EP0866869A2

EP0866869A2 - Modification process

Info

Publication number: EP0866869A2
Application number: EP96943105A
Authority: EP
Inventors: Morten Jorsboe; Janne Brunstedt; Steen Guldager Petersen
Original assignee: Danisco AS; Danisco US Inc
Current assignee: DuPont Nutrition Biosciences ApS; Danisco US Inc
Priority date: 1995-12-04
Filing date: 1996-12-02
Publication date: 1998-09-30
Also published as: WO1997020937A2; GB9524752D0; JP2000502252A; CN1207772A; AU1193997A; WO1997020937A3; MX9804483A; BR9612773A

Abstract

An in vivo modification process is described. The in vivo modification process affects the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof.

Description

MODIFICATION PROCESS

The present invention relates to a modification process.

In paπicular. the present invention relates to an in vivo modification process.

Galactomannans are a heterogenous group of cell wall polysaccharides consisting of a 0-1-4 linked mannan backbone with varying numbers of a- 1-6 linked galactose side chains.

The galactomannans of most significant industrial use are obtained from the endosperms of the legumes guar (Cyamopsis tetragonolobus) and locust bean (Ceratonia siliqua). These galactomannans differ in their galactose content, guar having a galactose to mannose ratio of approximately 1 : 1.6, whereas the ratio for locust bean gum (LBG) is approximately 1:3.4.

The differences in galactose content have significant effects on the functional properties of guar gum and LBG. Both galactomannans form highly viscous solutions at low concentrations (1-2%) but LBG has the additional property of being able to form firm gels with other polysaccharides such as xanthan, carrageenan and agarose. LBG is extensively used by the food industry in dairy products (notably ice cream), salad dressings, sauces, low calorie products and pet foods. However, the use of LBG is restricted by the high price and irregular supply.

Therefore, large scale production of galactomannans with improved functional properties, such as a result of an increased mannose to galactose ratio (such as that similar to LBG), is desirable.

Due to the generic chemical similarity between guar gum and LBG and the much lower price on guar gum, it has been attempted in vitro to convert guar gum into a galactomannan with LBG-like properties and with a chemical composition similar to LBG. An example of such an in vitro treatment includes the use of α-galactosidase. In this regard, see McCleary et al 1983 and EP-A-0255153.

By using α-galactosidase purified from guar seeds, guar gum with galactose contents of 10-34% was obtained (Bulpin et al 1990). Analysis of the gelation behaviour of the modified guar gum showed that a preparation with a galactose content of 24% formed mixed gels with carrageenan displaying similar rheological properties as LBG. In comparison, the galactose content of untreated guar gum was 38% and 23 % for LBG.

However, from an industrial point of view in vitro degalactosylation of guar gum is associated with a number of problems.

First, huge amounts of α-galactosidase have to be prepared as about 40% of the galactose in the guar gum has to be removed.

Second, during incubation it is very important that no hydrolysis of the mannan backbone occurs necessitating the use of highly purified α-galactosidase preparations devoid of any trace of mannanase activity. A procedure for heterologous production of the α-galactosidase from guar seed has been published (Overbeeke et al 1986). However, the produced α-galactosidases from the tested species were purified before investigating the action on guar gum suggesting that the mannanase problem remains to be solved.

Third, the yield of gaiactomannan is reduced because a 40% reduction in galactose content corresponds to approximately 15% less modified guar gum. The released galactose may be undesirable in the final product and may have to be removed.

Fourth, there is a considerable risk for depolymerisation of the gaiactomannan during incubation with α-galactosidase. Also, there is a risk for contaminating microorganisms to colonise the reaction mixture releasing endo-β-mannanases.

Finally, water has to be removed from the reaction mixture. In addition to the cost of this process, it will also result in concentration of the buffer that may be used for obtaining optimal reaction conditions.

These examples demonstrate that the present methods for the modification of guar gum are associated with problems, some of which are associated with considerable costs.

There is therefore need to have an improved method for the modification of guar gum.

In this regard, we now realise that it would be beneficial if the modification of a mannose/galactose containing compound (such as guar gum) were to occur in vivo in plants, such as guar plants, by use of recombinant DNA techniques.

Thus, in its broadest sense, the present invention relates to in vivo modification of a mannose/gaiactose containing compound - such as guar gum - in an organism (or part thereof) capable of synthesising that compound by a method that is not native to that organism - such as by a method that makes use of recombinant DNA techniques. The modification may occur to in relation to any one or more of the precursors of the compound (e.g. mannose and/or galactose) or in relation to the compound itself (i.e. modification of the mannose and/or galactose units of a compound comprising same).

In particular, the present invention relates to an in vivo modification process that affects, preferably increases, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/gaiactose containing compound or of a mannose/galactose containing compound thereof. This in vivo modification process is not a naturally occurring process. Thus, with the in vivo process of the present invention, it is possible to alter the internal in vivo ratio of mannose to galactose within an organism and/or the ratio of mannose to galactose of a mannose/galactose compound thereof.

One of the requirements for the production of in vivo modified guar gum is the availability of a method for the introduction of suitable genes into guar. This has been accomplished to a limited extent by Jόrsboe and Okkels (1994) who transferred a selectable and screenable gene used for the development of the transformation method. These authors did not report on transformation with a gene to affect the mannose to galactose ratio. This is an important point as, from a biotechnological point of view, the major obstacle for the production of in vivo modified guar gum is the lack of knowledge of gaiactomannan biosynthesis. Up until now, no genes or gene products which control the biosynthesis of guar gum in vivo have been isolated and characterised. However, we have now determined some of the genes or gene products which control the biosynthesis of guar gum in vivo - thus enabling us to modify guar gum in vivo.

In one preferred aspect, the present invention relates to an in vivo modification process that affects, preferably increases, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, the in vivo modification process comprising expressing a nucleotide sequence coding for a gene product, which gene product has an effect on:

(a) the mannose-to-galactose ratio of mannose and galactose components of a mannose/galactose containing compound; and/or

(b) the mannose-to-galactose ratio of mannose and galactose precursors for a mannose/galactose containing compound;

and wherein the nucleotide sequence is not a natural nucleotide sequence to the organism (or part thereof). In another preferred aspect, the present invention relates to an in vivo modification process that affects, preferably increases, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, the in vivo modification process comprising allowing a gene product that is capable of having an effect on:

to have an effect on:

(b) the mannose-to-galactose ratio of mannose ^"and galactose precursors for a mannose/galactose containing compound;

and wherein the gene product has not been expressed by a nucleotide sequence that is a natural nucleotide sequence to the organism (or part thereof)-

Another broad aspect of the present invention relates to the use of a nucleotide sequence to affect in vivo, preferably to increase, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, wherein the nucleotide sequence encodes a gene product which has an effect on:

(a) the mannose-to-galactose ratio of mannose and galactose components of a mannose/galactose containing compound; and/or (b) the mannose-to-galactose ratio of mannose and galactose precursors for a mannose/galactose containing compound;

and wherein the nucleotide sequence is not a natural nucleotide sequence to the organism (or part thereof)-

Another broad aspect of the present invention relates to the use of a gene product to affect in vivo, preferably to increase, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, wherein the gene product has an effect on:

and wherein the gene product is not expressed by a nucleotide sequence that is a natural nucleotide sequence to the organism (or part thereof)-

The term "mannose/galactose containing compound" means a compound comprising at least one mannose group and at least one galactose group.

In each of these preferred aspects, it is preferred that the mannose/galactose containing compound is gaiactomannan.

In each of these preferred aspects, it is more preferred that the mannose/galactose containing compound is guar gum. In each of these preferred aspects, it is more preferred that the organism capable of producing a mannose/galactose containing compound is a guar plant and the mannose/galactose containing compound thereof is gaiactomannan. However, other gaiactomannan producing plants are encompassed such as fenugreek and lucerne. Plants that are considered not to produce appropriate quantities of gaiactomannan belong to the family Solanacea and the species Nicotiana tabacum.

The term "organism (or part thereof) capable of producing a mannose/galactose containing compound" also includes any suitable organism - in particular a plant - capable of producing a mannose/galactose containing compound, such that the internal in vivo ratio of mannose to galactose of that organism is altered. The term also includes any part of an organism that is capable of producing a mannose/galactose containing compound, such that the ratio of mannose to galactose of that part is altered. The term also includes a part when within an organism or in a live culture medium. Preferably, the part is when within an organism per se. An example of a part is seed.

The term "a natural nucleotide sequence to the organism" means an entire nucleotide sequence that is in its natural environment and when operatively linked to an entire promoter with which it is naturally associated, which promoter is also in its natural environment.

The term "mannose and galactose precursors" includes mannose er se or derivatives thereof and/or galactose per se or derivatives thereof as precursors for the biosynthesis of a mannose/galactose containing compound, preferably gaiactomannan. In addition, the term includes precursors for mannose per se or derivatives thereof and/or galactose per se or derivatives thereof which in turn are used as precursors for the biosynthesis of a mannose/galactose containing compound, preferably gaiactomannan. Preferably, the term means mannose per se or derivatives thereof (such as mannose-6-phosphate or GDP-mannose) and/or galactose per se or derivatives thereof as precursors for the biosynthesis of gaiactomannan, preferably guar gaiactomannan. The term "gene product" includes peptides, polypeptides, proteins, enzymes and RNA. Preferably, the term means an enzyme.

Preferably the in vivo mannose-to-galactose ratio of the organism (or pan thereof) or mannose/galactose containing compound thereof is higher than that of the guar plant or the gaiactomannan thereof.

More preferably the in vivo mannose-to-galactose ratio of the organism (or part thereof) or mannose/galactose containing compound thereof is substantially similar to that of the locust bean or the gaiactomannan thereof.

Preferably the organism (or part thereof) or mannose/galactose containing compound thereof is a guar plant or the gum thereof.

The present invention also covers a mannose/galactose containing compound when prepared by the process of the present invention. This mannose/galactose containing compound will be referred to as a mannose/galactose containing compound according to the present invention.

In addition, the present invention also covers a foodstuff comprising a mannose/galactose containing compound according to the present invention.

In addition, the present invention also covers a composition - such as a foodstuff - comprising a mannose/galactose containing compound according to the present invention admixed with another polysaccharide. Preferably that other saccharide is any one or more of xanthan, carrageenan and agarose.

In addition, the present invention covers methods for preparing compositions or foodstuffs according to the present invention comprising mixing the mannose/galactose containing compound according to the present invention with another suitable ingredient. The broad aspects of the present invention can be achieved by one or more appropriate strategies, wherein each strategy constitutes a preferred embodiment of the present invention.

A first strategy relates to the use of one or more gene products, or nucleotide sequences coding for same, wherein the gene products are useful in the biosynthesis of GDP-mannose. This strategy involves the transformation of one or more of the genes encoding enzymes that are required for the biosynthesis of GDP-mannose - namely the enzyme phosphomannose isomerase (PMI) and/or the enzyme phosphomannose mutase and/or the enzyme GDP-mannose pyrophosphorylase.

In this regard, it is believed that one or more of the gene products that are useful in the biosynthesis of GDP-mannose increase the levels of mannose-6-phosphate, which in turn increase the mannose-to-galactose ratio of a mannose/galactose containing compound, such as a gaiactomannan.

A preferred aspect of the first strategy relates to at least the use of PMI and/or the nucleotide sequence coding for die same. In this regard, it is believed that the PMI gene product increases the levels of mannose-6-phosphate, which in turn increases the mannose-to-galactose ratio of a mannose/galactose containing compound, such as a gaiactomannan. It is further preferred that the PMI is a plant PMI.

A second strategy relates to the use of a α-galactosidase enzyme and the nucleotide sequence coding for the same. With this strategy it is possible to utilise α- galactosidase. such as that from senna or from coffee beans, to alter in vivo the mannose-to-galactose ratio of a mannose/galactose containing compound, such as a gaiactomannan.

A third strategy relates to the combination of the first strategy with the second strategy, which strategies can be used in any order or simultaneously. A preferred aspect of the present invention relates to a construct comprising or expressing any one or more of the nucleotide sequences of the present invention.

Another preferred aspect of the present invention relates to a vector comprising or expressing any one or more of the constructs or nucleotide sequences of the present invention.

Another preferred aspect of the present invention relates to a plasmid comprising or expressing any one or more of the vectors, constructs or nucleotide sequences of the present invention.

Another preferred aspect of the present invention relates to a transgenic organism (or part thereof) comprising or expressing any one or more of the plasmids, vectors, constructs or nucleotide sequences of the present invention.

Other preferred aspects of the present invention include methods of expressing or allowing expression or transforming any one or more of the nucleotide sequences, the constructs, the plasmids, the vectors, the cells, the tissues, the organs or the organisms, as well as the products thereof.

Further preferred aspects of the present invention include uses of the gene products for preparing or treating foodstuffs, including animal feed.

The present invention also relates to isolating a guar gum prepared by the method of the present invention.

The present invention also relates to a guar gum prepared by the method of the present invention.

The first strategy of the present invention will now be described in more detail by way of reference to further preferred aspects of the present invention. According to a first preferred aspect of this aspect of the present invention there is provided an enzyme comprising the amino acid sequence shown in Figure 1 , or a variant, homologue or fragment thereof.

According to a second preferred aspect of this aspect of the present invention there is provided a nucleotide sequence coding for the enzyme of the first aspect or a sequence that is complementary thereto.

According to a third preferred aspect of this aspect of the present invention there is provided a nucleotide sequence comprising the sequence shown in Figure 1 , or a variant, homologue or fragment thereof or a sequence that is complementary thereto.

According to a fourth preferred aspect of this aspect of the present invention there is provided a construct comprising or expressing the invention according to any one of the earlier aspects.

According to a fifth preferred aspect of this aspect of the present invention there is provided a vector comprising or expressing the invention of any one of the earlier aspects.

According to a sixth preferred aspect of this aspect of the present invention there is provided a plasmid comprising or expressing the invention of any one of the earlier aspects.

According to a seventh preferred aspect of this aspect of the present invention there is provided a transgenic organism (or part thereof) comprising or expressing the invention according to any one of the earlier aspects.

Preferably in these preferred aspects of this aspect of the present invention the nucleotide sequence or the enzyme is that as defined in or is contained within or is expressed by the above-mentioned aspects of the present invention. Other preferred aspects of this aspect of the present invention include methods of expressing or allowing expression or transforming any one of the nucleotide sequence, the construct, the plasmid, the vector, the cell, the tissue, the organ or the organism, as well as the products thereof.

Further preferred aspects of this aspect of the present invention include uses of the enzyme for preparing or treating foodstuffs, including animal feed.

A preferred aspect of this aspect of the present invention thus relates to the enzyme phosphomannose isomerase ("PMI") and a nucleotide sequence coding for that enzyme. In particular, the preferred aspect of the present invention relates to recombinant PMI.

In addition, the preferred aspect of the present invention relates to the use of that recombinant PMI to alter the mannose-to-galactose ratio of either an organism (or part thereof) and/or a mannose/galactose containing compound thereof, especially the mannose-to-galactose ratio of gaiactomannan.

One of the key advantages of the present invention is that by using the recombinant PMI it is possible to increase the mannose-to-galactose ratio of an organism (or part thereof) and/or a mannose/galactose containing compound thereof, in particular in vivo modified guar gum. This advantageous aspect is achieved by the insertion of a gene or genes encoding a gene product or products which are involved in the biosynthesis of mannose/galactose containing compounds such as mannose-6- phosphate, which gene is most preferably the nucleotide sequence of the present invention.

Other key advantages are that the recombinant enzyme can be prepared easily and in large quantities. Also, the nucleotide sequence can be used to change the in vivo ratio of mannose to galactose levels when inserted (preferably stably inserted) into the genome of an organism (or part thereof)- Preferably the nucleotide sequence is a DNA sequence.

In a highly preferred embodiment the nucleotide sequence is a recombinant DNA sequence.

Preferably the nucleotide sequence is obtainable from deposit NCIMB 40774.

In a highly preferred embodiment the enzyme is expressed by use of recombinant DNA techniques.

Preferably the enzyme is expressed by a nucleotide sequence obtainable from deposit NCIMB 40774.

Preferably the organism is a plant.

More preferably the plant is a guar plant.

Preferably the mannose/galactose containing compound is guar gum.

The enzyme or nucleotide sequence(s) coding for same may be used in vivo in combination with one or more other enzymes or nucleotide sequence(s) coding for same, which enzymes or nucleotide sequence(s) coding for same are preferably prepared by use of recombinant DNA techniques. The PMI enzyme or nucleotide sequence(s) coding for same may also be used in vitro. The PMI enzyme or nucleotide sequence(s) coding for same may also be used with one or more other enzymes or nucleotide sequence(s) coding for same, which enzymes or nucleotide sequence(s) coding for same are preferably prepared by use of recombinant DNA techniques. The terms "variant" , "homologue" or "fragment" in relation to the enzyme include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acid from or to the sequence providing the resultant amino acid sequence has PMI activity, preferably having at least the same activity of the enzyme shown in Figure 1 In particular, the term "homologue" covers homology with respect to structure and/or function providing the resultant enzyme has PMI activity. With respect to sequence homology, preferably there is at least 75 % , more preferably at least 85 % , more preferably at least 90% homology to the sequence shown m Figure 1 More preferably there is at least 95 % , more preferably at least 98% , homology to the sequence shown in the attached Figure 1

The terms "variant" , "homologue" or "fragment" in relation to the nucleotide sequence coding for the enzyme include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acid from or to the sequence providing the resultant nucleotide sequence codes for an enzyme having PMI activity, preferably having at least the same activity of the enzyme shown in Figure 1. In particular, the term "homologue" covers homology with respect to structure and/or function providing the resultant nucleotide sequence codes for an enzyme having PMI activity With respect to sequence homology, preferably there is at least 75%, more preferably at least 85%, more preferably at least 90% homology to the sequence shown in Figure 1. More preferably there is at least 95 % , more preferably at least 98%, homology to the sequence shown in Figure 1.

The above terms are synonymous with allelic variations of the sequences.

The term "complementary" means that the present invention also covers nucleotide sequences that can hybridise to the nucleotide sequence of the present invention

The second strategy of the present invention will now be described in more detail by way of reference to further preferred aspects of the present invention. According to a first preferred aspect of this aspect of the present invention there is provided an enzyme comprising the amino acid sequence shown in Figure 4, or a variant, homologue or fragment thereof.

According to a third preferred aspect of this aspect of the present invention there is provided a nucleotide sequence comprising the sequence shown in Figure 4, or a variant, homologue or fragment thereof or a sequence that is complementary thereto.

Preferably in these preferred aspects of this aspect of the present invention the nucleotide sequence or the enzyme is that as defined in or is contained within or is expressed by the above-mentioned aspects of the present invention. Other preferred aspects of this aspect of the present invention include methods of expressing or allowing expression or transforming any one of the nucleotide sequence, the construct, the plasmid, the vector, the cell, the tissue, the organ or the orgamsm, as well as the products thereof

Further preferred aspects of this aspect of the present invention include uses of the enzyme for preparing or treating foodstuffs, including animal feed

A preferred aspect of this aspect of the present invention thus relates to the enzyme α-galactosidase and a nucleotide sequence coding for that enzyme

In particular, the preferred aspect of the present invention relates to recombinant α- galactosidase

In addition, the preferred aspect of the present invention relates to the use of that recombinant α-galactosidase to alter the mannose-to-galactose ratio of either an orgamsm (or part thereof) and/or a mannose/galactose containing compound thereof, especially the mannose-to-galactose ratio of gaiactomannan

One of the key advantages of the present invention is that by using the recombinant α-galactosidase it is possible to increase the mannose-to-galactose ratio of an orgamsm (or part thereof) and/or a mannose/galactose contaimng compound thereof, in particular in vivo modified guar gum

Other key advantages are that the recombinant enzyme can be prepared easily and in large quantities Also, the nucleotide sequence can be used to change the in vivo ratio of mannose to galactose levels when inserted (preferably stably inserted) into the genome of an organism (or part thereof)

Preferably the nucleotide sequence is a DNA sequence In a highly preferred embodiment the nucleotide sequence is a recombinant DNA sequence Preferably the nucleotide sequence is obtainable from deposit NCIMB 40831.

Preferably the enzyme is expressed by a nucleotide sequence obtainable from deposit NCIMB 40831.

Preferably the organism is a plant.

More preferably the plant is a guar plant.

Preferably the mannose/galactose containing compound is guar gum.

The enzyme or nucleotide sequence(s) coding for same may be used in vivo in combination with one or more other enzymes or nucleotide sequence(s) coding for same, which enzymes or nucleotide sequence(s) coding for same are preferably prepared by use of recombinant DNA techniques. The α-galactosidase enzyme or nucleotide sequence(s) coding for same may also be used in vitro. The α- galactosidase enzyme or nucleotide sequence(s) coding for same may also be used w h one or more other enzymes or nucleotide sequence(s) coding for same, which enzymes or nucleotide sequence(s) coding for same are preferably prepared by use of recombinant DNA techniques.

The terms "variant", "homologue" or "fragment" in relation to the enzyme include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acid from or to the sequence providing the resultant amino acid sequence has α-galactosidase activity, preferably having at least the same activity of the enzyme shown in Figure 4. In particular, the term "homologue" covers homology with respect to structure and/or function providing the resultant enzyme has α-galactosidase activity. With respect to sequence homology, preferably there is at least 75 %, more preferably at least 85 % , more preferably at least 90% homology to the sequence shown in Figure 4. More preferably there is at least 95% , more preferably at least 98%, homology to the sequence shown in the attached Figure 4.

The terms "variant" , "homologue" or "fragment" in relation to the nucleotide sequence coding for the enzyme include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acid from or to the sequence providing the resultant nucleotide sequence codes for an enzyme having α-galactosidase activity, preferably having at least the same activity of the enzyme shown in Figure 4. In particular, the term "homologue" covers homology with respect to structure and/or function providing the resultant nucleotide sequence codes for an enzyme having α-galactosidase activity. With respect to sequence homology, preferably there is at least 75%, more preferably at least 85% , more preferably at least 90% homology to the sequence shown in Figure 4. More preferably there is at least 95% , more preferably at least 98%, homology to the sequence shown in Figure 4.

The above terms are synonymous with allelic variations of the sequences.

The term "complementary" means that the present invention also covers nucleotide sequences that can hybridise to the nucleotide sequence of the present invention.

The term "nucleotide" in relation to the present invention includes genomic DNA, cDNA, synthetic DNA, and RNA. Preferably it means DNA, more preferably cDNA for the coding sequence of the present invention.

The term "construct" - which is synonymous with terms such as "conjugate" , "cassette" and "hybrid" - includes the nucleotide sequence directly or indirectly attached or fused to a promoter. An example of an indirect attachment is the provision of a suitable spacer group such as an intron sequence, such as the Shl- intron or the ADH intron, intermediate the promoter and the nucleotide sequence. In each case, it is highly preferred that the terms do not cover the natural combination of the wild type gene coding for the enzyme ordinarily associated with the wild type gene promoter and when they are both in their natural environment. One highly preferred embodiment of the present invention therefore relates to the nucleotide sequence of the present invention operatively linked to a heterologous promoter.

The construct may even contain or express a marker which allows for the selection of the genetic construct in, for example, a plant, such as guar, into which it has been transferred. Various markers exist which may be used, such as for example those encoding mannose-6-phosphate isomerase (especially for plants) or those markers that provide for herbicide or antibiotic resistance - e.g. resistance to G418, hygromycin, bleomycin, kanamycin and gentamycin.

The term "vector" includes expression vectors and transformation vectors.

The term "expression vector" means a construct capable of in vivo or in vitro expression.

The term "transformation vector" means a construct capable of being transferred from one species to another - such as from an E. coli plasmid to an Agrobacterium to a plant.

The term "tissue" includes tissue per se and organ.

The term "organism" in relation to the present invention includes any organism that could comprise the nucleotide sequence coding for the enzyme according to the present invention and/or products obtained therefrom, and/or wherein the nucleotide sequence according to the present invention can be expressed when present in the organism.

Preferably the organism is a guar plant. The term "transgenic organism" in relation to the present invention includes any organism that comprises the nucleotide sequence coding for the enzyme according to the present invention and/or products obtained therefrom, and/or wherein the nucleotide sequence according to the present invention can be expressed within the organism. Preferably the nucleotide sequence is incorporated in the genome of the organism.

Preferably the transgenic organism is a plant, more preferably a guar plant.

The transgenic organism of the present invention includes an organism comprising any one or more of the nucleotide sequences coding for the enzymes according to the present invention, constructs according to the present invention, vectors according to the present invention, plasmids according to the present invention, cells according to the present invention, tissues according to the present invention, or the products thereof, including combinations thereof. For example the transgenic organism can also comprise any one or more of the nucleotide sequences coding for the enzymes of the present invention under the control of one or more heterologous promoters.

In a highly preferred embodiment, the transgenic organism (or part thereof) does not comprise the combination of a promoter and the nucleotide sequence coding for the enzyme according to the present invention, wherein both the promoter and the nucleotide sequence are native to that organism (or part thereof) and are in their namral environment. Thus, in this highly preferred embodiment, the present invention does not cover the native nucleotide coding sequence according to the present invention in its namral environment when it is under the control of its native promoter which is also in its namral environment. In addition, in this highly preferred embodiment, the present invention does not cover the native enzyme according to the present invention when it is in its natural environment and when it has been expressed by its native nucleotide coding sequence which is also in its namral environment and when that nucleotide sequence is under the control of its native promoter which is also in its namral environment. The term "promoter" is used in the normal sense of the art, e.g an RNA polymerase binding site in the Jacob-Mond theory of gene expression.

The promoter could additionally include one or more features to ensure or to increase expression in a suitable host. For example, the features can be conserved regions such as a Pribnow Box or a TATA box. The promoters may even contain other sequences to affect (such as to maintain, enhance, decrease) the levels of expression of the nucleotide sequence of the present invention For example, suitable other sequences include the SΛi-intron or an ADH intron Other sequences include inducible elements - such as temperamre, chemical, light or stress inducible elements.

Also, suitable elements to enhance transcription or translation may be present. An example of the latter element is the TMV 5' signal sequence (see Sleat Gene 217 [1987] 217-225; and Dawson Plant Mol. Biol. 23 [1993] 97).

Thus, in one aspect, the nucleotide sequence according to the present invention is under the control of a promoter that allows expression of the nucleotide sequence. In this aspect, the promoter may be a cell or tissue specific promoter. If, for example, the organism is a plant then the promoter can be one that affects expression of the nucleotide sequence in any one or more of seed, stem, sprout, root and leaf tissues

By way of example, the promoter for the nucleotide sequence of the present invention can be the α-Amy 1 promoter (otherwise known as the Amy 1 promoter, the Amy 637 promoter or the α-Amy 637 promoter) as described in PCT/EP95/02195

Alternatively, the promoter for the nucleotide sequence of the present invention can be the α-Amy 3 promoter (otherwise known as the Amy 3 promoter, the Amy 351 promoter or the α-Amy 351 promoter) as described in PCT/EP95/02196 With the Amy 351 promoter it is possible to inactivate a part of it so that the partially inactivated promoter expresses the nucleotide sequence in a more specific manner such as in just one specific tissue type or organ. The term "inactivated" means partial inactivation in the sense that the expression pattern of the promoter is modified but wherein the partially inactivated promoter still functions as a promoter However, as mentioned above, the modified promoter is capable of expressing the nucleotide sequence in at least one (but not all) specific tissue of the original promoter Examples of other partial inactivation of a promoter sequence (and not just necessarily that of the Amy 351 promoter) include altering the folding pattern of the promoter sequence, or binding species to parts of the nucleotide sequence, so that a part of the nucleotide sequence is not recogmsed by, for example, RNA polymerase Another, and preferable, way of partially inactivating the Amy 351 promoter is to truncate it to form fragments thereof Another way would be to mutate at least a part of the sequence so that the RNA poiymerase can not bind to that part or another pan

Another modification is to mutate the binding sites for regulatory proteins for example the CreA protein known from filamentous fungi to exert carbon catabohte repression, and thus abolish the catabolite repression of the native promoter

General teachings of recombinant DNA techniques may be found in Sambrook , Fπtsch, E F , Maniatis T (Editors) Molecular Cloning A laboratory manual Second edition Cold Spring Harbour Laboratory Press New York 1989

Even though the enzyme and the nucleotide sequence of the present invention are not disclosed in EP-B-0470145 and CA-A-2006454, those two documents do provide some useful background commentary on the types of techniques that may be employed to prepare transgemc plants accordmg to the present invention An adaption of some of these background teachings is now included in the following commentary

The basic principle in the construction of genetically modified plants is to insert genetic information in the plant genome so as to obtain a stable maintenance of the inserted genetic material. Several techniques exist for inserting the genetic information, the two main principles being direct introduction of the genetic information and introduction of the genetic information by use of a vector system. A review of the general techniques may be found in articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42:205- 225) and Christou (Agro-Food-Industry Hi-Tech March April 1994 17-27).

Thus, in one aspect, the present invention relates to a vector system which carries the nucleotide sequence or construct according to the present invention and which is capable of introducing the nucleotide sequence or construct into the genome of an organism, such as a plant.

The vector system may comprise one vector, but it can comprise two vectors. In the case of two vectors, the vector system is normally referred to as a binary vector system. Binary vector systems are described in further detail in Gynheung An et al. (1980), Binary Vectors, Plant Molecular Biology Manual A3, 1-19.

One extensively employed system for transformation of plant cells with a given promoter or nucleotide sequence or construct is based on the use of a Ti plasmid from Agrobacterium tumefaciens or a Ri plasmid from Agrobacteήum rhizogenes An et al. (1986), Plant Physiol. 81, 301-305 and Butcher D.N. et al. (1980), Tissue Culture Methods for Plant Pathologists, eds. : D.S. Ingrams and J.P. Helgeson, 203-208.

Several different Ti and Ri plasmids have been constructed which are suitable for the construction of the plant or plant cell constructs described above. A non-limiting example of such a Ti plasmid is pGV3850.

The nucleotide sequence or construct of the present invention should preferably be inserted into the Ti-plasmid between the terminal sequences of the T-DNA or adjacent a T-DNA sequence so as to avoid disruption of the sequences immediately surrounding the T-DNA borders, as at least one of these regions appear to be essential for insertion of modified T-DNA into the plant genome. As will be understood from the above explanation, if the organism is a plant, then the vector system of the present invention is preferably one which contains the sequences necessary to infect the plant (e.g. the vir region) and at least one border part of a T- DNA sequence, the border part being located on the same vector as the genetic construct.

Furthermore, the vector system is preferably an Agrobacterium tumefaciens Ti- plasmid or an Agrobacteήum rhizogenes Ri-plasmid or a derivative thereof, as these plasmids are well-known and widely employed in the construction of transgemc plants, many vector systems exist which are based on these plasmids or derivatives thereof.

In the construction of a transgenic plant the nucleotide sequence or construct of the present invention may be first constructed in a microorganism in which the vector can replicate and which is easy to manipulate before insertion into the plant. An example of a useful microorganism is E. coli, but other microorganisms having the above properties may be used. When a vector of a vector system as defined above has been constructed in E. coli, it is transferred, if necessary, into a suitable Agrobacterium strain, e.g. Agrobacterium tumefaciens. The Ti-plasmid harbouring the nucleotide sequence or construct of the invention is thus preferably transferred into a suitable Agrobacterium strain, e.g. A. tumefaciens, so as to obtain an Agrobacterium cell harbouring the nucleotide sequence or construct of the invention, which DNA is subsequently transferred into the plant cell to be modified.

As reported in CA-A-2006454, a large amount of cloning vectors are available which contain a replication system in E. coli and a marker which allows a selection of the transformed cells. The vectors contain for example pBR 322, pUC series, M13 mp series, pACYC 184 etc.

In this way, the nucleotide or construct of the present invention can be introduced into a suitable restriction position in the vector. The contained plasmid is used for the transformation in E. coli. The E. coli cells are cultivated in a suitable nutrient medium and then harvested and lysed. The plasmid is then recovered. As a method of analysis there is generally used sequence analysis, restriction analysis, electrophoresis and further biochemical-molecular biological methods. After each manipulation, the used DNA sequence can be restricted and connected with the next DNA sequence. Each sequence can be cloned in the same or different plasmid.

After each introduction method of the construct or nucleotide sequence according to the present invention in the plants the presence and/or insertion of further DNA sequences may be necessary. If, for example, for the transformation the Ti- or Ri- plasmid of the plant cells is used, at least the right boundary and often however the right and the left boundary of the Ti- and Ri-plasmid T-DNA, as flanking areas of the introduced genes, can be connected. The use of T-DNA for the transformation of plant cells has been intensively studied and is described in EP-A-120516; Hoekema, in: The Binary Plant Vector System Offset-drukkerij Kanters B.B. , Alblasserdam, 1985, Chapter V; Fraley, et al. , Crit. Rev. Plant Sci., 4: 1-46; and An et al., EMBO J. (1985) 4:277-284.

Direct infection of plant tissues by Agrobacterium is a simple technique which has been widely employed and which is described in Butcher D.N. et al. (1980), Tissue Culture Methods for Plant Pathologists, eds.: D.S. Ingrams and J.P. Helgeson, 203- 208. For further teachings on this topic see Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech March April 1994 17-27). With this technique, infection of a plant may be done on a certain part or tissue of the plant, i.e. on a part of a leaf, a root, a stem or another part of the plant.

Typically, with direct infection of plant tissues by Agrobacterium carrying the nucleotide sequence of the present invention, a plant to be infected is wounded, e.g. by cutting the plant with a razor or puncturing the plant with a needle or rubbing the plant with an abrasive. The wound is then inoculated with the Agrobacterium. The inoculated plant or plant part is then grown on a suitable culture medium and allowed to develop into mature plants. When plant cells are constructed, these cells may be grown and maintained in accordance with well-known tissue culturing methods such as by culturing the cells in a suitable culture medium supplied with the necessary growth factors such as amino acids, plant hormones, vitamins, etc.

Regeneration of the transformed cells into genetically modified plants may be accomplished using known methods for the regeneration of plants from cell or tissue cultures, for example by selecting transformed shoots using an antibiotic and by subculturing the shoots on a medium containing the appropriate nutrients, plant hormones, etc.

Further teachings on plant transformation may be found in EP-A-0449375.

Even further useful teachings on the transformation of guar plants can be found in Danish patent application No. 940662 (filed 10 June 1994).

Thus, the present invention relates to the use of a gene product (e.g. the PMI enzyme which is involved in the biosynthesis of mannose) to increase the mannose-to- galactose ratio of an organism (or part thereof) or mannose/galactose containing compound thereof. In addition, the present invention relates to that nucleotide sequence and the gene product it encodes.

The present invention is based on the surprising finding that it is possible to increase the mannose-to-galactose ratio of guar gum by the insertion of a gene or genes encoding a gene product or products which are involved in the biosynthesis of mannose/galactose containing compounds such as mannose-6-phosphate, namely PMI.

The findings of the present invention are in contrast to what would have been expected in view of the teachings of the art. In this regard, Edwards from analysis of unpurified preparations of developing endosperms from fenugreek and guar suggested that GDP-mannose may be a precursor for the biosynthesis of gaiactomannan (Edwards et al 1989, Reid and Edwards 1995). Through analysis of various amounts of GDP-mannose in the reaction mixture the authors concluded that the control of the mannose-to-galactose ratio might reside at the level of specificity of the galactomannan-synthesizmg glycosyltransferases themselves This might suggest that the glycosyltransferases might be the critical target for genetic manipulation for the in vivo modification of guar gum

Thus, in summation, this preferred aspect of the present invention relates to the insertion of a phosphomannose isomerase gene into a plant, preferably guar

The rationale behind this strategy is based on our understanding that the mannose incorporated into the guar gaiactomannan is derived from GDP-mannose However, the way in which the GDP-mannose is synthesized in guar is not known The classical way is by isomerization of GDP-glucose but some preliminary data suggest that in some legumes at least the GDP-mannose might be synthesized by isomerization of fructose-6-phosphate to mannose-6-phosphate which is isomenzed to mannose-1- phosphate which in turn is converted to GDP-mannose. But even if the latter pathway should be operative an increase in the PMI activity would not per se be expected to affect the gaiactomannan composition because firstly the fructose-6-phosphate to mannose-6-phosphate isomerization is a fully reversible reaction and secondly Reid and Edwards (1995) have predicted that the mannose-to-galactose ratio is determined by the specificity of the gaiactomannan synthesizing enzymes With this strategy, and as will become apparent, we have obtained an increase of the mannose-to-galactose ratio - even when using a weakly expressed promoter in guar But, even higher ratio levels could be achieved by using a stronger promoter.

The present invention is also based on the surprising finding that it is possible to increase the mannose-to-galactose ratio of guar gum by the insertion of a gene or genes encoding a gene product or products which are involved in the biosynthesis of guar or precursors therefor As just mentioned, in one preferred aspect of the present invention the gene codes for PMI In an alternative preferred aspect the gene codes for α-galactosidase, preferably coffee bean α-galactosidase or senna α-galactosidase, more preferably senna α-galactosidase The following sample comprising the PMI gene of the present invention was deposited in accordance with the Budapest Treaty at the recognised depositary The National Collections of Industrial and Marine Bacteria Limited (NCIMB) at 23 St. Machar Drive, Aberdeen, Scotland, United Kingdom, AB2 1RY on 9 November 1995:

E.coli K12 containing plasmid pPMI-60.

The deposit number is NCIMB 40774.

The present invention also covers nucleotide sequences obtainable from that deposit and the products encoded thereby.

The following sample comprising the α-galactosidase gene of the present invention was deposited in accordance with the Budapest Treaty at the recognised depositary The National Collections of Industrial and Marine Bacteria Limited (NCIMB) at 23 St. Machar Drive, Aberdeen, Scotland, United Kingdom, AB2 1RY on 28 November 1996:

E.coli K12 containing plasmid pT7-SEcDNA5.

The deposit number is NCIMB 40831.

The present invention will now be described by way of example. In the following Examples reference is made to the accompanying figures in which:

Figure 1 shows the amino acid sequence of one enzyme according to die present invention and the sequence of one nucleotide sequence according to the present invention; Figure 2 is a plasmid map of pcDNAII;

Figure 3 is a plasmid map of pSG-Man5;

Figure 4 shows the amino acid sequence of another enzyme according to the present invention and the sequence of another nucleotide sequence according to the present invention;

Figure 5 is a plasmid map of pPS48;

Figure 6 is a plasmid map of pPS48SEGAL;

Figure 7 is a plasmid map of pBKL4;

Figure 8 is a plasmid map of pBKL4SEGAL;

Figure 9 is a plasmid map of pPS48-GALIII; and

Figure 10 is a plasmid map of pBKL4GALIII.

7N VIVO MODIFICATION OF GUAR GUM USING PMI GENES

Cloning of a Phosphomannose Isomerase (PMI) Gene from Guar

A cDNA expression library represent mRNA from immamre guar endosperm was constructed in the plasmid pcDNAII (Invitrogen Corporation) and transformed into the E coli strain ToplOF - (Invitrogen Corporation). The quality of the cDNA library was controlled by purification of plasmids from a number of separate colonies picked at random. Restriction enzyme digestion of the plasmids showed that all contained an insert of at least 500 bp. The E coli strain CDl man- contains an inactive PMI gene and is thus unable to metabolise mannose (Darzins et al 1985). This strain was used for the following complementation studies.

CDl man- cells were made competent by the method of Hanahan (1985). A titer of 3-4 x 10" transformed cells/μg library plasmid cDNA was obtained. A similar titer was found when the cells were transformed with a Bluescript control plasmid.

Prior to the complementation studies, a number of control experiments were performed in which the transformed cells were plated onto selective medium containing M9-salts (Maniatis et al 1982) added 0.05 g/1 leucine, 0.05 g/1 methionine, 0.05 g/1 threonine, 1.0 g/1 thiamin-HCl , 50 mg/1 ampicillin, 6.0 g/1 mannose and 9.0 g/1 agarose. This medium is hereafter called M9-SGP.

In one experiment CDl man- competent cells were transformed with the E coli PMI gene under control of its native promoter (Mills and Guest 1984) and in another experiment the cells were transformed with the E coli PMI gene under the control of the plant promoter CaMV 35S (pSGMANl , see Bojsen et al 1993). In both experiments, plating of the transformed cells on M9-SGP resulted in large numbers of large colonies. When competent CDl man- cells were not transformed or transformed with a Bluescript control plasmid, no large colonies were obtained but a number of very small hardly visible colonies were observed. Thus the M9-SGP selective medium is suitable for selecting cells which contain an active PMI gene.

Competent CDl man- cells were transformed with plasmid DNA isolated from the guar endosperm cDNA library. Transformed CDl man- cells were plated onto the selective substrate M9-SGP. After incubation for two days at 37 °C the majority of the plated cells appeared as very small colonies whereas less than 0.1 % of the colonies were remarkably larger.

Plasmids from the larger colonies were purified and retransformed into competent CDl man- ceils. Twenty different retransformed colonies were assayed for PMI activity in crude extracts PMI activity was measured by the coupled enzymatic assay described by Gill et al (1986) One of the examined clones contained very high PMI activity This clone is designated PMI-60 and is the subject of the deposit number NCIMB 40774

In order to test whether the insert in PMI-60 originated from guar, genomic guar DNA was purified from leaves according to Dellaporta et al (1983), restriction enzyme digested. Southern blotted and probed with plasmid DNA derived from PMI- 60 labelled with P-32 according to Feinberg and Vogelstein (1983) Hybridisation and washing were performed at 68°C, 6 x SSC and 68°C, 0 2 x SSC (Maniatis et al 1982), respectively The PMI-60 probe hybridised to a number of fragments of the digested guar genomic DNA

The insert in the plasmid of PMI-60 (called pPMI-60) was sequenced by dideoxy sequencing applying primer walking (Sanger and Coulson 1977), first by fluorescein labelled primers (reverse and universal) and subsequently by internal labelling using fluorescein-dATP

The size of the cDNA clone was 1.66 kb of which the PMI gene covered 1.29 kb. The PMI start and stop codon was located at 0 09 kb and 1 38 kb, respectively The insert contained a putative polyadenylation signal at 0 11 kb downstream from the stop codon and is poly-A terminated

The identity of the insert was further characterised by comparison to other known PMI sequences At 137-145 ammo acids downstream from translation start a conserved region is found DGNHKPEM which is considered to be involved in the active PMI site of phosphomannose isomerases (Coulin et al 1993)

Thus, the presence of the insert in PMI-60 results in rapid growth on selective mannose contaimng medium, high PMI activity and hybridisation to guar DNA Furthermore, there is homology to some sequences from other PMI genes These data demonstrate that the insert in PMI-60 is a PMI gene from guar This PMI sequence is the first PMI sequence ever cloned and sequenced from a plant.

Transformation using phosphomannose isomerase (PMD gene

The following transformation studies show that it is possible to increase the mannose- to-galactose ratio of guar gum by the insertion of a phosphomannose isomerase (PMI) - such as that from E.coli or guar. The recombinant PMI catalyses the conversion of fructose-6-phosphate to mannose-6-phosphate or mannose-6-phosphate to fructose- 6-phosphate depending on the substrate available.

Transformation of Guar

Transgenic guar plants were obtained by Agrobacterium tumefaciens mediated gene transfer as described by Jόrsboe and Okkels (1994) - the contents of which are incorporated herein by reference. The preferred Agrobacterium tumefaciens strain was in these studies LB A 4404.

The insert in the T-DNA in the plasmid called pDO18 contained 3 genes (right border to left border): a /3-glucuronidase (GUS) gene, a phosphomannose isomerase (PMI) gene and a neomycin phosphotransferase (NPTII) gene. The expression of each of the genes was driven by a 35S promoter described in detail on Bojsen et al (1993).

Analysis of Guar Gum by HPLC

Pure guar endosperms devoid of embryo and seed coat were prepared by hand and treated repeatedly with 70% ethanol during homogenization according to Edwards et al (1992). The ethanol precipitate was added 2 ml 2 N trifluor acetic acid (TFA) and hydrolysis was performed at 120°C for 2 hours. The TFA was removed by evaporation at 50°C. The dried precipitate was dissolved in 500 μl HPLC grade H₂O and 25 μl sample was applied onto an Aminex HPX-87P column (300 x 7.8 mm). The column was heated to 80° C in a column oven and eluted with H₂O. Elution of saccharides was followed with an Rl-detector. Using this system mannose and galactose was baseline separated. The respective peak areas were determined and die mannose-to-galactose ratios were calculated. Guar gum and LBG from Sigma were used as standards along with endosperm samples from non-transgenic guar plants. The mannose-to-galactose ratios obtained were 1.6: 1 for both Sigma guar gum and non-transgenic endosperms, and 3.5: 1 for Sigma LBG. These ratios are in excellent agreement with those generally accepted (Reid and Edwards 1995).

Mannose-to-Galactose Ratio in PMI-Transformed Guar

Several independent guar transformants harbouring the PMI gene were analysed with respect to mannose-to-galactose ratio in the endosperm gaiactomannan, see the table below.

Each of the transformants increased the mannose-to-galactose ratio of guar gum.

Similar studies are done with the insertion of a phosphomannose isomerase (PMI) gene from guar. In this regard, it is believed that the guar PMI catalyses the con¬ version of fructose-6-phosphate to mannose-6-phosphate or mannose-6-phosphate to fructose-6-phosphate depending on the substrate available. 7N VIVO MODIFICATION OF GUAR GUM USING α-GALACTOSID ASE GENES

In the following examples it is shown that the insertion of an α-galactosidase gene into guar can result in the in vivo modification of guar gum.

Cloning and sequencing of senna α-galactosidase cDNA.

cDNA clones of α-galactosidase from senna endosperm were isolated by PCR as follows.

Total RNA was purified from senna endosperm according to me method of (Logemann et al. Anal. Biochem. 163 (1987) 16-20). Reverse transcription followed by PCR was done with the RT-PCR kit from Perkin Elmer and according to their protocol. Briefly, approximately 1 mg of total RNA and 1 mg oligo-dT was incubated at 42 °C for 45 min with reverse transcriptase followed by incubation at 99°C for 5 min and 5°C for 5 min.

For the following PCR, two oligo nucleotides derived from the guar α-galactosidase cDNA sequence (Overbeeke et al. Plant Mol. Biol 13 (1989) 541-550) were used:

PI (5'-CAACGGGGCTTGCTGCTTTAGG)

and

P2 (5'-GCCTATGTCA-GACCAGGATGC),

at positions 415-437 and 1248-1270, respectively in the guar α-galactosidase cDNA sequence.

The PCR conditions were: 1 min at 94°C, 2 min at 55°C, 2 min at 72°C for 35 cycles followed by 10 min at 72°C. The PCR product was analysed by agarose gel electrophoresis, and a single product of 850 bp was obtained.

The DNA product, designated SEGAL, was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).

The 3' and 5' ends of the senna α-galactosidase cDNA were obtained by the method called 3' and 5' RACE as previously described (Nielsen et al. Plant Mol. Biol 31 (1996) 539-552. Briefly, for 3' RACE, approximately lmg of the above total RNA and 2.5 pmol of the primer:

Q_τ (5' CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGC(T)₁₇)

was incubated at 42 °C for 45 min with reverse transcriptase followed by incubation at 99°C for 5 min and 5°C for 5 min.

The cDNA was amplified by two rounds of PCR.

For the first PCR the downstream primer was:

Q₀ (5'-CCAGTGAGCAGAGTGACG),

and the upstream primer was:

3 ' GSP 1 (5 ' -GTCCTCTG AGTG AT AAC AG AGTGG) ,

a gene specific primer derived from the 850 bp nucleotide sequence of the fragment SEGAL, position 1096-1118 in the senna α-galactosidase cDNA (Figure 4).

In the second PCR the downstream primer was: Q, (5'-GAGGACTCGAGCTCAAGC)

and the upstream primer was:

3'GSP2 (5'-GGTGTTGTGGAATAGAAGTTCATC),

a gene specific primer derived from the 850 bp nucleotide sequence of the fragment SEGAL, position 1123-1146 in the senna α-galactosidase cDNA (Figure 4).

The PCR conditions for the first PCR were: 1 min at 94°C, 2 min at 60°C, 2 min at 72°C for 35 cycles followed by 10 min at 72°C. For the second PCR the conditions were: 1 min at 94°C, 2 min at 50°C, 2 min at 72°C for 35 cycles followed by 10 min at 72 °C.

The PCR product after the second PCR was analysed by agarose gel electrophoresis, and a single product of 530 bp was obtained.

The DNA product, designated 3 'SEGAL, was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).

For 5' RACE the 5 'RACE system from Gibco BRL was employed with 3 gene specific primers constructed from the 850 bp nucleotide sequence of the fragment SEGAL. Briefly, approximately 1 mg of the same total RNA as used above and 2.5 pmol of the gene specific primer:

5'GSP1 (5'-TTGCACCTTGGTCTTCATGTCC),

position 561-582 in the senna α-galactosidase cDNA (Figure 4) was incubated for 70°C for 10 min followed by addition of reverse transcriptase and incubating at 42 °C for 30 min, 70°C for 15 min and the addition of RNaseH and incubating further 10 mm at 55°C

The cDNA was dC-tailed according to the protocol of Gibco BRL. The tailed cDNA was subjected to two rounds of PCR.

In the first PCR an upstream ANKER primer (5'-GGCCACGCGTC- GACTAGTACGGGGGGGGGG) was used with the gene specific downstream primer:

5 'GSP2 (5-C ATAGCTTTACTGCATGTTTGGTTTCC) ,

position 510-536 in the senna α-galactosidase cDNA (Figure 4)

In the second PCR an upstream UNI primer:

(5'-GGCCACGCGTCGACTAGTACG)

was used with the gene specific downstream primer:

5'GSP3 (5'-CAGCCAGAGCCTTAATTCCTGAAGG),

position 438-462 in the senna α-galactosidase cDNA (Figure 4)

The PCR conditions for the first PCR were: 1 min at 94°C, 2 mm at 51 °C, 2 min at 72°C for 10 cycles followed by 1 min at 94°C, 2 min at 59°C, 2 mm at 72°C for 25 cycles followed by 10 min at 72 °C.

For the second PCR the conditions were: 1 min at 94 °C, 2 min at 59° C, 2 min at 72 °C for 35 cycles followed by 10 min at 72 °C.

The PCR product after the second PCR was analysed by agarose gel electrophoresis, and a single product of 480 bp was obtained. The DNA product, designated 5' SEGAL, was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).

The complete nucleotide sequence of the senna α-galactosidase cDNA, combined from the 3 PCR clones, 5'SEGAL, SEGAL and 3'SEGAL, obtained above, consisting of 1630 bp is shown in Figure 4. Analysis of the nucleotide sequence reveals (Figure 4) an open reading frame encoding 406 amino acid residues with the first memionine at nucleotide position 93 and a translation stop codon at nucleotide position 1311. The deduced amino acid sequence is shown above the nucleotide sequence in Fig 4.

Construction of a plant transformation vector containing the senna a- galactosidase.

An expression vector comprising the coding sequence for senna α-galactosidase was constructed as follows.

The vector pPS48 (Figure 5) was constructed by inserting the 0.75 kb cauliflower mosaic virus (CaMV) 35S RNA promoter (E35S) containing a duplication of the -90 to -420 region (Kay et al. Science 236 (1987) 1299-1302), the 0.21 kb fragment containing the CaMV 35S RNA polyadenylation sequence (Odell et al. Nature 313 (1985) 810-812) and a synthetic oligonucleotide linker (Pstl-BamHl-Smal-Sacl-Sall- Sphl) into ρUC8 (Vieira and Messing, Gene 19 (1982) 259-268).

The three DNA fragments, 5'SEGAL, SEGAL and 3'SEGAL, were linked together by PCR to reconstitute a clone of senna α-galactosidase cDNA, containing the coding sequence and most of the non translated 5' end.

The fragment 5' SEGAL was re-amplified using the primers 5'GSP3 and B255, ( '- ATTGGATCCACTCACAC-GTATACACTACAC)

containing a BamHI site plus the nucleotides position 14-36 in the senna α- galactosidase cDNA (Figure 4).

The fragment 3'SEGAL was re-amplified using the primers 3'GSP2 and B254,

(5'-TTAGCATGCCCTTGGGATTGTATT-TCCTC),

containing a Sphl site and nucleotides position 1353-1373 in the senna α-galactosidase cDNA (Figure 4).

These PCR fragment were mixed with the fragment SEGAL, and the linked sequence was amplified by using the flanking primers B254 and B255.

The PCR conditions were: For 5'SEGAL, 1 min at 94°C, 2 min at 57°C, 2 min at 72°C for 35 cycles followed by 10 min at 72°C. For 3'SEGAL, 1 min at 94°C, 2 min at 48° C, 2 min at 72 °C for 35 cycles followed by 10 min at 72 °C. For the last PCR to link the three fragments, 1 min at 94°C, 2 min at 58°C, 2 min at 72°C for 35 cycles followed by 10 min at 72 °C.

The PCR product of the last PCR was analysed by agarose gel electrophoresis, and a single product of 1380 bp was obtained.

The DNA product was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).

The DNA fragment was isolated by digestion with BamHI and Sphl and cloned into the expression vector pPS48, resulting in pPS48SEGAL (Figure 6). A plant transformation vector comprising the expression cassette for senna α- galactosidase was constructed as follows.

The vector pBKL4 (Figure 7) was constructed from pBI121 (Clontec Laboratories) by deletion of the NPTII cassette and by insertion of a synthetic oligonucieotide linker (EcoRl-Clal-Sall-Hind l-Spel-Kpn-BamHl) and a new NPTII cassette containing the NPTII gene flanked by a CaMV 35S RNA promoter (Odell et al. Na re 313 (1985) 810-812) and a polyadenylation sequence from the octopine synthase gene (Caplan et al. Science 222 (1983) 815-821) between the GUS cassette and the left border.

The senna α-galactosidase expression cassette was excised from pPS48SEGAL and inserted into pBKL4.

The resulting plasmid pBKL4SEGAL (Figure 8) was transformed into Agrobacterium tumefaciens strain LBA4404 (Hockema et al. Namre 303 (1983) 179-180) for plant transformation.

Transformation of guar with senna α-galactosidase

The α-galactosidase gene from senna was transformed into guar using Agrobacterium tumefaciens transformation, as described in detail by Jόrsboe and Okkels (1994) - the contents of which are incorporated herein by reference.

Analysis of the mannose-to-galactose ratio of endosperms from guar plants transformed with the senna α-galactosidase gene.

Pure endosperms of guar plants transformed with the senna α-galactosidase gene were analysed by HPLC after hydrolysis in 2 N trifluor acetic acid (see above for details).

The results, which are shown in the following Table, are derived from the analysis of endosperms from 4 independent guar transformants harbouring the senna α- galactosidase gene. The results are given as % increases of the mannose-to-galactose ratios relative to un- transformed control endosperms.

Construction of a plant transformation vector containing the coffee bean α- galactosidase.

An expression vector comprising the coding sequence for coffee bean α-galactosidase was constructed as follows.

The vector pPS48 (Figure 5) was constructed by inserting the 0.75 kb cauliflower mosaic virus (CaMV) 35S RNA promoter (E35S) containing a duplication of the -90 to -420 region (Kay et al. Science 236 (1987) 1299-1302), the 0.21 kb fragment containing the CaMV 35S RNA polyadenylation sequence (Odell et al. Namre 313 (1985) 810-812) and a synthetic oligonucleotide linker (Pstl-BamHl-Smal-Sac\-Sal - Sphl) into pUC8 (Vieira and Messing, Gene 19 (1982) 259-268).

A DNA fragment containing the coffee bean α-galactosidase coding sequence was isolated from the plasmid pCR-BZ (Zhu and Goldstein Gene 140 (1994) 227-231) by polymerase chain reaction (PCR) employing an upstream primer:

5'-TTGGATCCACCCAAAA-GCTGGTGCTCC

(position 15-35 in the coffee bean α-galactosidase cDNA sequence) and a downstream primer:

5 ' -TTAGC ATGCCTGTTAATC ACTGTGGG

(position 1229-12446 in the coffee bean α-galactosidase cDNA sequence) resulting in a 1 ,2 kb DNA fragment containing a BamHI site in the 5' end of the α- galactosidase gene and a Sphl site in the 3' end.

The DNA fragment was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).

The DNA fragment was isolated by digestion with BamHI and Sphl and cloned into the vector pPS48, resulting in pPS48-GALIII (Figure 9).

A plant transformation vector comprising the expression cassette for coffee bean α- galactosidase was constructed as follows.

The vector pBKL4 (Figure 7) was constructed from pBI121 (Clontec Laboratories) by deletion of the NPΗI cassette and by insertion of a synthetic oligonucleotide linker (EcoRl-Clal-Sall-Hindll-Spel-Kpn-BamHΪ) and a new NPTII cassette containing the NPTII gene flanked by a CaMV 35S RNA promoter (Odell et al. Namre 313 (1985) 810-812) and a polyadenylation sequence from the octopine synthase gene (Caplan et al. Science 222 (1983) 815-821) between the GUS cassette and the left border.

The coffee bean α-galactosidase expression cassette was excised from pPS48-GALIII by digestion with Xbάl and inserted into Spel digested pBKLA.

The resulting plasmid pBKL4-GALIII (Figure 10) was transformed into Agrobacterium tumefaciens strain LBA4404 (Hockema et al. Namre 303 (1983) 179- 180) for plant transformation. Transformation of guar with coffee bean α-galactosidase

The α-galactosidase gene from coffee bean was transformed into guar using Agrobacterium tumefaciens transformation, as described in detail by Jόrsboe and Okkels (1994).

Analysis of the mannose-to-galactose ratio of endosperms from guar plants transformed with the coffee bean α-galactosidase gene.

Pure endosperms of guar plants transformed with the coffee bean α-galactosidase gene were analysed by HPLC after hydrolysis in 2 N trifluor acetic acid (see above for details). The results, which are shown in the following Table, are derived from me analysis of endosperms from 4 independent guar transformants harbouring the coffee bean α-galactosidase gene. The results are given as % increases of the mannose-to- galactose ratios relative to un-transformed control endosperms.

Discussion of in vivo modification of guar gum

In the two examples presented above, it is shown that the insertion of an α- galactosidase gene into guar can result in the in vivo modification of guar gum as evidenced by the fact that the mannose-to-galactose ratios of the transgenic galac¬ tomannans were higher than the non-transgenic control galactomannans. In addition to the example with an phosphomannose isomerase gene (see above), these are the first data ever presented on the in vivo modification of a plant cell wall storage polysaccharide.

SUMMATION

The results show that it is possible to form transgenic plants that are capable of forming guar gum such that the mannose-to-galactose ratio is affected.

In this regard, the PMI transformed lines, the coffee bean α-galactosidase transformed lines, and the senna α-gaiactosidase transformed lines yielded a higher ratio of mannose to galactose than the non-transformed lines. For example, the coffee bean α-galactosidase transformants had a ratio of mannose to galactose of up to 1.75 - compared to 1.65 for the non-transformed lines - and that some of the senna α- galactosidase transformants had a ratio of mannose to galactose of even up to 2. These results are highly surprising.

As will be apparent to those skilled in the art, the extent to which the in vivo modification occurs depend on the activity of the gaiactomannan related enzymes encoded by the genes transformed into guar. Thus, substimtion or modification of the promoters or other regulatory nucleotide or amino acid sequences may lead to in vivo modifications of galactomannans different from those described in the above examples.

Other modifications of the present invention will be apparent to those skilled in the art. As mentioned above, Figure 1 presents bom a nucleotide sequence coding for a PMI enzyme and the amino acid sequence of that PMI enzyme. For the avoidance of doubt, that nucleotide sequence can be referred to as SEQ ID No. 1 and that amino acid sequence can be referred to as SEQ ID No. 2.

As mentioned above, Figure 4 presents both a nucleotide sequence coding for an α- galactosidase enzyme and the amino acid sequence of that α-galactosidase enzyme. For the avoidance of doubt, that nucleotide sequence can be referred to as SEQ ID No. 3 and that amino acid sequence can be referred to as SEQ ID No. 4.

REFERENCES

Bojsen et al (1993) PCT patent application WO 94/20627

Bulpin P V, Gidley M J, Jeffcoat R, Underwood D R. Development of a biotechnological process for the modification of gaiactomannan polymers with plant α-galactosidase. Carbohydr. Polymers 1990, 12: 155.

Coulin F, Magnenat E, Proutfood A E I, Payton M A and Wells T N C (1993). Biochemistry 32 14139-14144

Darzins et al 1985. J Bacteriol \ l 249-257

Dellaporta S L, Wood J and Hicks J B (1983). A plant DNA minipreparation: Version II. Plant Molecular Biology Reporter 1 No 4, 19-21.

Edwards M, Bulpin P V, Dea I C M, Reid J S G. Biosynthesis of legume-seed gaiactomannan in vitro. Planta. 1989, 178:41.

Feinberg A P and Vogelstein B (1983). A technique for radio-labelling DNA restriction endonuclease fragments to high specific activity. Analytical Biochemistry 132. 6-13.

Gill et al (1986) J Bacteriol 167, 611-615

Hanahan D (1985). Techniques for Transformation of E coli. In: Glover D M (ed) DNA cioning vol I - a practical approach. IRL Press, Oxford, pp 109-135. ISBN: 0-947946-18-7.

Jόrsboe M and Okkles F T (1994) Transformation of guar. PCT patent application PCT/DK95/00221. McCleary B V, Critchley P, Bulpin B V. Processing of polysaccharides. European patent application, 1983, 0 121 960.

Maniatis T, Fritsch E F, Sambrook J (1982). Molecular cloning a laboratory manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, New York. ISBN: 0-87969- 136-0.

Mills and Guest. 1984. Gene 32 41-48.

Overbeeke N, Fellinger A J, Hughes S G. Production of guar alpha-galactosidase by hosts transformed by recombinant DNA methods. European patent application, 1986, 0 255 153.

Reid J S G, Edwards M E. Galactomannans and other cell wall storage polysaccharides in seeds. In: food polysaccharides and their application. Ed: A M Stephen, Marcel Dekker, 1995, pp 155-186.

Sanger F, Micklen S and Coulson A R (1977). Proc. Natl. Acad. Sci. USA 74 5463- 5467.

48

IND ICATIO NS RELATIN C TO A D EPOS ITED MICR O O RGANISM

(PCT Rule I2bis)

A. The indications made below relate to the microorganism referred ιo in ibe description on page Α% , lincS I *j

B . IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional she;: i 1

Name ot depositary insiirution

The National Collections of Industrial and Marine Bacteria Limited (NCIKB)

Address at depositary institution (inctuding ostal code and country)

23 St . Machar Drive

Aberdeen

Scotland

AB2 1RΪ

United Kingdom

Date of deposit Accession Number

C. ADDITIONAL INDICATIONS (leave blank if not appticcΛlc) This information is continued on an additional sheet I ]

In respect of those designations in which a European patent is sought, and any other designated state having equivalent legislation, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or vitiidrawn or is deemed to be withdrawn, only by the issue of such a sarnole to an expert nominated by the person requesting the sample. (Rule 28(4) EPC) .

D. D ESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (f ύe iniicaύons are not for all έaipvitcd Stat s)

E- SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)

Tne indications listed beiowwiil besuomitted to the International Bureau later (specify ύtcfencrat nature o/ _A_:_ι_ιc_ne__ __$., 'Accession Number of Deposit')

IND ICATIO NS RELATING TO A D EP OSITED MICRO OR GANISM

(PCT Ru le \2bis)

A. Tne indications made beiow relate to the microorganism referred Ό in ibe oescπotion on page -*~-Q , line_J I ^{* *}"~ __*■ I

C. IDENTIFICATION OF DEPOSIT Fui -her ceccsiu are .ctr.nf.ϊc on an additional she; D

Name oi αeposuary institution

The National Collections of Industrial and Marine Bacter-.a Limited ( .VCIMB )

Addreis of deposiury institution (inctudmς postal coae and country)

23 Sc. Machar Drive

Aberdeen

Scotland

AB2 1RY

United Kmedon

Date of deoosu Accession Numoer

U Ctnvg <4-o? 3 l

C. ADDITIONAL INOICATIONS (leave blank if not applicabl ) Tnis information is continued on an additional sheel [^"""]

In respect of tnose designations in which a European patent is sought, and any other designated state having equivalent legislation, a sampie of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which tne application has been refused or vithdrawπ or is deemed to be withdrawn, only by the issue of such a sasrole to an expert nominated by the person requesting the sample. (Rule 28(4) EPC).

D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MAΩZ (f lli- iniicauons arc not for allies, ς icd Slates)

E. SEPARATE FURNISHING OF IND ICATIONS (leave blank if not apoiicablc)

The inαications Itsied oelowwiil oesuomitte io e International Bureau later {specify uic rcnerai nature ol tne tnaxccttoni eg., 'Accession Numoer of Deposit "J

For International Bureau use only

1 j This sheet was received by the Internationa! Bureau on:

Authorized officer

FO BOX 17, 50

IK 1C01 Cσpennagen K, RECEIPT IN THE CASE OF AN ORICINΛL DEPOSIT

Denmark. Issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY Identified at the bottom of th s pa e

Where Rule ..4(d) appl_its. such date is the date on which the status of International d^βoositary authority was acquired

Form BP/4 (sole page) BUDAPEST TREATY ON THE INTERNATIONAL

RECOGNITION OF THE DEPOSIT 0? MICROORGANISMS

FOR THE PURPOSES OF PA EN PROCEDURE

Danisco Biotechnology, RM

-angebrogade 1, ^~1 INTERNATIONAL FO

?0 Box 17,

DK 1001 Copenhagen K,

Denmark.

VIABILITY STATEMENT issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORITY identified on the following page

NAME AND ADDRESS OF THE PARTY

TO WHOM THE VIABILITY STATEMENT

IS ISSUED

DEPOSITOR II. IDENTIFICATION OF THE MICROORGANISM

Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY:

AS ABOVE

Address: NCIMB 40774 Date of the deposit or of the transfer:

9 November 1995

XII. VIABILITY STATEMENT

The viability of the microorganism identified under II above was tested on 10 Novemoer 1995 ² On that date, the said microorganism was

!^x I viable

no longer viable

Indicate tne date of the original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit αr date of the trans er₎.

In the cases referred to in Rule 10.2(a) (ii) and (iii) , refer to the most recen_t viability test.

Mari with a cross the applicable box.

Form 3P/9 (first page) XV. CONDITIONS UNDER WHICH THE VIABILtT TEST HAS BEEN PERTORMED

INTERNATIONAL DEPOSITARY AUTHORITY

HCIMB to

Address:

rill In l∑ the information has been requested and if the results of the test were negative.

Form BP/9 ( second and las t page )

Claims

1. An in vivo modification process that affects the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof.

2. An in vivo modification process that affects the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, the in vivo modification process comprising expressing a nucleotide sequence coding for a gene product, which gene product has an effect on:

(b) the mannose-to-galactose ratio of mannose and galactose precursors for a mannose/galactose containing compound; and wherein the nucleotide sequence is not a natural nucleotide sequence to the organism (or part thereof).

3. An in vivo modification process that affects the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, the in vivo modification process comprising allowing a gene product that is capable of having an effect on:

(b) the mannose-to-galactose ratio of mannose and galactose precursors for a mannose/galactose containing compound; to have an effect on:

(b) the mannose-to-galactose ratio of mannose and galactose precursors for a mannose/galactose containing compound; and wherein the gene product has not been expressed by a nucleotide sequence that is a natural nucleotide sequence to the organism (or part thereof).

4. Use of a nucleotide sequence to affect in vivo the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, wherein the nucleotide sequence encodes a gene product which has an effect on:

(a) the mannose-to-galactose ratio of mannose and galactose components of a mannose/galactose containing compound; and/or (b) the mannose-to-galactose ratio of mannose and galactose precursors for a mannose/galactose containing compound; and wherein the nucleotide sequence is not a natural nucleotide sequence to the organism (or part thereof).

5. Use of a gene product to affect in vivo the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or a mannose/galactose containing compound thereof, wherein the gene product has an effect on:

(a) the mannose-to-galactose ratio of mannose and galactose components of a mannose/galactose containing compound; and/or (b) the mannose-to-galactose ratio of mannose and galactose precursors for a mannose/galactose containing compound; and wherein the gene product is not expressed by a nucleotide sequence that is a natural nucleotide sequence to the organism (or part thereof).

6. The invention according to any one of claims 1 to 5 wherein the mannose/galactose containing compound is galactomannan.

7. The invention according to any one of claims 1 to 6 wherein the organism capable of producing a mannose/galactose containing compound is a guar plant.

8. The invention according to any one of claims 1 to 6 wherein the in vivo mannose-to-galactose ratio of the organism (or part thereof) or mannose/galactose containing compound thereof is higher than that of the guar plant or the galactomannan thereof.

9. The invention according to any one of claims 1 to 8 wherein the in vivo mannose-to-galactose ratio of the organism (or part thereof) or mannose/galactose containing compound thereof is substantially similar to that of the locust bean or the galactomannan thereof.

10. The invention according to any one of claims 2 to 9 wherein the gene product is at least one gene product useful in the biosynthesis of GDP-mannose.

11. The invention according to claim 10 wherein the gene product is the protein shown in Figure 1 or is a variant, homologue or derivative thereof.

12. The invention according to claim 10 or claim 11 wherein the gene product is coded by the nucleotide sequence shown in Figure 1 or is a variant, homologue or derivative thereof and/or is obtainable from NCIMB 40774.

13. The invention according to any one of claims 2 to 9 wherein the gene product is an α-galactosidase enzyme.

14. The invention according to claim 13 wherein the gene product is the protein shown in Figure 4 or is a variant, homologue or derivative thereof.

15. The invention according to claim 13 or claim 14 wherein the gene product is coded by the nucleotide sequence shown in Figure 4 or is a variant, homologue or derivative thereof and/or is obtainable from NCIMB 40831.

16. An enzyme comprising the amino acid sequence shown in Figure 1 , or a variant, homologue or fragment thereof.

17. A nucleotide sequence coding for the enzyme of claim 16 or a sequence that is complementary thereto and/or is obtainable from NCIMB 40774.

18. A nucleotide sequence according to claim 17 wherein the nucleotide sequence is a DNA sequence.

19. A nucleotide sequence comprising the sequence shown in Figure 1 , or a variant, homologue or fragment thereof or a sequence that is complementary thereto and/or is obtainable from NCIMB 40774.

20. A construct comprising or expressing the invention according to any one of claims 16 to 19.

21. A vector comprising or expressing the invention of any one of claims 16 to 20.

22. A plasmid comprising or expressing the invention of any one of claims 16 to 21.

23. A transgenic organism (or part thereof) comprising or expressing the invention according to any one of claims 16 to 22.

24. A transgenic organism (or part thereof) according to claim 23 wherein the organism is a guar plant.

25. The invention according to claim 10 wherein the gene product is expressed by or is the invention according to any one of claims 16 to 24.

26. An enzyme comprising the amino acid sequence shown in Figure 4, or a variant, homologue or fragment thereof.

27. A nucleotide sequence coding for the enzyme of claim 26 or a sequence that is complementary thereto and/or is obtainable from NCIMB 40831.

28. A nucleotide sequence according to claim 27 wherein the nucleotide sequence is a DNA sequence.

29. A nucleotide sequence comprising the sequence shown in Figure 4, or a variant, homologue or fragment thereof or a sequence that is complementary thereto and/or is obtainable from NCIMB 40831.

30. A construct comprising or expressing the invention according to any one of claims 26 to 29.

31. A vector comprising or expressing the invention of any one of claims 26 to 30.

32. A plasmid comprising or expressing the invention of any one of claims 26 to 31.

33. A transgenic organism (or part thereof) comprising or expressing the invention according to any one of claims 26 to 32.

34. A transgenic organism (or part thereof) according to claim 33 wherein the organism is a guar plant.

35. The invention according to claim 9 wherein the gene product is expressed by or is the invention according to any one of claims 26 to 34.

36. A mannose/galactose containing compound when prepared by the process of any one of claims 1 to 3 or any claim dependent thereon.

37. A foodstuff comprising a mannose/galactose containing compound according to claim 36.

38. A composition comprising a mannose/galactose containing compound according to claim 36 admixed with another polysaccharide.

39. A composition comprising a mannose/galactose containing compound according to claim 36 admixed with any one or more of xanthan, carrageenan and agarose.

40. A method for preparing a composition or a foodstuff comprising mixing the mannose/galactose containing compound according to claim 36 with another suitable ingredient.

41. A process substantially as described herein.

42. A nucleotide sequence substantially as described herein and with reference to Figure 1.

43. An enzyme substantially as described herein and with reference to Figure 1.

44. A nucleotide sequence substantially as described herein and with reference to Figure 4.

45. An enzyme substantially as described herein and with reference to Figure 4.