FIELD OF THE INVENTION
-
The present invention relates to a technique for analyzing
different ligands (analytes) in biosamples, and more specifically
relates to a novel colorimetric sensor comprising a
polydiacetylene membrane and an analysis method which
employs the sensor.
BACKGROUND OF THE INVENTION
-
Membranes formed by self-assembling of amphipathic
(amphiphilic) diacetylene molecules exhibit a blue color when
polymerized with UV (ultraviolet) irradiation, and such
polydiacetylene membranes are known to undergo a change in
color to red by the effects of pH, temperature increase,
mechanical stress, etc. (see for example, Lipowsky, R. (1991)
Nature 349, 475-481; Bloor, D. and Chance, R.R. (1985)
Polydiacetylenes: NATO ASI Series E, Applied Science).
-
Recently, applications of polydiacetylene membranes as
biosensors utilizing this property have been proposed (Charych,
D.H. et al.,(1993) Science 261, 585-588; Reichert, A. et al.,
(1995) J. Am. Chem. Soc. 115, 1146-1147 (1995); Charych D.H.
et al., (1996) Chemistry & Biology 3, 113-120 (1996)). In
particular, attempts have been made to construct biosensors in
such a manner that the receptors which react specifically with
pathogenic bacteria, viruses, toxins and the like present in
biosamples are incorporated into polydiacetylene membranes,
and the color change (blue to red) induced when the receptors
bind to their specific ligands (pathogenic bacteria, viruses,
toxins, etc.) is utilized to allow detection of the ligands with
high sensitivity. To date, only saccharides and lipids have
been used as the receptors in such proposed methods.
-
Such methods, however, can only be applied to the detection
of ligands wherein the binding structure of the receptor and
ligand is known and the receptor has been identified.
Therefore a number of receptors must be synthesized which is
equivalent to the number of types of ligands to be detected,
presenting the likely insurmountable difficulty that the
conditions for preparation of the polydiacetylene membrane
must be determined for the respective cases Many receptors
consisting of saccharides and lipids are highly complicated and
difficult to synthesize, while the color change for detection of
the ligand is often insufficient. In the method of Charych, et.
al. (Chemistry & Biology 3, 113-119 (1996)), for example,
gangliosides are incorporated as the receptors for detection of
the influenza virus. Because of insufficient color change of the
polydiacetylene membrane upon binding between the
polydiacetylene membrane and the influenza virus, however, it
is necessary to introduce sialic acid into the polydiacetylene at a
few percent as a structural change promoter. This complicates
the process for preparation of the membrane as a sensor. When
the ligands to be detected are different, other types of
substances for promoting the structural change must be
designed.
-
In addition, the conventional methods are generally only
effective for ligands for which the receptors have molecular
weight of about 1000 or less, and the methods are not suitable
for detecting ligands which bind to macromolecular receptors.
This is because the macromolecular receptors cause color
changes in polydiacetylene membranes by simply being
incorporated therein.
SUMMARY OF THE INVENTION
-
It is an object of the present invention to provide a new
analysis system utilizing polydiacetylene membranes for
analyzing a variety of biosamples in a simple yet highly
sensitive manner, wherein the preparation of the membranes is
facilitated.
-
The present inventors were led to the present invention by
the finding that the abovementioned object can be attained by
incorporating into a polydiacetylene membrane a relatively low
molecular weight protein capable of reaction or interaction with
a ligand (analyte) in a biosample.
-
Thus, the present invention provides a colorimetric sensor
characterized by comprising polydiacetylene membrane
liposomes, a polydiacetylene membrane film or fine particles
coated with a polydiacetylene membrane, in which said
polydiacetylene membrane is incorporated with a protein having
a reduced molecular weight low enough not to cause color change
in the polydiacetylene membrane.
-
In a preferred embodiment, the reduced-molecular-weight
protein in the colorimetric sensor of the invention is an antibody
Fab' fragment which undergoes an antigen-antibody reaction
with an antigen contained in a sample. In another preferred
embodiment, the reduced-molecular-weight protein in the
colorimetric sensor of the invention is an antigenic protein of
molecular weight of 100,000 or less which undergoes an
antigen-antibody reaction with an antibody contained in a
sample. In still another preferred embodiment, the reduced-molecular-weight
protein in the colorimetric sensor of the
invention is a pep tide consisting of 3-20 amino acid residues
which undergoes an antigen-antibody reaction with an antibody
contained in a sample. In still another preferred embodiment,
the reduced-molecular-weight protein in the colorimetric sensor
of the invention is a combination of a single-stranded DNA of
100 bases or less which hybridizes with single-stranded DNA
contained in a sample to form a double-stranded DNA, and an
antibody which reacts with the double-stranded DNA but does
not react with the single-stranded DNA contained in the sample.
-
The invention also provides a method for analysis of a
biosample, which comprises contacting the abovementioned
colorimetric sensor with a solution sample and utilizing an
absorption measurement or a visual observation with the naked
eye to detect color change in the polydiacetylene membrane.
-
The sensor of the present invention which comprises a
polydiacetylene membrane is suitable for wide use and allows
highly sensitive and simple detection of various ligands
including ligands (analytes) which cannot be detected by the
prior art. The colorimetric sensor of the invention can be
manufactured easily under similar conditions for different
target ligands.
BRIEF DESCRIPTION OF THE DRAWING
-
- FIG. 1 is a graph showing the results of a detection test for α
-AFP using the polydiacetylene membrane liposomes according
to the invention.
- FIG. 2 is a graph showing the results of a detection test for α
-AFP using the polydiacetylene membrane-coated polystyrene
latex particles according to the invention.
- FIG. 3 is a graph showing the results of a detection test for
HIV antibody using the polydiacetylene membrane liposomes
according to the invention.
- FIG. 4 is a graph showing the results of a detection test for
HIV antibody using the polydiacetylene membrane-coated
polystyrene latex particles according to the invention.
-
EMBODIMENTS OF THE INVENTION
-
The sensor of the invention enables highly sensitive
detection of different analytes (ligands) by incorporating
reduced-molecular-weight proteins (antibody proteins, antigen
proteins, peptides, or nucleic acid/antibody proteins) into
polydiacetylene membranes. That is, the invention is based on
the finding that the incorporation of a protein of relatively low
molecular weight into a polydiacetylene membrane so as to
confer a structural change in the polydiacetylene membrane of
such an extent which does not cause a color change, allows a
very dramatic change to occur in the structure of the complex
protein formed by the antigen-antibody reaction when the
protein reacts with the analyte, thus allowing highly sensitive
detection of disturbance of the polydiacetylene membrane
structure and the resulting color change, without introducing
any structural change promoter.
-
The sensor of the invention can be applied to any desired type
of analysis system based on an antigen-antibody reaction. For
example, detection of all ligands, including those which cannot
be detected by the prior art since their receptors have not been
identified, becomes possible by preparation of their antibodies
(antibodies can be prepared for any type of ligand). Even in
cases where the detailed binding structure between the antibody
and its receptor has not been elucidated, the antibody can be
detected by incorporating into a polydiacetylene membrane an
antigenic protein or antigenic peptide known to undergo an
antigen-antibody reaction with the antibody. The sensor of the
invention can also be applied for detection of nucleic acids by a
nucleic acid/antibody combination as will be explained later.
-
The sensor of the invention which is based on an antigen-antibody
reaction can be manufactured by incorporating a
protein into liposomes or a film made from a polydiacetylene
membrane, or into a polydiacetylene membrane coated on fine
particles, in a simple and stable fashion under virtually the
same conditions even for different target analytes, with the
protein incorporated in a quantitative manner.
-
For example, a liposome-type sensor according to the
invention can be manufactured in all cases by forming a
diacetylene membrane in an appropriate organic solvent and
then removing the organic solvent, stirring the resulting
diacetylene membrane with a predetermined amount of the
protein in an appropriate buffer solution and subjecting the
mixture to ultrasonic treatment followed by UV irradiation, to
obtain a polydiacetylene membrane incorporated with the
protein. A sensor of the type wherein the protein is
incorporated in a polydiacetylene membrane coated onto fine
particles can be obtained by carrying out the same procedure
with addition of appropriate fine particles to the buffer
solution.
-
A sensor composed of a polydiacetylene membrane film can
be obtained by forming a film by the conventional LB
(Langmuir-Blodgett) process, transferring it onto an
appropriate support and then immersing the support with the
film in a solution (buffer solution) containing a predetermined
amount of the protein and subjecting the film to UV irradiation.
-
The examples of diacetylene used for preparing
polydiacetylene membranes of the sensor of the invention are
diacetylene compounds such as 10, 12-pentacosadiynoic acid,
10, 12-heptacosadiynoic acid and 10, 12-tricosadiynoic acid,
preferably in combination with diacetylene compounds having
functional groups which bind to the proteins to be incorporated
therein, such as 10, 12-pentacosadiynoic acid N-hydroxysuccinimide
ester, 10, 12-heptacosadiynoic acid N-hydroxysuccinimide
ester and 10, 12-pentacosadiynoic
acid p-nitrophenyl ester.
-
Thus, the sensor of the invention can be manufactured by
the abovementioned procedure basically for any type of
analysis system, thus avoiding the trouble of having to conduct
studies to determine different preparation conditions for
polydiacetylene membranes for different target ligands
(analytes).
-
One of the outstanding advantages of the sensor of the
invention is that incorporating an antibody into the
polydiacetylene membrane allows the detection of substantially
all naturally occurring ligands. This is because antibodies for
ligands (analytes) to be detected can be easily obtained by
immunizing animals using the ligands as antigens, according to
conventional methods. The antibodies used may be polyclonal
or monoclonal antibodies, depending on the purpose. The
antibody used must be reduced to a sufficiently low molecular
weight so as to not cause a color change when incorporated into
the polydiacetylene membrane. Although in some cases the
entire antibody can be used in the sensor of the invention, it is
generally preferred to use an antibody fragment such as intact
IgG, F(ab')2, Fab', etc. Fab' fragments are particularly
preferred because of their low molecular weight.
-
Sensors of the invention can detect specific antibodies by
incorporating into polydiacetylene membranes various proteins
or peptides known to undergo antigen-antibody reactions with
those antibodies. In order to prevent color change in the
polydiacetylene membrane when the protein is incorporated into
the membrane, it is generally preferred for the protein to have a
molecular weight of 100,000 or less, or for the peptide to consist
of 3-20 amino acids. Examples of proteins and peptides which
may be used in the sensor of the invention include the envelope
protein (gp 120) fragment 254-274 for use in detecting HIV
(human immunodeficiency virus) antibody and the envelope
protein (gp 90) for use in detecting HCV (hepatitis C virus)
antibody.
-
The sensor of the invention may also be applied for detection
of nucleic acids. For example, by incorporating into the
polydiacetylene membrane a single-stranded DNA (usually of
100 base pairs or less) which hybridizes with single-stranded
DNA contained in a sample to form a double-stranded DNA, and
an antibody which reacts with the double-stranded DNA but not
with the single-stranded DNA in the sample, it is possible to
achieve highly sensitive detection of DNA complementary to the
DNA incorporated in the diacetylene membrane. With this
sensor, the problem that color change of the polydiacetylene
membrane cannot be achieved by simple formation of double-stranded
DNA is solved by jointly using an antibody which
reacts specifically with the double-stranded DNA. Such
double-stranded DNA-specific antibodies can also be easily
prepared by immunizing suitable animals with the double-stranded
DNA.
-
By using the sensor of the invention it is possible to
qualitatively and quantitatively analyze various ligands
(pathogenic bacteria, viruses, toxins, etc. and active
components derived therefrom, as well as physiologically active
substances) in organisms based on the color change caused by
the antigen-antibody reaction between the protein incorporated
in the polydiacetylene membrane and the ligand (analyte) in the
sample to be tested as explained above. While the analysis is
generally accomplished by a measurement of the absorbance
using a spectrophotometer, it may also be accomplished by a
visual observation with the naked eye if qualitative analysis is
the main purpose. Particularly in cases where a film-type
sensor is used, the film may be mounted on a suitable support
such as paper or a thin plastic sheet and immersed in a solution
sample as in a litmus test, so that the presence of the target
component may be easily indentified by the degree of coloration
(color change).
-
When the sensor of the invention is to be used for
quantitative analysis, it is usually used in the form of fine
particles coated with the polydiacetylene membrane, for better
ease of handling and sensitivity. Preferred examples of such
fine particles are polystyrene, polyfluorine resins and the like.
The size of the fine particles is generally preferred to be 0.01-1.0
µm.
EXAMPLES
-
Examples will now be provided in order to further clarify the
features of the invention, but the invention is in no way
restricted by these examples.
Example 1: Incorporation of reduced-molecular-weight anti-human
α -fetoprotein antibody Fab' into diacetylene/NHS-diacetylene
(1:1) membrane liposomes. and high-sensitivity
detection of specific antigen
-
Diacetylene (10, 12-pentacosadiynoic acid, commercially
available from Wako Junyaku Kogyo, KK.)and NHS-diacetylene
(10, 12-pentacosadiynoic acid N-hydroxysuccinimide ester,
commercially available from Peptide Research Laboratories,
Inc.) (1:1) were dissolved in 100 ml of an organic solvent of
chloroform: methanol = 2:1 to a concentration of 0.1-2 mg/ml,
and after placing the solution in a 500-ml volume glass flask,
the organic solvent was removed at 25°C while rotating the flask
so as to form a uniform diacetylene membrane on the glass
surface. Upon adding 50 ml of a Tris-HCl buffer solution (pH
8.0) containing anti-human α-fetoprotein Fab' at 1-20 µ g/ml
concentration, the mixture was vigorously stirred for 10
minutes and subjected to ultrasonic treatment for homogenizing
the solution to yield 50 ml of diacetylene/NHS-diacetylene (1:1)
membrane liposomes incorporated with the anti-human α -
fetoprotein antibody Fab'. This was subjected to UV
irradiation to polymerize the diacetylene/NHS-diacetylene (1:1).
Various concentrations of α -fetoprotein ( α -AFP) (0.1-100
ng/ml) were added to 1 ml aliquots of the 0.2 mg/ml liposome
solution, and the change in absorbance at 640 nm was measured
with a spectrophotometer (DV-640 ultraviolet/visible
spectroanalyzer system, Beckman Co.).
-
The results are shown in Table 1 and Fig. 1, which indicate
quantitative and notable changes in the absorbance over a wide
range at very low concentrations of the ligand.
| α-AFP concentration (ng/ml) | Change in absorbance |
| 0 | 0.000 |
| 0.1 | 0.015 |
| 0.3 | 0.028 |
| 1.0 | 0.061 |
| 3.3 | 0.118 |
| 10 | 0.232 |
| 33 | 0.478 |
| 100 |
Example 2: Incorporation of reduced-molecular-weight anti-human
α -fetoprotein antibody Fab' into diacetylene/NHS-diacetylene
(1:1) membrane-coated fine particles. and high-sensitivity
detection of specific antigen
-
Diacetylene/NHS-diacetylene (1:1) was dissolved in 100 ml of
a solvent of chloroform: methanol = 2:1 to a concentration of
0.1-10 mg/ml, and after placing the solution in a 500-ml volume
glass flask, the organic solvent was removed at 25°C while
rotating the flask so as to form a uniform diacetylene membrane
on the glass surface. Upon simultaneously adding 45 ml of a
Tris-HCl buffer solution (pH 8.0) containing anti-human α -
fetoprotein Fab' at a 10-200 µ g/ml concentration and 5 ml of a
0.5% (w/w) solution of polystyrene latex particles with a particle
size of 0.212 µm (Seradyne, U.S.), the mixture was vigorously
stirred for 10 minutes and subjected to ultrasonic treatment for
3 minutes for thorough dispersion of the suspension, to yield 50
ml of diacetylene/NHS-diacetylene (1:1) membrane-coated
polystyrene latex particles incorporated with the anti-human α
-fetoprotein antibody Fab'. This was subjected to UV
irradiation to polymerize the diacetylene/NHS-diacetylene (1:1).
The latex suspension was diluted 100-fold with water and
various concentrations of human α -fetoprotein (α -AFP) (10-1000
pg/ml) were added to 1 ml aliquots of the diluted
suspension, and the change in absorbance at 640 nm was
measured with the spectrophotometer.
-
The results are shown in Table 2 and Fig. 2, which clearly
demonstrate a highly sensitive quantitative analysis.
| α-AFP concentration (pg/ml) | Change in absorbance |
| 0 | 0.000 |
| 10 | 0.040 |
| 33 | 0.082 |
| 100 | 0.162 |
| 330 | 0.331 |
| 1000 | 0.701 |
Example 3: Incorporation of reduced-molecular-weight antihuman
fetoprotein antibody Fab' into diacetylene/NHS-diacetylene
(1:1) membrane film. and high-sensitivity detection
of specific antigen
-
Diacetylene/NHS-diacetylene (1:1) was dissolved in 100 ml of
a solvent of chloroform:methanol = 2:1 to a concentration of
0.1-10.0 mg/ml and the solution was spread with a Langmuir-Blodgett
film-forming apparatus. The resulting film was then
transferred onto a glass coated with octyltrichlorosilane. The
diacetylene/NHS-diacetylene (1:1) membrane (a film of 0.7 X 2.5
cm) was immersed in a 0.1 M phosphate buffer solution (pH 8.0)
containing the anti-human α -fetoprotein antibody Fab' at a
concentration of 1 mg/ml and reacted at 4°C for one hour to
prepare a diacetylene/NHS-diacetylene (1:1) membrane
incorporated with the anti-human α -fetoprotein antibody Fab'.
This was then polymerized by UV irradiation. Films prepared
in this manner were then exposed to 20 µl of 0.1 M phosphate
buffer containing human α -fetoprotein (α -AFP) at various
concentrations (0.1-100 µ g/ml concentrations), and changes in
color were visually observed with the naked eye.
-
The results are shown in Table 3, which clearly demonstrate
that qualitative analysis of extremely low concentrations is
possible by the visual observation with the naked eye.
| α-AFP concentration (ng/ml) | Change in color |
| 0 (buffer alone) | no |
| 0.1 | yes |
| 0.33 | yes |
| 1.0 | yes |
| 3.3 | yes |
| 10 | yes |
| 33 | yes |
| 100 | yes |
Example 4: Incorporation of HIV envelope protein (gp 120)
fragment 254-274 (Cys-Thr-His-Gly-Ile-Arg-Pro-Val-Val-Ser
Thr-Gln-Leu-Asn-Gly-Ser-Leu-Ala-Glu) into diacetylene
membrane liposomes, and high-sensitivity detection of HIV
antibody
-
Diacetylene was dissolved in 100 ml of an organic solvent of
chloroform:methanol = 2:1 to a concentration of 0.1-2 mg/ml,
and after placing the solution in a 500-ml volume glass flask,
the organic solvent was removed at 25°C while rotating the flask
so as to form a uniform diacetylene/NHS-diacetylene (1:1)
membrane on the glass surface. Upon adding 50 ml of a Tris-HCl
buffer solution (pH 8.0) containing the HIV envelope
protein (gp 120) fragment 254-274 (Sigma Aldrich Japan) at a
1-20 µ g/ml concentration, the mixture was vigorously stirred
for 10 minutes and subjected to ultrasonic treatment for
homogenizing the solution to yield 50 ml of diacetylene/NHS-diacetylene
(1:1) membrane liposomes incorporated with the
HIV envelope protein (gp120) fragment 254-274. This was
subjected to UV irradiation to polymerize the diacetylene.
Various concentrations of inactivated HIV (0.1-1000 pg/ml) were
added to 1 ml aliquots of the 0.2 mg/ml liposome solution, and
the change in absorbance at 640 nm was measured with a
spectrophotometer (DV-640 ultraviolet/visible spectroanalyzer
system, Beckman Co.). The results are shown in Table 4 and
Fig. 3.
| HIV concentration (pg/m1) | Change in absorbance |
| 0 | 0.000 |
| 1.0 | 0.018 |
| 3.0 | 0.032 |
| 10 | 0.078 |
| 33 | 0.152 |
| 100 | 0.311 |
| 330 | 0.641 |
| 1000 |
Example 5: Incorporation of HIV envelope protein (gp120)
fragment 254-274 (Cys-Thr-His-Gly-Ile-Arg-Pro-Val-Val-Ser-Thr-Gln-Leu-Asn-Gly-Ser-Leu-Ala-Glu)
into diacetylene/NHS-diacetylene
(1:1) membrane-coated fine particles, and high-sensitivity
detection of HIV antibody
-
Diacetylene/NHS-diacetylene (1:1) was dissolved in 100 ml of
a solvent of chloroform:methanol = 2:1 to a concentration of
0.1-10 mg/ml, and after placing the solution in a 500-ml volume
glass flask, the organic solvent was removed at 25°C while
rotating the flask so as to form a uniform diacetylene membrane
on the glass surface. Upon simultaneously adding 45 ml of a
0.1 M phosphate buffer solution (pH 7.5) containing the HIV
envelope protein (gp120) fragment 254-274 at a 1-200 µ g/ml
concentration and 5 ml of a 0.5% (w/w) solution of polystyrene
latex particles with a particle size of 0.212 µ m (Seradyne, U.S.),
the mixture was vigorously stirred for 10 minutes and subjected
to ultrasonic treatment for 3 minutes for thorough dispersion of
the suspension, to yield 50 ml of diacetylene/NHS-diacetylene
(1:1) membrane-coated polystyrene latex particles incorporated
with the HIV envelope protein (gp120) fragment 254-274. This
was subjected to UV irradiation to polymerize the
diacetylene/NHS-diacetylene (1:1). The latex suspension was
diluted 100-fold with water and various concentrations of
inactivated HIV (0.1-10 pg/ml) were added to 1 ml aliquots of
the diluted suspension, and the change in absorbance at 640 nm
was measured with the spectrophotometer. The results are
shown in Table 5 and Fig. 4.
| HIV concentration (pg/m1) | Change in absorbance |
| 0 | 0.000 |
| 0.1 | 0.040 |
| 0.3 | 0.082 |
| 1.0 | 0.162 |
| 3.3 | 0.331 |
| 10 | 0.701 |
Example 6: Incorporation of HIV envelope protein (gp120)
fragment 254-274 (Cys-Thr-His-Gly-Ile-Arg-Pro-Val-Val-Ser-Thr-Gln-Leu-Asn-Gly-Ser-Leu-Ala-Glu)
into diacetylene/NHS-diacetylene
(1:1) membrane film, and high-sensitivity detection
of HIV antibody
-
Diacetylene/NHS-diacetylene (1:1) was dissolved in 100 ml of
a solvent of chloroform:methanol = 2:1 to a concentration of
0.1-10.0 mg/ml and the solution was spread with a Langmuir-Blodgett
film-forming apparatus. The resulting film was then
transferred onto a glass coated with octyltrichlorosilane. The
diacetylene/NHS-diacetylene (1:1) membrane (a film of 0.7 X 2.5
cm) was immersed in a 0.1 M phosphate buffer solution (pH 8.0)
containing the HIV envelope protein (gp120) fragment 254-274
at a concentration of 1 mg/ml and allowed for the reaction at 4°C
for one hour to yield a diacetylene/NHS-diacetylene (1:1)
membrane incorporated with the HIV envelope protein (gp120)
fragment 254-274. This was then polymerized by UV
irradiation. Films were then exposed to 20 µ l of 0.1 M
phosphate buffer containing the HIV envelope protein (gp 120)
fragment 254-274 at various concentrations (10-10,000 pg/ml),
and changes in color were visually observed with the naked eye.
The results are shown in
| HIV concentration (pg/ml) | Change in color |
| 0.0 (buffer alone) | no |
| 10 | yes |
| 33 | yes |
| 100 | yes |
| 330 | yes |
| 1000 | yes |
| 3300 | yes |
| 10000 | yes |
Example 7: Incorporation of deoxyribonucleotides (DNA) into
polydiacetylene membrane and simple high-sensitivity detection
of specific DNA in specimens
-
To polydiacetylene membrane films prepared according to the
method described in Example 3 and incorporated with amounts
(0.1-100 pg) of the probe DNA (number of base pairs: 20mers,
TATGCTTCCGGCTCGTATGT), there were added 20 µ l each of a
solution sample containing the complementary DNA
(ATACGAAGGCCGAGCATACA). No color change was not
observed. Next, 20 µ l of a solution containing an antibody (10
µ g/ml) which reacts only with the double-stranded DNA was
added to each film, and the change in color after 60 seconds was
visually observed.
-
The results are shown in Table 7. The results in Table 7
demonstrate that DNA in the samples can be easily and rapidly
detected at a high sensitivity by using an antibody which reacts
specifically with the double-stranded DNA.
| Amount of specimen DNA (pg) | Color change before addition of antibody for dsDNA | Color change after addition of antibody for dsDNA |
| 0 | no | no |
| 0.1 | no | yes |
| 0.3 | no | yes |
| 1.0 | no | yes |
| 3.3 | no | yes |
| 10 | no | yes |
| 33 | no | yes |
| 100 | no | yes |
