EP0934408A1 - Nucleic acid encoding ds-cam proteins and products related thereto - Google Patents

Nucleic acid encoding ds-cam proteins and products related thereto

Info

Publication number
EP0934408A1
EP0934408A1 EP97946341A EP97946341A EP0934408A1 EP 0934408 A1 EP0934408 A1 EP 0934408A1 EP 97946341 A EP97946341 A EP 97946341A EP 97946341 A EP97946341 A EP 97946341A EP 0934408 A1 EP0934408 A1 EP 0934408A1
Authority
EP
European Patent Office
Prior art keywords
ser
seq
cam
val
thr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP97946341A
Other languages
German (de)
French (fr)
Inventor
Julie R. Korenberg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cedars Sinai Medical Center
Original Assignee
Cedars Sinai Medical Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cedars Sinai Medical Center filed Critical Cedars Sinai Medical Center
Publication of EP0934408A1 publication Critical patent/EP0934408A1/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)

Definitions

  • the present invention relates to nucleic acids and proteins encoded thereby.
  • Invention nucleic acids encode a novel N-CAM member of the immunoglobulin superfamily of proteins.
  • the invention also relates to methods for making and using such nucleic acids and proteins.
  • CAMs Cell surface proteins, and especially the so-called Cellular Adhesion Molecules (“CAMs”) have correspondingly been the subject of pharmaceutical research and development having as its goal intervening in the processes of leukocyte extravasation to sites of inflammation and leukocyte movement to distinct target tissues.
  • VCAM-1 vascular adhesion molecule
  • PECAM-1 platelet endothelial cell adhesion molecule
  • U.S. Patents 5,525,487; 5,235,049; 5,272,263; 5,489,233; 5,264,554; 5,318,890; 5,389,520; 5,519,008; and the like.
  • N-CAM locus llq23.1
  • Rosenthal et al . (Nature Genet . 2:107-112, 1992) reported that mutations in CAM-LI (locus Xq28) cause X-linked hydrocephalus, and Jouet et al . , (Nature Genet.
  • isolated nucleic acids encoding novel mammalian N-CAM (neural-cell adhesion molecule) members of the immunoglobulin superfamily of proteins, referred to herein as Down Syndrome-Cell Adhesion Molecules (DS-CAMs) .
  • vectors containing invention nucleic acids, probes that hybridize thereto, host cells transformed therewith, antisense oligonucleotides thereto and related compositions are provided.
  • the nucleic acid molecules described herein can be incorporated into a variety of recombinant expression systems known to those of skill in the art to readily produce isolated DS-CAM proteins.
  • nucleic acid molecules of the present invention are useful as probes for assaying for the presence and/or amount of a DS-CAM gene or mRNA transcript in a given sample.
  • the nucleic acid molecules described herein, and oligonucleotide fragments thereof, are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding DS-CAM proteins.
  • isolated mammalian DS-CAM proteins are useful, for example, in neural prosthetic devices used in entubulation methods of repairing (regenerating) damaged or severed peripheral nerves (see, e.g., U.S. Patent No. 4,955,892, incorporated herein by reference) .
  • these proteins, or fragments thereof are useful as immunogens for producing anti-DS-CAM antibodies, or in therapeutic compositions containing such proteins and/or antibodies.
  • Invention DS-CAM proteins are also useful in bioassays to identify agonists and antagonists thereto.
  • transgenic non-human mammals that express the invention protein.
  • Antibodies that are immunoreactive with invention DS-CAM proteins are also provided. These antibodies are useful in diagnostic assays to determine levels of DS-CAM proteins present in a given sample, e.g., tissue samples, Western blots, and the like. The antibodies can also be used to purify DS-CAM proteins from crude cell extracts and the like. Moreover, these antibodies are considered therapeutically useful to counteract or supplement the biological effect of DS-CAMs in vivo . Methods and diagnostic systems for determining the levels of DS-CAM protein in various tissue samples are also provided. These diagnostic methods can be used for monitoring the level of therapeutically administered DS-CAM protein or fragments thereof to facilitate the maintenance of therapeutically effective amounts. These diagnostic methods can also be used to diagnose physiological disorders that result from abnormal levels or abnormal structures of the DS-CAM protein.
  • Figure 1 shows a physical map of the localization of the DS-CAM gene to a region between D21S345 and D21S347 on chromosome 21.
  • the locations of BAC clones (starting with numbers) and PAC clones (starting with "P") are indicated by horizontal bars.
  • An arrow head indicates a gap in the BAC and PAC contig.
  • the location of the DS-CAM gene is indicated by a thick arrow.
  • Figure 2 shows the predicted amino acid sequence of the human DS-CAMl protein corresponding to SEQ ID NO: 2 and a schematic structure.
  • Figure 3 shows a partial genomic structure of DS-CAMl and a deletion contained in DS-CAM2 cDNA clones (clones pDS-CAM-18 and pDS-CAM-52) .
  • the deletion boundary sequence (GC-AG) suggests an unusual alternative splicing.
  • the horizontal bar represents genomic sequence containing exons of DS-CAM-42. Exons are indicated by open boxes. Exon-intron boundaries are defined by a comparison of the cDNA sequence of pDS-CAM-42 and genomic sequence determined from a BAC clone.
  • Figure 4 shows a schematic comparison of neuronal Ig superfamily members. Ig-like type C-2 domains, fibronectin type III domains and transmembrane domains are indicated.
  • MAG myelin-associated glycoprotein
  • N-CAM neural cell adhesion molecule
  • BIG-1 brain-derived immunoglobulin (Ig) superfamily molecule-1
  • DCC deleted in colorectal carcinoma.
  • DS-CAM refers to substantially pure native DS-CAM protein, or recombinantly produced proteins, including naturally occurring allelic variants thereof encoded by mRNA generated by alternative splicing of a primary transcript, such as DS-CAMl (SEQ ID NO: 2) and DS-CAM2 (SEQ ID NO: 11) disclosed herein, and further including fragments thereof which retain at least one native biological activity, such as immunogenicity .
  • invention DS-CAM proteins, such as DS-CAMl are cell-surface glycoproteins that are mobile in the plane of the membrane.
  • invention DS-CAMl proteins contain extra- and intra-cellular domains that transduce information from the outside of the cell to the cytoplasm and the nucleus, thereby determining cell function.
  • invention DS-CAM proteins such as DS- CAM2
  • DS-CAM proteins are further characterized as comprising at least 7 Immunoglobulin-like (Ig-like) domains homologous to the immunoglobulin superfamily and 6 type III fibronectin repeats (see, e.g., Edelman and Crossin, "CELL ADHESION MOLECULES: Implications for a Molecular Histology", Ann. Rev. Biochem. , 60:155-190, 1991; and Walsh and Doherty,
  • DS-CAM proteins are those proteins comprising at least 8, preferably at least 9 Ig-like domains, with at least 10 Ig-like domains being especially preferred.
  • Ig-like domains refers to the well known repeats that are common among Cell Adhesion Molecules (CAMs) (see, e.g., Figure 1A at p. 158 of Edelman and Crossin, supra , 1991; and Walsh and Doherty, supra. 1993; each of which is incorporated herein by reference in its entirety) .
  • CAMs Cell Adhesion Molecules
  • fibronectin repeats refers to the well known repeats that are common among Cell Adhesion Molecules (CAMs) (see, e.g., Figure 1A at p. 158 of Edelman and Crossin, supra , 1991; and Walsh and Doherty, supra , 1993; each of which is incorporated herein by reference in its entirety) .
  • CAMs Cell Adhesion Molecules
  • the invention DS-CAM proteins define a novel sub-class of the Ig (immunoglobulin) superfamily with highest homologies to the neural cell adhesion molecules including BIG-1 (Yoshihara et al . , Neuron 13:415-426,
  • DS-CAM proteins is unique within the neural immunoglobulin superfamily, and is distinctive due to the number of Ig-like type C2 and fibronectin III domains (10 and 6 respectively) and from the interruption of the fourth and fifth fibronectin domains by a 10th C2 domain, the functional significance of which may be of interest.
  • the novel structure of DS-CAM and its expression throughout the nervous system during differentiation suggest interesting roles for the neural CAM in neural development and function.
  • the location of DS-CAM in a region critical for DS neurocognitive phenotypes provides a human model in which to test the significance of these roles for cognitive function.
  • the neural Ig-superfamily members play critical roles in neural development and function and have been implicated in cell migration and sorting, axon guidance and fasciculation, formation of neural connections, and in synaptic plasticity (Edelman and Crossin, supra, 1991; Walsh and Doherty, supra . 1993; Tessier-Lavigne et al . , Science 274:1123-1133. 1996: Shuster et al . , Neuron
  • differentiated neurons express DS-CAM when they have finished migrating to their proper positions within the neuroepithelium, during neurite outgrowth.
  • Neural crest cells may express DS-CAM while they are migrating. At 15.5 and 16.5 days pc, most of the neural crest derived tissues have some expression, although not all have finished migration. The continued expression of DS-CAM in the myenteric plexus after 15.5- 16.5 dpc is due to the neural crest cells that have stopped dividing, although others are in the cell cycle. Approximately 50% of myenteric ganglia neurons arise after birth and DS-CAM may be expressed later in this subset. At later stages, the data suggest that DS-CAM is down regulated in the neural crest derivatives such as the myenteric ganglia and ganglia of the pancreas.
  • the DS-CAM expression in tissues derived from the neural crest is of interest with respect to the high level detected in the umbilical cord.
  • the tissue surrounding the umbilical artery and vein is derived from the neural crest and functions in coordinating the cardiovascular changes occurring at birth.
  • the expression detected in the fetal liver and branchial arches is also derived from neural crest related to the ductus venosus and ultimately the ductus arteriosus and cardiac outflow tracts, respectively.
  • DS-CAM expression continues post-natally, in the differentiating regions of the newborn brain, such as, the septum and inferior colliculus, and in the adult in regions associated with plasticity, such as, the olfactory bulb and hippocampus.
  • the continued expression supports a role for DS-CAM in remodeling, learning and memory.
  • the expression pattern and the role of dendritic connections in cell body maintenance indicate that an increase in DS-CAM expression in DS brain is responsible in part for the abnormalities of dendritic structure and decreased intersections seen at four months post-natal in DS individuals .
  • CAMs Alternatively spliced variants of CAMs have distinct roles in different parts of the brain, as demonstrated for closely related Ig-superfamily members, such as, NCAM (Cunningham et al . , Science 236:799-806,
  • RT-PCR The results of RT-PCR (Example 5) indicated that all RNAs tested from various human tissues expressed both the DS-CAMl and DS-CAM2 transcripts and that the PCR products generated the sequence and size predicted for the appropriate form.
  • the proximal and distal borders of the deletion are located within neighboring exons and reveal variant consensus splice site sequences (Jackson, Nuc . Acid Res . 19:3795-3798,
  • Example 4 From Northern analyses (Example 4) a minimum of three distinct transcripts are recognized by a probe for the transmembrane domain. From cDNA sequence analyses (Example 5) two forms of the DS-CAM protein are deduced, one that generates a transmembrane adhesion molecule and a second that is deleted for the transmembrane domain, thereby generating a molecule that is transported to the extracellular matrix. This mode of generating extracellular and membrane bound forms of CAMs is in surprising contrast to the GPI
  • glycosylphosphatidylinositol linkage used by most CAMs, and would provide a way of generating longer range homophilic interactions between cells and the extracellular matrix, which may be significant for cell migration.
  • the DS-CAM gene was isolated (as described in the Examples hereinafter) by using the BAC contig on 21q22.2-q22.3 covering the region between D21S55 and MX1 (Hubert et al . , Genomics 41:218-226, 1997).
  • the gene spans a minimum of 900 kb, estimated by summing the size of BACs and PACs that are non-overlapping and covered by the DS-CAM gene ( Figure 1) .
  • the DS-CAM gene covers a gap in all physical maps of this region.
  • a 5' intron is at least this size, similar to the first intron of the DCC gene (Cho et al., Genomics 19:525-531, 1994).
  • other alternative transcripts can contain exons located in this BAC.
  • the gene spans the boundary of bands 21q22.2 and q22.3, a Giemsa-dark and Giemsa-light band, respectively.
  • the location of the gene for PEP19, a small 634 bp gene with large introns within the same band 21q22.2 suggests a general structure of genes in G- bands having large introns.
  • nucleic acid molecules described herein are useful for producing invention DS-CAM proteins, when such nucleic acids are incorporated into a variety of protein expression systems known to those of skill in the art.
  • nucleic acid molecules or fragments thereof can be labeled with a readily detectable substituent and used as hybridization probes for assaying for the presence and/or amount of a DS-CAM gene or mRNA transcript in a given sample.
  • the nucleic acid molecules described herein, and fragments thereof are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding the invention protein described herein.
  • nucleic acid encompasses ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), probes, oligonucleotides, and primers.
  • DNA can be either complementary DNA (cDNA) or genomic DNA, e.g. a gene encoding a DS-CAM protein.
  • cDNA complementary DNA
  • genomic DNA e.g. a gene encoding a DS-CAM protein.
  • One means of isolating a nucleic acid encoding a DS-CAM polypeptide is to probe a mammalian genomic library with a natural or artificially designed DNA probe using methods well known in the art. DNA probes derived from the DS-CAM gene are particularly useful for this purpose.
  • DNA and cDNA molecules that encode DS-CAM polypeptides can be used to obtain complementary genomic DNA, cDNA or RNA from mammalian (e.g., human, mouse, rat, rabbit, pig, and the like), or other animal sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, by methods described in more detail below.
  • Examples of nucleic acids are RNA, cDNA, or isolated genomic DNA encoding a DS-CAM polypeptide.
  • nucleic acids may include, but are not limited to, nucleic acids having substantially the same nucleotide sequence as set forth in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO: 8, SEQ ID NO : 9 , SEQ ID NO: 10, or at least nucleotides 453-6185 set forth in SEQ ID NO:l, or nucleotides 453-5168 set forth in SEQ ID NO:10.
  • mammalian refers to the variety of species from which the invention DS-CAM protein is derived, e.g., human, rat, mouse, rabbit, monkey, baboon, bovine, porcine, ovine, canine, feline, and the like.
  • a preferred DS-CAM protein herein, is human DS-CAM.
  • cDNAs encoding the invention DS-CAM proteins disclosed herein include substantially the same nucleotide sequence as set forth in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, or SEQ ID NO: 10.
  • Preferred cDNA molecules encoding the invention proteins include the same nucleotide sequence as nucleotides 453-6185 set forth in SEQ ID N0:1, or nucleotides 453-5168 set forth in SEQ ID NO: 10.
  • substantially the same nucleotide sequence refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent hybridization conditions.
  • DNA having substantially the same nucleotide sequence as the reference nucleotide sequence encodes substantially the same amino acid sequence as that set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9 , or a larger amino acid sequence including SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO: 8 or SEQ ID NO : 9.
  • DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence has at least 60% identity with respect to the reference nucleotide sequence.
  • DNA having at least 70%, more preferably at least 90%, yet more preferably at least 95%, identity to the reference nucleotide sequence is preferred.
  • This invention also encompasses nucleic acids which differ from the nucleic acids shown in SEQ ID NO : 1 , SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10 but which have the same phenotype. Phenotypically similar nucleic acids are also referred to as “functionally equivalent nucleic acids” . As used herein, the phrase “functionally equivalent nucleic acids” encompasses nucleic acids characterized by slight and non- consequential sequence variations that will function in substantially the same manner to produce the same protein product (s) as the nucleic acids disclosed herein.
  • nucleic acids encode polypeptides that are the same as those disclosed herein or that have conservative amino acid variations, or that encode larger polypeptides that includes SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO : 9.
  • conservative variations include substitution of a non-polar residue with another non-polar residue, or substitution of a charged residue with a similarly charged residue.
  • nucleic acids encoding DS-CAM polypeptides that, by virtue of the degeneracy of the genetic code, do not necessarily hybridize to the invention nucleic acids under specified hybridization conditions.
  • Preferred nucleic acids encoding the invention polypeptides are comprised of nucleotides that encode substantially the same amino acid sequences set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9.
  • an exemplary nucleic acid encoding an invention DS-CAM protein may be selected from:
  • Hybridization refers to the binding of complementary strands of nucleic acid (i.e., sense : antisense strands or probe : target -DNA) to each other through hydrogen bonds, similar to the bonds that naturally occur in chromosomal DNA.
  • Stringency levels used to hybridize a given probe with target -DNA can be readily varied by those of skill in the art.
  • the phrase "stringent hybridization” is used herein to refer to conditions under which polynucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T m ) of the hybrids. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions.
  • moderately stringent hybridization refers to conditions that permit target-DNA to bind a complementary nucleic acid that has about 60% identity, preferably about 75% identity, more preferably about 85% identity to the target DNA; with greater than about 90% identity to target-DNA being especially preferred.
  • moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5X Denhardt ' s solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.2X SSPE, 0.2% SDS, at 65°C.
  • high stringency hybridization refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65°C (i.e., if a hybrid is not stable in 0.018M NaCl at 65°C, it will not be stable under high stringency conditions, as contemplated herein) .
  • High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5X Denhardt ' s solution, 5X SSPE, 0.2% SDS at 42 °C, followed by washing in 0. IX SSPE, and 0.1% SDS at 65°C.
  • low stringency hybridization refers to conditions equivalent to hybridization in 10% formamide, 5X Denhardt ' s solution, 6X SSPE, 0.2% SDS at 42°C, followed by washing in IX SSPE, 0.2% SDS, at 50°C.
  • Denhardt ' s solution and SSPE are well known to those of skill in the art as are other suitable hybridization buffers .
  • the term “degenerate” refers to codons that differ in at least one nucleotide from a reference nucleic acid, e.g., SEQ ID NO : 1 , but encode the same amino acids as the reference nucleic acid.
  • codons specified by the triplets "UCU” , “UCC”, “UCA” , and “UCG” are degenerate with respect to each other since all four of these codons encode the amino acid serine.
  • Preferred nucleic acids encoding the invention polypeptide hybridize under moderately stringent, preferably high stringency, conditions to substantially the entire sequence, or in certain embodiments substantial portions (i.e., typically at least 15-30 nucleotides) of the nucleic acid sequence set forth in SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10.
  • nucleic acids can be produced by a variety of methods well-known in the art, e.g., the methods described herein, employing PCR amplification using oligonucleotide primers from various regions of SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, and the like.
  • optionally labeled DS-CAM-encoding cDNAs, or fragments thereof can be employed to probe library (ies) (e.g., cDNA, genomic, and the like) for additional nucleic acid sequences encoding novel mammalian DS-CAM proteins.
  • libraries e.g., cDNA, genomic, and the like
  • construction of mammalian cDNA libraries preferably a human trisomy 21 fetal brain cDNA library, is well-known in the art. Screening of such a cDNA library is initially carried out under low-stringency conditions, which comprise a temperature of less than about 42°C, a formamide concentration of less than about 50%, and a moderate to low salt concentration.
  • Presently preferred probe-based screening conditions comprise a temperature of about 37°C, a formamide concentration of about 20%, and a salt concentration of about 5X standard saline citrate (SSC; 20X SSC contains 3M sodium chloride, 0.3M sodium citrate, pH 7.0) .
  • SSC standard saline citrate
  • Such conditions will allow the identification of sequences which have a substantial degree of similarity with the probe sequence, without requiring perfect homology.
  • the phrase "substantial similarity" refers to sequences which share at least 50% homology.
  • hybridization conditions will be selected which allow the identification of sequences having at least 70% homology with the probe, while discriminating against sequences which have a lower degree of homology with the probe.
  • nucleic acids having substantially the same nucleotide sequence as nucleotides 453-6185 set forth in SEQ ID NO : 1 , or nucleotides 453-5168 set forth in SEQ ID NO:10, SEQ ID NO : 7 , SEQ ID NO: 8, or SEQ ID NO : 9 are obtained.
  • a nucleic acid "probe” is single-stranded DNA or RNA, or analogs thereof, that has a sequence of nucleotides that includes at least 14, at least 20, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 contiguous bases that are the same as (or the complement of) any contiguous bases set forth in any of SEQ ID NO : 1 , SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10.
  • Preferred regions from which to construct probes include 5' and/or 3' coding regions of SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO: 8, SEQ ID NO : 9 or SEQ ID NO: 10.
  • the entire cDNA encoding region of an invention DS-CAM protein, or the entire sequence corresponding to SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10 may be used as a probe. Probes may be labeled by methods well-known in the art, as described hereinafter, and used in various diagnostic kits.
  • label and "indicating means” in their various grammatical forms refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal. Any label or indicating means can be linked to invention nucleic acid probes, expressed proteins, polypeptide fragments, or antibody molecules. These atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well-known in clinical diagnostic chemistry.
  • the labeling means can be a fluorescent labeling agent that chemically binds to antibodies or antigens without denaturation to form a fluorochrome (dye) that is a useful immunofluorescent tracer.
  • a fluorochrome a fluorochrome that is a useful immunofluorescent tracer.
  • the indicating group is an enzyme, such as horseradish peroxidase (HRP) , glucose oxidase, and the like.
  • HRP horseradish peroxidase
  • radioactive elements are employed labeling agents.
  • the linking of a label to a substrate, i.e., labeling of nucleic acid probes, antibodies, polypeptides, and proteins, is well known in the art.
  • an invention antibody can be labeled by metabolic incorporation of radiolabeled amino acids provided in the culture medium. See, for example, Galfre et al . , Meth. Enzymol . 73:3-46, 1981.
  • Conventional means of protein conjugation or coupling by activated functional groups are particularly applicable. See, for example, Aurameas et al . , Scand. J. Immunol. 8(7): 7-23, 1978; Rodwell et al . , Biotech. 3:889-894, 1984; and U.S. Patent
  • isolated mammalian DS-CAM proteins preferably human
  • polypeptides preferably human
  • fragments thereof encoded by invention nucleic acid are provided.
  • DS-CAM proteins referred to herein are those polypeptides specifically recognized by an antibody that also specifically recognizes a DS-CAM protein including the sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or
  • SEQ ID NO: 9 Invention isolated DS-CAM proteins are free of cellular components and/or contaminants normally associated with a native in vivo environment.
  • the invention DS-CAM proteins are further characterized as being primarily expressed in fetal brain and not expressed in fetal lung or fetal liver.
  • Northern analysis (described in Example 4) using human fetal tissues showed that 8.5 kb and 7.6 kb transcripts are expressed only in fetal brain and not expressed in fetal lung, fetal liver and fetal kidney.
  • Northern blot analyses of adult tissues revealed differential expression of three alternative transcripts of 9.7 kb, 8.5 kb and 7.6 kb in different substructures of the brain.
  • the 9.7 kb transcript is highly expressed in the substantia nigra, moderately expressed in the amygdala and hippocampus, and less expressed in the whole brain.
  • a similar pattern is observed by using a PCR product spanning the 191 bp deletion found in DS-CAM-18 and DS-CAM-52.
  • the placenta shows faint bands, and the sizes are smaller than those in brain.
  • a faint band (6.5 kb) is detected.
  • RT-PCR demonstrated expression of human DS-CAM mRNA in fetal and adult brain, in fetal kidney, as well as in a breast carcinoma cell line mRNA.
  • splice variant cDNA transcripts encoding a DS-CAM family of proteins are clearly contemplated by the present invention.
  • DS-CAM is contemplated as the gene, which when defective, deleted or present as a duplication, is responsible for holoprosencephaly, agenesis of the corpus callosum and/or structural defects of the brain.
  • DS-CAM may also be responsible for several phenotypes of Down Syndrome including mental retardation as well as, more specifically, the abnormal dendritic structure observed in Down Syndrome.
  • Presently preferred DS-CAM proteins of the invention include amino acid sequences that are substantially the same as the protein sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9, as well as biologically active, modified forms thereof.
  • Those of skill in the art will recognize that numerous residues of the above-described sequences can be substituted with other, chemically, sterically and/or electronically similar residues without substantially altering the biological activity of the resulting receptor species.
  • polypeptide sequences containing substantially the same sequence as SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9 , therein (e.g., splice variants) are contemplated.
  • substantially the same amino acid sequence refers to amino acid sequences having at least about 50%, preferably at least about 60%, more preferably at least about 70% identity with respect to the reference amino acid sequence, and retaining comparable functional and biological activity characteristic of the protein defined by the reference amino acid sequence.
  • preferred invention proteins having "substantially the same amino acid sequence” will have at least about 80%, more preferably 90% amino acid identity with respect to the reference amino acid sequence; with greater than about 95% amino acid sequence identity being especially preferred.
  • polypeptides or nucleic acids referred to hereinbefore
  • DS-CAM protein(s) or polypeptide fragment thereof, refers to a polypeptide that exhibits functional characteristics similar to DS-CAM.
  • one biological activity of DS-CAM is the ability to act as an immunogen for the production of polyclonal and monoclonal antibodies that bind specifically to DS-CAM.
  • an invention nucleic acid encoding DS-CAM will encode a polypeptide specifically recognized by an antibody that also specifically recognizes the DS-CAM protein including the sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9. Such activity may be assayed by any method known to those of skill in the art.
  • a test-polypeptide encoded by a DS-CAM cDNA can be used to produce antibodies, which are then assayed for their ability to bind to the protein including the sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9. If the antibody binds to the test-polypeptide and the protein including the sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO: 7, SEQ ID NO : 8 or SEQ ID NO : 9 with substantially the same affinity, then the polypeptide possesses the requisite biological activity.
  • the invention DS-CAM proteins can be isolated by a variety of methods well-known in the art, e.g., the methods described herein, the recombinant expression systems described herein, precipitation, gel filtration, ion-exchange, reverse-phase and affinity chromatography, and the like. Other well-known methods are described in Deutscher et al . , Guide to Protein Purification: Methods in Enzymology 182 (Academic Press, 1990), which is incorporated herein by reference. Alternatively, the isolated polypeptides of the present invention can be obtained using well-known recombinant methods as described, for example, in Sambrook et al . , supra . ,
  • invention polypeptide (s) An example of the means for preparing the invention polypeptide (s) is to express nucleic acids encoding the DS-CAM in a suitable host cell, such as a bacterial cell, a yeast cell, an amphibian cell (i.e., oocyte), or a mammalian cell, using methods well known in the art, and recovering the expressed polypeptide, again using well-known methods.
  • a suitable host cell such as a bacterial cell, a yeast cell, an amphibian cell (i.e., oocyte), or a mammalian cell.
  • invention polypeptides can be isolated directly from cells that have been transformed with expression vectors as described below herein.
  • the invention polypeptide, biologically active fragments, and functional equivalents thereof can also be produced by chemical synthesis.
  • synthetic polypeptides can be produced using Applied Biosystems, Inc. Model 430A or 431A automatic peptide synthesizer (Foster City, CA) employing the chemistry provided by
  • acceptable carrier encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents .
  • antisense oligonucleotides having a sequence capable of binding specifically with any portion of an mRNA that encodes DS-CAM polypeptides so as to prevent translation of the mRNA.
  • the antisense oligonucleotide may have a sequence capable of binding specifically with any portion of the sequence of the cDNA encoding DS-CAM polypeptides.
  • binding specifically encompasses the ability of a nucleic acid sequence to recognize a complementary nucleic acid sequence and to form double-helical segments therewith via the formation of hydrogen bonds between the complementary base pairs.
  • An example of an antisense oligonucleotide is an antisense oligonucleotide comprising chemical analogs of nucleotides.
  • compositions comprising an amount of the antisense oligonucleotide, described above, effective to reduce expression of DS-CAM polypeptides by passing through a cell membrane and binding specifically with mRNA encoding DS-CAM polypeptides so as to prevent translation and an acceptable hydrophobic carrier capable of passing through a cell membrane are also provided herein.
  • Suitable hydrophobic carriers are described, for example, in U.S. Patent Nos. 5,334,761; 4,889,953;
  • the acceptable hydrophobic carrier capable of passing through cell membranes may also comprise a structure which binds to a receptor specific for a selected cell type and is thereby taken up by cells of the selected cell type.
  • the structure may be part of a protein known to bind to a cell-type specific receptor.
  • Antisense oligonucleotide compositions are useful to inhibit translation of mRNA encoding invention polypeptides.
  • Synthetic oligonucleotides, or other antisense chemical structures are designed to bind to mRNA encoding DS-CAM polypeptides and inhibit translation of mRNA and are useful as compositions to inhibit expression of DS-CAM associated genes in a tissue sample or in a subject.
  • kits for detecting mutations, duplications, deletions, rearrangements and aneuploidies in chromosome 21 at locus q22.2 comprising at least one invention probe or antisense nucleotide.
  • the present invention provides means to modulate levels of expression of DS-CAM polypeptides by employing synthetic antisense oligonucleotide compositions (hereinafter SAOC) which inhibit translation of mRNA encoding these polypeptides.
  • SAOC synthetic antisense oligonucleotide compositions
  • Synthetic oligonucleotides, or other antisense chemical structures designed to recognize and selectively bind to mRNA are constructed to be complementary to portions of the DS-CAM coding strand or nucleotide sequences shown in SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or
  • the SAOC is designed to be stable in the blood stream for administration to a subject by injection, or in laboratory cell culture conditions.
  • the SAOC is designed to be capable of passing through the cell membrane in order to enter the cytoplasm of the cell by virtue of physical and chemical properties of the SAOC which render it capable of passing through cell membranes, for example, by designing small, hydrophobic SAOC chemical structures, or by virtue of specific transport systems in the cell which recognize and transport the SAOC into the cell.
  • the SAOC can be designed for administration only to certain selected cell populations by targeting the SAOC to be recognized by specific cellular uptake mechanisms which bind and take up the SAOC only within select cell populations .
  • the SAOC may be designed to bind to a receptor found only in a certain cell type, as discussed supra .
  • the SAOC is also designed to recognize and selectively bind to target mRNA sequence, which may correspond to a sequence contained within the sequence shown in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 ,
  • the SAOC is designed to inactivate target mRNA sequence by either binding thereto and inducing degradation of the mRNA by, for example, RNase I digestion, or inhibiting translation of mRNA target sequence by interfering with the binding of translation-regulating factors or ribosomes, or inclusion of other chemical structures, such as ribozyme sequences or reactive chemical groups which either degrade or chemically modify the target mRNA.
  • SAOCs have been shown to be capable of such properties when directed against mRNA targets (see Cohen et al . , TIBS 10:435, 1989 and
  • a method for the recombinant production of invention DS-CAM protein (s) by expressing the above-described nucleic acid sequences in suitable host cells by expressing the above-described nucleic acid sequences in suitable host cells.
  • Recombinant DNA expression systems that are suitable to produce DS-CAM proteins described herein are well-known in the art.
  • the above-described nucleotide sequences can be incorporated into vectors for further manipulation.
  • vector or plasmid refers to discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof.
  • Suitable expression vectors are well-known in the art, and include vectors capable of expressing DNA operatively linked to a regulatory sequence, such as a promoter region that is capable of regulating expression of such DNA.
  • an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the inserted DNA.
  • Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.
  • a promoter region refers to a segment of DNA that controls transcription of DNA to which it is operatively linked.
  • the promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation.
  • the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences may be cis acting or may be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, may be constitutive or regulated.
  • Exemplary promoters contemplated for use in the practice of the present invention include the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid- inducible promoter, Moloney murine leukemia virus (MMLV) promoter, and the like.
  • CMV cytomegalovirus
  • MMTV mouse mammary tumor virus
  • MMLV Moloney murine leukemia virus
  • operatively linked refers to the functional relationship of DNA with regulatory and effector nucleotide sequences, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences.
  • operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
  • expression refers to the process well-known to those of skill in the art by which polynucleic acids are transcribed into mRNA and translated into peptides or proteins and, optionally thereafter, modified post-translationally . If the invention nucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA.
  • Prokaryotic transformation vectors are well-known in the art and include pBluescript and phage Lambda ZAP vectors (STRATAGENE, San Diego, CA) , and the like. Other suitable vectors and promoters are disclosed in detail in U.S. Patent No. 4,798,885, issued January 17, 1989, the disclosure of which is incorporated herein by reference in its entirety.
  • Suitable vectors for transformation of E. coli cells include the pET expression vectors
  • T7 promoter T7 terminator
  • E. coli ompT secretion signal Another suitable vector is the pIN-IIIompA2 (see Duffaud et al . , Meth. in Enzymology, 153:492-507, 1987), which contains the lpp promoter, the lacUV5 promoter operator, the ompA secretion signal, and the lac repressor gene.
  • Exemplary, eukaryotic transformation vectors include the cloned bovine papilloma virus genome, the cloned genomes of the murine retroviruses, and eukaryotic cassettes, such as the pSV-2 gpt system (described by Mulligan and Berg, Nature 277:108-114, 1979) the
  • Particularly preferred base vectors which contain regulatory elements that can be linked to the invention DS-CAM-encoding DNAs for transfection of mammalian cells are cytomegalovirus (CMV) promoter-based vectors such as pcDNAl (Invitrogen, San Diego, CA) , MMTV promoter-based vectors such as pMAMNeo (Clontech, Palo Alto, CA) and pMSG (Pharmacia, Piscataway, NJ) , and SV40 promoter-based vectors such as pSV ⁇ (Clontech, Palo Alto, CA) .
  • CMV cytomegalovirus
  • pcDNAl Invitrogen, San Diego, CA
  • MMTV promoter-based vectors such as pMAMNeo (Clontech, Palo Alto, CA) and pMSG (Pharmacia, Piscataway, NJ)
  • SV40 promoter-based vectors such as pSV ⁇ (Clontech,
  • nucleic acid molecules i.e., DNA or mRNA
  • suitable host cells preferably bacterial cells, and more preferably E. coli cells, as well as methods applicable for culturing said cells containing a gene encoding a heterologous protein, are generally known in the art. See, for example, Sambrook et al . , supra , 1989.
  • Exemplary methods of transformation include, e.g., transformation employing plasmids, viral, or bacterial phage vectors, transfection, electroporation, lipofection, and the like.
  • the heterologous DNA can optionally include sequences which allow for its extrachromosomal maintenance, or said heterologous DNA can be caused to integrate into the genome of the host (as an alternative means to ensure stable maintenance in the host) .
  • Host organisms contemplated for use in the practice of the present invention include those organisms in which recombinant production of heterologous proteins has been carried out.
  • Exemplary cells for introducing DNA include cells of mammalian origin (e.g., COS cells, mouse L cells, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, African green monkey cells and other such cells known to those of skill in the art) , amphibian cells (e.g., Xenopus laevis o ⁇ cytes) , yeast cells (e.g., Saccharomyces cerevisiae, Candida tropicalis, Hansenula polymorpha and P . pastoris; see, e.g., U.S. Patent Nos. 4,882,279, 4,837,148, 4,929,555 and 4,855,231), bacteria (e.g., E. coli ) , and the like.
  • mammalian origin e.g., COS cells, mouse L cells
  • nucleic acids encoding the invention DS-CAM proteins can be delivered into mammalian cells, either in vivo or in vitro using suitable viral vectors well-known in the art.
  • suitable viral vectors well-known in the art.
  • Suitable retroviral vectors, designed specifically for in vivo "gene therapy" methods are described, for example, in WIPO publications WO 9205266 and WO 9214829, which provide a description of methods for efficiently introducing nucleic acids into human cells in vivo .
  • the introduction of the antisense strand of the invention nucleic acid is contemplated.
  • anti-DS-CAM antibodies having specific reactivity with DS-CAM polypeptides of the present invention. Active fragments of antibodies are encompassed within the definition of "antibody” .
  • Invention antibodies can be produced by methods known in the art using invention polypeptides, proteins or portions thereof as antigens. For example, polyclonal and monoclonal antibodies can be produced by methods well known in the art, as described, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, 1988) , which is incorporated herein by reference. Invention polypeptides can be used as immunogens in generating such antibodies.
  • synthetic peptides can be prepared (using commercially available synthesizers) and used as immunogens .
  • Amino acid sequences can be analyzed by methods well known in the art to determine whether they encode hydrophobic or hydrophilic domains of the corresponding polypeptide.
  • Altered antibodies such as chimeric, humanized, CDR-grafted or bifunctional antibodies can also be produced by methods well known in the art. Such antibodies can also be produced by hybridoma, chemical synthesis or recombinant methods described, for example, in Sambrook et al . , supra , 1989; and Harlow and Lane, supra, 1988. Both anti-peptide and anti-fusion protein antibodies can be used, (see, for example, Bahouth et al . , Trends Pharmacol. Sci. 12:338
  • Antibody so produced can be used, inter alia, in diagnostic methods and systems to detect the level of DS-CAM protein present in a mammalian, preferably human, body sample, such as tissue or vascular fluid. Such antibodies can also be used for the immunoaffinity or affinity chromatography purification of the invention DS-CAM protein.
  • methods are contemplated herein for detecting the presence of DS-CAM polypeptides on the surface of a cell comprising contacting the cell with an antibody that specifically binds to DS-CAM polypeptides, under conditions permitting binding of the antibody to the polypeptides, detecting the presence of the antibody bound to the cell, and thereby detecting the presence of invention polypeptides on the surface of the cell. With respect to the detection of such polypeptides, the antibodies can be used for in vitro diagnostic or in vivo imaging methods.
  • Immunological procedures useful for in vitro detection of target DS-CAM polypeptides in a sample include immunoassays that employ a detectable antibody.
  • immunoassays include, for example, ELISA, Pandex microfluorimetric assay, agglutination assays, flow cytometry, serum diagnostic assays and immunohistochemical staining procedures which are well known in the art.
  • An antibody can be made detectable by various means well known in the art.
  • a detectable marker can be directly or indirectly attached to the antibody.
  • Useful markers include, for example, radionucleotides, enzymes, fluorogens, chromogens and chemiluminescent labels.
  • compositions comprising a carrier and an amount of an antibody having specificity for DS-CAM polypeptides effective to block naturally occurring ligands or other DS-CAM-binding proteins from binding to invention DS-CAM polypeptides are contemplated herein.
  • a monoclonal antibody directed to an epitope of DS-CAM polypeptide molecules present on the surface of a cell and having an amino acid sequence substantially the same as an amino acid sequence for a cell surface epitope of a DS-CAM polypeptide including the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9, can be useful for this purpose.
  • the present invention further provides transgenic non-human mammals that are capable of expressing exogenous nucleic acids encoding DS-CAM polypeptides.
  • exogenous nucleic acid refers to nucleic acid sequence which is not native to the host, or which is present in the host in other than its native environment (e.g., as part of a genetically engineered DNA construct) .
  • transgenic non-human mammals capable of expressing nucleic acids encoding DS-CAM polypeptides so mutated as to be incapable of normal activity, i.e., do not express native DS-CAM.
  • the present invention also provides transgenic non-human mammals having a genome comprising antisense nucleic acids complementary to nucleic acids encoding DS-CAM polypeptides, placed so as to be transcribed into antisense mRNA complementary to mRNA encoding DS-CAM polypeptides, which hybridizes to the mRNA and, thereby, reduces the translation thereof.
  • the nucleic acid may additionally comprise an inducible promoter and/or tissue specific regulatory elements, so that expression can be induced, or restricted to specific cell types.
  • nucleic acids are DNA or cDNA having a coding sequence substantially the same as the coding sequence shown in SEQ ID NO:l.
  • An example of a non-human transgenic mammal is a transgenic mouse.
  • tissue specificity- determining elements are the metallothionein promoter and the L7 promoter.
  • Animal model systems which elucidate the physiological and behavioral roles of DS-CAM polypeptides are also provided, and are produced by creating transgenic animals in which the expression of the DS-CAM polypeptide is altered using a variety of techniques. Examples of such techniques include the insertion of normal or mutant versions of nucleic acids encoding a DS-CAM polypeptide by microinjection, retroviral infection or other means well known to those skilled in the art, into appropriate fertilized embryos to produce a transgenic animal. See, for example, Hogan et al . , Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratory, 1986) .
  • DS-CAM genes are used with the native gene locus in transgenic animals, to alter the regulation of expression or the structure of DS-CAM polypeptides (see, Capecchi et al . , Science 244:1288, 1989; Zimmer et al . , Nature 338:150,
  • Homologous recombination techniques are well known in the art. Homologous recombination replaces the native (endogenous) gene with a recombinant or mutated gene to produce an animal that cannot express native (endogenous) protein but can express, for example, a mutated protein which results in altered expression of DS-CAM polypeptides .
  • microinj ection adds genes to the host genome, without removing host genes.
  • Microinjection can produce a transgenic animal that is capable of expressing both endogenous and exogenous DS-CAM protein.
  • Inducible promoters can be linked to the coding region of nucleic acids to provide a means to regulate expression of the transgene.
  • Tissue specific regulatory elements can be linked to the coding region to permit tissue-specific expression of the transgene.
  • Transgenic animal model systems are useful for in vivo screening of compounds for identification of specific ligands, i.e., agonists and antagonists, which activate or inhibit protein responses.
  • Invention nucleic acids, oligonucleotides (including antisense) , vectors containing same, transformed host cells, polypeptides and combinations thereof, as well as antibodies of the present invention can be used to screen compounds in vitro to determine whether a compound functions as a potential agonist or antagonist to invention polypeptides.
  • These in vitro screening assays provide information regarding the function and activity of invention polypeptides, which can lead to the identification and design of compounds that are capable of specific interaction with one or more types of polypeptides, peptides or proteins.
  • a method for identifying compounds which bind to DS-CAM polypeptides may be employed in a competitive binding assay.
  • Such an assay can accommodate the rapid screening of a large number of compounds to determine which compounds, if any, are capable of binding to DS-CAM proteins. Subsequently, more detailed assays can be carried out with those compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of invention proteins .
  • test samples e.g., biological fluids
  • test samples e.g., biological fluids
  • serum from a patient displaying symptoms thought to be related to over- or under-production of DS-CAM can be assayed to determine if the observed symptoms are indeed caused by over- or under-production of DS-CAM.
  • invention polypeptides are contacted with an "unknown” or test substance (in the presence of a reporter gene construct when antagonist activity is tested) , the activity of the polypeptide is monitored subsequent to the contact with the "unknown” or test substance, and those substances which cause the reporter gene construct to be expressed are identified as functional ligands for DS-CAM polypeptides.
  • transformed host cells that recombinantly express invention polypeptides can be contacted with a test compound, and the modulating effect (s) thereof can then be evaluated by comparing the DS-CAM-mediated response (e.g., via reporter gene expression) in the presence and absence of test compound, or by comparing the response of test cells or control cells (i.e., cells that do not express DS-CAM polypeptides), to the presence of the compound.
  • a compound or a signal that "modulates the activity" of invention polypeptides refers to a compound or a signal that alters the activity of DS-CAM polypeptides so that the activity of the invention polypeptide is different in the presence of the compound or signal than in the absence of the compound or signal .
  • such compounds or signals include agonists and antagonists.
  • An agonist encompasses a compound or a signal that activates DS-CAM protein expression.
  • an antagonist includes a compound or signal that interferes with DS-CAM protein expression.
  • the effect of an antagonist is observed as a blocking of agonist-induced protein activation.
  • Antagonists include competitive and non-competitive antagonists.
  • a competitive antagonist interacts with or near the site specific for agonist binding.
  • a non-competitive antagonist or blocker inactivates the function of the polypeptide by interacting with a site other than the agonist interaction site.
  • assay methods for identifying compounds that modulate DS-CAM activity generally require comparison to a control.
  • One type of a "control” is a cell or culture that is treated substantially the same as the test cell or test culture exposed to the compound, with the distinction that the "control" cell or culture is not exposed to the compound.
  • control is a cell or culture that is identical to the transfected cells, with the exception that the "control" cell or culture do not express native proteins.
  • the response of the transfected cell to compound is compared to the response (or lack thereof) of the "control" cell or culture to the same compound under the same reaction conditions.
  • invention DS-CAM proteins interact with extracellular ligands.
  • invention DS-CAM proteins act specifically in concert or in competition with other
  • the present invention contemplates various bioassays for identifying ligands for invention DS-CAM proteins.
  • the present invention contemplates an assay measuring the effect of co-expressing during development either normal or defective invention DS-CAMs with other CAMs known in the art to assess the resulting phenotype.
  • a bioassay for evaluating whether test compounds are capable of acting as agonists comprises: (a) culturing cells containing:
  • the bioassay for evaluating whether test compounds are capable of acting as antagonists for DS-CAM protein (s) of the invention, or functional modified forms of said DS-CAM protein (s), comprises:
  • step (a) of the above-described antagonist bioassay culturing may also be carried out in the presence of : fixed concentrations of at least one compound whose ability to inhibit signal transduction activity of DS-CAM protein (s) is sought to be determined, and an increasing concentration of at least one agonist for DS-CAM protein (s) , or functional modified forms thereof .
  • the bioassay for evaluating whether test compounds are capable of acting as agonists or antagonists comprises: (a) culturing cells containing:
  • Methods well-known in the art that measure intracellular levels of cAMP, or measure cyclase activity can be employed in binding assays described herein to identify agonists and antagonists of the DS-CAM. For example, because activation of some CAMs results in decreases or increases in cAMP, assays that measure intracellular cAMP levels can be used to evaluate recombinant DS-CAMs expressed in mammalian host cells.
  • ability to modulate signal transduction activity of DS-CAM protein refers to a compound that has the ability to either induce (agonist) or inhibit (antagonist) signal transduction activity of the DS-CAM protein.
  • Each of the invention bioassays can be conducted as competitive assays by co-expressing one or more members of the CAM immunoglobulin superfamily of proteins known in the art, such as N-CAMs, along with invention DS-CAMs.
  • one or more members of the CAM immunoglobulin superfamily of proteins known in the art can be co-expressed with invention DS-CAMs to evaluate the agonistic or antagonistic effect on signal transduction of the non-DS-CAM members acting in concert with invention DS-CAMS.
  • the activation of DS-CAM polypeptides can be modulated by contacting the polypeptides with an effective amount of at least one compound identified by the above-described bioassays.
  • N-CAM N-CAM superfamily of immunoglobulins
  • various alterations of N-CAM levels have been seen in degenerative disease, developmental defects, and toxic conditions.
  • Increases in the levels of N-CAM in the cerebrospinal fluid of patients with multiple sclerosis have been observed to parallel their clinical improvement (Massaro et al . , Ital. J. Neurol . Sci. Suppl . 6:85-88, 1987).
  • Levels of N-CAM were reported to be elevated in the amniotic fluid of mothers carrying fetuses with neural tube defects (Ibsen et al . , J. Neurochem. 41:363-366, 1983).
  • E-A conversion itself has been found to be delayed in the mouse mutant staggerer (Edelman and Chuong, Proc. Natl. Acad. Sci. USA, 79:7036-7042, 1982) in conjunction with the connectivity changes associated with the mutation.
  • DS-CAM Down Syndrome
  • the Ts65Dn mouse model of DS contains the region of MMU16 (Pgkl-psl to MXl/2) that includes
  • HCR Hirschsprung ' s disease
  • the DS-CAM gene maps within this small region.
  • the expression of DS-CAM in the neural crest derived enteric plexus of the gut was detected by mouse tissue in situ hybridization (Example 7) .
  • the function of the DS- CAM protein as a neural cell adhesion molecule and the association of this region of chromosome 21 with HSCR, indicate that DS-CAM can play a role in the migration of the cranial neural crest that populate this region.
  • DS-CAM overexpression is responsible for the chromosome 21 association in non-DS HSCR and for the HSCR seen in DS .
  • the perturbation of development by the aneuploid expression of CAM-LI supports a role for the aneuploid expression of DS-CAM in the causation of developmental and neurological abnormalities.
  • DS-CAM associated disease such as mental retardation, holoprosencephaly, agenesis of the corpus callosum, or schizencephaly
  • said method comprising: detecting, in said subject, a genomic or transcribed mRNA sequence including SEQ ID NO : 1 or SEQ ID NO: 10, or fragments thereof.
  • the DS-CAM nucleic acids detected in accordance with the invention diagnostic methods are either mutated in one form or another (such as point mutations, deletions, and the like), or are overexpressed relative to levels of DS-CAM expression in healthy non-diseased individuals.
  • diagnostic systems preferably in kit form, comprising at least one invention nucleic acid in a suitable packaging material .
  • the diagnostic nucleic acids are derived from the DS-CAM-encoding nucleic acids described herein.
  • the diagnostic nucleic acids are derived from SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9 or SEQ ID NO: 10.
  • Invention diagnostic systems are useful for assaying for the presence or absence of nucleic acid encoding DS-CAM in either genomic DNA or in transcribed nucleic acid (such as mRNA or cDNA) encoding DS-CAM.
  • a suitable diagnostic system includes at least one invention nucleic acid, preferably two or more invention nucleic acids, as a separately packaged chemical reagent (s) in an amount sufficient for at least one assay. Instructions for use of the packaged reagent are also typically included. Those of skill in the art can readily incorporate invention nucleic probes and/or primers into kit form in combination with appropriate buffers and solutions for the practice of the invention methods as described herein.
  • packaging material refers to one or more physical structures used to house the contents of the kit, such as invention nucleic acid probes or primers, and the like.
  • the packaging material is constructed by well known methods, preferably to provide a sterile, contaminant-free environment.
  • the packaging material has a label which indicates that the invention nucleic acids can be used for detecting a particular sequence encoding DS-CAM including the nucleotide sequence set forth in SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10, thereby diagnosing the presence of, or a predisposition for, holoprosencephaly, agenesis of the corpus callosum, or for several phenotypes of Down Syndrome including mental retardation, and the like.
  • packaging material contains instructions indicating how the materials within the kit are employed both to detect a particular sequence and diagnose the presence of, or a predisposition for, holoprosencephaly, agenesis of the corpus callosum, or for several phenotypes of Down syndrome including mental retardation, and the like.
  • packaging materials employed herein in relation to diagnostic systems are those customarily utilized in nucleic acid-based diagnostic systems.
  • the term "package” refers to a solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding within fixed limits an isolated nucleic acid, oligonucleotide, or primer of the present invention.
  • a package can be a glass vial used to contain milligram quantities of a contemplated nucleic acid, oligonucleotide or primer, or it can be a microtiter plate well to which microgram quantities of a contemplated nucleic acid probe have been operatively affixed.
  • Instructions for use typically include a tangible expression describing the reagent concentration or at least one assay method parameter, such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions, and the like.
  • BAC library construction of Bacterial Artificial Chromosome (BAC) library was performed as described in Shizuya et al . , Proc. Natl. Acad. Sci. USA 89:8794-8797, 1992; and Hubert et al . , Genomics 41:218-226, 1997.
  • Yeast artificial chromosome (YAC) clones were obtained from the CEPH mega-YAC library and grown under standard conditions (Cohen et al . , Nature 366:689-701 1993).
  • PI artificial chromosome (PAC) library construction A 3X human PAC library, designated RPCI-1
  • the library was arrayed in 384 well dishes. Subsequently, STSs generated by sequencing of clones using vector primers were used as hybridization probes to gridded colony filters of the PAC library.
  • YAC DNA preparation YAC clones were grown in selective media, pelleted and resuspended in 3 ml 0.9 M sorbitol, 0. IM EDTA pH 7.5, then incubated with 100 U of lytocase (Sigma, St. Louis, MO) at 37°C for 1 hour. After centrifugation for 5 minutes at 5,000 rpm pellets were resuspended in 3 ml 50 mM Tris pH 7.45, 20 mM EDTA 0.3ml 10% SDS was added and the mixture was incubated at 65°C for 30 minutes. One ml of 5 M potassium acetate was added and tubes were left on ice for 1 hour, then centrifuged at 10,000 rpm for 10 minutes. Supernatant was precipitated in 2 volumes of ethanol and pelleted at 6,000 rpm for 15 minutes. Pellets were resuspended in TE, treated with RNase and reextracted with phenol -chloroform.
  • FISH Fluorescence in situ hybridization
  • PAC or BAC clones were biotinylated by nicktranslation in the presence of biotin-14-dATP using the BioNick Labeling Kit (Gibco-BRL) .
  • FISH was performed essentially as described (Korenberg et al . , Cytogenet . Cell Genet. 69:196-200, 1995). Briefly, 400 ng of probe
  • DNA was mixed with 8 ng of human Cot 1 DNA (Gibco-BRL) and 2 ⁇ g of sonicated salmon sperm DNA in order to suppress possible background produced from repetitive human sequences as well as yeast sequences in the probe.
  • the probes were denatured at 75°C, preannealed at 37°C for one hour, and applied to denatured chromosome slides prepared from normal male lymphocytes (Korenberg et al . , supra , 1995) . Post-hybridization washes were performed at 40°C in 2X SSC/50% formamide followed by washes in IX SSC at 50°C.
  • Hybridized DNAs were detected with avidin-conjugated fluorescent isothiocyanate (Vector Laboratories) .
  • One amplification was performed by using biotinylated anti-avidin.
  • a reverse banding technique was used, which was achieved by chromomycin A3 and distamycin A double staining (Korenberg et al . , supra , 1995) .
  • the color images were captured by using a Photometries Cooled-CCD camera and BDS image analysis software (Oncor Imaging, Inc . ) .
  • DNA was carried out on 0.8% agarose gels in IX TBE . Transfer of nucleic acids to Nybond N+ nylon membrane
  • Probes were labeled using RadPrime Labeling System (BRL) . Hybridization was carried out at 42°C for 16 hours in 50% formamide, 5X SSPE, 5X Denhardt ' s 0.1% SDS, 100 mg/ml denatured salmon sperm DNA. The filters were washed once in lx SSC, 0.1% SDS at room temperature for 20 minutes, and twice in 0. IX SSC, 0.1% SDS for 20 minutes at 65°C. The blots were exposed onto X-ray film (Kodak, X-OMAT-AR) .
  • PAC and BAC endcl ones were inoculated into 500 ml of LB/kanamycin and grown overnight.
  • BAC clones were inoculated into 500 ml of LB/chloramphenicol and grown overnight .
  • DNAs were isolated using QIAGEN columns according to the vendors protocol with one additional phenol/chloroform/isoamylalcohol extraction followed by one additional chloroform/isoamylalcohol extraction. Clones were sequenced using the Gibco-BRL cycle sequencing kit with standard T7 and SP6 primers .
  • BACs Bacterial Artificial Chromosomes
  • PACs PI Artificial Chromosomes
  • the minimal contig sizes as determined by counting only non-overlapping clones are: 1100 kb, 900 kb, 510 kb, 380 kb and 270 kb .
  • Insert size of BAC clones was measured by running pulse-field gel electrophoresis after digesting DNA with NotI.
  • BAC-423A5 BAC-430F1, BAC-628H2, BAC-371H8 and PAC-31P10
  • Figure 1 Yamakawa et al . , Cytogenet . Cell Genet. 74:140-145, 1996) was applied to BAC-423A5, BAC-430F1, BAC-628H2, BAC-371H8 and PAC-31P10 ( Figure 1) by using cDNA from trisomy 21 human fetal brain, and the selected fragments were then subcloned into a plasmid vector.
  • Total RNA was isolated from 14 week trisomy 21 fetal brain using TRI regionTM (Molecular Research Center, Inc.) .
  • Poly (A) + RNA was isolated using Poly (A) Quick mRNA isolation kit (STRATAGENE) .
  • Double stranded cDNA was synthesized using SuperscriptTM Choice System (GIBCO BRL) from 5 ⁇ g trisomy 21 fetal brain poly (A) + RNA using 1 ⁇ g oligo (dT) 15 or 0.1 ⁇ g random hexamer.
  • the entire synthesis reaction was purified by Gene Clean II kit (BIO101, Inc.) and then kinased. Sau3AI linker was attached to the cDNA which was subsequently digested with Sau3AI .
  • the reaction was purified using Gene Clean.
  • Mbol linker was attached to the cDNA and the reaction purified by Gene Clean (Morgan et al . , supra, 1992) .
  • the synthesized product was amplified by PCR using one strand of Mbol linker ( 5 ' CCTGATGCTCGAGTGAATTC3 ' ) (SEQ ID NO : 4 ) as a primer.
  • PCR cycling conditions were 40 cycles of 94°C/15 seconds, 60°C/23 seconds, 72°C/2 minutes in a 100 ⁇ l of lx PCR buffer (Promega) , 3 mM MgCl 2 , 5.0 units of Taq polymerase (Promega), 2 ⁇ M primer and 0.2 mM dNTPs .
  • BAC DNAs total 2.5 ⁇ g
  • 2 PAC DNAs between the region ETS2 and MX1 were prepared using QIAGEN plasmid kit and were biotinylated using Nick Translation Kit and biotin-16-dUTP (Boehringer Manneheim) .
  • 3 ⁇ g of heat denatured PCR amplified cDNA was annealed with 3 ⁇ g of heat denatured COTl DNA (BRL) in lOO ⁇ l hybridization buffer (750 mM NaCl, 50 mM NaP0 4 (pH7.2) , 5 mM EDTA, 5X Denhardt' s, 0.05% SDS and 50% formamide) at 42°C for two hours.
  • cDNA-BAC DNA hybrids were precipitated with EtOH and dissolved in 60 ⁇ l of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. After addition of 40 ⁇ l 5 M NaCl, the DNA was incubated with magnetic beads (Dynabeads M-280, Dynal) at 25°C for 1 hour with gentle rotating to allow attachment of the DNA to the magnetic beads.
  • the beads were then washed twice by pipetting in 400 ⁇ l of 2X SSC, setting in magnet holder (MPC-E TM , Dynal) for 30 seconds and removing the supernatant. Four additional washes were performed in 0.2X SSC at 68°C for 10 minutes each with transfer of the beads to new tubes at each wash.
  • cDNAs were eluted in lOO ⁇ l of distilled water for 10 minutes at 80°C with occasional mixing.
  • the eluted cDNAs were amplified by PCR as described above. After twice repeating the selection procedure using magnetic beads, amplified cDNAs were digested with EcoRI and subcloned into pBlueScript KS+ (STRATAGENE) . Insert DNAs were isolated from the subclones, and were analyzed by Southern hybridization and DNA sequencing.
  • the direct cDNA selection procedure using 19 BACs and 2 PACs between ETS2 and MXl generated a total of 145 unique cDNA fragments.
  • a cDNA library from a trisomy 21 fetal brain at 14 weeks gestation was screened using one of these unique cDNA fragments labeled "E51" (SEQ ID NO: 3) .
  • a trisomy 21 human fetal brain (14 weeks of age) cDNA library was constructed using ZAP-cDNA ® synthesis kit (STRATAGENE) which generates a unidirectional cDNA library. Briefly, double- stranded cDNA was synthesized from 5 ⁇ g trisomy 21 fetal brain poly (A) + RNA using a hybrid oligo (dT) -Xhol linker primer with 5-methyl dCTP . An EcoRI linker was attached to the cDNA which was subsequently digested with EcoRI and Xhol, and then cloned into UNI -ZAP XR vector (STRATAGENE) . The library was packaged using Gigapack ® II Gold packaging extract. The titer of the original library was 1.1 x 10 s p. f . u. /package . The library was amplified once. A blue-white color assay indicated that 99% of the clones had inserts.
  • DS-CAM-42 revealed a 6110 bp DNA sequence which contained a large ORF (5687 bp) as well as 3 ' -UTR sequence (423 bp) , but the 5 ' UTR and start codon were not located in clone DS-CAM-42.
  • DS-CAM-18 of 6.5 kb
  • DS-CAM-52 of 6.6 kb were characterized. Sequence analyses of these clones close to the 5 ' end overlap with sequence at the 5' end of DS-CAM-42. However, DS-CAM-18 extends 416 bp farther 5', and DS-CAM-52 extends 494 bp farther 5' than DS-CAM-42.
  • the extra 494 bp sequence extends the ORF by 43 bp at the 5' end and contains a start codon. Two stop codons occur 330 bp and 427 bp upstream of the start codon.
  • the 494 bp of additional 5' sequence found in DS-CAM-52 combined with DS-CAM-42 (6604 bp) yield a consensus cDNA that encodes one isoform of the invention protein labeled DS-CAMl.
  • the DS-CAMl cDNA contains an open reading frame of 5730 bp (SEQ ID NO:l) coding for a 1910 amino acid protein (SEQ ID NO : 2 ; approximately 211 kilodaltons), flanked by 452 bp of 5 ' -UTR and 422 bp of 3' -UTR.
  • the 5 ' -UTR is highly GC rich (81% GC over 452 bp) and contains 13 Mspl sites, as well as 72 CG and 93 GC dinucleotide pairs.
  • the DS-CAMl protein contains an extracellular component at the N-terminus consisting of nine tandemly repeated Ig-like C2 type domains and a tenth Ig-like C2 domain located between domains four and five of an array of six repeated fibronectin type III domains ( Figure 2) .
  • Each Ig-like C2 domain consists of approximately 100 amino acids with a pair of conserved cysteines separated by 49-56 residues.
  • a single transmembrane domain of 22 amino acids was defined by using the TMBASE program (Hoffmann and Stoffel, Biol. Chem. Hoppe-Seyler 374:166,
  • the putative protein contains 16 potential N-glycosylation sites.
  • Ig immunoglobulin
  • Homology searches with sequences of Ig type-C2 domains and fibronectin type-Ill domains of the most highly related Ig-superfamily members (CAM-LI, DCC, and axonin-1) were conducted by using the FASTA program (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444-2448, 1988).
  • DS-CAM2 a splice variant cDNA sequence encoding a non-membrane bound isoform of DS-CAMl, referred to herein as DS-CAM2, is provided herein.
  • Two human DS-CAM cDNA clones (DS-CAM-18 and DS-CAM-52) were found to contain identical deletions of 191 bp that occur in neighboring exons and that delete bp 5133 to 5323 of the SEQ ID NO : 1 cDNA sequence encoding DS-CAMl ( Figure
  • the resulting splice variant transcript encoding DS- CAM2 (SEQ ID NO: 10) is deleted for the entire transmembrane domain that is encoded by the more 3 ' of these exons. Further, the deletion changes the reading frame and creates a stop codon 36 bp downstream of the deletion resulting in a soluble extracellular protein of 1571 amino acids (SEQ ID NO: 11) .
  • the distal border of the resulting deletion contains the canonical AG of the RNA splicing consensus acceptor site.
  • the proximal border contains a variant of the donor splice site consensus sequence (Jackson, Nucl . Acids Res . 19:3795-
  • BACs 816F6, 116E8, 720G4, 619H8 were only positive for DS-CAM-18 and DS-CAM-52 but negative for DS-CAM-42. All other BACs shown in Figure 1 were negative. These results indicate that the DS-CAM gene spans 900 kb-1200 kb genomic DNA and covers a gap in this BAC and PAC contig indicated by an arrowhead as well as in the available YAC contigs (Korenberg et al . , Genome Res. 5:427-443, 1995; Gardiner et al., Somat . Cell Mol. Genet. 21:399-414, 1995).
  • DS-CAM cDNA sequences were confirmed to originate from these BACs and PACs by direct sequencing of the BACs and PACs as templates using cDNA sequence-specific primers.
  • the map position of DS-CAM on chromosome 21q22.2-22.3 was confirmed by using clone DS-CAM-42 as a probe for fluorescence in-situ hybridization. Two independent experiments were performed and over 100 metaphase cells were evaluated. Signals were clearly seen on two chromatids of at least one chromosome in 85% of cells. There were no other double signal sites seen in greater than 1% of cells.
  • Inserts containing DS-CAM cDNA were excised from the base vector by digestion with Xhol and EcoRI. After labeling using the random priming method (RadPrime Labeling System; GIBCO BRL) , followed by purification using G-50 Sephadex columns (Quick Spin Column; Boehringer Mannheim) , the fragments were used a probes for Northern hybridization using Multiple Tissue Northern Blot (Clontech) .
  • a Northern blot assay was conducted using DS-CAM cDNA as a probe in various fetal and adult tissues including heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. Northern hybridization was performed by following the manufacturer's instructions.
  • the hybridized membrane was washed at a final stringency of 0. IX SSC and 0. IX SDS at 50°C.
  • the filter was exposed to X-ray film (Kodak X-OMAT AR) at -70°C for 1-5 days.
  • the 9.7 kb transcript is highly expressed in the substantia nigra, moderately expressed in amygdala and hippocampus, and less expressed in the whole brain.
  • a similar pattern is obtained using a PCR product which spans the 191 bp deletion found in clones DS-CAM-18 and DS-CAM-52 encoding the splice variant sequence corresponding to DS-CAM2.
  • splice variant cDNA transcripts encoding a DS-CAM family of proteins are clearly contemplated by the present invention.
  • RT-PCR Reverse-transcriptase polymerase chain reaction
  • the cDNAs from 13 independent human fetal and adult sources were analyzed by PCR using primer pairs that flanked the alternatively spliced region that results in a 191 base pair deletion of nucleotides 5133- 5323 of the DS-CAMl cDNA set forth in SEQ ID NO : 1.
  • the primers were designed to generate products of different sizes for each of the two alternatively spliced transcripts: 536 bp corresponding to the non-deleted DS-CAM-1 transcript and 345 bp corresponding to the deleted DS-CAM2 transcripts.
  • the analyses included adult samples from amygdala (24 years) , skeletal muscle (36 years) and three independent lymphoblastoid cell lines.
  • Fetal samples included whole brain of a trisomy 21 fetus (14 weeks), four from whole brain (4.5-13 weeks), one from temporal lobe (28 weeks) and two from heart (4.5 and 13 weeks) .
  • the results indicate that all fetal and adult samples produced two bands corresponding to PCR products of the predicted sizes which indicates the expression of two alternatively spliced transcripts.
  • a mouse brain cDNA library was prepared from 19 week old female C57 Black/6 mice in the Uni-ZAP XR Vector (STRATAGENE) .
  • the cDNAs were oligo-dT primed and cloned unidirectionally into the EcoRI and Xhol sites of the vector.
  • the average insert size is 1.0 kb.
  • the library was screened using a human DS-CAM cDNA clone as a probe. Two partial mouse DS-CAM cDNA clones were isolated and sequenced.
  • the combined nucleotide sequences of these clones are set forth in SEQ ID NO : 7 , SEQ ID NO : 8 and SEQ ID NO: 9, and were found to represent the 5', middle and 3' portions, respectively, of cDNA encoding a mouse DS-CAM.
  • Embryos were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) overnight, dehydrated and infiltrated with paraffin.
  • PBS phosphate buffered saline
  • Five to seven micron serial sections were mounted on gelatinized slides. Two sections were mounted/slide, deparaffinized in xylene, rehydrated and post-fixed. The sections were digested with proteinase K, post-fixed, treated with tri-ethanolamine/acetic anhydride, washed and dehydrated.
  • cRNA probes were prepared from DS-CAM-M-14. The plasmid was linearized with Xbal and T7 polymerase was used to generate the antisense cRNA.
  • the plasmid was linearized with Kpnl and T3 polymerase was used to generate the sense control cRNA.
  • the cRNA transcripts were synthesized according to manufacturer's conditions (STRATAGENE) and labeled with 35 S-UTP (>1000 Ci/mmol;
  • cRNA transcripts larger than 100 nucleotides were subjected to alkali hydrolysis to give a mean size of 70 bases for efficient hybridization.
  • Sections were hybridized overnight at 52°C in 50% deionized formamide, 0.3M NaCl, 20 mM Tris-HCl pH 7.4, 5 mM EDTA, 10 mM NaP04 , 10% dextran sulfate, lx Denhardt 's, 50 ⁇ g/ml total yeast RNA, and 50-75,000 cpm/ ⁇ l 35 S-labeled cRNA probe.
  • the tissue was subjected to stringent washing at 65°C in 50% formamide, 2X SSC, 10 mM DTT and washed in PBS before treatment with 20 ⁇ g/ml
  • Tissue in situ hybridization analysis was performed using a mouse cDNA as a probe on sections of normal mouse embryos from days 8.5-17.5 post coitum (pc) as well as in newborn, two weeks and adult brains as described above. The results indicate that there is no detectable expression of DS-CAM at 8.5 days pc . At 9.5 days pc, expression was detected in the neuroepithelium. Low levels of expression were detected within the branchial arches, suggestive of migrating neural crest cells. At 10.5 days pc, the trigeminal ganglia (neural crest derived) begin to express the transcript and expression within the branchial arches was more evident.
  • Expression at 11.5 days pc was abundant throughout the brain.
  • the transcript was found within the regions of the nervous system that differentiate earliest during development (Altman and Bayer, supra , 1995) . In the brain, this includes the ventral-most regions, such as the thalamus and medulla. Some expression was detected within the olfactory epithelium. Expression within the neural tube begins in two areas: the ventrolateral (corresponding to the areas in which the motor neurons differentiate) and the lateral gray columns (that later form commissural neurons) (Leber et al . , J Neurosci . 15:1236-1248, 1990). The dorsal root ganglia (neural crest derived) expressed the transcript at 11.5 days pc .
  • the trigeminal ganglia show higher levels at 11.5 days pc than they did at 10.5 days.
  • Migrating neural crest can be seen within the maxilla, the mandibular arch, and in the developing gut. Signal was observed within the mesenchyme surrounding the umbilical vein and artery.
  • the gonad exhibits signal both in the granule cells and within the tufted mitral cells.
  • the olfactory bulb exhibits signal both in the granule cells and within the tufted mitral cells.
  • the transcript was expressed most extensively within the differentiating regions such as the septal area, olfactory bulb, inferior colliculus and hippocampus.
  • the gene was expressed in many areas including amygdala, cortex, hippocampus and thalamus.
  • the transcripts were detected in the Purkinje cell layer and in the deep cerebellar nuclei.
  • SEQ ID N0:1 is the nucleic acid sequence (and the deduced amino acid sequence) of cDNA encoding a novel human DS-CAMl protein of the present invention.
  • SEQ ID NO : 2 is the deduced amino acid sequence of a human DS-CAMl protein of the present invention.
  • SEQ ID NO: 3 is the cDNA probe (labeled "E51") used to isolate cDNA encoding human DS-CAM.
  • SEQ ID NO: 4 is an Mbol linker sequence.
  • SEQ ID NO: 5 is a primer labeled B9-131F used in the RT-PCR assay described in Example 5.
  • SEQ ID NO: 6 is a primer labeled B9-131R used in the RT-PCR assay described in Example 5.
  • SEQ ID NO : 7 is the 5' region of a partial mouse-derived cDNA clone encoding an invention DS-CAM protein.
  • SEQ ID NO: 8 is the middle region of a partial mouse-derived cDNA clone encoding an invention DS-CAM protein.
  • SEQ ID NO:9 is the 3' region of a partial mouse-derived cDNA clone encoding an invention DS-CAM protein.
  • SEQ ID NO: 10 is the nucleic acid sequence (and the deduced amino acid sequence) of cDNA encoding a novel human DS-CAM2 protein of the present invention.
  • SEQ ID NO: 11 is the deduced amino acid sequence of a human DS-CAM2 protein of the present invention, which is a splice variant of DS-CAMl (SEQ ID NO: 2) .
  • GAG GCG TAC ATC ACT GTC GTC TCA TGG GAG AAA GAC ACT GTT TCA CTT 953 Glu Ala Tyr He Thr Val Val Ser Trp Glu Lys Asp Thr Val Ser Leu 155 160 165
  • GAC CAT CGC AAA GCC ATG GCT GGG CAG CGT GTG GAG CTG CCT TGC AAA 1193 Asp His Arg Lys Ala Met Ala Gly Gin Arg Val Glu Leu Pro Cys Lys 235 240 245
  • AAG AGC GAG CCC AGC AAC GAG CTC ACC ATC ACG GCG GAC GAG GCA GCT 3401 Lys Ser Glu Pro Ser Asn Glu Leu Thr He Thr Ala Asp Glu Ala Ala 970 975 980
  • AAG TTC ACA CTG ACA GCC CAA AAT GGA GTG GGC CCA GGG CGC ATA AGT 4841 Lys Phe Thr Leu Thr Ala Gin Asn Gly Val Gly Pro Gly Pro Gly Arg He Ser 1450 1455 1460 GAA ATC ATA GAA GCA AAG ACC TTA GGA AAA GAG CCC CAG TTC TCA AAG 4889 Glu He He Glu Ala Lys Thr Leu Gly Lys Glu Pro Gin Phe Ser Lys 1465 1470 1475
  • GAG TAC AGG CCC TTT GGG ACC ACA GTT TGG ACC ACA GCT CAG AGG ACC 5033 Glu Tyr Arg Pro Phe Gly Thr Thr Val Trp Thr Thr Ala Gin Arg Thr 1515 1520 1525
  • GCC AAG GCT GGG CCC ACA GCG AGA AAC CGC TAT GCC AGC CAG TGG ACC 5705 Ala Lys Ala Gly Pro Thr Ala Arg Asn Arg Tyr Ala Ser Gin Trp Thr 1740 1745 1750
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • AATTGATAGC ATGGCAGGAG AAGAAACCGG AATCTTCTCT CACTGTTGGC AAAATCTGCA 660
  • GAGTAGGTCC CGGGCGCATA AGTGAAATCA TAGAAGCCAA AACCCTGGGG AAAGAACCCC 480
  • CCCATCCTAC CATCTCTGCA CACACCCTCA CCACAGAATG AGACTGCTAC ACCAGGCTAC 1380
  • CTGCTCCATA CCTACGATGG ATTCTTGTTA AACCGGGCGC ACCAGGCACC AGCAGGACTG 1800
  • GAG GCG TAC ATC ACT GTC GTC TCA TGG GAG AAA GAC ACT GTT TCA CTT 953 Glu Ala Tyr He Thr Val Val Ser Trp Glu Lys Asp Thr Val Ser Leu 155 160 165
  • GAC CAT CGC AAA GCC ATG GCT GGG CAG CGT GTG GAG CTG CCT TGC AAA 1193 Asp His Arg Lys Ala Met Ala Gly Gin Arg Val Glu Leu Pro Cys Lys 235 240 245
  • CAC CAA AGC CAG TTG ATT GTC AGA GTT CCT CCC AAG TTT GTG GTT CAG 2537 His Gin Ser Gin Leu He Val Arg Val Pro Pro Lys Phe Val Val Gin 680 685 690 695
  • AAG AGC GAG CCC AGC AAC GAG CTC ACC ATC ACG GCG GAC GAG GCA GCT 3401 Lys Ser Glu Pro Ser Asn Glu Leu Thr He Thr Ala Asp Glu Ala Ala 970 975 980
  • GAG TAC AGG CCC TTT GGG ACC ACA GTT TGG ACC ACA GCT CAG AGG ACC 5033 Glu Tyr Arg Pro Phe Gly Thr Thr Val Trp Thr Thr Ala Gin Arg Thr 1515 1520 1525

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)

Abstract

In accordance with the present invention, there are provided novel Down Syndrome-Cell Adhesion Molecule (DS-CAM) proteins. Nucleic acid sequences encoding such proteins and assays employing same are also disclosed. The invention DS-CAM proteins can be employed in a variety of ways, for example, for the production of anti-DS-CAM antibodies thereto, in therapeutic compositions and methods employing such proteins and/or antibodies. DS-CAM proteins are also useful in bioassays to identify agonists and antagonists thereto.

Description

NUCLEIC ACID ENCODING DS-CAM PROTEINS AND PRODUCTS RELATED THERETO
This is a non-provisional application based on, and claims the benefit of, U.S. Provisional Application No. 60/029,322 filed October 25, 1996, the content of which is incorporated herein by reference in its entirety.
ACKNOWLEDGMENT
This invention was made with Government support under Grant Numbers HL50025 and HD17449 awarded by the National Institutes of Health and DE-FG03 -92ER61402 awarded by the Department of Energy. The Government has certain rights in this invention.
FIELD OF THE INVENTION
The present invention relates to nucleic acids and proteins encoded thereby. Invention nucleic acids encode a novel N-CAM member of the immunoglobulin superfamily of proteins. The invention also relates to methods for making and using such nucleic acids and proteins.
BACKGROUND OF THE INVENTION
Research spanning the last decade has significantly elucidated the molecular events attending cell-cell interactions in the body, especially those events involved in the movement and activation of cells in the immune system. See generally, Springer et al . , Nature 346:425-434, 1990. Cell surface proteins, and especially the so-called Cellular Adhesion Molecules ("CAMs") have correspondingly been the subject of pharmaceutical research and development having as its goal intervening in the processes of leukocyte extravasation to sites of inflammation and leukocyte movement to distinct target tissues. The isolation and characterization of cellular adhesion molecules, the cloning and expression of DNA sequences encoding such molecules, and the development of therapeutic and diagnostic agents relevant to inflammatory process, viral infection and cancer metastasis have also been the subject of numerous U.S. and foreign applications for Letters Patent. See Edwards, Current Opinion in Therapeutic Patents 1 (11) : 1617-1630 , 1991 and particularly the published "patent literature references" cited therein.
Numerous CAMs have been characterized to date. See, for example, vascular adhesion molecule (VCAM-1) as described in PCT WO 90/13300; platelet endothelial cell adhesion molecule (PECAM-1) described in Newman et al . , Science 247:1219-1222, 1990; and PCT WO 91/10683; and the following U.S. Patents: 5,525,487; 5,235,049; 5,272,263; 5,489,233; 5,264,554; 5,318,890; 5,389,520; 5,519,008; and the like.
There is substantial evidence that N-CAM and its relatives play an important part in neural development (Edelman and Crossin, "CELL ADHESION
MOLECULES: Implications for a Molecular Histology", Ann. Rev. Biochem. 60:155-190, 1991; and Walsh and Doherty,
Curr. Opinion in Cell Biol. 5:791-796, 1993) . For example, antibodies directed against N-CAMs disturbed the normal growth pattern of nerve processes. N-CAM (locus llq23.1) is expressed in large amounts in cells of the developing neural tube, but when neural crest cells dissociate from the neural tube and migrate away, they lose N-CAM, only to reexpress it later when they reaggregate to form a neural ganglion. In addition, Rosenthal et al . , (Nature Genet . 2:107-112, 1992) reported that mutations in CAM-LI (locus Xq28) cause X-linked hydrocephalus, and Jouet et al . , (Nature Genet. 7:402-407, 1994) showed that mutations in CAM Ll gene are responsible for type 1 X-linked spastic paraplegia and MASA syndrome which shows agenesis of the corpus callosum. Therefore, there is a need in the art to identify and isolate novel N-CAM members of the immunoglobulin superfamily so that their role in neural development and neural cell communication can be determined.
Therefore, there continues to be a need in the art for the discovery of additional proteins participating in human cell-cell interactions and especially a need for information serving to specifically identify and characterize such proteins in terms of their amino acid sequence. Moreover, to the extent that such molecules might form the basis for the development of therapeutic and diagnostic agents, it is essential that the DNA encoding them be elucidated. The present invention satisfies this need and provides related advantages as well.
BRIEF DESCRIPTION OF THE INVENTION
In accordance with the present invention, there are provided isolated nucleic acids encoding novel mammalian N-CAM (neural-cell adhesion molecule) members of the immunoglobulin superfamily of proteins, referred to herein as Down Syndrome-Cell Adhesion Molecules (DS-CAMs) . Further provided are vectors containing invention nucleic acids, probes that hybridize thereto, host cells transformed therewith, antisense oligonucleotides thereto and related compositions. The nucleic acid molecules described herein can be incorporated into a variety of recombinant expression systems known to those of skill in the art to readily produce isolated DS-CAM proteins. In addition, the nucleic acid molecules of the present invention are useful as probes for assaying for the presence and/or amount of a DS-CAM gene or mRNA transcript in a given sample. The nucleic acid molecules described herein, and oligonucleotide fragments thereof, are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding DS-CAM proteins.
In accordance with the present invention, there are also provided isolated mammalian DS-CAM proteins. These proteins are useful, for example, in neural prosthetic devices used in entubulation methods of repairing (regenerating) damaged or severed peripheral nerves (see, e.g., U.S. Patent No. 4,955,892, incorporated herein by reference) . In addition, these proteins, or fragments thereof, are useful as immunogens for producing anti-DS-CAM antibodies, or in therapeutic compositions containing such proteins and/or antibodies. Invention DS-CAM proteins are also useful in bioassays to identify agonists and antagonists thereto. Also provided are transgenic non-human mammals that express the invention protein.
Antibodies that are immunoreactive with invention DS-CAM proteins are also provided. These antibodies are useful in diagnostic assays to determine levels of DS-CAM proteins present in a given sample, e.g., tissue samples, Western blots, and the like. The antibodies can also be used to purify DS-CAM proteins from crude cell extracts and the like. Moreover, these antibodies are considered therapeutically useful to counteract or supplement the biological effect of DS-CAMs in vivo . Methods and diagnostic systems for determining the levels of DS-CAM protein in various tissue samples are also provided. These diagnostic methods can be used for monitoring the level of therapeutically administered DS-CAM protein or fragments thereof to facilitate the maintenance of therapeutically effective amounts. These diagnostic methods can also be used to diagnose physiological disorders that result from abnormal levels or abnormal structures of the DS-CAM protein.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows a physical map of the localization of the DS-CAM gene to a region between D21S345 and D21S347 on chromosome 21. The locations of BAC clones (starting with numbers) and PAC clones (starting with "P") are indicated by horizontal bars. An arrow head indicates a gap in the BAC and PAC contig. The location of the DS-CAM gene is indicated by a thick arrow.
Figure 2 shows the predicted amino acid sequence of the human DS-CAMl protein corresponding to SEQ ID NO: 2 and a schematic structure. IG:
Immunoglobulin type-C2 domain. FbN: Fibronectin type III domain. The bold Cs in the amino acid sequence indicates
Cysteine residues forming disulfide bonds in the Ig-like type-C2 domains. The bold NXS and NXT in the amino acid sequence correspond to potential N-glycosylation sites.
Figure 3 shows a partial genomic structure of DS-CAMl and a deletion contained in DS-CAM2 cDNA clones (clones pDS-CAM-18 and pDS-CAM-52) . The deletion boundary sequence (GC-AG) suggests an unusual alternative splicing. The horizontal bar represents genomic sequence containing exons of DS-CAM-42. Exons are indicated by open boxes. Exon-intron boundaries are defined by a comparison of the cDNA sequence of pDS-CAM-42 and genomic sequence determined from a BAC clone.
Figure 4 shows a schematic comparison of neuronal Ig superfamily members. Ig-like type C-2 domains, fibronectin type III domains and transmembrane domains are indicated. MAG: myelin-associated glycoprotein, N-CAM: neural cell adhesion molecule, BIG-1: brain-derived immunoglobulin (Ig) superfamily molecule-1, DCC : deleted in colorectal carcinoma.
DETAILED DESCRIPTION OF THE INVENTION
In accordance with the present invention, there are provided isolated nucleic acids, which encode novel mammalian members of the DS-CAM family of proteins, and fragments thereof. The phrase "DS-CAM" refers to substantially pure native DS-CAM protein, or recombinantly produced proteins, including naturally occurring allelic variants thereof encoded by mRNA generated by alternative splicing of a primary transcript, such as DS-CAMl (SEQ ID NO: 2) and DS-CAM2 (SEQ ID NO: 11) disclosed herein, and further including fragments thereof which retain at least one native biological activity, such as immunogenicity . In one aspect, invention DS-CAM proteins, such as DS-CAMl, are cell-surface glycoproteins that are mobile in the plane of the membrane. Invention DS-CAMl proteins contain extra- and intra-cellular domains that transduce information from the outside of the cell to the cytoplasm and the nucleus, thereby determining cell function. In another aspect, invention DS-CAM proteins, such as DS- CAM2 , are non-membrane bound, soluble proteins. In one aspect of the invention DS-CAM proteins are further characterized as comprising at least 7 Immunoglobulin-like (Ig-like) domains homologous to the immunoglobulin superfamily and 6 type III fibronectin repeats (see, e.g., Edelman and Crossin, "CELL ADHESION MOLECULES: Implications for a Molecular Histology", Ann. Rev. Biochem. , 60:155-190, 1991; and Walsh and Doherty,
Curr. Opinion in Cell Biol., 5:791-796, 1993; each of which is incorporated herein by reference in its entirety) . In another aspect of the invention, DS-CAM proteins are those proteins comprising at least 8, preferably at least 9 Ig-like domains, with at least 10 Ig-like domains being especially preferred.
As used herein, "Ig-like domains", or grammatical variations thereof, refers to the well known repeats that are common among Cell Adhesion Molecules (CAMs) (see, e.g., Figure 1A at p. 158 of Edelman and Crossin, supra , 1991; and Walsh and Doherty, supra. 1993; each of which is incorporated herein by reference in its entirety) .
The phrase "type III fibronectin repeats", "fibronectin repeats," or grammatical variations thereof, refers to the well known repeats that are common among Cell Adhesion Molecules (CAMs) (see, e.g., Figure 1A at p. 158 of Edelman and Crossin, supra , 1991; and Walsh and Doherty, supra , 1993; each of which is incorporated herein by reference in its entirety) .
The invention DS-CAM proteins define a novel sub-class of the Ig (immunoglobulin) superfamily with highest homologies to the neural cell adhesion molecules including BIG-1 (Yoshihara et al . , Neuron 13:415-426,
1994), CAM-LI (Moos et al . , Nature 334:701-703, 1988),
DCC (Fearon et al . , Science 247:49-56, 1990), neogenin (Lane et al . , Genomics 35:456-465, 1996), and contactin
(Ranscht, J. Cell Bio. 107:1561-1573, 1988) (Figure 4).
It has been found that the structure of invention DS-CAM proteins is unique within the neural immunoglobulin superfamily, and is distinctive due to the number of Ig-like type C2 and fibronectin III domains (10 and 6 respectively) and from the interruption of the fourth and fifth fibronectin domains by a 10th C2 domain, the functional significance of which may be of interest. The novel structure of DS-CAM and its expression throughout the nervous system during differentiation suggest interesting roles for the neural CAM in neural development and function. The location of DS-CAM in a region critical for DS neurocognitive phenotypes provides a human model in which to test the significance of these roles for cognitive function.
The neural Ig-superfamily members play critical roles in neural development and function and have been implicated in cell migration and sorting, axon guidance and fasciculation, formation of neural connections, and in synaptic plasticity (Edelman and Crossin, supra, 1991; Walsh and Doherty, supra . 1993; Tessier-Lavigne et al . , Science 274:1123-1133. 1996: Shuster et al . , Neuron
17:641-654. 1996: Shuster et al . , Neuron 17:655-657, 1996) . These activities are mediated by the homophilic or heterophilic binding properties of Ig-superfamily members (Mauro et al . , J. Cell Bio. 119:191-202, 1992 and
Milev et al . , J. Biol. Chem. 271:15716-15723, 1996), the binding of Ig-superfamily proteins to extracellular matrix proteins (Grumet et al . , Cell Adhesion Comm.
1:177-190, 1993; Taira et al . , Neuron 12 :861-872, 1994; and Zisch et al . , J. Cell Bio. 119:203-213, 1992), and the binding to smaller diffusible chemorepellents or chemoattractants, for example, DCC and netrin (Keino-Masu et al., Cell 87:175-185, 1996). The specificity of DS-CAM expression for the central nervous system and the timing of its expression to the period of neurite outgrowth in both the central and peripheral nervous systems, indicates a role for DS-CAM in early development and differentiation (Examples 4 and 5) . Early in development when, with the exception of neural crest precursors, expression is clearly absent from regions that contain dividing neuroepithelial precursors such as the ependymal layer of the neural tube and the ventricular zone of the brain (Altman and Bayer,
Atlas of Prenatal Rat Brain Development , CRC Press, Ann
Arbor, MI, 1995) . In the embryo, differentiated neurons express DS-CAM when they have finished migrating to their proper positions within the neuroepithelium, during neurite outgrowth.
Neural crest cells may express DS-CAM while they are migrating. At 15.5 and 16.5 days pc, most of the neural crest derived tissues have some expression, although not all have finished migration. The continued expression of DS-CAM in the myenteric plexus after 15.5- 16.5 dpc is due to the neural crest cells that have stopped dividing, although others are in the cell cycle. Approximately 50% of myenteric ganglia neurons arise after birth and DS-CAM may be expressed later in this subset. At later stages, the data suggest that DS-CAM is down regulated in the neural crest derivatives such as the myenteric ganglia and ganglia of the pancreas. The DS-CAM expression in tissues derived from the neural crest is of interest with respect to the high level detected in the umbilical cord. The tissue surrounding the umbilical artery and vein is derived from the neural crest and functions in coordinating the cardiovascular changes occurring at birth. The expression detected in the fetal liver and branchial arches is also derived from neural crest related to the ductus venosus and ultimately the ductus arteriosus and cardiac outflow tracts, respectively.
DS-CAM expression continues post-natally, in the differentiating regions of the newborn brain, such as, the septum and inferior colliculus, and in the adult in regions associated with plasticity, such as, the olfactory bulb and hippocampus. When combined with the evidence for involvement of the Ig superfamily in determining synaptic strength (Mayford et al . , Science 256:638-644, 1992)), the continued expression supports a role for DS-CAM in remodeling, learning and memory. The expression pattern and the role of dendritic connections in cell body maintenance indicate that an increase in DS-CAM expression in DS brain is responsible in part for the abnormalities of dendritic structure and decreased intersections seen at four months post-natal in DS individuals .
Alternatively spliced variants of CAMs have distinct roles in different parts of the brain, as demonstrated for closely related Ig-superfamily members, such as, NCAM (Cunningham et al . , Science 236:799-806,
1987 and Figarella-Branger et al . , J. Neuropathol . Exp. Neurol . 51:12-23, 1992) . The differential expression of alternatively spliced DS-CAM transcripts encoding DS-CAMl (SEQ ID N0:2) and DS-CAM2 (SEQ ID NO: 11) has likewise been observed in various parts of the human adult brain. For example, it has been found that DS-CAM clones encoding DS-CAM2 contain a small deletion relative to DS-CAMl, which deletion contains the transmembrane domain (Example 3 and Figure 3) and results in a stop codon 36 bp downstream. The results of RT-PCR (Example 5) indicated that all RNAs tested from various human tissues expressed both the DS-CAMl and DS-CAM2 transcripts and that the PCR products generated the sequence and size predicted for the appropriate form. The proximal and distal borders of the deletion are located within neighboring exons and reveal variant consensus splice site sequences (Jackson, Nuc . Acid Res . 19:3795-3798,
1991) with further surrounding homology to the UI spliceosome RNA.
From Northern analyses (Example 4) a minimum of three distinct transcripts are recognized by a probe for the transmembrane domain. From cDNA sequence analyses (Example 5) two forms of the DS-CAM protein are deduced, one that generates a transmembrane adhesion molecule and a second that is deleted for the transmembrane domain, thereby generating a molecule that is transported to the extracellular matrix. This mode of generating extracellular and membrane bound forms of CAMs is in surprising contrast to the GPI
(glycosylphosphatidylinositol ) linkage used by most CAMs, and would provide a way of generating longer range homophilic interactions between cells and the extracellular matrix, which may be significant for cell migration.
The DS-CAM gene was isolated (as described in the Examples hereinafter) by using the BAC contig on 21q22.2-q22.3 covering the region between D21S55 and MX1 (Hubert et al . , Genomics 41:218-226, 1997). The gene spans a minimum of 900 kb, estimated by summing the size of BACs and PACs that are non-overlapping and covered by the DS-CAM gene (Figure 1) . The DS-CAM gene covers a gap in all physical maps of this region. From hybridization experiments indicating no signal of the complete cDNA to BAC 277G10 covering 210 kb, a 5' intron is at least this size, similar to the first intron of the DCC gene (Cho et al., Genomics 19:525-531, 1994). Alternatively, other alternative transcripts can contain exons located in this BAC. The gene spans the boundary of bands 21q22.2 and q22.3, a Giemsa-dark and Giemsa-light band, respectively. The location of the gene for PEP19, a small 634 bp gene with large introns within the same band 21q22.2 (Cabin et al . , Somat . Cell Mol. Genet. 22:167- 175, 1996) suggests a general structure of genes in G- bands having large introns.
The nucleic acid molecules described herein are useful for producing invention DS-CAM proteins, when such nucleic acids are incorporated into a variety of protein expression systems known to those of skill in the art. In addition, such nucleic acid molecules or fragments thereof can be labeled with a readily detectable substituent and used as hybridization probes for assaying for the presence and/or amount of a DS-CAM gene or mRNA transcript in a given sample. The nucleic acid molecules described herein, and fragments thereof, are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding the invention protein described herein.
The term "nucleic acid" (also referred to as polynucleotides) encompasses ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), probes, oligonucleotides, and primers. DNA can be either complementary DNA (cDNA) or genomic DNA, e.g. a gene encoding a DS-CAM protein. One means of isolating a nucleic acid encoding a DS-CAM polypeptide is to probe a mammalian genomic library with a natural or artificially designed DNA probe using methods well known in the art. DNA probes derived from the DS-CAM gene are particularly useful for this purpose. DNA and cDNA molecules that encode DS-CAM polypeptides can be used to obtain complementary genomic DNA, cDNA or RNA from mammalian (e.g., human, mouse, rat, rabbit, pig, and the like), or other animal sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, by methods described in more detail below. Examples of nucleic acids are RNA, cDNA, or isolated genomic DNA encoding a DS-CAM polypeptide. Such nucleic acids may include, but are not limited to, nucleic acids having substantially the same nucleotide sequence as set forth in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO: 8, SEQ ID NO : 9 , SEQ ID NO: 10, or at least nucleotides 453-6185 set forth in SEQ ID NO:l, or nucleotides 453-5168 set forth in SEQ ID NO:10.
Use of the terms "isolated" and/or "purified" in the present specification and claims as a modifier of DNA, RNA, polypeptides or proteins means that the DNA, RNA, polypeptides or proteins so designated have been produced in such form by the hand of man, and thus are separated from their native in vivo cellular environment. As a result of this human intervention, the recombinant DNAs , RNAs, polypeptides and proteins of the invention are useful in ways described herein that the DNAs, RNAs, polypeptides or proteins as they naturally occur are not.
As used herein, "mammalian" refers to the variety of species from which the invention DS-CAM protein is derived, e.g., human, rat, mouse, rabbit, monkey, baboon, bovine, porcine, ovine, canine, feline, and the like. A preferred DS-CAM protein herein, is human DS-CAM.
In one embodiment of the present invention, cDNAs encoding the invention DS-CAM proteins disclosed herein include substantially the same nucleotide sequence as set forth in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, or SEQ ID NO: 10. Preferred cDNA molecules encoding the invention proteins include the same nucleotide sequence as nucleotides 453-6185 set forth in SEQ ID N0:1, or nucleotides 453-5168 set forth in SEQ ID NO: 10. As employed herein, the term "substantially the same nucleotide sequence" refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent hybridization conditions. In one embodiment, DNA having substantially the same nucleotide sequence as the reference nucleotide sequence encodes substantially the same amino acid sequence as that set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9 , or a larger amino acid sequence including SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO: 8 or SEQ ID NO : 9. In another embodiment, DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence has at least 60% identity with respect to the reference nucleotide sequence. DNA having at least 70%, more preferably at least 90%, yet more preferably at least 95%, identity to the reference nucleotide sequence is preferred.
This invention also encompasses nucleic acids which differ from the nucleic acids shown in SEQ ID NO : 1 , SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10 but which have the same phenotype. Phenotypically similar nucleic acids are also referred to as "functionally equivalent nucleic acids" . As used herein, the phrase "functionally equivalent nucleic acids" encompasses nucleic acids characterized by slight and non- consequential sequence variations that will function in substantially the same manner to produce the same protein product (s) as the nucleic acids disclosed herein. In particular, functionally equivalent nucleic acids encode polypeptides that are the same as those disclosed herein or that have conservative amino acid variations, or that encode larger polypeptides that includes SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO : 9. For example, conservative variations include substitution of a non-polar residue with another non-polar residue, or substitution of a charged residue with a similarly charged residue. These variations include those recognized by skilled artisans as those that do not substantially alter the tertiary structure of the protein.
Further provided are nucleic acids encoding DS-CAM polypeptides that, by virtue of the degeneracy of the genetic code, do not necessarily hybridize to the invention nucleic acids under specified hybridization conditions. Preferred nucleic acids encoding the invention polypeptides are comprised of nucleotides that encode substantially the same amino acid sequences set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9.
Thus, an exemplary nucleic acid encoding an invention DS-CAM protein may be selected from:
(a) DNA encoding the amino acid sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 ,
SEQ ID NO: 8 or SEQ ID NO : 9 ,
(b) DNA that hybridizes to the DNA of (a) under moderately stringent conditions, wherein said DNA encodes biologically active DS-CAM, or (c) DNA degenerate with respect to either
(a) or (b) above, wherein said DNA encodes biologically active DS-CAM.
Hybridization refers to the binding of complementary strands of nucleic acid (i.e., sense : antisense strands or probe : target -DNA) to each other through hydrogen bonds, similar to the bonds that naturally occur in chromosomal DNA. Stringency levels used to hybridize a given probe with target -DNA can be readily varied by those of skill in the art. The phrase "stringent hybridization" is used herein to refer to conditions under which polynucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (Tm) of the hybrids. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions.
As used herein, the phrase "moderately stringent hybridization" refers to conditions that permit target-DNA to bind a complementary nucleic acid that has about 60% identity, preferably about 75% identity, more preferably about 85% identity to the target DNA; with greater than about 90% identity to target-DNA being especially preferred. Preferably, moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5X Denhardt ' s solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.2X SSPE, 0.2% SDS, at 65°C.
The phrase "high stringency hybridization" refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65°C (i.e., if a hybrid is not stable in 0.018M NaCl at 65°C, it will not be stable under high stringency conditions, as contemplated herein) . High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5X Denhardt ' s solution, 5X SSPE, 0.2% SDS at 42 °C, followed by washing in 0. IX SSPE, and 0.1% SDS at 65°C.
The phrase "low stringency hybridization" refers to conditions equivalent to hybridization in 10% formamide, 5X Denhardt ' s solution, 6X SSPE, 0.2% SDS at 42°C, followed by washing in IX SSPE, 0.2% SDS, at 50°C. Denhardt ' s solution and SSPE (see, e.g., Sambrook et al . , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989) are well known to those of skill in the art as are other suitable hybridization buffers .
As used herein, the term "degenerate" refers to codons that differ in at least one nucleotide from a reference nucleic acid, e.g., SEQ ID NO : 1 , but encode the same amino acids as the reference nucleic acid. For example, codons specified by the triplets "UCU" , "UCC", "UCA" , and "UCG" are degenerate with respect to each other since all four of these codons encode the amino acid serine.
Preferred nucleic acids encoding the invention polypeptide (s) hybridize under moderately stringent, preferably high stringency, conditions to substantially the entire sequence, or in certain embodiments substantial portions (i.e., typically at least 15-30 nucleotides) of the nucleic acid sequence set forth in SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10.
The invention nucleic acids can be produced by a variety of methods well-known in the art, e.g., the methods described herein, employing PCR amplification using oligonucleotide primers from various regions of SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, and the like.
In accordance with a further embodiment of the present invention, optionally labeled DS-CAM-encoding cDNAs, or fragments thereof, can be employed to probe library (ies) (e.g., cDNA, genomic, and the like) for additional nucleic acid sequences encoding novel mammalian DS-CAM proteins. As described in Example 3, construction of mammalian cDNA libraries, preferably a human trisomy 21 fetal brain cDNA library, is well-known in the art. Screening of such a cDNA library is initially carried out under low-stringency conditions, which comprise a temperature of less than about 42°C, a formamide concentration of less than about 50%, and a moderate to low salt concentration.
Presently preferred probe-based screening conditions comprise a temperature of about 37°C, a formamide concentration of about 20%, and a salt concentration of about 5X standard saline citrate (SSC; 20X SSC contains 3M sodium chloride, 0.3M sodium citrate, pH 7.0) . Such conditions will allow the identification of sequences which have a substantial degree of similarity with the probe sequence, without requiring perfect homology. The phrase "substantial similarity" refers to sequences which share at least 50% homology. Preferably, hybridization conditions will be selected which allow the identification of sequences having at least 70% homology with the probe, while discriminating against sequences which have a lower degree of homology with the probe. As a result, nucleic acids having substantially the same nucleotide sequence as nucleotides 453-6185 set forth in SEQ ID NO : 1 , or nucleotides 453-5168 set forth in SEQ ID NO:10, SEQ ID NO : 7 , SEQ ID NO: 8, or SEQ ID NO : 9 are obtained.
As used herein, a nucleic acid "probe" is single-stranded DNA or RNA, or analogs thereof, that has a sequence of nucleotides that includes at least 14, at least 20, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 contiguous bases that are the same as (or the complement of) any contiguous bases set forth in any of SEQ ID NO : 1 , SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10. Preferred regions from which to construct probes include 5' and/or 3' coding regions of SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO: 8, SEQ ID NO : 9 or SEQ ID NO: 10. In addition, the entire cDNA encoding region of an invention DS-CAM protein, or the entire sequence corresponding to SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10, may be used as a probe. Probes may be labeled by methods well-known in the art, as described hereinafter, and used in various diagnostic kits.
As used herein, the terms "label" and "indicating means" in their various grammatical forms refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal. Any label or indicating means can be linked to invention nucleic acid probes, expressed proteins, polypeptide fragments, or antibody molecules. These atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well-known in clinical diagnostic chemistry.
The labeling means can be a fluorescent labeling agent that chemically binds to antibodies or antigens without denaturation to form a fluorochrome (dye) that is a useful immunofluorescent tracer. A description of immunofluorescent analytic techniques is found in DeLuca, "Immunofluorescence Analysis", in Antibody As a Tool. Marchalonis et al . , eds . , John Wiley & Sons, Ltd., pp. 189-231, 1982, which is incorporated herein by reference.
In one embodiment, the indicating group is an enzyme, such as horseradish peroxidase (HRP) , glucose oxidase, and the like. In another embodiment, radioactive elements are employed labeling agents. The linking of a label to a substrate, i.e., labeling of nucleic acid probes, antibodies, polypeptides, and proteins, is well known in the art. For instance, an invention antibody can be labeled by metabolic incorporation of radiolabeled amino acids provided in the culture medium. See, for example, Galfre et al . , Meth. Enzymol . 73:3-46, 1981. Conventional means of protein conjugation or coupling by activated functional groups are particularly applicable. See, for example, Aurameas et al . , Scand. J. Immunol. 8(7): 7-23, 1978; Rodwell et al . , Biotech. 3:889-894, 1984; and U.S. Patent
No. 4,493,795.
In accordance with another embodiment of the present invention, there are provided isolated mammalian DS-CAM proteins (preferably human), polypeptides, and fragments thereof encoded by invention nucleic acid.
Preferably, DS-CAM proteins referred to herein, are those polypeptides specifically recognized by an antibody that also specifically recognizes a DS-CAM protein including the sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or
SEQ ID NO: 9. Invention isolated DS-CAM proteins are free of cellular components and/or contaminants normally associated with a native in vivo environment.
The invention DS-CAM proteins are further characterized as being primarily expressed in fetal brain and not expressed in fetal lung or fetal liver. For example, the results of Northern analysis (described in Example 4) using human fetal tissues showed that 8.5 kb and 7.6 kb transcripts are expressed only in fetal brain and not expressed in fetal lung, fetal liver and fetal kidney. Northern blot analyses of adult tissues revealed differential expression of three alternative transcripts of 9.7 kb, 8.5 kb and 7.6 kb in different substructures of the brain. The 9.7 kb transcript is highly expressed in the substantia nigra, moderately expressed in the amygdala and hippocampus, and less expressed in the whole brain. A similar pattern is observed by using a PCR product spanning the 191 bp deletion found in DS-CAM-18 and DS-CAM-52. The placenta shows faint bands, and the sizes are smaller than those in brain. In skeletal muscle, a faint band (6.5 kb) is detected.
The results of RT-PCR (Example 5) demonstrated expression of human DS-CAM mRNA in fetal and adult brain, in fetal kidney, as well as in a breast carcinoma cell line mRNA. Thus, splice variant cDNA transcripts encoding a DS-CAM family of proteins are clearly contemplated by the present invention.
The region of chromosome locus 21q22.2 from which DS-CAM is derived is part of the candidate region for holoprosencephaly type I (HPE1) . In addition, some patients with this region he izygously deleted show abnormalities of the corpus callosum and schizencephaly . Therefore, DS-CAM is contemplated as the gene, which when defective, deleted or present as a duplication, is responsible for holoprosencephaly, agenesis of the corpus callosum and/or structural defects of the brain. In addition, DS-CAM may also be responsible for several phenotypes of Down Syndrome including mental retardation as well as, more specifically, the abnormal dendritic structure observed in Down Syndrome. Additional roles for DS-CAM were further evaluated by database homology searches using BLAST X/N and TIGR database analyses. Results of these searches indicate that DS-CAM shows moderate homology to N-CAM-1 (Cunningham et al . , Science , 236:799-806, 1987) and to DCC (Fearon et al . , Science,
247:49-56, 1990) .
Presently preferred DS-CAM proteins of the invention include amino acid sequences that are substantially the same as the protein sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9, as well as biologically active, modified forms thereof. Those of skill in the art will recognize that numerous residues of the above-described sequences can be substituted with other, chemically, sterically and/or electronically similar residues without substantially altering the biological activity of the resulting receptor species. In addition, larger or smaller polypeptide sequences containing substantially the same sequence as SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9 , therein (e.g., splice variants) are contemplated.
As employed herein, the term "substantially the same amino acid sequence" refers to amino acid sequences having at least about 50%, preferably at least about 60%, more preferably at least about 70% identity with respect to the reference amino acid sequence, and retaining comparable functional and biological activity characteristic of the protein defined by the reference amino acid sequence. In another embodiment of the invention, preferred invention proteins having "substantially the same amino acid sequence" will have at least about 80%, more preferably 90% amino acid identity with respect to the reference amino acid sequence; with greater than about 95% amino acid sequence identity being especially preferred. It is recognized, however, that polypeptides (or nucleic acids referred to hereinbefore) containing less than the described levels of sequence identity arising as splice variants or that are modified by conservative amino acid substitutions, or by substitution of degenerate codons are also encompassed within the scope of the present invention. The term "biologically active" or "functional", when used herein as a modifier of invention DS-CAM protein(s), or polypeptide fragment thereof, refers to a polypeptide that exhibits functional characteristics similar to DS-CAM. For example, one biological activity of DS-CAM is the ability to act as an immunogen for the production of polyclonal and monoclonal antibodies that bind specifically to DS-CAM. Thus, an invention nucleic acid encoding DS-CAM will encode a polypeptide specifically recognized by an antibody that also specifically recognizes the DS-CAM protein including the sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9. Such activity may be assayed by any method known to those of skill in the art. For example, a test-polypeptide encoded by a DS-CAM cDNA can be used to produce antibodies, which are then assayed for their ability to bind to the protein including the sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9. If the antibody binds to the test-polypeptide and the protein including the sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO: 7, SEQ ID NO : 8 or SEQ ID NO : 9 with substantially the same affinity, then the polypeptide possesses the requisite biological activity.
The invention DS-CAM proteins can be isolated by a variety of methods well-known in the art, e.g., the methods described herein, the recombinant expression systems described herein, precipitation, gel filtration, ion-exchange, reverse-phase and affinity chromatography, and the like. Other well-known methods are described in Deutscher et al . , Guide to Protein Purification: Methods in Enzymology 182 (Academic Press, 1990), which is incorporated herein by reference. Alternatively, the isolated polypeptides of the present invention can be obtained using well-known recombinant methods as described, for example, in Sambrook et al . , supra . ,
1989) .
An example of the means for preparing the invention polypeptide (s) is to express nucleic acids encoding the DS-CAM in a suitable host cell, such as a bacterial cell, a yeast cell, an amphibian cell (i.e., oocyte), or a mammalian cell, using methods well known in the art, and recovering the expressed polypeptide, again using well-known methods. Invention polypeptides can be isolated directly from cells that have been transformed with expression vectors as described below herein. The invention polypeptide, biologically active fragments, and functional equivalents thereof can also be produced by chemical synthesis. For example, synthetic polypeptides can be produced using Applied Biosystems, Inc. Model 430A or 431A automatic peptide synthesizer (Foster City, CA) employing the chemistry provided by the manufacturer.
The present invention also provides compositions containing an acceptable carrier and any of an isolated, purified DS-CAM polypeptide, an active fragment thereof, or a purified, mature protein and active fragments thereof, alone or in combination with each other. These polypeptides or proteins can be recombinantly derived, chemically synthesized or purified from native sources. As used herein, the term "acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents .
Also provided are antisense oligonucleotides having a sequence capable of binding specifically with any portion of an mRNA that encodes DS-CAM polypeptides so as to prevent translation of the mRNA. The antisense oligonucleotide may have a sequence capable of binding specifically with any portion of the sequence of the cDNA encoding DS-CAM polypeptides. As used herein, the phrase "binding specifically" encompasses the ability of a nucleic acid sequence to recognize a complementary nucleic acid sequence and to form double-helical segments therewith via the formation of hydrogen bonds between the complementary base pairs. An example of an antisense oligonucleotide is an antisense oligonucleotide comprising chemical analogs of nucleotides.
Compositions comprising an amount of the antisense oligonucleotide, described above, effective to reduce expression of DS-CAM polypeptides by passing through a cell membrane and binding specifically with mRNA encoding DS-CAM polypeptides so as to prevent translation and an acceptable hydrophobic carrier capable of passing through a cell membrane are also provided herein. Suitable hydrophobic carriers are described, for example, in U.S. Patent Nos. 5,334,761; 4,889,953;
4,897,355, and the like. The acceptable hydrophobic carrier capable of passing through cell membranes may also comprise a structure which binds to a receptor specific for a selected cell type and is thereby taken up by cells of the selected cell type. The structure may be part of a protein known to bind to a cell-type specific receptor.
Antisense oligonucleotide compositions are useful to inhibit translation of mRNA encoding invention polypeptides. Synthetic oligonucleotides, or other antisense chemical structures are designed to bind to mRNA encoding DS-CAM polypeptides and inhibit translation of mRNA and are useful as compositions to inhibit expression of DS-CAM associated genes in a tissue sample or in a subject. In accordance with another embodiment of the invention, kits for detecting mutations, duplications, deletions, rearrangements and aneuploidies in chromosome 21 at locus q22.2 comprising at least one invention probe or antisense nucleotide.
The present invention provides means to modulate levels of expression of DS-CAM polypeptides by employing synthetic antisense oligonucleotide compositions (hereinafter SAOC) which inhibit translation of mRNA encoding these polypeptides. Synthetic oligonucleotides, or other antisense chemical structures designed to recognize and selectively bind to mRNA, are constructed to be complementary to portions of the DS-CAM coding strand or nucleotide sequences shown in SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or
SEQ ID NO: 10. The SAOC is designed to be stable in the blood stream for administration to a subject by injection, or in laboratory cell culture conditions. The SAOC is designed to be capable of passing through the cell membrane in order to enter the cytoplasm of the cell by virtue of physical and chemical properties of the SAOC which render it capable of passing through cell membranes, for example, by designing small, hydrophobic SAOC chemical structures, or by virtue of specific transport systems in the cell which recognize and transport the SAOC into the cell. In addition, the SAOC can be designed for administration only to certain selected cell populations by targeting the SAOC to be recognized by specific cellular uptake mechanisms which bind and take up the SAOC only within select cell populations .
For example, the SAOC may be designed to bind to a receptor found only in a certain cell type, as discussed supra . The SAOC is also designed to recognize and selectively bind to target mRNA sequence, which may correspond to a sequence contained within the sequence shown in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 ,
SEQ ID NO: 9 or SEQ ID NO: 10. The SAOC is designed to inactivate target mRNA sequence by either binding thereto and inducing degradation of the mRNA by, for example, RNase I digestion, or inhibiting translation of mRNA target sequence by interfering with the binding of translation-regulating factors or ribosomes, or inclusion of other chemical structures, such as ribozyme sequences or reactive chemical groups which either degrade or chemically modify the target mRNA. SAOCs have been shown to be capable of such properties when directed against mRNA targets (see Cohen et al . , TIBS 10:435, 1989 and
Weintraub, Sci. American January 1990, pp.40; both incorporated herein by reference) .
In accordance with yet another embodiment of the present invention, there is provided a method for the recombinant production of invention DS-CAM protein (s) by expressing the above-described nucleic acid sequences in suitable host cells. Recombinant DNA expression systems that are suitable to produce DS-CAM proteins described herein are well-known in the art. For example, the above-described nucleotide sequences can be incorporated into vectors for further manipulation. As used herein, vector (or plasmid) refers to discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof.
Suitable expression vectors are well-known in the art, and include vectors capable of expressing DNA operatively linked to a regulatory sequence, such as a promoter region that is capable of regulating expression of such DNA. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the inserted DNA. Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.
As used herein, a promoter region refers to a segment of DNA that controls transcription of DNA to which it is operatively linked. The promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. In addition, the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences may be cis acting or may be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, may be constitutive or regulated. Exemplary promoters contemplated for use in the practice of the present invention include the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid- inducible promoter, Moloney murine leukemia virus (MMLV) promoter, and the like.
As used herein, the term "operatively linked" refers to the functional relationship of DNA with regulatory and effector nucleotide sequences, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences. For example, operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA. As used herein, expression refers to the process well-known to those of skill in the art by which polynucleic acids are transcribed into mRNA and translated into peptides or proteins and, optionally thereafter, modified post-translationally . If the invention nucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA.
Prokaryotic transformation vectors are well-known in the art and include pBluescript and phage Lambda ZAP vectors (STRATAGENE, San Diego, CA) , and the like. Other suitable vectors and promoters are disclosed in detail in U.S. Patent No. 4,798,885, issued January 17, 1989, the disclosure of which is incorporated herein by reference in its entirety.
Other suitable vectors for transformation of E. coli cells include the pET expression vectors
(Novagen, see U.S patent 4,952,496), e.g., pETlla, which contains the T7 promoter, T7 terminator, the inducible E. coli lac operator, and the lac repressor gene; and pET
12a-c, which contain the T7 promoter, T7 terminator, and the E. coli ompT secretion signal . Another suitable vector is the pIN-IIIompA2 (see Duffaud et al . , Meth. in Enzymology, 153:492-507, 1987), which contains the lpp promoter, the lacUV5 promoter operator, the ompA secretion signal, and the lac repressor gene.
Exemplary, eukaryotic transformation vectors, include the cloned bovine papilloma virus genome, the cloned genomes of the murine retroviruses, and eukaryotic cassettes, such as the pSV-2 gpt system (described by Mulligan and Berg, Nature 277:108-114, 1979) the
Okayama-Berg cloning system (Mol. Cell Biol. 2:161-170,
1982) , and the expression cloning vector described by Genetics Institute (Science 228:810-815, 1985), are available which provide substantial assurance of at least some expression of the protein of interest in the transformed eukaryotic cell line.
Particularly preferred base vectors which contain regulatory elements that can be linked to the invention DS-CAM-encoding DNAs for transfection of mammalian cells are cytomegalovirus (CMV) promoter-based vectors such as pcDNAl (Invitrogen, San Diego, CA) , MMTV promoter-based vectors such as pMAMNeo (Clontech, Palo Alto, CA) and pMSG (Pharmacia, Piscataway, NJ) , and SV40 promoter-based vectors such as pSVβ (Clontech, Palo Alto, CA) .
In accordance with another embodiment of the present invention, there are provided "recombinant cells" containing the nucleic acid molecules (i.e., DNA or mRNA) of the present invention. Methods of transforming suitable host cells, preferably bacterial cells, and more preferably E. coli cells, as well as methods applicable for culturing said cells containing a gene encoding a heterologous protein, are generally known in the art. See, for example, Sambrook et al . , supra , 1989.
Exemplary methods of transformation include, e.g., transformation employing plasmids, viral, or bacterial phage vectors, transfection, electroporation, lipofection, and the like. The heterologous DNA can optionally include sequences which allow for its extrachromosomal maintenance, or said heterologous DNA can be caused to integrate into the genome of the host (as an alternative means to ensure stable maintenance in the host) .
Host organisms contemplated for use in the practice of the present invention include those organisms in which recombinant production of heterologous proteins has been carried out. Exemplary cells for introducing DNA include cells of mammalian origin (e.g., COS cells, mouse L cells, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, African green monkey cells and other such cells known to those of skill in the art) , amphibian cells (e.g., Xenopus laevis oόcytes) , yeast cells (e.g., Saccharomyces cerevisiae, Candida tropicalis, Hansenula polymorpha and P . pastoris; see, e.g., U.S. Patent Nos. 4,882,279, 4,837,148, 4,929,555 and 4,855,231), bacteria (e.g., E. coli ) , and the like.
In one embodiment, nucleic acids encoding the invention DS-CAM proteins can be delivered into mammalian cells, either in vivo or in vitro using suitable viral vectors well-known in the art. Suitable retroviral vectors, designed specifically for in vivo "gene therapy" methods, are described, for example, in WIPO publications WO 9205266 and WO 9214829, which provide a description of methods for efficiently introducing nucleic acids into human cells in vivo . In addition, where it is desirable to limit or reduce the in vivo expression of the invention DS-CAM, the introduction of the antisense strand of the invention nucleic acid is contemplated.
In accordance with yet another embodiment of the present invention, there are provided anti-DS-CAM antibodies having specific reactivity with DS-CAM polypeptides of the present invention. Active fragments of antibodies are encompassed within the definition of "antibody" . Invention antibodies can be produced by methods known in the art using invention polypeptides, proteins or portions thereof as antigens. For example, polyclonal and monoclonal antibodies can be produced by methods well known in the art, as described, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, 1988) , which is incorporated herein by reference. Invention polypeptides can be used as immunogens in generating such antibodies. Alternatively, synthetic peptides can be prepared (using commercially available synthesizers) and used as immunogens . Amino acid sequences can be analyzed by methods well known in the art to determine whether they encode hydrophobic or hydrophilic domains of the corresponding polypeptide. Altered antibodies such as chimeric, humanized, CDR-grafted or bifunctional antibodies can also be produced by methods well known in the art. Such antibodies can also be produced by hybridoma, chemical synthesis or recombinant methods described, for example, in Sambrook et al . , supra , 1989; and Harlow and Lane, supra, 1988. Both anti-peptide and anti-fusion protein antibodies can be used, (see, for example, Bahouth et al . , Trends Pharmacol. Sci. 12:338
1991; Ausubel et al . , Current Protocols in Molecular Biology (John Wiley and Sons, NY 1989) which are incorporated herein by reference) .
Antibody so produced can be used, inter alia, in diagnostic methods and systems to detect the level of DS-CAM protein present in a mammalian, preferably human, body sample, such as tissue or vascular fluid. Such antibodies can also be used for the immunoaffinity or affinity chromatography purification of the invention DS-CAM protein. In addition, methods are contemplated herein for detecting the presence of DS-CAM polypeptides on the surface of a cell comprising contacting the cell with an antibody that specifically binds to DS-CAM polypeptides, under conditions permitting binding of the antibody to the polypeptides, detecting the presence of the antibody bound to the cell, and thereby detecting the presence of invention polypeptides on the surface of the cell. With respect to the detection of such polypeptides, the antibodies can be used for in vitro diagnostic or in vivo imaging methods.
Immunological procedures useful for in vitro detection of target DS-CAM polypeptides in a sample include immunoassays that employ a detectable antibody. Such immunoassays include, for example, ELISA, Pandex microfluorimetric assay, agglutination assays, flow cytometry, serum diagnostic assays and immunohistochemical staining procedures which are well known in the art. An antibody can be made detectable by various means well known in the art. For example, a detectable marker can be directly or indirectly attached to the antibody. Useful markers include, for example, radionucleotides, enzymes, fluorogens, chromogens and chemiluminescent labels.
Invention anti-DS-CAM antibodies are contemplated for use herein to modulate the activity of the DS-CAM polypeptide in living animals, in humans, or in biological tissues or fluids isolated therefrom. Accordingly, compositions comprising a carrier and an amount of an antibody having specificity for DS-CAM polypeptides effective to block naturally occurring ligands or other DS-CAM-binding proteins from binding to invention DS-CAM polypeptides are contemplated herein. For example, a monoclonal antibody directed to an epitope of DS-CAM polypeptide molecules present on the surface of a cell and having an amino acid sequence substantially the same as an amino acid sequence for a cell surface epitope of a DS-CAM polypeptide including the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9, can be useful for this purpose.
The present invention further provides transgenic non-human mammals that are capable of expressing exogenous nucleic acids encoding DS-CAM polypeptides. As employed herein, the phrase "exogenous nucleic acid" refers to nucleic acid sequence which is not native to the host, or which is present in the host in other than its native environment (e.g., as part of a genetically engineered DNA construct) .
Also provided are transgenic non-human mammals capable of expressing nucleic acids encoding DS-CAM polypeptides so mutated as to be incapable of normal activity, i.e., do not express native DS-CAM. The present invention also provides transgenic non-human mammals having a genome comprising antisense nucleic acids complementary to nucleic acids encoding DS-CAM polypeptides, placed so as to be transcribed into antisense mRNA complementary to mRNA encoding DS-CAM polypeptides, which hybridizes to the mRNA and, thereby, reduces the translation thereof. The nucleic acid may additionally comprise an inducible promoter and/or tissue specific regulatory elements, so that expression can be induced, or restricted to specific cell types. Examples of nucleic acids are DNA or cDNA having a coding sequence substantially the same as the coding sequence shown in SEQ ID NO:l. An example of a non-human transgenic mammal is a transgenic mouse. Examples of tissue specificity- determining elements are the metallothionein promoter and the L7 promoter.
Animal model systems which elucidate the physiological and behavioral roles of DS-CAM polypeptides are also provided, and are produced by creating transgenic animals in which the expression of the DS-CAM polypeptide is altered using a variety of techniques. Examples of such techniques include the insertion of normal or mutant versions of nucleic acids encoding a DS-CAM polypeptide by microinjection, retroviral infection or other means well known to those skilled in the art, into appropriate fertilized embryos to produce a transgenic animal. See, for example, Hogan et al . , Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratory, 1986) .
Also contemplated herein, is the use of homologous recombination of mutant or normal versions of DS-CAM genes with the native gene locus in transgenic animals, to alter the regulation of expression or the structure of DS-CAM polypeptides (see, Capecchi et al . , Science 244:1288, 1989; Zimmer et al . , Nature 338:150,
1989; which are incorporated herein by reference) . Homologous recombination techniques are well known in the art. Homologous recombination replaces the native (endogenous) gene with a recombinant or mutated gene to produce an animal that cannot express native (endogenous) protein but can express, for example, a mutated protein which results in altered expression of DS-CAM polypeptides .
In contrast to homologous recombination, microinj ection adds genes to the host genome, without removing host genes. Microinjection can produce a transgenic animal that is capable of expressing both endogenous and exogenous DS-CAM protein. Inducible promoters can be linked to the coding region of nucleic acids to provide a means to regulate expression of the transgene. Tissue specific regulatory elements can be linked to the coding region to permit tissue-specific expression of the transgene. Transgenic animal model systems are useful for in vivo screening of compounds for identification of specific ligands, i.e., agonists and antagonists, which activate or inhibit protein responses.
Invention nucleic acids, oligonucleotides (including antisense) , vectors containing same, transformed host cells, polypeptides and combinations thereof, as well as antibodies of the present invention, can be used to screen compounds in vitro to determine whether a compound functions as a potential agonist or antagonist to invention polypeptides. These in vitro screening assays provide information regarding the function and activity of invention polypeptides, which can lead to the identification and design of compounds that are capable of specific interaction with one or more types of polypeptides, peptides or proteins.
In accordance with still another embodiment of the present invention, there is provided a method for identifying compounds which bind to DS-CAM polypeptides. The invention proteins may be employed in a competitive binding assay. Such an assay can accommodate the rapid screening of a large number of compounds to determine which compounds, if any, are capable of binding to DS-CAM proteins. Subsequently, more detailed assays can be carried out with those compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of invention proteins .
Another application of the binding assay of the invention is the assay of test samples (e.g., biological fluids) for the presence or absence of DS-CAM. Thus, for example, serum from a patient displaying symptoms thought to be related to over- or under-production of DS-CAM can be assayed to determine if the observed symptoms are indeed caused by over- or under-production of DS-CAM.
In another embodiment of the invention, there is provided a bioassay for identifying compounds which modulate the activity of invention DS-CAM polypeptides. According to this method, invention polypeptides are contacted with an "unknown" or test substance (in the presence of a reporter gene construct when antagonist activity is tested) , the activity of the polypeptide is monitored subsequent to the contact with the "unknown" or test substance, and those substances which cause the reporter gene construct to be expressed are identified as functional ligands for DS-CAM polypeptides.
In accordance with another embodiment of the present invention, transformed host cells that recombinantly express invention polypeptides can be contacted with a test compound, and the modulating effect (s) thereof can then be evaluated by comparing the DS-CAM-mediated response (e.g., via reporter gene expression) in the presence and absence of test compound, or by comparing the response of test cells or control cells (i.e., cells that do not express DS-CAM polypeptides), to the presence of the compound.
As used herein, a compound or a signal that "modulates the activity" of invention polypeptides refers to a compound or a signal that alters the activity of DS-CAM polypeptides so that the activity of the invention polypeptide is different in the presence of the compound or signal than in the absence of the compound or signal . In particular, such compounds or signals include agonists and antagonists. An agonist encompasses a compound or a signal that activates DS-CAM protein expression. Alternatively, an antagonist includes a compound or signal that interferes with DS-CAM protein expression. Typically, the effect of an antagonist is observed as a blocking of agonist-induced protein activation. Antagonists include competitive and non-competitive antagonists. A competitive antagonist (or competitive blocker) interacts with or near the site specific for agonist binding. A non-competitive antagonist or blocker inactivates the function of the polypeptide by interacting with a site other than the agonist interaction site. As understood by those of skill in the art, assay methods for identifying compounds that modulate DS-CAM activity generally require comparison to a control. One type of a "control" is a cell or culture that is treated substantially the same as the test cell or test culture exposed to the compound, with the distinction that the "control" cell or culture is not exposed to the compound. For example, in methods that use voltage clamp electrophysiological procedures, the same cell can be tested in the presence or absence of compound, by merely changing the external solution bathing the cell. Another type of "control" cell or culture may be a cell or culture that is identical to the transfected cells, with the exception that the "control" cell or culture do not express native proteins.
Accordingly, the response of the transfected cell to compound is compared to the response (or lack thereof) of the "control" cell or culture to the same compound under the same reaction conditions.
Since it is well-known that CAMs interact with extracellular ligands, it is contemplated that invention DS-CAM proteins interact with extracellular ligands. In another embodiment of the present invention, it is contemplated that invention DS-CAM proteins act specifically in concert or in competition with other
CAMs. Thus, the present invention contemplates various bioassays for identifying ligands for invention DS-CAM proteins. In addition, the present invention contemplates an assay measuring the effect of co-expressing during development either normal or defective invention DS-CAMs with other CAMs known in the art to assess the resulting phenotype.
In one embodiment of the present invention, there is provided a bioassay for evaluating whether test compounds are capable of acting as agonists comprises: (a) culturing cells containing:
DNA which expresses DS-CAM protein (s) or functional modified forms thereof, and DNA encoding a reporter protein, wherein said DNA is operatively linked to a DS-CAM responsive transcription element; wherein said culturing is carried out in the presence of at least one compound whose ability to induce signal transduction activity of DS-CAM protein is sought to be determined, and thereafter
(b) monitoring said cells for expression of said reporter protein.
In another embodiment of the present invention, the bioassay for evaluating whether test compounds are capable of acting as antagonists for DS-CAM protein (s) of the invention, or functional modified forms of said DS-CAM protein (s), comprises:
(a) culturing cells containing:
DNA which expresses DS-CAM protein (s), or functional modified forms thereof, and DNA encoding a reporter protein, wherein said DNA is operatively linked to a DS-CAM responsive transcription element wherein said culturing is carried out in the presence of: increasing concentrations of at least one compound whose ability to inhibit signal transduction activity of DS-CAM protein (s) is sought to be determined, and a fixed concentration of at least one agonist for DS-CAM protein (s), or functional modified forms thereof; and thereafter (b) monitoring in said cells the level of expression of said reporter protein as a function of the concentration of said compound, thereby indicating the ability of said compound to inhibit signal transduction activity.
In step (a) of the above-described antagonist bioassay, culturing may also be carried out in the presence of : fixed concentrations of at least one compound whose ability to inhibit signal transduction activity of DS-CAM protein (s) is sought to be determined, and an increasing concentration of at least one agonist for DS-CAM protein (s) , or functional modified forms thereof .
In yet another embodiment of the present invention, it is contemplated that invention DS-CAM proteins mediate signal transduction through the modulation of adenylate cyclase. For example, when a DS-CAM ligand binds to DS-CAM, adenylate cyclase causes an elevation in the level of intracellular cAMP . Accordingly, in one embodiment of the present invention, the bioassay for evaluating whether test compounds are capable of acting as agonists or antagonists comprises: (a) culturing cells containing:
DNA which expresses DS-CAM protein (s) or functional modified forms thereof, wherein said culturing is carried out in the presence of at least one compound whose ability to modulate signal transduction activity of DS-CAM protein is sought to be determined, and thereafter
(b) monitoring said cells for either an increase or decrease in the level of intracellular cAMP .
Methods well-known in the art that measure intracellular levels of cAMP, or measure cyclase activity, can be employed in binding assays described herein to identify agonists and antagonists of the DS-CAM. For example, because activation of some CAMs results in decreases or increases in cAMP, assays that measure intracellular cAMP levels can be used to evaluate recombinant DS-CAMs expressed in mammalian host cells.
As used herein, "ability to modulate signal transduction activity of DS-CAM protein" refers to a compound that has the ability to either induce (agonist) or inhibit (antagonist) signal transduction activity of the DS-CAM protein.
Each of the invention bioassays (e.g., those described herein, and the like) , can be conducted as competitive assays by co-expressing one or more members of the CAM immunoglobulin superfamily of proteins known in the art, such as N-CAMs, along with invention DS-CAMs. In addition, one or more members of the CAM immunoglobulin superfamily of proteins known in the art can be co-expressed with invention DS-CAMs to evaluate the agonistic or antagonistic effect on signal transduction of the non-DS-CAM members acting in concert with invention DS-CAMS. In yet another embodiment of the present invention, the activation of DS-CAM polypeptides can be modulated by contacting the polypeptides with an effective amount of at least one compound identified by the above-described bioassays.
Members of the N-CAM superfamily of immunoglobulins have previously been implicated in disease. For example, various alterations of N-CAM levels have been seen in degenerative disease, developmental defects, and toxic conditions. Increases in the levels of N-CAM in the cerebrospinal fluid of patients with multiple sclerosis have been observed to parallel their clinical improvement (Massaro et al . , Ital. J. Neurol . Sci. Suppl . 6:85-88, 1987). Levels of N-CAM were reported to be elevated in the amniotic fluid of mothers carrying fetuses with neural tube defects (Ibsen et al . , J. Neurochem. 41:363-366, 1983). Since many such defects are likely to be due to mechanical aberrations rather than genetic defects, confirmation of these results would provide a new diagnostic component for prenatal testing. Another provocative finding relates to observations on the stimulation of Golgi sialyltransferases by lead (Breen and Regan, Development 104:147-154, 1988; and Cookman et al . , J. Neurochem. 49:399-403, 1987). Exposure to lead chloride markedly stimulated sialyltransferase activity from postnatal days 16 to 30 in rate. This time is coincident with the period when N-CAM normally becomes less sialylated. Thus exposure to lead at critical developmental periods would presumably lead to more highly sialylated, less adhesive, forms of N-CAM: this prevention of E-A conversion could have significant effects on neural development. E-A conversion itself has been found to be delayed in the mouse mutant staggerer (Edelman and Chuong, Proc. Natl. Acad. Sci. USA, 79:7036-7042, 1982) in conjunction with the connectivity changes associated with the mutation.
The location and expression of DS-CAM in the Down Syndrome (DS) phenotype is supported by the studies of patients with partial trisomy 21. A subset of the DS features, including the typical facial appearance and mental retardation, were suggested by duplication of band 21q22 only (Niebuhr, Humangenetik 21:99-101, 1974).
Other studies mapped those features and congenital heart disease to the region 21q22.2-q22.3 and between D21S267 and MX1/MX2 (Korenberg et al . , Am. J. Hum. Genet. 50:294-302, 1992 and Korenberg et al . , Proc. Natl. Acad.
Sci. USA 91:4997-5001, 1994), a region of about 4 Mb that contains DS-CAM. The Ts65Dn mouse model of DS contains the region of MMU16 (Pgkl-psl to MXl/2) that includes
DS-CAM and reveals some of the neurobehaviourial features of DS (Reeves et al . , Nature Genet . 11:177-183, 1995 and
Holtzman et al . , Proc. Natl. Acad. Sci. USA 93:13333-
13338, 1996) .
Close to 6% of DS individuals have
Hirschsprung ' s disease (HSCR) (Garver et al . , Clin.
Genet . 28:503-5-8, 1985) and more than 10% of all HSCR is associated with DS (Passarge, New Eng. J. Med. 276:138-
143, 1967) . A modifier region of HSCR on chromosome 21q22 (D21S259 - D21S156) has been reported in non-DS
HSCR (Puffenberger et al . , Hum. Mol. Genet. 3:1217-1225,
1994) . The DS-CAM gene maps within this small region. The expression of DS-CAM in the neural crest derived enteric plexus of the gut was detected by mouse tissue in situ hybridization (Example 7) . The function of the DS- CAM protein as a neural cell adhesion molecule and the association of this region of chromosome 21 with HSCR, indicate that DS-CAM can play a role in the migration of the cranial neural crest that populate this region. Thus, DS-CAM overexpression is responsible for the chromosome 21 association in non-DS HSCR and for the HSCR seen in DS .
Mutations in the molecule CAM-LI, a molecule more similar to DS-CAM than to N-CAM (Figure 4), have established roles in human disease. The result in X- linked hydrocephalus (Rosenthal et al . , Nature Genet . 2:107-112, 1992), type 1 X-linked spastic paraplegia and the MASA syndrome (including mental retardation, aphasia, shuffling gait, adducted thumb and agenesis of the corpus callosum) (Jouet et al . , Nature Genet . 7:402-407, 1994).
The perturbation of development by the aneuploid expression of CAM-LI supports a role for the aneuploid expression of DS-CAM in the causation of developmental and neurological abnormalities.
In accordance with another embodiment of the present invention, there are provided methods for diagnosing DS-CAM associated disease, such as mental retardation, holoprosencephaly, agenesis of the corpus callosum, or schizencephaly, said method comprising: detecting, in said subject, a genomic or transcribed mRNA sequence including SEQ ID NO : 1 or SEQ ID NO: 10, or fragments thereof.
Preferably, the DS-CAM nucleic acids detected in accordance with the invention diagnostic methods are either mutated in one form or another (such as point mutations, deletions, and the like), or are overexpressed relative to levels of DS-CAM expression in healthy non-diseased individuals.
In accordance with another embodiment of the present invention, there are provided diagnostic systems, preferably in kit form, comprising at least one invention nucleic acid in a suitable packaging material . The diagnostic nucleic acids are derived from the DS-CAM-encoding nucleic acids described herein. In one embodiment, for example, the diagnostic nucleic acids are derived from SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9 or SEQ ID NO: 10. Invention diagnostic systems are useful for assaying for the presence or absence of nucleic acid encoding DS-CAM in either genomic DNA or in transcribed nucleic acid (such as mRNA or cDNA) encoding DS-CAM.
A suitable diagnostic system includes at least one invention nucleic acid, preferably two or more invention nucleic acids, as a separately packaged chemical reagent (s) in an amount sufficient for at least one assay. Instructions for use of the packaged reagent are also typically included. Those of skill in the art can readily incorporate invention nucleic probes and/or primers into kit form in combination with appropriate buffers and solutions for the practice of the invention methods as described herein.
As employed herein, the phrase "packaging material" refers to one or more physical structures used to house the contents of the kit, such as invention nucleic acid probes or primers, and the like. The packaging material is constructed by well known methods, preferably to provide a sterile, contaminant-free environment. The packaging material has a label which indicates that the invention nucleic acids can be used for detecting a particular sequence encoding DS-CAM including the nucleotide sequence set forth in SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10, thereby diagnosing the presence of, or a predisposition for, holoprosencephaly, agenesis of the corpus callosum, or for several phenotypes of Down Syndrome including mental retardation, and the like. In addition, the packaging material contains instructions indicating how the materials within the kit are employed both to detect a particular sequence and diagnose the presence of, or a predisposition for, holoprosencephaly, agenesis of the corpus callosum, or for several phenotypes of Down syndrome including mental retardation, and the like.
The packaging materials employed herein in relation to diagnostic systems are those customarily utilized in nucleic acid-based diagnostic systems. As used herein, the term "package" refers to a solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding within fixed limits an isolated nucleic acid, oligonucleotide, or primer of the present invention. Thus, for example, a package can be a glass vial used to contain milligram quantities of a contemplated nucleic acid, oligonucleotide or primer, or it can be a microtiter plate well to which microgram quantities of a contemplated nucleic acid probe have been operatively affixed.
"Instructions for use" typically include a tangible expression describing the reagent concentration or at least one assay method parameter, such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions, and the like.
All U.S. patents and all publications mentioned herein are incorporated in their entirety by reference thereto. The invention will now be described in greater detail by reference to the following non-limiting examples . Materials and Methods
Unless otherwise stated, the present invention was performed using standard procedures, as described, for example in Maniatis et al . , Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA, 1982; Sambrook et al . , supra, 1989; Davis et al . , Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA, 1986; or Methods in Enzymology: Guide to Molecular Cloning Techniques Vol. 152, S. L. Berger and A. R.
Kimmerl Eds., Academic Press Inc., San Diego, USA, 1987.
Libraries .
Construction of Bacterial Artificial Chromosome (BAC) library. BAC library construction of total human genomic DNA was performed as described in Shizuya et al . , Proc. Natl. Acad. Sci. USA 89:8794-8797, 1992; and Hubert et al . , Genomics 41:218-226, 1997. Yeast artificial chromosome (YAC) clones were obtained from the CEPH mega-YAC library and grown under standard conditions (Cohen et al . , Nature 366:689-701 1993).
PI artificial chromosome (PAC) library construction . A 3X human PAC library, designated RPCI-1
(Ioannou et al . , Hum. Genet. 219-220, 1994) was constructed as described (Ioannou et al . , Nat . Genet .
6:84-89, 1994). The library was arrayed in 384 well dishes. Subsequently, STSs generated by sequencing of clones using vector primers were used as hybridization probes to gridded colony filters of the PAC library.
YAC DNA preparation . YAC clones were grown in selective media, pelleted and resuspended in 3 ml 0.9 M sorbitol, 0. IM EDTA pH 7.5, then incubated with 100 U of lytocase (Sigma, St. Louis, MO) at 37°C for 1 hour. After centrifugation for 5 minutes at 5,000 rpm pellets were resuspended in 3 ml 50 mM Tris pH 7.45, 20 mM EDTA 0.3ml 10% SDS was added and the mixture was incubated at 65°C for 30 minutes. One ml of 5 M potassium acetate was added and tubes were left on ice for 1 hour, then centrifuged at 10,000 rpm for 10 minutes. Supernatant was precipitated in 2 volumes of ethanol and pelleted at 6,000 rpm for 15 minutes. Pellets were resuspended in TE, treated with RNase and reextracted with phenol -chloroform.
Analysis by fluorescence in si tu hybridiza tion
(FISH) . PAC or BAC clones were biotinylated by nicktranslation in the presence of biotin-14-dATP using the BioNick Labeling Kit (Gibco-BRL) . FISH was performed essentially as described (Korenberg et al . , Cytogenet . Cell Genet. 69:196-200, 1995). Briefly, 400 ng of probe
DNA was mixed with 8 ng of human Cot 1 DNA (Gibco-BRL) and 2 μg of sonicated salmon sperm DNA in order to suppress possible background produced from repetitive human sequences as well as yeast sequences in the probe. The probes were denatured at 75°C, preannealed at 37°C for one hour, and applied to denatured chromosome slides prepared from normal male lymphocytes (Korenberg et al . , supra , 1995) . Post-hybridization washes were performed at 40°C in 2X SSC/50% formamide followed by washes in IX SSC at 50°C. Hybridized DNAs were detected with avidin-conjugated fluorescent isothiocyanate (Vector Laboratories) . One amplification was performed by using biotinylated anti-avidin. For distinguishing chromosome subbands precisely, a reverse banding technique was used, which was achieved by chromomycin A3 and distamycin A double staining (Korenberg et al . , supra , 1995) . The color images were captured by using a Photometries Cooled-CCD camera and BDS image analysis software (Oncor Imaging, Inc . ) .
Southern blot analysis . Gel electrophoresis of
DNA was carried out on 0.8% agarose gels in IX TBE . Transfer of nucleic acids to Nybond N+ nylon membrane
(Amersham) was performed according to the manufacturer's instruction. Probes were labeled using RadPrime Labeling System (BRL) . Hybridization was carried out at 42°C for 16 hours in 50% formamide, 5X SSPE, 5X Denhardt ' s 0.1% SDS, 100 mg/ml denatured salmon sperm DNA. The filters were washed once in lx SSC, 0.1% SDS at room temperature for 20 minutes, and twice in 0. IX SSC, 0.1% SDS for 20 minutes at 65°C. The blots were exposed onto X-ray film (Kodak, X-OMAT-AR) .
Sequencing of PAC and BAC endcl ones . PAC clones were inoculated into 500 ml of LB/kanamycin and grown overnight. BAC clones were inoculated into 500 ml of LB/chloramphenicol and grown overnight . DNAs were isolated using QIAGEN columns according to the vendors protocol with one additional phenol/chloroform/isoamylalcohol extraction followed by one additional chloroform/isoamylalcohol extraction. Clones were sequenced using the Gibco-BRL cycle sequencing kit with standard T7 and SP6 primers .
EXAMPLE 1
Construction of BAC Contig
To provide stable clones for gene isolation and sequencing initiatives in the D21S55 to MX1 region, contigs were constructed using Bacterial Artificial Chromosomes (BACs) and PI Artificial Chromosomes (PACs) . BAC library construction of total human genomic DNA was performed as described (Shiyuza et al . , supra . 1992; Kim et al . , Genomics 34:213-218, 1996) . A BAC library was screened using several YACs spanning the region; a PAC library (Iannou et al . , Nature Genet . 6:84-89, 1994) was screened using radiolabeled STS PCR products and whole BACs in gap filling initiatives.
The location of these BAC and PAC clones was confirmed by fluorescence in si tu hybridization (FISH) .
Clone to clone Southerns using 24 new STSs (generated from direct sequencing of BAC and PAC ends) along with 35 pre-existing STSs were used to show overlaps between BACs and PACs. The STS density over the intervals covered in BACs and PACs was 1 STS every 60 kb, and 79% of the clones were positive for 2 or more STSs. Approximately 3.5Mb of the 4-5Mb D21S55 to MX1 interval is covered in 85 BACs and 25 PACs representing 4 -fold coverage within the contigs (Hubert et al . , Genomics 41:218-226, 1997).
The minimal contig sizes as determined by counting only non-overlapping clones are: 1100 kb, 900 kb, 510 kb, 380 kb and 270 kb . Insert size of BAC clones was measured by running pulse-field gel electrophoresis after digesting DNA with NotI.
EXAMPLE 2
Direct cDNA Selection
A modified direct cDNA selection technique (Yamakawa et al . , Hum. Mol. Genet. 4:709-716, 1995;
Yamakawa et al . , Cytogenet . Cell Genet. 74:140-145, 1996) was applied to BAC-423A5, BAC-430F1, BAC-628H2, BAC-371H8 and PAC-31P10 (Figure 1) by using cDNA from trisomy 21 human fetal brain, and the selected fragments were then subcloned into a plasmid vector. Total RNA was isolated from 14 week trisomy 21 fetal brain using TRI region™ (Molecular Research Center, Inc.) . Poly (A) + RNA was isolated using Poly (A) Quick mRNA isolation kit (STRATAGENE) . Double stranded cDNA was synthesized using Superscript™ Choice System (GIBCO BRL) from 5 μg trisomy 21 fetal brain poly (A) + RNA using 1 μg oligo (dT)15 or 0.1 μg random hexamer. The entire synthesis reaction was purified by Gene Clean II kit (BIO101, Inc.) and then kinased. Sau3AI linker was attached to the cDNA which was subsequently digested with Sau3AI . The reaction was purified using Gene Clean. Mbol linker was attached to the cDNA and the reaction purified by Gene Clean (Morgan et al . , supra, 1992) . The synthesized product was amplified by PCR using one strand of Mbol linker ( 5 ' CCTGATGCTCGAGTGAATTC3 ' ) (SEQ ID NO : 4 ) as a primer. PCR cycling conditions were 40 cycles of 94°C/15 seconds, 60°C/23 seconds, 72°C/2 minutes in a 100 μl of lx PCR buffer (Promega) , 3 mM MgCl2, 5.0 units of Taq polymerase (Promega), 2 μM primer and 0.2 mM dNTPs .
Nineteen BAC DNAs (total 2.5 μg) and 2 PAC DNAs between the region ETS2 and MX1 were prepared using QIAGEN plasmid kit and were biotinylated using Nick Translation Kit and biotin-16-dUTP (Boehringer Manneheim) . 3 μg of heat denatured PCR amplified cDNA was annealed with 3 μg of heat denatured COTl DNA (BRL) in lOOμl hybridization buffer (750 mM NaCl, 50 mM NaP04 (pH7.2) , 5 mM EDTA, 5X Denhardt' s, 0.05% SDS and 50% formamide) at 42°C for two hours. After prehybridization, 1.2 μg of heat denatured biotinylated BAC DNA was added and incubated at 42°C for 16 hours. cDNA-BAC DNA hybrids were precipitated with EtOH and dissolved in 60 μl of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. After addition of 40 μl 5 M NaCl, the DNA was incubated with magnetic beads (Dynabeads M-280, Dynal) at 25°C for 1 hour with gentle rotating to allow attachment of the DNA to the magnetic beads. The beads were then washed twice by pipetting in 400 μl of 2X SSC, setting in magnet holder (MPC-ETM, Dynal) for 30 seconds and removing the supernatant. Four additional washes were performed in 0.2X SSC at 68°C for 10 minutes each with transfer of the beads to new tubes at each wash. cDNAs were eluted in lOOμl of distilled water for 10 minutes at 80°C with occasional mixing. The eluted cDNAs were amplified by PCR as described above. After twice repeating the selection procedure using magnetic beads, amplified cDNAs were digested with EcoRI and subcloned into pBlueScript KS+ (STRATAGENE) . Insert DNAs were isolated from the subclones, and were analyzed by Southern hybridization and DNA sequencing.
The direct cDNA selection procedure using 19 BACs and 2 PACs between ETS2 and MXl generated a total of 145 unique cDNA fragments. Genbank and TIGR homology searches using FASTA revealed matches to ETS2 , HMG14, PEP19, a Na K ATPase, Titan ESTs , MXl region ESTs, and 14 ESTs of unknown function. A cDNA library from a trisomy 21 fetal brain at 14 weeks gestation was screened using one of these unique cDNA fragments labeled "E51" (SEQ ID NO: 3) .
EXAMPLE 3
Isolation of human DS-CAM cDNA using cDNA Library Screening
A trisomy 21 human fetal brain (14 weeks of age) cDNA library was constructed using ZAP-cDNA® synthesis kit (STRATAGENE) which generates a unidirectional cDNA library. Briefly, double- stranded cDNA was synthesized from 5 μg trisomy 21 fetal brain poly (A) + RNA using a hybrid oligo (dT) -Xhol linker primer with 5-methyl dCTP . An EcoRI linker was attached to the cDNA which was subsequently digested with EcoRI and Xhol, and then cloned into UNI -ZAP XR vector (STRATAGENE) . The library was packaged using Gigapack® II Gold packaging extract. The titer of the original library was 1.1 x 10s p. f . u. /package . The library was amplified once. A blue-white color assay indicated that 99% of the clones had inserts.
Screening of the trisomy 21 fetal brain cDNA library was performed using one of the 145 unique cDNA fragments labeled "E51" (SEQ ID NO : 3 ) prepared as described above. Phages were plated to an average density of 1 x 105 per 175 cm2 plate. Plaque lifts of 20 plates (2 x 106 phages) were made using duplicated nylon membranes (Hybond-N+; Amersham) . Hybridized membranes were washed to final stringency of 0.2X SSC, 0. IX SDS at 65°C. The filters were exposed overnight onto X-ray film.
Identification of 62 clones were made out of 2 x 106 clones in the original library. Eighteen of these positive phage clones were converted to plasmids, and their DNAs were isolated. These cDNAs were independently numbered as separate DS-CAM (Down Syndrome Cell Adhesion Molecule) clones. The length of the inserts of these clones ranged from 2.4 kb to 6.6 kb . Exon trapping (Buckler et al . , Proc. Natl. Acad. Sci. USA 88:4005-4009, 1991; Church et al . , Nature Genet . 6:98-105, 1994) was also used to isolate cDNAs in the BAC and PAC contig. With this approach, three exons identified from BAC-539E7 and one from BAC-430F1 were found to identify the same sequences as those isolated by cDNA selection.
Sequence analysis of one of the clones, labeled
DS-CAM-42, revealed a 6110 bp DNA sequence which contained a large ORF (5687 bp) as well as 3 ' -UTR sequence (423 bp) , but the 5 ' UTR and start codon were not located in clone DS-CAM-42. To characterize the 5' end, two further clones, DS-CAM-18 of 6.5 kb and DS-CAM-52 of 6.6 kb were characterized. Sequence analyses of these clones close to the 5 ' end overlap with sequence at the 5' end of DS-CAM-42. However, DS-CAM-18 extends 416 bp farther 5', and DS-CAM-52 extends 494 bp farther 5' than DS-CAM-42. The extra 494 bp sequence extends the ORF by 43 bp at the 5' end and contains a start codon. Two stop codons occur 330 bp and 427 bp upstream of the start codon. The 494 bp of additional 5' sequence found in DS-CAM-52 combined with DS-CAM-42 (6604 bp) yield a consensus cDNA that encodes one isoform of the invention protein labeled DS-CAMl. The DS-CAMl cDNA contains an open reading frame of 5730 bp (SEQ ID NO:l) coding for a 1910 amino acid protein (SEQ ID NO : 2 ; approximately 211 kilodaltons), flanked by 452 bp of 5 ' -UTR and 422 bp of 3' -UTR. The 5 ' -UTR is highly GC rich (81% GC over 452 bp) and contains 13 Mspl sites, as well as 72 CG and 93 GC dinucleotide pairs.
The DS-CAMl protein contains an extracellular component at the N-terminus consisting of nine tandemly repeated Ig-like C2 type domains and a tenth Ig-like C2 domain located between domains four and five of an array of six repeated fibronectin type III domains (Figure 2) . Each Ig-like C2 domain consists of approximately 100 amino acids with a pair of conserved cysteines separated by 49-56 residues. A single transmembrane domain of 22 amino acids was defined by using the TMBASE program (Hoffmann and Stoffel, Biol. Chem. Hoppe-Seyler 374:166,
1993) . The remaining 294 amino acids at the C-terminus corresponding to the cytoplasmic domain have partial homologies to the mouse M-phase inducer phosphatase 2 (Kakizuka et al . , Genes Dev. 6:578-590, 1992) in two regions, one with 34% identity and 52% similarity over 46 bp and a second with 38% identity and 52% similarity over 21 bp . The homolog of Drosophila glass gene (O'Neill et al., Proc. Natl. Acad. Sci. USA 92:6557-6561, 1995) with 30% identity and 52% similarity over 42 bp, and the mouse delta opioid receptor (Evans et al . , Science 258:1952-
1955, 1992) with 43% identity and 60% similarity over 30 bp. The putative protein contains 16 potential N-glycosylation sites.
A homology search of the predicted amino acid sequence of the 5730 bp open reading frame of DS-CAMl (SEQ ID N0:1) to genes registered in the Genbank and the EMBL databases was conducted by using the BLAST-P program (Altschul et al . , J. Mol. Biol. 215:403-410, 1990). The predicted amino acid sequence revealed homologies to multiple proteins (Figure 4) including CAM-LI (Moos et al., Nature 334:701-703. 1988), BIG-1 (brain-derived immunoglobulin (Ig) superfamily molecule-1) (Yoshihara et al., Neuron 13:415-426, 1994), DCC (deleted in colon cancer) (Fearon et al . , Science 247:49-56, 1990), and revealed DS-CAM as defining a novel class of the immunoglobulin (Ig) superfamily. Homology searches with sequences of Ig type-C2 domains and fibronectin type-Ill domains of the most highly related Ig-superfamily members (CAM-LI, DCC, and axonin-1) were conducted by using the FASTA program (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444-2448, 1988).
In addition, a splice variant cDNA sequence encoding a non-membrane bound isoform of DS-CAMl, referred to herein as DS-CAM2, is provided herein. Two human DS-CAM cDNA clones (DS-CAM-18 and DS-CAM-52) were found to contain identical deletions of 191 bp that occur in neighboring exons and that delete bp 5133 to 5323 of the SEQ ID NO : 1 cDNA sequence encoding DS-CAMl (Figure
3) . The resulting splice variant transcript encoding DS- CAM2 (SEQ ID NO: 10) is deleted for the entire transmembrane domain that is encoded by the more 3 ' of these exons. Further, the deletion changes the reading frame and creates a stop codon 36 bp downstream of the deletion resulting in a soluble extracellular protein of 1571 amino acids (SEQ ID NO: 11) . The distal border of the resulting deletion contains the canonical AG of the RNA splicing consensus acceptor site. The proximal border contains a variant of the donor splice site consensus sequence (Jackson, Nucl . Acids Res . 19:3795-
3798, 1991) .
To confirm that the DS-CAM cDNA originated from the BACs and PACs in the Down syndrome region and to determine the genomic size of DS-CAM, the longest DS-CAM cDNA clones (DS-CAM-42; 6.1 kb, DS-CAM-18; 6.5 kb, DS-CAM-52; 6.6 kb) were hybridized to Southern blots containing the BAC and PAC clone contig (Figure 1) . DS-CAM-42, 18 and 52 hybridized to BACs 423A5, 430F1,
628H2, 539E7, 371H8, 825E1, 593D1, 261F12, 30E4, 385B7, 388F4, and to PACs 31P10, 58D10. BACs 816F6, 116E8, 720G4, 619H8 were only positive for DS-CAM-18 and DS-CAM-52 but negative for DS-CAM-42. All other BACs shown in Figure 1 were negative. These results indicate that the DS-CAM gene spans 900 kb-1200 kb genomic DNA and covers a gap in this BAC and PAC contig indicated by an arrowhead as well as in the available YAC contigs (Korenberg et al . , Genome Res. 5:427-443, 1995; Gardiner et al., Somat . Cell Mol. Genet. 21:399-414, 1995).
DS-CAM cDNA sequences were confirmed to originate from these BACs and PACs by direct sequencing of the BACs and PACs as templates using cDNA sequence-specific primers.
The map position of DS-CAM on chromosome 21q22.2-22.3 was confirmed by using clone DS-CAM-42 as a probe for fluorescence in-situ hybridization. Two independent experiments were performed and over 100 metaphase cells were evaluated. Signals were clearly seen on two chromatids of at least one chromosome in 85% of cells. There were no other double signal sites seen in greater than 1% of cells.
EXAMPLE 4
Northern Blot Analysis Of Human DS-CAM Expression
Inserts containing DS-CAM cDNA were excised from the base vector by digestion with Xhol and EcoRI. After labeling using the random priming method (RadPrime Labeling System; GIBCO BRL) , followed by purification using G-50 Sephadex columns (Quick Spin Column; Boehringer Mannheim) , the fragments were used a probes for Northern hybridization using Multiple Tissue Northern Blot (Clontech) . A Northern blot assay was conducted using DS-CAM cDNA as a probe in various fetal and adult tissues including heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. Northern hybridization was performed by following the manufacturer's instructions. The hybridized membrane was washed at a final stringency of 0. IX SSC and 0. IX SDS at 50°C. The filter was exposed to X-ray film (Kodak X-OMAT AR) at -70°C for 1-5 days.
The results of Northern analysis using human fetal tissues showed that 8.5 kb and 7.6 kb transcripts are expressed only in fetal brain and not expressed in fetal lung, fetal liver and fetal kidney. In adult tissues, three transcripts of 9.7 kb, 8.5 kb, and 7.6 kb are present in the brain. Placenta shows faint bands, and the sizes are similar to those in brain. In skeletal muscle, a faint smaller band (6.5 kb) is detected. In multiple parts of the adult human brain, transcripts of 9.7 kb, 8.5 kb and 7.6 kb are differentially expressed.
The 9.7 kb transcript is highly expressed in the substantia nigra, moderately expressed in amygdala and hippocampus, and less expressed in the whole brain. A similar pattern is obtained using a PCR product which spans the 191 bp deletion found in clones DS-CAM-18 and DS-CAM-52 encoding the splice variant sequence corresponding to DS-CAM2. Thus, splice variant cDNA transcripts encoding a DS-CAM family of proteins are clearly contemplated by the present invention.
EXAMPLE 5
RT-PCR Assays Of Human DS-CAM Expression
Reverse-transcriptase polymerase chain reaction (RT-PCR) assays verses cDNA libraries of various human tissues were conducted using primers numbered B9-131F (SEQ ID NO:5) and B9-131R (SEQ ID NO : 6 ) . The results demonstrated expression of human DS-CAM mRNA in fetal and adult brain, and fetal kidney. In addition, a breast carcinoma cell line showed expression of human DS-CAM mRNA.
The cDNAs from 13 independent human fetal and adult sources were analyzed by PCR using primer pairs that flanked the alternatively spliced region that results in a 191 base pair deletion of nucleotides 5133- 5323 of the DS-CAMl cDNA set forth in SEQ ID NO : 1. The primers were designed to generate products of different sizes for each of the two alternatively spliced transcripts: 536 bp corresponding to the non-deleted DS-CAM-1 transcript and 345 bp corresponding to the deleted DS-CAM2 transcripts. The analyses included adult samples from amygdala (24 years) , skeletal muscle (36 years) and three independent lymphoblastoid cell lines. Fetal samples included whole brain of a trisomy 21 fetus (14 weeks), four from whole brain (4.5-13 weeks), one from temporal lobe (28 weeks) and two from heart (4.5 and 13 weeks) . The results indicate that all fetal and adult samples produced two bands corresponding to PCR products of the predicted sizes which indicates the expression of two alternatively spliced transcripts.
EXAMPLE 6
Isolation of mouse DS-CAM cDNA clones
A mouse brain cDNA library was prepared from 19 week old female C57 Black/6 mice in the Uni-ZAP XR Vector (STRATAGENE) . The cDNAs were oligo-dT primed and cloned unidirectionally into the EcoRI and Xhol sites of the vector. The average insert size is 1.0 kb. The library was screened using a human DS-CAM cDNA clone as a probe. Two partial mouse DS-CAM cDNA clones were isolated and sequenced. The combined nucleotide sequences of these clones are set forth in SEQ ID NO : 7 , SEQ ID NO : 8 and SEQ ID NO: 9, and were found to represent the 5', middle and 3' portions, respectively, of cDNA encoding a mouse DS-CAM.
EXAMPLE 7
Hybridization analysis of DS-CAM cDNA in mouse tissues
BALB/c and C57BL/6 x DBA/2 embryos, fetuses and postnatal brains were fixed and embedded as described in detail in Lyons et al . , (J. Neurosci . 15:5727-5738,
1995) . Embryos were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) overnight, dehydrated and infiltrated with paraffin. Five to seven micron serial sections were mounted on gelatinized slides. Two sections were mounted/slide, deparaffinized in xylene, rehydrated and post-fixed. The sections were digested with proteinase K, post-fixed, treated with tri-ethanolamine/acetic anhydride, washed and dehydrated. cRNA probes were prepared from DS-CAM-M-14. The plasmid was linearized with Xbal and T7 polymerase was used to generate the antisense cRNA. The plasmid was linearized with Kpnl and T3 polymerase was used to generate the sense control cRNA. The cRNA transcripts were synthesized according to manufacturer's conditions (STRATAGENE) and labeled with 35S-UTP (>1000 Ci/mmol;
Amersham) . cRNA transcripts larger than 100 nucleotides were subjected to alkali hydrolysis to give a mean size of 70 bases for efficient hybridization.
Sections were hybridized overnight at 52°C in 50% deionized formamide, 0.3M NaCl, 20 mM Tris-HCl pH 7.4, 5 mM EDTA, 10 mM NaP04 , 10% dextran sulfate, lx Denhardt 's, 50 μg/ml total yeast RNA, and 50-75,000 cpm/μl 35S-labeled cRNA probe. The tissue was subjected to stringent washing at 65°C in 50% formamide, 2X SSC, 10 mM DTT and washed in PBS before treatment with 20 μg/ml
RNase A at 37°C for 30 minutes. Following washes in 2X SSC and 0. IX SSC for 10 minutes at 37°C, the slides were dehydrated and dipped in Kodak NTB-2 nuclear track emulsion and exposed for 2-3 weeks in light-tight boxes with desiccant at 4°C. Photographic development was carried out in Kodak D-19. Slides were counterstained lightly with toluidine blue and analyzed using both light- and darkfield optics of a Zeiss Axiophot microscope. Sense control cRNA probes (identical to the mRNAs) always gave background levels of hybridization signal. Embryonic structures were identified with the help of the following atlases : Rugh (The Mouse: Its Reproduction and Development. Oxford Univ. Press, Oxford,
UK, 1990) , Kaufman (The Atlas of Mouse Development. Acad. Press, New York, NY, 1992) , and Altman and Bayer (supra. 1995) .
Tissue in situ hybridization analysis was performed using a mouse cDNA as a probe on sections of normal mouse embryos from days 8.5-17.5 post coitum (pc) as well as in newborn, two weeks and adult brains as described above. The results indicate that there is no detectable expression of DS-CAM at 8.5 days pc . At 9.5 days pc, expression was detected in the neuroepithelium. Low levels of expression were detected within the branchial arches, suggestive of migrating neural crest cells. At 10.5 days pc, the trigeminal ganglia (neural crest derived) begin to express the transcript and expression within the branchial arches was more evident.
Expression at 11.5 days pc was abundant throughout the brain. The transcript was found within the regions of the nervous system that differentiate earliest during development (Altman and Bayer, supra , 1995) . In the brain, this includes the ventral-most regions, such as the thalamus and medulla. Some expression was detected within the olfactory epithelium. Expression within the neural tube begins in two areas: the ventrolateral (corresponding to the areas in which the motor neurons differentiate) and the lateral gray columns (that later form commissural neurons) (Leber et al . , J Neurosci . 15:1236-1248, 1990). The dorsal root ganglia (neural crest derived) expressed the transcript at 11.5 days pc . The trigeminal ganglia show higher levels at 11.5 days pc than they did at 10.5 days. Migrating neural crest can be seen within the maxilla, the mandibular arch, and in the developing gut. Signal was observed within the mesenchyme surrounding the umbilical vein and artery.
At 12.5 days pc, expression was more extensive than at 11.5 days pc . More of the nervous system exhibits expression of the transcript, including a larger portion of midbrain, the pontine areas, the basal ganglia and the outermost layer of cortex. Neurons in this layer have undergone mitosis in the subependymal layer of the cortex and migrated into the mantle layer of the cerebral cortex as differentiated cells (Smart et al . , J . Comp . Neurol . 116:325-347, 1961).
At 13.5 days pc, expression was seen throughout most of the brain. The outermost layer of the gut also appears to be expressing at this stage; these cells are neural crest derived and form the myenteric ganglia. At 15.5 and 16.5 days pc, most of the neural crest derived neural structures have some expression. For example, the regions of the snout that will develop into the sensory structures at the base of the vibrissae, the pancreatic ganglia, the heart ganglion, the enteric nervous system, and the sympathetic trunk all express the transcript.
There is no expression within the umbilicus at this stage. Two non-neuronal structures express this gene, the gonad and the annulus fibrosus of the intervertebral disk. The olfactory bulb exhibits signal both in the granule cells and within the tufted mitral cells. Within the newborn brain, the transcript was expressed most extensively within the differentiating regions such as the septal area, olfactory bulb, inferior colliculus and hippocampus. In the adult brain, the gene was expressed in many areas including amygdala, cortex, hippocampus and thalamus. In the adult cerebellum the transcripts were detected in the Purkinje cell layer and in the deep cerebellar nuclei.
While the invention has been described in detail with reference to certain preferred embodiments thereof, it will be understood that modifications and variations are within the spirit and scope of that which is described and claimed. Summary of Sequences
SEQ ID N0:1 is the nucleic acid sequence (and the deduced amino acid sequence) of cDNA encoding a novel human DS-CAMl protein of the present invention.
SEQ ID NO : 2 is the deduced amino acid sequence of a human DS-CAMl protein of the present invention.
SEQ ID NO: 3 is the cDNA probe (labeled "E51") used to isolate cDNA encoding human DS-CAM.
SEQ ID NO: 4 is an Mbol linker sequence.
SEQ ID NO: 5 is a primer labeled B9-131F used in the RT-PCR assay described in Example 5.
SEQ ID NO: 6 is a primer labeled B9-131R used in the RT-PCR assay described in Example 5.
SEQ ID NO : 7 is the 5' region of a partial mouse-derived cDNA clone encoding an invention DS-CAM protein.
SEQ ID NO: 8 is the middle region of a partial mouse-derived cDNA clone encoding an invention DS-CAM protein.
SEQ ID NO:9 is the 3' region of a partial mouse-derived cDNA clone encoding an invention DS-CAM protein.
SEQ ID NO: 10 is the nucleic acid sequence (and the deduced amino acid sequence) of cDNA encoding a novel human DS-CAM2 protein of the present invention.
SEQ ID NO: 11 is the deduced amino acid sequence of a human DS-CAM2 protein of the present invention, which is a splice variant of DS-CAMl (SEQ ID NO: 2) . SEQUENCE LISTING
(1) GENERAL INFORMATION:
(I) APPLICANT: Cedars-Sinai Medical Center
(ii) TITLE OF INVENTION: NUCLEIC ACID ENCODING DS-CAM PROTEINS AND PRODUCTS RELATED THERETO
(m) NUMBER OF SEQUENCES: 11
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Campbell and Flores
(B) STREET: 4370 La Jolla Village Drive, Suite 700
(C) CITY:San Diego
(D) STATE: CA
(E) COUNTRY: USA
(F) ZIP:92122
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A ) APPLICATION NUMBER :
( B ) FILING DATE :
(C) CLASSIFICATION:
(vn) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/029,322
(B) TILING DATE: 25-OCT-1996
(vm) ATTORNEY/AGENT INFORMATION:
(A) NAME: Ramos, Robert T.
(B) REGISTRATION NUMBER: 37,915
(C) REFERENCE/DOCKET NUMBER: P-CE 2817
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 619-535-9001
(B) TELEFAX: 619-535-8949
(2) INFORMATION FOR SEQ ID NO : 1 :
(I) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6604 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ll) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 453..6185 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
TGACTGAGGC CGGAGCACGG CAAAGATGAG CCTGCCCGCC CGCCTGCTGC CTGGATGCGG 60
AGGGTGAGGG CTGGCGCACG GGAGGCCGCT GGCTGCGCAT TCTGGGCGCC GAGTGCCCGG 120
GATGAGCTCA CGCCCGCGTC TGCGGCTCTC TCCACCTGCC GACCTGCCGG GGGCCCACTG 180
AGCTGACGGC GCACCTGGGC TCCGGCCGCA GCGTGGGGCG CGGCGCCCGG GAGCAGGTGT 240
GCAGGAGCGC AGCGCGCGGC GAGCGCAGCC CTCGCTCCGG AGCCCGGCCG CGCCGCGTGC 300
CCGGGCGGCT AGGCAGCGGC GGCGGCGGCG GCGGGCGGCG GGCGGGCGGC GGCCCCCGGG 360
CAGGTGCCGA GCGGCGAGCG GAGCCGGGCC GGGCGGAGCG CGGGGGGCGA GGCCGGCGCG 420
TCGCTCGCGG GAGGCCGGGG AGCGGCAGGG GC ATG TGG ATA CTG GCT CTC TCC 473
Met Trp lie Leu Ala Leu Ser 1 5
TTG TTC CAG AGC TTC GCG AAT GTT TTC AGT GAA GAC CTA CAC TCC AGC 521 Leu Phe Gin Ser Phe Ala Asn Val Phe Ser Glu Asp Leu His Ser Ser 10 15 20
CTC TAC TTT GTC AAT GCA TCT CTG CAA GAG GTA GTG TTT GCC AGC ACC 569 Leu Tyr Phe Val Asn Ala Ser Leu Gin Glu Val Val Phe Ala Ser Thr 25 30 35
ACG GGG ACT CTG GTG CCC TGC CCC GCA GCA GGC ATC CCT CCT GTG ACT 617 Thr Gly Thr Leu Val Pro Cys Pro Ala Ala Gly lie Pro Pro Val Thr 40 45 50 55
CTC AGA TGG TAC CTA GCC ACG GGC GAG GAG ATC TAC GAT GTC CCC GGG 665 Leu Arg Trp Tyr Leu Ala Thr Gly Glu Glu I le Tyr Asp Val Pro Gly 60 65 70
ATC CGC CAC GTC CAC CCC AAC GGC ACT CTC CAA ATT TTC CCC TTC CCT 713 lie Arg His Val His Pro Asn Gly Thr Leu Gin lie Phe Pro Phe Pro 75 80 85
CCT TCA AGC TTC AGT ACC TTA ATC CAT GAT AAT ACT TAT TAT TGC ACA 761 Pro Ser Ser Phe Ser Thr Leu lie His Asp Asn Thr Tyr Tyr Cys Thr 90 95 100
GCT GAA AAT CCT TCA GGG AAA ATT AGA AGT CAG GAT GTC CAC ATC AAG 809 Ala Glu Asn Pro Ser Gly Lys lie Arg Ser Gin Asp Val His lie Lys 105 110 115
GCT GTT TTA CGG GAG CCC TAT ACA GTC CGT GTG GAG GAC CAG AAA ACC 857 Ala Val Leu Arg Glu Pro Tyr Thr Val Arg Val Glu Asp Gin Lys Thr 120 125 130 135
ATG AGA GGC AAT GTT GCG GTC TTC AAG TGC ATT ATC CCC TCC TCG GTG 905 Met Arg Gly Asn Val Ala Val Phe Lys Cys He He Pro Ser Ser Val 140 145 150
GAG GCG TAC ATC ACT GTC GTC TCA TGG GAG AAA GAC ACT GTT TCA CTT 953 Glu Ala Tyr He Thr Val Val Ser Trp Glu Lys Asp Thr Val Ser Leu 155 160 165
GTC TCA GGA TCT AGA TTT CTC ATC ACA TCC ACG GGA GCC TTG TAT ATT 1001 Val Ser Gly Ser Arg Phe Leu He Thr Ser Thr Gly Ala Leu Tyr He 170 175 180 AAA GAT GTA CAG AAT GAA GAT GGA TTG TAT AAC TAC CGC TGC ATC ACG 1049 Lys Asp Val Gin Asn Glu Asp Gly Leu Tyr Asn Tyr Arg Cys He Thr 185 190 195
CGG CAT CGA TAC ACC GGA GAG ACG AGG CAG AGC AAC AGC GCC AGA CTT 1097 Arg His Arg Tyr Thr Gly Glu Thr Arg Gin Ser Asn Ser Ala Arg Leu 200 205 210 215
TTT GTA TCA GAC CCA GCG AAC TCA GCC CCA TCC ATA CTG GAT GGG TTT 1145 Phe Val Ser Asp Pro Ala Asn Ser Ala Pro Ser He Leu Asp Gly Phe 220 225 230
GAC CAT CGC AAA GCC ATG GCT GGG CAG CGT GTG GAG CTG CCT TGC AAA 1193 Asp His Arg Lys Ala Met Ala Gly Gin Arg Val Glu Leu Pro Cys Lys 235 240 245
GCG CTC GGG CAC CCT GAG CCA GAT TAC CGC TGG CTG AAG GAC AAC ATG 1241 Ala Leu Gly His Pro Glu Pro Asp Tyr Arg Trp Leu Lys Asp Asn Met 250 255 260
CCC CTG GAA CTT TCA GGG AGG TTC CAG AAG ACC GTG ACG GGG CTG CTC 1289 Pro Leu Glu Leu Ser Gly Arg Phe Gin Lys Thr Val Thr Gly Leu Leu 265 270 275
ATT GAG AAC ATT CGC CCC TCG GAC TCA GGC AGC TAT GTT TGT GAA GTG 1337 He Glu Asn He Arg Pro Ser Asp Ser Gly Ser Tyr Val Cys Glu Val 280 285 290 295
TCC AAC AGA TAC GGA ACT GCT AAG GTG ATA GGC CGC CTG TAC GTG AAA 1385 Ser Asn Arg Tyr Gly Thr Ala Lys Val He Gly Arg Leu Tyr Val Lys 300 305 310
CAG CCA CTG AAA GCC ACC ATC AGT CCC AGG AAG GTT AAA AGC AGC GTG 1433 Gin Pro Leu Lys Ala Thr He Ser Pro Arg Lys Val Lys Ser Ser Val 315 320 325
GGT AGC CAA GTT TCC TTG TCC TGC AGC GTG ACA GGA ACT GAG GAC CAG 1481 Gly Ser Gin Val Ser Leu Ser Cys Ser Val Thr Gly Thr Glu Asp Gin 330 335 340
GAA CTC TCC TGG TAC CGC AAT GGT GAA ATC CTC AAC CCT GGA AAA AAT 1529 Glu Leu Ser Trp Tyr Arg Asn Gly Glu He Leu Asn Pro Gly Lys Asn 345 350 355
GTG AGG ATC ACA GGG ATC AAC CAC GAA AAC CTT ATA ATG GAT CAC ATG 1577 Val Arg He Thr Gly He Asn His Glu Asn Leu He Met Asp His Met 360 365 370 375
GTC AAA AGT GAC GGG GGC GCA TAC CAG TGC TTT GTG CGC AAG GAC AAG 1625 Val Lys Ser Asp Gly Gly Ala Tyr Gin Cys Phe Val Arg Lys Asp Lys 380 385 390
CTG TCC GCT CAA GAC TAT GTG CAG GTG GTC CTT GAA GAT GGA ACT CCC 1673 Leu Ser Ala Gin Asp Tyr Val Gin Val Val Leu Glu Asp Gly Thr Pro 395 400 405
AAA ATT ATT TCT GCC TTT AGT GAA AAG GTG GTG AGT CCA GCA GAG CCG 1721 Lys He He Ser Ala Phe Ser Glu Lys Val Val Ser Pro Ala Glu Pro 410 415 420
GTT TCC CTT ATG TGC AAC GTG AAG GGA ACA CCT TTG CCC ACG ATC ACG 1769 Val Ser Leu Met Cys Asn Val Lys Gly Thr Pro Leu Pro Thr He Thr 425 430 435 TGG ACC CTG GAC GAT GAC CCG ATT CTC AAG GGT GGC AGT CAC CGC ATC 1817 Trp Thr Leu Asp Asp Asp Pro He Leu Lys Gly Gly Ser His Arg He 440 445 450 455
AGC CAG ATG ATC ACG TCG GAG GGG AAC GTG GTC AGC TAC CTG AAC ATC 1865 Ser Gin Met He Thr Ser Glu Gly Asn Val Val Ser Tyr Leu Asn He 460 465 470
TCC AGC TCC CAG GTC CGG GAC GGG GGA GTC TAC CGC TGC ACT GCC AAC 1913 Ser Ser Ser Gin Val Arg Asp Gly Gly Val Tyr Arg Cys Thr Ala Asn 475 480 485
AAC TCG GCG GGA GTC GTC CTG TAC CAG GCT CGA ATA AAC GTA AGA GGG 1961 Asn Ser Ala Gly Val Val Leu Tyr Gin Ala Arg He Asn Val Arg Gly 490 495 500
CCT GCA AGC ATT CGA CCA ATG AAA AAC ATC ACA GCA ATA GCA GGA CGG 2009 Pro Ala Ser He Arg Pro Met Lys Asn He Thr Ala He Ala Gly Arg 505 510 515
GAC ACA TAC ATT CAC TGT CGT GTG ATT GGC TAT CCG TAT TAC TCC ATT 2057 Asp Thr Tyr He His Cys Arg Val He Gly Tyr Pro Tyr Tyr Ser He 520 525 530 535
AAA TGG TAC AAG AAC TCT AAC CTG CTT CCT TTC AAC CAC CGC CAA GTG 2105 Lys Trp Tyr Lys Asn Ser Asn Leu Leu Pro Phe Asn His Arg Gin Val 540 545 550
GCA TTT GAG AAC AAT GGA ACT CTT AAA CTT TCA GAT GTG CAA AAG GAA 2153 Ala Phe Glu Asn Asn Gly Thr Leu Lys Leu Ser Asp Val Gin Lys Glu 555 560 565
GTG GAC GAG GGG GAG TAC ACG TGC AAC GTG TTG GTT CAA CCA CAA CTC 2201 Val Asp Glu Gly Glu Tyr Thr Cys Asn Val Leu Val Gin Pro Gin Leu 570 575 580
TCC ACC AGC CAG AGC GTC CAC GTG ACC GTG AAA GTT CCG CCT TTC ATA 2249 Ser Thr Ser Gin Ser Val His Val Thr Val Lys Val Pro Pro Phe He 585 590 595
CAA CCC TTT GAG TTT CCA AGA TTC TCC ATT GGG CAG CGG GTC TTC ATC 2297 Gin Pro Phe Glu Phe Pro Arg Phe Ser He Gly Gin Arg Val Phe He 600 605 610 615
CCC TGT GTT GTG GTC TCA GGG GAC TTA CCC ATC ACG ATC ACC TGG CAG 2345 Pro Cys Val Val Val Ser Gly Asp Leu Pro He Thr He Thr Trp Gin 620 625 630
AAG GAT GGC CGG CCA ATC CCT GGG AGC CTT GGG GTG ACC ATT GAC AAT 2393 Lys Asp Gly Arg Pro He Pro Gly Ser Leu Gly Val Thr He Asp Asn 635 640 645
ATT GAC TTC ACG AGC TCC TTG AGG ATT TCC AAT CTC TCG CTC ATG CAC 2441 He Asp Phe Thr Ser Ser Leu Arg He Ser Asn Leu Ser Leu Met His 650 655 660
AAT GGG AAT TAC ACC TGC ATA GCC CGG AAT GAG GCC GCC GCT GTG GAG 2489 Asn Gly Asn Tyr Thr Cys He Ala Arg Asn Glu Ala Ala Ala Val Glu 665 670 675
CAC CAA AGC CAG TTG ATT GTC AGA GTT CCT CCC AAG TTT GTG GTT CAG 2537 His Gin Ser Gin Leu He Val Arg Val Pro Pro Lys Phe Val Val Gin 680 685 690 695 CCA CGG GAC CAG GAC GGG ATT TAT GGC AAA GCA GTC ATC CTC AAT TGT 2585 Pro Arg Asp Gin Asp Gly He Tyr Gly Lys Ala Val He Leu Asn Cys 700 705 710
TCT GCT GAG GGT TAC CCT GTA CCT ACC ATC GTG TGG AAA TTC TCT AAA 2633 Ser Ala Glu Gly Tyr Pro Val Pro Thr He Val Trp Lys Phe Ser Lys 715 720 725
GGT GCT GGG GTT CCC CAG TTC CAG CCA ATT GCC CTA AAT GGC CGA ATC 2681 Gly Ala Gly Val Pro Gin Phe Gin Pro He Ala Leu Asn Gly Arg He 730 735 740
CAA GTT CTC AGC AAT GGG TCG TTG CTG ATC AAG CAT GTC GTG GAG GAA 2729 Gin Val Leu Ser Asn Gly Ser Leu Leu He Lys His Val Val Glu Glu 745 750 755
GAC AGT GGC TAC TAC CTC TGC AAG GTC AGC AAC GAT GTG GGC GCA GAC 2777 Asp Ser Gly Tyr Tyr Leu Cys Lys Val Ser Asn Asp Val Gly Ala Asp 760 765 770 775
GTC AGC AAG TCC ATG TAC CTC ACG GTT AAA ATT CCT GCG ATG ATA ACA 2825 Val Ser Lys Ser Met Tyr Leu Thr Val Lys He Pro Ala Met He Thr 780 785 790
TCC TAT CCA AAT ACT ACC CTG GCC ACG CAG GGG CAG AAA AAG GAG ATG 2873 Ser Tyr Pro Asn Thr Thr Leu Ala Thr Gin Gly Gin Lys Lys Glu Met 795 800 805
AGC TGC ACG GCG CAT GGT GAG AAG CCC ATT ATA GTC CGC TGG GAG AAG 2921 Ser Cys Thr Ala His Gly Glu Lys Pro He He Val Arg Trp Glu Lys 810 815 820
GAG GAC CGA ATC ATT AAC CCT GAG ATG GCC CGT TAT CTT GTG TCC ACC 2969 Glu Asp Arg He He Asn Pro Glu Met Ala Arg Tyr Leu Val Ser Thr 825 830 835
AAG GAG GTG GGA GAA GAG GTG ATT TCT ACT CTG CAG ATT TTG CCA ACT 3017 Lys Glu Val Gly Glu Glu Val He Ser Thr Leu Gin He Leu Pro Thr 840 845 850 855
GTG AGA GAA GAT TCT GGT TTC TTT TCC TGC CAT GCT ATT AAT TCT TAT 3065 Val Arg Glu Asp Ser Gly Phe Phe Ser Cys His Ala He Asn Ser Tyr 860 865 870
GGG GAG GAC CGT GGA ATA ATT CAG CTC ACA GTG CAA GAG CCC CCA GAC 3113 Gly Glu Asp Arg Gly He He Gin Leu Thr Val Gin Glu Pro Pro Asp 875 880 885
CCT CCC GAA ATT GAG ATC AAA GAT GTC AAA GCA CGC ACA ATT ACG CTC 3161 Pro Pro Glu He Glu He Lys Asp Val Lys Ala Arg Thr He Thr Leu 890 895 900
AGG TGG ACC ATG GGG TTT GAT GGA AAC AGT CCC ATC ACA GGC TAC GAT 3209 Arg Trp Thr Met Gly Phe Asp Gly Asn Ser Pro He Thr Gly Tyr Asp 905 910 915
ATT GAA TGC AAA AAT AAA TCA GAC TCC TGG GAT TCT GCT CAG AGA ACC 3257 He Glu Cys Lys Asn Lys Ser Asp Ser Trp Asp Ser Ala Gin Arg Thr 920 925 930 935
AAA GAT GTT TCC CCT CAG CTG AAC TCG GCC ACC ATC ATT GAT ATC CAC 3305 Lys Asp Val Ser Pro Gin Leu Asn Ser Ala Thr He He Asp He His 940 945 950 CCT TCC TCC ACC TAC AGC ATC CGC ATG TAC GCC AAG AAC CGG ATT GGC 3353 Pro Ser Ser Thr Tyr Ser He Arg Met Tyr Ala Lys Asn Arg He Gly 955 960 965
AAG AGC GAG CCC AGC AAC GAG CTC ACC ATC ACG GCG GAC GAG GCA GCT 3401 Lys Ser Glu Pro Ser Asn Glu Leu Thr He Thr Ala Asp Glu Ala Ala 970 975 980
CCT GAT GGT CCA CCT CAG GAA GTT CAC CTG GAG CCT ATA TCA TCT CAG 3449 Pro Asp Gly Pro Pro Gin Glu Val His Leu Glu Pro He Ser Ser Gin 985 990 995
AGC ATC AGG GTC ACA TGG AAG GCT CCC AAG AAA CAT TTG CAA AAT GGG 3497 Ser He Arg Val Thr Trp Lys Ala Pro Lys Lys His Leu Gin Asn Gly 1000 1005 1010 1015
ATT ATC CGT GGC TAC CAA ATA GGT TAC CGA GAG TAC AGC ACT GGG GGT 3545 He He Arg Gly Tyr Gin He Gly Tyr Arq Glu Tyr Ser Thr Gly Gly 1020 1025 1030
AAC TTC CAA TTC AAC ATT ATC AGT GTC GAC ACC AGC GGG GAC AGT GAG 3593 Asn Phe Gin Phe Asn He He Ser Val Asp Thr Ser Gly Asp Ser Glu 1035 1040 1045
GTT TAC ACC CTG GAC AAC CTG AAT AAG TTC ACT CAG TAC GGC CTG GTG 3641 Val Tyr Thr Leu Asp Asn Leu Asn Lys Phe Thr Gin Tyr Gly Leu Val 1050 1055 1060
GTG CAG GCC TGT AAC CGG GCC GGC ACG GGG CCT TCT TCT CAG GAA ATC 3689 Val Gin Ala Cys Asn Arg Ala Gly Thr Gly Pro Ser Ser Gin Glu He 1065 1070 1075
ATC ACC ACC ACT CTC GAG GAT GTG CCC AGT TAC CCC CCC GAA AAT GTC 3737 He Thr Thr Thr Leu Glu Asp Val Pro Ser Tyr Pro Pro Glu Asn Val 1080 1085 1090 1095
CAA GCC ATA GCA ACA TCA CCA GAA AGC ATA TCA ATA TCC TGG TCC ACA 3785 Gin Ala He Ala Thr Ser Pro Glu Ser He Ser He Ser Trp Ser Thr 1100 1105 1110
CTT TCC AAG GAA GCC TTG AAT GGA ATT CTC CAG GGG TTC AGA GTC ATT 3833 Leu Ser Lys Glu Ala Leu Asn Gly He Leu Gin Gly Phe Arg Val He 1115 1120 1125
TAC TGG GCC AAC CTC ATG GAC GGA GAG CTG GGT GAG ATT AAA AAC ATC 3881 Tyr Trp Ala Asn Leu Met Asp Gly Glu Leu Gly Glu He Lys Asn He 1130 1135 1140
ACC ACC ACA CAG CCT TCA CTG GAG CTG GAC GGG CTG GAA AAG TAC ACC 3929 Thr Thr Thr Gin Pro Ser Leu Glu Leu Asp Gly Leu Glu Lys Tyr Thr 1145 1150 1155
AAC TAC AGC ATC CAG GTG CTG GCC TTC ACC CGC GCA GGA GAC GGG GTC 3977 Asn Tyr Ser He Gin Val Leu Ala Phe Thr Arg Ala Gly Asp Gly Val 1160 1165 1170 1175
AGG AGT GAG CAG ATC TTC ACC CGG ACC AAA GAG GAT GTT CCA GGT CCT 4025 Arg Ser Glu Gin He Phe Thr Arg Thr Lys Glu Asp Val Pro Gly Pro 1180 1185 1190
CCC GCG GGT GTG AAG GCA GCG GCG GCC TCA GCC TCC ATG GTC TTT GTG 4073 Pro Ala Gly Val Lys Ala Ala Ala Ala Ser Ala Ser Met Val Phe Val 1195 1200 1205 TCC TGG CTT CCC CCT CTC AAG CTG AAC GGC ATC ATC CGA AAG TAC ACT 4121 Ser Trp Leu Pro Pro Leu Lys Leu Asn Gly He He Arg Lys Tyr Thr 1210 1215 1220
GTA TTC TGC TCC CAC CCC TAT CCC ACA GTG ATC AGC GAG TTT GAG GCC 4169 Val Phe Cys Ser His Pro Tyr Pro Thr Val He Ser Glu Phe Glu Ala 1225 1230 1235
TCT CCC GAC TCG TTT TCC TAC AGA ATT CCC AAC CTG AGT AGG AAT CGT 4217 Ser Pro Asp Ser Phe Ser Tyr Arg He Pro Asn Leu Ser Arg Asn Arg 1240 1245 1250 1255
CAG TAC AGC GTC TGG GTG GTG GCT GTT ACT TCA GCC GGA AGA GGC AAC 4265 Gin Tyr Ser Val Trp Val Val Ala Val Thr Ser Ala Gly Arg Gly Asn 1260 1265 1270
AGC AGT GAA ATC ATC ACA GTC GAG CCA CTA GCA AAA GCT CCT GCA CGA 4313 Ser Ser Glu He He Thr Val Glu Pro Leu Ala Lys Ala Pro Ala Arg 1275 1280 1285
ATC CTG ACC TTC AGT GGG ACA GTG ACT ACT CCA TGG ATG AAA GAC ATT 4361 He Leu Thr Phe Ser Gly Thr Val Thr Thr Pro Trp Met Lys Asp He 1290 1295 1300
GTC TTG CCT TGT AAG GCT GTT GGG GAC CCT TCT CCT GCA GTC AAA TGG 4409 Val Leu Pro Cys Lys Ala Val Gly Asp Pro Ser Pro Ala Val Lys Trp 1305 1310 1315
ATG AAA GAC AGT AAC GGG ACA CCC AGT CTA GTA ACG ATT GAT GGG CGG 4457 Met Lys Asp Ser Asn Gly Thr Pro Ser Leu Val Thr He Asp Gly Arg 1320 1325 1330 1335
AGG AGC ATC TTT AGC AAC GGA AGC TTC ATT ATT CGC ACG GTG AAA GCA 4505 Arg Ser He Phe Ser Asn Gly Ser Phe He He Arg Thr Val Lys Ala 1340 1345 1350
GAA GAC TCC GGC TAT TAC AGC TGC ATT GCC AAT AAC AAC TGG GGA TCT 4553 Glu Asp Ser Gly Tyr Tyr Ser Cys He Ala Asn Asn Asn Trp Gly Ser 1355 1360 1365
GAT GAA ATT ATT TTA AAC TTA CAA GTA CAA GTT CCA CCA GAT CAG CCT 4601 Asp Glu He He Leu Asn Leu Gin Val Gin Val Pro Pro Asp Gin Pro 1370 1375 1380
CGG CTT ACA GTC TCC AAG ACC ACG TCT TCC TCC ATC ACC CTT TCT TGG 4649 Arg Leu Thr Val Ser Lys Thr Thr Ser Ser Ser He Thr Leu Ser Trp 1385 1390 1395
CTC CCT GGA GAC AAC GGG GGC AGC TCT ATC AGA GGA TAC ATA CTG CAG 4697 Leu Pro Gly Asp Asn Gly Gly Ser Ser He Arg Gly Tyr He Leu Gin 1400 1405 1410 1415
TAC TCC GAG GAC AAT AGT GAG CAG TGG GGG AGT TTT CCA ATC AGC CCC 4745 Tyr Ser Glu Asp Asn Ser Glu Gin Trp Gly Ser Phe Pro He Ser Pro 1420 1425 1430
AGC GAA CGT TCC TAT CGC TTG GAA AAT CTC AAA TGT GGG ACT TGG TAT 4793 Ser Glu Arg Ser Tyr Arg Leu Glu Asn Leu Lys Cys Gly Thr Trp Tyr 1435 1440 1445
AAG TTC ACA CTG ACA GCC CAA AAT GGA GTG GGC CCA GGG CGC ATA AGT 4841 Lys Phe Thr Leu Thr Ala Gin Asn Gly Val Gly Pro Gly Arg He Ser 1450 1455 1460 GAA ATC ATA GAA GCA AAG ACC TTA GGA AAA GAG CCC CAG TTC TCA AAG 4889 Glu He He Glu Ala Lys Thr Leu Gly Lys Glu Pro Gin Phe Ser Lys 1465 1470 1475
GAG CAG GAG CTG TTT GCC AGC ATC AAC ACC ACA CGC GTG AGG CTG AAC 4937 Glu Gin Glu Leu Phe Ala Ser He Asn Thr Thr Arg Val Arg Leu Asn 1480 1485 1490 1495
CTC ATT GGC TGG AAT GAT GGC GGC TGC CCC ATC ACC TCC TTC ACA CTA 4985 Leu He Gly Trp Asn Asp Gly Gly Cys Pro He Thr Ser Phe Thr Leu 1500 1505 1510
GAG TAC AGG CCC TTT GGG ACC ACA GTT TGG ACC ACA GCT CAG AGG ACC 5033 Glu Tyr Arg Pro Phe Gly Thr Thr Val Trp Thr Thr Ala Gin Arg Thr 1515 1520 1525
TCT CTC TCC AAG TCC TAC ATC CTG TAT GAC CTG CAG GAA GCC ACC TGG 5081 Ser Leu Ser Lys Ser Tyr He Leu Tyr Asp Leu Gin Glu Ala Thr Trp 1530 1535 1540
TAT GAG CTG CAG ATG CGG GTG TGC AAC AGT GCG GGC TGC GCG GAG AAG 5129 Tyr Glu Leu Gin Met Arg Val Cys Asn Ser Ala Gly Cys Ala Glu Lys 1545 1550 1555
CAG GCC AAC TTC GCT ACG CTG AAC TAC GAT GGC AGT ACA ATT CCT CCA 5177 Gin Ala Asn Phe Ala Thr Leu Asn Tyr Asp Gly Ser Thr He Pro Pro 1560 1565 1570 1575
CTC ATT AAG TCA GTT GTC CAA AAC GAA GAA GGG CTG ACG ACC AAC GAG 5225 Leu He Lys Ser Val Val Gin Asn Glu Glu Gly Leu Thr Thr Asn Glu 1580 1585 1590
GGG CTC AAG ATG CTG GTG ACC ATC TCC TGT ATC CTG GTG GGG GTC TTG 5273 Gly Leu Lys Met Leu Val Thr He Ser Cys He Leu Val Gly Val Leu 1595 1600 1605
CTG CTG TTT GTG CTC CTG CTG GTT GTG CGG AGG AGG CGG CGG GAG CAG 5321 Leu Leu Phe Val Leu Leu Leu Val Val Arg Arg Arg Arg Arg Glu Gin 1610 1615 1620
AGG CTA AAG AGG CTG CGA GAT GCA AAG AGT TTA GCT GAA ATG CTC ATG 5369 Arg Leu Lys Arg Leu Arg Asp Ala Lys Ser Leu Ala Glu Met Leu Met 1625 1630 1635
AGT AAG AAT ACC CGG ACT TCA GAT ACG TTA AGC AAG CAA CAG CAG ACC 5417 Ser Lys Asn Thr Arg Thr Ser Asp Thr Leu Ser Lys Gin Gin Gin Thr 1640 1645 1650 1655
CTG CGA ATG CAC ATC GAC ATA CCC AGG GCT CAG CTT TTG ATT GAA GAG 5465 Leu Arg Met His He Asp He Pro Arg Ala Gin Leu Leu He Glu Glu 1660 1665 1670
AGA GAC ACG ATG GAG ACC ATT GAT GAT CGC TCC ACG GTT CTG TTG ACG 5513 Arg Asp Thr Met Glu Thr He Asp Asp Arg Ser Thr Val Leu Leu Thr 1675 1680 1685
GAT GCT GAC TTT GGA GAG GCA GCT AAG CAG AAG TCC CTG ACG GTC ACT 5561 Asp Ala Asp Phe Gly Glu Ala Ala Lys Gin Lys Ser Leu Thr Val Thr 1690 1695 1700
CAC ACG GTC CAT TAC CAA TCG GTG TCT CAG GCC ACT GGG CCC TTA GTG 5609 His Thr Val His Tyr Gin Ser Val Ser Gin Ala Thr Gly Pro Leu Val 1705 1710 1715 GAT GTT TCA GAC GCT CGG CCG GGA ACG AAT CCC ACC ACC AGG AGG AAT 5657 Asp Val Ser Asp Ala Arg Pro Gly Thr Asn Pro Thr Thr Arg Arg Asn 1720 1725 1730 1735
GCC AAG GCT GGG CCC ACA GCG AGA AAC CGC TAT GCC AGC CAG TGG ACC 5705 Ala Lys Ala Gly Pro Thr Ala Arg Asn Arg Tyr Ala Ser Gin Trp Thr 1740 1745 1750
CTC AAC CGA CCC CAC CCC ACC ATC TCA GCA CAC ACC CTC ACC ACA GAC 5753 Leu Asn Arg Pro His Pro Thr He Ser Ala His Thr Leu Thr Thr Asp 1755 1760 1765
TGG AGG CTG CCA ACA CCC AGG GCT GCA GGA TCA GTA GAC AAA GAG AGC 5801 Trp Arg Leu Pro Thr Pro Arg Ala Ala Gly Ser Val Asp Lys Glu Ser 1770 1775 1780
GAC AGT TAC AGC GTC AGC CCC TCG CAA GAC ACA GAT CGA GCA AGA AGC 5849 Asp Ser Tyr Ser Val Ser Pro Ser Gin Asp Thr Asp Arg Ala Arg Ser 1785 1790 1795
AGC ATG GTC TCC ACA GAA AGT GCC TCC TCC ACT TAC GAA GAA CTG GCC 5897 Ser Met Val Ser Thr Glu Ser Ala Ser Ser Thr Tyr Glu Glu Leu Ala 1800 1805 1810 1815
AGG GCC TAC GAA CAC GCC AAG ATG GAA GAG CAA CTG AGG CAC GCC AAG 5945 Arg Ala Tyr Glu His Ala Lys Met Glu Glu Gin Leu Arg His Ala Lys 1820 1825 1830
TTC ACC ATC ACG GAG TGC TTC ATA TCA GAC ACG TCA TCG GAG CAG TTG 5993 Phe Thr He Thr Glu Cys Phe He Ser Asp Thr Ser Ser Glu Gin Leu 1835 1840 1845
ACG GCA GGG ACA AAT GAG TAC ACG GAC AGT CTG ACC TCC AGC ACC CCT 6041 Thr Ala Gly Thr Asn Glu Tyr Thr Asp Ser Leu Thr Ser Ser Thr Pro 1850 1855 1860
TCC GAA TCG GGA ATC TGC AGG TTC ACT GCA TCT CCC CCC AAA CCT CAG 6089 Ser Glu Ser Gly He Cys Arg Phe Thr Ala Ser Pro Pro Lys Pro Gin 1865 1870 1875
GAT GGA GGA AGA GTA ATG AAT ATG GCA GTT CCA AAG GCA ATC GGC CAG 6137 Asp Gly Gly Arg Val Met Asn Met Ala Val Pro Lys Ala He Gly Gin 1880 1885 1890 1895
GTG ACC TCA TAC ATT TGC CTC CAT ACC TTA GAA TGG ACT TTT TGT TAAACCGAGG Val Thr Ser Tyr He Cys Leu His Thr Leu Glu Trp Thr Phe Cys 1900 1905 1910
TGGTCCAGGC ACCAGCAGGG ACCTGAGCTT AGGACAAGCA TGCTTGGAAC CTCAGAAAAG 6252
CCGGACCCTG AAGCGCCCCA CGGTCCTGGA GCCCATCCCG ATGGAAGCCG CCTCCTCCGC 6312
CTCCTCCACG AGAGAAGGAC AGTCGTGGCA GCCGGGGGCC GTGGCCACAT TACCTCAGCG 6372
GGAGGGAGCA GAGCTGGGAC AGGCAGCTAA AATGAGCAGC TCCCAAGAAT CACTGCTCGA 6432
CTCCCGGGGC CATTTGAAAG GAAACAATCC TTACGCAAAA TCTTACACCC TGGTATAACA 6492
GACAGCATGA CTGGACAGCG GTTGTAAATA CAATTCAAAC AATTCAATCA AAGCTACCTT 6552
TTTTTTACGG AATTCCAATA TTTATAATTA AAGAAAATTG CCAAAATATA TT 6604 (2) INFORMATION FOR SEQ ID NO : 2 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1910 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 2 :
Met Trp He Leu Ala Leu Ser Leu Phe Gin Ser Phe Ala Asn Val Phe 1 5 10 15
Ser Glu Asp Leu His Ser Ser Leu Tyr Phe Val Asn Ala Ser Leu Gin 20 25 30
Glu Val Val Phe Ala Ser Thr Thr Gly Thr Leu Val Pro Cys Pro Ala 35 40 45
Ala Gly He Pro Pro Val Thr Leu Arg Trp Tyr Leu Ala Thr Gly Glu 50 55 60
Glu He Tyr Asp Val Pro Gly He Arg His Val His Pro Asn Gly Thr 65 70 75 80
Leu Gin He Phe Pro Phe Pro Pro Ser Ser Phe Ser Thr Leu He His 85 90 95
Asp Asn Thr Tyr Tyr Cys Thr Ala Glu Asn Pro Ser Gly Lys He Arg 100 105 110
Ser Gin Asp Val His He Lys Ala Val Leu Arg Glu Pro Tyr Thr Val 115 120 125
Arg Val Glu Asp Gin Lys Thr Met Arg Gly Asn Val Ala Val Phe Lys 130 135 140
Cys He He Pro Ser Ser Val Glu Ala Tyr He Thr Val Val Ser Trp 145 150 155 160
Glu Lys Asp Thr Val Ser Leu Val Ser Gly Ser Arg Phe Leu He Thr 165 170 175
Ser Thr Gly Ala Leu Tyr He Lys Asp Val Gin Asn Glu Asp Gly Leu 180 185 190
Tyr Asn Tyr Arg Cys He Thr Arg His Arg Tyr Thr Gly Glu Thr Arg 195 200 205
Gin Ser Asn Ser Ala Arg Leu Phe Val Ser Asp Pro Ala Asn Ser Ala 210 215 220
Pro Ser He Leu Asp Gly Phe Asp His Arg Lys Ala Met Ala Gly Gin 225 230 235 240
Arg Val Glu Leu Pro Cys Lys Ala Leu Gly His Pro Glu Pro Asp Tyr 245 250 255
Arg Trp Leu Lys Asp Asn Met Pro Leu Glu Leu Ser Gly Arg Phe Gin 260 265 270 Lys Thr Val Thr Gly Leu Leu He Glu Asn He Arg Pro Ser Asp Ser 275 280 285
Gly Ser Tyr Val Cys Glu Val Ser Asn Arg Tyr Gly Thr Ala Lys Val 290 295 300
He Gly Arg Leu Tyr Val Lys Gin Pro Leu Lys Ala Thr He Ser Pro 305 310 315 320
Arg Lys Val Lys Ser Ser Val Gly Ser Gin Val Ser Leu Ser Cys Ser 325 330 335
Val Thr Gly Thr Glu Asp Gin Glu Leu Ser Trp Tyr Arg Asn Gly Glu 340 345 350
He Leu Asn Pro Gly Lys Asn Val Arg He Thr Gly He Asn His Glu 355 360 365
Asn Leu He Met Asp His Met Val Lys Ser Asp Gly Gly Ala Tyr Gin 370 375 380
Cys Phe Val Arg Lys Asp Lys Leu Ser Ala Gin Asp Tyr Val Gin Val 385 390 395 400
Val Leu Glu Asp Gly Thr Pro Lys He He Ser Ala Phe Ser Glu Lys 405 410 415
Val Val Ser Pro Ala Glu Pro Val Ser Leu Met Cys Asn Val Lys Gly 420 425 430
Thr Pro Leu Pro Thr He Thr Trp Thr Leu Asp Asp Asp Pro He Leu 435 440 445
Lys Gly Gly Ser His Arg He Ser Gin Met He Thr Ser Glu Gly Asn 450 455 460
Val Val Ser Tyr Leu Asn He Ser Ser Ser Gin Val Arg Asp Gly Gly 465 470 475 480
Val Tyr Arg Cys Thr Ala Asn Asn Ser Ala Gly Val Val Leu Tyr Gin 485 490 495
Ala Arg He Asn Val Arg Gly Pro Ala Ser He Arg Pro Met Lys Asn 500 505 510
He Thr Ala He Ala Gly Arg Asp Thr Tyr He His Cys Arg Val He 515 520 525
Gly Tyr Pro Tyr Tyr Ser He Lys Trp Tyr Lys Asn Ser Asn Leu Leu 530 535 540
Pro Phe Asn His Arg Gin Val Ala Phe Glu Asn Asn Gly Thr Leu Lys 545 550 555 560
Leu Ser Asp Val Gin Lys Glu Val Asp Glu Gly Glu Tyr Thr Cys Asn 565 570 575
Val Leu Val Gin Pro Gin Leu Ser Thr Ser Gin Ser Val His Val Thr 580 585 590
Val Lys Val Pro Pro Phe He Gin Pro Phe Glu Phe Pro Arg Phe Ser 595 600 605 He Gly Gin Arg Val Phe He Pro Cys Val Val Val Ser Gly Asp Leu 610 615 620
Pro He Thr He Thr Trp Gin Lys Asp Gly Arg Pro He Pro Gly Ser 625 630 635 640
Leu Gly Val Thr He Asp Asn He Asp Phe Thr Ser Ser Leu Arg He 645 650 655
Ser Asn Leu Ser Leu Met His Asn Gly Asn Tyr Thr Cys He Ala Arg 660 665 670
Asn Glu Ala Ala Ala Val Glu His Gin Ser Gin Leu He Val Arg Val 675 680 685
Pro Pro Lys Phe Val Val Gin Pro Arg Asp Gin Asp Gly He Tyr Gly 690 695 700
Lys Ala Val He Leu Asn Cys Ser Ala Glu Gly Tyr Pro Val Pro Thr 705 710 715 720
He Val Trp Lys Phe Ser Lys Gly Ala Gly Val Pro Gin Phe Gin Pro 725 730 735
He Ala Leu Asn Gly Arg He Gin Val Leu Ser Asn Gly Ser Leu Leu 740 745 750
He Lys His Val Val Glu Glu Asp Ser Gly Tyr Tyr Leu Cys Lys Val 755 760 " 765
Ser Asn Asp Val Gly Ala Asp Val Ser Lys Ser Met Tyr Leu Thr Val 770 775 780
Lys He Pro Ala Met He Thr Ser Tyr Pro Asn Thr Thr Leu Ala Thr 785 790 795 800
Gin Gly Gin Lys Lys Glu Met Ser Cys Thr Ala His Gly Glu Lys Pro 805 810 815
He He Val Arg Trp Glu Lys Glu Asp Arg He He Asn Pro Glu Met 820 825 830
Ala Arg Tyr Leu Val Ser Thr Lys Glu Val Gly Glu Glu Val He Ser 835 840 845
Thr Leu Gin He Leu Pro Thr Val Arg Glu Asp Ser Gly Phe Phe Ser 850 855 860
Cys His Ala He Asn Ser Tyr Gly Glu Asp Arg Gly He He Gin Leu 865 870 875 880
Thr Val Gin Glu Pro Pro Asp Pro Pro Glu He Glu He Lys Asp Val 885 890 895
Lys Ala Arg Thr He Thr Leu Arg Trp Thr Met Gly Phe Asp Gly Asn 900 905 910
Ser Pro He Thr Gly Tyr Asp He Glu Cys Lys Asn Lys Ser Asp Ser 915 920 925
Trp Asp Ser Ala Gin Arg Thr Lys Asp Val Ser Pro Gin Leu Asn Ser 930 935 940 Ala Thr He He Asp He His Pro Ser Ser Thr Tyr Ser He Arg Met 945 950 955 960
Tyr Ala Lys Asn Arg He Gly Lys Ser Glu Pro Ser Asn Glu Leu Thr 965 970 975
He Thr Ala Asp Glu Ala Ala Pro Asp Gly Pro Pro Gin Glu Val His 980 985 990
Leu Glu Pro He Ser Ser Gin Ser He Arg Val Thr Trp Lys Ala Pro 995 1000 1005
Lys Lys His Leu Gin Asn Gly He He Arg Gly Tyr Gin He Gly Tyr 1010 1015 1020
Arg Glu Tyr Ser Thr Gly Gly Asn Phe Gin Phe Asn He He Ser Val 1025 1030 1035 1040
Asp Thr Ser Gly Asp Ser Glu Val Tyr Thr Leu Asp Asn Leu Asn Lys 1045 1050 1055
Phe Thr Gin Tyr Gly Leu Val Val Gin Ala Cys Asn Arg Ala Gly Thr 1060 1065 1070
Gly Pro Ser Ser Gin Glu He He Thr Thr Thr Leu Glu Asp Val Pro 1075 1080 1085
Ser Tyr Pro Pro Glu Asn Val Gin Ala He Ala Thr Ser Pro Glu Ser 1090 1095 1100
He Ser He Ser Trp Ser Thr Leu Ser Lys Glu Ala Leu Asn Gly He 1105 1110 1115 1120
Leu Gin Gly Phe Arg Val He Tyr Trp Ala Asn Leu Met Asp Gly Glu 1125 1130 1135
Leu Gly Glu He Lys Asn He Thr Thr Thr Gin Pro Ser Leu Glu Leu 1140 1145 1150
Asp Gly Leu Glu Lys Tyr Thr Asn Tyr Ser He Gin Val Leu Ala Phe 1155 1160 1165
Thr Arg Ala Gly Asp Gly Val Arg Ser Glu Gin He Phe Thr Arg Thr 1170 1175 1180
Lys Glu Asp Val Pro Gly Pro Pro Ala Gly Val Lys Ala Ala Ala Ala 1185 1190 1195 1200
Ser Ala Ser Met Val Phe Val Ser Trp Leu Pro Pro Leu Lys Leu Asn 1205 1210 1215
Gly He He Arg Lys Tyr Thr Val Phe Cys Ser His Pro Tyr Pro Thr 1220 1225 1230
Val He Ser Glu Phe Glu Ala Ser Pro Asp Ser Phe Ser Tyr Arg He 1235 1240 1245
Pro Asn Leu Ser Arg Asn Arg Gin Tyr Ser Val Trp Val Val Ala Val 1250 1255 1260
Thr Ser Ala Gly Arg Gly Asn Ser Ser Glu He He Thr Val Glu Pro 1265 1270 1275 1280 Leu Ala Lys Ala Pro Ala Arg He Leu Thr Phe Ser Gly Thr Val Thr 1285 1290 1295
Thr Pro Trp Met Lys Asp He Val Leu Pro Cys Lys Ala Val Gly Asp 1300 1305 1310
Pro Ser Pro Ala Val Lys Trp Met Lys Asp Ser Asn Gly Thr Pro Ser 1315 1320 1325
Leu Val Thr He Asp Gly Arg Arg Ser He Phe Ser Asn Gly Ser Phe 1330 1335 1340
He He Arg Thr Val Lys Ala Glu Asp Ser Gly Tyr Tyr Ser Cys He 1345 1350 1355 1360
Ala Asn Asn Asn Trp Gly Ser Asp Glu He He Leu Asn Leu Gin Val 1365 1370 1375
Gin Val Pro Pro Asp Gin Pro Arg Leu Thr Val Ser Lys Thr Thr Ser 1380 1385 1390
Ser Ser He Thr Leu Ser Trp Leu Pro Gly Asp Asn Gly Gly Ser Ser 1395 1400 1405
He Arg Gly Tyr He Leu Gin Tyr Ser Glu Asp Asn Ser Glu Gin Trp 1410 1415 1420
Gly Ser Phe Pro He Ser Pro Ser Glu Arg Ser Tyr Arg Leu Glu Asn 1425 1430 1435 1440
Leu Lys Cys Gly Thr Trp Tyr Lys Phe Thr Leu Thr Ala Gin Asn Gly 1445 1450 1455
Val Gly Pro Gly Arg He Ser Glu He He Glu Ala Lys Thr Leu Gly 1460 1465 1470
Lys Glu Pro Gin Phe Ser Lys Glu Gin Glu Leu Phe Ala Ser He Asn 1475 1480 1485
Thr Thr Arg Val Arg Leu Asn Leu He Gly Trp Asn Asp Gly Gly Cys 1490 1495 1500
Pro He Thr Ser Phe Thr Leu Glu Tyr Arg Pro Phe Gly Thr Thr Val 1505 1510 1515 1520
Trp Thr Thr Ala Gin Arg Thr Ser Leu Ser Lys Ser Tyr He Leu Tyr 1525 1530 1535
Asp Leu Gin Glu Ala Thr Trp Tyr Glu Leu Gin Met Arg Val Cys Asn 1540 1545 1550
Ser Ala Gly Cys Ala Glu Lys Gin Ala Asn Phe Ala Thr Leu Asn Tyr 1555 1560 1565
Asp Gly Ser Thr He Pro Pro Leu He Lys Ser Val Val Gin Asn Glu 1570 1575 1580
Glu Gly Leu Thr Thr Asn Glu Gly Leu Lys Met Leu Val Thr He Ser 1585 1590 1595 1600
Cys He Leu Val Gly Val Leu Leu Leu Phe Val Leu Leu Leu Val Val 1605 1610 1615 Arg Arg Arg Arg Arg Glu Gin Arg Leu Lys Arg Leu Arg Asp Ala Lys 1620 1625 1630
Ser Leu Ala Glu Met Leu Met Ser Lys Asn Thr Arg Thr Ser Asp Thr 1635 1640 1645
Leu Ser Lys Gin Gin Gin Thr Leu Arg Met His He Asp He Pro Arg 1650 1655 1660
Ala Gin Leu Leu He Glu Glu Arg Asp Thr Met Glu Thr He Asp Asp 1665 1670 1675 1680
Arg Ser Thr Val Leu Leu Thr Asp Ala Asp Phe Gly Glu Ala Ala Lys 1685 1690 1695
Gin Lys Ser Leu Thr Val Thr His Thr Val His Tyr Gin Ser Val Ser 1700 1705 1710
Gin Ala Thr Gly Pro Leu Val Asp Val Ser Asp Ala Arg Pro Gly Thr 1715 1720 1725
Asn Pro Thr Thr Arg Arg Asn Ala Lys Ala Gly Pro Thr Ala Arg Asn 1730 1735 1740
Arg Tyr Ala Ser Gin Trp Thr Leu Asn Arg Pro His Pro Thr He Ser 1745 1750 1755 1760
Ala His Thr Leu Thr Thr Asp Trp Arg Leu Pro Thr Pro Arg Ala Ala 1765 1770 1775
Gly Ser Val Asp Lys Glu Ser Asp Ser Tyr Ser Val Ser Pro Ser Gin 1780 1785 1790
Asp Thr Asp Arg Ala Arg Ser Ser Met Val Ser Ihr Glu Ser Ala Ser 1795 1800 1805
Ser Thr Tyr Glu Glu Leu Ala Arg Ala Tyr Glu His Ala Lys Met Glu 1810 1815 1820
Glu Gin Leu Arg His Ala Lys Phe Thr He Thr Glu Cys Phe He Ser 1825 1830 1835 1840
Asp Thr Ser Ser Glu Gin Leu Thr Ala Gly Thr Asn Glu Tyr Thr Asp 1845 1850 1855
Ser Leu Thr Ser Ser Thr Pro Ser Glu Ser Gly He Cys Arg Phe Thr 1860 1865 1870
Ala Ser Pro Pro Lys Pro Gin Asp Gly Gly Arg Val Met Asn Met Ala 1875 1880 1885
Val Pro Lys Ala He Gly Gin Val Thr Ser Tyr He Cys Leu His Thr 1890 1895 1900
Leu Glu Trp Thr Phe Cys 1905 1910 (2) INFORMATION FOR SEQ ID NO : 3 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 388 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CCGGGTATTC TTACTCATGA GCATTTCAGC TAAACTCTTT GCATCTCGCA GCCTCTTTAG 60
CCTCTGCTCC CGCCGCCTCC TCCGCACAAC CAGCAGGAGC ACAAACAGCA GCAAGACCCC 120
CACCAGGATA CAGGAGATGG TCACCAGCAT CTTGAGCCCC TCGTTGGTCG TCAGCCCTTC 180
TTCGTTTTGG ACAACTGACT TAATGAGTGG AGGAATTGTA CTGCCATCGT AGTTCAGCGT 240
AGCGAAGTTG GCCTGCTTCT CCGCGCAGCC CGCACTGTTG CACACCCGCA TCTGCAGCTC 300
ATACCAGGTG GCTTCCTGCA GGTCATACAG GATGTAGGAC TTGGAGAGAG AGGTCCTCTG 360
AGCTGTGGTC CAAACTGTGG TCCCAAAG 388
(2) INFORMATION FOR SEQ ID NO : 4 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 4 : CCTGATGCTC GAGTGAATTC 20
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: CCAGTTCTCA AAGGAGCAGG 20 (2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: CCTGTATGAC CTGCAGGAAG 20
(2) INFORMATION FOR SEQ ID NO : 7 :
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 842 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 7 :
CCGGGCCGGG CGCGGCGGAG CGCAGCGCAA CGCGGGGGGC GAGGCCGGCG CGTGGCTCGC 60
TCGCTGGCTC GCTGGCTCGC GGGAGGCCGG GCAGCAGCAG GGGCATGTGG ATACTGGCTC 120
TCTCCTTGTT CCAGAGCTTC GCGAATGTTT TCAGTGAAGA GCCCCACTCC AGCCTCTACT 180
TTGTCAATGC ATCGCTGCAA GAGGTAGTGT TTGCAAGCAC ATCGGGGACG CTGGTGCCCT 240
GCCCGGCTGC AGGCATCCCT CCTGTGACTC TCAGATGGTA CCTAGCAACG GGCGAGGAGA 300
TCTACGATGT CCCCGGGATC CGCCACGTCC ATCCCAATGG CACTCTCCAA ATTTTCCCCT 360
TTCCTCCTTC AAGCTTCAGC ACCTTAATCC ATGATAATAC TTACTATTGC ACAGCTGAAA 420
ACCCTTCAGG GAAAATTAGA AGTCAGGATG TCCACATCAA GGCTGTTTTA CGGGAGCCCT 480
ATACAGTCCG TGTGGAGGAC CAGAAAACCA TGAGAGGCAA TGTCGCGGTG TTCAAGTGCA 540
TTATCCCCTC CTCGGTGGAG GCGTACGTCT CTGTCGTCTC ATGGGAGAAA GACACGGTTT 600
CACTTGTCTC AGGATCTAGA TTTCTCATCA CATCCACGGG AGCCTTGTAT ATTAAAGATG 660
TTCAGAACGA AGATGGGCTG TACAACTACC GCTGCATCGC GCGGCACAGA TTCGCGGGGG 720
AGACGAGACA GAGCAACTGC GCGAGACTGT TCGTGTCAGA ACCAGCAAAC TCAGCCCATC 780
CATCCTGGAA GGGTTTGACC ACCGCCAAAC CATGGCCGGG CACGCGTGGA GCTGCCTTGC 840
CA 842 (2) INFORMATION FOR SEQ ID NO : 8 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 898 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:
TGCCGGCCGG TTGCAAGCCT GTACTACAGG CCATACTGCG TGAATTATCA GGTTGTCCAG 60
GGTGTACACT TCGCTGTCCC GGTGGTGTCA ATACTGATGA TGTTGAACTG GAAGTTACCC 120
CGTGCTGTAC TCCGGTAGCC TATTGGTAGC CGCGAATGAT CCCGTCTTGT ATAGTGTTCT 180
TGGGAGCCTC TCCAGGTAAC CCTGATACTC TGAGATGAGG TGGGTTCCAA GTGAACTTCC 240
TGAGGTGGAC ATCACGAGCT GCCTCATCCG CCGTGATGGT GATCTCGTTG CTGGGCTCAC 300
TCTTGCCAAT CCGGTTCTTG GCGTACATGC GGATGCTGTA GGTGGAGGAA GGGTGGATAT 360
CAATGATGGT GGCCGAGTTC AGCTGAGGGG AAACATCTTT GGTTCTCTGA GCAGAATCCC 420
ACGAGTCTGA TTTATTTTTG CATTCACACT GTCATAGCCT GTGATGGGGC TGTTGCCATC 480
AAACCCCATG GTCCACCTGA GCGTGATGGT GCGAGCTTTG ACATCTCTTG ATCTCAATCT 540
CGGGAGGATC TGGGGGTTCT TGCACTGTGA GTTGAATTAT TCCACGGTCC TCCCCGTATG 600
AATTGATAGC ATGGCAGGAG AAGAAACCGG AATCTTCTCT CACTGTTGGC AAAATCTGCA 660
GCGTAGATAT CACTTCCTCT CCCACCTCCT TGGTGGATAC AGTACGGGCC ACTTTCAGGG 720
TTAATGATCC TGTCTCTCTT CTCCAGCGGA CAATGATGGG CTCTCCCATG GGCTGTGCAG 780
CTCATTCCTT CCTTTGACCC TGATGGCCAG GTGGTGTGGG TATAAGTTAT ATCATGGCCG 840
GAATTTCCCT GTGAGTCCAT GGACTTGCTG AACGTTCTGC GCCCACATCG TTCGCTGA 898 (2) INFORMATION FOR SEQ ID NO : 9 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2173 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
ACCACCATTC ACACACCCAG ACATGGCGGG TTCGCGGCAA CCTTCAGTTC CTGGCCTTCC 60
TGTAGGGTAA AGGGCTGCTG CGGGTTTATA GACCGGCACA TGCCCATCCT GGCATACGGT 120
GGCCAGTGGC TTTCCATCTG GATTCCAGGC CAAGCTAAAA ATCTGTTCCT GATGGCCCTG 180 CAGTTTCAGC CGTTCAGCTC CAGTCTGAAG TTCCCAGATG CGAACGGTTA GATCATAGGA 240
ACTGGAAGCC AGTACATCGG CAGCCAGGGG GTGGAAGCGC AGAGAGTAGA TCTTTTCTGT 300
GTGGCCTGTG AGCACAGTCT CAGGTGTGGT GAGAACATTC TCGAGCCAGC GAGCGTTCAT 360
ACCGCTTGGA AAACCTAAAG TGTGGGACTT GGTATAAGTT CACCCTTACT GCCCAAAATG 420
GAGTAGGTCC CGGGCGCATA AGTGAAATCA TAGAAGCCAA AACCCTGGGG AAAGAACCCC 480
AGTTCTCCAA GGAGCAGGAG CTTTTCGCCA GCATCAATAC CACCCGAGTG AGGCTGAATC 540
TGATTGGCTG GAATGACGGC GGCTGTCCAA TCACCTCATT CACTCTTGAA TACAGACCCT 600
TTGGGACCAC GGTCTGGACC ACAGCTCAGC GGACCTCCCT TTCCAAGTCC TAACATTCTG 660
TATGACCTGC AAGAAGCCAC GTGGTATGAA CTGCAGATGA GAGTGTGCAA CAGCGCCGGC 720
TGTGCGGATA AGCAAGCCAA CTTCGCCACG CTGAACTACG ATGGCAGTAC AATCCCTCCA 780
CTCATTAAGT CAGTTGTCCA CAAAGCGAAG AAGGGCTGAC AACCAACGAA GGGCTCAAGA 840
TCCTCGTGAC CATCTCCTGC ATCCTGGTCG GGGTTCTACT GCTCTTTGTG CTTCTGCTGG 900
TTGTGCGGAG GAGACGGCGA GAGCAGAGGC TGAAGAGGCT GAGAGATGCA AAGAGTTTAG 960
CTGAAATGCT CATGAGCAAA AACACACGGA CTTCAGATAC CTTAAGCAAA CAGCAGCAGA 1020
CTTTGAGAAT GCACATTGAT ATACCCAGGG CTCAGCTTTT GATTGAAGAG AGAGACACAA 1080
TGGAGACCAT AGATGACCGC TCCACAGTCC TGTTGACGGA TGCTGACTTC GGGGAGGCAG 1140
CCAAACAGAA GTCACTGACA GTGACTCACA CGGTGCATTA CCAATCGGTG TCTCAGGCCA 1200
CCGGGCCCCT CGTGGATGTC TCCGATGCTC GGCCAGGAAC GAATCCCACC ACCAGGAGGA 1260
ATGCAAAGGC TGGACCCACA GCGAGAAACC GGTACGCCAG CCAGTGGACG CTCAACAGAC 1320
CCCATCCTAC CATCTCTGCA CACACCCTCA CCACAGAATG AGACTGCTAC ACCAGGCTAC 1380
AGGATCCGTG ACAGGAGAGC GACAGTACAG CGTCAGCCCA TTCACAAGAC ACAGACGAGC 1440
AAGAAGCAGC ATGTTCTCCA CAGAAAGTGC TTCTTCTACC TACGAAGACT GCCAGGCCTA 1500
TGAACACGCC AAGATGGAAG AGCAGCTGAG GCATGCCAAG TTCACCATCA CAGAGTGCTT 1560
CATATCCGAT ACGTCCTCCG AGCAGTTGAC GGCAGGACAA ATGAGTACAC GGACAGTCTG 1620
ACTCCAGTAC CCCTTCAGAA TCGGGATCTG CAGATTCATG CATCTCCCCC CAACCTCAGG 1680
ATGGAGGACG AGTGTGAACA TGGCGGTTCC AAAGGCCCAT CGGCCAGGCG ACTCATACAC 1740
CTGCTCCATA CCTACGATGG ATTCTTGTTA AACCGGGCGC ACCAGGCACC AGCAGGACTG 1800
AGTTTAGGAC AAGCGTGCTT GGAACCCCAG AAAGTCGGAC CCTGAAACGC CCCACGGTCG 1860
TTGAGCCCAC CCCTATGGAG GCCTCCTCCT CCACTTCTTC CACGCGAGAA GGACAGCAGT 1920
CGTGGCAACA AGGGGCTGTG GCCACCTTAC CTCAGCGAGA GGGTGCAGAG CTGGACAGGC 1980
AGCTAAAATG AGCAGCTCCC AAGAGTCACT GCTGGACTCC CGGGCCATTG AAAGGAACAA 2040
TCCCTACGCA AATCTTACAC CTTGGTATAA CACATGGCAC TGATGGACAG CGGTTGTAAT 2100 ACAATTAACG AGCCAATCAA GCTACTTTTT TATGAATTCC GATATTTATA ATTAAGAATT 2160 GCCAAATATA TTA 2173
(2) INFORMATION FOR SEQ ID NO: 10:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6413 base pairs
(B) TYPE: nucleic ac d
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: cDNA
;ιx) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 453..5168
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10
TGACTGAGGC CGGAGCACGG CAAAGATGAG CCTGCCCGCC CGCCTGCTGC CTGGATGCGG 60
AGGGTGAGGG CTGGCGCACG GGAGGCCGCT GGCTGCGCAT TCTGGGCGCC GAGTGCCCGG 120
GATGAGCTCA CGCCCGCGTC TGCGGCTCTC TCCACCTGCC GACCTGCCGG GGGCCCACTG 180
AGCTGACGGC GCACCTGGGC TCCGGCCGCA GCGTGGGGCG CGGCGCCCGG GAGCAGGTGT 240
GCAGGAGCGC AGCGCGCGGC GAGCGCAGCC CTCGCTCCGG AGCCCGGCCG CGCCGCGTGC 300
CCGGGCGGCT AGGCAGCGGC GGCGGCGGCG GCGGGCGGCG GGCGGGCGGC GGCCCCCGGG 360
CAGGTGCCGA GCGGCGAGCG GAGCCGGGCC GGGCGGAGCG CGGGGGGCGA GGCCGGCGCG 420
TCGCTCGCGG GAGGCCGGGG AGCGGCAGGG GC ATG TGG ATA CTG GCT CTC TCC 473
Met Trp He Leu Ala Leu Ser 1 5
TTG TTC CAG AGC TTC GCG AAT GTT TTC AGT GAA GAC CTA CAC TCC AGC 521 Leu Phe Gin Ser Phe Ala Asn Val Phe Ser Glu Asp Leu His Ser Ser 10 15 20
CTC TAC TTT GTC AAT GCA TCT CTG CAA GAG GTA GTG TTT GCC AGC ACC 569 Leu Tyr Phe Val Asn Ala Ser Leu Gin Glu Val Val Phe Ala Ser Thr 25 30 35
ACG GGG ACT CTG GTG CCC TGC CCC GCA GCA GGC ATC CCT CCT GTG ACT 617 Thr Gly Thr Leu Val Pro Cys Pro Ala Ala Gly He Pro Pro Val Thr 40 45 50 55
CTC AGA TGG TAC CTA GCC ACG GGC GAG GAG ATC TAC GAT GTC CCC GGG 665 Leu Arg Trp Tyr Leu Ala Thr Gly Glu Glu He Tyr Asp Val Pro Gly 60 65 70
ATC CGC CAC GTC CAC CCC AAC GGC ACT CTC CAA ATT TTC CCC TTC CCT 713 He Arg His Val His Pro Asn Gly Thr Leu Gin He Phe Pro Phe Pro 75 80 85
CCT TCA AGC TTC AGT ACC TTA ATC CAT GAT AAT ACT TAT TAT TGC ACA 761 Pro Ser Ser Phe Ser Thr Leu He His Asp Asn Thr Tyr Tyr Cys Thr 90 95 100 GCT GAA AAT CCT TCA GGG AAA ATT AGA AGT CAG GAT GTC CAC ATC AAG 809 Ala Glu Asn Pro Ser Gly Lys He Arg Ser Gin Asp Val His He Lys 105 110 115
GCT GTT TTA CGG GAG CCC TAT ACA GTC CGT GTG GAG GAC CAG AAA ACC 857 Ala Val Leu Arg Glu Pro Tyr Thr Val Arg Val Glu Asp Gin Lys Thr 120 125 130 135
ATG AGA GGC AAT GTT GCG GTC TTC AAG TGC ATT ATC CCC TCC TCG GTG 905 Met Arg Gly Asn Val Ala Val Phe Lys Cys He He Pro Ser Ser Val 140 145 150
GAG GCG TAC ATC ACT GTC GTC TCA TGG GAG AAA GAC ACT GTT TCA CTT 953 Glu Ala Tyr He Thr Val Val Ser Trp Glu Lys Asp Thr Val Ser Leu 155 160 165
GTC TCA GGA TCT AGA TTT CTC ATC ACA TCC ACG GGA GCC TTG TAT ATT 1001 Val Ser Gly Ser Arg Phe Leu He Thr Ser Thr Gly Ala Leu Tyr He 170 175 180
AAA GAT GTA CAG AAT GAA GAT GGA TTG TAT AAC TAC CGC TGC ATC ACG 1049 Lys Asp Val Gin Asn Glu Asp Gly Leu Tyr Asn Tyr Arg Cys He Thr 185 190 195
CGG CAT CGA TAC ACC GGA GAG ACG AGG CAG AGC AAC AGC GCC AGA CTT 1097 Arg His Arg Tyr Thr Gly Glu Thr Arg Gin Ser Asn Ser Ala Arg Leu 200 205 210 215
TTT GTA TCA GAC CCA GCG AAC TCA GCC CCA TCC ATA CTG GAT GGG TTT 1145 Phe Val Ser Asp Pro Ala Asn Ser Ala Pro Ser He Leu Asp Gly Phe 220 225 230
GAC CAT CGC AAA GCC ATG GCT GGG CAG CGT GTG GAG CTG CCT TGC AAA 1193 Asp His Arg Lys Ala Met Ala Gly Gin Arg Val Glu Leu Pro Cys Lys 235 240 245
GCG CTC GGG CAC CCT GAG CCA GAT TAC CGC TGG CTG AAG GAC AAC ATG 1241 Ala Leu Gly His Pro Glu Pro Asp Tyr Arg Trp Leu Lys Asp Asn Met 250 255 260
CCC CTG GAA CTT TCA GGG AGG TTC CAG AAG ACC GTG ACG GGG CTG CTC 1289 Pro Leu Glu Leu Ser Gly Arg Phe Gin Lys Thr Val Thr Gly Leu Leu 265 270 275
ATT GAG AAC ATT CGC CCC TCG GAC TCA GGC AGC TAT GTT TGT GAA GTG 1337 He Glu Asn He Arg Pro Ser Asp Ser Gly Ser Tyr Val Cys Glu Val 280 285 290 295
TCC AAC AGA TAC GGA ACT GCT AAG GTG ATA GGC CGC CTG TAC GTG AAA 1385 Ser Asn Arg Tyr Gly Thr Ala Lys Val He Gly Arg Leu Tyr Val Lys 300 305 310
CAG CCA CTG AAA GCC ACC ATC AGT CCC AGG AAG GTT AAA AGC AGC GTG 1433 Gin Pro Leu Lys Ala Thr He Ser Pro Arg Lys Val Lys Ser Ser Val 315 320 325
GGT AGC CAA GTT TCC TTG TCC TGC AGC GTG ACA GGA ACT GAG GAC CAG 1481 Gly Ser Gin Val Ser Leu Ser Cys Ser Val Thr Gly Thr Glu Asp Gin 330 335 340
GAA CTC TCC TGG TAC CGC AAT GGT GAA ATC CTC AAC CCT GGA AAA AAT 1529 Glu Leu Ser Trp Tyr Arg Asn Gly Glu He Leu Asn Pro Gly Lys Asn 345 350 355 GTG AGG ATC ACA GGG ATC AAC CAC GAA AAC CTT ATA ATG GAT CAC ATG 1577 Val Arg He Thr Gly He Asn His Glu Asn Leu He Met Asp His Met 360 365 370 375
GTC AAA AGT GAC GGG GGC GCA TAC CAG TGC TTT GTG CGC AAG GAC AAG 1625 Val Lys Ser Asp Gly Gly Ala Tyr Gin Cys Phe Val Arg Lys Asp Lys 380 385 390
CTG TCC GCT CAA GAC TAT GTG CAG GTG GTC CTT GAA GAT GGA ACT CCC 1673 Leu Ser Ala Gin Asp Tyr Val Gin Val Val Leu Glu Asp Gly Thr Pro 395 400 405
AAA ATT ATT TCT GCC TTT AGT GAA AAG GTG GTG AGT CCA GCA GAG CCG 1721 Lys He He Ser Ala Phe Ser Glu Lys Val Val Ser Pro Ala Glu Pro 410 415 420
GTT TCC CTT ATG TGC AAC GTG AAG GGA ACA CCT TTG CCC ACG ATC ACG 1769 Val Ser Leu Met Cys Asn Val Lys Gly Thr Pro Leu Pro Thr He Thr 425 430 435
TGG ACC CTG GAC GAT GAC CCG ATT CTC AAG GGT GGC AGT CAC CGC ATC 1817 Trp Thr Leu Asp Asp Asp Pro He Leu Lys Gly Gly Ser His Arg He 440 445 450 455
AGC CAG ATG ATC ACG TCG GAG GGG AAC GTG GTC AGC TAC CTG AAC ATC 1865 Ser Gin Met He Thr Ser Glu Gly Asn Val Val Ser Tyr Leu Asn He 460 465 470
TCC AGC TCC CAG GTC CGG GAC GGG GGA GTC TAC CGC TGC ACT GCC AAC 1913 Ser Ser Ser Gin Val Arg Asp Gly Gly Val Tyr Arg Cys Thr Ala Asn 475 480 485
AAC TCG GCG GGA GTC GTC CTG TAC CAG GCT CGA ATA AAC GTA AGA GGG 1961 Asn Ser Ala Gly Val Val Leu Tyr Gin Ala Arg He Asn Val Arg Gly 490 495 500
CCT GCA AGC ATT CGA CCA ATG AAA AAC ATC ACA GCA ATA GCA GGA CGG 2009 Pro Ala Ser He Arg Pro Met Lys Asn He Thr Ala He Ala Gly Arg 505 510 515
GAC ACA TAC ATT CAC TGT CGT GTG ATT GGC TAT CCG TAT TAC TCC ATT 2057 Asp Thr Tyr He His Cys Arg Val He Gly Tyr Pro Tyr Tyr Ser He 520 525 530 535
AAA TGG TAC AAG AAC TCT AAC CTG CTT CCT TTC AAC CAC CGC CAA GTG 2105 Lys Trp Tyr Lys Asn Ser Asn Leu Leu Pro Phe Asn His Arg Gin Val 540 545 550
GCA TTT GAG AAC AAT GGA ACT CTT AAA CTT TCA GAT GTG CAA AAG GAA 2153 Ala Phe Glu Asn Asn Gly Thr Leu Lys Leu Ser Asp Val Gin Lys Glu 555 560 565
GTG GAC GAG GGG GAG TAC ACG TGC AAC GTG TTG GTT CAA CCA CAA CTC 2201 Val Asp Glu Gly Glu Tyr Thr Cys Asn Val Leu Val Gin Pro Gin Leu 570 575 580
TCC ACC AGC CAG AGC GTC CAC GTG ACC GTG AAA GTT CCG CCT TTC ATA 2249 Ser Thr Ser Gin Ser Val His Val Thr Val Lys Val Pro Pro Phe He 585 590 595
CAA CCC TTT GAG TTT CCA AGA TTC TCC ATT GGG CAG CGG GTC TTC ATC 2297 Gin Pro Phe Glu Phe Pro Arg Phe Ser He Gly Gin Arg Val Phe He 600 605 610 615 CCC TGT GTT GTG GTC TCA GGG GAC TTA CCC ATC ACG ATC ACC TGG CAG 2345 Pro Cys Val Val Val Ser Gly Asp Leu Pro He Thr He Thr Trp Gin 620 625 630
AAG GAT GGC CGG CCA ATC CCT GGG AGC CTT GGG GTG ACC ATT GAC AAT 2393 Lys Asp Gly Arg Pro He Pro Gly Ser Leu Gly Val Thr He Asp Asn 635 640 645
ATT GAC TTC ACG AGC TCC TTG AGG ATT TCC AAT CTC TCG CTC ATG CAC 2441 He Asp Phe Thr Ser Ser Leu Arg He Ser Asn Leu Ser Leu Met His 650 655 660
AAT GGG AAT TAC ACC TGC ATA GCC CGG AAT GAG GCC GCC GCT GTG GAG 2489 Asn Gly Asn Tyr Thr Cys He Ala Arg Asn Glu Ala Ala Ala Val Glu 665 670 675
CAC CAA AGC CAG TTG ATT GTC AGA GTT CCT CCC AAG TTT GTG GTT CAG 2537 His Gin Ser Gin Leu He Val Arg Val Pro Pro Lys Phe Val Val Gin 680 685 690 695
CCA CGG GAC CAG GAC GGG ATT TAT GGC AAA GCA GTC ATC CTC AAT TGT 2585 Pro Arg Asp Gin Asp Gly He Tyr Gly Lys Ala Val He Leu Asn Cys 700 705 710
TCT GCT GAG GGT TAC CCT GTA CCT ACC ATC GTG TGG AAA TTC TCT AAA 2633 Ser Ala Glu Gly Tyr Pro Val Pro Thr He Val Trp Lys Phe Ser Lys 715 720 725
GGT GCT GGG GTT CCC CAG TTC CAG CCA ATT GCC CTA AAT GGC CGA ATC 2681 Gly Ala Gly Val Pro Gin Phe Gin Pro He Ala Leu Asn Gly Arg He 730 735 740
CAA GTT CTC AGC AAT GGG TCG TTG CTG ATC AAG CAT GTC GTG GAG GAA 2729 Gin Val Leu Ser Asn Gly Ser Leu Leu He Lys His Val Val Glu Glu 745 750 755
GAC AGT GGC TAC TAC CTC TGC AAG GTC AGC AAC GAT GTG GGC GCA GAC 2777 Asp Ser Gly Tyr Tyr Leu Cys Lys Val Ser Asn Asp Val Gly Ala Asp 760 765 770 775
GTC AGC AAG TCC ATG TAC CTC ACG GTT AAA ATT CCT GCG ATG ATA ACA 2825 Val Ser Lys Ser Met Tyr Leu Thr Val Lys He Pro Ala Met He Thr 780 785 790
TCC TAT CCA AAT ACT ACC CTG GCC ACG CAG GGG CAG AAA AAG GAG ATG 2873 Ser Tyr Pro Asn Thr Thr Leu Ala Thr Gin Gly Gin Lys Lys Glu Met 795 800 805
AGC TGC ACG GCG CAT GGT GAG AAG CCC ATT ATA GTC CGC TGG GAG AAG 2921 Ser Cys Thr Ala His Gly Glu Lys Pro He He Val Arg Trp Glu Lys 810 815 820
GA IAC CGA ATC ATT AAC CCT GAG ATG GCC CGT TAT CTT GTG TCC ACC 2969 Glu Asp Arg He He Asn Pro Glu Met Ala Arg Tyr Leu Val Ser Thr 825 830 835
AAG GAG GTG GGA GAA GAG GTG ATT TCT ACT CTG CAG ATT TTG CCA ACT 3017 Lys Glu Val Gly Glu Glu Val He Ser Thr Leu Gin He Leu Pro Thr 840 845 850 855
GTG AGA GAA GAT TCT GGT TTC TTT TCC TGC CAT GCT ATT AAT TCT TAT 3065 Val Arg Glu Asp Ser Gly Phe Phe Ser Cys His Ala He Asn Ser Tyr 860 865 870 GGG GAG GAC CGT GGA ATA ATT CAG CTC ACA GTG CAA GAG CCC CCA GAC 3113 Gly Glu Asp Arg Gly He He Gin Leu Thr Val Gin Glu Pro Pro Asp 875 880 885
CCT CCC GAA ATT GAG ATC AAA GAT GTC AAA GCA CGC ACA ATT ACG CTC 3161 Pro Pro Glu He Glu He Lys Asp Val Lys Ala Arg Thr He Thr Leu 890 895 900
AGG TGG ACC ATG GGG TTT GAT GGA AAC AGT CCC ATC ACA GGC TAC GAT 3209 Arg Trp Thr Met Gly Phe Asp Gly Asn Ser Pro He Thr Gly Tyr Asp 905 910 915
ATT GAA TGC AAA AAT AAA TCA GAC TCC TGG GAT TCT GCT CAG AGA ACC 3257 He Glu Cys Lys Asn Lys Ser Asp Ser Trp Asp Ser Ala Gin Arg Thr 920 925 930 935
AAA GAT GTT TCC CCT CAG CTG AAC TCG GCC ACC ATC ATT GAT ATC CAC 3305 Lys Asp Val Ser Pro Gin Leu Asn Ser Ala Thr He He Asp He His 940 945 950
CCT TCC TCC ACC TAC AGC ATC CGC ATG TAC GCC AAG AAC CGG ATT GGC 3353 Pro Ser Ser Thr Tyr Ser He Arg Met Tyr Ala Lys Asn Arg He Gly 955 960 965
AAG AGC GAG CCC AGC AAC GAG CTC ACC ATC ACG GCG GAC GAG GCA GCT 3401 Lys Ser Glu Pro Ser Asn Glu Leu Thr He Thr Ala Asp Glu Ala Ala 970 975 980
CCT GAT GGT CCA CCT CAG GAA GTT CAC CTG GAG CCT ATA TCA TCT CAG 3449 Pro Asp Gly Pro Pro Gin Glu Val His Leu Glu Pro He Ser Ser Gin 985 990 995
AGC ATC AGG GTC ACA TGG AAG GCT CCC AAG AAA CAT TTG CAA AAT GGG 3497 Ser He Arg Val Thr Trp Lys Ala Pro Lys Lys His Leu Gin Asn Gly 1000 1005 1010 1015
ATT ATC CGT GGC TAC CAA ATA GGT TAC CGA GAG TAC AGC ACT GGG GGT 3545 He He Arg Gly Tyr Gin He Gly Tyr Arg Glu Tyr Ser Thr Gly Gly 1020 1025 1030
AAC TTC CAA TTC AAC ATT ATC AGT GTC GAC ACC AGC GGG GAC AGT GAG 3593 Asn Phe Gin Phe Asn He He Ser Val Asp Thr Ser Gly Asp Ser Glu 1035 1040 1045
GTT TAC ACC CTG GAC AAC CTG AAT AAG TTC ACT CAG TAC GGC CTG GTG 3641 Val Tyr Thr Leu Asp Asn Leu Asn Lys Phe Thr Gin Tyr Gly Leu Val 1050 1055 1060
GTG CAG GCC TGT AAC CGG GCC GGC ACG GGG CCT TCT TCT CAG GAA ATC 3689 Val Gin Ala Cys Asn Arg Ala Gly Thr Gly Pro Ser Ser Gin Glu He 1065 1070 1075
ATC ACC ACC ACT CTC GAG GAT GTG CCC AGT TAC CCC CCC GAA AAT GTC 3737 He Thr Thr Thr Leu Glu Asp Val Pro Ser Tyr Pro Pro Glu Asn Val 1080 1085 1090 1095
CAA GCC ATA GCA ACA TCA CCA GAA AGC ATA TCA ATA TCC TGG TCC ACA 3785 Gin Ala He Ala Thr Ser Pro Glu Ser He Ser He Ser Trp Ser Thr 1100 1105 1110
CTT TCC AAG GAA GCC TTG AAT GGA ATT CTC CAG GGG TTC AGA GTC ATT 3833 Leu Ser Lys Glu Ala Leu Asn Gly He Leu Gin Gly Phe Arg Val He 1115 1120 1125 TAC TGG GCC AAC CTC ATG GAC GGA GAG CTG GGT GAG ATT AAA AAC ATC 3881 Tyr Trp Ala Asn Leu Met Asp Gly Glu Leu Gly Glu He Lys Asn He 1130 1135 1140
ACC ACC ACA CAG CCT TCA CTG GAG CTG GAC GGG CTG GAA AAG TAC ACC 3929 Thr Thr Thr Gin Pro Ser Leu Glu Leu Asp Gly Leu Glu Lys Tyr Thr 1145 1150 1155
AAC TAC AGC ATC CAG GTG CTG GCC TTC ACC CGC GCA GGA GAC GGG GTC 3977 Asn Tyr Ser He Gin Val Leu Ala Phe Thr Arg Ala Gly Asp Gly Val 1160 1165 1170 1175
AGG AGT GAG CAG ATC TTC ACC CGG ACC AAA GAG GAT GTT CCA GGT CCT 4025 Arg Ser Glu Gin He Phe Thr Arg Thr Lys Glu Asp Val Pro Gly Pro 1180 1185 1190
CCC GCG GGT GTG AAG GCA GCG GCG GCC TCA GCC TCC ATG GTC TTT GTG 4073 Pro Ala Gly Val Lys Ala Ala Ala Ala Ser Ala Ser Met Val Phe Val 1195 1200 1205
TCC TGG CTT CCC CCT CTC AAG CTG AAC GGC ATC ATC CGA AAG TAC ACT 4121 Ser Trp Leu Pro Pro Leu Lys Leu Asn Gly He He Arg Lys Tyr Thr 1210 1215 1220
GTA TTC TGC TCC CAC CCC TAT CCC ACA GTG ATC AGC GAG TTT GAG GCC 4169 Val Phe Cys Ser His Pro Tyr Pro Thr Val He Ser Glu Phe Glu Ala 1225 1230 1235
TCT CCC GAC TCG TTT TCC TAC AGA ATT CCC AAC CTG AGT AGG AAT CGT 4217 Ser Pro Asp Ser Phe Ser Tyr Arg He Pro Asn Leu Ser Arg Asn Arg 1240 1245 1250 1255
CAG TAC AGC GTC TGG GTG GTG GCT GTT ACT TCA GCC GGA AGA GGC AAC 4265 Gin Tyr Ser Val Trp Val Val Ala Val Thr Ser Ala Gly Arg Gly Asn 1260 1265 1270
AGC AGT GAA ATC ATC ACA GTC GAG CCA CTA GCA AAA GCT CCT GCA CGA 4313 Ser Ser Glu He He Thr Val Glu Pro Leu Ala Lys Ala Pro Ala Arg 1275 1280 1285
ATC CTG ACC TTC AGT GGG ACA GTG ACT ACT CCA TGG ATG AAA GAC ATT 4361 He Leu Thr Phe Ser Gly Thr Val Thr Thr Pro Trp Met Lys Asp He 1290 1295 1300
GTC TTG CCT TGT AAG GCT GTT GGG GAC CCT TCT CCT GCA GTC AAA TGG 4409 Val Leu Pro Cys Lys Ala Val Gly Asp Pro Ser Pro Ala Val Lys Trp 1305 1310 1315
ATG AAA GAC AGT AAC GGG ACA CCC AGT CTA GTA ACG ATT GAT GGG CGG 4457 Met Lys Asp Ser Asn Gly Thr Pro Ser Leu Val Thr He Asp Gly Arg 1320 1325 1330 1335
AGG AGC ATC TTT AGC AAC GGA AGC TTC ATT ATT CGC ACG GTG AAA GCA 4505 Arg Ser He Phe Ser Asn Gly Ser Phe He He Arg Thr Val Lys Ala 1340 1345 1350
GAA GAC TCC GGC TAT TAC AGC TGC ATT GCC AAT AAC AAC TGG GGA TCT 4553 Glu Asp Ser Gly Tyr Tyr Ser Cys He Ala Asn Asn Asn Trp Gly Ser 1355 1360 1365
GAT GAA ATT ATT TTA AAC TTA CAA GTA CAA GTT CCA CCA GAT CAG CCT 4601 Asp Glu He He Leu Asn Leu Gin Val Gin Val Pro Pro Asp Gin Pro 1370 1375 1380 CGG CTT ACA GTC TCC AAG ACC ACG TCT TCC TCC ATC ACC CTT TCT TGG 4649 Arg Leu Thr Val Ser Lys Thr Thr Ser Ser Ser He Thr Leu Ser Trp 1385 1390 1395
CTC CCT GGA GAC AAC GGG GGC AGC TCT ATC AGA GGA TAC ATA CTG CAG 4697 Leu Pro Gly Asp Asn Gly Gly Ser Ser He Arg Gly Tyr He Leu Gin 1400 1405 1410 1415
TAC TCC GAG GAC AAT AGT GAG CAG TGG GGG AGT TTT CCA ATC AGC CCC 4745 Tyr Ser Glu Asp Asn Ser Glu Gin Trp Gly Ser Phe Pro He Ser Pro 1420 1425 1430
AGC GAA CGT TCC TAT CGC TTG GAA AAT CTC AAA TGT GGG ACT TGG TAT 4793 Ser Glu Arg Ser Tyr Arg Leu Glu Asn Leu Lys Cys Gly Thr Trp Tyr 1435 1440 1445
AAG TTC ACA CTG ACA GCC CAA AAT GGA GTG GGC CCA GGG CGC ATA AGT 4841 Lys Phe Thr Leu Thr Ala Gin Asn Gly Val Gly Pro Gly Arg He Ser 1450 1455 1460
GAA ATC ATA GAA GCA AAG ACC TTA GGA AAA GAG CCC CAG TTC TCA AAG 4889 Glu He He Glu Ala Lys Thr Leu Gly Lys Glu Pro Gin Phe Ser Lys 1465 1470 1475
GAG CAG GAG CTG TTT GCC AGC ATC AAC ACC ACA CGC GTG AGG CTG AAC 4937 Glu Gin Glu Leu Phe Ala Ser He Asn Thr Thr Arg Val Arg Leu Asn 1480 1485 1490 1495
CTC ATT GGC TGG AAT GAT GGC GGC TGC CCC ATC ACC TCC TTC ACA CTA 4985 Leu He Gly Trp Asn Asp Gly Gly Cys Pro He Thr Ser Phe Thr Leu 1500 1505 1510
GAG TAC AGG CCC TTT GGG ACC ACA GTT TGG ACC ACA GCT CAG AGG ACC 5033 Glu Tyr Arg Pro Phe Gly Thr Thr Val Trp Thr Thr Ala Gin Arg Thr 1515 1520 1525
TCT CTC TCC AAG TCC TAC ATC CTG TAT GAC CTG CAG GAA GCC ACC TGG 5081 Ser Leu Ser Lys Ser Tyr He Leu Tyr Asp Leu Gin Glu Ala Thr Trp 1530 1535 ' 1540
TAT GAG CTG CAG ATG CGG GTG TGC AAC AGT GCG GGC TGC GCG GAG AAG 5129 Tyr Glu Leu Gin Met Arg Val Cys Asn Ser Ala Gly Cys Ala Glu Lys 1545 1550 1555
CAG GCT AAA GAG GCT GCG AGA TGC AAA GAG TTT AGC TGAAATGCTC 5175
Gin Ala Lys Glu Ala Ala Arg Cys Lys Glu Phe Ser 1560 1565 1570
ATGAGTAAGA ATACCCGGAC TTCAGATACG TTAAGCAAGC AACAGCAGAC CCTGCGAATG 5235
CACATCGACA TACCCAGGGC TCAGCTTTTG ATTGAAGAGA GAGACACGAT GGAGACCATT 5295
GATGATCGCT CCACGGTTCT GTTGACGGAT GCTGACTTTG GAGAGGCAGC TAAGCAGAAG 5355
TCCCTGACGG TCACTCACAC GGTCCATTAC CAATCGGTGT CTCAGGCCAC TGGGCCCTTA 5415
GTGGATGTTT CAGACGCTCG GCCGGGAACG AATCCCACCA CCAGGAGGAA TGCCAAGGCT 5475
GGGCCCACAG CGAGAAACCG CTATGCCAGC CAGTGGACCC TCAACCGACC CCACCCCACC 5535
ATCTCAGCAC ACACCCTCAC CACAGACTGG AGGCTGCCAA CACCCAGGGC TGCAGGATCA 5595
GTAGACAAAG AGAGCGACAG TTACAGCGTC AGCCCCTCGC AAGACACAGA TCGAGCAAGA 5655 AGCAGCATGG TCTCCACAGA AAGTGCCTCC TCCACTTACG AAGAACTGGC CAGGGCCTAC 5715
GAACACGCCA AGATGGAAGA GCAACTGAGG CACGCCAAGT TCACCATCAC GGAGTGCTTC 5775
ATATCAGACA CGTCATCGGA GCAGTTGACG GCAGGGACAA ATGAGTACAC GGACAGTCTG 5835
ACCTCCAGCA CCCCTTCCGA ATCGGGAATC TGCAGGTTCA CTGCATCTCC CCCCAAACCT 5895
CAGGATGGAG GAAGAGTAAT GAATATGGCA GTTCCAAAGG CAATCGGCCA GGTGACCTCA 5955
TACATTTGCC TCCATACCTT AGAATGGACT TTTTGTTAAA CCGAGGTGGT CCAGGCACCA 6015
GCAGGGACCT GAGCTTAGGA CAAGCATGCT TGGAACCTCA GAAAAGCCGG ACCCTGAAGC 6075
GCCCCACGGT CCTGGAGCCC ATCCCGATGG AAGCCGCCTC CTCCGCCTCC TCCACGAGAG 6135
AAGGACAGTC GTGGCAGCCG GGGGCCGTGG CCACATTACC TCAGCGGGAG GGAGCAGAGC 6195
TGGGACAGGC AGCTAAAATG AGCAGCTCCC AAGAATCACT GCTCGACTCC CGGGGCCATT 6255
TGAAAGGAAA CAATCCTTAC GCAAAATCTT ACACCCIGGT ATAACAGACA GCATGACTGG 6315
ACAGCGGTTG TAAATACAAT TCAAACAATT CAATCAAAGC TACCTTTTTT TTACGGAATT 6375
CCAATATTTA TAATTAAAGA AAATTGCCAA AATATATT 6413
(2) INFORMATION FOR SEQ ID NO: 11:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1571 ammo acids (D) TOPOLOGY: linear
(n) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 11 :
Met Trp He Leu Ala Leu Ser Leu Phe Gin Ser Phe Ala Asn Val Phe 1 5 10 15
Ser Glu Asp Leu His Ser Ser Leu Tyr Phe Val Asn Ala Ser Leu Gin 20 25 30
Glu Val Val Phe Ala Ser Thr Thr Gly Thr Leu Val Pro Cys Pro Ala 35 40 45
Ala Gly He Pro Pro Val Thr Leu Arg Trp Tyr Leu Ala Thr Gly Glu 50 55 60
Glu He Tyr Asp Val Pro Gly He Arg His Val His Pro Asn Gly Thr 65 70 75 80
Leu Gin He Phe Pro Phe Pro Pro Ser Ser Phe Ser Thr Leu He His 85 90 95
Asp Asn Thr Tyr Tyr Cys Thr Ala Glu Asn Pro Ser Gly Lys He Arg 100 105 110
Ser Gin Asp Val His He Lys Ala Val Leu Arg Glu Pro Tyr Thr Val 115 120 125 Arg Val Glu Asp Gin Lys Thr Met Arg Gly Asn Val Ala Val Phe Lys 130 135 140
Cys He He Pro Ser Ser Val Glu Ala Tyr He Thr Val Val Ser Trp 145 150 155 160
Glu Lys Asp Thr Val Ser Leu Val Ser Gly Ser Arg Phe Leu He Thr 165 170 175
Ser Thr Gly Ala Leu Tyr He Lys Asp Val Gin Asn Glu Asp Gly Leu 180 185 190
Tyr Asn Tyr Arg Cys He Thr Arg His Arg Tyr Thr Gly Glu Thr Arg 195 200 205
Gin Ser Asn Ser Ala Arg Leu Phe Val Ser Asp Pro Ala Asn Ser Ala 210 215 220
Pro Ser He Leu Asp Gly Phe Asp His Arg Lys Ala Met Ala Gly Gin 225 230 235 240
Arg Val Glu Leu Pro Cys Lys Ala Leu Gly His Pro Glu Pro Asp Tyr 245 250 255
Arg Trp Leu Lys Asp Asn Met Pro Leu Glu Leu Ser Gly Arg Phe Gin 260 265 270
Lys Thr Val Thr Gly Leu Leu He Glu Asn He Arg Pro Ser Asp Ser 275 280 285
Gly Ser Tyr Val Cys Glu Val Ser Asn Arg Tyr Gly Thr Ala Lys Val 290 295 300
He Gly Arg Leu Tyr Val Lys Gin Pro Leu Lys Ala Thr He Ser Pro 305 310 315 320
Arg Lys Val Lys Ser Ser Val Gly Ser Gin Val Ser Leu Ser Cys Ser 325 330 335
Val Thr Gly Thr Glu Asp Gin Glu Leu Ser Trp Tyr Arg Asn Gly Glu 340 345 350
He Leu Asn Pro Gly Lys Asn Val Arg He Thr Gly He Asn His Glu 355 360 365
Asn Leu He Met Asp His Met Val Lys Ser Asp Gly Gly Ala Tyr Gin 370 375 380
Cys Phe Val Arg Lys Asp Lys Leu Ser Ala Gin Asp Tyr Val Gin Val 385 390 395 400
Val Leu Glu Asp Gly Thr Pro Lys He He Ser Ala Phe Ser Glu Lys 405 410 415
Val Val Ser Pro Ala Glu Pro Val Ser Leu Met Cys Asn Val Lys Gly 420 425 430
Thr Pro Leu Pro Thr He Thr Trp Thr Leu Asp Asp Asp Pro He Leu 435 440 445
Lys Gly Gly Ser His Arg He Ser Gin Met He Thr Ser Glu Gly Asn 450 455 460 Val Val Ser Tyr Leu Asn He Ser Ser Ser Gin Val Arg Asp Gly Gly 465 470 475 480
Val Tyr Arg Cys Thr Ala Asn Asn Ser Ala Gly Val Val Leu Tyr Gin 485 490 495
Ala Arg He Asn Val Arg Gly Pro Ala Ser He Arg Pro Met Lys Asn 500 505 510
He Thr Ala He Ala Gly Arg Asp Thr Tyr He His Cys Arg Val He 515 520 525
Gly Tyr Pro Tyr Tyr Ser He Lys Trp Tyr Lys Asn Ser Asn Leu Leu 530 535 540
Pro Phe Asn His Arg Gin Val Ala Phe Glu Asn Asn Gly Thr Leu Lys 545 550 555 560
Leu Ser Asp Val Gin Lys Glu Val Asp Glu Gly Glu Tyr Thr Cys Asn 565 570 575
Val Leu Val Gin Pro Gin Leu Ser Thr Ser Gin Ser Val His Val Thr 580 585 590
Val Lys Val Pro Pro Phe He Gin Pro Phe Glu Phe Pro Arg Phe Ser 595 600 605
He Gly Gin Arg Val Phe He Pro Cys Val Val Val Ser Gly Asp Leu 610 615 620
Pro He Thr He Thr Trp Gin Lys Asp Gly Arg Pro He Pro Gly Ser 625 630 635 640
Leu Gly Val Thr He Asp Asn He Asp Phe Thr Ser Ser Leu Arg He 645 650 655
Ser Asn Leu Ser Leu Met His Asn Gly Asn Tyr Thr Cys He Ala Arg 660 665 670
Asn Glu Ala Ala Ala Val Glu His Gin Ser Gin Leu He Val Arg Val 675 680 685
Pro Pro Lys Phe Val Val Gin Pro Arg Asp Gin Asp Gly He Tyr Gly 690 695 700
Lys Ala Val He Leu Asn Cys Ser Ala Glu Gly Tyr Pro Val Pro Thr 705 710 715 720
He Val Trp Lys Phe Ser Lys Gly Ala Gly Val Pro Gin Phe Gin Pro 725 730 735
He Ala Leu Asn Gly Arg He Gin Val Leu Ser Asn Gly Ser Leu Leu 740 745 750
He Lys His Val Val Glu Glu Asp Ser Gly Tyr Tyr Leu Cys Lys Val 755 760 765
Ser Asn Asp Val Gly Ala Asp Val Ser Lys Ser Met Tyr Leu Thr Val 770 775 780
Lys He Pro Ala Met He Thr Ser Tyr Pro Asn Thr Thr Leu Ala Thr 785 790 795 800 Gin Gly Gin Lys Lys Glu Met Ser Cys Thr Ala His Gly Glu Lys Pro 805 810 815
He He Val Arg Trp Glu Lys Glu Asp Arg He He Asn Pro Glu Met 820 825 830
Ala Arg Tyr Leu Val Ser Thr Lys Glu Val Gly Glu Glu Val He Ser 835 840 845
Thr Leu Gin He Leu Pro Thr Val Arg Glu Asp Ser Gly Phe Phe Ser 850 855 860
Cys His Ala He Asn Ser Tyr Gly Glu Asp Arg Gly He He Gin Leu 865 870 875 880
Thr Val Gin Glu Pro Pro Asp Pro Pro Glu He Glu He Lys Asp Val 885 890 895
Lys Ala Arg Thr He Thr Leu Arg Trp Thr Met Gly Phe Asp Gly Asn 900 905 910
Ser Pro He Thr Gly Tyr Asp He Glu Cys Lys Asn Lys Ser Asp Ser 915 920 925
Trp Asp Ser Ala Gin Arg Thr Lys Asp Val Ser Pro Gin Leu Asn Ser 930 935 940
Ala Thr He He Asp He His Pro Ser Ser Thr Tyr Ser He Arg Met 945 950 955 960
Tyr Ala Lys Asn Arg He Gly Lys Ser Glu Pro Ser Asn Glu Leu Thr 965 970 975
He Thr Ala Asp Glu Ala Ala Pro Asp Gly Pro Pro Gin Glu Val His 980 985 990
Leu Glu Pro He Ser Ser Gin Ser He Arg Val Thr Trp Lys Ala Pro 995 1000 1005
Lys Lys His Leu Gin Asn Gly He He Arg Gly Tyr Gin He Gly Tyr 1010 1015 1020
Arg Glu Tyr Ser Thr Gly Gly Asn Phe Gin Phe Asn He He Ser Val 1025 1030 1035 1040
Asp Thr Ser Gly Asp Ser Glu Val Tyr Thr Leu Asp Asn Leu Asn Lys 1045 1050 1055
Phe Thr Gin Tyr Gly Leu Val Val Gin Ala Cys Asn Arg Ala Gly Thr 1060 1065 1070
Gly Pro Ser Ser Gin Glu He He Thr Thr Thr Leu Glu Asp Val Pro 1075 1080 1085
Ser Tyr Pro Pro Glu Asn Val Gin Ala He Ala Thr Ser Pro Glu Ser 1090 1095 1100
He Ser He Ser Trp Ser Thr Leu Ser Lys Glu Ala Leu Asn Gly He 1105 1110 1115 1120
Leu Gin Gly Phe Arg Val He Tyr Trp Ala Asn Leu Met Asp Gly Glu 1125 1130 1135 Leu Gly Glu He Lys Asn He Thr Thr Thr Gin Pro Ser Leu Glu Leu 1140 1145 1150
Asp Gly Leu Glu Lys Tyr Thr Asn Tyr Ser He Gin Val Leu Ala Phe 1155 1160 1165
Thr Arg Ala Gly Asp Gly Val Arg Ser Glu Gin He Phe Thr Arg Thr 1170 1175 1180
Lys Glu Asp Val Pro Gly Pro Pro Ala Gly Val Lys Ala Ala Ala Ala 1185 1190 1195 1200
Ser Ala Ser Met Val Phe Val Ser Trp Leu Pro Pro Leu Lys Leu Asn 1205 1210 1215
Gly He He Arg Lys Tyr Thr Val Phe Cys Ser His Pro Tyr Pro Thr 1220 1225 1230
Val He Ser Glu Phe Glu Ala Ser Pro Asp Ser Phe Ser Tyr Arg He 1235 1240 1245
Pro Asn Leu Ser Arg Asn Arg Gin Tyr Ser Val Trp Val Val Ala Val 1250 1255 1260
Thr Ser Ala Gly Arg Gly Asn Ser Ser Glu He He Thr Val Glu Pro 1265 1270 1275 1280
Leu Ala Lys Ala Pro Ala Arg He Leu Thr Phe Ser Gly Thr Val Thr 1285 1290 1295
Thr Pro Trp Met Lys Asp He Val Leu Pro Cys Lys Ala Val Gly Asp 1300 1305 1310
Pro Ser Pro Ala Val Lys Trp Met Lys Asp Ser Asn Gly Thr Pro Ser 1315 1320 1325
Leu Val Thr He Asp Gly Arg Arg Ser He Phe Ser Asn Gly Ser Phe 1330 1335 1340
He He Arg Thr Val Lys Ala Glu Asp Ser Gly Tyr Tyr Ser Cys He 1345 1350 1355 1360
Ala Asn Asn Asn Trp Gly Ser Asp Glu He He Leu Asn Leu Gin Val 1365 1370 1375
Gin Val Pro Pro Asp Gin Pro Arg Leu Thr Val Ser Lys Thr Thr Ser 1380 1385 1390
Ser Ser He Thr Leu Ser Trp Leu Pro Gly Asp Asn Gly Gly Ser Ser 1395 1400 1405
He Arg Gly Tyr He Leu Gin Tyr Ser Glu Asp Asn Ser Glu Gin Trp 1410 1415 1420
Gly Ser Phe Pro He Ser Pro Ser Glu Arg Ser Tyr Arg Leu Glu Asn 1425 1430 1435 1440
Leu Lys Cys Gly Thr Trp Tyr Lys Phe Thr Leu Thr Ala Gin Asn Gly 1445 1450 1455
Val Gly Pro Gly Arg He Ser Glu He He Glu Ala Lys Thr Leu Gly 1460 1465 1470 Lys Glu Pro Gin Phe Ser Lys Glu Gin Glu Leu Phe Ala Ser He Asn 1475 1480 1485
Thr Thr Arg Val Arg Leu Asn Leu He Gly Trp Asn Asp Gly Gly Cys 1490 1495 1500
Pro He Thr Ser Phe Thr Leu Glu Tyr Arg Pro Phe Gly Thr Thr Val 1505 1510 1515 1520
Trp Thr Thr Ala Gin Arg Thr Ser Leu Ser Lys Ser Tyr He Leu Tyr 1525 1530 1535
Asp Leu Gin Glu Ala Thr Trp Tyr Glu Leu Gin Met Arg Val Cys Asn 1540 1545 1550
Ser Ala Gly Cys Ala Glu Lys Gin Ala Lys Glu Ala Ala Arg Cys Lys 1555 1560 1565
Glu Phe Ser 1570

Claims

That which is claimed is:
1. Isolated nucleic acid encoding a mammalian DS- CAM member of the Immunoglobin (Ig) superfamily of proteins, or a fragment thereof, wherein said DS-CAM comprises at least 7 Ig-like domains.
2. Isolated nucleic acid according to claim 1, wherein said nucleic acid, or fragments thereof, is selected from: (a) DNA encoding the amino acid sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9 ,
(b) DNA that hybridizes to the DNA of (a) under moderately stringent conditions, wherein said DNA encodes biologically active DS-CAM, or
(c) DNA degenerate with respect to either (a) or (b) above, wherein said DNA encodes biologically active
DS-CAM.
3. A nucleic acid according to claim 2, wherein said nucleic acid hybridizes under high stringency conditions to the DS-CAM coding portion of nucleotides SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10.
4. A nucleic acid according to claim 2, wherein the nucleotide sequence of said nucleic acid is substantially the same as that set forth in SEQ ID NO:l, SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10.
5. A nucleic acid according to claim 2, wherein the nucleotide sequence of said nucleic acid is the same as that set forth in SEQ ID NO:l, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO : 9 or SEQ ID NO: 10.
6. A nucleic acid according to claim 2, wherein said nucleic acid is cDNA.
7. A vector containing the nucleic acid of claim 2.
8. Recombinant cells containing the nucleic acid of claim 2.
9. An oligonucleotide comprising at least 15 nucleotides capable of specifically hybridizing with a sequence of nucleic acids of the nucleotide sequence set forth in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9 or SEQ ID NO: 10.
10. An oligonucleotide according to claim 9, wherein said oligonucleotide is labeled with a detectable marker.
11. An antisense oligonucleotide capable of specifically binding to mRNA encoded by said nucleic acid according to claim 2.
12. A kit for detecting the presence of the DS-CAM cDNA sequence comprising at least one oligonucleotide according to claim 10.
13. An isolated DS-CAM protein comprising at least 7 Ig-like domains.
14. A DS-CAM protein according to claim 13, further characterized by being expressed in a significantly higher amount in brain versus lung, liver or kidney.
15. A DS-CAM protein according to claim 13, wherein the amino acid sequence of said protein comprises substantially the same protein sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO: 7, SEQ ID NO : 8 or SEQ ID NO : 9.
16. A DS-CAM protein according to claim 15 comprising the same amino acid sequence as the protein sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9.
17. A DS-CAM protein according to claim 13, wherein said protein is encoded by a nucleotide sequence comprising substantially the same nucleotide sequence set forth in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, or SEQ ID NO: 10.
18. A DS-CAM protein according to claim 17, wherein said protein is encoded by a nucleotide sequence comprising SEQ ID NO : 1 or SEQ ID NO: 10.
19. A DS-CAM protein according to claim 13, wherein said protein is encoded by a nucleotide sequence that comprises substantially the same nucleotide sequence as nucleotides 453-6185 set forth in SEQ ID NO:l, nucleotides 453-5168 set forth in SEQ ID NO:10, SEQ ID NO: 7, SEQ ID NO : 8 or SEQ ID NO : 9.
20. Method for expression of a DS-CAM-related protein, said method comprising culturing cells of claim
8 under conditions suitable for expression of said DS-CAM protein.
21. An isolated anti-DS-CAM antibody having specific reactivity with a DS-CAM protein according to claim 13.
22. Antibody according to claim 21, wherein said antibody is a monoclonal antibody.
23. An antibody according to claim 21, wherein said antibody is a polyclonal antibody.
24. A composition comprising an amount of the antisense oligonucleotide according to claim 11 effective to inhibit expression of a DS-CAM protein and an acceptable hydrophobic carrier capable of passing through a cell membrane.
25. A transgenic nonhuman mammal expressing exogenous nucleic acid encoding a DS-CAM protein.
26. A transgenic nonhuman mammal according to claim 25, wherein said nucleic acid encoding said DS-CAM protein has been mutated, and wherein the DS-CAM protein so expressed is not native DS-CAM.
27. A transgenic nonhuman mammal according to claim 25, wherein the transgenic nonhuman mammal is a mouse.
28. A method for identifying nucleic acids encoding a mammalian DS-CAM protein, said method comprising: contacting a sample containing nucleic acids with an oligonucleotide according to claim 9, wherein said contacting is effected under high stringency hybridization conditions, and identifying compounds which hybridize thereto.
29. A method for detecting the presence of a mammalian DS-CAM protein in a sample, said method comprising contacting a test sample with an antibody according to claim 21, detecting the presence of an antibody-DS-CAM complex, and therefor detecting the presence of a mammalian DS-CAM in said test sample.
30. Single strand DNA primers for amplification of DS-CAM nucleic acid, wherein said primers comprise a nucleic acid sequence derived from the nucleic acid sequence set forth as SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 7, SEQ ID NO : 8 or SEQ ID NO : 9.
EP97946341A 1996-10-25 1997-10-23 Nucleic acid encoding ds-cam proteins and products related thereto Ceased EP0934408A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US2932296P 1996-10-25 1996-10-25
US29322P 1996-10-25
PCT/US1997/019547 WO1998017795A1 (en) 1996-10-25 1997-10-23 Nucleic acid encoding ds-cam proteins and products related thereto

Publications (1)

Publication Number Publication Date
EP0934408A1 true EP0934408A1 (en) 1999-08-11

Family

ID=21848445

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97946341A Ceased EP0934408A1 (en) 1996-10-25 1997-10-23 Nucleic acid encoding ds-cam proteins and products related thereto

Country Status (3)

Country Link
EP (1) EP0934408A1 (en)
JP (1) JP2001502906A (en)
WO (1) WO1998017795A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5952171A (en) * 1996-11-19 1999-09-14 Millennium Biotherapeutics, Inc. Method for identifying genes encoding secreted or membrane-associated proteins
WO2000006698A1 (en) * 1998-07-30 2000-02-10 Human Genome Sciences, Inc. 98 human secreted proteins
JP2001017028A (en) * 1999-05-06 2001-01-23 Mitsubishi Chemicals Corp ApoE HOMINOID MAMMAL

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9817795A1 *

Also Published As

Publication number Publication date
WO1998017795A1 (en) 1998-04-30
JP2001502906A (en) 2001-03-06

Similar Documents

Publication Publication Date Title
US5773268A (en) Chromosome 21 gene marker, compositions and methods using same
US6287788B1 (en) DNA encoding galanin GALR3 receptors and uses thereof
WO1997042314A1 (en) Nucleic acid encoding spinocerebellar ataxia-2 and products related thereto
WO1998021333A2 (en) Nucleic acid encoding schwannomin-binding-proteins and products related thereto
US8975018B2 (en) Method of detecting expanded CAG repeat region in spinocerebellar ataxia-2 gene
US6194171B1 (en) Nucleic acids encoding ataxin-2 binding proteins
JP4810036B2 (en) Neurotrophic factor receptor
WO1998017795A1 (en) Nucleic acid encoding ds-cam proteins and products related thereto
US6960656B1 (en) Nucleic acid encoding DS-CAM proteins and products related thereto
US6844431B1 (en) Nucleic acid encoding spinocerebellar ataxia-2 and products related thereto
US6040429A (en) Congenital heart disease proteins and products related thereto
US6475752B1 (en) Mammalian imidazoline receptor
US20030054446A1 (en) Novel retina-specific human proteins C7orf9, C12orf7, MPP4 and F379
US20040248247A1 (en) Bhlh-pas proteins, genes thereof and utilization of the same
CA2403547A1 (en) Purified and isolated potassium-chloride cotransporter nucleic acids and polypeptides and therapeutic and screening methods using same
US20030157649A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
WO1997017437A2 (en) A chromosome 21 - derived nucleic acid encoding a novel protein, compositions and method using same
US20030022208A1 (en) Isolated human secreted proteins, nucleic acid molecules encoding human secreted proteins, and uses thereof
US20030180887A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
US20020028773A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
CA2422508A1 (en) Atp-binding cassette protein
US20020146767A1 (en) Human EMR1-like G protein-coupled receptor
US20030166183A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins and uses thereof
US20030219747A1 (en) Isolated human secreted proteins, nucleic acid molecules encoding human secreted proteins, and uses thereof
WO2002062835A1 (en) Nucleic acids and polypeptides for controlling food intake and/or body weight

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19990518

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): BE DE ES FR GB IT LU NL

17Q First examination report despatched

Effective date: 20031211

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20060202