, J.Exp. Biol. 200, 2685-2692
  • Changeux et al. (1992) The functional architecture of the nicotinic acetylcholine receptor explored by affinity labeling and site-directed mutagenesis, Quarterly Review of Biophysics 25, 395-432
  • Claudio et al. (1983) Nucleotide and deduced amino acid sequences of Torpedo californica acetylcholine receptor g subunit, Proc. Natl. Acad. Sci. USA 80, 1111-1115
  • Devereux et al. (1984), Nucleic Acids Researeh 12, 387
  • Devillers-Thiery et al. (1983) Complete mRNA coding sequence of the acetylcholine binding α-subunit of Torpedo marmorata acetylcholine receptor: a model for the transmembrane organization of the polypeptide chain, Proc. Natl. Acad. Sci. USA 80, 2067-2071
  • Elgoyhen et al. (1997) US Pat. 5,683,912
  • Eastham et al. (1998) Characterization of a nicotinic acetylcholine receptor from the insect Manduca sexta, Eur. J. Neurosci 10, 879-889
  • Grynkiewicz et al. (1985) A new generation of Ca2 + indicators with greatly improved fluorescence properties, J Biol Chem. 260, 3440-3450
  • Hay et al. (1997), P element insertion-dependent gene activation in the Drosophila eye, Proceedings of The National Academy of Sciences of The United States of America 94 (10), 5195-5200
  • Hermans-Borgmeyer et al. (1986) Primary structure of a developmentally regulated nicotinic acetylcholine receptor protein from Drosophila EMBO J. 5, 1503-1508
  • Heinemann et al. (1997) US Pat. No. 5,591,590
  • Jespersen et al. (1997) Efficient Non-PCR-Mediated Overlap Extension of PCR Fragments by Exonuclease "End Polishing", Biotechniques, 23, 48-52
  • Lindstrom et al. (1997) US Pat. 5,599,709
  • Marshall et al. (1990) Sequence and functional expression of a single a subunit of an insect nicotinic acetylcholine receptor, EMBO J. 9, 4391-4398
  • Noda et al. (1982), Primary structure of α-subunit precursor of Torpedo californica acetylcholine receptor deduced from cDNA sequence, Nature 299, 793-797
  • Noda et al. (1983a), Primary structures of β- and δ-subunit precursor of Torpedo califomica acetylcholine receptor deduced from cDNA sequences, Nature 301, 251-255
  • Noda et al. (1983b), Structural homology of Torpedo californica acetylcholine receptor subunits, Nature 302, 528-532
  • Ortells et al. (1995), Evolutionary history of the ligand-gated ion-channel superfamily of receptors, Trends in Neurosience 18, 121-127
  • Plasterk (1996), The Tc1 / mariner transposon family, Transposable Elements / Current Topics in Microbiology and Immunology 204, 125-143
  • Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, 2nd ed. Cold Spring Harbor Press
  • Sawruk et al. (1990a), EMBO J. 9, 2671-2677 Heterogeneity of Drosophila nicotinic acetylcholine receptors: SAD, a novel developmentally regulated α-subunit
  • Sawruk et al. (1990b), SBD, a novel structural subunit of the Drosophila nicotinic acetylcholine receptor, shares its genomic localization with two a-subunits, FEBS Lett. 273, 177-181
  • Schloß et al. (1988), Neuronal acetylcholine receptors of Drosophila: the ARD protein is a component of a high-affinity α-bungarotoxin binding complex, EMBO J 7, 2889-2984
  • Stetzer et al. (1996) Stable expression in HEK-293 cells of the rat α3 / β4 subtype of neuronal nicotinic acetylcholine receptor, FEBS Lett. 397, 39-44
  • Zong et al. (1995) On the regulation of the expressed L-type calcium channel by cAMP-dependent phosphorylation, Pflügers Arch. - Eur. J. Physiol. 430, 340-347.
    • Figure 00200001
    Figure 00210001
    Figure 00220001
    Figure 00230001
    Figure 00240001
    Figure 00250001
    Figure 00260001
    Figure 00270001
    Figure 00280001
    Figure 00290001
    Figure 00300001
    Figure 00310001
    Figure 00320001
    Figure 00330001
    Figure 00340001
    Figure 00350001
    Figure 00360001
    Figure 00370001
    Figure 00380001
    Figure 00390001
    Figure 00400001

    Claims (21)

    Nukleinsäure umfassend eine Sequenz ausgewählt aus (a) den Sequenzen gemäß SEQ ID NO: 1, SEQ ID NO: 3 oder SEQ ID NO: 5, (b) zumindest 14 Basenpaare langen Teilsequenzen der unter (a) definierten Sequenzen, (c) Sequenzen, welche an die unter (a) definierten Sequenzen hybridisieren in 2 x SSC bei 60°C, bevorzugt in 0,5 x SSC bei 60°C, besonders bevorzugt in 0,2 x SSC bei 60°C, (d) Sequenzen, welche eine zumindest 70%ige Identität zu den unter (a) definierten Sequenzen zwischen Position 1295 und Position 2195 aus SEQ ID NO: 1 oder zwischen Position 432 und Position 1318 aus SEQ ID NO: 3 oder zwischen Position 154 und Position 1123 aus SEQ ID NO: 5 aufweisen, (e) Sequenzen, welche zu den unter (a) definierten Sequenzen komplementär sind und (f) Sequenzen, welche aufgrund der Degeneration des genetischen Codes für dieselbe Aminosäuresequenz kodieren wie die unter (a) bis (d) definierten Sequenzen. Nucleic acid comprising a sequence selected from (a) the sequences according to SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, (b) at least 14 base pairs long partial sequences of the sequences defined under (a), (c) sequences which hybridize to the sequences defined under (a) in 2 x SSC at 60 ° C, preferably in 0.5 x SSC at 60 ° C, particularly preferably in 0.2 x SSC at 60 ° C, (d) Sequences which have at least 70% identity to the sequences defined under (a) between position 1295 and position 2195 from SEQ ID NO: 1 or between position 432 and position 1318 from SEQ ID NO: 3 or between position 154 and Have position 1123 from SEQ ID NO: 5, (e) sequences which are complementary to the sequences defined under (a) and (f) Sequences which code for the same amino acid sequence as the sequences defined under (a) to (d) due to the degeneration of the genetic code. Vektor umfassend zumindest eine Nukleinsäure gemäß Anspruch 1. Vector comprising at least one nucleic acid according to claim 1. Vektor nach Anspruch 2, dadurch gekennzeichnet, daß je besagte Nukleinsäure funktionell mit regulatorischen Sequenzen verknüpft ist, die die Expression der Nukleinsäure in pro- oder eukaryotischen Zellen gewährleisten.Vector according to claim 2, characterized in that each said nucleic acid is functionally linked to regulatory sequences that expression ensure nucleic acid in pro- or eukaryotic cells. Wirtszelle enthaltend eine Nukleinsäure gemäß Anspruch 1 oder einen Vektor gemäß Anspruch 2 oder 3.Host cell containing a nucleic acid according to claim 1 or a vector according to claim 2 or 3. Wirtszelle nach Anspruch 4, dadurch gekennzeichnet, daß es sich um eine pro- oder eukaryotische Zelle handelt.Host cell according to claim 4, characterized in that it is a pro- or eukaryotic cell. Wirtszelle nach Anspruch 5, dadurch gekennzeichnet, daß die prokaryotische Zelle E.coli ist.Host cell according to claim 5, characterized in that the prokaryotic E.coli cell. Wirtszelle nach Anspruch 5, dadurch gekennzeichnet, daß die eukaryotische Zelle eine Säuger- oder Insektenzelle ist.Host cell according to claim 5, characterized in that the eukaryotic Cell is a mammalian or insect cell. Polypeptid, welches von einer Nukleinsäure gemäß Anspruch 1 kodiert wird.Polypeptide which is encoded by a nucleic acid according to claim 1. Acetylcholinrezeptor umfassend zumindest ein Polypeptid gemäß Anspruch 8.Acetylcholine receptor comprising at least one polypeptide according to claim 8th. Verfahren zur Herstellung eines Polypeptids gemäß Anspruch 8 umfassend (a) das Kultivieren einer Wirtszelle gemäß einem der Ansprüche 4 bis 7 unter Bedingungen, die die Expression der Nukleinsäure gemäß Anspruch 1 gewährleisten, und (b) die Gewinnung des Polypeptids aus der Zelle oder dem Kulturmedium. A method for producing a polypeptide according to claim 8 comprising (a) culturing a host cell according to one of claims 4 to 7 under conditions which ensure the expression of the nucleic acid according to claim 1, and (b) recovering the polypeptide from the cell or culture medium. Antikörper, welcher spezifisch mit dem Polypeptid gemäß Anspruch 8 oder dem Rezeptor gemäß Anspruch 9 reagiert.Antibody which is specific to the polypeptide according to claim 8 or the receptor according to claim 9 reacts. Transgener Invertebrat enthaltend eine Nukleinsäure gemäß Anspruch 1.Transgenic invertebrate containing a nucleic acid according to claim 1. Transgener Invertebrat nach Anspruch 12, dadurch gekennzeichnet, daß es sich um Drosophila melanogaster oder Caenorhabditis elegans handelt.Transgenic invertebrate according to Claim 12, characterized in that it is Drosophila melanogaster or Caenorhabditis elegans. Verfahren zur Herstellung eines transgenen Invertebraten gemäß Anspruch 12 oder 13 umfassend das Einbringen einer Nukleinsäure gemäß Anspruch 1 oder eines Vektors gemäß Anspruch 2 oder 3.A method for producing a transgenic invertebrate according to claim 12 or 13 comprising introducing a nucleic acid according to claim 1 or a vector according to claim 2 or 3. Transgene Nachkommen eines Invertebraten gemäß Anspruch 12 oder 13.Transgenic offspring of an invertebrate according to claim 12 or 13. Verfahren zur Herstellung einer Nukleinsäure gemäß Anspruch 1 umfassend die folgenden Schritte: (a) Vollständige chemische Synthese aufan sich bekannte Weise oder (b) chemische Synthese von Oligonukleotiden, Markieren der Oligonukleotide, Hybridisieren der Oligonukleotide an DNA einer InsektencDNA-Bank, Selektieren von positiven Klonen und Isolieren der hybridisierenden DNA aus positiven Klonen oder (c) chemische Synthese von Oligonukleotiden und Amplifizierung der Ziel-DNA mittels PCR. A method for producing a nucleic acid according to claim 1 comprising the following steps: (a) Complete chemical synthesis in a manner known per se or (b) chemical synthesis of oligonucleotides, labeling of the oligonucleotides, hybridization of the oligonucleotides to DNA from an insect cDNA library, selection of positive clones and isolation of the hybridizing DNA from positive clones or (c) chemical synthesis of oligonucleotides and amplification of the target DNA by means of PCR. Regulatorische Region, welche natürlicherweise die Transkription einer Nukleinsäure gemäß Anspruch 1 in Insektenzellen kontrolliert und eine spezifische Expression gewährleistet. Regulatory region, which naturally transcribes a Controlled nucleic acid according to claim 1 in insect cells and a specific Expression guaranteed. Verfahren zum Auffinden neuer Wirkstoffe für den Pflanzenschutz, insbesondere von Verbindungen, welche die Leitungseigenschaften von Rezeptoren gemäß Anspruch 9 verändern, umfassend die folgenden Schritte: (a) Bereitstellen einer Wirtszelle gemäß einem der Ansprüche 4 bis 7, (b) Kultivieren der Wirtszelle in der Gegenwart einer Verbindung oder einer Probe, welche eine Vielzahl von Verbindungen umfaßt, und (c) Detektieren veränderter Rezeptoreigenschaften. A method for finding new active substances for crop protection, in particular compounds which change the conduction properties of receptors according to claim 9, comprising the following steps: (a) providing a host cell according to any one of claims 4 to 7, (b) culturing the host cell in the presence of a compound or sample comprising a plurality of compounds, and (c) detecting altered receptor properties. Verfahren zum Auffinden einer Verbindung, die an Rezeptoren gemäß Anspruch 9 bindet, umfassend die folgenden Schritte: (a) Inkontaktbringen einer Wirtszelle gemäß einem der Ansprüche 4 bis 7, eines Polypeptids gemäß Anspruch 8 oder eines Rezeptors gemäß Anspruch 9 mit einer Verbindung oder einem Gemisch von Verbindungen unter Bedingungen, die die Interaktion der Verbindung(en) mit der Wirtszelle, dem Polypeptid oder dem Rezeptor erlauben, und (b) Bestimmen der Verbindung(en), die spezifisch an die Rezeptoren binden. A method of finding a compound that binds to receptors according to claim 9, comprising the following steps: (a) contacting a host cell according to any one of claims 4 to 7, a polypeptide according to claim 8 or a receptor according to claim 9 with a compound or a mixture of compounds under conditions that affect the interaction of the compound (s) with the host cell, the polypeptide or allow the receptor, and (b) Determine the compound (s) that bind specifically to the receptors. Verfahren zum Auffinden von Verbindungen, die die Expression von Rezeptoren gemäß Anspruch 9 verändern, umfassend die folgenden Schritte: (a) Inkontaktbringen einer Wirtszelle gemäß einem der Ansprüche 4 bis 7 oder eines transgenen Invertebraten gemäß Anspruch 11 oder 12 mit einer Verbindung oder einem Gemisch von Verbindungen, (b) Bestimmen der Rezeptorkonzentration, und (c) Bestimmen der Verbindung(en), die die Expression des Rezeptors spezifisch beeinflussen. A method of finding compounds that alter the expression of receptors according to claim 9, comprising the following steps: (a) contacting a host cell according to one of claims 4 to 7 or a transgenic invertebrate according to claim 11 or 12 with a compound or a mixture of compounds, (b) determining receptor concentration, and (c) Determining the compound (s) that specifically affect expression of the receptor. Verwendung zumindest einer Nukleinsäure gemäß Anspruch 1, eines Vektors gemäß Anspruch 2 oder 3, einer regulatorischen Region gemäß Anspruch 16 oder eines Antikörpers gemäß Anspruch 11 zum Auffinden neuer Wirkstoffe für den Pflanzenschutz oder zum Auffinden von Genen, die für Polypeptide kodieren, welche am Aufbau von fünktionell ähnlichen Acetylcholinrezeptoren in Insekten beteiligt sind.Use of at least one nucleic acid according to claim 1, a vector according to claim 2 or 3, a regulatory region according to claim 16 or an antibody according to claim 11 for finding new active substances for crop protection or to find genes for polypeptides encode which on the construction of functionally similar acetylcholine receptors are involved in insects.
    EP99107852A 1998-05-04 1999-04-21 Nucleic acids encoding acetylcholin-receptor subunits from insects Withdrawn EP0962528A3 (en)

    Applications Claiming Priority (2)

    Application Number Priority Date Filing Date Title
    DE19819829A DE19819829A1 (en) 1998-05-04 1998-05-04 New nucleic acid encoding a nicotinic acetylcholine receptor from insects, used to identify potential insecticides
    DE19819829 1998-05-04

    Publications (2)

    Publication Number Publication Date
    EP0962528A2 true EP0962528A2 (en) 1999-12-08
    EP0962528A3 EP0962528A3 (en) 2001-10-04

    Family

    ID=34832462

    Family Applications (1)

    Application Number Title Priority Date Filing Date
    EP99107852A Withdrawn EP0962528A3 (en) 1998-05-04 1999-04-21 Nucleic acids encoding acetylcholin-receptor subunits from insects

    Country Status (4)

    Country Link
    US (1) US6933131B2 (en)
    EP (1) EP0962528A3 (en)
    JP (1) JP2000023680A (en)
    DE (1) DE19819829A1 (en)

    Cited By (4)

    * Cited by examiner, † Cited by third party
    Publication number Priority date Publication date Assignee Title
    EP1106689A2 (en) * 1999-12-10 2001-06-13 Bayer Ag Nucleic acids encoding acetylcholine beta subunits from insects
    EP1184391A3 (en) * 2000-08-28 2002-07-10 Bayer Ag Acetylcholine receptor subunits
    WO2006091672A2 (en) * 2005-02-23 2006-08-31 Dow Agrosciences Llc Novel assays utilizing nicotinic acetylcholine receptor subunits
    US9005981B2 (en) 2008-12-30 2015-04-14 Dow Agrosciences Llc Assays utilizing nicotinic acetylcholine receptor subunits

    Families Citing this family (2)

    * Cited by examiner, † Cited by third party
    Publication number Priority date Publication date Assignee Title
    WO2002074079A2 (en) 2001-03-15 2002-09-26 Clemson University Polynucleotide encoding a gene conferring resistance to bacillus thuringiensis toxins
    CN104920307B (en) * 2015-06-19 2018-01-26 安徽省农业科学院农业工程研究所 A kind of Caenorthaditis elegans ws123 fixing means suitable for single-particle microbeam device

    Family Cites Families (5)

    * Cited by examiner, † Cited by third party
    Publication number Priority date Publication date Assignee Title
    CA1341554C (en) 1988-03-18 2007-10-09 The Salk Institute For Biological Studies Neuronal nicotinic acetylcholine receptor compositions and assay
    US5683912A (en) 1994-07-21 1997-11-04 The Salk Institute For Biological Studies Cloning and expression of a novel acetylcholine-gated ion channel receptor subunit
    US5599709A (en) 1989-09-28 1997-02-04 The Salk Institute For Biological Studies Recombinant DNA encoding neuronal α-bungarotoxin-binding proteins
    US5693492A (en) * 1995-05-05 1997-12-02 Merck & Co., Inc. DNA encoding glutamate gated chloride channels
    US6485967B1 (en) * 1995-06-07 2002-11-26 Merck & Co., Inc. Human neuronal nicotinic acetylcholine receptor α6 and β3 nucleic acid

    Non-Patent Citations (1)

    * Cited by examiner, † Cited by third party
    Title
    HERMSEN ET AL: "Neuronal nicotinic receptors in the locust Locusta migratoria", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 273, no. 29, 17 July 1998 (1998-07-17), pages 18394 - 18404, XP002198051 *

    Cited By (6)

    * Cited by examiner, † Cited by third party
    Publication number Priority date Publication date Assignee Title
    EP1106689A2 (en) * 1999-12-10 2001-06-13 Bayer Ag Nucleic acids encoding acetylcholine beta subunits from insects
    EP1106689A3 (en) * 1999-12-10 2002-11-20 Bayer Ag Nucleic acids encoding acetylcholine beta subunits from insects
    EP1184391A3 (en) * 2000-08-28 2002-07-10 Bayer Ag Acetylcholine receptor subunits
    WO2006091672A2 (en) * 2005-02-23 2006-08-31 Dow Agrosciences Llc Novel assays utilizing nicotinic acetylcholine receptor subunits
    WO2006091672A3 (en) * 2005-02-23 2007-05-31 Dow Agrosciences Llc Novel assays utilizing nicotinic acetylcholine receptor subunits
    US9005981B2 (en) 2008-12-30 2015-04-14 Dow Agrosciences Llc Assays utilizing nicotinic acetylcholine receptor subunits

    Also Published As

    Publication number Publication date
    US6933131B2 (en) 2005-08-23
    DE19819829A1 (en) 1999-11-11
    US20020006657A1 (en) 2002-01-17
    JP2000023680A (en) 2000-01-25
    EP0962528A3 (en) 2001-10-04

    Similar Documents

    Publication Publication Date Title
    CH694428A5 (en) GABA-B receptors.
    DE69534310T2 (en) PTC GENES AND ITS USE
    DE69431432T2 (en) UNITS OF HUMAN N-METHYL-D-ASPARTATE RECEPTORS, THESE ENCODING NUCLEIC ACID, AND THEIR USE
    DE69430808T2 (en) NF-AT POLYPEPTIDES AND POLYNUCLEOTIDES
    DE69334187T2 (en) Stably transfected cell lines expressing human GABA-A receptors with the subunit combination alpha-2, beta-3 and gamma-2
    Thany et al. Apisα2, Apisα7-1 and Apisα7-2: three new neuronal nicotinic acetylcholine receptor α-subunits in the honeybee brain
    DE69837267T2 (en) KCNQ KALIUM CHANNELS AND METHOD FOR MODULATING THEM
    DE69635517T2 (en) HUMAN NEURONAL ACETYLCHOLIN RECEPTOR COMPOUNDS AND METHODS OF THEIR APPLICATION
    EP0962528A2 (en) Nucleic acids encoding acetylcholin-receptor subunits from insects
    DE60036548T2 (en) NEW KALIUM CHANNELS, AND GENES THAT ARE CODED FOR
    DE10042177A1 (en) New acetylcholine receptor subunit, useful for identifying plant-protection and therapeutic agents, comprises segment of insect subunit inserted into vertebrate subunit
    DE69836591T2 (en) DNA encoding a human proton dependent ion channel and its uses
    EP1106689A2 (en) Nucleic acids encoding acetylcholine beta subunits from insects
    DE60038025T2 (en) HIGH AFFINITY-choline
    DE60126940T2 (en) HELIOTHIS GLUTAMATE RECEPTOR
    DE60225046T2 (en) PRODUCTION OF EUKARYONTIC PROTEINS AND NUCLEIC ACID MOLECULES IN C. ELEGANS
    EP1136501A2 (en) Receptors for peptides from insect origin
    DE10036469A1 (en) Ultraspiracle (USP) protein from Heliothis virescens
    DE19757695A1 (en) Cloned neurotransmitter receptor producing cells
    WO2001070797A1 (en) Ligand-controlled anion channels of insects
    EP1136504A1 (en) Receptor for Latrotoxin from insects
    WO2003087356A2 (en) Helicokinin-receptor from insects
    Lee A molecular genetic analysis of target selection in Drosophila melanogaster: Visualizing axons, identifying genes, and understanding the role of the protocadherin flamingo
    Yang Studies of the Drosophila Brain Using P [GAL4] Enhancer Trap Lines
    EP1132476A1 (en) Inorganic Pyrophosphatases from Lepidoptera

    Legal Events

    Date Code Title Description
    PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

    Free format text: ORIGINAL CODE: 0009012

    AK Designated contracting states

    Kind code of ref document: A2

    Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

    Kind code of ref document: A2

    Designated state(s): BE CH DE FR GB IT LI NL

    AX Request for extension of the european patent

    Free format text: AL;LT;LV;MK;RO;SI

    PUAL Search report despatched

    Free format text: ORIGINAL CODE: 0009013

    AK Designated contracting states

    Kind code of ref document: A3

    Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

    AX Request for extension of the european patent

    Free format text: AL;LT;LV;MK;RO;SI

    17P Request for examination filed

    Effective date: 20020404

    AKX Designation fees paid

    Free format text: BE CH DE FR GB IT LI NL

    RAP1 Party data changed (applicant data changed or rights of an application transferred)

    Owner name: BAYER CROPSCIENCE AG

    17Q First examination report despatched

    Effective date: 20071009

    STAA Information on the status of an ep patent application or granted ep patent

    Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

    18D Application deemed to be withdrawn

    Effective date: 20080220