EP0862654A1 - Microorganism quantitation and detection method and kit - Google Patents

Microorganism quantitation and detection method and kit

Info

Publication number
EP0862654A1
EP0862654A1 EP96937396A EP96937396A EP0862654A1 EP 0862654 A1 EP0862654 A1 EP 0862654A1 EP 96937396 A EP96937396 A EP 96937396A EP 96937396 A EP96937396 A EP 96937396A EP 0862654 A1 EP0862654 A1 EP 0862654A1
Authority
EP
European Patent Office
Prior art keywords
rna
dna
microorganism
standard
target
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96937396A
Other languages
German (de)
French (fr)
Inventor
Jean-Marie Andrieu
Wei Lu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Microdiag
Original Assignee
Microdiag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Microdiag filed Critical Microdiag
Publication of EP0862654A1 publication Critical patent/EP0862654A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • the present invention relates to the quantification and detection of microorganisms. It relates more particularly to the quantitative assay and / or the detection of microorganisms carrying a DNA or RNA genome.
  • the invention applies to all known microorganisms, such as viruses, bacteria, bacilli, protozoa, hematozoa, carriers of a DNA or RNA genome, affecting humans, animals or plants, as well as microorganisms as they exist in humans, animals and plants, in a pathological or normal state; it also applies to the quantification and detection of these same microorganisms in products obtained from animals, including humans, and plants, as well as those likely to exist in water.
  • the method according to the invention is described below for the quantification of infection with the human immunodeficiency RNA virus (HIV) and of infection with the human DNA hepatitis B virus (HBV).
  • HIV human immunodeficiency RNA virus
  • HBV human DNA hepatitis B virus
  • PCR polymerase chain reaction
  • an enzyme the polymerase, it is thus possible to amplify a DNA genome fragment.
  • a retrotranscription (or reverse transcription) of RNA into DNA and an amplification by means of the reverse transcriptase + polymerase couple or an enzyme carrying out the two operations.
  • this piece of genome or amplificate is specifically identified by different methods (radioactive or colored probe, size of the fragment).
  • PCR quantification methods for HIV are for example described by Holodniy M. et al., In J. Infect. Say. 163, 862-866 (1991); Aoki-Sei S. et al., In J. AIDS Res. Hmm. Retrovirus 8, 1263-1270 (1992) Bagnarelli P. et al., In J. Virol. 66, 7328-7335 (1992) Piatak Jr. M. et al., In Science 259, 1749-1755 (1993) Bruisten S.M. et al., In AIDS 7 (suppl. 2), S15-S20 (1993).
  • Hepatitis B virus DNA quantification methods have been described for example by Lehtovaara P. et al., In PCR Methods Appl. 3 (3), 169-75 (1993); Wu J. et al., In J. Virol. Methods 49 (3), 331-41 (1994); Zaaijer HL et al., In J. Clin. Microbiol. 32 (9), 2088- 91- (1994); Kaneko S. et al., In J. Clin. Microbiol. 27 (9), 1930-33 (1989).
  • the relationship between the amplified product and the initial DNA or RNA is really not really constant from one experiment to another, hence the need to be concerned with the problem of measuring a standard. the concentrations of which are known elsewhere.
  • the amplification capacities of the ACP have so far been able to be assessed using cells with the genome to be assayed only in a constant number of copies or with plasmids each comprising a single piece of gene. It has thus been established that even a single gene fragment can, thanks to PCR, be specifically identified. It has also been established that there is a proportionality relationship between DNA concentrations of a plasmid subjected to amplification and the DNA concentrations measured after amplification. However, this proportionality ratio was found to change from one experiment to the next, since PCR amplification is a biological process, resulting from the action of the polymerase, which is not controlled as completely as it would be a purely physical technique.
  • the standard consists of a series of concentrations (three to five in general) of a standard plasmid whose DNA fragment to be amplified has the same primers and is according to technologies with a partially different sequence or identical sequence.
  • the problem is even more complex if one seeks to quantify or identify RNA viruses, such as for example that of AIDS (HIV).
  • the step of amplification by PCR must, for RNA viruses, be associated with a step of retrotranscription often carried out either thanks to another enzyme, the reverse transcriptase or reverse transcriptase (in abbreviation TR), or thanks to an enzyme with both actions (reverse transcription and DNA amplification).
  • the enzymes currently available on the market make it possible to obtain retrotranscription ratios which can vary from one experiment to another by 10: 1 (that is to say that 10 copies of RNA gives 1 copy of DNA) at 100: 1 (100 copies of RNA gives 1 copy of DNA).
  • the resulting problem namely the non-comparability of the results of successive experiments, has so far been resolved by simultaneously incubating a range of concentrations of a standard RNA fragment (standard transcript) using the same primers, but the amplified part of which is either identical if used as an external standard, or different, in sequence or in length, if used in co-amplification, the transcript then being incubated in the same tube as the RNA of the target micro ⁇ organism to be assayed.
  • concentrations of amplifiers icats originating from the same concentrations of two transcripts may be different and similarly different from those originating from RNA originating from identical concentrations of virus.
  • a standard is required, which can be either internal or external;
  • an external standard composed either of a plasmid for a microorganism with DNA, or of a RNA transcribed for a microorganism with RNA, allows only a relative quantification, because the amplification ratio is not necessarily identical to that of the DNA or RNA of the complete microorganism;
  • a co-amplified internal standard also involves different lengths or sequences of the plasmid or transcript and has the same drawbacks as an external standard using a plasmid or a transcript.
  • the amplification of the DNA of a plasmid is not really proportional to that undergone by the viral DNA.
  • the standard currently used for RNA viruses it is a transcript, which has the same drawbacks as a plasmid and adds the possibility of degradation of free RNA.
  • step (2) may consist essentially of a comparative revelation based on the comparison of the concentrations of the standard with the concentrations of the target microorganism as preferably detected by means of the so-called method of plugged-in DNA or any other method of disclosure that does not amplify the DNA or RNA of the standard or target microorganism.
  • the method according to the invention advantageously comprises the steps according to which:
  • any quantity of the microorganism to be assayed is sampled and purified, from human, animal or plant samples, or from cell cultures, the quantity of microorganism being advantageously sufficient for the target DNA or RNA concentrations to be measurable by direct methods;
  • the number of nucleotide bases of the microorganism concerned is also used, this number being known, for example from databases, or determinable by conventional methods; 4) the total molecular mass of the DNA or RNA of said microorganism is calculated from this number of nucleotide bases, taking into account the average molecular mass of a nucleotide, which is also known (approximately 330 daltons); 5) the quantity of DNA or RNA carried by each microorganism is thus calculated, using the Avogadro number (that is 6.02 x 10 23 );
  • a range of concentrations of standard microorganism obtained from successive dilutions of the microorganism previously calibrated according to its DNA or RNA concentrations is prepared and / or used to form an external standard, of which we thus know for each dilution (a) the concentration of DNA or RNA and (b) the concentration of microorganisms; 7) the DNA or RNA of the standard and target microorganisms are extracted and the extracts are subjected in parallel to a revelation by means of the so-called branched DNA method or any other method of revelation which does not amplify not the DNA or RNA of the standard or target microorganism and / or to a transcription and / or to at least one amplification and the values obtained are recorded; and 8) the DNA or RNA concentrations of the standard and target microorganisms or the amplification products of the target microorganisms are compared with those of the external standard, so as to deduce the concentration values thereof.
  • the method according to the present invention can optionally comprise the addition of an internal control, preferably in the form of a heterologous plasmid DNA or of a heterologous transcript RNA, and of which the sequence and the primers have no relation to the target DNAs or RNAs.
  • Said internal control is advantageously added to each of the samples to be examined and serves as internal control (hereinafter abbreviated as "CI"), that is to say for controlling the amplification efficiency or the efficiency amplification related to reverse transcription (hereinafter "TR").
  • the preparation according to the invention can be replaced by the preparation of known concentrations of microorganism by the preparation of known concentrations:
  • preparations and storage are prepared until they are made available to the user of preparations of known calibrated concentrations of the complete microorganism with DNA or RNA of the type to be quantified or to detect, or preparations of DNA or RNA concentrations of the genome of said microorganism corresponding to known concentrations of this microorganism.
  • the subject of the invention is also a kit or set of means for the quantification and detection of DNA or RNA microorganisms, essentially comprising, in appropriate containers and / or in the form of suitable devices: - a series of known calibrated concentrations of the complete DNA or RNA microorganism of the type to be quantified or detected, or of con c t ra ti ons of DNA or RNA corresponding to concentrations known to said microorganism,
  • - means of extraction, revelation and / or backtranscription and / or amplification, in particular by PCR, TR-ACP or NASBA of the DNA or RNA of the target and standard microorganism, - means for the analysis of DNA or RNA of the target and standard microorganism or of revelation or amplification products.
  • Said kit or set of means can also optionally comprise an internal control, for example in the form of approximately 10 3 copies / ⁇ l of a heterologous plasmid DNA or of heterologous transcript RNA, as a control for the amplification efficiency or the amplification efficiency linked to RT.
  • an internal control for example in the form of approximately 10 3 copies / ⁇ l of a heterologous plasmid DNA or of heterologous transcript RNA, as a control for the amplification efficiency or the amplification efficiency linked to RT.
  • the means of analysis of the ACP or TR-ACP products can consist of means external to the kit and intended to be used in combination with the latter. These means may, for example, include devices and / or products for determination by electrophoresis, by colorimetry, by radiometry or by any other suitable analytical means.
  • the above method and means provide in an original way an absolute quantification of DNA or RNA microorganisms, since the target microorganism or its genome to be assayed is identical to the standard microorganism or its genome processed in parallel.
  • this method and these means have been found to provide a universal technique of quantification and identification, since they allow the quantification of all microorganisms.
  • the method and the means according to the invention can be used for detection of the minimum quantity of microorganism measurable with current methods of reverse transcription and / or amplification of micro ⁇ organisms with RNA or DNA.
  • the minimum measurable quantity is of the order of one to five micro ⁇ organisms for DNA microorganisms, while it is of the order of 10 to 100 microorganisms for RNA microorganisms .
  • Fig. 1 graphically represents the variation in detection sensitivity and in the amplification efficiency of different PCR experiments carried out with several different concentrations of standard DNA of the same virus;
  • Fig. 2 graphically represents the variation in detection sensitivity and in the amplification efficiency of different TR-ACP experiments carried out with several concentrations of RNA of the same virus
  • Fig. 3 graphically represents the variation in the amplification efficiency in PCR experiments carried out with several concentrations of DNA originating from virus preparations originating from different patients, within the same experiment
  • Fig. 4 graphically represents the variation in the amplification efficiency in PCR experiments carried out respectively with several concentrations of DNA obtained from several preparations of the same virus and with several concentrations of DNA originating from two different plasmids
  • Fig. 5 graphically represents the variation in the amplification efficiency in TR-ACP experiments carried out with several concentrations of RNA from virus preparations from different patients
  • Fig. 6 graphically represents the variation in the amplification efficiency in TR-ACP experiments carried out respectively with several concentrations of RNA originating from virus preparations originating from different patients and with two RNAs from different transcripts.
  • the HIV RNA from a culture was concentrated, purified and extracted so as to obtain 300 ng; Knowing that the total number of HIV nucleotides is 19,000 and that the molecular mass of a nucleotide is 330 daltons, it has been deduced therefrom that the global molecular mass of an HIV RNA is 6,300,000 daltons. We then obtained, by a calculation using the Avogadro number, the exact number of viral genomes and therefore of viruses from which emanates the quantity of 300 ng of RNA, or approximately 3x10-0 virus. Knowing the concentration of virus in an aliquot part of the purified viral preparation, one can then prepare a standard range of this virus and use it in the process according to the present invention.
  • the method according to the invention allows reliable identification and / or absolute quantification, since the target microorganism (to be assayed) is identical to the standard microorganism.
  • the method that this method implements is also universal, because it allows the quantification of all microorganisms, the quantity of which can be measured in parallel.
  • This method and the kit for its implementation can be used not only for the quantification of microorganisms in any medium or specimen, but also for the detection of the minimum quantity of microorganism measurable with current methods of reverse transcription and / or amplification of RNA or DNA microorganisms.
  • the minimum measurable quantity is of the order of 1 to 5 microorganisms, while it is approximately 10 to 100 microorganisms for those with RNA.
  • the present invention brings decisive progress to the means and methods for quantitative assay of microorganisms in vitro by providing a simple and effective means and technique for standardizing assays.
  • the invention is described in more detail in the examples below, which do not limit it in any way and in which the proportions and percentages are by weight / weight, unless otherwise indicated.
  • Example 1 Demonstration of the interest of a universal standard for the detection and quantification of target DNA by PCR (in English PCR).
  • HBV DNA virion was purified by centrifugation (overnight at 25,000 rpm and 4 ° C in a Spmco 25 centrifuge) through a 30% (w / v) bed of sucrose in TEBM medium (0.01 M Tris-HCl, pH 7.6, 0.001 M NaEDTA, 1% bovine serum albumin and 0.3% 2-mercapto-ethanol). The purity of the fractionated HBV virions was monitored by electron microscopy. The DNA associated with the virions was extracted using a commercial DNA purification kit.
  • the viral DNA obtained was quantified by spectrophotometry.
  • the number of copies of viral DNA was calculated using the molecular weight of the viral genome of . HBV DNA.
  • the number of virions can also be quantified by electron microscopy.
  • Serial dilutions (10, 100, 1000, 10,000 copies) of HBV DNA were subjected to a succession of identical PCR cycles (94 ° C for 60 s, 56 ° C for 60 s and 72 ° C for 90 s), with 100 pmol of HBV primer pairs specific for the C gene: (GCTTTGGGGCATGGACATTGCC / GACTACTAGATCCCTGGATGCTGG).
  • the specific PCR products were analyzed by dot-blot hybridization with a probe labeled at the end with ⁇ - 3 2 P (TCAGCTCTGTATCGAGAAGCC) and the counts per minute (cpm) of each PCR signal were noted by through a beta radiation counter.
  • Example 2 Demonstration of the interest of a universal standard for the detection and quantification of target RNA by TR-ACP (in English RT-PCR).
  • HIV-1 RNA virion was purified by passing the culture supernatant from blasts of mononuclear blood cells infected with a primary isolate over a sepharose column. The purity of the fractionated HIV-1 virions was monitored by electron microscopy. RNA associated with virions was extracted using a commercial RNA isolation kit. The viral RNA obtained was quantified by spectrophotometry. The number of copies of viral RNA was calculated using the molecular mass of the viral genome of HIV-1 RNA.
  • RNA sample After addition of 1 microgram of tRNA, serial dilutions (1,000,000, 100,000, 10,000, 1,000 copies) of the RNA sample were pelletized and resuspended in 10 ⁇ l. An aliquot of 10 ⁇ l of RNA and 1 ⁇ g of reference tRNA (free of HIV) was immediately added to each of the reaction mixtures (90 ⁇ l) of TR-ACP containing 10 units of reverse transcriptase from murine leukemia virus of Moloney recombinant and 3 units of DNA polymerase ampliTaq for the amplification of the HIV gag gene.
  • the TR-ACP was carried out for 25 minutes at 42 ° C, then for 5 min at 94 ° C and then over 40 cycles (94 ° C for 60 s, 56 ° C for 60 s and 72 ° C for 90 s) PCR using 100 pmol of each of the HIV primer pairs specific for the gag gene (GGAACATCAAGCAGCCATGC / TCCTTTGGTCCTTGTCTTATGTC).
  • the specific PCR products were analyzed by dot-blot hybridization with a probe labeled at the end with ⁇ - 3 2 P (ATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTAC) and the counts per minute (cpm) of each PCR signal were taken by through a beta radiation counter.
  • Example 3 Validation of a virion DNA standard. This example illustrates the identity of the efficiency of amplification by identical PCR cycles of native HBV virion DNA from sera from different patients infected with HBV. Serial dilutions of samples of different HBV virion DNAs prepared as shown in Example 1 were subjected to the same number of PCR cycles in the same experiment. The product of ACP (output) was quantified by dot blot and counting of cpm.
  • Example 4 Validation of a virion DNA standard. By proceeding as indicated in Example 3, but each time using in the same PCR cycles a native virion DNA and DNAs originating from two HBV plasmids (input), it was possible to establish the compared efficiencies of amplification by PCR (see Figure 4). DNA fragments of the HBV gene C sequence were produced by PCR from HBVsAg + sera and ligated into plasmids pGEM-3Z (Promega) and pCT®
  • results reported in graphical form in FIG. 4 show that a known number of copies may or may not have an amplification efficiency comparable to that of an identical number of copies of native viral DNA from several samples. It thus emerges from Examples 3 and 4 that known concentrations of HBV virion DNA from different origins constitute an ideal universal standard, whereas fragments of viral DNA integrated into different plasmids have different behaviors between them and different from DNAs natives.
  • Example 5 Validation of a virion RNA standard.
  • This example illustrates the identity of the efficiency of amplification by identical TR-ACP cycles of native HIV virion RNA from sera from different patients infected with HIV.
  • Serial dilutions of samples of different HIV virion RNAs prepared as shown in Example 2 were subjected to a TR-ACP cycle in the same experiment.
  • the product of ACP (output) was quantified by dot blot and counting of cpm.
  • the results reported in graphical form in FIG. 5 show that the amplification efficiency by TR-ACP is identical whatever the source of the HIV virion.
  • Example 6 Validation of a virion RNA standard.
  • HIV-1 gag sequence RNA fragments were produced by transcription of HIV-1 DNA templates (plasmid pBR322 of HIV-Z6 DNA and plasmid ⁇ BHlO-R3 of HIV ⁇ IB DNA) with T7 RNA polymerase (HIV RNA1 and RNA2 transcribed respectively).
  • EXAMPLE 7 Kit for Quantifying the Genome of the Human Immunodeficiency Virus (HIV) for Detection by Visualization
  • a kit for quantifying the genome of the human immunodeficiency virus (HIV) according to the present invention was designed for the detection and quantification of HIV genomic RNA (including all the genotypes HIV-0, HIV-1 and HIV -2) in all biological fluids free from cells (such as plasma, serum, seminal fluid, bronchoalveolar lavage fluid, etc.), as well as culture supernatants.
  • HIV genomic RNA including all the genotypes HIV-0, HIV-1 and HIV -2
  • biological fluids free from cells such as plasma, serum, seminal fluid, bronchoalveolar lavage fluid, etc.
  • Reagents have been included to allow viral RNA to be isolated by a rapid method - reverse transcription of RNA from HIV virion into cDNA by means of reverse transcriptase from the cloned Moloney murine leukemia virus - the amplification then using Taq DNA polymerase - and finally quantitative detection by a simple visualization procedure on agarose gel, which allowed a detection limit of 1000 copies of viral RNA and a quantification range of more than 4 orders of magnitude in a single test in 8 hours. Sufficient reagents were provided for 100 reactions (40 ⁇ l each) in a protocol with a final volume of 50 ⁇ l.
  • the kit contained a set of HIV virion standards (hereinafter "VirionStandard”) as explained above (IO 4 , IO 3 , IO 2 and 10 copies / ⁇ l, supplied for 4 series of tests), which allowed a measurement precise concentration of HIV virion RNA in plasma / serum.
  • the kit also contained a plasmid HIV DNA (IO 2 copies per reaction, for 4 series of tests), which served as a positive amplification signal control, as well as optionally a heterologous transcribed RNA, added to each of the samples to be examined and used as internal control (hereinafter "CI”) (IO 3 copies per reaction, supplied for 100 reactions).
  • CI internal control
  • the HIV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label.
  • VirionStandard of HIV VirionStandard 1 (10 ⁇ copies / ⁇ l) 0.4 ml Calibrates the sample RNA lb VirionStandard 2 (IO 3 copies / ⁇ l) 0.4 ml Calibrates the sample RNA the VirionStandard 3 ( IO 2 copies / ⁇ l) 0.4 ml Caliber sample RNA ld VirionStandard 4 (10 copies / ⁇ l) 0.4 ml Caliber sample RNA VirionStandard 5 (HIV negative serum) 0.4 ml Specificity check (negative)
  • RNA reserve buffer 4 Dissolves the RNA samples
  • HIV plasmid DNA IO 2 copies of DNA / ⁇ l
  • Signal control positive of HIV cDNA
  • RNA isolation solution 100 ⁇ l of VirionStandard samples of HIV and plasma or serum were homogenized with 400 ⁇ l of RNA isolation solution, with a few oscillations in a homogenizer. 60 ⁇ l of chloroform were added and the mixture was stirred vigorously for 15 seconds and left to stand on ice for 10 minutes. The suspension was centrifuged at 12,000 g at 4 ° C for 15 minutes. After addition of chloroform and centrifugation, two phases were formed: the lower phenol-chloroform phase ( ⁇ 240 ⁇ l) and the upper aqueous phase ( ⁇ 320 ⁇ l). The RNAs remained exclusively in the aqueous phase, while the DNAs and proteins were in the interphase and in the organic phase.
  • RNA pellet was washed once with 75% ethanol (500 ⁇ l) under the effect of a vortex, and finally the RNA pellet was dried under vacuum. The RNA pellet was dissolved in 11 ⁇ l of RNA reserve buffer.
  • RNA precipitate formed a white-yellow pellet (visible only in large quantities) at the bottom of the tube. It is important not to let the RNA pellet dry completely, as drying greatly decreases its solubility.
  • RNA samples and positive / - negative controls were added to new tubes (200 ⁇ l).
  • 40 ⁇ l of reverse transcription / amplification mixture (MTRA) 38.9 ⁇ l of HIV amplification mixture + 1.1 ⁇ l of enzyme mixture
  • MTRA reverse transcription / amplification mixture
  • the tubes were transferred to an apparatus providing a thermal cycle (commercially called Thermal Cycler), with a heated cover. - 42 ° C for 25 minutes;
  • the specifically amplified HIV sequences could be easily viewed by size differences.
  • the ranges of copies of HIV-related RNA in 100 ⁇ l of plasma / serum samples could be estimated by comparison of their amplification bands with those of HIV VirionStandard (semi-quantification).
  • EXAMPLE 8 Human Immunodeficiency Virus (HIV) Genome Quantification Kit for Detection with an Optical Density Reader
  • a kit for quantifying the genome of the human immunodeficiency virus (HIV) according to the present invention was designed for the detection and quantification of HIV genomic RNA (including all the genotypes HIV-0, HIV-1 and HIV -2) in all biological fluids free from cells (such as plasma, serum, seminal fluid, bronchoalveolar lavage fluid, etc.), as well as culture supernatants.
  • HIV genomic RNA including all the genotypes HIV-0, HIV-1 and HIV -2
  • biological fluids free from cells such as plasma, serum, seminal fluid, bronchoalveolar lavage fluid, etc.
  • Reagents have been included to allow viral RNA to be isolated by a rapid method - reverse transcription of HIV virion RNA into cDNA using reverse transcriptase from cloned Moloney murine leukemia virus - the amplifica ⁇ tion then using Taq DNA polymerase - and finally quantitative detection by a liquid hybridization procedure linked to DIG (digoxigenin), which allowed a detection limit of 100 copies of viral RNA and a quantification range of approximately 2 orders of magnitude in a single test in 8 hours. Sufficient reagents were provided for 100 reactions (40 ⁇ l each) in a protocol with a final volume of 50 ⁇ l.
  • DIG digoxigenin
  • the kit contained a set of HIV virion standards "VirionStandard" (IO 3 , 10 2 , 10 and 1 copies / ⁇ l, supplied for 4 series of tests), which allowed an accurate measurement of the concentration of HIV virion RNA plasma / serum.
  • the kit also contained a plasmid HIV DNA (IO 2 copies per reaction for 4 sets of tests), which served as a positive amplification signal control. as well as an optional heterologous transcript RNA, added to each of the samples to be examined and serving as internal control "CI” (IO 3 copies per reaction, supplied for 100 reactions). 8.2. LIST OF KIT COMPONENTS
  • the HIV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label.
  • HIV VirionStandard VirionStandard 1 (IO 3 copies / ⁇ l) 0.4 ml Calibrates the sample RNA lb VirionStandard 2 (IO 2 copies / ⁇ l) 0.4 ml Caliber the sample RNA the VirionStandard 3 ( 10 copies / ⁇ l) 0.4 ml Calibrate the sample RNA ld VirionStandard 4 (1 copy / ⁇ l) 0.4 ml Calibrate the sample RNA the VirionStandard 5 (HIV negative serum) 0.4 ml Control specificity (negative)
  • RNA reserve buffer Dissolves the rO RNA samples
  • HIV plasmid DNA 10 2 copies of DNA / ⁇ l) 40 ⁇ l 1 Signal control (positive) of HIV cDNA
  • Hybridization buffer 40 ml 1 Allows hybridization of the probe to the target DNA
  • Anti-DIG-POD working solution 40 ml 1 Attaches to the DIG molecules of the specifically amplified product
  • RNA isolation solution 100 ⁇ l of VirionStandard samples of HIV and plasma or serum were homogenized with 400 ⁇ l of RNA isolation solution, with a few oscillations in a homogenizer. 60 ⁇ l of chloroform were added and the mixture was stirred vigorously for 15 seconds and left to stand on ice for 10 minutes. The suspension was centrifuged at 12,000 g at 4 ° C for 15 minutes. After addition of chloroform and centrifugation, two phases were formed: the lower phenol-chloroform phase ( ⁇ 240 ⁇ l) and the upper aqueous phase (-320 ⁇ l). The RNAs remained exclusively in the aqueous phase, while the DNAs and proteins were in the interphase and in the organic phase.
  • RNA pellet was washed once with 75% ethanol (500 ⁇ l) under the effect of a vortex, and finally the RNA pellet was dried under vacuum. The RNA pellet was dissolved in 11 ⁇ l of RNA reserve buffer.
  • RNA precipitate formed a white-yellow pellet (visible only in large quantities) at the bottom of the tube. It is important not to let the RNA pellet dry completely, as drying greatly decreases its solubility.
  • RNA samples and positive / - negative controls were added to new tubes (200 ⁇ l).
  • 40 ⁇ l of reverse transcription / amplification mixture (MTRA) 38.7 ⁇ l of HIV amplification mixture + 1.1 ⁇ l of enzymatic mixture + 0.2 ⁇ l of DIG-dUTP were placed in each tube.
  • the tubes were transferred to an apparatus providing a thermal cycle, with a heated cover. - 42 ° C for 25 minutes;
  • a kit for quantifying the genome of the human immunodeficiency virus (HIV) according to the present invention was designed and implemented substantially as described in Example 8, except that the range of quantification was more than 4 orders of greatness in a single test in 7 hours.
  • the HIV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label. 3
  • HIV VirionStandard la VirionStandard 1 (1CP copies / ⁇ l) 0.4 ml Calibrates the sample RNA lb VirionStandard 2 (IO 2 copies / ⁇ l) 0.4 ml Caliber the sample RNA the VirionStandard 3 (10 0.4 ml Caliber sample RNA ld VirionStandard 4 (1 copy / ⁇ l) 0.4 ml Caliber sample RNA VirionStandard 5 (HIV negative serum) 0.4 ml specificity (negative)
  • RNA reserve buffer 250 ⁇ l Dissolves RNA samples
  • HIV plasmid DNA 10 2 copies of DNA / ⁇ l) 40 ⁇ l 1 Signal control (positive) of HIV cDNA
  • Hybridization buffer 20 ml 1 Allows hybridization of the probe to the target DNA
  • VirionStandard samples of HIV and plasma or serum were homogenized with 400 ⁇ l of RNA isolation solution, with a few oscillations in a homogenizer. 60 ⁇ l of chloroform were added and the mixture was stirred vigorously for 15 seconds and left to stand on ice for 10 minutes. The suspension was centrifuged at 12,000 g at 4 ° C for 15 minutes.
  • RNAs remained exclusively in the aqueous phase, while the DNAs and proteins were in the interphase and in the organic phase.
  • the aqueous phase 300 ⁇ l was transferred to new tubes. An equal volume of isopropanol was added and the samples were stored at -20 ° C for 1 hour. The samples were centrifuged for 10 minutes at 12,000 g (4 ° C) and the pellet (pellet) was briefly dried.
  • RNA pellet was washed once with 75% ethanol (500 ⁇ l) under the effect of a vortex, and finally the pellet of RNA was dried under vacuum.
  • the RNA pellet was dissolved in 11 ⁇ l of RNA reserve buffer.
  • the RNA precipitate formed a white-yellow pellet (visible only in large quantities) at the bottom of the tube. It is important not to let the RNA pellet dry completely, as drying greatly decreases its solubility.
  • RNA samples 10 ⁇ l were added to new tubes (200 ⁇ l).
  • MTRA (38.9 ⁇ l of HIV amplification mixture + 1.1 ⁇ l of enzyme mixture) were placed in each tube.
  • the tubes were transferred to an apparatus providing a thermal cycle, with a heated cover.
  • a kit for quantifying the genome of the human immunodeficiency virus (HIV) according to the present invention was designed and implemented substantially as described in Example 8, except that the range of quantification was more than 4 orders of magnitude. in one test in 7 hours. 10.2. LIST OF KIT COMPONENTS
  • the HIV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label.
  • VirionStandard of HIV VirionStandard 1 (10 ⁇ copies / ⁇ l) 0.4 ml Calibrates sample RNA lb VirionStandard 2 (10 2 copies / ⁇ l) 0.4 ml Calibrates sample RNA VirionStandard 3 ( 10 copies / ⁇ l) 0.4 ml Calibrate the sample RNA ld VirionStandard 4 (1 copy / ⁇ l) 0.4 ml Calibrate the sample RNA the VirionStandard 5 (HIV negative serum) 0.4 ml Control specificity (negative)
  • RNA reserve buffer 250 ⁇ l Dissolves RNA samples
  • HIV plasmid DNA 10 2 copies of DNA / ⁇ l) 40 ⁇ l 1 Signal control (positive) of HIV cDNA
  • VirionStandard samples of HIV and plasma or serum were homogenized with 400 ⁇ l of RNA isolation solution, with a few oscillations in a homogenizer. 60 ⁇ l of chloroform were added and the mixture was stirred vigorously for 15 seconds and left to stand on ice for 10 minutes. The suspension was centrifuged at 12,000 g at 4 ° C for 15 minutes.
  • RNAs remained exclusively in the aqueous phase, while the DNAs and proteins were in the interphase and in the organic phase.
  • the aqueous phase 300 ⁇ l was transferred to new tubes. An equal volume of isopropanol was added and the samples were stored at -20 ° C for 1 hour. The samples were centrifuged for 10 minutes at 12,000 g (4 ° C) and the pellet (pellet) was briefly dried.
  • RNA was washed once with 75% ethanol (500 ⁇ l) under the effect of a vortex, and finally the pellet of RNA was dried under vacuum.
  • the RNA pellet was dissolved in 11 ⁇ l of RNA reserve buffer. The RNA precipitate formed a white-yellow pellet
  • RNA samples 10 ⁇ l were added to new tubes (200 ⁇ l).
  • the tubes were transferred to an apparatus providing a thermal cycle, with a heated cover.
  • a human hepatitis B virus (HBV) genome quantification kit has been designed for the detection and quantification of HBV genomic DNA in all cell-free biological fluids (such as plasma, serum, seminal fluid, bronchoalveolar lavage fluid, etc.).
  • Reagents were included to allow viral DNA to be isolated by a rapid method, amplification of HBV virion DNA with Taq DNA polymerase and quantitative detection by a liquid hybridization procedure linked to the chemiluminescence, which allowed a detection limit of 50 copies of viral DNA and a quantification range of more than 4 orders of magnitude in a single test in 5 hours.
  • Sufficient reagents were provided for 100 reactions (40 ⁇ l each) in a protocol with final volume of 50 ⁇ l.
  • the kit contained a set of HBV "VirionStandard" virion standards (10 4 , IO 3 , IO 2 and 10 copies / ⁇ l, supplied for 4 series of tests), which allowed precise measurement of the concentration of virion DNA. HBV plasma / serum.
  • the kit also contained HBV plasmid DNA (10 3 copies per reaction, for 4 sets of tests), which served as a positive amplification signal control, as well as optional heterologous plasmid DNA, added to each of the samples to be examined and serving as internal control "CI" (IO 3 copies per reaction, supplied for 100 reactions). 11.2.
  • the HBV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label.
  • HBV plasmid DNA IO 2 copies of DNA / ⁇ l
  • HBV cDNA signal control positive
  • HBV VirionStandard samples and of plasma or serum were homogenized with 50 ⁇ l of discharge or DNA release buffer, and then allowed to stand at 98 ° C for 10 minutes.

Abstract

A method wherein predetermined amounts of a microorganism of interest or the DNA or RNA thereof are used as the external standard; a fraction of the genome of said microorganism is extracted, revealed using a specific method or subjected to reverse transcription and/or amplification; and the DNA or RNA concentrations of the standard and target microorganisms or the target microorganism amplification products are compared with those of the external standard to determine values for the DNA or RNA concentration or the total microorganism concentration in each target microorganism sample. The method is useful for the quantitation and detection of all microorganisms.

Description

PROCEDE ET KIT POUR LA QUANTIFICATION ET LA DETECTION DES MICRO-ORGANISMES METHOD AND KIT FOR QUANTIFICATION AND DETECTION OF MICROORGANISMS
La présente invention concerne la quantification et la détection des micro-organismes. Elle concerne plus particulièrement le dosage quantitatif et/ou la détection des micro-organismes porteurs d'un génome à ADN ou à ARN. L'invention s'applique à tous les micro-organismes connus, tels que des virus, bactéries, bacilles, protozoaires, hématozoaires, porteurs d'un génome à ADN ou à ARN, touchant l'homme, l'animal ou les végétaux, ainsi qu'aux micro-organismes tels qu'ils existent chez l'homme, les animaux et les végétaux, en état pathologique ou normal; elle s'applique également à la quantification et la détection de ces mêmes micro-organismes dans les produits issus des animaux, y compris l'homme, et des végétaux, de même que de ceux susceptibles d'exister dans 1 'eau. La méthode selon l'invention est décrite plus loin pour la quantification de l'infection par le virus à ARN de 1 ' immunodéficience humaine (VIH) et de l'infection par le virus de l'hépatite B à ADN humain (VHB) .The present invention relates to the quantification and detection of microorganisms. It relates more particularly to the quantitative assay and / or the detection of microorganisms carrying a DNA or RNA genome. The invention applies to all known microorganisms, such as viruses, bacteria, bacilli, protozoa, hematozoa, carriers of a DNA or RNA genome, affecting humans, animals or plants, as well as microorganisms as they exist in humans, animals and plants, in a pathological or normal state; it also applies to the quantification and detection of these same microorganisms in products obtained from animals, including humans, and plants, as well as those likely to exist in water. The method according to the invention is described below for the quantification of infection with the human immunodeficiency RNA virus (HIV) and of infection with the human DNA hepatitis B virus (HBV).
L'étude de 1 ' épidémiologie, le traitement et la prophylaxie des pathologies humaines, animales et végétales sont de nos jours un objectif prioritaire de la médecine humaine et vétérinaire et de l'agronomie ou de l'industrie phytosanitaire . L'identification et la quantification des micro-organismes dans des milieux tels que par exemple les tissus, les fluides biologiques et les préparations in vitro sont des étapes indispensables à la bonne conduite de tels projets. Compte tenu de la taille de la plupart des micro-organismes, notamment des virus, et de leur concentration dans les milieux biologiques (en général de l'ordre de 10^- à ÎO1^ micro-organismes/ml) , seuls les outils technologiques actuels faisant appel à l'amplification de fragments de génomes permettent à la fois l'identification moléculaire et une évaluation quantitative. La méthode d'amplification génomique la plus utilisée actuellement est dénommée amplification en chaîne par polymerase ou ACP (en anglais polymerase chain reaction ou PCR) . Grâce à une enzyme, la polymerase, il est ainsi possible d'amplifier un fragment de génome à ADN. De même, on peut réaliser une rétrotranscription (ou transcription réverse) d'ARN en ADN et une amplification grâce au couple transcriptase réverse + polymerase ou à une enzyme réalisant les deux opérations. Une fois amplifié, ce morceau de génome ou amplificat est spécifiquement identifié par différentes méthodes (sonde radioactive ou colorée, taille du fragment) .The study of epidemiology, treatment and prophylaxis of human, animal and plant pathologies are nowadays a priority objective of human and veterinary medicine and of agronomy or the phytosanitary industry. The identification and quantification of microorganisms in media such as tissues, biological fluids and in vitro preparations are essential steps for the successful conduct of such projects. Taking into account the size of most microorganisms, in particular viruses, and their concentration in biological media (in general of the order of 10 ^ - to ÎO 1 ^ microorganisms / ml), only current technological tools involving the amplification of genome fragments allow both molecular identification and quantitative evaluation. The most widely used genomic amplification method today is called polymerase chain reaction or PCR (in English polymerase chain reaction or PCR). Thanks to an enzyme, the polymerase, it is thus possible to amplify a DNA genome fragment. Similarly, it is possible to carry out a retrotranscription (or reverse transcription) of RNA into DNA and an amplification by means of the reverse transcriptase + polymerase couple or an enzyme carrying out the two operations. Once amplified, this piece of genome or amplificate is specifically identified by different methods (radioactive or colored probe, size of the fragment).
Des méthodes de quantification de VIH par ACP sont par exemple décrites par Holodniy M. et al., dans J. Infect. Dis. 163, 862-866 (1991) ; Aoki-Sei S. et al., dans J. AIDS Res. Hum. Rétrovirus 8, 1263-1270 (1992) Bagnarelli P. et al., dans J. Virol . 66, 7328-7335 (1992) Piatak Jr. M. et al., dans Science 259, 1749-1755 (1993) Bruisten S.M. et al., dans AIDS 7 (suppl. 2) , S15-S20 (1993) .PCR quantification methods for HIV are for example described by Holodniy M. et al., In J. Infect. Say. 163, 862-866 (1991); Aoki-Sei S. et al., In J. AIDS Res. Hmm. Retrovirus 8, 1263-1270 (1992) Bagnarelli P. et al., In J. Virol. 66, 7328-7335 (1992) Piatak Jr. M. et al., In Science 259, 1749-1755 (1993) Bruisten S.M. et al., In AIDS 7 (suppl. 2), S15-S20 (1993).
Des méthodes de quantification d'ARN du virus de l'hépatite C ont été décrites par exemple par Kumar U. et al., dans J. Virol. Methods 47(1-2), 95-102 (1994); Manzin A. et al., dans J. Clin. Microbiol. 32(8), 1939-44 (1994) ; Ravaggi A. et al., J. Clin. Microbiol. 33(2) , 265-9 (1995); Young K.K. et al., J. Clin. Microbiol. 33(3), 654- 7 (1995) .Methods for the quantification of hepatitis C virus RNA have been described, for example, by Kumar U. et al., In J. Virol. Methods 47 (1-2), 95-102 (1994); Manzin A. et al., In J. Clin. Microbiol. 32 (8), 1939-44 (1994); Ravaggi A. et al., J. Clin. Microbiol. 33 (2), 265-9 (1995); Young K.K. et al., J. Clin. Microbiol. 33 (3), 654-7 (1995).
Des méthodes de quantification d'ADN du virus de l'hépatite B ont été décrites par exemple par Lehtovaara P. et al., dans PCR Methods Appl . 3(3) , 169-75 (1993); Wu J. et al., dans J. Virol. Methods 49(3) , 331-41 (1994) ; Zaaijer H.L. et al., dans J. Clin. Microbiol. 32(9), 2088- 91- (1994) ; Kaneko S. et al., dans J. Clin. Microbiol. 27(9), 1930-33 (1989) .Hepatitis B virus DNA quantification methods have been described for example by Lehtovaara P. et al., In PCR Methods Appl. 3 (3), 169-75 (1993); Wu J. et al., In J. Virol. Methods 49 (3), 331-41 (1994); Zaaijer HL et al., In J. Clin. Microbiol. 32 (9), 2088- 91- (1994); Kaneko S. et al., In J. Clin. Microbiol. 27 (9), 1930-33 (1989).
Cependant, la relation entre le produit amplifié et l'ADN ou l'ARN initial n'est réellement pas vraiment constante d'une expérience à l'autre, d'où la nécessité de se préoccuper du problème de la mesure d'un étalon dont les concentrations sont connues par ailleurs.However, the relationship between the amplified product and the initial DNA or RNA is really not really constant from one experiment to another, hence the need to be concerned with the problem of measuring a standard. the concentrations of which are known elsewhere.
Les capacités d'amplification de l'ACP ont pu être évaluées jusqu'ici grâce à des cellules n'ayant le génome à doser qu'en un nombre constant d'exemplaires ou à des plasmides comportant chacun un unique morceau de gène. Il a ainsi pu être établi que même un seul fragment de gène peut, grâce à l'ACP, être spécifiquement identifié. On a également établi qu'il existait un rapport de proportionnalité entre des concentrations d'ADN d'un plasmide soumises à amplification et les concentrations d'ADN mesurées après amplification. Cependant ce rapport de proportionnalité s'est avéré changer d'une expérience à l'autre, car l'amplification par ACP est un processus biologique, résultant de l'action de la polymerase, qui n'est pas maîtrisé de façon aussi complète que le serait une technique purement physique.The amplification capacities of the ACP have so far been able to be assessed using cells with the genome to be assayed only in a constant number of copies or with plasmids each comprising a single piece of gene. It has thus been established that even a single gene fragment can, thanks to PCR, be specifically identified. It has also been established that there is a proportionality relationship between DNA concentrations of a plasmid subjected to amplification and the DNA concentrations measured after amplification. However, this proportionality ratio was found to change from one experiment to the next, since PCR amplification is a biological process, resulting from the action of the polymerase, which is not controlled as completely as it would be a purely physical technique.
Cela a conduit les chercheurs et les ingénieurs des firmes de biotechnologie à introduire un étalonnage dans chaque expérience de quantification virale. Jusqu'à présent, l'étalon est constitué d'une série de concentrations (trois à cinq en général) d'un plasmide étalon dont le fragment d'ADN à amplifier a les mêmes amorces et est selon les technologies de séquence partiellement différente ou de séquence identique. Le rapport d'amplification de l'ADN de concentrations égales de deux plasmides à amorces identiques, mais de longueur et donc de séquences différentes: 1) peut être différent d'un cas à l'autre et 2) n'est pas nécessairement identique à celui de l'ADN issu de concentrations identiques de virus natifs au sein de la même expérience. Le problème est plus complexe encore si l'on cherche à quantifier ou à identifier des virus à ARN, tels que par exemple celui du SIDA (VIH) . En effet, l'étape d'amplification par ACP doit, pour les virus à ARN, être associée à une étape de rétrotranscription souvent réalisée soit grâce à une autre enzyme, la transcriptase réverse ou transcriptase inverse (en abrégé TR) , soit grâce à une enzyme ayant les deux actions (de rétrotranscription et d'amplification de l'ADN). Dans l'un et l'autre cas, les enzymes actuellement disponibles sur le marché permettent d'obtenir des rapports de rétrotranscription pouvant varier d'une expérience à l'autre de 10 : 1 (c'est-à-dire que 10 copies d'ARN donnent 1 copie d'ADN) à 100 : 1 (100 copies d'ARN donnent 1 copie d'ADN) . Le problème qui en résulte, à savoir la non-comparabilité des résultats d'expériences sucessives, a jusqu'à présent été résolu par incubation simultanée d'une gamme de concentrations d'un fragment d'ARN étalon (transcrit étalon) utilisant les mêmes amorces, mais dont la partie amplifiée est soit identique si on l'utilise en étalon externe, soit différente, en séquence ou en longueur, si on l'utilise en coamplif ication, le transcrit étant alors incubé dans le même tube que l'ARN du micro¬ organisme cible à doser. Il apparaît malheureusement que les concentrations d ' amplif icats issus des mêmes concentrations de deux transcrits peuvent être différentes et de même différentes de celles issues d'ARN provenant de concentrations identiques de virus. En conclusion, - les techniques connues de rétrotranscription et/ou d'amplification ne donnent pas des résultats identiques d'une expérience à l'autre pour un même échantillon; - un étalon s'impose, qui peut être soit interne, soit externe;This has led researchers and engineers from biotechnology firms to introduce calibration in each viral quantification experiment. Until now, the standard consists of a series of concentrations (three to five in general) of a standard plasmid whose DNA fragment to be amplified has the same primers and is according to technologies with a partially different sequence or identical sequence. The DNA amplification ratio of equal concentrations of two plasmids with identical primers, but of length and therefore of different sequences: 1) may be different from one case to another and 2) is not necessarily identical to that of DNA from identical concentrations of native viruses in the same experiment. The problem is even more complex if one seeks to quantify or identify RNA viruses, such as for example that of AIDS (HIV). Indeed, the step of amplification by PCR must, for RNA viruses, be associated with a step of retrotranscription often carried out either thanks to another enzyme, the reverse transcriptase or reverse transcriptase (in abbreviation TR), or thanks to an enzyme with both actions (reverse transcription and DNA amplification). In either case, the enzymes currently available on the market make it possible to obtain retrotranscription ratios which can vary from one experiment to another by 10: 1 (that is to say that 10 copies of RNA gives 1 copy of DNA) at 100: 1 (100 copies of RNA gives 1 copy of DNA). The resulting problem, namely the non-comparability of the results of successive experiments, has so far been resolved by simultaneously incubating a range of concentrations of a standard RNA fragment (standard transcript) using the same primers, but the amplified part of which is either identical if used as an external standard, or different, in sequence or in length, if used in co-amplification, the transcript then being incubated in the same tube as the RNA of the target micro¬ organism to be assayed. Unfortunately, it appears that the concentrations of amplifiers icats originating from the same concentrations of two transcripts may be different and similarly different from those originating from RNA originating from identical concentrations of virus. In conclusion, - the known techniques of retrotranscription and / or amplification do not give identical results from one experiment to another for the same sample; - a standard is required, which can be either internal or external;
- un étalon externe composé soit d'un plasmide pour un micro-organisme à ADN, soit d'un ARN transcrit pour un micro-organisme à ARN, ne permet qu'une quantification relative, car le rapport d'amplification n'est pas nécessairement identique à celui de l'ADN ou de l'ARN du micro-organisme complet;- an external standard composed either of a plasmid for a microorganism with DNA, or of a RNA transcribed for a microorganism with RNA, allows only a relative quantification, because the amplification ratio is not necessarily identical to that of the DNA or RNA of the complete microorganism;
- un étalon interne coamplifié fait de plus intervenir des longueurs ou des séquences différentes du plasmide ou du transcrit et a les mêmes inconvénients qu'un étalon externe utilisant un plasmide ou un transcrit.- A co-amplified internal standard also involves different lengths or sequences of the plasmid or transcript and has the same drawbacks as an external standard using a plasmid or a transcript.
Dans l'état de la technique actuelle, l'amplification de l'ADN d'un plasmide n'est pas vraiment proportionnelle à celle subie par l'ADN viral. Quant à l 'étalon actuellement utilisé pour les virus à ARN, il s'agit d'un transcrit, qui a les mêmes inconvénients qu'un plamside et y ajoute la possibilité de dégradation d'ARN libre.In the current state of the art, the amplification of the DNA of a plasmid is not really proportional to that undergone by the viral DNA. As for the standard currently used for RNA viruses, it is a transcript, which has the same drawbacks as a plasmid and adds the possibility of degradation of free RNA.
Il y avait donc un besoin pour des tests de quantification et de détection de micro-organismes procurant des valeurs absolues du nombre de micro¬ organismes cible.There was therefore a need for quantification and detection tests for microorganisms providing absolute values of the number of target micro¬ organisms.
On a maintenant trouvé que l'on peut quantifier ou détecter de façon absolue et directe n'importe quel micro- organisme à ADN ou à ARN, à la condition:We have now found that any DNA or RNA microorganism can be quantified or detected absolutely and directly, provided that:
(1) que l'on connaisse ou que l'on puisse déterminer par ailleurs une concentration étalon du micro-organisme ou la concentration de l'ADN ou de l'ARN porté par ce micro¬ organisme, appelé micro-organisme étalon, et (2) que l'on compare la quantité du produit de la transcription réverse et/ou de l'amplification de l'ARN ou de l'ADN issu d'une concentration inconnue du micro¬ organisme avec des quantités d'amplificat issues de l'ARN ou de l'ADN de plusieurs concentrations connues du dit micro-organisme. Un tel procédé constitue le premier objet de la présente invention.(1) that one knows or that one can also determine a standard concentration of the micro-organism or the concentration of DNA or RNA carried by this micro-organism, called standard micro-organism, and (2) that the quantity of the product of reverse transcription and / or of amplification of RNA or DNA from an unknown concentration of the microorganism is compared with quantities of amplificate from RNA or DNA of several known concentrations of said microorganism. Such a method constitutes the first object of the present invention.
Selon une variante de ce procédé, l'étape (2) peut consister essentiellement en une révélation comparative fondée sur la comparaison des concentrations de l'étalon avec les concentrations du micro-organisme cible telles que détectées de préférence au moyen de la méthode dite de l'ADN branché ou de toute autre méthode de révélation qui n'amplifie pas les ADN ou les ARN de l'étalon ou du micro- organisme cible.According to a variant of this method, step (2) may consist essentially of a comparative revelation based on the comparison of the concentrations of the standard with the concentrations of the target microorganism as preferably detected by means of the so-called method of plugged-in DNA or any other method of disclosure that does not amplify the DNA or RNA of the standard or target microorganism.
Pour préparer des concentrations connues de micro¬ organisme, on procède selon l 'une quelconque des techniques connues de l'homme du métier, de préférence en centrifugeant et purifiant (à partir d'échantillons humains, animaux ou végétaux du milieu à tester, ou à partir de cultures cellulaires) des quantités quelconques du micro-organisme à doser, puis en extrayant l'ADN ou l'ARN de ces préparations centrifugées purifiées, par des moyens classiques. Les quantités à mettre en oeuvre dans la suite du procédé sont des quantités quelconques, qui doivent seulement être suffisantes pour que l'on obtienne finalement des quantités d'ADN ou d'ARN du micro-organisme étalon mesurables par les méthodes microbiologiques directes, n'utilisant pas l'amplification de type ACP et qui sont à la portée de l'homme du métier. Dans la pratique et compte tenu de la précision des matériels actuellement disponibles dans les laboratoires pour ces mesures, des quantités de l'ordre de plusieurs centaines de nanogrammes ou de quelques microgrammes conviennent. Le procédé selon l'invention comporte avantageusement les étapes selon lesquelles:To prepare known concentrations of microorganism, one proceeds according to any of the techniques known to those skilled in the art, preferably by centrifuging and purifying (from human, animal or plant samples from the medium to be tested, or from cell cultures) any amounts of the microorganism to be assayed, then extracting the DNA or RNA from these purified centrifuged preparations, by conventional means. The quantities to be used in the rest of the process are any quantities, which need only be sufficient for quantities of DNA or RNA of the standard microorganism to be finally obtained which can be measured by direct microbiological methods, n not using the ACP type amplification and which are within the reach of the skilled person. In practice and taking into account the precision of the materials currently available in laboratories for these measurements, quantities of the order of several hundred nanograms or a few micrograms are suitable. The method according to the invention advantageously comprises the steps according to which:
1) on prélève et on purifie une quantité quelconque du micro-organisme à doser, à partir d'échantillons de prélèvement humains, animaux ou végétaux, ou à partir de cultures cellulaires, la quantité de micro-organisme étant avantageusement suffisante pour que les concentrations en ADN ou ARN cible soient mesurables par des méthodes directes;1) any quantity of the microorganism to be assayed is sampled and purified, from human, animal or plant samples, or from cell cultures, the quantity of microorganism being advantageously sufficient for the target DNA or RNA concentrations to be measurable by direct methods;
2) on extrait l'ADN ou l'ARN et on en mesure la quantité (exprimée en ng ou en μg) recueillie;2) extract the DNA or RNA and measure the amount (expressed in ng or μg) collected;
3) on utilise par ailleurs le nombre de bases nucleotidiques du micro-organisme concerné, ce nombre étant connu, par exemple d'après des banques de données, ou déterminable par des méthodes classiques; 4) on calcule à partir de ce nombre de bases nucleotidiques la masse moléculaire totale de l'ADN ou de l'ARN du dit micro-organisme, en tenant compte de la masse moléculaire moyenne d'un nucleotide, elle aussi connue (environ 330 daltons) ; 5) on calcule ainsi, en utilisant le nombre d'Avogadro (soit 6,02 x IO23) , la quantité d'ADN ou d'ARN portée par chaque micro-organisme;3) the number of nucleotide bases of the microorganism concerned is also used, this number being known, for example from databases, or determinable by conventional methods; 4) the total molecular mass of the DNA or RNA of said microorganism is calculated from this number of nucleotide bases, taking into account the average molecular mass of a nucleotide, which is also known (approximately 330 daltons); 5) the quantity of DNA or RNA carried by each microorganism is thus calculated, using the Avogadro number (that is 6.02 x 10 23 );
6) on prépare et/ou utilise une gamme de concentrations de micro-organisme étalon obtenue à partir des dilutions successives du micro-organisme préalablement étalonné selon ses concentrations d'ADN ou d'ARN, pour former un étalon externe, dont on connaît ainsi pour chaque dilution (a) la concentration d'ADN ou d'ARN et (b) la concentra¬ tion en micro-organismes; 7) on extrait l'ADN ou l'ARN des micro-organismes étalon et cible et on soumet les extraits en parallèle à une révélation au moyen de la méthode dite à l'ADN branché ou de toute autre méthode de révélation qui n'amplifie pas les ADN ou les ARN du micro-organisme étalon ou cible et/ou à une rétrotranscription et/ou à au moins une amplification et on enregistre les valeurs obtenues; et 8) on compare les concentrations d'ADN ou d'ARN des micro¬ organismes étalon et cible ou les produits d'amplification des micro-organismes cible avec ceux de l'étalon externe, de façon à en déduire les valeurs de concentration en ADN ou. ARN ou en micro-organisme total dans chaque échantillon de micro-organisme cible.6) a range of concentrations of standard microorganism obtained from successive dilutions of the microorganism previously calibrated according to its DNA or RNA concentrations is prepared and / or used to form an external standard, of which we thus know for each dilution (a) the concentration of DNA or RNA and (b) the concentration of microorganisms; 7) the DNA or RNA of the standard and target microorganisms are extracted and the extracts are subjected in parallel to a revelation by means of the so-called branched DNA method or any other method of revelation which does not amplify not the DNA or RNA of the standard or target microorganism and / or to a transcription and / or to at least one amplification and the values obtained are recorded; and 8) the DNA or RNA concentrations of the standard and target microorganisms or the amplification products of the target microorganisms are compared with those of the external standard, so as to deduce the concentration values thereof. DNA or. RNA or total microorganism in each sample of target microorganism.
A titre d'exemples de sources bibliographiques dans lesquelles on peut trouver des indications ou les références de banques de données concernant le nombre de bases nucleotidiques des micro-organismes, on peut citer: Virus Res. 23, 39-53 (1992) ; Gène 81, 275-284 (1989) ; Virology 177, 305-311 (1990) et J. Gen. Virol. 69, 2575- 2583 (1988) . Selon une variante avantageuse pouvant être mise en oeuvre si les micro-organismes sont assez gros pour pouvoir être détectés et comptés directement, notamment par des moyens optiques et/ou électroniques, les étapes 2) à 5) susdites du procédé selon l'invention sont remplacées par la simple mesure directe du nombre de micro¬ organismes .As examples of bibliographic sources in which one can find indications or references of databases concerning the number of nucleotide bases of microorganisms, there may be mentioned: Virus Res. 23, 39-53 (1992); Gene 81, 275-284 (1989); Virology 177, 305-311 (1990) and J. Gen. Virol. 69, 2575-2583 (1988). According to an advantageous variant which can be implemented if the microorganisms are large enough to be able to be detected and counted directly, in particular by optical and / or electronic means, the above steps 2) to 5) of the method according to the invention are replaced by the simple direct measurement of the number of micro¬ organisms.
Selon un mode de mise en oeuvre préféré le procédé selon la présente invention peut comprendre en option l'addition d'un contrôle interne, de préférence sous la forme d'un ADN de plasmide hétérologue ou d'un ARN de transcrit hétérologue, et dont la séquence et les amorces n'ont pas de rapport avec les ADN ou les ARN de la cible. Ledit contrôle interne est avantageusement ajouté à chacun des échantillons à examiner et sert de contrôle interne (ci-après en abrégé "CI") , c'est-à-dire pour le contrôle de l'efficacité d'amplification ou de l'efficacité de l'amplification liée à la transcription réverse (ci-après "TR") .According to a preferred embodiment, the method according to the present invention can optionally comprise the addition of an internal control, preferably in the form of a heterologous plasmid DNA or of a heterologous transcript RNA, and of which the sequence and the primers have no relation to the target DNAs or RNAs. Said internal control is advantageously added to each of the samples to be examined and serves as internal control (hereinafter abbreviated as "CI"), that is to say for controlling the amplification efficiency or the efficiency amplification related to reverse transcription (hereinafter "TR").
En variante, on peut remplacer dans le procédé selon l'invention la préparation de concentrations connues de micro-organisme par la préparation de concentrations connues :As a variant, the preparation according to the invention can be replaced by the preparation of known concentrations of microorganism by the preparation of known concentrations:
. du même micro-organisme inactivé, dont l'ADN ou l'ARN demeure apte à la détection ou la quantification au moyen d'une méthode de révélation telle que la méthode de révélation dite à l 'ADN branché et/ou la rétrotranscription et/ou à l'amplification de façon identique à l'ADN ou l'ARN du virus natif, . d'une séquence nucléotidique complète, extraite du même micro-organisme, ou. of the same inactivated microorganism, whose DNA or RNA remains capable of detection or quantification by means of a revelation method such as the method of revelation said to the connected DNA and / or the retrotranscription and / or the amplification in an identical manner to the DNA or the RNA of the native virus,. a complete nucleotide sequence, extracted from the same microorganism, or
. d'une séquence nucléotidique complète, fabriquée par synthèse.. of a complete nucleotide sequence, produced by synthesis.
Selon une variante particulièrement avantageuse du procédé selon l'invention, on prépare et on stocke jusqu'à leur mise à la disposition de l'utilisateur deε préparations de concentrations connues étalonnées du micro-organisme complet à ADN ou à ARN du type à quantifier ou à détecter, ou des préparations de concentrations d'ADN ou d'ARN du génome du dit micro- organisme correspondant à des concentrations connues de ce micro-organisme .According to a particularly advantageous variant of the method according to the invention, preparations and storage are prepared until they are made available to the user of preparations of known calibrated concentrations of the complete microorganism with DNA or RNA of the type to be quantified or to detect, or preparations of DNA or RNA concentrations of the genome of said microorganism corresponding to known concentrations of this microorganism.
Pour simplifier l'exposé, il est fait référence dans la suite, à titre de simple exemple illustratif, à une détection accomplie par une amplification, plus précisé- ment au moyen d'une ACP ou d'une TR-ACP, mais d'autres méthodes d'amplification peuvent également être employées, comme par exemple la méthode dite NASBA (c'est-à-dire la méthode par "nucleic acid séquence based assay") .To simplify the presentation, reference is made hereinafter, by way of a simple illustrative example, to a detection accomplished by an amplification, more precisely by means of an ACP or a TR-ACP, but of other amplification methods can also be used, such as the so-called NASBA method (that is to say the "nucleic acid sequence based assay" method).
Une quantification moléculaire et une détection selon l'invention présentent un intérêt marqué aussi bien pour de petits micro-organismes que pour de plus gros micro¬ organismes, mais en faible concentration ou dont les techniques empiriques traditionnelles d'évaluation ne sont plus systématiquement maîtrisées dans les pays développés. L'invention a également pour objet un kit ou ensemble de moyens pour la quantification et la détection de micro¬ organismes à ADN ou à ARN, comprenant essentiellement, dans des récipients appropriés et/ou sous la forme de dispositifs appropriés: - une série de concentrations connues étalonnées du micro- organisme complet à ADN ou à ARN du type à quanti f ier ou à dé t ec t e r , ou de con c en t ra t i ons d ' ADN ou d ' ARN correspondant à des concentrations connues du dit micro- organisme ,Molecular quantification and detection according to the invention are of marked interest both for small microorganisms as for larger micro¬ organisms, but in low concentration or whose traditional empirical evaluation techniques are no longer systematically mastered in developped countries. The subject of the invention is also a kit or set of means for the quantification and detection of DNA or RNA microorganisms, essentially comprising, in appropriate containers and / or in the form of suitable devices: - a series of known calibrated concentrations of the complete DNA or RNA microorganism of the type to be quantified or detected, or of con c t ra ti ons of DNA or RNA corresponding to concentrations known to said microorganism,
- des moyens d'extraction, de révélation et/ou de rétrotranscription et/ou d'amplification, notamment par ACP, TR-ACP ou NASBA de l'ADN ou de l'ARN du micro- organisme cible et étalon, - des moyens pour l'analyse de l'ADN ou de l'ARN du micro- organisme cible et étalon ou des produits de révélation ou d'amplification.- means of extraction, revelation and / or backtranscription and / or amplification, in particular by PCR, TR-ACP or NASBA of the DNA or RNA of the target and standard microorganism, - means for the analysis of DNA or RNA of the target and standard microorganism or of revelation or amplification products.
Ledit kit ou ensemble de mmoyens peut également comprendre en option un contrôle interne, par exemple sous la forme d ' approximativement IO3 copies/μl d'un ADN de plasmide hétérologue ou d'ARN de transcrit hétérologue, en tant que contrôle pour l'efficacité d'amplification ou de l'efficacité de l'amplification liée à la TR.Said kit or set of means can also optionally comprise an internal control, for example in the form of approximately 10 3 copies / μl of a heterologous plasmid DNA or of heterologous transcript RNA, as a control for the amplification efficiency or the amplification efficiency linked to RT.
Il convient de noter que les moyens d'analyse des produits d'ACP ou de TR-ACP peuvent consister en des moyens extérieurs au kit et destinés à être utilisés en combinaison avec celui-ci. Ces moyens peuvent par exemple comprendre des dispositifs et/ou des produits pour la détermination par életrophorèse, par colorimétπe, par radiométπe ou par tout autre moyen analytique approprié.It should be noted that the means of analysis of the ACP or TR-ACP products can consist of means external to the kit and intended to be used in combination with the latter. These means may, for example, include devices and / or products for determination by electrophoresis, by colorimetry, by radiometry or by any other suitable analytical means.
Le procédé et les moyens susdits procurent de manière originale une quantification absolue des micro-organismes à ADN ou à ARN, car le micro-organisme cible ou son génome à doser, est identique au micro-organisme étalon ou son génome traité en parallèle. De plus, ce procédé et ces moyens se sont avérés procurer une technique universelle de quantification et d'identification, car ils permettent la quantification de tous les micro-organismes .The above method and means provide in an original way an absolute quantification of DNA or RNA microorganisms, since the target microorganism or its genome to be assayed is identical to the standard microorganism or its genome processed in parallel. In addition, this method and these means have been found to provide a universal technique of quantification and identification, since they allow the quantification of all microorganisms.
En dehors même des préoccupations de quantification, le procédé et les moyens selon l'invention peuvent être employés pour une détection de la quantité minimale de micro-organisme mesurable avec les méthodes actuelles de transcription réverse et/ou d'amplification des micro¬ organismes à ARN ou à ADN. En pratique, la quantité minimale mesurable est de l'ordre de un à cinq micro¬ organismes pour les micro-organismes à ADN, tandis qu'elle est de l'ordre de 10 à 100 micro-organismes pour les micro-organismes à ARN.Besides the concerns of quantification, the method and the means according to the invention can be used for detection of the minimum quantity of microorganism measurable with current methods of reverse transcription and / or amplification of micro¬ organisms with RNA or DNA. In practice, the minimum measurable quantity is of the order of one to five micro¬ organisms for DNA microorganisms, while it is of the order of 10 to 100 microorganisms for RNA microorganisms .
L'invention est décrite plus concrètement ci-après en référence aux dessins annexés, qui ne la limitent aucune¬ ment et dans lesquels:The invention is described more specifically below with reference to the accompanying drawings, which do not limit it, and in which:
- Fig. 1 représente graphiquement la variation de la sensibilité de détection et de l 'efficacité d'amplification de différentes expériences d'ACP effectuées avec plusieurs concentrations différentes d'ADN étalon du même virus;- Fig. 1 graphically represents the variation in detection sensitivity and in the amplification efficiency of different PCR experiments carried out with several different concentrations of standard DNA of the same virus;
- Fig. 2 représente graphiquement la variation de la sensibilité de détection et de l'efficacité d'amplification de différentes expériences de TR-ACP effectuées avec plusieurs concentrations d'ARN du même virus; Fig. 3 représente graphiquement la variation de l'efficacité d'amplification dans des expériences d'ACP effectuées avec plusieurs concentrations d'ADN issues de préparations de virus provenant de différents patients, au sein de la même expérience; Fig. 4 représente graphiquement la variation de l'efficacité d'amplification dans des expériences d'ACP effectuées respectivement avec plusieurs concentrations d'ADN isues de plusieurs préparations du même virus et avec plusieurs concentrations d'ADN issues de deux plasmides différents; Fig. 5 représente graphiquement la variation de l'efficacité d'amplification dans des expériences de TR-ACP effectuées avec plusieurs concentrations d'ARN issues de préparations de virus provenant de différents patients; Fig. 6 représente graphiquement la variation de l'efficacité d'amplification dans des expériences de TR-ACP effectuées respectivement avec plusieurs concentrations d'ARN issues de préparations de virus provenant de différents patients et avec deux ARN de transcrits différents.- Fig. 2 graphically represents the variation in detection sensitivity and in the amplification efficiency of different TR-ACP experiments carried out with several concentrations of RNA of the same virus; Fig. 3 graphically represents the variation in the amplification efficiency in PCR experiments carried out with several concentrations of DNA originating from virus preparations originating from different patients, within the same experiment; Fig. 4 graphically represents the variation in the amplification efficiency in PCR experiments carried out respectively with several concentrations of DNA obtained from several preparations of the same virus and with several concentrations of DNA originating from two different plasmids; Fig. 5 graphically represents the variation in the amplification efficiency in TR-ACP experiments carried out with several concentrations of RNA from virus preparations from different patients; Fig. 6 graphically represents the variation in the amplification efficiency in TR-ACP experiments carried out respectively with several concentrations of RNA originating from virus preparations originating from different patients and with two RNAs from different transcripts.
Ainsi, à titre indicatif, on a concentré, purifié et extrait l'ARN de VIH issu d'une culture de façon à en obtenir 300 ng; sachant que le nombre total de nucléotides du VIH est de 19000 et que la masse moléculaire d'un nucleotide est de 330 daltons, on en a déduit que la masse moléculaire globale d'un ARN de VIH est de 6.300.000 daltons. On a alors obtenu, par un calcul utilisant le nombre d'Avogadro, le nombre exact de génomes viraux et donc de virus d'où émane la quantité de 300 ng d'ARN, soit approximativement 3x10-0 virus. Connaissant la concentra¬ tion de virus d'une partie aliquote de la préparation virale purifiée, on peut alors préparer une gamme étalon de ce virus et l'utiliser dans le procédé selon la présente invention.Thus, as an indication, the HIV RNA from a culture was concentrated, purified and extracted so as to obtain 300 ng; Knowing that the total number of HIV nucleotides is 19,000 and that the molecular mass of a nucleotide is 330 daltons, it has been deduced therefrom that the global molecular mass of an HIV RNA is 6,300,000 daltons. We then obtained, by a calculation using the Avogadro number, the exact number of viral genomes and therefore of viruses from which emanates the quantity of 300 ng of RNA, or approximately 3x10-0 virus. Knowing the concentration of virus in an aliquot part of the purified viral preparation, one can then prepare a standard range of this virus and use it in the process according to the present invention.
Le procédé selon l ' invention permet une identification fiable et/ou une quantification absolue, car le micro-organisme cible (à doser) est identique au micro-organisme étalon. La méthode que ce procédé met en oeuvre est en outre universelle, car elle permet la quantification de tous les micro-organismes dont la quantité est mesurable parallèlement. Ce procédé et le kit pour sa mise en oeuvre peuvent être utilisés non seulement pour la quantification des micro-organismes dans tous milieux ou spécimens, mais également pour la détection de la quantité minimale de micro-organisme mesurable avec les méthodes actuelles de transcription réverse et/ou d'amplification des micro- organismes à ARN ou à ADN.The method according to the invention allows reliable identification and / or absolute quantification, since the target microorganism (to be assayed) is identical to the standard microorganism. The method that this method implements is also universal, because it allows the quantification of all microorganisms, the quantity of which can be measured in parallel. This method and the kit for its implementation can be used not only for the quantification of microorganisms in any medium or specimen, but also for the detection of the minimum quantity of microorganism measurable with current methods of reverse transcription and / or amplification of RNA or DNA microorganisms.
Pour les micro-organismes à ADN la quantité minimale mesurable est de l'ordre de 1 à 5 micro-organismes, tandis qu'elle est d'environ 10 à 100 micro-organismes pour ceux à ARN.For DNA microorganisms the minimum measurable quantity is of the order of 1 to 5 microorganisms, while it is approximately 10 to 100 microorganisms for those with RNA.
La présente invention apporte un progrès décisif aux moyens et aux méthodes de dosage quantitatif de micro- organismes m vitro en procurant un moyen et une technique simples et efficaces pour la standardisation des dosages. L'invention est décrite plus en détails dans les exemples ci-après, qui ne la limitent aucunement et dans lesquels les proportions et les pourcentages sont en poids/poids, sauf indication contraire.The present invention brings decisive progress to the means and methods for quantitative assay of microorganisms in vitro by providing a simple and effective means and technique for standardizing assays. The invention is described in more detail in the examples below, which do not limit it in any way and in which the proportions and percentages are by weight / weight, unless otherwise indicated.
Exemple 1: Démonstration de l'intérêt d'un étalon universel pour la détection et la quantification d'ADN cible par ACP (en anglais PCR) .Example 1: Demonstration of the interest of a universal standard for the detection and quantification of target DNA by PCR (in English PCR).
On a étudié la variation de la sensibilité de détection et de l'efficacité d'amplification de l'ACP sur l'ADN issu de différentes concentrations du même VHB. Les plasmas ont été obtenus à partir de porteurs de VHB chroniques par plasmaphérèse avec des titres en HBsAg élevés. Du virion à ADN de VHB a été purifié par centrifugation (pendant une nuit à 25.000 tours/mm et à 4°C dans une centrifugeuse Spmco 25) à travers un lit à 30 % (en poids/volume) de saccharose dans du milieu TEBM (Tris-HCl 0,01 M, pH 7,6, NaEDTA 0,001 M, 1 % d'albumine sérique bovine et 0,3 % de 2-mercapto-éthanol) . La pureté des virions de VHB fractionnés a été suivie par microscopie électronique. L'ADN associé aux virions a été extrait par l'intermédiaire d'un kit de purification d'ADN du commerce. L'ADN viral obtenu a été quantifié par spectrophotométrie. Le nombre de copies d'ADN viral a été calculé au moyen de la masse moléculaire du génome viral de. l'ADN de VHB. En variante le nombre de virions peut également être quantifié par microscopie électronique. Des dilutions en série (10, 100, 1000, 10.000 copies) de l'ADN de VHB ont été soumises à une succession de cycles d'ACP identiques (94°C pendant 60 s, 56°C pendant 60 s et 72°C pendant 90 s) , avec 100 pmol de paires d'amorce de VHB spécifiques pour le gène C: (GCTTTGGGGCATGGACATTGCC/ GACTACTAGATCCCTGGATGCTGG) . Les produits d'ACP spécifiques ont été analysés par une hybridation dot-blot avec une sonde marquée à l 'extrémité par γ- 3 2 P (TCAGCTCTGTATCGAGAAGCC) et les comptages par minute (cpm) de chaque signal d'ACP ont été relevés par l'intermédiaire d'un compteur de rayonnement bêta.We studied the variation in detection sensitivity and amplification efficiency of PCR on DNA from different concentrations of the same HBV. The plasmas were obtained from chronic HBV carriers by plasmapheresis with high HBsAg titers. HBV DNA virion was purified by centrifugation (overnight at 25,000 rpm and 4 ° C in a Spmco 25 centrifuge) through a 30% (w / v) bed of sucrose in TEBM medium (0.01 M Tris-HCl, pH 7.6, 0.001 M NaEDTA, 1% bovine serum albumin and 0.3% 2-mercapto-ethanol). The purity of the fractionated HBV virions was monitored by electron microscopy. The DNA associated with the virions was extracted using a commercial DNA purification kit. The viral DNA obtained was quantified by spectrophotometry. The number of copies of viral DNA was calculated using the molecular weight of the viral genome of . HBV DNA. Alternatively the number of virions can also be quantified by electron microscopy. Serial dilutions (10, 100, 1000, 10,000 copies) of HBV DNA were subjected to a succession of identical PCR cycles (94 ° C for 60 s, 56 ° C for 60 s and 72 ° C for 90 s), with 100 pmol of HBV primer pairs specific for the C gene: (GCTTTGGGGCATGGACATTGCC / GACTACTAGATCCCTGGATGCTGG). The specific PCR products were analyzed by dot-blot hybridization with a probe labeled at the end with γ- 3 2 P (TCAGCTCTGTATCGAGAAGCC) and the counts per minute (cpm) of each PCR signal were noted by through a beta radiation counter.
Les résultats ont été enregistrés et reportés sous forme graphique sur la figure 1. Il apparaît clairement que l'étalon donnerait des résultats différents et doit donc être mis en oeuvre dans chaque expérience en parallèle avec l'échantillon cible.The results were recorded and reported in graphical form in FIG. 1. It is clear that the standard would give different results and must therefore be implemented in each experiment in parallel with the target sample.
Ainsi, pour chaque input d'ADN de matrice constante (nombre de copies), il existe d'après les courbes de la figure 1 un large intervalle de concentrations de produit d'ACP d'une expérience à l'autre.Thus, for each input of DNA of constant matrix (number of copies), there exists from the curves of FIG. 1 a wide range of concentrations of PCR product from one experiment to another.
Exemple 2 : Démonstration de l 'intérêt d'un étalon universel pour la détection et la quantification d'ARN cible par TR-ACP (en anglais RT-PCR) .Example 2: Demonstration of the interest of a universal standard for the detection and quantification of target RNA by TR-ACP (in English RT-PCR).
On a étudié la variation de la sensibilité de détection et de l'efficacité de la transcription réverse/amplification de l'ACP sur l'ARN issu de différentes concentrations du même VIH-1. Du virion à ARN de VIH-1 a été purifié par passage du surnageant de culture de blastes de cellules mononuclées du sang infectés par un isolât primaire sur une colonne de sépharose. La pureté des virions de VIH-1 fractionnés a été suivie par microscopie électronique. L'ARN associé aux virions a été extrait par l'intermédiaire d'un kit d'isolation d'ARN du commerce. L'ARN viral obtenu a été quantifié par spectrophotométrie. Le nombre de copies d'ARN viral a été calculé au moyen de la masse moléculaire du génome viral de l'ARN de VIH-1. Après addition de 1 microgramme d'ARNt, des dilutions en série (1.000.000, 100.000, 10.000, 1000 copies) de l'échantillon d'ARN ont été pastillées et remises en suspension dans 10 μl . Une partie aliquote de 10 μl d'ARN et 1 μg d'ARNt de référence (exempt de VIH) ont été ajoutés immédiatement à chacun des mélanges réactionnels (90 μl) de TR-ACP contenant 10 unités de transcriptase réverse de virus de leucémie murine de Moloney recombinant et 3 unités d'ADN polymerase ampliTaq pour l'amplification du gène gag du VIH. La TR- ACP a été mise en oeuvre pendant 25 minutes à 42°C, puis pendant 5 min à 94°C et ensuite sur 40 cycles (94°C peandnt 60 s, 56°C pendant 60 s et 72°C pendant 90 s) d'ACP utilisant 100 pmol de chacune des paires d'amorce de VIH spécifiques du gène gag (GGAACATCAAGCAGCCATGC/ TCCTTTGGTCCTTGTCTTATGTC) . Les produits d'ACP spécifiques ont été analysés par hybridation par dot-blot avec une sonde marquée à 1 'extrémité par γ- 3 2 P (ATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTAC) et les comptages par minute (cpm) de chaque signal d'ACP ont été relevés par l'intermédiaire d'un compteur de rayonnement bêta.We studied the variation in detection sensitivity and efficiency of reverse transcription / amplification of PCR on RNA from different concentrations of the same HIV-1. HIV-1 RNA virion was purified by passing the culture supernatant from blasts of mononuclear blood cells infected with a primary isolate over a sepharose column. The purity of the fractionated HIV-1 virions was monitored by electron microscopy. RNA associated with virions was extracted using a commercial RNA isolation kit. The viral RNA obtained was quantified by spectrophotometry. The number of copies of viral RNA was calculated using the molecular mass of the viral genome of HIV-1 RNA. After addition of 1 microgram of tRNA, serial dilutions (1,000,000, 100,000, 10,000, 1,000 copies) of the RNA sample were pelletized and resuspended in 10 μl. An aliquot of 10 μl of RNA and 1 μg of reference tRNA (free of HIV) was immediately added to each of the reaction mixtures (90 μl) of TR-ACP containing 10 units of reverse transcriptase from murine leukemia virus of Moloney recombinant and 3 units of DNA polymerase ampliTaq for the amplification of the HIV gag gene. The TR-ACP was carried out for 25 minutes at 42 ° C, then for 5 min at 94 ° C and then over 40 cycles (94 ° C for 60 s, 56 ° C for 60 s and 72 ° C for 90 s) PCR using 100 pmol of each of the HIV primer pairs specific for the gag gene (GGAACATCAAGCAGCCATGC / TCCTTTGGTCCTTGTCTTATGTC). The specific PCR products were analyzed by dot-blot hybridization with a probe labeled at the end with γ- 3 2 P (ATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTAC) and the counts per minute (cpm) of each PCR signal were taken by through a beta radiation counter.
Les résultats ont été enregistrés et reportés sous forme graphique sur la figure 2. Il apparaît que la variabilité des résultats est très importante d'une expérience à l'autre. Là encore, il apparaît clairement que l'étalon donnerait des résultats différents et doit donc être mis en oeuvre dans chaque expérience en parallèle avec l'échantillon cible.The results were recorded and reported in graphical form in FIG. 2. It appears that the variability of the results is very important from one experiment to another. Again, it is clear that the standard would give different results and must therefore be implemented in each experiment in parallel with the target sample.
Ainsi, pour chaque input d'ARN constant (nombre de copies), il existe d'après les courbes de la figure 2 un large intervalle de concentrations de produit d'ACP d'une expérience à l'autre.Thus, for each constant RNA input (number of copies), there exists according to the curves of FIG. 2 a wide range of PCR product concentrations from experiment to experiment.
Exemple 3 : Validation d'un étalon d'ADN de virion. Cet exemple illustre l'identité d'efficacité de l'amplification par des cycles d'ACP identiques d'ADN de virion de VHB natif provenant de sérums de différents patients infectés par VHB. Des dilutions en série d'échantillons de différents ADN de virion de VHB préparés comme indiqué dans l'exemple 1 ont été soumises à un même nombre de cycles d'ACP dans la même expérience. Le produit d'ACP (output) a été quantifié par dot blot et comptage de cpm.Example 3: Validation of a virion DNA standard. This example illustrates the identity of the efficiency of amplification by identical PCR cycles of native HBV virion DNA from sera from different patients infected with HBV. Serial dilutions of samples of different HBV virion DNAs prepared as shown in Example 1 were subjected to the same number of PCR cycles in the same experiment. The product of ACP (output) was quantified by dot blot and counting of cpm.
Les résultats reportés sous forme graphique sur la figure 3 montrent que l'efficacité d'amplification par ACP est identique quelle que soit la source du virion VHB (ici pour quatre sources différentes) .The results reported in graphical form in FIG. 3 show that the amplification efficiency by PCR is identical whatever the source of the HBV virion (here for four different sources).
Exemple 4 : Validation d'un étalon d'ADN de virion. En procédant comme indiqué dans l'exemple 3, mais en mettant en oeuvre à chaque fois dans les mêmes cycles d'ACP un ADN de virion natif et des ADN issus de deux plasmides VHB (input) , on a pu établir les efficacités comparées de l'amplification par ACP (voir figure 4) . Des fragments d'ADN de la séquence de gène C de VHB ont été produits par ACP à partir de sérums de HBVsAg+ et ligaturés dans des plasmides pGEM-3Z (Promega) et pCT®Example 4: Validation of a virion DNA standard. By proceeding as indicated in Example 3, but each time using in the same PCR cycles a native virion DNA and DNAs originating from two HBV plasmids (input), it was possible to establish the compared efficiencies of amplification by PCR (see Figure 4). DNA fragments of the HBV gene C sequence were produced by PCR from HBVsAg + sera and ligated into plasmids pGEM-3Z (Promega) and pCT®
(Invitrogen) (respectivement plasmide ADN1 et ADN2 de(Invitrogen) (plasmid DNA1 and DNA2 of
VHB) . Tous les construits ont été confirmés par séquençage d'ADN au moyen d'un kit commercial approprié.VHB). All constructs were confirmed by DNA sequencing using an appropriate commercial kit.
Les résultats reportés sous forme graphique sur la figure 4 montrent qu'un nombre connu de copies peut avoir ou non une efficacité d'amplification comparable à celle d'un nombre de copies identique d'ADN viral natif issu de plusieurs échantillons. Il ressort ainsi des exemples 3 et 4 que des concentrations connues d'ADN de virion VHB de différentes provenances constituent un étalon universel idéal, alors que des fragments d'ADN viral intégrés dans des plasmides différents ont des comportements différents entre eux et différents des ADN natifs.The results reported in graphical form in FIG. 4 show that a known number of copies may or may not have an amplification efficiency comparable to that of an identical number of copies of native viral DNA from several samples. It thus emerges from Examples 3 and 4 that known concentrations of HBV virion DNA from different origins constitute an ideal universal standard, whereas fragments of viral DNA integrated into different plasmids have different behaviors between them and different from DNAs natives.
Exemple 5: Validation d'un étalon d'ARN de virion.Example 5: Validation of a virion RNA standard.
Cet exemple illustre l'identité d'efficacité de l'amplification par des cycles de TR-ACP identiques d'ARN de virion de VIH natif provenant de sérums de différents patients infectés par du VIH. Des dilutions en série d'échantillons de différents ARN de virion de VIH préparés comme indiqué dans l'exemple 2 ont été soumises à un cycle de TR-ACP dans la même expérience. Le produit d'ACP (output) a été quantifié par dot blot et comptage de cpm. Les résultats reportés sous forme graphique sur la figure 5 montrent que l'efficacité d'amplification par TR- ACP est identique quelle que soit la source du virion VIH.This example illustrates the identity of the efficiency of amplification by identical TR-ACP cycles of native HIV virion RNA from sera from different patients infected with HIV. Serial dilutions of samples of different HIV virion RNAs prepared as shown in Example 2 were subjected to a TR-ACP cycle in the same experiment. The product of ACP (output) was quantified by dot blot and counting of cpm. The results reported in graphical form in FIG. 5 show that the amplification efficiency by TR-ACP is identical whatever the source of the HIV virion.
Exemple 6: Validation d'un étalon d'ARN de virion.Example 6: Validation of a virion RNA standard.
En procédant comme indiqué dans l'exemple 5, mais en mettant en oeuvre à chaque fois dans les mêmes cycles de TR-ACP un ARN de virion natif et un ARN de transcrit avec un nombre connu de copies (input), on a pu établir les efficacités comparées de l'amplification par TR-ACP (voir figure 6) .By proceeding as indicated in example 5, but each time using in the same TR-ACP cycles a native virion RNA and a transcribed RNA with a known number of copies (input), it was possible to establish the comparative efficiencies of amplification by TR-ACP (see Figure 6).
Des fragments d'ARN de séquence gag de VIH-1 ont été produits par transcription de matrices d'ADN de VIH-1 (respectivement plasmide pBR322 d'ADN de VIH-Z6 et plasmide ρBHlO-R3 d'ADN de VIHΠIB) avec de l'ARN polymerase de T7 (respectivement transcrits ARN1 et ARN2 de VIH) .HIV-1 gag sequence RNA fragments were produced by transcription of HIV-1 DNA templates (plasmid pBR322 of HIV-Z6 DNA and plasmid ρBHlO-R3 of HIVΠIB DNA) with T7 RNA polymerase (HIV RNA1 and RNA2 transcribed respectively).
Les résultats reportés sous forme graphique sur la figure 6 montrent qu'un ARN de transcrit ayant un nombre connu de copies a une efficacité d'amplification par TR- ACP différente de celle d'un ARN d'échantillon.The results reported in graphical form in FIG. 6 show that a transcript RNA having a number known from copies has an amplification efficiency by TR-ACP different from that of a sample RNA.
Il ressort ainsi des exemples 5 et 6 que des concentrations connues d'ARN de virion VIH de différentes provenances constituent un étalon universel idéal, alors que des fragments d'ARN viral intégrés dans des plasmides différents ont des comportements différents entre eux et différents des ARN natifs. Ainsi : - l'utilisation selon l'invention d'ADN de virion comme étalon externe est de loin plus précise et commode que celle d'un ADN de plasmide servant d'étalon externe ou interne pour le suivi de l'efficacité de l'amplification dans un essai d'ACP quantitative; - l'utilisation selon l'invention d'ARN de virion comme étalon externe est de loin plus précise et commode que celle d'un ARN de transcrit servant d'étalon externe ou interne pour le suivi de l'efficacité de l'amplification dans un essai de TR-ACP quantitative.It thus emerges from Examples 5 and 6 that known concentrations of HIV virion RNA from different origins constitute an ideal universal standard, whereas fragments of viral RNA integrated into different plasmids have different behaviors between them and different from RNA natives. Thus: the use according to the invention of virion DNA as an external standard is far more precise and convenient than that of a plasmid DNA serving as an external or internal standard for monitoring the effectiveness of the amplification in a quantitative PCR assay; the use according to the invention of virion RNA as an external standard is far more precise and convenient than that of a transcribed RNA serving as an external or internal standard for monitoring the efficiency of amplification in a quantitative TR-ACP trial.
Exemple 7 : Kit de quantification du génome du virus de 1 ' immunodéficience humaine (VIH) pour détection par visualisationEXAMPLE 7 Kit for Quantifying the Genome of the Human Immunodeficiency Virus (HIV) for Detection by Visualization
7.1. INTRODUCTION7.1. INTRODUCTION
Un kit de quantification du génome du virus de 1 ' immunodéficience humaine (VIH) selon la présente invention a été conçu pour la détection et la quantification d'ARN génomique de VIH (y compris tous les génotypes VIH-0, VIH-1 et VIH-2) dans tous fluides biologiques exempts de cellules (tels que plasma, sérum, liquide séminal, fluide de lavage broncho-alvéolaire, etc.), ainsi que les surnageants de culture. On y a inclus des réactifs pour permettre d'isoler l'ARN viral par une méthode rapide - la transcription réverse de l'ARN de virion VIH en ADNc au moyen de transcriptase réverse du virus de leucémie murine de Moloney clone - l'amplifica¬ tion utilisant alors de la Taq ADN polymerase - et finalement la détection quantitative par une procédure simple de visualisation sur gel d'agarose, qui permettait une limite de détection de 1000 copies d'ARN viral et une gamme de quantification de plus de 4 ordres de grandeur en un seul test en 8 heures. Suffisamment de réactifs étaient fournis pour 100 réactions (40 μl chacune) dans un protocole avec volume final de 50 μl .A kit for quantifying the genome of the human immunodeficiency virus (HIV) according to the present invention was designed for the detection and quantification of HIV genomic RNA (including all the genotypes HIV-0, HIV-1 and HIV -2) in all biological fluids free from cells (such as plasma, serum, seminal fluid, bronchoalveolar lavage fluid, etc.), as well as culture supernatants. Reagents have been included to allow viral RNA to be isolated by a rapid method - reverse transcription of RNA from HIV virion into cDNA by means of reverse transcriptase from the cloned Moloney murine leukemia virus - the amplification then using Taq DNA polymerase - and finally quantitative detection by a simple visualization procedure on agarose gel, which allowed a detection limit of 1000 copies of viral RNA and a quantification range of more than 4 orders of magnitude in a single test in 8 hours. Sufficient reagents were provided for 100 reactions (40 μl each) in a protocol with a final volume of 50 μl.
Le kit contenait un ensemble d'étalons de virion VIH (ci-après "VirionStandard" ) comme expliqué plus haut (IO4, IO3, IO2 et 10 copies/μl, fournis pour 4 séries de tests) , qui permettaient une mesure précise de la concentration d'ARN de virion VIH du plasma/sérum. Le kit contenait également un ADN de VIH de plasmide (IO2 copies par réaction, pour 4 séries de tests), qui servait de contrôle de signal d'amplification positif, ainsi qu'en option un ARN de tanscrit hétérologue, ajouté à chacun des échantillons à examiner et servant de contrôle interne (ci-après "CI") (IO3 copies par réaction, fourni pour 100 réactions) . 7.2. LISTE DES COMPOSANTS DU KITThe kit contained a set of HIV virion standards (hereinafter "VirionStandard") as explained above (IO 4 , IO 3 , IO 2 and 10 copies / μl, supplied for 4 series of tests), which allowed a measurement precise concentration of HIV virion RNA in plasma / serum. The kit also contained a plasmid HIV DNA (IO 2 copies per reaction, for 4 series of tests), which served as a positive amplification signal control, as well as optionally a heterologous transcribed RNA, added to each of the samples to be examined and used as internal control (hereinafter "CI") (IO 3 copies per reaction, supplied for 100 reactions). 7.2. LIST OF KIT COMPONENTS
Le kit de quantification de génome de VIH doit de préférence être conservé à -20°C dans un congélateur à température constante ou à 4°C avec utilisation d'une solution de conservation d'enzyme appropriée. S'il est stocké dans des conditions appropriées, le produit reste stable jusqu'à une date de contrôle imprimée sur une étiquette. OThe HIV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label. O
~4~ 4
No. Réactif Volume Quantité Commentaires e>Reagent No. Volume Quantity Comments e>
UlUl
1 VirionStandard de VIH la VirionStandard 1 (10^ copies/μl) 0,4 ml Calibre l'ARN d'échantillon lb VirionStandard 2 (IO3 copies/μl) 0,4 ml Calibre l'ARN d'échantillon le VirionStandard 3 (IO2 copies/μl) 0,4 ml Calibre l'ARN d'échantillon ld VirionStandard 4 (10 copies/μl) 0,4 ml Calibre l'ARN d'échantillon le VirionStandard 5 (sérum négatif au VIH) 0,4 ml Contrôle de spécificité (négatif)1 VirionStandard of HIV VirionStandard 1 (10 ^ copies / μl) 0.4 ml Calibrates the sample RNA lb VirionStandard 2 (IO 3 copies / μl) 0.4 ml Calibrates the sample RNA the VirionStandard 3 ( IO 2 copies / μl) 0.4 ml Caliber sample RNA ld VirionStandard 4 (10 copies / μl) 0.4 ml Caliber sample RNA VirionStandard 5 (HIV negative serum) 0.4 ml Specificity check (negative)
2 ARNt (0,1 mg/ml) 1 ml Sert d'ARN support pour l'ARN d'échantillon2 tRNA (0.1 mg / ml) 1 ml Serves as supporting RNA for the sample RNA
3 Tampon de réserve d'ARN 250 μl 4 Dissout les échantillons d'ARN3 250 μl RNA reserve buffer 4 Dissolves the RNA samples
4 Mélange d'amplification de VIH, avec amorces 1 ml 4 S'hybride à l'ARN de VIH et aux génomes de VIH et amorces de CI, éventuellement d'ADNc t-υ o4 HIV amplification mixture, with primers 1 ml 4 Hybridizes with HIV RNA and HIV genomes and CI primers, possibly cDNA t-υ o
5 Mélange enzymatique 28 μl 4 Rétrotranscrit l'ARN de cible et amplifie l'ADNc5 Enzyme Mixture 4 28 .mu.l reverse transcribed target RNA and amplifying cDNA
6 ADN de VIH de plasmide (IO2 copies d'ADN/μl) 40 μl 1 Contrôle de signal (positif) d'ADNc de VIH6 HIV plasmid DNA (IO 2 copies of DNA / μl) 40 μl 1 Signal control (positive) of HIV cDNA
7 CI optimal (103 copies/μl) 1 ml 1 Contrôle interne d'efficacité d'amplification liée à la TR7 optimal CI (10 3 copies / μl) 1 ml 1 Internal control of amplification efficiency linked to RT
8 Eau passée à l'autoclave 40 μl 1 Contrôle de signal (négatif) de fond8 Autoclaved water 40 μl 1 Bottom signal (negative) control
OO
-J-J
OJOJ
Ov Ov
7.3. REACTIFS ET EQUIPEMENTS7.3. REAGENTS AND EQUIPMENT
7.3.1. REACTIFS7.3.1. REAGENTS
- Chloroforme (pur pour analyses)- Chloroform (pure for analyzes)
- Isopropanol (pur pour analyses) - Ethanol à 75 % (pur pour analyses)- Isopropanol (pure for analyzes) - Ethanol at 75% (pure for analyzes)
- Agarose (exempt de DNase)- Agarose (free of DNase)
- Bromure d'éthidium- Ethidium bromide
- Solution d'isolement d'ARN- RNA isolation solution
7.3.2. EQUIPEMENTS - Centrifugeuse à microtube (4°C)7.3.2. EQUIPMENT - Microtube centrifuge (4 ° C)
- Installation de mise sous vide- Vacuum installation
- Appareil pour cycle thermique à couvercle chauffant- Apparatus for thermal cycle with heated lid
- Générateur et bain pour électrophorèse- Generator and bath for electrophoresis
7.4. PROTOCOLE POUR QUANTIFICATION DE VIH PAR AMPLIFICATION DE GENOME LIEE A TRANSCRIPTION REVERSE7.4. PROTOCOL FOR QUANTIFICATION OF HIV BY REVERSE TRANSCRIPTION-LINKED GENOME AMPLIFICATION
7.4.1. EXTRACTION D'ARN7.4.1. RNA EXTRACTION
100 μl d'échantillons de VirionStandard de VIH et de plasma ou de sérum ont été homogénéisés avec 400 μl de solution d'isolement d'ARN, avec quelques oscillations dans un homogeneiseur. 60 μl de chloroforme ont été ajoutés et on a agité vigoureusement pendant 15 secondes et laissé reposer sur de la glace pendant 10 minutes. La suspension a été centrifugée à 12.000 g à 4°C pendant 15 minutes . Après addition de chloroforme et centrifugation, il se formait deux phases: la phase phénol-chloroformique inférieure (~240 μl) et la phase aqueuse supérieure (~320 μl) . Les ARN restaient exclusivement dans la phase aqueuse, tandis que les ADN et les protéines étaient dans l' interphase et dans la phase organique.100 μl of VirionStandard samples of HIV and plasma or serum were homogenized with 400 μl of RNA isolation solution, with a few oscillations in a homogenizer. 60 μl of chloroform were added and the mixture was stirred vigorously for 15 seconds and left to stand on ice for 10 minutes. The suspension was centrifuged at 12,000 g at 4 ° C for 15 minutes. After addition of chloroform and centrifugation, two phases were formed: the lower phenol-chloroform phase (~ 240 μl) and the upper aqueous phase (~ 320 μl). The RNAs remained exclusively in the aqueous phase, while the DNAs and proteins were in the interphase and in the organic phase.
La phase aqeuse (300 μl) a été transférée dans de nouveaux tubes. Un volume égal d' isopropanol a été ajouté et les échantillons ont été conservés à -20°C pendant 1 heure. Les échantillons ont été centrifugés pendant 10 minutes à 12.000 g (4°C) et le pellet (pastille) a été brièvement séché. Le surnageant a été éliminé, le pellet d'ARN a été lavé une fois avec de l'éthanol à 75% (500 μl) sous l'effet d'un vortex, et finalement le pellet d'ARN a été séché sous vide. Le pellet d'ARN a été dissous dans 11 μl de tampon de réserve d'ARN.The aqueous phase (300 μl) was transferred to new tubes. An equal volume of isopropanol was added and the samples were stored at -20 ° C for 1 hour. The samples were centrifuged for 10 minutes at 12,000 g (4 ° C) and the pellet was briefly dried. The supernatant was removed, the RNA pellet was washed once with 75% ethanol (500 μl) under the effect of a vortex, and finally the RNA pellet was dried under vacuum. The RNA pellet was dissolved in 11 μl of RNA reserve buffer.
Le précipité d'ARN formait un pellet blanc-jaune (visible seulement en grande quantité) au fond du tube. Il est important de ne pas laisser le pellet d'ARN sécher complètement, car le séchage diminue fortement sa solubilité.The RNA precipitate formed a white-yellow pellet (visible only in large quantities) at the bottom of the tube. It is important not to let the RNA pellet dry completely, as drying greatly decreases its solubility.
7.4.2. TRANSCRIPTION REVERSE D'ARN ET AMPLIFICATION D'ADNc7.4.2. REVERSE RNA TRANSCRIPTION AND cDNA AMPLIFICATION
10 μl d'échantillons d'ARN et de contrôles positif/- négatif ont été ajoutés dans de nouveaux tubes (200 μl) . 40 μl de mélange de transcription réverse/amplification (MTRA) (38,9 μl de mélange d'amplification de VIH + 1,1 μl de mélange enzymatique) ont été placés dans chaque tube. Les tubes ont été transférés dans un appareil fournissant un cycle thermique (dénommé commercialement Thermal Cycler) , à couvercle chauffant. - 42°C pendant 25 minutes;10 μl of RNA samples and positive / - negative controls were added to new tubes (200 μl). 40 μl of reverse transcription / amplification mixture (MTRA) (38.9 μl of HIV amplification mixture + 1.1 μl of enzyme mixture) were placed in each tube. The tubes were transferred to an apparatus providing a thermal cycle (commercially called Thermal Cycler), with a heated cover. - 42 ° C for 25 minutes;
- 94°C pendant 5 minutes;- 94 ° C for 5 minutes;
- 35 cycles (94°C pendant 35 s, 55°C pendant 45 s et- 35 cycles (94 ° C for 35 s, 55 ° C for 45 s and
72°C pendant 60 s) ;72 ° C for 60 s);
- puis 55°C pendant 5 minutes et ensuite 72°C pendant 5 minutes.- then 55 ° C for 5 minutes and then 72 ° C for 5 minutes.
7.5. VISUALISATION ET QUANTIFICATION7.5. VISUALIZATION AND QUANTIFICATION
10 μl du mélange post-réactionnel ont été distribués sur du gel d'agarose à 1,5% contenant 0,5 μg/ml de bromure d'éthidium et on a effectué une électrophorèse sous 150 V pendant 10 minutes.10 μl of the post-reaction mixture were distributed over 1.5% agarose gel containing 0.5 μg / ml of ethidium bromide and electrophoresis was carried out at 150 V for 10 minutes.
Les séquences de VIH spécifiquement amplifiées pouvaient être visualisées aisément par différences de taille. Les gammes de copies d'ARN de viron VIH dans 100 μl d'échantillons de plasma/sérum pouvaient être estimées par comparaison de leurs bandes d'amplification avec celles du VirionStandard de VIH (semi-quantification) .The specifically amplified HIV sequences could be easily viewed by size differences. The ranges of copies of HIV-related RNA in 100 μl of plasma / serum samples could be estimated by comparison of their amplification bands with those of HIV VirionStandard (semi-quantification).
Exemple 8: Kit de quantification de génome de virus d' immunodéficience humaine (VIH) pour détection avec un lecteur de densité optiqueEXAMPLE 8 Human Immunodeficiency Virus (HIV) Genome Quantification Kit for Detection with an Optical Density Reader
8.1. INTRODUCTION8.1. INTRODUCTION
Un kit de quantification du génome du virus de 1 ' immunodéficience humaine (VIH) selon la présente invention a été conçu pour la détection et la quantification d'ARN génomique de VIH (y compris tous les génotypes VIH-0, VIH-1 et VIH-2) dans tous fluides biologiques exempts de cellules (tels que plasma, sérum, liquide séminal, fluide de lavage broncho-alvéolaire, etc.), ainsi que les surnageants de culture. On y a inclus des réactifs pour permettre d'isoler l'ARN viral par une méthode rapide - la transcription reverse de l'ARN de virion VIH en ADNc au moyen de transcriptase réverse du virus de leucémie murine de Moloney clone - l'amplifica¬ tion utilisant alors de la Taq ADN polymerase - et finalement la détection quantitative par une procédure d'hybridation liquide liée à la DIG (digoxigénine) , qui permettait une limite de détection de 100 copies d'ARN viral et une gamme de quantification d'environ 2 ordres de grandeur en un seul test en 8 heures. Suffisamment de réactifs étaient fournis pour 100 réactions (40 μl chacune) dans un protocole avec volume final de 50 μl .A kit for quantifying the genome of the human immunodeficiency virus (HIV) according to the present invention was designed for the detection and quantification of HIV genomic RNA (including all the genotypes HIV-0, HIV-1 and HIV -2) in all biological fluids free from cells (such as plasma, serum, seminal fluid, bronchoalveolar lavage fluid, etc.), as well as culture supernatants. Reagents have been included to allow viral RNA to be isolated by a rapid method - reverse transcription of HIV virion RNA into cDNA using reverse transcriptase from cloned Moloney murine leukemia virus - the amplifica¬ tion then using Taq DNA polymerase - and finally quantitative detection by a liquid hybridization procedure linked to DIG (digoxigenin), which allowed a detection limit of 100 copies of viral RNA and a quantification range of approximately 2 orders of magnitude in a single test in 8 hours. Sufficient reagents were provided for 100 reactions (40 μl each) in a protocol with a final volume of 50 μl.
Le kit contenait un ensemble d'étalons de virion VIH "VirionStandard" (IO3, 102, 10 et 1 copies/μl, fournis pour 4 séries de tests) , qui permettaient une mesure précise de la concentration d'ARN de virion VIH du plasma/sérum. Le kit contenait également un ADN de VIH de plasmide (IO2 copies par réaction pour 4 séries de tests) , qui servait de contrôle de signal d'amplification positif. ainsi qu'en option un ARN de tanscrit hétérologue, ajouté à chacun des échantillons à examiner et servant de contrôle interne "CI" (IO3 copies par réaction, fourni pour 100 réactions) . 8.2. LISTE DES COMPOSANTS DU KITThe kit contained a set of HIV virion standards "VirionStandard" (IO 3 , 10 2 , 10 and 1 copies / μl, supplied for 4 series of tests), which allowed an accurate measurement of the concentration of HIV virion RNA plasma / serum. The kit also contained a plasmid HIV DNA (IO 2 copies per reaction for 4 sets of tests), which served as a positive amplification signal control. as well as an optional heterologous transcript RNA, added to each of the samples to be examined and serving as internal control "CI" (IO 3 copies per reaction, supplied for 100 reactions). 8.2. LIST OF KIT COMPONENTS
Le kit de quantification de génome de VIH doit de préférence être conservé à -20°C dans un congélateur à température constante ou à 4°C avec utilisation d'une solution de conservation d'enzyme appropriée. S'il est stocké dans des conditions appropriées, le produit reste stable jusqu'à une date de contrôle imprimée sur une étiquette. The HIV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label.
O yoO y o
No. Réactif Volume Quantité CommentairesNo. Reagent Volume Quantity Comments
I Amplification de génome de VIH liée à une transcription réverse (TR) et marquage par DIGI Amplification of the HIV genome linked to reverse transcription (TR) and labeling with DIG
1 VirionStandard de VIH la VirionStandard 1 (IO3 copies/μl) 0,4 ml Calibre l'ARN d'échantillon lb VirionStandard 2 (IO2 copies/μl) 0,4 ml Calibre l'ARN d'échantillon le VirionStandard 3 (10 copies/μl) 0,4 ml Calibre l'ARN d'échantillon ld VirionStandard 4 (1 copie/μl) 0,4 ml Calibre l'ARN d'échantillon le VirionStandard 5 (sérum négatif auVIH) 0,4 ml Contrôle de spécificité (négatif)1 HIV VirionStandard VirionStandard 1 (IO 3 copies / μl) 0.4 ml Calibrates the sample RNA lb VirionStandard 2 (IO 2 copies / μl) 0.4 ml Caliber the sample RNA the VirionStandard 3 ( 10 copies / μl) 0.4 ml Calibrate the sample RNA ld VirionStandard 4 (1 copy / μl) 0.4 ml Calibrate the sample RNA the VirionStandard 5 (HIV negative serum) 0.4 ml Control specificity (negative)
2 ARNt (0,1 mg/ml) 1 ml Sert d'ARN support pour l'ARN d'échantillon2 tRNA (0.1 mg / ml) 1 ml Serves as supporting RNA for the sample RNA
3 Tampon de réserve d'ARN 250 μl Dissout les échantillons d'ARN rO3 250 μl RNA reserve buffer Dissolves the rO RNA samples
4 Mélange d'amplification de VIH, avec amorces 1 ml S'hybride à l'ARN de VIH et aux génomes LΠ de VIH et CI, (5% de DIG-dUTP) d'ADNc4 HIV amplification mixture, with primers 1 ml Hybridizes with HIV RNA and LΠ genomes of HIV and CI, (5% DIG-dUTP) of cDNA
5 Mélange enzymatique 28 μl Rétrotranscrit l'ARN de cible et amplifie l'ADNc5 Enzymatic mixture 28 μl Retrotranscribes the target RNA and amplifies the cDNA
6 ADN de VIH de plasmide (102 copies d'ADN/μl) 40 μl 1 Contrôle de signal (positif) d'ADNc de VIH6 HIV plasmid DNA (10 2 copies of DNA / μl) 40 μl 1 Signal control (positive) of HIV cDNA
7 ADN de transcrit hétérologue (10 copies/μl) 1 ml 1 Contrôle interne d'efficacité d'amplification liée à TR7 heterologous transcript DNA (10 copies / μl) 1 ml 1 Internal control of amplification efficiency linked to TR
8 Eau passée à l'autoclave 40 μl 1 Contrôle de signal (négatif) de fond8 Autoclaved water 40 μl 1 Bottom signal (negative) control
II Hybridation liquide et détection par DIG ΌII Liquid hybridization and detection by DIG Ό
OO
9 Sonde de VIH biotinylée 200 μl 1 Capture d'ADNc de VIH en hybridation liquide H9 Biotinylated HIV probe 200 μl 1 Capture of HIV cDNA in liquid hybridization H
10 Contrôle interne biotinylé, 100 μl 1 Capture d'ADNc de CI en hybridation liquide 50 sonde spécifique d'ADN10 Biotinylated internal control, 100 μl 1 Capture of CI cDNA in liquid hybridization 50 specific DNA probe
<\<\
UiUi
0\ 0 \
O •oO • o
11 Tampon de dénaturation 4 ml 1 Permet dénaturation d'ADNds amplifié 0\11 Denaturation buffer 4 ml 1 Allows denaturation of amplified dds 0 \
12 Tampon d'hybridation 40 ml 1 Permet hybridation de la sonde à l'ADN de cible12 Hybridization buffer 40 ml 1 Allows hybridization of the probe to the target DNA
13 Tampon de lavage (lOx) 50 ml 1 Elimine l'ADN non-spécifique13 Wash buffer (10x) 50 ml 1 Eliminate non-specific DNA
14 Billes revêtues de streptavidine (ou microplaque) 200 (8 puits) 1 (24) Capture d'ADNc de VIH hybride en hybridation liquide14 Streptavidin coated beads (or microplate) 200 (8 wells) 1 (24) Capture of hybrid HIV cDNA in liquid hybridization
15 Solution de travail anti-DIG-POD 40 ml 1 Se fixe aux molécules DIG du produit spécifiquement amplifié15 Anti-DIG-POD working solution 40 ml 1 Attaches to the DIG molecules of the specifically amplified product
16 Solution de substrat ABTS 40 ml Permet le développement de couleur en système POD16 ABTS 40 ml substrate solution Allows color development in POD system
O HOH
-4-4
Ul Oi Ul Oi
8.3. REACTIFS ET EQUIPEMENTS8.3. REAGENTS AND EQUIPMENT
8.3.1. REACTIFS8.3.1. REAGENTS
- Chloroforme (pur pour analyses)- Chloroform (pure for analyzes)
- Isopropanol (pur pour analyses) - Ethanol à 75 % (pur pour analyses)- Isopropanol (pure for analyzes) - Ethanol at 75% (pure for analyzes)
- Solution d'isolement d'ARN- RNA isolation solution
- Microplaque revêtue de streptavidine- Streptavidin coated microplate
8.3.2. EQUIPEMENTS8.3.2. EQUIPMENT
- Centrifugeuse à microtube (4°C) - Installation de mise sous vide- Microtube centrifuge (4 ° C) - Vacuum installation
- Appareil pour cycle thermique à couvercle chauffant- Apparatus for thermal cycle with heated lid
- Bain-mane ou incubateur pour hybridation liquide- Bain-mane or incubator for liquid hybridization
- Lecteur de densité optique automatisé- Automated optical density reader
8.4. PROTOCOLE POUR QUANTIFICATION DE VIH PAR AMPLIFICATION DE GENOME LIEE A TRANSCRIPTION REVERSE8.4. PROTOCOL FOR QUANTIFICATION OF HIV BY REVERSE TRANSCRIPTION-LINKED GENOME AMPLIFICATION
8.4.1. EXTRACTION D'ARN8.4.1. RNA EXTRACTION
100 μl d'échantillons de VirionStandard de VIH et de plasma ou de sérum ont été homogénéisés avec 400 μl de solution d'isolement d'ARN, avec quelques oscillations dans un homogeneiseur. 60 μl de chloroforme ont été ajoutés et on a agité vigoureusement pendant 15 secondes et laissé reposer sur de la glace pendant 10 minutes. La suspension a été centrifugée à 12.000 g à 4°C pendant 15 minutes . Après addition de chloroforme et centrifugation, il se formait deux phases: la phase phénol-chloroformique inférieure (~240 μl) et la phase aqueuse supérieure (-320 μl) . Les ARN restaient exclusivement dans la phase aqueuse, tandis que les ADN et les protéines étaient dans l' interphase et dans la phase organique.100 μl of VirionStandard samples of HIV and plasma or serum were homogenized with 400 μl of RNA isolation solution, with a few oscillations in a homogenizer. 60 μl of chloroform were added and the mixture was stirred vigorously for 15 seconds and left to stand on ice for 10 minutes. The suspension was centrifuged at 12,000 g at 4 ° C for 15 minutes. After addition of chloroform and centrifugation, two phases were formed: the lower phenol-chloroform phase (~ 240 μl) and the upper aqueous phase (-320 μl). The RNAs remained exclusively in the aqueous phase, while the DNAs and proteins were in the interphase and in the organic phase.
La phase aqeuse (300 μl) a été transférée dans des nouveaux tubes. Un volume égal d' isopropanol a été ajouté et les échantillons ont été conservés à -20°C pendant 1 heure. Les échantillons ont été centrifugés pendant 10 minutes à 12.000 g (4°C) et le pellet (pastille) a été brièvement séché. Le surnageant a été éliminé, le pellet d'ARN a été lavé une fois avec de l'éthanol à 75% (500 μl) sous l'effet d'un vortex, et finalement le pellet d'ARN a été séché sous vide. Le pellet d'ARN a été dissous dans 11 μl de tampon de réserve d'ARN.The aqueous phase (300 μl) was transferred to new tubes. An equal volume of isopropanol was added and the samples were stored at -20 ° C for 1 hour. The samples were centrifuged for 10 minutes at 12,000 g (4 ° C) and the pellet was briefly dried. The supernatant was removed, the RNA pellet was washed once with 75% ethanol (500 μl) under the effect of a vortex, and finally the RNA pellet was dried under vacuum. The RNA pellet was dissolved in 11 μl of RNA reserve buffer.
Le précipité d'ARN formait un pellet blanc-jaune (visible seulement en grande quantité) au fond du tube. Il est important de ne pas laisser le pellet d'ARN sécher complètement, car le séchage diminue fortement sa solubilité.The RNA precipitate formed a white-yellow pellet (visible only in large quantities) at the bottom of the tube. It is important not to let the RNA pellet dry completely, as drying greatly decreases its solubility.
8.4.2. TRANSCRIPTION REVERSE D'ARN ET AMPLIFICATION D'ADNc8.4.2. REVERSE RNA TRANSCRIPTION AND cDNA AMPLIFICATION
10 μl d'échantillons d'ARN et de contrôles positif/- négatif ont été ajoutés dans de nouveaux tubes (200 μl ) . 40 μl de mélange de transcription réverse/amplification (MTRA) (38,7 μl de mélange d'amplification de VIH + 1,1 μl de mélange enzymatique + 0,2 μl de DIG-dUTP) ont été placés dans chaque tube. Les tubes ont été transférés dans un appareil fournissant un cycle thermique, à couvercle chauffant . - 42°C pendant 25 minutes;10 μl of RNA samples and positive / - negative controls were added to new tubes (200 μl). 40 μl of reverse transcription / amplification mixture (MTRA) (38.7 μl of HIV amplification mixture + 1.1 μl of enzymatic mixture + 0.2 μl of DIG-dUTP) were placed in each tube. The tubes were transferred to an apparatus providing a thermal cycle, with a heated cover. - 42 ° C for 25 minutes;
- 94°C pendant 5 minutes;- 94 ° C for 5 minutes;
- 36 cycles (94°C pendant 35 s, 55°C pendant 45 s et- 36 cycles (94 ° C for 35 s, 55 ° C for 45 s and
72°C pendant 60 s) ;72 ° C for 60 s);
- puis 55°C pendant 5 minutes et ensuite 72°C pendant 5 minutes.- then 55 ° C for 5 minutes and then 72 ° C for 5 minutes.
8.5. DETECTION ET QUANTIFICATION8.5. DETECTION AND QUANTIFICATION
2 μl de produit amplifié (x2) et une dilution par 10 fois (x2) ont été ajoutés dans de nouveaux tubes et mélangés avec 18 μl de solution de dénaturation à température ambiante pendant 10 minutes. Après addition jusqu'à 180 μl de solution d'hybridation (x4) contenant une sonde de VIH et une sonde de CI, vortex, puis transfert à la pipette dans un puits d'une microplaque revêtue de streptavidine, puis 2 heures d'incubation à 37°C sur une secoueuse, la solution a été jetée et chaque puits ou alvéole a été lavé 3 fois avec 200 μl de tampon de lavage, 200 μl de solution de substrat ABTS ont été ajoutés dans chaque puits, suivis d'une incubation de 30 minutes à 37°C avec agitation. La plaque a été maintenue dans l'obscurité pendant l'incubation. On a lu l'absorbance à 405 nm. Les nombres de particules de VIH par ml de chaque échantillon de plasma/sérum peuvent être enregistrés par un système automatique informatisé utilisant une courbe étalon générée à partir du VirionStandard de VIH (quantification absolue) .2 μl of amplified product (x2) and a 10-fold dilution (x2) were added to new tubes and mixed with 18 μl of denaturation solution at room temperature for 10 minutes. After adding up to 180 μl of hybridization solution (x4) containing an HIV probe and a CI probe, vortex, then transfer with a pipette to a well of a microplate coated with streptavidin, then 2 hours of incubation at 37 ° C on a shaker, the solution was discarded and each well or cell was washed 3 times with 200 μl of washing buffer, 200 μl of ABTS substrate solution were added to each well, followed by an incubation of 30 minutes at 37 ° C with shaking. The plate was kept in the dark during the incubation. The absorbance was read at 405 nm. The numbers of HIV particles per ml of each plasma / serum sample can be recorded by a computerized automatic system using a standard curve generated from the HIV VirionStandard (absolute quantification).
Exemple 9 : Kit de quantification de génome de virus d' immunodéficience humaine (VIH) pour détection par fluorescenceEXAMPLE 9 Human Immunodeficiency Virus (HIV) Genome Quantification Kit for Fluorescence Detection
9.1. INTRODUCTION9.1. INTRODUCTION
Un kit de quantification du génome du virus de 1 ' immunodéf icience humaine (VIH) selon la présente invention a été conçu et mis en oeuvre sensiblement comme décrit dans l 'exemple 8, sauf que la gamme de quantification était de plus de 4 ordres de grandeur en un seul test en 7 heures.A kit for quantifying the genome of the human immunodeficiency virus (HIV) according to the present invention was designed and implemented substantially as described in Example 8, except that the range of quantification was more than 4 orders of greatness in a single test in 7 hours.
9.2. LISTE DES COMPOSANTS DU KIT9.2. LIST OF KIT COMPONENTS
Le kit de quantification de génome de VIH doit de préférence être conservé à -20°C dans un congélateur à température constante ou à 4°C avec utilisation d'une solution de conservation d'enzyme appropriée. S'il est stocké dans des conditions appropriées, le produit reste stable jusqu'à une date de contrôle imprimée sur une étiquette. 3The HIV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label. 3
OO
No. Réactif Volume Quantité Commentaires 0\ UlNo. Reagent Volume Quantity Comments 0 \ Ul
I Amplification de génome de VIH liée à une transcription réverse (TR)I Amplification of the HIV genome linked to reverse transcription (TR)
1 VirionStandard de VIH la VirionStandard 1 (1CP copies/μl) 0,4 ml Calibre l'ARN d'échantillon lb VirionStandard 2 (IO2 copies/μl) 0,4 ml Calibre l'ARN d'échantillon le VirionStandard 3 (10 copies/μl) 0,4 ml Calibre l'ARN d'échantillon ld VirionStandard 4 (1 copie/μl) 0,4 ml Calibre l'ARN d'échantillon le VirionStandard 5 (sérum négatif au VIH) 0,4 ml Contrôle de spécificité (négatif)1 HIV VirionStandard la VirionStandard 1 (1CP copies / μl) 0.4 ml Calibrates the sample RNA lb VirionStandard 2 (IO 2 copies / μl) 0.4 ml Caliber the sample RNA the VirionStandard 3 (10 0.4 ml Caliber sample RNA ld VirionStandard 4 (1 copy / μl) 0.4 ml Caliber sample RNA VirionStandard 5 (HIV negative serum) 0.4 ml specificity (negative)
2 ARNt (0,1 mg/ml) 1 ml Sert d'ARN support pour l'ARN d'échantillon2 tRNA (0.1 mg / ml) 1 ml Serves as supporting RNA for the sample RNA
3 Tampon de réserve d'ARN 250 μl Dissout les échantillons d'ARN3 RNA reserve buffer 250 μl Dissolves RNA samples
4 Mélange d'amplification de VIH, avec amorces 1 ml U) 4 HIV amplification mixture, with primers 1 ml U )
S'hybride à l'ARN de VIH et aux génomes o de VIH et amorces de CI d'ADNcHybridizes to HIV RNA and HIV o genomes and cDNA CI primers
5 Mélange enzymatique 28 μl Rétrotranscrit l'ARN de cible et amplifie l'ADNc5 Enzymatic mixture 28 μl Retrotranscribes the target RNA and amplifies the cDNA
6 ADN de VIH de plasmide (102 copies d'ADN/μl) 40 μl 1 Contrôle de signal (positif) d'ADNc de VIH6 HIV plasmid DNA (10 2 copies of DNA / μl) 40 μl 1 Signal control (positive) of HIV cDNA
7 ADN de transcrit hétérologue (10-* copies/μl) 1 ml 1 Contrôle inteme d'efficacité d'amplification liée à TR7 heterologous transcript DNA (10- * copies / μl) 1 ml 1 Internal control of amplification efficiency linked to TR
8 Eau passée à l'autoclave 40 μl 1 Contrôle de signal (négatif) de fond8 Autoclaved water 40 μl 1 Bottom signal (negative) control
II Hybridation liquide et comptage de fluorescenceII Liquid hybridization and fluorescence counting
9 Microplaque revêtue de sondes de VIH (souches + & -) 8 puits 12 Capture d'ADNc de VIH en hybridation liquide H o9 Microplate coated with HIV probes (strains + & -) 8 wells 12 Capture of HIV cDNA in liquid hybridization H o
10 Microplaque revêtue de sonde de CI 8 puits 12 Capture d'ADNc de CI en hybridation liquide10 Microplate coated with 8-well CI probe 12 Capture of CI cDNA in liquid hybridization
11 Tampon de déna tura tion 2 ml 1 Permet dénaturation d'ADNds amplifié I 11 Denaturing buffer 2 ml 1 Allows denaturation of amplified dds I
33
O O
12 Tampon d'hybridation 20 ml 1 Permet hybridation de la sonde à l'ADN de cible12 Hybridization buffer 20 ml 1 Allows hybridization of the probe to the target DNA
UlUl
13 Tampon de lavage 100 ml 1 Retient spécifiquement l'ADN amplifié dans la microplaque13 Wash buffer 100 ml 1 Specifically retains amplified DNA in the microplate
14 Fluorochrome 10 ml 1 Permet la détection d'ADNds post-amplification14 Fluorochrome 10 ml 1 Allows detection of post-amplification DNAds
nnot
HH
-4 o\ -4 o \
9.3. REACTIFS ET EQUIPEMENTS9.3. REAGENTS AND EQUIPMENT
9.3.1. REACTIFS9.3.1. REAGENTS
- Chloroforme (pur pour analyses)- Chloroform (pure for analyzes)
- Isopropanol (pur pour analyses) - Ethanol à 75 % (pur pour analyses)- Isopropanol (pure for analyzes) - Ethanol at 75% (pure for analyzes)
- Solution d'isolement d'ARN- RNA isolation solution
9.3.2. EQUIPEMENTS9.3.2. EQUIPMENT
- Centrifugeuse à microtube (4°C)- Microtube centrifuge (4 ° C)
- Installation de mise sous vide ou pompe centrifuge - Appareil pour cycle thermique à couvercle chauffant- Vacuum installation or centrifugal pump - Apparatus for thermal cycle with heating cover
- Bain-mane ou incubateur pour hybridation liquide- Bain-mane or incubator for liquid hybridization
- Fluonmètre sensible- Sensitive fluorometer
9.4. PROTOCOLE POUR QUANTIFICATION DE VIH PAR AMPLIFICATION DE GENOME LIEE A TRANSCRIPTION REVERSE 9.4.1. EXTRACTION D'ARN9.4. PROTOCOL FOR QUANTIFICATION OF HIV BY REVERSE TRANSCRIPTION-LINKED GENOME AMPLIFICATION 9.4.1. RNA EXTRACTION
100 μl d'échantillons de VirionStandard de VIH et de plasma ou de sérum ont été homogénéisés avec 400 μl de solution d'isolement d'ARN, avec quelques oscillations dans un homogeneiseur. 60 μl de chloroforme ont été ajoutés et on a agité vigoureusement pendant 15 secondes et laissé reposer sur de la glace pendant 10 minutes. La suspension a été centrifugée à 12.000 g à 4°C pendant 15 minutes .100 μl of VirionStandard samples of HIV and plasma or serum were homogenized with 400 μl of RNA isolation solution, with a few oscillations in a homogenizer. 60 μl of chloroform were added and the mixture was stirred vigorously for 15 seconds and left to stand on ice for 10 minutes. The suspension was centrifuged at 12,000 g at 4 ° C for 15 minutes.
Après addition de chloroforme et centrifugation, il se formait deux phases: la phase phénol-chloroformique inférieure (~240 μl) et la phase aqueuse supérieure (~320 μl) . Les ARN restaient exclusivement dans la phase aqueuse, tandis que les ADN et les protéines étaient dans 1' interphase et dans la phase organique. La phase aqeuse (300 μl) a été transférée dans de nouveaux tubes. Un volume égal d ' isopropanol a été ajouté et les échantillons ont été conservés à -20°C pendant 1 heure. Les échantillons ont été centrifugés pendant 10 minutes à 12.000 g (4°C) et le pellet (pastille) a été brièvement séché. Le surnageant a été éliminé, le pellet d'ARN a été lavé une fois avec de l'éthanol à 75% (500 μl) sous l'effet d'un vortex, et finalement le pellet d'ARN a été séché sous vide. Le pellet d'ARN a été dissous dans 11 μl de tampon de réserve d'ARN. Le précipité d'ARN formait un pellet blanc-jaune (visible seulement en grande quantité) au fond du tube. Il est important de ne pas laisser le pellet d'ARN sécher complètement, car le séchage diminue fortement sa solubilité. 9.4.2. TRANSCRIPTION REVERSE D'ARN ET AMPLIFICATION D'ADNcAfter addition of chloroform and centrifugation, two phases were formed: the lower phenol-chloroform phase (~ 240 μl) and the upper aqueous phase (~ 320 μl). The RNAs remained exclusively in the aqueous phase, while the DNAs and proteins were in the interphase and in the organic phase. The aqueous phase (300 μl) was transferred to new tubes. An equal volume of isopropanol was added and the samples were stored at -20 ° C for 1 hour. The samples were centrifuged for 10 minutes at 12,000 g (4 ° C) and the pellet (pellet) was briefly dried. The supernatant has been removed, the pellet of RNA was washed once with 75% ethanol (500 μl) under the effect of a vortex, and finally the pellet of RNA was dried under vacuum. The RNA pellet was dissolved in 11 μl of RNA reserve buffer. The RNA precipitate formed a white-yellow pellet (visible only in large quantities) at the bottom of the tube. It is important not to let the RNA pellet dry completely, as drying greatly decreases its solubility. 9.4.2. REVERSE RNA TRANSCRIPTION AND cDNA AMPLIFICATION
10 μl d'échantillons d'ARN et de contrôles positif/- négatif ont été ajoutés dans de nouveaux tubes (200 μl) .10 μl of RNA samples and positive / - negative controls were added to new tubes (200 μl).
40 μl de mélange de transcription réverse/amplification40 μl of reverse transcription / amplification mixture
(MTRA) (38,9 μl de mélange d'amplification de VIH + 1,1 μl de mélange enzymatique) ont été placés dans chaque tube. Les tubes ont été transférés dans un appareil fournissant un cycle thermique, à couvercle chauffant.(MTRA) (38.9 μl of HIV amplification mixture + 1.1 μl of enzyme mixture) were placed in each tube. The tubes were transferred to an apparatus providing a thermal cycle, with a heated cover.
- 42°C pendant 25 minutes;- 42 ° C for 25 minutes;
- 94°C pendant 5 minutes; - 35 cycles (94°C pendant 35 s, 55°C pendant 45 s et 72°C pendant 60 s) ;- 94 ° C for 5 minutes; - 35 cycles (94 ° C for 35 s, 55 ° C for 45 s and 72 ° C for 60 s);
- puis 55°C pendant 5 minutes et ensuite 72°C pendant 5 minutes .- then 55 ° C for 5 minutes and then 72 ° C for 5 minutes.
9.5. DETECTION ET QUANTIFICATION 5 μl (x2) du mélange post-réactionnel ont été ajoutés dans de nouveaux tubes et mélangés avec 15 μl de solution de dénaturation à température ambiante pendant 10 minutes. Après addition jusqu'à 180 μl (x2) de solution d'hybridation, vortex, puis transfert à la pipette dans un puits d'une microplaque revêtue de sondes de VIH, puis 2 heures d'incubation à 37°C sur une secoueuse, la solution a été jetée et chaque puits ou alvéole a été lavé 3 fois avec 200 μl de tampon de lavage. 100 μl de solution de fluorochrome ont été ajoutés, suivis par le transfert de la microplaque sur un fluorimètre automatisé pour comptage de fluorescence et édition des résultats.9.5. DETECTION AND QUANTIFICATION 5 μl (x2) of the post-reaction mixture were added to new tubes and mixed with 15 μl of denaturation solution at room temperature for 10 minutes. After adding up to 180 μl (x2) of hybridization solution, vortex, then transfer with a pipette to a well of a microplate coated with HIV probes, then 2 hours of incubation at 37 ° C on a shaker, the solution was discarded and each well or cell was washed 3 times with 200 μl of washing buffer. 100 μl of fluorochrome solution were added, followed by the transfer of the microplate on an automated fluorimeter for fluorescence counting and editing of results.
Exemple 10 : Kit de quantification de génome de virus d ' immunodéficience humaine (VIH) pour détection par chimioluminescenceEXAMPLE 10 Human Immunodeficiency Virus (HIV) Genome Quantification Kit for Detection by Chemiluminescence
10.1. INTRODUCTION10.1. INTRODUCTION
Un kit de quantification du génome du virus de 1 ' immunodéficience humaine (VIH) selon la présente invention a été conçu et mis en oeuvre sensiblement comme décrit dans l 'exemple 8, sauf que la gamme de quantification était de plus de 4 ordres de grandeur en un seul test en 7 heures. 10.2. LISTE DES COMPOSANTS DU KITA kit for quantifying the genome of the human immunodeficiency virus (HIV) according to the present invention was designed and implemented substantially as described in Example 8, except that the range of quantification was more than 4 orders of magnitude. in one test in 7 hours. 10.2. LIST OF KIT COMPONENTS
Le kit de quantification de génome de VIH doit de préférence être conservé à -20°C dans un congélateur à température constante ou à 4°C avec utilisation d'une solution de conservation d'enzyme appropriée. S'il est stocké dans des conditions appropriées, le produit reste stable jusqu'à une date de contrôle imprimée sur une étiquette. The HIV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label.
33
O yeO y e
No. Réactif Volume Quantité Commentaires inNo. Reagent Volume Quantity Comments in
I Amplification de génome de VIH liée à une transcription réverse (TR)I Amplification of the HIV genome linked to reverse transcription (TR)
1 VirionStandard de VIH la VirionStandard 1 (10^ copies/μl) 0,4 ml Calibre l'ARN d'échantillon lb VirionStandard 2 (102 copies/μl) 0,4 ml Calibre l'ARN d'échantillon le VirionStandard 3 (10 copies/μl) 0,4 ml Calibre l'ARN d'échantillon ld VirionStandard 4 (1 copie/μl) 0,4 ml Calibre l'ARN d'échantillon le VirionStandard 5 (sérum négatif auVIH) 0,4 ml Contrôle de spécificité (négatif)1 VirionStandard of HIV VirionStandard 1 (10 ^ copies / μl) 0.4 ml Calibrates sample RNA lb VirionStandard 2 (10 2 copies / μl) 0.4 ml Calibrates sample RNA VirionStandard 3 ( 10 copies / μl) 0.4 ml Calibrate the sample RNA ld VirionStandard 4 (1 copy / μl) 0.4 ml Calibrate the sample RNA the VirionStandard 5 (HIV negative serum) 0.4 ml Control specificity (negative)
2 ARNt (0,1 mg/ml) 1 ml Sert d'ARN support pour l'ARN d'échantillon2 tRNA (0.1 mg / ml) 1 ml Serves as supporting RNA for the sample RNA
3 Tampon de réserve d'ARN 250 μl Dissout les échantillons d'ARN3 RNA reserve buffer 250 μl Dissolves RNA samples
4 Mélange d'amplification de VIH, avec amorces 1 ml OJ4 HIV amplification mixture, with primers 1 ml OJ
S'hybride à l'ARN de VIH et aux génomes un de VIH et amorces de CI biotinylées d'ADNcHybridizes to HIV RNA and HIV genomes one and biotinylated CI primers of cDNA
5 Mélange enzymatique 28 μl Rétrotranscrit l'ARN de cible et amplifie l'ADNc5 Enzymatic mixture 28 μl Retrotranscribes the target RNA and amplifies the cDNA
6 ADN de VIH de plasmide (102 copies d'ADN/μl) 40 μl 1 Contrôle de signal (positif) d'ADNc de VIH6 HIV plasmid DNA (10 2 copies of DNA / μl) 40 μl 1 Signal control (positive) of HIV cDNA
7 ADN de transcrit hétérologue (KP copies/μl) 1 ml 1 Contrôle interne d'efficacité d'amplification liée à TR7 heterologous transcript DNA (KP copies / μl) 1 ml 1 Internal control of amplification efficiency linked to TR
8 Eau passée à l'autoclave 40 μl 1 Contrôle de signal (négatif) de fond8 Autoclaved water 40 μl 1 Bottom signal (negative) control
II Hybridation liquide et marquage par chimioluminescence OII Liquid hybridization and labeling by chemiluminescence O
HH
9 Sonde spécifique pour VIH 100 μl 1 S'hybride spécifiquement à l'ADNc de VIH9 Specific probe for HIV 100 μl 1 Hybridizes specifically with HIV cDNA
JBJB
10 Sonde spécifique de l'ADNc de CI 100 μl 1 S'hybride spécifiquement à l'ADNc de CI vo o\10 Specific probe of CI cDNA 100 μl 1 Hybridizes specifically to CI cDNA vo o \
11 Tampon de dénaturation 5 ml 1 Permet dénaturation d'ADNds amplifié11 Denaturation buffer 5 ml 1 Allows denaturation of amplified dds
1*1 1 * 1
-4-4
12 Tampon d'hybridation 50 ml 1 Permet hybridation de la sonde à l'ADN de cible Ul12 50 ml hybridization buffer 1 Allows hybridization of the probe to the target DNA U1
13 Tampon de lavage (xlO) 50 ml 1 Elimine l'ADN non-spécifique dans la microplaque13 Wash buffer (x10) 50 ml 1 Eliminate non-specific DNA in the microplate
14 Billes revêtues de streptavidine (ou microplaque) (8 puits) 1 (24) Capture d'ADNc de VIH hybride en hybridation liquide14 Streptavidin coated beads (or microplate) (8 wells) 1 (24) Capture of hybrid HIV cDNA in liquid hybridization
15 Solution de travail anti-ADNds-PAL 10 ml 1 Marquage d'ADN cible hybride15 Anti-dds-PAL working solution 10 ml 1 Hybrid target DNA labeling
16 Solution de substrat de chimioluminescence 10 ml 1 Permet détection par luminescence et quantification16 Chemiluminescence substrate solution 10 ml 1 Allows luminescence detection and quantification
enin
"0"0
H nH n
73 o 73 o
10.3. REACTIFS ET EQUIPEMENTS10.3. REAGENTS AND EQUIPMENT
10.3.1. REACTIFS10.3.1. REAGENTS
- Chloroforme (pur pour analyses)- Chloroform (pure for analyzes)
- Isopropanol (pur pour analyses) - Ethanol à 75 % (pur pour analyses)- Isopropanol (pure for analyzes) - Ethanol at 75% (pure for analyzes)
- Solution d'isolement d'ARN- RNA isolation solution
10.3.2. EQUIPEMENTS10.3.2. EQUIPMENT
- Centrifugeuse à microtube (4°C)- Microtube centrifuge (4 ° C)
- Installation de mise sous vide ou pompe centrifuge - Appareil pour cycle thermique à couvercle chauffant- Vacuum installation or centrifugal pump - Apparatus for thermal cycle with heating cover
- Bain-marie ou incubateur pour hybridation liquide- Water bath or incubator for liquid hybridization
- Luminomètre- Luminometer
10.4. PROTOCOLE POUR QUANTIFICATION DE VIH PAR AMPLIFICATION DE GENOME LIEE A TRANSCRIPTION REVERSE 10.4.1. EXTRACTION D'ARN10.4. PROTOCOL FOR QUANTIFICATION OF HIV BY REVERSE TRANSCRIPTION-LINKED GENOME AMPLIFICATION 10.4.1. RNA EXTRACTION
100 μl d'échantillons de VirionStandard de VIH et de plasma ou de sérum ont été homogénéisés avec 400 μl de solution d'isolement d'ARN, avec quelques oscillations dans un homogeneiseur. 60 μl de chloroforme ont été ajoutés et on a agité vigoureusement pendant 15 secondes et laissé reposer sur de la glace pendant 10 minutes. La suspension a été centrifugée à 12.000 g à 4°C pendant 15 minutes.100 μl of VirionStandard samples of HIV and plasma or serum were homogenized with 400 μl of RNA isolation solution, with a few oscillations in a homogenizer. 60 μl of chloroform were added and the mixture was stirred vigorously for 15 seconds and left to stand on ice for 10 minutes. The suspension was centrifuged at 12,000 g at 4 ° C for 15 minutes.
Après addition de chloroforme et centrifugation, il se formait deux phases: la phase phénol-chloroformique inférieure (~240 μl) et la phase aqueuse supérieure (~320 μl) . Les ARN restaient exclusivement dans la phase aqueuse, tandis que les ADN et les protéines étaient dans 1' interphase et dans la phase organique. La phase aqeuse (300 μl) a été transférée dans de nouveaux tubes. Un volume égal d' isopropanol a été ajouté et les échantillons ont été conservés à -20°C pendant 1 heure. Les échantillons ont été centrifugés pendant 10 minutes à 12.000 g (4°C) et le pellet (pastille) a été brièvement séché. Le surnageant a été éliminé, le pellet d'ARN a été lavé une fois avec de l'éthanol à 75% (500 μl) sous l'effet d'un vortex, et finalement le pellet d'ARN a été séché sous vide. Le pellet d'ARN a été dissous dans 11 μl de tampon de réserve d'ARN. Le précipité d'ARN formait un pellet blanc-jauneAfter addition of chloroform and centrifugation, two phases were formed: the lower phenol-chloroform phase (~ 240 μl) and the upper aqueous phase (~ 320 μl). The RNAs remained exclusively in the aqueous phase, while the DNAs and proteins were in the interphase and in the organic phase. The aqueous phase (300 μl) was transferred to new tubes. An equal volume of isopropanol was added and the samples were stored at -20 ° C for 1 hour. The samples were centrifuged for 10 minutes at 12,000 g (4 ° C) and the pellet (pellet) was briefly dried. The supernatant has been removed, the pellet of RNA was washed once with 75% ethanol (500 μl) under the effect of a vortex, and finally the pellet of RNA was dried under vacuum. The RNA pellet was dissolved in 11 μl of RNA reserve buffer. The RNA precipitate formed a white-yellow pellet
(visible seulement en grande quantité) au fond du tube. Il est important de ne pas laisser le pellet d'ARN sécher complètement, car le séchage diminue fortement sa solubilité. 10.4.2. TRANSCRIPTION REVERSE D'ARN ET AMPLIFICATION(visible only in large quantities) at the bottom of the tube. It is important not to let the RNA pellet dry completely, as drying greatly decreases its solubility. 10.4.2. ARN REVERSE TRANSCRIPTION AND AMPLIFICATION
D«ADNcD "cDNA
10 μl d'échantillons d'ARN et de contrôles positif/- négatif ont été ajoutés dans de nouveaux tubes (200 μl) .10 μl of RNA samples and positive / - negative controls were added to new tubes (200 μl).
40 μl de mélange de transcription réverse/amplification (MTRA) (38,9 μl de mélange d'amplification de VIH + 1,1 μl de mélange enzymatique) ont été placés dans chaque tube.40 μl of reverse transcription / amplification mixture (MTRA) (38.9 μl of HIV amplification mixture + 1.1 μl of enzyme mixture) were placed in each tube.
Les tubes ont été transférés dans un appareil fournissant un cycle thermique, à couvercle chauffant.The tubes were transferred to an apparatus providing a thermal cycle, with a heated cover.
- 42°C pendant 25 minutes; - 94°C pendant 5 minutes;- 42 ° C for 25 minutes; - 94 ° C for 5 minutes;
- 35 cycles (94°C pendant 35 s, 55°C pendant 45 s et- 35 cycles (94 ° C for 35 s, 55 ° C for 45 s and
72°C pendant 60 s) ;72 ° C for 60 s);
- puis 55°C pendant 5 minutes et ensuite 72°C pendant 5 minutes . 10.5. DETECTION ET QUANTIFICATION- then 55 ° C for 5 minutes and then 72 ° C for 5 minutes. 10.5. DETECTION AND QUANTIFICATION
5 μl (x2) du mélange post-réactionnel ont été ajoutés dans 2 tubes frais et mélangés avec 15 μl de solution de dénaturation à température ambiante pendant 10 minutes. Après addition jusqu'à 180 μl (x2) de solution d'hybridation contenant une sonde spécifique pour VIH ou une sonde spécifique pour l'ADN du contrôle interne (CI), vortex, puis transfert à la pipette dans le tube de billes revêtues de streptavidine ou transfert dans le puits d'une microplaque revêtue de streptavidine, puis 2 heures d'incubation à 37°C sur une secoueuse, la solution a été jetée et chaque puits ou alvéole a été lavé 3 fois avec 200 μl de tampon de lavage. 200 μl des anticorps anti- ADNds conjugués avec de la phosphatase alcaline (PAL) ont été ajoutés, suivis d'une incubation pendant 30 minutes à 37°C sur une secoueuse. Après lavage 3 fois avec 200 μl de tampon de lavage, 100 μl de solution de substrat de chimioluminescence ont été ajoutés. Ensuite, la microplaque a été immédiatement transférée sur un luminomètre pour comptage de chimioluminescence et édition des résultats. Les nombres de particules de VIH par ml de chaque échantillon de plasma/sérum peuvent être enregistrés par un système automatique informatisé utilisant la courbe étalon générée à partir du VirionStandard de VIH (quantification absolue) .5 μl (x2) of the post-reaction mixture were added to 2 fresh tubes and mixed with 15 μl of denaturation solution at room temperature for 10 minutes. After adding up to 180 μl (x2) of hybridization solution containing a specific probe for HIV or a specific probe for the DNA of the internal control (IC), vortex, then transfer with the pipette into the tube of beads coated with streptavidin or transfer to the well of a microplate coated with streptavidin, then 2 hours of incubation at 37 ° C. on a shaker, the solution was discarded and each well or cell was washed 3 times with 200 μl of washing buffer. 200 μl of anti-dsDNA antibodies conjugated with alkaline phosphatase (PAL) were added, followed by incubation for 30 minutes at 37 ° C on a shaker. After washing 3 times with 200 μl of washing buffer, 100 μl of chemiluminescence substrate solution were added. Then, the microplate was immediately transferred to a luminometer for counting chemiluminescence and editing the results. The numbers of HIV particles per ml of each plasma / serum sample can be recorded by a computerized automatic system using the standard curve generated from the HIV VirionStandard (absolute quantification).
Exemple 11: Kit de quantification de génome de virus de l'hépatite B humaine (VHB) pour détection par chimioluminescenceEXAMPLE 11 Human Hepatitis B Virus (HBV) Genome Quantification Kit for Detection by Chemiluminescence
11.1. INTRODUCTION11.1. INTRODUCTION
Un kit de quantification du génome du virus de l'hépatite B humaine (VHB) selon la présente invention a été conçu pour la détection et la quantification d'ADN génomique de VHB dans tous fluides biologiques exempts de cellules (tels que plasma, sérum, liquide séminal, fluide de lavage broncho-alvéolaire, etc.) . On y a inclus des réactifs pour permettre d'isoler l'ADN viral par une méthode rapide, l'amplification de l'ADN du virion VHB avec de la Taq ADN polymerase et la détection quantitative par une procédure d'hybridation liquide liée à la chimioluminescence, qui permettait une limite de détection de 50 copies d'ADN viral et une gamme de quantification de plus de 4 ordres de grandeur en un seul test en 5 heures. Suffisamment de réactifs étaient fournis pour 100 réactions (40 μl chacune) dans un protocole avec volume final de 50 μl .A human hepatitis B virus (HBV) genome quantification kit according to the present invention has been designed for the detection and quantification of HBV genomic DNA in all cell-free biological fluids (such as plasma, serum, seminal fluid, bronchoalveolar lavage fluid, etc.). Reagents were included to allow viral DNA to be isolated by a rapid method, amplification of HBV virion DNA with Taq DNA polymerase and quantitative detection by a liquid hybridization procedure linked to the chemiluminescence, which allowed a detection limit of 50 copies of viral DNA and a quantification range of more than 4 orders of magnitude in a single test in 5 hours. Sufficient reagents were provided for 100 reactions (40 μl each) in a protocol with final volume of 50 μl.
Le kit contenait un ensemble d'étalons de virion VHB "VirionStandard" (104, IO3, IO2 et 10 copies/μl, fournis pour 4 séries de tests) , qui permettaient une mesure précise de la concentration d'ADN de virion VHB du plasma/sérum. Le kit contenait également un ADN de VHB de plasmide (103 copies par réaction, pour 4 séries de tests) , qui servait de contrôle de signal d'amplification positif, ainsi qu'en option un ADN de plasmide hétérologue, ajouté à chacun des échantillons à examiner et servant de contrôle interne "CI" (IO3 copies par réaction, fourni pour 100 réactions) . 11.2. LISTE DES COMPOSANTS DU KIT Le kit de quantification de génome de VHB doit de préférence être conservé à -20°C dans un congélateur à température constante ou à 4°C avec utilisation d'une solution de conservation d'enzyme appropriée. S'il est stocké dans des conditions appropriées, le produit reste stable jusqu'à une date de contrôle imprimée sur une étiquette. The kit contained a set of HBV "VirionStandard" virion standards (10 4 , IO 3 , IO 2 and 10 copies / μl, supplied for 4 series of tests), which allowed precise measurement of the concentration of virion DNA. HBV plasma / serum. The kit also contained HBV plasmid DNA (10 3 copies per reaction, for 4 sets of tests), which served as a positive amplification signal control, as well as optional heterologous plasmid DNA, added to each of the samples to be examined and serving as internal control "CI" (IO 3 copies per reaction, supplied for 100 reactions). 11.2. LIST OF KIT COMPONENTS The HBV genome quantification kit should preferably be stored at -20 ° C in a freezer at constant temperature or at 4 ° C using an appropriate enzyme preservation solution. If stored under appropriate conditions, the product remains stable until an inspection date printed on a label.
No. Réactif Volume Quant té CommentairesNo. Reagent Volume Quant ty Comments
I Amplification de génome de VHBI HBV genome amplification
(Λ(Λ
1 VirionStandard de VHB la VirionStandard 1 (10^ copies/μl) 0,2 ml Calibre l'ADN d'échantillon lb VirionStandard 2 (IO3 copics/μl) 0,2 ml Calibre l'ADN d'échantillon le VirionStandard 3 (102 copies/μl) 0,2 m] Calibre l'ADN d'échantillon ld VirionStandard 4 (10 copies/μl) 0,2 ml Calibre l'ADN d'échantillon le VirionStandard 5 (sérum négatif au VHB) 0,2 ml Contrôle de spécificité (négatif)1 HBV VirionStandard la VirionStandard 1 (10 ^ copies / μl) 0.2 ml Calibrates the sample DNA lb VirionStandard 2 (IO 3 copies / μl) 0.2 ml Caliber the sample DNA the VirionStandard 3 ( 10 2 copies / μl) 0.2 m] Caliber sample DNA ld VirionStandard 4 (10 copies / μl) 0.2 ml Caliber sample DNA VirionStandard 5 (HBV negative serum) 0.2 ml Specificity control (negative)
2 Mélange d'amplification de VHB, avec amorces 1 ,1 ml S'hybride au génome d'ADN de VHB2 HBV amplification mixture, with primers 1.1 ml Hybridizes to the HBV DNA genome
3 ADN polymerase Taq 25 μl Amplifie l'ADN de cible3 Taq DNA polymerase 25 μl Amplifies target DNA
4 ADN de VHB de plasmide (IO2 copies d'ADN/μl) 50 μl Contrôle de signal (positif) d'ADNc de VHB4 HBV plasmid DNA (IO 2 copies of DNA / μl) 50 μl HBV cDNA signal control (positive)
5 ADN de plasmide hétérologue (IO2 copies d'ADN/μl) l ml Contrôle interne d'efficacité d'amplification5 heterologous plasmid DNA (IO 2 copies of DNA / μl) l ml Internal control of amplification efficiency
6 Eau passée à l'autoclave 100 μl Contrôle de signal (négatif) de fond6 Autoclaved water 100 μl Bottom signal (negative) control
7 Tampon de décharge ou libération d'ADN7 DNA discharge or release buffer
II Hybridation liquide et marquage par chimioluminescenceII Liquid hybridization and chemiluminescence labeling
8 Sonde spécifique pour VHB 100 μl S'hybride spécifiquement à l'ADNc de VHB8 Specific probe for HBV 100 μl Hybridizes specifically with HBV cDNA
9 Sonde spécifique de l'ADN de CI 100 μl S'hybride spécifiquement à l'ADN de CI9 Specific probe of CI DNA 100 μl Hybridizes specifically to CI DNA
10 Tampon de dénaturation 5 ml Permet dénaturation d'ADNds amplifié10 Denaturation buffer 5 ml Allows denaturation of amplified DNAs
11 Tampon d'hybridation 50 ml Permet hybridation de la sonde à l'ADN de cible11 50 ml hybridization buffer Allows hybridization of the probe to the target DNA
-o-o
12 Tampon de lavage (xlO) 50 ml Elimine l'ADN non-spécifique O12 Wash buffer (xlO) 50 ml Eliminates non-specific DNA O
13 Billes revêtues de streptavidine (ou microplaquc) 200 (8 puits) 1 (24) Capture d'ADNc de VHB hybride en hybridation liquide 3 7313 Streptavidin coated beads (or microplate) 200 (8 wells) 1 (24) Capture of hybrid HBV cDNA in liquid hybridization 3 73
14 Solution de travail anti-ADNds-PAL 10 ml Marquage d'ADN cible hybride o14 Anti-dds-PAL working solution 10 ml Labeling of hybrid target DNA o
15 Solution de substrat de chimioluminescence 10 ml W15 Chemiluminescence substrate solution 10 ml W
Permet détection par luminescence et quantification Enables luminescence detection and quantification
11.3. REACTIFS ET EQUIPEMENTS11.3. REAGENTS AND EQUIPMENT
- Centrifugeuse à microtube- Microtube centrifuge
- Appareil pour cycle thermique à couvercle chauffant- Apparatus for thermal cycle with heated lid
- Bain-marie pour hybridation liquide - Luminomètre- Water bath for liquid hybridization - Luminometer
11.4. PROTOCOLE POUR PREPARATION D'ECHANTILLON ET AMPLIFICATION11.4. PROTOCOL FOR SAMPLE PREPARATION AND AMPLIFICATION
11.4.1. PREPARATION D'ECHANTILLON11.4.1. SAMPLE PREPARATION
50 μl d'échantillons de VirionStandard de VHB et de plasma ou de sérum ont été homogénéisés avec 50 μl de tampon de décharge ou libération d'ADN, et on a ensuite laissé reposer à 98°C pendant 10 minutes.50 μl of HBV VirionStandard samples and of plasma or serum were homogenized with 50 μl of discharge or DNA release buffer, and then allowed to stand at 98 ° C for 10 minutes.
Après centrifugation, les ADN restaient exclusivement dans la phase liquide (10-15 μl), tandis que les protéines étaient dans le pellet.After centrifugation, the DNA remained exclusively in the liquid phase (10-15 μl), while the proteins were in the pellet.
11.4.2. AMPLIFICATION D'ADNc11.4.2. AMPLIFICATION OF cDNA
10 μl de la phase liquide ont été transférés dans de nouveaux tubes (200 μl) . 40 μl de mélange d'amplification de VHB + 5 μl de Taq ADN polymerase) ont été placés dans chaque tube. Les tubes ont été transférés dans un appareil fournissant un cycle thermique, à couvercle chauffant.10 μl of the liquid phase were transferred to new tubes (200 μl). 40 μl of HBV amplification mixture + 5 μl of Taq DNA polymerase) were placed in each tube. The tubes were transferred to an apparatus providing a thermal cycle, with a heated cover.
- 94°C pendant 5 minutes;- 94 ° C for 5 minutes;
- 35 cycles (94°C pendant 35 s, 60°C pendant 45 s et- 35 cycles (94 ° C for 35 s, 60 ° C for 45 s and
72°C pendant 60 s) ; - puis encore 72°C pendant 5 minutes. 11.5. VISUALISATION ET QUANTIFICATION72 ° C for 60 s); - then another 72 ° C for 5 minutes. 11.5. VISUALIZATION AND QUANTIFICATION
5 μl (x2) du mélange post-réactionnel ont été ajoutés dans 2 nouveaux tubes en parallèle et mélangés avec 15 μl de solution de dénaturation à température ambiante pendant 10 minutes. Après addition jusqu'à 180 μl (x2) de solution d'hybridation contenant une sonde spécifique pour VHB ou une sonde spécifique pour l'ADN du contrôle interne (CI), vortex, puis transfert à la pipette dans le tube de billes revêtues de streptavidine ou transfert dans le puits d'une microplaque revêtue de streptavidine, puis 2 heures d'incubation à 37°C sur une secoueuse, la solution a été jetée et chaque puits ou alvéole a été lavé 3 fois avec 200 μl de tampon de lavage. 200 μl des anticorps anti- ADNds conjugués avec de la phosphatase alcaline (PAL) ont été ajoutés, suivis d'une incubation pendant 30 minutes à 37°C sur une secoueuse. Après lavage 3 fois avec 200 μl de tampon de lavage, 100 μl de solution de substrat de chimioluminescence ont été ajoutés. Ensuite, la microplaque a été immédiatement transférée sur un luminomètre pour comptage de chimioluminescence et édition des résultats. Les nombres de particules de VHB par ml de chaque échantillon de plasma/sérum peuvent être enregistrés par un système automatique informatisé utilisant la courbe étalon générée à partir du VirionStandard de VHB (quantification absolue) . 5 μl (x2) of the post-reaction mixture were added to 2 new tubes in parallel and mixed with 15 μl of denaturation solution at room temperature for 10 minutes. After adding up to 180 μl (x2) of hybridization solution containing a specific probe for HBV or a specific probe for the DNA of the internal control (IC), vortex, then transfer with a pipette into the tube of beads coated with streptavidin or transfer to the well of a microplate coated with streptavidin, then 2 hours incubation at 37 ° C on a shaker, the solution was discarded and each well or cell was washed 3 times with 200 μl of washing buffer. 200 μl of anti-dsDNA antibodies conjugated with alkaline phosphatase (PAL) were added, followed by incubation for 30 minutes at 37 ° C on a shaker. After washing 3 times with 200 μl of washing buffer, 100 μl of chemiluminescence substrate solution were added. Then, the microplate was immediately transferred to a luminometer for counting chemiluminescence and editing the results. The numbers of HBV particles per ml of each plasma / serum sample can be recorded by a computerized automatic system using the standard curve generated from the HBV VirionStandard (absolute quantification).

Claims

REVENDICATIONS
1. Procédé pour la quantification et la détection de n'importe quel micro-organisme à ADN ou à ARN, caractérisé en ce qu'il comprend:1. Method for the quantification and detection of any DNA or RNA microorganism, characterized in that it comprises:
(1) l'utilisation ou la détermination d'une concentration étalon du micro-organisme ou de la concentration de l'ADN ou de l'ARN porté par ce micio-organisme, appelé micro¬ organisme étalon, et (2) la comparaison de la quantité du produit de la transcription réverse et/ou de l'amplification de l'ARN ou de l'ADN issu d'une concentration inconnue du micro- organisme avec des quantités d'amplificat issues de l'ARN ou de l'ADN de concentrations connues du dit micro- organisme.(1) the use or the determination of a standard concentration of the micro-organism or of the concentration of DNA or RNA carried by this micro-organism, called standard micro-organism, and (2) comparison the amount of the product of reverse transcription and / or amplification of RNA or DNA from an unknown concentration of the microorganism with amounts of amplificate from RNA or DNA of known concentrations of said microorganism.
2. Procédé selon la revendication 1, caractérisé en ce que l'étape (2) consiste essentiellement en une révélation comparative fondée sur la comparaison des concentrations de l'étalon avec les concentrations du micro-organisme cible telles que détectées de préférence au moyen de la méthode dite à l'ADN branché ou de toute autre méthode de révélation qui n'amplifie pas les ADN ou les ARN de l'étalon ou du micro-organisme cible.2. Method according to claim 1, characterized in that step (2) consists essentially of a comparative revelation based on the comparison of the concentrations of the standard with the concentrations of the target microorganism as preferably detected by means of the so-called branched DNA method or any other method of revealing which does not amplify the DNA or RNA of the standard or of the target microorganism.
3. Procédé selon la revendication 1, caractérisé en ce qu'il comporte les étapes selon lesquelles:3. Method according to claim 1, characterized in that it comprises the steps according to which:
1) on prélève et on purifie une quantité quelconque du micro-organisme à doser, à partir d'échantillons de prélèvement humains, animaux ou végétaux, ou à partir de cultures cellulaires, la quantité de micro-organisme étant suffisante pour que les concentrations en ADN ou ARN cible soient mesurables par des méthodes directes;1) any quantity of the microorganism to be assayed is taken and purified, from human, animal or plant samples, or from cell cultures, the quantity of microorganism being sufficient for the concentrations of Target DNA or RNA are measurable by direct methods;
2) on extrait l'ADN ou l'ARN et on en mesure la quantité recueillie;2) extract the DNA or RNA and measure the amount collected;
3) on utilise par ailleurs le nombre de bases nucleotidiques du micro-organisme concerné; 4) on calcule à partir de ce nombre de bases nucleotidiques la masse moléculaire totale de l'ADN ou de l'ARN du dit micro-organisme, en tenant compte de la masse moléculaire moyenne d'un nucleotide, elle aussi connue; 5) on calcule ainsi, en utilisant le nombre d'Avogadro, la quantité d'ADN ou d'ARN portée par chaque micro-organisme;3) the number of nucleotide bases of the microorganism concerned is also used; 4) the total molecular mass of the DNA or RNA of said microorganism is calculated from this number of nucleotide bases, taking into account the average molecular mass of a nucleotide, which is also known; 5) the quantity of DNA or RNA carried by each microorganism is thus calculated, using the number of Avogadro;
6) on prépare et/ou utilise une gamme de concentrations de micro-organisme étalon obtenue à partir des dilutions successives du micro-organisme préalablement étalonné selon ses concentrations d'ADN ou d'ARN, pour former un étalon externe, dont on connaît ainsi pour chaque dilution (a) la concentration d'ADN ou d'ARN et (b) la concentra¬ tion en micro-organismes;6) a range of concentrations of standard microorganism obtained from successive dilutions of the microorganism previously calibrated according to its DNA or RNA concentrations is prepared and / or used to form an external standard, of which we thus know for each dilution (a) the concentration of DNA or RNA and (b) the concentration of microorganisms;
7) on extrait l'ADN ou l'ARN des micro-organismes étalon et cible et on soumet les extraits en parallèle à une révélation au moyen de la méthode dite à l'ADN branché ou de toute autre méthode de révélation qui n'amplifie pas les ADN ou les ARN de l'étalon ou du micro-organisme cible et/ou à une rétrotranscription et/ou à au moins une amplification, et on enregistre les valeurs obtenues; et7) the DNA or RNA of the standard and target microorganisms are extracted and the extracts are subjected in parallel to a revelation by means of the so-called branched DNA method or any other method of revelation which does not amplify not the DNA or RNA of the standard or of the target microorganism and / or to a transcription and / or to at least one amplification, and the values obtained are recorded; and
8) on compare les concentrations d'ADN ou d'ARN des micro- organismes étalon et cible ou les produits d'amplification des micro-organismes cible avec ceux de l'étalon externe, de façon à en déduire les valeurs de concentration en ADN ou ARN ou en micro-organisme total dans chaque échantillon de micro-organisme cible.8) the DNA or RNA concentrations of the standard and target microorganisms or the amplification products of the target microorganisms are compared with those of the external standard, so as to deduce the DNA concentration values therefrom or RNA or total microorganism in each sample of target microorganism.
4. Procédé selon la revendication 3, caractérisé en ce que les étapes 2) à 5) sont remplacées par la simple mesure directe du nombre de micro-organismes. 4. Method according to claim 3, characterized in that steps 2) to 5) are replaced by the simple direct measurement of the number of microorganisms.
5. Procédé selon l'une quelconque des revendications 1 à 4, qui comprend également l'addition d'un contrôle interne, de préférence sous la forme d'un ADN de plasmide hétérologue ou d'un ARN de transcrit hétérologue, et dont la séquence et les amorces n'ont pas de rapport avec les ADN ou ARN cible, pour le contrôle de l'efficacité d'amplification ou de l'efficacité de l'amplification liée à la TR.5. Method according to any one of claims 1 to 4, which also comprises the addition of an internal control, preferably in the form of a heterologous plasmid DNA or a heterologous transcript RNA, and the sequence and primers have no relation to target DNA or RNA, for efficiency control amplification or the effectiveness of the amplification linked to the TR.
6. Procédé selon l'une des revendications 1 ou 2 , caractérisé en ce qu'on remplace la préparation de concentrations connues de micro-organisme par la préparation de concentrations connues:6. Method according to one of claims 1 or 2, characterized in that the preparation of known concentrations of microorganism is replaced by the preparation of known concentrations:
. du même micro-organisme inactivé, dont l'ADN ou l'ARN demeure apte à une détection ou à une quantification au moyen d'une méthode de révélation telle que la méthode de révélation dite à l'ADN branché et/ou la rétrotranscrip¬ tion et/ou à l'amplification de façon identique à l'ADN ou l'ARN du virus natif,. of the same inactivated microorganism, whose DNA or RNA remains capable of detection or quantification by means of a revelation method such as the revelation method known as branched DNA and / or retrotranscrip¬ tion and / or amplification in a manner identical to the DNA or RNA of the native virus,
. d'une séquence nucléotidique complète, extraite du même micro-organisme, ou . d'une séquence nucléotidique complète, fabriquée par synthèse.. a complete nucleotide sequence, extracted from the same microorganism, or. of a complete nucleotide sequence, produced by synthesis.
7. Procédé selon l'une quelconque des revendications 1 à 6, caractérisé en ce qu'on prépare et on stocke jusqu'à leur mise à la disposition de l'utilisateur des préparations de concentrations connues étalonnées du micro-organisme complet à ADN ou à ARN du type à quantifier ou à détecter, ou des préparations de concentrations d'ADN ou d'ARN du génome du dit micro¬ organisme correspondant à des concentrations connues de ce micro-organisme.7. Method according to any one of claims 1 to 6, characterized in that preparations are made and stored until they are made available to the user preparations of known concentrations calibrated from the complete microorganism with DNA or with RNA of the type to be quantified or detected, or preparations of DNA or RNA concentrations of the genome of said microorganism corresponding to known concentrations of this microorganism.
8. Kit ou ensemble de moyens pour la quantification et la détection de micro-organismes à ADN ou à ARN, comprenant essentiellement, dans des récipients appropriés et/ou sous la forme de dispositifs appropriés: - une série de concentrations connues étalonnées du micro¬ organisme complet à ADN ou à ARN du type à quantifier ou à détecter, ou de concentrations d'ADN ou d'ARN correspondant à des concentrations connues du dit micro¬ organisme, des moyens d'extraction, de révélation et/ou de rétrotranscription et/ou d'amplification de l'ADN ou de l'ARN du micro-organisme cible et étalon,8. Kit or set of means for the quantification and detection of DNA or RNA microorganisms, essentially comprising, in appropriate containers and / or in the form of appropriate devices: - a series of known concentrations calibrated from the micro¬ complete organism with DNA or RNA of the type to be quantified or detected, or concentrations of DNA or RNA corresponding to known concentrations of said micro¬ organism, means for extracting, revealing and / or retrotranscribing and / or amplifying the DNA or RNA of the target and standard microorganism,
- des moyens pour l'analyse de l'ADN ou de l'ARN du micro- organisme cible et étalon ou des produits de révélation ou d'amplification.means for the analysis of the DNA or RNA of the target and standard microorganism or of the revelation or amplification products.
9. Kit ou ensemble de moyens selon la revendication 8, qui comprend des moyens pour la simple mesure directe du nombre de microorganismes. 9. Kit or set of means according to claim 8, which comprises means for the simple direct measurement of the number of microorganisms.
10. Kit ou ensemble de moyens selon l'une des revendications 8 ou 9, qui comprend également un contrôle interne, de préférence sous la forme d'un ADN de plasmide hétérologue ou d'un ARN de transcrit hétérologue, et dont la séquence et les amorces ne sont pas en rapport avec les ADN ou ARN de la cible, pour le contrôle de l'efficacité d'amplification ou de l'efficacité de l'amplification liée à la TR.10. Kit or set of means according to one of claims 8 or 9, which also comprises an internal control, preferably in the form of a heterologous plasmid DNA or a heterologous transcript RNA, and the sequence and the primers are not related to the DNA or RNA of the target, for controlling the amplification efficiency or the efficiency of the amplification linked to the TR.
11. Utilisation du procédé selon l'une quelconque des revendications 1 à 7 pour la quantification des micro- organismes dans tous les milieux ou spécimens ou pour la détection de la quantité minimale mesurable ou d'une quantité supérieure de micro-organisme.11. Use of the method according to any one of claims 1 to 7 for the quantification of microorganisms in all media or specimens or for the detection of the minimum measurable quantity or a greater quantity of microorganism.
12. Utilisation d'un kit ou ensemble selon l'une quelconque des revendications 8 à 10 pour la quantifica- tion des micro-organismes dans tous les milieux ou spécimens ou pour la détection de la quantité minimale mesurable ou d'une quantité supérieure de micro-organisme. 12. Use of a kit or assembly according to any one of claims 8 to 10 for the quantification of microorganisms in all media or specimens or for the detection of the minimum measurable quantity or a greater quantity of microorganism.
REVENDICATIONS MODIFIEESAMENDED CLAIMS
[reçues par le Bureau International le 11 avril 1997 (11.04.97); revendication 1 modifiée; autres revendications inchangées (1 page)][received by the International Bureau on April 11, 1997 (April 11, 1997); claim 1 as amended; other claims unchanged (1 page)]
1. Procédé utilisant un étalon externe pour la quantification et la détection de n'importe quel micro¬ organisme à ADN ou à ARN, caractérisé en ce qu'il comprend :1. Method using an external standard for the quantification and detection of any DNA or RNA microorganism, characterized in that it comprises:
(1) l'utilisation ou la détermination d'une concentration étalon du micro-organisme ou de la concentration de l'ADN ou de l'ARN porté par ce micro-organisme, appelé micro¬ organisme étalon, et(1) the use or determination of a standard concentration of the microorganism or of the concentration of DNA or RNA carried by this microorganism, called a standard microorganism, and
(2) la comparaison de la quantité du produit de la transcription réverse et/ou de l'amplification de l'ARN ou de l'ADN issu d'une concentration inconnue du micro- organisme avec des quantités d'amplificat issues de l'ARN ou de l'ADN de concentrations connues du dit micro¬ organisme, le micro-organisme cible ou son génome à doser étant identique au micro-organisme étalon ou son génome traité en parallèle.(2) comparing the amount of the product of reverse transcription and / or amplification of RNA or DNA from an unknown concentration of the microorganism with amounts of amplificate from RNA or DNA of known concentrations of said microorganism, the target microorganism or its genome to be assayed being identical to the standard microorganism or its genome treated in parallel.
2. Procédé selon la revendication 1, caractérisé en ce que l'étape (2) consiste essentiellement en une révélation comparative fondée sur la comparaison des concentrations de l'étalon avec les concentrations du micro-organisme cible telles que détectées de préférence au moyen de la méthode dite à l'ADN branché ou de toute autre méthode de révélation qui n'amplifie pas les ADN ou les ARN de l'étalon ou du micro-organisme cible. 3. Procédé selon la revendication 1, caractérisé en ce qu'il comporte les étapes selon lesquelles:2. Method according to claim 1, characterized in that step (2) consists essentially of a comparative revelation based on the comparison of the concentrations of the standard with the concentrations of the target microorganism as preferably detected by means of the so-called branched DNA method or any other method of revealing which does not amplify the DNA or RNA of the standard or of the target microorganism. 3. Method according to claim 1, characterized in that it comprises the steps according to which:
1) on prélève et on purifie une quantité quelconque du micro-organisme à doser, à partir d'échantillons de prélèvement humains, animaux ou végétaux, ou à partir de cultures cellulaires, la quantité de micro-organisme étant suffisante pour que les concentrations en ADN ou ARN cible soient mesurables par des méthodes directes;1) any quantity of the microorganism to be assayed is taken and purified, from human, animal or plant samples, or from cell cultures, the quantity of microorganism being sufficient for the concentrations of Target DNA or RNA are measurable by direct methods;
2) on extrait l'ADN ou l'ARN et on en mesure la quantité recueillie; 3) on utilise par ailleurs le nombre de bases nucleotidiques du micro-organisme concerné; 2) extract the DNA or RNA and measure the amount collected; 3) the number of nucleotide bases of the microorganism concerned is also used;
DECLARATION SELON L'ARTICLE 19DECLARATION ACCORDING TO ARTICLE 19
A toutes fins utiles, nous précisons que les modifications apportées au libellé de la revendication 1. initiale sont :For all intents and purposes, we point out that the modifications made to the wording of the initial claim 1. are:
- l'insertion après le mot "Procédé" de l'expression "utilisant un étalon externe" ;- the insertion after the word "Process" of the expression " using an external standard";
- l'insertion, à la fin de la partie caractérisante de ladite revendication 1., de l'expression ", le micro-organisme cible ou son génome a doser étant identique au micro-organisme étalon ou son génome traité en parallèle- the insertion, at the end of the characterizing part of said claim 1., of the expression ", the target microorganism or its genome to be assayed being identical to the standard microorganism or its genome treated in parallel
Ces modifications visent respectivement pour la première d'entre elles à indiquer que la technique antérieure la plus proche est celle des procédés utilisant un étalon externe, et pour la deuxième d'entre elles que le procédé revendiqué constitue une méthode non compétitive, qui ne met en oeuvre à titre d'étalon externe ni un plasmide, ni un transcrit, mais bien uniquement le même micro-organisme que le micro-organisme cible ou son génome à doser.These modifications are aimed respectively for the first of them to indicate that the closest prior art is that of processes using an external standard, and for the second of them that the claimed process constitutes a non-competitive method, which does not used as an external standard neither a plasmid nor a transcript, but only the same microorganism as the target microorganism or its genome to be assayed.
L'une et l'autre de ces modifications sont totalement supportées par la description initiale, en particulier par le passage allant de la page 4 ligne 31 à la page 5 ligne 12, ainsi que par les indications qui se trouvent en page 10 lignes 28-30. Both of these modifications are fully supported by the initial description, in particular by the passage from page 4 line 31 to page 5 line 12, as well as by the indications on page 10 lines 28 -30.
EP96937396A 1995-11-06 1996-11-05 Microorganism quantitation and detection method and kit Withdrawn EP0862654A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR9513093 1995-11-06
FR9513093A FR2740781B1 (en) 1995-11-06 1995-11-06 METHOD AND KIT FOR QUANTIFICATION AND DETECTION OF MICROORGANISMS
PCT/FR1996/001736 WO1997017465A1 (en) 1995-11-06 1996-11-05 Microorganism quantitation and detection method and kit

Publications (1)

Publication Number Publication Date
EP0862654A1 true EP0862654A1 (en) 1998-09-09

Family

ID=9484269

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96937396A Withdrawn EP0862654A1 (en) 1995-11-06 1996-11-05 Microorganism quantitation and detection method and kit

Country Status (11)

Country Link
US (1) US6277560B1 (en)
EP (1) EP0862654A1 (en)
JP (1) JP2000500007A (en)
AU (1) AU7500496A (en)
BR (1) BR9611334A (en)
CA (1) CA2236842A1 (en)
CZ (1) CZ120598A3 (en)
EA (1) EA000613B1 (en)
FR (1) FR2740781B1 (en)
NO (1) NO982039L (en)
WO (1) WO1997017465A1 (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2377972A1 (en) * 1999-06-24 2001-01-04 Peter A. Anton Determining nucleic acid sequences in a biological sample
EP1469083A1 (en) * 2003-04-17 2004-10-20 Centre National De La Recherche Scientifique (Cnrs) Method of calibration of reverse transcription using a synthetic messenger RNA (smRNA) as an internal control
GB2405405A (en) * 2003-08-29 2005-03-02 Rhm Tech Ltd Standards in PCR
US7981606B2 (en) * 2005-12-21 2011-07-19 Roche Molecular Systems, Inc. Control for nucleic acid testing
AU2010303153B2 (en) * 2009-10-09 2015-08-27 Monsanto Technology Llc Methods of quantifying target organisms and creating reniform resistant cotton plants
CN109715827B (en) * 2016-05-06 2023-01-10 明尼苏达大学董事会 Analytical standards and methods of use thereof

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5389512A (en) * 1988-10-07 1995-02-14 Hoffman-La Roche Inc. Method for determining the relative amount of a viral nucleic acid segment in a sample by the polymerase chain reaction
US5219727A (en) * 1989-08-21 1993-06-15 Hoffmann-Laroche Inc. Quantitation of nucleic acids using the polymerase chain reaction
FR2691162B1 (en) * 1992-05-12 1994-07-08 Aremas MEANS FOR QUANTITATIVE DOSING OF RETROVIRUSES, METHOD FOR ITS PREPARATION AND DIAGNOSTIC KIT COMPRISING SAID MEANS.
AU4248193A (en) * 1992-05-15 1993-12-13 New England Deaconess Hospital Quantitation of viral rna by competitive polymerase chain reaction
AU6359794A (en) * 1993-03-05 1994-09-26 Genelabs Technologies, Inc. Method for hiv quantitation
WO1995014109A1 (en) * 1993-11-19 1995-05-26 U.S. Department Of The Army High through-put quantitative polymerase chain reaction for hiv clinical specimens
US5710029A (en) * 1995-06-07 1998-01-20 Gen-Probe Incorporated Methods for determining pre-amplification levels of a nucleic acid target sequence from post-amplification levels of product
US5705365A (en) * 1995-06-07 1998-01-06 Gen-Probe Incorporated Kits for determining pre-amplification levels of a nucleic acid target sequence from post-amplification levels of product

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9717465A1 *

Also Published As

Publication number Publication date
JP2000500007A (en) 2000-01-11
FR2740781A1 (en) 1997-05-09
FR2740781B1 (en) 1998-03-20
BR9611334A (en) 1999-04-06
AU7500496A (en) 1997-05-29
NO982039D0 (en) 1998-05-05
CA2236842A1 (en) 1997-05-15
NO982039L (en) 1998-05-05
WO1997017465A1 (en) 1997-05-15
CZ120598A3 (en) 1998-08-12
US6277560B1 (en) 2001-08-21
EA000613B1 (en) 1999-12-29
EA199800438A1 (en) 1998-12-24

Similar Documents

Publication Publication Date Title
CA2059657C (en) Process for the detection of a nucleotidic sequence by use of the sandwich hybridation technique
JPH03133379A (en) Extraction of nucleic acid without using protein decomposing enzyme and pcr augmenting method
JP2002536981A (en) Method for measuring the presence of a nucleic acid target sequence and its application
Ciftci et al. A novel mutation tolerant padlock probe design for multiplexed detection of hypervariable RNA viruses
CN109750124B (en) Nucleic acid group for detecting lentivirus and detection method
EP0763602B1 (en) Detection of enterobacteria
EP0862654A1 (en) Microorganism quantitation and detection method and kit
JP4903722B2 (en) Method for detecting live cells in a sample by using a virus
AU2018236842A1 (en) Compositions and methods for detecting gastrointestinal pathogen nucleic acid
JP5818587B2 (en) Method for detecting C. perfringens and kit for C. perfringens detection
FR2674254A1 (en) NON-RADIOACTIVE DETECTION OF THE PRESENCE OF A DETERMINED NUCLEIC ACID IN A BIOLOGICAL SAMPLE.
JP2018000124A (en) Kit for nucleic acid extraction and amplification from virus and extraction and amplification method using the same
FR2921064A1 (en) OLIGONUCLEOTIDES, USE, DETECTION METHOD AND KIT FOR DIAGNOSING THE PRESENCE OF THE CHIKUNGUNYA VIRUS E1 GENE
FR2740782A1 (en) Detection and quantitation of microorganisms by measuring nucleic acid content
KR101034805B1 (en) Norovirus standardized positive control and norovirus detecting kits being provided with rna transcripts thereof
BE1010608A3 (en) Method for quantification of nucleic acid sequence.
Gallup et al. SPUD qPCR Assay Confirms PREXCEL-Q Software's Ability to Avoid qPCR Inhibition
CN111676272A (en) Cas12 a/crRNA-based food-borne pathogenic bacteria detection method
EP3818181A1 (en) Method and device for detecting and differentiating point mutations in microorganisms by oligochromatography
CN113817854B (en) Method for visually detecting salmonella genes by single-label ssDNA probe
JP2019129798A (en) Quick and efficient isothermal amplification reaction using heating sample
KR101203067B1 (en) Norovirus standardized positive control genes RNA transcripts
JP2017195871A (en) Reagents for extraction and amplification of nucleic acid from virus
FR2786786A1 (en) METHOD AND KIT FOR AMPLIFICATION, DETECTION AND / OR QUANTIFICATION OF GENOME POPULATIONS
EP1137801A1 (en) Method for detecting and/or quantifying a known function from a nucleic acid sample

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19980605

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 980605;LT PAYMENT 980605;LV PAYMENT 980605;RO PAYMENT 980605;SI PAYMENT 980605

RAX Requested extension states of the european patent have changed

Free format text: RO PAYMENT 980605

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20020604