EP0956346A1 - An enzyme with cyclomaltodextrin glucanotransferase (cgtase) activity - Google Patents

Abstract

The present invention relates to a novel alkali stable CGTase which mainly produces alpha-cyclodextrin, an enzyme composition comprising said CGTase, and the use of said enzyme and enzyme composition for a number of industrial applications, e.g., in a dough-improving composition.

Description

TITLE: An enzyme with CYCLOMALTODEXTRIN GLUCANOTRANSFERASE (CGTase) activity

FIELD OF INVENTION The present invention relates to a DNA sequence encoding a novel alkali CGTase, the novel stable alkaline CGTase, an enzyme composition comprising said CGTase, and the use of said enzyme and enzyme composition for a number of industrial applications .

BACKGROUND OF THE INVENTION

Cyclo altodextrin glucanotransferase (E.C. 2.4.1.19), also designated cyclodextrin glucanotransferase or cyclodextrin glycosyltransferase, in the following termed CGTase, catalyses the conversion of starch and similar substrates into cyclomaltodextrins via an intramolecular transglycosylation reaction, thereby forming cyclomaltodextrins, in the following termed cyclodextrins (or CD) , of various sizes. Commercially most important are cyclodextrins of 6, 7 and 8 glucose units, which are termed α-, β- and γ-cyclodextrins, respectively. Coiranercially less important are cyclodextrins of 9, 10, and 11 glucose units, which are termed δ-, ε-, and ξ-cyclodextrins , respectively.

Cyclodextrins are thus cyclic glucose oligo ers with a hydrophobic internal cavity. They are able to form inclusion complexes with many small hydrophobic molecules in aqueous solutions, resulting in changes in physical properties, e.g. increased solubility and stability and decreased chemical reactivity and volatility. Cyclodextrins find applications particularly in the food, cosmetic, chemical and pharmaceutical industries .

Most CGTases have both starch-degrading activity and transglycosylation activity. Although some CGTases produce α- cyclodextrins and some CGTases produce mainly respective β- cyclodextrins or γ-cyclodextrins, CGTases usually form a mixture of α-, β- and γ-cyclodextrins. Selective precipitation steps with organic solvents may be used for the isolation of separate α-, β- and γ-cyclodextrins. To avoid expensive and environmentally harmful procedures, the availability of CGTases capable of producing an increased ratio of one particular type of cyclodextrin is desirable.

It is the object of the present invention to provide a CGTase which is thermoalkali stable, having a broad pH range of activity for cyclodextrin cyclization and mainly producing α-CD.

It is also desirable to find a CGTase which is stable at relatively high temperature and pH values.

This makes the enzyme suitable for a variety of industrial applications that need to be carried out at elevated pH and higher temperatures.

The Structure of CGTases

CGTases are functionally related to α-amylases. CGTases and α-amylases both degrade starch by hydrolysis of the α-(l,4)- glycosidic bonds, but produce virtually exclusively cyclic and linear products, respectively.

Members of the CGTase family possess a high overall amino acid sequence identity, more than 60 % of CGTases. Further, relatively to α-amylases CGTases share about 30% amino acid sequence identity.

Previously characterized CGTases:

Mentioned below are references describing identification of preciously characterized CGTases.

It is presently believed that none of the below mentioned CGTases have the specific characteristics of the CGTase of the present invention, in particular the ability to mainly producing α-CD. CGTases from different bacterial sources, including CGTases obtained from Bacillus , Brevibacterium, Clostridium ,

Corynebacterium , Klebsiella , Micrococcus , Thermoanaerobacter and Thermoanaerobacterium have been described in the literature.

Thus Kimura et al . [Kimura K, Kataoka S, Ishii Y, Takano T and Yamane K; J. Bacteriol. 1987 169 4399-4402] describe a Bacillus sp. 1011 CGTase, Kaneko et al . [Kaneko T, Hamamoto T and Horikoshi K; J. Gen. Microbiol. 1988 134 97-105] describe a Bacillus sp. Strain 38-2 CGTase, Kaneko et al . [Kaneko T, Song K B, Hamamoto T, Kudo T and Horikoshi K; J. Gen. Microbiol. 1989 135 3447-3457] describe a Bacillus sp. Strain 17-1 CGTase, Itkor et al . [Itkor P, Tsukagoshi N and ϋdaka S; Biochem. Biophys. Res. Commun. 1990 166 630-636] describe a Bacillus sp. B1018 CGTase, Schmid et al . [Schmid G, Englbrecht A, Schmid D; Proceedings of the Fourth International Symposium on Cyclodextrins (flujber O, Szejtli J, Eds.), 1988 71-76] describe a Bacillus sp. 1-1 CGTase, Kitamoto et al . [Kitamoto N, Kimura T, Kito Y, Ohmiya K; J^ Ferment. Bioenq. 1992 74 345-351] describe a Bacillus sp. KC201 CGTase, Sakai et al . [Sakai S, Kubota M, Nakada T, Torigoe K, Ando O and Sugimoto T; J. Jpn. Soc. Starch. Sci. 1987 34 140-147] describe a Bacillus stearothermophilus CGTase and a Bacillus maceranε CGTase, Takano et al . [Takano T, Fukuda M, Monma M, Kobayashi S, Kainuma K and Yamane K,' J. Bacteriol. 1986 166 (3) 1118-1122] describe a Bacillus macerans CGTase, Sin et al . [Sin K A, Nakamura A, Kobayashi K, Masaki H and Uozumi T; Appl. Microbiol . Biotechnol . 1991 35 600-605] describe a Bacillus ohbenεis CGTase, Nitschke et al . [Nitschke L, Heeger K, Bender H and Schultz G; Appl . Microbiol . Biotechnol . 1990 33 542-546] describe a Bacillus circulanε CGTase, Hill et al . [Hill D E, Aldape R and Rozzell J D; Nucleic Acids Res. 1990 18 199] describe a Bacillus licheniformis CGTase, Tomita et al . [Tomita K, Kaneda M, Kawamura K and Nakaniεhi K; J. Ferm. Bioenq. 1993 75 (2) 89-92] describe a Bacillus autolyticus CGTase, Jamuna et al . [Jamuna R, Saεwathi N, Sheela R and Ramakriεhna S V ; Appl. Biochem. Biotechnol . 1993 43 163-176] describe a Bacilluε cereus CGTase, Akimaru et al . [Akimaru K, Yagi T and Yamamoto S ; J. ferm. Bioenq. 1991 71 (5) 322-328] describe a Bacillus coagulans CGTase, Schmid G [Schmid G; New Trends in Cyclodextrins and Derivatives (Duchene D, Ed.), Editions de Sante, Paris, 1991, 25- 54] describes a Bacilluε firmuε CGTase, Abelian et al . [Abelian V A, Adamian M O, Abelian L A A, Balayan A M and Afrikian E K; Biochememistrv (Moscow) 1995 60 (6) 665-669] describe a Bacilluε halophiluε CGTase, and Jato et al . [Kato T and Horikoεhi K; J. Jpn. Soc. Starch Sci. 1986 33 (2) 137-143] describe a Bacilluε subtil iε CGTase.

EP 614971 describes a Brevibacterium CGTase, Haeckel & Bahl [Haeckel K, Bahl H; FEMS Microbiol. Lett. 1989 60 333-338] describe Cloεtridium thermosulfurogeneε CGTase, Podkovyrov & Zeikuε [Podkovyrov S M, Zeikuε J G; J. Bacteriol. 1992 174 5400- 5405] describe a Cloεtridium thermohydroεulfuricum CGTase, JP 7000183 describes a Corynebacterium CGTase, Binder et al . [Binder F, Huber O and Bock A; Gene 1986 47 269-277] describe a Klebεiella pneumoniae CGTase, US 4,317,881 describes a Micrococcus CGTase, and Wind et al . [Wind R D, Liebl W, Buitelaar R M, Penninga D, Spreinat A, Dijkhuizen , Bahl H; Appl . Environ . Microbiol . 1995 61 (4) 1257-1265] describe Thermoanaerobacterium thermosulfurigenes CGTase.

A CGTase produced by Thermoanaerobacter sp. has been reported by Norman & Jørgensen [Norman B E, Jørgenεen S T Denpun Kagaku 1992 39 99-106, and WO 89/03421].

Also, CGTases from therraophilic Actinomyceteε have been reported [Abelian V A, Afyan K B, Avakian Z G, Melkumyan A G and Afrikian E G; Biochemistry (Moscow) 1995 60 (10) 1223-1229].

Recently protein engineering has been employed in order to modify certain CGTases to selectively produce more or less of a specific cyclodextrin. WO 96/33267 (Novo Nordisk) describes novel variants of CGTases, which variants, when compared to the precursor enzyme, show increased product selectivity and/or reduced product inhibition.

SUMMARY OF THE INVENTION

The present inventors have surprisingly identified a

CYCLOMALTODEXTRIN GLUCANOTRANSFERASE (CGTase) from a novel moderately thermo alkaliphile anaerobe strain named

Thermoalcalibacter bogoriae, which belong to the Cloεtridium /Bacilluε subphyllum.

The CGTase of the invention has been thoroughly characterized and shown that it is producing mainly α-cyclodextrin (relative to β and γ- cyclodextrin) .

Further, a partial DNA sequence has been cloned, isolated and sequenced and expressed heterologously.

Accordingly, in a first aspect the invention relates to an isolated CGTase characterized by producing at least 75% α- cyclodextrin (relative to β and γ- cyclodextrin) after 2 hours of incubation with amylopectin at 65°C, pH 8.0. In other word at least 75% α-cyclodextrin calculated on the basis of the total amount of cyclodextrin, i.e. α-, β- and γ-cyclodextrin.

The ability of the CGTase of the present invention to produce at least 75% α-cyclodextrin at the relatively high temperature

(65°C) is highly advantageous in a number of industrial applications.

The previously characterized CGTases and CGTase variants either produce a minor fraction of α-cyclodextrin relatively to β or γ-CD (WO 96/33267) , or when they are able to produce relatively high amounts of α-cyclodextrin they are not thermostable (i.e. not able to exhibit any substantial activity at 65°C) (Kitahata, S. and Okada, S. 1982. Comparison of

Action of Cyclodextrin Glucanotransferase from Bacillus megaterium, B. circulans, B. stearothermophilus and B. macerans. J. Jap. Soc. Starch Sci. 29,1:13-18; and Lee, J.-H. et al. 1992) .

Further the CGTase of the invention is presently believed to be the first description and characterization of extracellular amylolytic enzymes from an anaerobe ther o alkaliphile

Accordingly, in a second aspect the present invention relates to an isolated extracellular CGTase obtained from a strain of

Ther oalcalibacter sp.

In a third aspect the invention relates to a method of producing a CGTase of the invention homologously, the method comprising culturing a strain of Thermoalcalibacter sp. under conditions permitting the production of the enzyme, and recovering the enzyme from the culture.

Further, the invention relates to an enzyme or an enzyme composition and the use of such an enzyme or enzyme composition for various industrial applications.

The invention also relates to an isolated DNA sequence encoding an enzyme exhibiting CGTAse activity comprising the partial sequence shown in SEQ ID NO. 13; an expression vector comprising said CGTase encoding sequence comprising the sequence shown in SEQ ID No. 13; a host cell into which has been introduced an expression vector of the invention which cell expresses the CGTase encoded by the DNA sequence comprising the DNA sequence shown in SEQ ID No. 13.

5 BRIEF DESCRIPTION OF THE DRAWINGS

The present invention is further illustrated by reference to the accompanying drawings, in which:

Figure 1: SDS-PAGE of variaos purification steps. Figure 1 shows electrophoretic separation of the proteins of

10 Thermoalcalibacter bogoriae grown on starch. Concentrated supernatant after PD-10 (lane 1+2), α-amylase (lane 3,4,5), purified α-amylase (lane 5) , CGTase (lane 6+7) , silver staining (lane 1, 3, 5, 6), activity staining (lane 2, 4, 7).

Figure 2 shows the pH optimum of CGTase from

15 Thermoalcalibacter bogoriae . For the determination of the pH optimum universal buffer (Britton & Robinson) pH 4.0-11.0 containing 0.5% (wt/vol) soluble starch was used at 65°C and 30 minutes incubation time. The hydrolysis activity (J) or the cyclization activity (C) exhibited by the CGTase was determined.

20 100% residual activity corresponds to 0.12 U/ml conversion to oligosaccharides (•) or to 500 U/ml cyclisation activity (Δ) , respectively.

Figure 3 shows the temperature optimum of CGTase from

Thermoalcalibacter bogoriae . Incubation was done for 30 minutes 25 in 100 mM sodium phosphate buffer pH 8.0 containing 0.5% (wt/vol) soluble starch. 100% residual activity corresponds to 0.11 U/ml activity measured as conversion to oligosaccharides.

Figure 4 shows analysis of hydrolysis products by HPLC after incubation of CGTase from Thermoalcalibacter bogoriae with 30 soluble starch (A), and amylopectin (B) , at pH 9.0 for up to 16 hours. Prepurified CGTase was incubated with various substrates pH 8.0 and 65°C for up to 16 hours.

Figure 5 shows the ratio of cyclodextrins produced by prepurified CGTase action. 35

DEFINITIONS Prior to discussing this invention in further detail, the following terms will first be defined.

"A cloned DNA sequence": The term "A cloned DNA sequence", refers to a DNA sequence cloned by standard cloning procedure used in genetic engineering to relocate a segment of DNA from its natural location to a different site where it will be reproduced. The cloning process involves excision and isolation of the desired DNA segment, alternatively its manufacture by PCR amplification, insertion of the piece of DNA into the vector molecule and incorporation of the recombinant vector into a cell where multiple copies or clones of the DNA segment will be replicated.

The "cloned DNA sequence" of the invention may alternatively be termed "DNA construct" or "isolated DNA sequence" .

"Obtained from" : For the purpose of the present invention the term "obtained from" as used herein in connection with a specific microbial source, means that the enzyme is produced by the specific source, or by a cell in which a gene from the source have been inserted.

"An isolated polypeptide" : As defined herein the term, "an isolated polypeptide" or "isolated CGTase", as used about the CGTase of the invention, is a CGTase or CGTase part which is essentially free of other non-CGTase polypeptides, e.g., at least about 20% pure, preferably at least about 40% pure, more preferably about 60% pure, even more preferably about 80% pure, most preferably about 90% pure, and even most preferably about 95% pure, as determined by SDS-PAGE.

The term "isolated polypeptide" may alternatively be termed "purified polypeptide".

"Homo1o ous impurities" : As used herein the term "homologous impurities" means any impurity (e.g. another polypeptide than the enzyme of the invention) which originate from the homologous cell where the enzyme of the invention is originally obtained from. In the present invention the homologous cell may e . g . be a strain of Thermoalcalibacter bogoriae .

"CYCLOMALTODEXTRIN GLUCANOTRANSFERASE (CGTase)" In the present context CGTase is defined according to the IUB enzyme nomenclature as EC 2.4.1.19. Alternative Name (s) : Cyclodextrin- glycosyltransferase. Cyclodextrin glucanotransferase degrades starch to cyclodextrins by formation of a 1,4-alpha-D- glucosidic bond.

"amylolytic" In the present context, the term "amylolytic" or "amylolytic activity" is intended to indicate that the enzyme in question has a starch-degrading capability. Specific examples of enzymes having amylolytic activity, i.e. amylolytic enzymes, includes α-amylases, pullulanases, neo-pullulanases, iso- amylases, beta-amylases, CTGases, maltogenases as well as G-4 and G-6 amylases.

"moderate ther o alkaliphile" : The term "moderately thermo alkaliphile" relates to a cell which is capable of surviving at relatively high temperatures, i.e. at a temperature above 55°C such as above 60°C or 65°C, and at relatively high pH levels, above 8.5 such as above 9 or 10.

"extracellular" : The term "extracellular" as used herein in connection with an enzyme relates to an enzyme which is exported out of the cell producing the enzyme, i.e. it is secreted by or diffused out of the cell. Such an enzyme will generally comprise a signal-peptide to guide the secretion (i.e. exporting out of the cell) of the enzyme.

The term "alignment" used herein in connection with a alignment of a number of DNA and/or amino acid sequences means that the sequences of interest is aligned in order to identify mutual/common sequences of homology/identity between the sequences of interest. This procedure is used to identify common "conserved regions" between sequences of interest. An alignment may suitably be determined by means of computer programs known in the art, such as ClusterW or PILEUP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443- 453) . The term "conserved region" used herein in connection with a "conserved region" between DNA and/or amino acid sequences of interest means a mutual common sequence region of the sequences of interest, wherein there is a relatively high degree of se- quence identity between the sequences of interest. In the present context a conserved sequence is preferably at least 10 base pairs (bp)/3 amino acids(a.a), more preferably at least 20 bp/7 a. a., and even more preferably at least 30 bp/10 a. a.. Using the computer program GAP (Program Manual for the

Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453) (vide supra) with the following settings for DNA sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3, the degree of DNA sequence identity within the conserved region is preferably of at least 80%, more preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%. The term "primer" used herein especially in connection with a PCR reaction is an oligonucleotide (especially a "PCR-primer") defined and constructed according to general standard specification known in the art ("PCR A practical approach" IRL Press, (1991)). The term "a primer directed to a sequence" means that the primer (preferably to be used in a PCR reaction) is constructed so it exhibits at least 80% degree of sequence identity to the sequence part of interest, more preferably at least 90% degree of sequence identity to the sequence part of interest, which said primer consequently is "directed to" . The primer is designed in order to specifically anneal at the region at a given temperature it is directed towards. Especially identity at the 3' end of the primer is essential for the function of the polymerase, i.e. the ability of a polymerase to extend the annealed primer. The term "expression vector" denotes a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription. Such additional segments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both. The expression vector of the invention may be any expression vector that is conveniently subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which the vector it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extra- chromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome (s) into which it has been integrated. The term "recombinant expressed" or "recombinantly expressed" used herein in connection with expression of a polypeptide or protein is defined according to the standard definition in the art. Reco binantly expression of a protein is generally performed by using an expression vector as described immediately above.

The term "isolated" , when applied to a DNA, denotes that the DNA has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems. Such isolated DNA are those that are separated from their natural environment and include cDNA and genomic clones. Isolated DNA molecules of the present invention are free of other genes with which they are ordinarily associated, but may include naturally occurring 5¹ and 3' untranslated regions such as promoters and terminators. The identification of associated regions will be evident to one of ordinary skill in the art (see for example, Dynan and Tijan, Nature 316: 774-78, 1985). The term "an isolated polynucleo- tide" may alternatively be termed "a cloned polynucleotide" . When applied to a protein, the term "isolated" indicates that the protein is found in a condition other than its native environment. In a preferred form, the isolated protein is substantially free of other proteins, particularly other homologous proteins (i.e. "homologous impurities" (see below)). It is preferred to provide the protein in a greater than 40% pure form, more preferably greater than 60% pure form. Even more preferably it is preferred to provide the protein in a highly purified form, i.e., greater than 80% pure, more pref- erably greater than 95% pure, and even more preferably greater than 99% pure, as determined by SDS-PAGE.

The term "isolated protein/polypeptide" may alternatively be termed "purified protein/polypeptide" . The term "partial DNA sequence" denotes a partial DNA sequence which is comprised in a longer DNA sequence, wherein said longer DNA sequence contains sufficient information to encode a polypeptide having the activity of interest.

The term "partial polypeptide sequence" denotes a partial polypeptide sequence which is comprised in a longer polypeptide sequence, wherein said longer polypeptide sequence is having the activity of interest.

The term "homologous impurities" means any impurity (e.g. another polypeptide than the polypeptide of the invention) which originate from the homologous cell where the polypeptide of the invention is originally obtained from.

The term "obtained from" as used herein in connection with a specific microbial source, means that the polynucleotide and/or polypeptide produced by the specific source, or by a cell in which a gene from the source have been inserted.

The term "operably linked", when referring to DNA segments, denotes that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in the promoter and proceeds through the coding segment to the terminator

DETAILED DESCRIPTION OF THE INVENTION

CGTase obtained from Thermoalcalibacter bogoriae :

The assay used to measure the relative amount of α- cyclodextrin produced by the CGTase of the present invention, is described in a working example herein (vide infra ) and the experimental results are shown in Figure 5.

Briefly, in order to determine the hydrolysis products of the CGTase activity, the enzyme was incubated with various substrates (e.g. amylopectin) at 65°C and pH 8.0 for 1, 2 and up to 16 hour. The substrate specificity was determined qualitatively measuring the cyclization activity and the ratio between the produced CDs was elucidated from a quantitative HPLC analysis.

When amylopectin is used as the substrate and incubation is done for 2 hours at 65°C, pH 8.0, the CGTase of the present

5 invention preferably produce at least 75% α-cyclodextrin

(relative to β or γ- cyclodextrin) , more preferably at least 80% α-cyclodextrin (relative to β or γ- cyclodextrin) , or even more preferably at least 85% α-cyclodextrin (relative to β or γ- cyclodextrin) . 10 It will be understood that in addition to the predominantly α-cyclodextrin, the CGTase of the invention is capable of producing minor fractions of β or γ- cyclodextrin.

In a further embodiment, the CGTase of the invention is preferably one which has a molecular mass of 67 ± 10 kD (i.e. 57-

15 77 kD) , more preferably a molecular mass of 67 + 5 kD (i.e. 62-

72 kD) , even more preferably a molecular mass of 67 ± 3 kD (i.e.

64-70 kD) , and most preferably a molecular mass of 67 ± 2 kD (i.e. 65-69 kD) . The molecular mass is measured by SDS-PAGE electrophoresis as further described in the "Materials and 20 Methods" section (vide infra) .

In a further embodiment, the CGTase of the invention is preferably one which has a temperature optimum of 65 ± 10 °c

(i.e. 55-75°C) , more preferably a temperature optimum of 65 ± 5

°C (i.e. 60-70°C) , and even more preferably a temperature optimum

25 of 65 ± 2 °C (i.e. 63-67°C) . The temperature optimum is measured by incubating the enzyme with a 0.5% (wt/vol) substrate solution (soluble starch; Merck) in 100 mM sodium phosphate buffer at pH 8.0. Incubation was done for 30 minutes at temperatures between 30-80°C For further details see working 30 example herein (vide infra) .

Microbial Sources

The CGTase of the invention or a DNA sequence encoding the CGTase of the invention may be obtained from bacteria 35 corresponding to the Thermoalcalibacter line within the Clostridium/Bacilluε subphyllum in particular a strain of Thermoalcalibacter bogoriae as described below:

Charateristic of Thermoalcalibacter bogoriae Cells are rod-shaped, 0.3-0.5 μm thick and 3-5 μm long. Colonies are 3-5 mm in diameter, pale-whitish, lense-shaped. Obligately anaerobic. Temperature range for growth from 30°C to

65°C, optimum around 50°C to 55°C Range of growth from pH 6 to 10.5, optimum at pH 9.5; growth from 0 to 4% NaCl with an optimum around 1% NaCl, represents an optimum Na concentration of 230 mM. Grows heterotrophically with peptone. Growth in presence of sulfate, thiosulfate or sulfur. Thiosulfate enhances growth on a fermentable substrate such as glucose and starch, resulting in the formation of H₂S. Fermentation products on starch with thiosulfate are acetate and ethanol. Cell wall type is Gram- positive, but cell wall is atypically thin. Sheat like structures at the cell separation area. Branched cells were regularly present. Parts of an outer surface layer were observed.

16S rRNA analysis shows that Thermoalcalibacter bogoriae represents a new line within the Cloεtridium /Bacilluε subphyllum. The 16 rRNA sequencing analysis was done at Deutche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) .

An isolate of a strain of Thermoalcalibacter bogoriae from which an CGTase of the invention or a DNA sequence encoding the CGTAse of the invention can be derived has been deposited by the inventors according to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure at the Deutche Sammlung von Mikroorganismen und Zellkulturen, Mascheroder Weg lb, D-38124 Braunschweig, Federal Republic of Germany, (DSMZ) . Deposit date : 11 of September 1996 Depositor's ref. : NN049260 DSM No. : Thermoalcalibacter bogoriae DSM No. 9380.

Method of producing CGTase

The CGTase of the present invention may be produced by cultivation of a homologous strain e . g . the above mentioned deposited strain in a suitable medium resulting in conditions permitting the production of the enzyme.

The medium used to culture the strain may be any conventional medium suitable for growing the cells in question. The secreted, into the culture medium, CGTase may be recovered therefrom by well-known procedures including separating the cells from the medium by centrifugation or filtration, precipitating proteinaceous components of the medium by means of a salt such as ammonium sulphate, followed by chro- matographic procedures such as ion exchange chromatography, affinity chromatography, or the like.

Cloning of CGTase:

A DNA sequence encoding an CGTase of the present invention can be cloned from a strain of Thermoalcalibacter bogoriae .

A number of suitable standard DNA cloning methods are e.g. described by Sambrook et al. (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab.; Cold Spring Harbor, NY. (1989) ) . The DNA sequence may be cloned by purifying the enzyme (e.g. as described in a working example herein (vide infra) ) , sequencing the amino acid sequence, and preparing a suitable probe or PCR primers based on this amino acid sequence.

The DNA sequence the invention may also be cloned by any general method involving

- cloning, in suitable vectors, a DNA library from any organism expected to produce the CGTase of interest, transforming suitable host cells with said vectors,

- culturing the host cells under suitable conditions to express the CGTase encoded by a clone in the DNA library, screening for positive clones by determining any CGTase activity of the enzyme produced by such clones , and isolating the CGTase encoding DNA from such clones. As will be described below in Example 3 and 4 a partial DNA sequence (see SEQ ID No. 13 comprising SEQ ID No. 10) was isolated, cloned and sequenced. First 3 conserved regions of known CGTases were identified by aligning an number of known CGTases available in the public domain on the SWISSPROT database. From the knowledge to these conserved regions 3 primers were designed. PCR amplification was then carried out on purified genomic DNA from T. bogoriae DSM No. 9380 providing a PCR product of 1.15 kb which was sequenced. Said partial CGTase encoding DNA sequence is shown in SEQ ID NO. 10. This partial sequence shown in SEQ ID No. 10 was then used as the starting point for determining a further part of the CGTase sequence. SEQ ID No. 10 was extended to give the sequence shown in SEQ ID No. 13 by the use of Inverse PCR (See M.J. MCPherson et al. ("PCR A practical approach" Information Press Ltd. , Oxford England) .

Based on the partial DNA sequence shown in SEQ ID No. 10 or SEQ ID No. 13 a full length DNA sequence encoding the entire CGTase of the invention can easily be cloned by a person skilled in the art. Once the full sequence of the gene is known, the entire gene may be cloned by PCR amplification procedures into suitable expression vectors, e.g. plasmids derived from pUBHO (Gryczan, et al. (1978), J. Bacteriol., 134,318-329), pE194 (Horinouchi et al. (1982), J. Bacteriol., 150, 815-825) or pC194 (Horinouchi et al. (1982), J. Bacteriol., 150, 804-814 for use in Bacilluε species.

Based on the sequence information disclosed herein (SEQ ID No. 13 and SEQ ID No. 14) it is routine work for a person skilled in the art to isolate homologous polynucleotide se- quences encoding homologous CGTases of the invention by a similar strategy using genomic libraries from related microbial organisms, in particular from genomic libraries from other strains of the Cloεtridium /Bacilluε subphyllum, in particular the genus Thermoalcalibacter . It is expected that a DNA sequence coding for a homologous enzyme, i.e. an analogous DNA sequence, is obtainable from other bacteria, such as a strain of the following genera: Bacilluε , Brevibacterium , Cloεtridium, Corynebacterium, JQejbsiella, Micro- coccuε, ThermoanaeroJacter and ThermoanaeroJbacteriujTi, such as the species mentioned above in the "Previously characterized CGTases" section.

DNA construct The invention also relates to a DNA construct which comprises a DNA sequence, which DNA sequence comprises a) a CGTase encoding DNA sequence comprising the partial DNA sequence shown in SEQ ID No. 13, or b) an analogue of the DNA sequence defined in a) , which i) is at least 70% homologous with the DNA sequence defined in a) comprising the partial sequence shown in SEQ ID No. 13, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence defined in a) comprising the partial sequence shown SEQ ID No. 13, or iii) encodes a polypeptide which is at least 70% homologous with the polypeptide encoded by the DNA sequence defined in a) comprising the partial DNA sequence shown in SEQ ID NO. 13, or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against the purified CGTase derived from T. bogoriae DSM no. 9380 encoded by the DNA sequence defined in a) , comprising the partial sequence shown in SEQ ID NO. 13.

In the present context, the expression "analogue" of the defined DNA sequence comprising the partial sequence shown in SEQ

ID No. 13 is intended to indicate an DNA sequence encoding polypeptides, which has the properties i)-iv) above. Typically, the analogous DNA sequence

- is isolated from another or related (e.g. the same) organism known or contemplated to produce an enzyme with CGTase activity on the basis of the defined DNA sequence comprising the partial DNA sequence shown in SEQ ID No. 13, e.g. using the procedures described herein, or

- is constructed on the basis of the defined DNA sequence comprising the partial sequence shown in SEQ ID No. 13, e.g. by introduction of nucleotide substitutions, which do not give rise to another amino acid sequence of the CGTase encoded by a DNA sequence comprising the partial sequence shown in SEQ ID NO. 13, but which correspond to the codon usage of the host organism intended for production of the enzyme (s) , or by introduction of nucleotide substitutions which do give rise to a different amino acid sequence and therefore, possibly, a different protein structure which might give rise to a mutant with different properties than the native enzymes. Other examples of possible modifications are insertion of one or more nucleotides into the sequence (s) , addition of one or more nucleotides at either end of 5 the sequence (s), or deletion of one or more nucleotides at either end or within the sequence. For instance, the analogous DNA sequence may be a subsequence of the partial DNA sequence shown in SEQ ID No. 13.

The homology referred to in i) above is determined as the

10 degree of identity between two sequences indicating a derivation of the first sequence from the second. The homology may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology 48, p. 443-

15 453) . Using GAP with the following settings for DNA sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3, the coding region of the DNA sequence exhibits a degree of identity preferably of at least 70%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%,

20 even more preferably at least 95%, especially at least 99%, with the coding region of the partail DNA sequence shown in SEQ ID No. 13.

The hybridization referred to in ii) above is intended to indicate that the analogous DNA sequence hybridizes to the same

25 probe as the DNA sequence, comprising the partial sequence shown in SEQ ID NO. 13, encoding the CGTase of the invention under certain specified conditions, which are described in detail in the Materials and Methods section hereinafter.

Normally, an analogous DNA sequence is highly homologous to

30 the DNA sequence such as at least 70% homologous to the above defined DNA sequence comprising the partial sequence shown in SEQ ID NO. 13, such as at least 80%, at least 85%, at least 90%, at least 95% or even at least 99% homologous to the defined DNA sequence comprising the partial sequence shown in SEQ ID No. 13.

35 The degree of homology referred to in iii) above is determined as the degree of identity between two sequences indicating a derivation of the first sequence from the second. The homology may suitably be determined by means of computer programs known in the art. Typically, the polypeptide encoded by an analogous DNA sequence exhibits a degree of homology of at least 70%, such as at least 80%, 85%, 90%, 95%, 99% with the enzyme encoded by the above defined DNA construct comprising a DNA sequence comprising the partial DNA sequence shown in SEQ ID No. 13. The immunological reactivity may be determined by the method described in the Materials and Methods section below.

Expression vector

The DNA sequence defined above comprising the partial DNA sequence shown in SEQ ID No. 13 may subsequently be inserted into a recombinant expression vector. This may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.

In the vector, the DNA sequence encoding the CGTase of the invention should be operably connected to a suitable promoter and terminator sequence. The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell.

It is preferred to use a vector under control of the promoter for the maltogenic α-l,4-amylase from Bacilluε lichiniformiε and/or the signal of Bacilluε lichiniformiε .

The procedures used to ligate the DNA sequences coding for the enzyme/protein, the promoter, and the terminator, respectively, and to insert them into suitable vectors are well known to persons skilled in the art (cf . , for instance, Sambrook et al., (1989), Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, NY) .

Host cells Host cells, which can be transformed with the DNA sequence encoding the CGTase of the invention, may be either eukaryotic or prokaryotic.

Suitable prokaryotic host cells are bacterial cells. Examples of such bacterial host cells which, on cultivation, are capable of producing the novel enzyme of the invention are grampositive bacteria such as strains of Bacilluε , such as strains of B . εubtiliε , B . licheniformiε , B . lentuε , B . breviε , B . εtearothermophiluε , B . alkalophiluε , B . amyloliquefacienε , B . coagulan , B . circulanε , B . lautuε, B . megaterium or B . thuringienεi , or strains of Streptomyceε , such as S . lividanε or S . murinuε , or gramnegative bacteria such as Eεcherichia coli . The transformation of the bacteria may be effected by protoplast transformation or by using competent cells in a manner known per se (cf. Sambrook et al.,(1989), supra).

When expressing the CGTase in bacteria such as E. coli , the polypeptide may be retained in the cytoplasm, typically as insoluble granules (known as inclusion bodies) , or may be directed to the periplasmic space by a bacterial secretion sequence. In the former case, the cells are lysed and the granules are recovered and denatured after which the polypeptide is refolded by diluting the denaturing agent. In the latter case, the polypeptide may be recovered from the periplasmic space by disrupting the cells, e.g. by sonication or osmotic shock, to release the contents of the periplasmic space and recovering the polypeptide.

Suitable eukaryotic cells are, in particular fungal cells, such as a yeast or filamentous fungal cells.

Examples of suitable yeasts cells include cells of Saccharomyceε spp. , in particular strains of Saccharomyceε cereviεiae, Saccharomyceε kluyveri , Sacchromyceε uvarum, or Schizoεaccharomyceε spp., such as Schizoεaccharomyceε pombe . Methods for transforming yeast cells with heterologous DNA and producing heterologous polypeptides there from are described, e.g. in US 4,599,311, US 4,931,373, US 4,870,008, 5,037,743, and US 4,845,075, all of which are hereby incorporated by reference. Transformed cells are selected by a phenotype determined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient, e.g. leucine. A preferred vector for use in yeast is the POT1 vector disclosed in

US 4,931,373. The DNA sequence encoding the polypeptide of the

. invention may be preceded by a signal sequence and optionally a leader sequence , e.g. as described above. Further examples of

5 suitable yeast cells are strains of Kluyveromyceε spp. , such as K. lactiε , or Hanεenula spp., e.g. H. polymorpha , or Pichia spp., e.g. P. pastor is , Yarrowia spp., such as Yarrowia lipolytica (cf. Gleeson et al. , (1986), J. Gen. Microbiol. 132, p. 3459-3465; US 4,882,279) .

10 Examples of other fungal cells are cells of filamentous fungi, e.g. Aεpergilluε spp., Neurospora spp., Fuεarium spp. or Trichoderma spp., in particular strains of A . oryzae , A. nidulanε or A. niger. The use of Aεpergillus spp. for the expression of proteins is described in, e.g., EP 272 277, EP 238 023 and EP 184

15 438. The transformation of F. oxyεporum may, for instance, be carried out as described by Malardier et al., (1989), Gene 78, p. 147-156.

When a filamentous fungus is used as the host cell, it may be transformed with the DNA construct of the invention, conveniently

20 by integrating the DNA construct in the host chromosome to obtain a recombinant host cell. This integration is generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the cell. Integration of the DNA constructs into the host chromosome may be performed according to conven-

25 tional methods, e.g. by homologous or heterologous recombination.

Recombinant or heterologous expression of the CGTase of the invention

In a yet another aspect, the present invention relates to a

30 method of producing the CGTase of the invention, wherein a suitable host cell transformed with a DNA sequence encoding the CGTase is cultured under conditions permitting the production of the CGTase, and the resulting CGTase is recovered from the culture.

35 The medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection) .

The expressed CGTase produced by the cells may then be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium sulphate, purification by a variety of chromatographic procedures, e.g. ion exchange chromatography, gelfiltration chromatography, affinity chromatography, or the like, dependent on the type of polypeptide in question.

Recombinantly expressed CGTase

In a still further aspect, the invention relates to a CGTase, which a) is encoded by a DNA construct of the invention, b) produced by the method of the invention, and/or c) is immunologically reactive with an antibody raised against a purified CGTase encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 13 derived from T. bogoriae DMS No. 9380.

Enzyme compositions

In a still further aspect, the present invention relates to an enzyme composition, which comprises an homologously or heterologously expressed CGTase as described above.

The enzyme composition may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition. For instance, the enzyme composition may be in the form of a granulate or a microgranulate (US 4106991, US

5324649) . The enzyme to be included in the composition may be stabilized in accordance with methods known in the art.

Examples are given below of preferred uses of the enzyme composition of the invention. The dosage of the enzyme composi- tion of the invention and other conditions under which the composition is used may be determined on the basis of methods known in the art. The enzyme and/or the enzyme composition according to the invention may be useful for at least one of the following purposes.

Industrial Applications of the CGTase of the present invention

The CGTase of the invention find application in processes for the manufacture of cyclodextrins for various industrial applications, particularly in the food, cosmetic, chemical, agrochemical and pharmaceutical industries. Therefore, in another aspect, the invention relates to the use, of a CGTase of the invention, in a process for the manufacture of cyclodextrins, in particular α-cyclodextrins.

The CGTase of the invention may also be used in a process for the manufacture of linear oligosaccharides, in particular linear oligosaccharides of 2 to 12 glucose units, preferably linear oligosaccharides of 2 to 9 glucose units.

In yet another preferred embodiment, the CGTase of the invention may be used for in situ generation of cyclodextrins. In this way the CGTase of the invention may be added to a substrate containing medium in which the enzyme is capable of forming the desired cyclodextrins. This application is particularly well suited for being implemented in methods of producing baked products, in methods for stabilizing chemical products during their manufacture, and in detergent compositions. Certain cyclodextrins are known to improve the quality of baked products. The CGTase of the invention therefore also may be used for implementation into bread-improving additives, e.g. dough compositions, dough additives, dough conditioners, pre- mixes, and similar preparations conventionally used for adding to the flour and/or the dough during processes for making bread or other baked products.

Therefore, in an aspect the invention relates to a bread- improving and/or a dough-improving composition, and further to the use of a CGTase of the invention in such compositions, and to a dough or baked product comprising a bread-improving and/or a dough-improving composition of the invention.

In the present context the terms "bread-improving composition" and "dough-improving composition" are intended to indicate compositions which, in addition to the enzyme component, may comprise other substances conventionally used in baking to improve the properties of dough and/or baked products. Examples of such components are given below. In the present context the term "improved properties" is intended to indicate any property which may be improved by the action of a CGTase enzyme. In particular, the use of CGTase results in an increased volume and an improved crumb structure and softness of the baked product, as well as an increased strength, sta- bility and reduced stickiness and thereby improved machinability of the dough. The effect on the dough has been found to be particularly good when a poor quality flour has been used. The improved machinability is of particular importance in connection with dough which is to be processed industrially. The improved properties are evaluated by comparison with dough and/or baked products prepared without addition of CGTase in accordance with the present invention.

The bread- and/or dough-improving composition of the invention may further comprise another enzyme. Examples of other en- zymes are a cellulase, a hemicellulase, a pentosanase (useful for the partial hydrolysis of pentosans which increases the extensibility of the dough) , a glucose oxidase (useful for strengthening the dough) , a lipase (useful for the modification of lipids present in the dough or dough constituents so as to soften the dough) , a peroxidase (useful for improving the dough consistency) , a protease (useful for gluten weakening, in particular when using hard wheat flour), a peptidase and/or an amylase, e.g. α-amylase (useful for providing sugars fermentable by yeast) .

In addition or as an alternative to other enzyme components, the dough-improving and/or bread-improving composition may comprise a conventionally used baking agent, e.g. one or more of the following constituents:

A milk powder (providing crust colour) , gluten (to improve the gas retention power of weak flours) , an emulsifier (to i - prove dough extensibility and to some extent the consistency of the resulting bread) , granulated fat (for dough softening and consistency of bread) , an oxidant (added to strengthen the gluten structure; e.g. ascorbic acid, potassium bromate, azodicarbona- mide, calcium peroxide, potassium iodate or ammonium persulfate) , an amino acid (e.g. cysteine) , a sugar, and salt (e.g. sodium chloride, calcium acetate, sodium sulfate or calcium sulfate serving to make the dough firmer) , flour or starch. Examples of suitable e ulsifiers are mono- and diglycerides, diacetyl tartaric acid esters of mono- and diglycerides, sugar esters of fatty acids, polyglycerol esters of fatty acids, lactic acid esters of monoglycerides, acetic acid esters of monogly- cerides, polyoxyethylene stearates, phospholipids, lecithin and lysolecithin.

In the present context the term "baked product" is intended to include any product prepared from dough or batter, either of a soft or a crisp character. Examples of baked products, whether of a white, light or dark type, which may advantageously be produced by the present invention are bread (in particular white, wholemeal, rye bread or mixtures) , typically in the form of loaves or rolls, French baguette-type bread, bagels, pita bread, tacos, tortillas, cakes, pan-cakes, pannetone, biscuits, pizza, crisp bread, steamed bread and the like. The dough of the invention may be of any of the types discussed above, and may be fresh, par-baked or frozen.

From the above disclosure it will be apparent that the dough of the invention is normally a leavened dough or batter, or a dough or batter to be subjected to leavening. The dough or batter may be leavened in various ways such as by chemical leavening agents, sour culture/dough, and/or yeast, but it is preferred to leaven the dough by adding a suitable yeast culture such as a culture of Saccharomyceε cereviεiae (baker's yeast) . Any of the commercially available S . cereviciae strains may be employed. It is further contemplated that the invention may be advantageously used for the preparation of pasta dough, preferably prepared from durum flour or a flour of comparable quality. The dough may be prepared by use of conventional techniques and the CGTase used in a manner similar to that described above. It is believed that when used in the preparation of pasta the CGTase results in a strengthening of the gluten structure and thus a reduction in the dough stickiness and an increased dough strength.

Cyclodextrins have an inclusion ability useful for stabilization, solubilization, etc. Thus cyclodextrins can make oxidizing and photolytic substances stable, volatile substances non-volatile, poorly-soluble substances soluble, and odoriferous substances odorless, etc. and thus are useful to encapsulate perfumes, vitamins, dyes, pharmaceuticals, pesticides and fungicides. Cyclodextrins are also capable of binding lipophilic substances such as cholesterol, to remove them from egg yolk, butter, etc.

Cyclodextrins also find utilization in products and processes relating to plastics and rubber, where they have been used for different purposes in plastic laminates, films, membranes, etc.

Also cyclodextrins have been used for the manufacture of biodegradable plastics.

The invention is described in further detail in the following examples which are not in any way intended to limit the scope of the invention as claimed.

MATERIALS AND METHODS

Deposited organisms: Thermoalcalibacter bogoriae DSM No. 9380 comprising the CGTase of the invention.

Electrophoresis and molecular mass determination: According to Laemmli (Laemmli et al.) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was carried out with 11.5% polyacrylamide gels in a Mini Protean II electrophoresis system (Bio-Rad) at constant current of 24 mA and voltage high. Proteins were silver stained according to Blum et al (Blum et al) . In order to determine the molecular weight, a broad range molecular weight protein mixture (Bio-Rad) was used as standard.

Activity staining of amylolytic enzyme activity in SDS-PAGE: Prior to activity staining, the SDS gel was incubated for 30 in in a 2.5% Triton X-100 solution in order to remove SDS . Amylolytic protein bands were detected by incubating the gel for 10 min at 65°C in 100 mM sodium phosphate buffer pH 8.0 for CGTase, supplemented with 0.5% soluble starch (Merck) . Protein bands with amylolytic activity were visualized by staining the gel with a KJ-J₂ solution (3 g KJ, 2 g J₂ per liter aqua dest.), resulting in white activity bands within a brownish background. Amylolytic assay: The enzyme assay routinely used was carried out with enzyme solution using the respective prepurified enzyme and substrate solutions at 0.5% soluble starch (Merck, Darmstadt,

5 Germany) or 0.2% amylose or 0.2% amylopectine (each wt/vol) in 100 mM sodium phosphate buffer pH 9.0 to give a final volume of 0.1 ml. Incubation was done for 30 min at 65°C if not stated otherwise. The amount of reducing sugars was estimated using the So ogyi-Nelson method (Somogyi, M. J. Biol. Chem. (1945) 160:61-

10 68; Nelson, N. J. Biol. Chem. (1944) 153:375-380), enzyme activity was calculated using a standard calibartion curve with 0-1% (wt/vol) maltose. One unit (U) of amylolytic activity was defined as the amount of 1 μmol reducing sugars liberated by the enzyme per minute under standard conditions (pH 9.0; 65 °C) . 15

CGTase (cyclodextrine glycosyltransferase) assay: For determination of CGTase activity a specific assay for production of β-CD was used (Vikmon, 1982), measuring the cyclization activity. Enzyme solution containing the prepurified CGTase was 20 used with substrate solutions containing 0.5% starch (Merck) or 0.2% amylose or 0.2% amylopectine (each wt/vol) in 100 mM sodium phosphate buffer pH 8.0 to give a final assay volume of 0.1 ml.

Incubation was done for 30 min at 65°C β-CD was detected due to its ability to from a stable colorless inclusion complex with the

25 usually purple phenolphtalein. The decrease of the purple colour is proportional to the production of β-CD due to CGTase activity.

One unit (U) of CGTase activity catalyzes the formation of 1 μmol β-CD per minute under standard conditions (65°C, pH 8.0). Derived from HPLC analysis, also reducing sugars were detected as 30 products of CGTase action (see below) . Thus, CGTase hydrolysis activity could be elucidated from the amount of reducing sugars.

Protein determination: Protein concentrations were determined by the Lowry method. Microassays were performed and bovine serum 35 albumine was used as standard protein. Effect of pH and temperature: To study the influence of pH and temperature on amylase and CGTase activity, the prepurified enzyme solution was used. 10ml of the enzyme solution were mixed with 90 ml of a 0.5% (wt/vol) substrate solution (soluble starch; Merck) in 120 mM universal buffer (Britton & Robinsson) with pH 4.0 to 11.0. The changes in pH due to the mixture of the enzyme solution and substrate solution were measured. After a preincubation for 30 minutes of this mixture on ice, the enzyme assay was performed at 65°C for 30 minutes. The developed reducing sugars were plotted against the respective pH value.

The influence of temperature on amylase and CGTase activity was studied using the prepurified enzyme. 10 ml enzyme solution were mixed with 90 ml of a 0.5% substrate solution (soluble starch; Merck) in 100 mM sodium phosphate buffer at its optimal pH 9.0 or pH 8.0, respectivelly. Incubation was done for 30 minutes at temperature between 30°C and 80°C To test the temperature stability, enzyme solution in screw-cap Eppendorf tubes was incubated at 60°, 70°C and 80°C for up to 21 h and samples were withdrawn at certain time intervals and were used to test for residual amylase or CGTase activity.

Substrate specificity: In order to determine the substrate specificity of the α-amylase or CGTase, the enzyme was incubated with substrate solution (each wt/vol) containing soluble starch (Merck) (0.5%), amylopectin (0.2%), amylose (0.2%), pullulan (0.2%), maltotriose, maltotetraose and maltopentose (each 0.1%). The assay was incubated for 30 min under standard conditions (65°C, pH 8.0). The enzyme activity was determined by measuring the amount of cyclodextrins produced by the enzymes action.

Analysis of hydrolysis products: The hydrolysis pattern of amylase and CGTase action on different substrates were analyzed by high-performance liquid chromatography (HPLC) (Knauer GmbH, Berlin, Germany) with an Aminex-HPX-42 A column (300 by 7.8 mm; Bio-Rad, Hercules, Calif.). One part of the prepurified respective enzyme was incubated together with 9 parts of substrate solution pH 8.0, at 65°C for up to 16 hours. After incubation the samples were kept frozen at -20°C until they were analyzed. As substrate solution we utilized soluble starch (0.5%), pullulan (0.5%), amylose (0.2%), amylopectine (0.2%), maltooligosaccharides DPI to DP5 (DP=degree of polymerization) , cyclodextrine mixture (0.1%) and the pure cyclodextrins (α,β, γ) each wt/vol in 100 mM sodium phosphate buffer pH 9.0 or pH 8.0, for amylase or CGTase, respectivelly.

For the destinction between γ-CD and DP2 due to their same retention time, an assay as followed was performed. Soluble starch (0.5% wt/vol) as substrate was incubated with CGTase at standard conditions (pH 8.0; 65°C) for 60 min and subsequently cooked at 100°C for 5 min. The assay was cooled down and incubated with 0.125 U of yeast α-glucosidase (Boehringer, Mannheim, Germany) for 30 min at 25°C in order to degrade maltose and maltotriose to glucose. The reminder detection signal at ^"30 min retention time was now only γ-CD and the ratio between the CDs could be determined correctly.

Chemicals. Pullulan cyclodextrins and maltooligosaccharides were obtained from Sigma (St. Louis, Mo.). Chemicals for electrophoresis were purchased by Serva (Heidelberg, Germany) . Other chemicals were obtained from Merck (Darmstadt, Germany) .

Southern blot hybridization analysis conditions

Hybridization of Southern blots on nylon filters (Hybond-N, Amersham) with ³²P-labelled PCR probe is carried out following methods described by Sambrook et al., (1989), supra. The membrane is placed in a plastic bag and pre-hybridized in 50% (v/v) formamide, 6xSSC, 0.05xBLOTTO, 1 mM EDTA at 42 °C for 1-2 hours. Then the membrane is hybridized with the radiolabelled and denaturated DNA probe in 50% (v/v) formamide, 6xSSC, 0.5% (w/v) SDS, 1 mM EDTA at 42°C (which corresponds to a temperature of 68°C without formamide in the hybridization solution) , overnight. After hybridization, the membrane is washed first in 2xSSC, 0.5% (w/v) SDS and then with O.lxSSC, 0.5% (w/v) SDS at 50°C. Then, the membrane is wrapped in Saran Wrap and exposed to X-ray Film at -70° for the requested period of time.

Immunological cross-reactivity: Antibodies to be used in determining immunological cross-reactivity may be prepared by use of a purified CGTase. More specifically, antiserum against the CGTase of the invention may be raised by immunizing rabbits (or other rodents) according to the procedure described by N. Axelsen et al. in: A Manual of Quantitative Immunoelectrophoresis, Blackwell Scientific Publications, 1973, Chapter 23, or A. Johnstone and R. Thorpe, Immunochemistry in Practice, Blackwell Scientific Publications, 1982 (more specifically p. 27-31) . Purified immunoglobulins may be obtained from the antisera, for example by salt precipitation ((NH_ι)₂ SO₄) , followed by dialysis and ion exchange chromatography, e.g. on DEAE-Sephadex. Immunochemical characterization of proteins may be done either by Outcherlony double-diffusion analysis (O. Ouchterlony in: Handbook of Experimental Immunology, (D.M. Weir, Ed.), Blackwell Scientific Publications, (1967) , p. 655-706) , by crossed immunoelectrophoresis (N. Axelsen et al., supra, Chapters 3 and 4), or by rocket immunoelectrophoresis (N. Axelsen et al., Chapter 2) .

EXAMPLE 1

Thermoalcalibacter bogoriae DSM No. 9380 comprises the CGTase of the invention was cultivated under anaerobic conditions in the following medium: (NH₄)₂Sθ₄, 1.0; NH C1, 0.4; Na₂S₂0₄, 0.1; K₂HP0 , 0.5; MgS0₄, 0.1; CaCl₂, 0.05; NaCl, 10.0; Trypton, 0.25; yeast extract, 0.25; FeCl₃, 0.01; Resazurin, 0.001; NaHC0₃, 2.2; Na₂C0₃, 2.2; Cystein, 0.5, Starch, 5.0 , all concentrations in grams per litre. Trace element solution 141, 10 ml/1, vitamine solution 141, 10 ml both solutions prepared as described in the DSM Catalogue of Strains 1993. Large scale cultivation was done in a 19 liter fermentor (Bioengineering, Wald, Switzerland) under pH regulation at pH 9.0 and 50°C, the culture was stirred at 300 rpm and flushed with N₂ at 10 liters/hour. Inoculation of the fermentor was done with one liter of a preculture, grown for 8 hours at 50°C in a 2 liter flask without shaking.

Purification of amylolytic enzymes. All purification steps were conducted at room temperature unless otherwise stated. After cultivation in a 19 liter fermentor for 8 hours, the culture broth consisting of 16 liter was centrifuged in a continuous flow centrifuge rotor (Heraeus, Osterode, Germany) at 41°C and 12,000 rpm until the cells were separated from the culture supernatant. The culture supernatant was subsequently concentrated to give a final volume of 1 liter by cross flow filtration using a 10 kD filter (Filtron) . Further concentration was performed with an Amicon filtration chamber using a 10 kD filter (Amicon) . In order to remove disturbing amounts of H₂S and to change the buffer, the concentrated supernatant was applied to a PD-10 ion exchange column (Pharmacia) and eluated with 100 mM sodium phosphate buffer pH 9.0. The eluate containing amylolytic activity was collected and concentrated 10-fold in an Amicon chamber (10 kD filter Amicon) . Samples of this solution were applied to a Q- Sepharose anion exchange chromatography column (15 x 2.5 cm) (Pharmacia) preequilibrated with 100 mM sodium phosphate buffer pH 9.0. The column was washed with 90 ml of equilibrating buffer. The enzyme solution was eluated with equilibration buffer containing 1 M NaCl, using a gradient of NaCl from 0 to 300 mM and 300 to 500 mM at a flow rate of 0.2 ml/min. Fractions were collected (2 ml per tube) and their amylolytic activity was determined as above in the "Materials and Methods" section above. The active fractions were collected, assembled and subsequently 10-fold concentrated in a Amicon chamber. Samples of this prepurified amylase were added to a Superose 75 gel filtration column (Pharmacia) preequilibrated with 50 mM sodium phosphate buffer pH 9.0. The enzyme was eluated with the equilibration buffer at a flow rate of 0.1 ml/min. The fractions were collected (1 ml/tube) and the active fractions were pooled and subsequently concentrated in an Amicon chamber with a 10 kDa membrane.

Purification/Separation of CGTase

The specific activity of the amylase/CGTase in a 70-fold concentrated culture supernatant after cultivation was determined to 0.096 U/mg. Due to the production of H₂S during fermentation, as previously described, a purification using a PD-10 ion exchange column was necessary in order to remove H₂S, sulfides and other activity disturbing agents. After this treatment, the amount of detectable activity was raised to 0.48 U/mg. This effect was regardless to the used method for detection of reducing sugars (data not shown) . The concentrated culture supernatant revealed three activity bands in an SDS-PAGE electrophoresis gel (Figure 1, lane 2) by activity staining. The lowest activity band with an apparent molecular weight of 57 ± 3 kDa was shown to exhibit α-amylase activity. Samples of the 10- fold concentrated PD-10 eluate were applied to a Q-Sepharose anion exchange chromatography column (Pharmacia, Sweden; 25 x 200 mm) and the column was run at 1.0 ml/min with the equilibration buffer (100 mM sodium phosphate pH 8.0) using the Bio-Rad Econo System. A 10-fold concentrated sample of this amylase containing pool (Figure 1, lane 3) was applied to a Superdex 75 gel filtration column (Pharmacia, Sweden; 15 x 300 mm) and eluated with a 100 mM sodium phosphate buffer pH 8.0 at a flow rate of 0.1 ml/min using the Bio-Rad Econo System. The CGTase activity could be eluated at NaCl concentrations around 400 mM and the fractions containing the active enzyme were combined and subsequently 10-fold concentrated in an Amicon filtration chamber with a 10 kDa exclusion volume membrane. This prepurified CGTase solution, containing 2443 U/mg cyclization activity, was used for further characterization of the enzyme. The mobility of the silver stained single protein band coincided with that of the active amylase band determined by activity staining (Figure 1, lane 6 and 7) .

EXAMPLE 2

Characterization of the CGTase:

Molecular mass determination. The molecular mass of the CGTase was determined by activity stained SDS-PAGE gel and revealed to be 67 ± 2 kDa (Figure 1, lane 6+7) .

Effect of pH and temperature on CGTase activity. The prepurified CGTase exhibited different results for the pH optimum, when reducing sugars (hydrolysis activity) or cyclodextrin production (cyclization activity) , respectivelly, were tested using starch as substrate. After incubation under the standard assay conditions (65°C, pH 8.0, 30 min), the data derived for hydrolysis activity displayed a destinct pH optimum at pH 8.0 (Figure 2) . More than 40% residual activity could be detected within a pH range between pH 6.0 and pH 9.2. If data for cyclization activity of CGTase were plotted against the respective pH value, a broad range for activity was displayed (Figure 2) . The production of CDs was shown to occur between pH 4.0 and pH 10.0. Almost the same maximal level of CD production by CGTase activity was observed between pH 5 and 7, and still high yields of CDs were produced at high pH values. The temperature optimum of the CGTase was 65°C, measured at pH 8.0 and within 60 min incubation (Figure 3). 50% of residual activity were measured at 50°C and 75°C, respectivelly, displaying a broad temperature range of activity for CGTase. At its optimal temperature, 65°C, the enzyme is stable for more than 2 hours, but gets inactivated at 70°C within one hour (data not shown) . Analysis of hydrolysis products. In order to determine the hydrolysis products of prepurified CGTase activity, the enzyme was incubated with various substrates at 65°C and pH 8.0 for up to 16 h. The substrate specificity was determined qualitativelly measuring the cyclization activity and the ratio between the produced CDs was elucidated from a quantitative HPLC analysis. Both starch (Merck) and amylopectine (Figure 4) were hydrolyzed well by the CGTase of the present invention. When starch was hydrolyzed by CGTase action, already after 20 min incubation time α-CD was detected as major product, as well as after 120 min incubation (Figure 4 A) ; the same effect could be observed with amylopectin after 120 min incubation (Figure 4 B) . An incubation time of 16 hours lead to another ratio between the CD-oligomerε, which is documented by the HPLC analysis (Figure 4, B) as well as by Figure 5, pointing out the differences in the CD-ratio due to the incubation time. The predominant hydrolysis product in every assay after 2 hours incubation was α-CD, whereas after prolonged incubation time α-CD and β-CD were the major hydrolysis products, both being produced in the approximate same ratio. γ-CD was only produced in very low amounts.

EXAMPLE 3

Sequencing a partial CGTase sequence of T. bogoriae DMS No. 9380 In order to prepare a PCR product of the T. bogoriae DSM No. 9380 CGTase a number of known CGTases available from the SWISS PROT batabase were aligned to identify CGTase conserved regions. On the basis of identified conserved regions (see be- low) having a suitable distance inbetween each other 3 primers (Primer 1-3 below) were designed directed to the sequence encoding the concersed regions.

PI was designed from the knowledge to the identifyed conserved region: TDVIYQI (SEQ ID No. 1) . PI is an N-terminal primer. PI was designed to cover some differences in the CGTase sequence. This was done by incorporating either deoxy-inosine or degenerated bases. PI is read down-stream relative to the protein sequence.

P2 was designed from the knowledge to the identifyed con- served region: RWINNDV (SEQ ID NO. 2) . P2 is read up-strearns relative to the protein sequence. Also the P2 primer was degenerated to cover some degree of sequence diversity.

P3 was designed from the knowledge to the identifyed conserved region: TSYHGYWA (SEQ ID NO. 3) . P3 is like PI read down-stream relative to the protein sequence.

After the first round of sequencing 3 further primers named P4-P6 was designed on the basis of primes P1-P3. PI 5 'ACNGAYGTGATITAYCARAT ^» 3 (SEQ ID NO. 4) P2 5 'ACRTCRTTRTTDATCCANCG ' 3 (SEQ ID NO. 5) P3 5 • CATCNTAYCAYGGNTAYTGGGC ' 3 (SEQ ID NO. 6)

P4 5 ' CTTTATTCTGAGGACGGGGCTGATTTGC • 3 (SEQ ID NO. 7) P5 5 ' GTTCTCTAAAATCATTTACATCCCC ' 3 (SEQ ID NO. 8) P6 5 • GCATTTTTACTAACATCAAGGGG • 3 (SEQ ID NO. 9) D = A, G or T; R = A or G; Y = T or C; N = A, C , T or G; I = deoxyinosine

PCR was carried out on genomic DNA from Thermoalcalibacter bogoriae purified as described in Example 4 (below) by using either the primer set Pi and P2 or the primer set P2 and P3. Ampli-Taq DNA polymerase (Perkin Elmer inc.) was used under buffer conditions according to the manufactures instructions. 2 minutes of denaturation at 94°C, 5 cycles with an annealing temperature at 35°C and 2 minutes elongation time was followed by 25 cycles with an annealing temperature at 50°C and 2 minutes elongation.

Using the P1-P2 primer set one PCR band of 1.2 kb was obtained, whereas one PCR band of 0.9 kb was obtained by using the P2-P3 primers. This is in accordance with the expected sizes for CGTases.

Sequencing of the PCR product was carried out by cycle- sequencing using dye-terminator mix (Perkin-El er, USA) and automatic sequencing by using the primers P1-P6. This way 1.15 kb DNA sequence between the PI and P2 primers was determined. SEQ ID NO. 10 shows the DNA sequence obtained from sequencing a PCR fragment of the internal of the Thermoalcalibacter bogoriae CGTase.

Further determination of the esequence was carried out by inverse PCR as described in Example 4.

EXAMPLE 4

Further CGTAse sequencing

In Example 3 the DNA sequence of a 1.15 kb fragment PCR ampli- fied from the T . bogoriae DSM No. 9380 CGTase encoding gene was determined. This sequence was used as the starting point for the determination of a further part of the CGTase gene sequence by an inverse PCR approach. Thus, the following two oligonu- cleotide primers, corresponding to a region near each end of the sequenced 1.15 kb DNA sequence, and reading away from each other, were prepared:

Primer 101304:

5 ' -TCGTAAGCCTATGTCGTC-3 ' ( SEQ ID NO . 11 )

Primer 101305:

5 • -ACCTCTCCAATCTCCACC-3 ' (SEQ ID No. 12)

Chromosomal DNA was extracted from Thermoalcalibacter bogoriae cells (lysozyme treatment/phenol extractions) . In a first attempt, this DNA was digested with restriction enzyme Pstl, ligated after phenol extraction, and a portion of this sample subsequently digested with Bglll. This material was used as template in a PCR amplification with primer 101304 and Primer 101305 (annealing temperature 49°C) . No amplification products were observed.

The ligation mixture was subsequently digested with en- zymes Pstl + BamHI + EcoRI + Hindlll + Nsil + Sail, and this digested sample ligated. After ligation, a Bglll digestion was performed. This material was used as template in the PCR reaction. This time, fragments of 1 kb, 1.4 kb and 2 kb was obtained. These fragments were gel purified and used as templates in new PCR reactions. Again, 1 kb and 1.4 kb fragments were obtained. These fragments were gel purified, and DNA sequenced, using the same primers for sequencing as was used for PCR amplification.

The DNA sequence of the 1 kb fragment revealed this frag- ment to be derived from the CGTase gene, and the sequence obtained could be used to extend the sequence determined in Example 3.

The total DNA sequence determined, together with its translation into amino acid sequence, is given in SEQ ID NO: 13 and 14.

The deduced amino acid sequence, SEQ ID No. 14, was compared to database sequences using the BLASTP and FASTA programs from the GCG version 9 program package. The same three sequences were identified as highest scoring, using either pro- gram.

These are

SW:AMY_THETU ! P26827 (Thermoanaerobacter thermoεulfurogeneε ) SW:CDGT_BACST ! P31797 (Bacilluε εtearother ophiluε) SW:CDGT_BACOH ! P27036 (Bacilluε ohbenεiε) The homology between SEQ ID 14 and these sequences was determined using the program gap in the GCG program package, version 8. The figures given below are percent identity.

The DNA sequence, SEQ ID 13, was compared to database sequences using the BLASTN and FASTA programs from the GCG version 9 program package. The three highest scoring sequences in either search was found between the following four sequences: GB_BA:TTPULSA ! M57692 (Thermoanaerobacterium thermosulfuro- genes)

GB_BA:BSCGT5 ! X59043 (Bacillus stearothermophilus) GB_BA:BSCGT232 ! X59044 (Bacillus stearothermophilus) GB_BA:BSCGT1 ! X59042 (Bacillus stearothermophilus)

The homology between SEQ ID 13 and these sequences was determined using the program gap in the GCG program package, version 8. The figures given below are percent identity.

From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims. References.

Bender, H.. 1991. Branched saccharides formed by the action of His-modified cyclodextrin glycosyltransferase from Klebεiella pneumoniae M 5 al on starch. Carbohydr Res 222:239-244.

Binder, F., 0. Huber, and A. Bock. 1986. Cyclodextrin- glycosyltransferase from Klebεiella pneumoniae M5al: cloning, nucleotide sequence, and expression. Gene 47:269-277. Boyer, E. W., M. B. ingle, and G. D. Mercer. 1973. Bacillus alcalophiluε subsp. haloduranε subsp. nov. : an alkaline-amylase- producing, alkalophilic organism. Int J Syst Bacteriol 23:238- 242.

Canganella, F., C. M. Andrade, and G. Antranikian. 1994. Characterization of amylolytic and pullulytic enzymes from thermophilic archaea and from a new Fervidobacterium species. Appl Microbiol Biotechnol 42:239-245.

Galvin, N. M. , C. T. Kelly, and W. M. Fogarty. 1994. Purification and properties of the cyclodextrinase of Bacilluε εphaericuε ATCC 7055. Appl Microbiol Biotechnol 42:46-50. Grant, W. D., W. E. Mwatha, and B. E. Jones. 1990. Alkaliphiles: ecology, diversity and applications. FEMS Microb Rev 75:255-270. Grant, W. D., and K. Horikoshi. 1992. Alkaliphiles: ecology and biotechnological applications. In R. A. Herbert and R. J. Sharp (ed.), Molecular biology and biotechnology of extremophiles. Blackie & Son, Glasgow.

Hayashi, T., T. Akiba, and K. Horokoshi. 1988. Production and purification of new maltohexaose-froming amylases from alkalophilic Bacilluε sp. H-167. Agric Biol Chem 52:443-448. Hofmann, B. E., H. Bender, and G. E. Schulze. 1989. Three- dimensional structure of cyclodextrin glycosyltransferase from Bacilluε circulanε at 3.4 A resolution. J Mol Biol 209: 793-800. Horikoshi, K.. 1991. General view of alkaliphiles and thermophiles, p. 3-14. In K. Horikoshi and W. D. Grant (ed.), Superbugs: Microorganisms in extreme environments. Springer Verlag, Berlin.

Kambourova, M. S., and E. I. Emanuilova. 1992. Purification and general biochemical properties of thermostable pullulanase from B. εtaerothermophiluε G-82. Appl Biochem Biotechnol 33:193-203. Kanai, H., T. Kobayashi, R. Aono, and T. Kudo. 1995.

Natronococcus amylolyticuε sp. nov. , a haloalkaliphilic archaeon.

Int J Syst Bacteriol 45:762-766.

Keller, M., F.-J. Braun, R. Dir eier, D. Hafenbradl, S. Burggraf, 5 R. Rachel, and K.-O. Stetter. 1995. Thermococcuε alcaliphiluε sp. nov., a new hyperthermophilic archaeum growing on polysulfide at alkaline pH. Arch Microbiol 164:390-395. Kelly, C. T., M. SA. McTigue, E. M. Doyle, and w. M. Fogarty.

1995. The raw starch-degrading alkaline amylase of Bacilluε sp. 10 IMD 370. J Ind Microbiol 15:446-448.

Kim, T.-J., B.-C. Kim, and H.-S. Lee. Production of cyclodexttrins using moderately heat-treated cornstarch. Enzyme

Microb Technol 17:1057-1061.

Kim, T. U., B. G. Gu, J. Y. Jeong, S. M. Byun, and Y. C. shin. 15 1995. Purification and characterization of a maltotetraose- froming alkaline a-amylase from an alkalophilic Bacilluε strain,

GM8901. Appl Environ Microbiol 61:3105-3112.

Koch, R., A. Spreinat, K. Le ke, and G. Antranikian. 1991.

Purification and ptoperties of a hyperther oactive a-amylase from 20 the archaeobacterium Pyrococcuε woeεei . Arch Microbiol 155:572-

578.

Lee, J.-H., K.-H. Choi, J.-Y. Choi, Y.-S. Lee, I.-B. Kwon, and

J.-H. Yu. 1992. Enzymatic production of a-cyclodextrin with the cyclomaltodextrin gluconotransferase of Klebεiella oxytoca 19-1. 25 Enzyme Microb Technol 14:1017-1020.

Leuschner, C, and G. Antranikian. 1995. Heat-stable enzymes from extremely thermophilic and hyperthermophilic microorganisms.

World J Microb Biotechnol 11:95-114.

Li, Y., L. Mandelco, and J. Wiegel. 1993. Isolation and 30 characterization of a moderately thermophilic anaerobic alkaliphile, Clostridium paradoxum sp. nov.. Int J Syst Bacteriol

43:450-460.

Li, Y., M. Engle, N. Weiss, L. Mandelco, and J. Wiegel. 1994.

Clostridium thermoalcaliphilum sp. nov. , an anaerobic and 35 thermotolerant facultative alkaliphile. Int J Syst Bacteriol

44:111-118.

Lin, J.-M., T. Nakagama, H. Okazawa, X.-Z. Wu, and T. Hobo. 1996.

Separation and determination of some stereoisomers by capillary gel electrophoresis with cyclodextrin incorporated in polyacrylamide gel. Fresenius J Anal Chem 354:451-454.

Luong, J. H. T., R. S. Brown, K. B. Male, M. V. Cattaneo, and S.

Zhao. 1995. Enzyme reactions in the presence of cyclodextrins: biosensors and enzyme assays. Tibtech 13:457-463.

McTigue, M. A., C. T. Kelly, E. M. Doyle, and W. M. Fogarty.

1995. The alkaline amylase of the alkalophilic Bacillus sp. IMD

370. Enzyme Microb Technol 17:570-573.

Nakamura, N., N. Sashihara, H. Nagayama, and K. Horikoshi. 1989. Characterization of pullulanase and a-amylase activities of a

Thermus sp. AMD33. Starch 41:112-117.

Nόgrady, N. I. Pόcsi and A. Szentirmai. 1995. Cyclodextrin glycosyltransferase may be the only starch-degrading enzyme in

Bacilluε maceranε . Biotechnol Appl. Biochem 21:233-243. Norman, B. E. and S. T. Jørgensen. 1992. Thermoanaerobacter sp.

CGTase: its properties and application. Denpun Kagaku 39:101-108.

Pedersen, S., B. F. Jensen, L. Dijkhuizen, S. T. Jørgensen, B. W.

Dijkstra. 1995. A better enzyme for cyclodextrins. Chemtech

December 1995. Pongsawasdi, P., and M. Yagisawa. 1988. Purification and some properties of cyclodextrin glucanotransferase from Bacilluε circulanε . Agric Biol Chem 52:1099-1103.

Rawyler, A, P.A. Siegenthaler. 1996. Cyclodextrins: a new tool for the controlled lipid depletion of thylakoid membranes. Biochim Biophys Acta 1278:89-97.

Rudiger, A., P. L. Jørgensen, and G. Antranikian. 1995. Isolation and characterization of a heat-stable pullulanase from the hyperthermophilic archaeon Pyrococcuε woesei after cloning and expression of its gene in Escherichia coli . Appl Environ Microbiol 61:567-575.

Sabioni, J. G. and Y. K. Park. 1992. Production and characterization of cyclodextrin glycosyltransferase from

Bacilluε lentuε . Starch 44:225-229.

Sana, B. C. and J. G. Zeikus. 1992. Cyclodextrin degrading enzymes. Starch 44:312-315.

Spreinat, A., and G. Antranikian. 1990. Purification and properties of a thermostable pullulanase from Cloεtridium thermoεulfurogeneε EMI which hydrolyses both a-1,6 and a-1,4- glycosidic linkages. Appl Microbiol Biotechnol 33:511-518. Szejtli, J.. 1982. Cyclodextrins in food, cosmetics and toiletries. Starch 34:379-385.

Vetter, D. and W. Thorn. 1992. Chain length specificity of cyclodextrin glycosyltransferase. Starch 44:229-233. Wind, R. D., W. Liebl, R. M. Buitelaar, D. Penninga, A. Spreinat, L. Dijkhuizen, and H. Bahl. 1995. Cyclodextrin formation by the thermostable a-amylase of Thermoanaerobacterium thermoεufurigeneε EMI and reclassification of the enzyme as a cyclodextrin glycosyltransferase. Appl Environ Microbiol 61: 1257-1265. Zhilina, T. N., G. A. Zavarzin, F. Rainey, V. V. Kevbrin, N. A. Kostrikina, and A. M. Lysenko. 1996. Spirochaeta alkalica sp. nov., Spirochaeta africana sp. nov., and Spirochaeta aεiεtica sp. nov. , alkaliphilic anaerobes from the continental soda lakes in Central Asia and the East African Rift. Int J Syst Bacteriol 46:305-312.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: Novo Nordisk A/S (B) STREET: Novo Alle

(C) CITY: Bagsvaerd

(E) COUNTRY: Denmark

(F) POSTAL CODE (ZIP): DK 2880

(G) TELEPHONE: +45 4444 8888 (H) TELEFAX: +45 4449 3256

(ii) TITLE OF INVENTION: An enzyme with CGTase activity (iii) NUMBER OF SEQUENCES: 14 (iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.30 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE:

(A) NAME/KEY: misc-feature

(B) OTHER INFORMATION: /desc: "Conserved region" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

Thr Asp Val lie Tyr Gin lie 1 5

(2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid ( i ) FEATURE :

(A) NAME/KEY: misc-feature

(B) OTHER INFORMATION: /desc: "Conserved region" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

Arg Trp lie Asn Asn Asp Val 1 5

(2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 8 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE:

(A) NAME/KEY: misc-feature

(B) OTHER INFORMATION: /desc: "Conserved region* (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: Thr Ser Tyr His Gly Tyr Trp Ala 1 5 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE:

(A) NAME/KEY: misc-feature

(B) OTHER INFORMATION: /desc: "Primer 1" (ix) FEATURE:

(A) NAME/KEY: misc-feature (B) ocation: 3,6,12,15,18

(C) OTHER INFORMATION: R = A or G;

Y = T or C; N = A, C, T or G;

I = deoxyinosine

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

ACNGAYGTGA TITAYCARAT 20

(2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE:

(A) NAME/KEY: misc-feature (B) OTHER INFORMATION: /desc: "Primer 2"

( ix ) FEATURE :

(A) NAME/KEY: misc-feature

(B) Location: 3,6, 9,12,18

(D) OTHER INFORMATION: D = A, G or T; R = A or G;

N = A, C, T or G (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

ACRTCRTTRT TDATCCANCG 20

(2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE:

(A) NAME/KEY: misc-feature (B) OTHER INFORMATION: /desc: "Primer 3' (ix) FEATURE:

(A) NAME/KEY: misc-feature

(B) Location: 5,8,11,14,17

(C) OTHER INFORMATION: Y = T or C; N = A, C, T or G; (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

CATCNTAYCA YGGNTAYTGG GC 22

(2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D ) TOPOLOGY : 1inear (ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE:

(A) NAME/KEY: misc-feature (B) OTHER INFORMATION: /desc: "Primer 4"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

CTTTATTCTG AGGACGGGGC TGATTTGC 28 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: other nucleic acid ( ix) FEATURE :

(A) NAME/KEY: misc-feature

(B) OTHER INFORMATION: /desc: "Primer 5" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

GTTCTCTAAA ATCATTTACA TCCCC 25

(2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE:

(A) NAME/KEY: misc-feature

(B) OTHER INFORMATION: /desc: "Primer 6" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

GCATTTTTAC TAACATCAAG GGG 23

(2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1155 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:

(B) STRAIN: Thermoalcalibacter bogoriae DSM No. 9380 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: CCACCGATGT GATGTATCAG ATTGTAACAG ATCGTTTTTT AGATGGCGAT AAATATAATA 60

ATCCAACTTG TGAAAACCTT TATTCTGAGG ACGGGGCTGA TTTGCGTAAA TATTTAGGTG 120

GAGATTGGAG AGGTATTATA CAAAAAATTG AGGATGGATA TTTACCTGAT ATGGGAATTT 180

CAGCTATTTG GATTTCTTCA CCAGTAGAAA ATATATATGC TGTTCATCCG CAATTTGGAA 240 CATCTTATCA TGGTTATTGG GCAAGGGATT TTAAAAGAAA TAATCCTTTT TTTGGGGATC 300

TAAATGATTT TAGAGAACTT ATAGCGGTTG CTAATGAACA TGATATAAAA GTAATTATTG 360

ATTTTGCACC TAATCATACT TCTCCAGCAG AAGTTAATAA TCCTAACTAT GCTGAAGATG 420

GTAATTTGTA TAATAACGGA GAATTTGTAG CTTCTTATTC TAATGATTTA AATGAAATTT 480

TTTACCATTT TGGAGGAACT GATTTTTCAA CTTATGAAGA TAGTATATAT AGAAACCTGT 540 TTGATTTAGC AGGATTAAAT TTAAATAATA ATTTTGTTGA TCAATATTTA CGTGATTCGA 600

TAAAATTTTG GTTAGATCTC GGTGTTGATG GTATTAGAGT GGATGCTGTT AAACATATGC 660

CGTTAGGATG GCAAAAATCT TTTGTGGATA CCATTTATAA TCATAAACCT GTATTTGTTT 720

TTGGTGAGTG GTATTTAGGT AAAGATGAAT ATGATCCTAA TTATTATCAT TTTGCAAATA 780

ATAGTGGTAT GAGTTTATTA GACTTTGAAT TTGCTCAAAC AACACGTAGT GTGTTTCGAA 840 ATCATGAAAA AAATATGTTT GACTTATATG ACATGCTAAA AAATACGGAA AACAACTATG 900

AACGTGTTGT AGATCAGGTA ACTTTTATTG ATAATCATGA TATGGATCGC TTTCACTATG 960

ATGGAGCAAC TAAAAGAAAT GTAGAAATTG GATTAGCATT TTTACTAACA TCAAGGGGAG 1020

TTCCAACTAT TTATTATGGT ACTGAACAAT ATTTAACAGG AAATGGTGAT CCATATAATC 1080

GTAAGCCTAT GTCGTCTTTT GATCAAAATA CAAAAGCATA TAAAATTATT CAAAAATTAG 1140 CACCTTTAAG GAAGT 1155

(2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE:

(A) NAME/KEY: misc-feature

(B) OTHER INFORMATION: /desc: "Primer 101304" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: TCGTAAGCCT ATGTCGTC 18

(2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: other nucleic acid ( ix ) FEATURE : (A) NAME/KEY: misc-feature

(B) OTHER INFORMATION: /desc: "Primer 101305' (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:

ACCTCTCCAA TCTCCACC 18

(2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1580 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:

(B) STRAIN: Thermoalcalibacter DSM No. 9380 ( ix ) FEATURE :

(A) NAME/KEY: CDS

(B) LOCATION:1..1580

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13

GAT GTG ATG TAT CAG ATT GTA ACA GAT CGT TTT TTA GAT GGC GAT AAA 48 Asp Val Met Tyr Gin lie Val Thr Asp Arg Phe Leu Asp Gly Asp Lys 1 5 10 15 TAT AAT AAT CCA ACT TGT GAA AAC CTT TAT TCT GAG GAC GGG GCT GAT 96 Tyr Asn Asn Pro Thr Cys Glu Asn Leu Tyr Ser Glu Asp Gly Ala Asp 20 25 30

TTG CGT AAA TAT TTA GGT GGA GAT TGG AGA GGT ATT ATA CAA AAA ATT 144 Leu Arg Lys Tyr Leu Gly Gly Asp Trp Arg Gly lie lie Gin Lys lie 35 40 45

GAG GAT GGA TAT TTA CCT GAT ATG GGA ATT TCA GCT ATT TGG ATT TCT 192 Glu Asp Gly Tyr Leu Pro Asp Met Gly lie Ser Ala lie Trp lie Ser 50 55 60

TCA CCA GTA GAA AAT ATA TAT GCT GTT CAT CCG CAA TTT GGA ACA TCT 240

Ser Pro Val Glu Asn lie Tyr Ala Val His Pro Gin Phe Gly Thr Ser 65 70 75 80

TAT CAT GGT TAT TGG GCA AGG GAT TTT AAA AGA AAT AAT CCT TTT TTT 288

Tyr His Gly Tyr Trp Ala Arg Asp Phe Lys Arg Asn Asn Pro Phe Phe 85 90 95 GGG GAT CTA AAT GAT TTT AGA GAA CTT ATA GCG GTT GCT AAT GAA CAT 336 Gly Asp Leu Asn Asp Phe Arg Glu Leu lie Ala Val Ala Asn Glu His 100 105 110

GAT ATA AAA GTA ATT ATT GAT TTT GCA CCT AAT CAT ACT TCT CCA GCA 384 Asp lie Lys Val lie lie Asp Phe Ala Pro Asn His Thr Ser Pro Ala 115 120 125

GAA GTT AAT AAT CCT AAC TAT GCT GAA GAT GGT AAT TTG TAT AAT AAC 432 Glu Val Asn Asn Pro Asn Tyr Ala Glu Asp Gly Asn Leu Tyr Asn Asn 130 135 140

GGA GAA TTT GTA GCT TCT TAT TCT AAT GAT TTA AAT GAA ATT TTT TAC 480 Gly Glu Phe Val Ala Ser Tyr Ser Asn Asp Leu Asn Glu lie Phe Tyr 145 150 155 160

CAT TTT GGA GGA ACT GAT TTT TCA ACT TAT GAA GAT AGT ATA TAT AGA 528

His Phe Gly Gly Thr Asp Phe Ser Thr Tyr Glu Asp Ser lie Tyr Arg 165 170 175 AAC CTG TTT GAT TTA GCA GGA TTA AAT TTA AAT AAT AAT TTT GTT GAT 576 Asn Leu Phe Asp Leu Ala Gly Leu Asn Leu Asn Asn Asn Phe Val Asp 180 185 190

CAA TAT TTA CGT GAT TCG ATA AAA TTT TGG TTA GAT CTC GGT GTT GAT 624 Gin Tyr Leu Arg Asp Ser lie Lys Phe Trp Leu Asp Leu Gly Val Asp 195 200 205

GGT ATT AGA GTG GAT GCT GTT AAA CAT ATG CCG TTA GGA TGG CAA AAA 672 Gly lie Arg Val Asp Ala Val Lys His Met Pro Leu Gly Trp Gin Lys 210 215 220

TCT TTT GTG GAT ACC ATT TAT AAT CAT AAA CCT GTA TTT GTT TTT GGT 720 Ser Phe Val Asp Thr lie Tyr Asn His Lys Pro Val Phe Val Phe Gly 5 225 230 235 240

GAG TGG TAT TTA GGT AAA GAT GAA TAT GAT CCT AAT TAT TAT CAT TTT 768 Glu Trp Tyr Leu Gly Lys Asp Glu Tyr Asp Pro Asn Tyr Tyr His Phe 245 250 255

10

GCA AAT AAT AGT GGT ATG AGT TTA TTA GAC TTT GAA TTT GCT CAA ACA 816 Ala Asn Asn Ser Gly Met Ser Leu Leu Asp Phe Glu Phe Ala Gin Thr 260 265 270

15 ACA CGT AGT GTG TTT CGA AAT CAT GAA AAA AAT ATG TTT GAC TTA TAT 864 Thr Arg Ser Val Phe Arg Asn His Glu Lys Asn Met Phe Asp Leu Tyr 275 280 285

GAC ATG CTA AAA AAT ACG GAA AAC AAC TAT GAA CGT GTT GTA GAT CAG 912 20 Asp Met Leu Lys Asn Thr Glu Asn Asn Tyr Glu Arg Val Val Asp Gin 290 295 300

GTA ACT TTT ATT GAT AAT CAT GAT ATG GAT CGC TTT CAC TAT GAT GGA 960 Val Thr Phe lie Asp Asn His Asp Met Asp Arg Phe His Tyr Asp Gly 25 305 310 315 320

GCA ACT AAA AGA AAT GTA GAA ATT GGA TTA GCA TTT TTA CTA ACA TCA 1008

Ala Thr Lys Arg Asn Val Glu lie Gly Leu Ala Phe Leu Leu Thr Ser

325 330 335

30

AGG GGA GTT CCA ACT ATT TAT TAT GGT ACT GAA CAA TAT TTA ACA GGA 1056

Arg Gly Val Pro Thr lie Tyr Tyr Gly Thr Glu Gin Tyr Leu Thr Gly 340 345 350

35 AAT GGT GAT CCA TAT AAT CGT AAG CCT ATG TCG TCT TTT GAT CAA AAT 1104 Asn Gly Asp Pro Tyr Asn Arg Lys Pro Met Ser Ser Phe Asp Gin Asn 355 360 365

ACA AAA GCA TAT AAA ATT ATT CAA AAA TTA GCA CCT TTA AGG AAG TCT 1152 40 Thr Lys Ala Tyr Lys lie He Gin Lys Leu Ala Pro Leu Arg Lys Ser 370 375 380

AAC CCA GCC CTT GCT TAC GGA ACA ACA CAA CAA CGC TGG TTG AAT AAT 1200 Asn Pro Ala Leu Ala Tyr Gly Thr Thr Gin Gin Arg Trp Leu Asn Asn 45 385 390 395 400

GAT GTT ATT ATT TAT GAA CGT AAA TTT GGA AAT AAT ATT GTT TTA GTG 1248 Asp Val He He Tyr Glu Arg Lys Phe Gly Asn Asn He Val Leu Val 405 410 415

50

GCA ATA AAT AGA AAT TTA AGT CAA TCT TAC TCT ATA ACT GGT CTC AAT 1296 Ala He Asn Arg Asn Leu Ser Gin Ser Tyr Ser He Thr Gly Leu Asn 420 425 430

55 ACC AAA CTT CCT GAG GGT TAT TAT TAT GAT GAG CTA GAC GGA TTG TTA 1344 Thr Lys Leu Pro Glu Gly Tyr Tyr Tyr Asp Glu Leu Asp Gly Leu Leu 435 440 445

TCA GGT AAA AGT ATT ACT GTT AAC CCT GAT GGT TCA GTG AAT CAA TTT 1392 1440

1488

1536

1580

(2) INFORMATION FOR SEQ ID NO: 14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 526 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

Asp Val Met Tyr Gin He Val Thr Asp Arg Phe Leu Asp Gly Asp Lys 1 5 10 15

Tyr Asn Asn Pro Thr Cys Glu Asn Leu Tyr Ser Glu Asp Gly Ala Asp 20 25 30 Leu Arg Lys Tyr Leu Gly Gly Asp Trp Arg Gly He He Gin Lys He 35 40 45

Glu Asp Gly Tyr Leu Pro Asp Met Gly He Ser Ala He Trp He Ser 50 55 60

Ser Pro Val Glu Asn He Tyr Ala Val His Pro Gin Phe Gly Thr Ser 65 70 75 80

Tyr His Gly Tyr Trp Ala Arg Asp Phe Lys Arg Asn Asn Pro Phe Phe 85 90 95

Gly Asp Leu Asn Asp Phe Arg Glu Leu He Ala Val Ala Asn Glu His 100 105 110 Asp He Lys Val He He Asp Phe Ala Pro Asn His Thr Ser Pro Ala 115 120 125

Glu Val Asn Asn Pro Asn Tyr Ala Glu Asp Gly Asn Leu Tyr Asn Asn 130 135 140

Gly Glu Phe Val Ala Ser Tyr Ser Asn Asp Leu Asn Glu He Phe Tyr 145 150 155 160

His Phe Gly Gly Thr Asp Phe Ser Thr Tyr Glu Asp Ser He Tyr Arg 165 170 175

Asn Leu Phe Asp Leu Ala Gly Leu Asn Leu Asn Asn Asn Phe Val Asp 180 185 190

Gin Tyr Leu Arg Asp Ser He Lys Phe Trp Leu Asp Leu Gly Val Asp 195 200 205

Gly He Arg Val Asp Ala Val Lys His Met Pro Leu Gly Trp Gin Lys 210 215 220

Ser Phe Val Asp Thr He Tyr Asn His Lys Pro Val Phe Val Phe Gly 225 230 235 240 Glu Trp Tyr Leu Gly Lys Asp Glu Tyr Asp Pro Asn Tyr Tyr His Phe

245 250 255

Ala Asn Asn Ser Gly Met Ser Leu Leu Asp Phe Glu Phe Ala Gin Thr 260 265 270

Thr Arg Ser Val Phe Arg Asn His Glu Lys Asn Met Phe Asp Leu Tyr 275 280 285

Asp Met Leu Lys Asn Thr Glu Asn Asn Tyr Glu Arg Val Val Asp Gin 290 295 300

Val Thr Phe He Asp Asn His Asp Met Asp Arg Phe His Tyr Asp Gly 305 310 315 320 Ala Thr Lys Arg Asn Val Glu He Gly Leu Ala Phe Leu Leu Thr Ser

325 330 335

Arg Gly Val Pro Thr He Tyr Tyr Gly Thr Glu Gin Tyr Leu Thr Gly 340 345 350

Asn Gly Asp Pro Tyr Asn Arg Lys Pro Met Ser Ser Phe Asp Gin Asn 355 360 365

Thr Lys Ala Tyr Lys He He Gin Lys Leu Ala Pro Leu Arg Lys Ser 370 375 380

Asn Pro Ala Leu Ala Tyr Gly Thr Thr Gin Gin Arg Trp Leu Asn Asn 385 390 395 400 Asp Val He He Tyr Glu Arg Lys Phe Gly Asn Asn He Val Leu Val

405 410 415

Ala He Asn Arg Asn Leu Ser Gin Ser Tyr Ser He Thr Gly Leu Asn 420 425 430

Thr Lys Leu Pro Glu Gly Tyr Tyr Tyr Asp Glu Leu Asp Gly Leu Leu 435 440 445

Ser Gly Lys Ser He Thr Val Asn Pro Asp Gly Ser Val Asn Gin Phe 450 455 460

He He Asn Pro Gly Glu Val Ser He Trp Gin Phe Ala Gly Glu Thr 465 470 475 480 He Thr Pro Leu He Gly Gin Val Gly Pro He Met Gly Gin Val Gly 485 490 495

Asn Lys Val Thr He Asn Gly Val Gly Phe Gly Asp Lys Lys Gly Thr 500 505 510

Val Asn Phe Gly Gin He Asp Ala Thr He He Ser Trp Thr 515 520 525

INDICATIONS RELATING TO A DEPOSITED MICROORGANISM

The indications made below relate to the microorganism referred to in the descnption on page 13 , line 31-35

B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet

Name of depositary institution

DEUTSCHE SAMMLUNG VON MIKROORGANISMEN UND ZELLKULTUREN GmbH

Address of depositary institution (including postal code and country) Mascheroder Weg lb, D-38124 Braunschweig, GERMANY

Date of deposit Accession Number 9380

11 September 1996

C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is contmued on an additional sheet

Until the publication of the mention of grant of a European patent or, where applicable, for twenty years from the date of filing if the application has been refused, withdrawn or deemed withdrawn, a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (cf. Rule 28(4) EPC). And as far as Australia is concerned, the expert option is likewise requested, reference being had to RegulaUon 3.25 of Australia Statutory Rules 1991 No 71.

D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)

E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)

The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g., "Accession Number of Deposit")

Claims

1. An isolated CGTase characterized by producing at least 75% racyclodextrin (relative to β and γ- cyclodextrin) after 2 hours of incubation with amylopectin at 65°C, pH 8.0.

2. The CGTase according to claim 1, wherein the CGTase is obtained from a strain of a Thermoalcalibacter εp.

3. An isolated extracellular CGTase obtained from a strain of a Thermoalcalibacter εp.

4. The CGTase according to claim 2 or 3 , wherein the Thermoalcalibacter εp . strain is an moderately thermo alkaliphile anaerobe strain.

5. The CGTase according to claim 4, wherein the strain is Thermoalcalibacter bogoriae, in particular Thermoalcalibacter bogoriae DSM No. 9380.

6. The CGTase according to any of claims 1-5, wherein the CGTase has, i) a molecular mass of 67 ± 10 kD determined by SDS-PAGE, and/or ii) a temperature optimum at 65 ± 10°C, measured at pH 8.0.

7. A method of producing a CGTase according to any of claims 1 to 4 , the method comprising culturing a strain of a Thermoalcalibacter εp under conditions permitting the production of the enzyme, and recovering the enzyme from the culture.

8. The method according to claim 1 , wherein the Thermoalcalibacter εp is a strain of Thermoalcalibacter bogoriae, in particular Thermoalcalibacter bogoriae DSM No. 9380.

9. A DNA construct comprising a DNA sequence encoding a CGTase, which DNA sequence comprises a) a CGTase encoding DNA sequence comprising the partial DNA sequence shown in SEQ ID No. 13, or 5 b) an analogue of the DNA sequence defined in a) , which i) is at least 70% homologous with the DNA sequence defined in a) comprising the partial sequence shown in SEQ ID No. 13, or ii) hybridizes with the same oligonucleotide probe as the DNA sequence defined in a) comprising the partial sequence 10 shown SEQ ID No. 13, or iii) encodes a polypeptide which is at least 70% homologous with the polypeptide encoded by the DNA sequence defined in a) comprising the partial DNA sequence shown in SEQ ID NO. 13, or iv) encodes a polypeptide which is immunologically reactive 15 with an antibody raised against the purified CGTase derived from T. bogoriae DSM no. 9380 encoded by the DNA sequence defined in a) , comprising the partial sequence shown in SEQ ID NO. 13.

20 10. The DNA construct according to claim 9, in which said DNA sequence is obtained from a strain of a Thermoalcalibacter sp, εuch aε a strain of Thermoalcalibacter bogoriae, in particular Thermoalcalibacter bogoriae DSM No. 9380.

25 11. A recombinant expression vector comprising a DNA construct according to any of claims 9 or 10.

12. A cell comprising a DNA construct according to any of claims 1 to 8 or a recombinant expression vector according to any of the

30 claims 9 to 12.

13. The cell according to claim 12, which cell is a microbial cell, such as a bacterial cell, a fungal cell, such as a filamentous fungus cell or a yeast cell.

35

14. The cell according to claim 13 , in which the cell is a bacterial cell is a strain of Bacilluε , such as strains of B . subtilis , B . licheniformiε , B . lentuε, B . breviε, B . Stearo- thermophiluε , B . alkalophiluε , B . amyloliquefacienε , B . coagulanε, B . circulans , B . lautuε , B . megaterium or B . thuringienεiε , or a strain of Streptomyceε , such as S . lividanε or S. murinus , or strains of Eεcherichia, such as E. coli .

15. A method of producing a CGTase, comprising culturing a cell according to any of the claims 12 to 14 , under conditions permitting the production of the enzyme, and recovering the enzyme from the culture.

16. A isolated CGTase which a) is encoded by a DNA construct according to any of claims 9 or 10, b) produced by the method according to claim 15.

17. An enzyme composition comprising a CGTase according to any of claims 1-6 or claim 16.

18. A bread-improving and/or a dough-improving composition comprising a CGTase according to any of claims 1-6 or claim 16.

19. Use of a CGTase according to any of claims 1-6 or claim 16 or an enzyme composition according to claim 17, in a process for the manufacture of cyclodextrins, in particular α-cyclo- dextrin.

20. Use of a CGTase according to any of claims 1-6 or claim 16 or an enzyme composition according to claim 17, in a bread- improving or dough-improving composition.

21. A dough or baked product comprising a bread-improving and/or a dough-improving composition according to claim 18.