EP0751827A1

EP0751827A1 - Method of processing nucleic acids

Info

Publication number: EP0751827A1
Application number: EP95913132A
Authority: EP
Inventors: Wolf Bertling
Original assignee: Roche Diagnostics GmbH; Boehringer Mannheim GmbH
Current assignee: Roche Diagnostics GmbH
Priority date: 1994-03-19
Filing date: 1995-03-16
Publication date: 1997-01-08
Anticipated expiration: 2015-03-16
Also published as: EP0751827B1; DE59503269D1; ATE169844T1; US5985555A; ES2123239T3; JP3591653B2; JPH09510353A; WO1995025592A1; DE4409436A1

Abstract

PCT No. PCT/EP95/00975 Sec. 371 Date Sep. 19, 1996 Sec. 102(e) Date Sep. 19, 1996 PCT Filed Mar. 16, 1995 PCT Pub. No. WO95/25592 PCT Pub. Date Sep. 28, 1995Method and device for processing nucleic acids in a reaction mixture on a surface that can be temperature-controlled and its immediate vicinity wherein the main space of the reaction mixture remains essentially isothermal. The method has the advantage of a very short processing time.

Description

Process for processing nucleic acids

The invention relates to methods for processing nucleic acids using a temperature regulating element and devices and devices for carrying out these methods.

In analytics, especially in medical diagnostics, more and more methods are beginning to establish themselves, which are based on the detection and synthesis of nucleic acids. Nucleic acids are known as e.g. B. very specific detection agent for organisms for the diagnosis of diseases well suited. Various processing steps, such as denaturation, hybridization, synthesis and immobilization of nucleic acids, and their enzymatic treatment are common during these detection methods. For a long time, a problem with such methods was the small amount of nucleic acids in the samples.

A solution to this problem, which makes a large number of analytes available for detection, brought the amplification of nucleic acids. Such a method is described in EP-A-0200362, namely the polymerase chain reaction (PCR). A large number of copies of the original nucleic acid are produced by repeatedly extending primers in a reaction solution. These can be detected for example by hybridization with a labeled nucleic acid probe according to EP-A-0201 184. The reaction solutions used for this purpose are heated to specific temperatures or cooled again at intervals to separate double strands and for the extension reaction. Because the volumes are relatively large, the times for temperature regulation require a relatively long time for carrying out the entire amplification process.

The so-called capillary PCR tries to remedy this. The reaction mixture is in glass capillaries with a small diameter. As a result, the time for carrying out an amplification sequence can be reduced to approximately 30 minutes. A problem with capillary PCR is the vulnerability of the glass of the capillary to be heated and the difficult to handle sample application. More and more amplification methods have recently been described, in which the amplification reactions can be carried out in a closed system, ie without the addition of reagents during the cycles. For example, WO 92/07089 describes a system in which the amplification mixture is kept in a circulatory system for as long as necessary by repeatedly heating and cooling the reaction mixture. The residence time of the mixture in the individual zones of the system can be influenced by the choice of the diameter. EP 0511712A1 describes an amplification process in which the amplification mixture is cyclically brought to very specific temperatures in order to achieve relatively short cycle times. Sample handling is also difficult here.

One of the objects of the present invention was to improve the existing nucleic acid processing methods and in particular to provide methods in which the amplification can be completed in a particularly short time.

The invention therefore relates to a method for processing and, in particular, multiplying nucleic acids in a reaction mixture, characterized in that the temperature of a surface adjacent to the reaction mixture and its immediate surroundings is regulated, but the main space of the reaction mixture remains essentially isothermal.

The invention also relates to a device for processing and multiplying nucleic acids with a temperature regulating element and a device which contains this device.

Nucleic acids in the sense of the invention are all types of nucleic acids, modified or unmodified. Unmodified nucleic acids are, for example, the naturally occurring nucleic acids. Modified nucleic acids can be created by exchanging groups of the natural nucleic acids for other chemical residues. Examples are nucleic acid phosphonates or phosphothioates and nucleic acids modified on the sugar residues or the bases by chemical groups, which can also be detectable.

The processing of nucleic acids according to the present invention preferably contains at least one reaction step which takes place at an elevated temperature, but at least at a temperature which deviates from the ambient temperature. Such reaction steps are, for example, the thermal denaturation of partially or completely double-stranded nucleic acids. It is used to manufacture single strands or to Melt secondary structures that heat nucleic acids to temperatures above the corresponding melting point. A further processing step of nucleic acids is the hybridization of mutually complementary nucleic acids in single-stranded areas to form a double-stranded nucleic acid (hybrid). This takes place at temperatures below the melting point of the hybrid. In order to achieve hybridization, the reaction mixture often has to be cooled. In particular in amplification or sequencing methods, a further processing step is carried out, namely the extension of a primer hybridized to a so-called template nucleic acid (template) with the aid of further mono- or oligonucleotides. The temperature at which the corresponding enzyme used has its optimum activity or competitive reactions are reduced is preferably set here. This temperature can also be identical to the hybridization temperature (2-stage PCR).

A special case of processing nucleic acids is the multiplication of nucleic acids. According to the present invention, practically all amplification methods, eg. B. target sequence-dependent amplifications (in particular non-isothermal amplifications such as the polymerase chain reaction, ligase chain reaction or similar) are carried out. At least one of the temperature-sensitive processing steps mentioned above also takes place during these propagation processes.

A central feature of the present invention is the fact that the change in temperature does not take place in the entire reaction mixture, but only in a very small part of the reaction mixture. The consequence of this is that the heating up or cooling down of this relatively small area can take place very quickly and thus the processing of the nucleic acids is greatly accelerated. To carry out the process according to the invention, the reaction mixture is therefore brought into contact with a temperature-controllable surface. By changing the temperature of the surface, the immediate surroundings of this surface are heated, adjusted or cooled, depending on the processing step and the temperature of the reaction mixture. There are several cases here.

In the event that the temperature of the reaction mixture is higher than the melting temperature of the nucleic acids to be processed, the surface can be cooled in order to achieve hybridization of the nucleic acids in the surrounding area. In the event that the temperature of the reaction mixture is lower than the melting temperature and the temperature required for extending a primer on the nucleic acid, the surface and thus the immediate surroundings can first be heated to a temperature where the primer can be extended. The temperature can then be raised above the melting point of the nucleic acids, as a result of which denaturation and strand separation of the double-stranded nucleic acids formed can take place. This can be followed by cooling to a temperature at which the single strands can hybridize with new primers. This cycle can be run through several times.

In the event that the temperature of the reaction mixture is between the optimum temperature for the extension and the melting temperature, the temperature on the surface is first increased in order to separate double strands. The temperature is then reduced to a temperature at which the individual strands hybridize with primers. The optimum temperature for the extension is then set and, if desired, the cycle is repeated.

The desired temperature can be maintained for a set period of time, e.g. B. until the desired reactions have occurred on the surface. For this purpose, the temperature of the surface can also be kept constant by known control measures and connected control measures (reheating, cooling). As is customary in known methods, the time periods depend on the length of the nucleic acids to be processed and their homology, as well as the special hybridization conditions. However, the person skilled in the art can determine the optimal periods of time by simple experiments. Depending on the processing step, the periods are between fractions of a second and a few seconds.

In the cases described above, the main space of the reaction mixture remains essentially isothermal, while the reaction mixture located in the immediate vicinity of the surface adapts to the temperatures set on the surface.

To regulate the temperature and to set specific temperatures on the surface and its immediate surroundings, it is advisable to choose the surface of a device as the surface, which consists of a heating element and a cooling element. The heating element preferably has a relatively large surface area with a comparatively low heat capacity. Metal foils, for example, have proven to be suitable, which can be heated in a suitable manner, e.g. B. by electrical Electricity. Materials for the metal foil are good heat-conducting materials, e.g. B. gold, preferred.

The cooling element should have a comparatively high heat capacity. Solid, liquid or gaseous substances are suitable as cooling medium. Liquid cooling media, e.g. B. water. Good thermal conductivity is an advantage.

The arrangement of the heating element and the cooling element can be changed in accordance with the temperature of the reaction medium, depending on whether the device is to be used more for heating or for cooling the surface and its immediate surroundings. In general, however, the heating element will be located in close proximity to the surface. The surface of the heating element can also directly adjoin the reaction mixture. However, it is also possible to separate the heating element from the reaction mixture by means of a thin, thermally conductive layer.

The cooling element can in principle be positioned at any point with which the surface and the immediate surroundings can be cooled. However, it has proven to be preferred to position the cooling element on the side of the heating element remote from the reaction mixture. In the event that the heating element has a low heat capacity, the fact that the heating element also has to be cooled is not a decisive disadvantage.

In the method according to the invention, the heating element is used for heating until the surface and its immediate surroundings are heated to the desired temperature. A strong temperature gradient will form near the surface, while the rest of the reaction mixture remains isothermal. This applies in particular if no remarkable liquid exchange is realized during the heating process, but also if a liquid exchange takes place. The heating process can be completed within fractions of a second, in favorable cases even milliseconds. The same applies to cooling. The reaction space, which is heated to the desired temperature, can be very small, preferably it is less than 0.2 mm, particularly preferably less than 0.5 μm deep. The surface of the heating element which is directed onto the reaction mixture influences the depth of the temperature gradient and its rate of build-up. A preferred size of the surface can result from the desired applications of the method. As a rule, the surface is <2 cm ^, particularly preferably between 0.2 cm ^ and 0.2 mm ^. The surface can be smooth or rough. In case the surface is at the same time is used as a carrier of agents for processing the nucleic acids, it is advantageous to enlarge this surface by means of surface structures.

The volume of the reaction mixture is practically not of great importance for the invention. This can be a drop with a volume of 20 μl, but it can also be any volume. It is an advantage of the method according to the invention that the device containing the heating and cooling element can, for example, also be introduced into a large vessel with reaction mixture, the essential reactions taking place only in a very small boundary region of the surface, while the rest of the reaction space has practically no influence on the reaction. On the other hand, the available samples and reagent quantities represent a practical limit for the size of the reaction mixture. The reaction volumes will therefore usually be in a range between 1 ml and 30 μl, preferably between 100 μl and 50 μl, but can be applied, for example of the reaction mixture on the temperature-regulating surface also work with much smaller volumes.

For processing the nucleic acids, they are brought to the temperature-regulatable surface or its immediate surroundings. This can be done in various ways, for example mechanically or by diffusion. The nucleic acids are preferably bound to the surface. This binding again can be of different types. A chemical bond is preferred, either via adsorption or biospecific interactions. In the case of binding by adsorption, the surface can be coated with a nucleic acid-binding reagent. Biospecific interactions can be interactions between nucleic acids and the nucleic acids to be processed (hybridization, complementary part of these nucleic acids), but also interactions between antigens or haptens with antibodies directed against them and receptor-ligand interactions. A preferred way of binding the nucleic acids to be processed to the surface is via oligonucleotides which are covalently bound to the surface and which are complementary to at least part of the nucleic acid to be processed. However, these oligonucleotides can also have biospecific interactions, e.g. B. biotin streptavidin, bound to the surface.

According to the present invention, the binding of the nucleic acids to be processed is preferably reversible. After a time dependent on the process to be carried out, the nucleic acids can be heated by heating the surface and its immediate exercise can be released again. Any steps can be carried out between binding and releasing the nucleic acid, e.g. B. Implementation of chemical reactions, but also separation of the bound nucleic acids from the original reaction mixture and transfer to a new reaction mixture.

In the case of a multiplication reaction of the nucleic acids, the oligonucleotides bound to the surface can be used as primers for the elongarion or extension using the nucleic acid to be processed as a template. This forms an extended primer bound to the nucleic acid to be processed. The nucleic acid used as a template can be detached from the extension product by increasing the temperature and can act as a template for a new immobilized primer which has not yet been extended in the next temperature cycle. In this way it is possible to extend a large amount of primers immobilized on the surface and thus to produce copies of parts of the nucleic acid to be processed. The extended (extended) surface-primers serve in turn by means of complementary primers to multiply the molecules serving as the template. The reagents required for the reactions to be carried out must be kept in stock in the entire reaction mixture or added as required. For a multiplication reaction according to the principle of the polymerase reaction (EP-B-0201 184), the deoxyribonucleotides, a DNA polymerase and another primer and suitable buffer reagents must therefore be kept in the reaction mixture. To display other nucleic acid types (e.g. RNA), other reagents, e.g. B. ribonucleotides or RNA-dependent polymerases are provided. This step of the process can take particular account of the working temperature of the processing enzyme.

However, the nucleic acids to be processed can also be bound to the surface by physical methods, e.g. B. by means of a magnet. To do this, however, the nucleic acids must be bound to a magnetizable particle. The binding of magnetic particles loaded with nucleic acid can be made reversible in that a magnet is located behind the surface or is induced. The magnetic parts can be bound to or removed from the surface by applying an alternating field.

Special embodiments, some of which have an advantageous effect, are also conceivable. The efficiency can be increased by increasing the diffusion of the nucleic acids in the reaction mixture by convection. It can also be partial to use higher concentrations of the reactants compared to the reaction mixtures usually used. In addition, the nucleic acid to be processed can be concentrated on the surface by prehybridization at the start of the reaction.

In the case of amplification or multiplication of the nucleic acids, it may be that the number of cycles to be completed, e.g. B. in a PCR, must be increased so that enough amplification product is generated. However, this is not a disadvantage because of the very short cycle time according to the method according to the invention.

In the event that the reaction mixture is kept at a relatively low temperature, this means that less demands are made of the heat stability of the reagents than if the entire reaction mixture is heated several times. A thermostable polymerase is therefore not absolutely necessary for a multiplication reaction and nevertheless new enzyme does not have to be pipetted into the reaction mixture in every amplification cycle.

Any further steps can follow the processing of the nucleic acids according to the invention. For example, the nucleic acids can either be examined in the state bound to the surface or in the released state again, or processed with further reagents.

With the help of the described amplification method according to the invention, a method for the detection of nucleic acids in a sample can thus be formed in a simple manner. For this purpose, the surface to which the oligonucleotides functioning as primers are bound is brought into contact with the sample liquid. The temperature of the surface and its immediate surroundings is then brought to a temperature which is above the melting point of the double-stranded nucleic acid contained in the sample. After cooling the surface and the immediate surroundings, the nucleic acid to be detected will hybridize with the oligonucleotide. By cycling, as described above, the nucleic acid to be detected is used to produce a large number of copies which can remain bound to the surface at the end of the multiplication reaction. The amount of nucleic acids on the surface can be determined by hybridization with labeled nucleic acid probes and their detection with the aid of the label. For methods that allow the direct detection of nucleic acid hybrids without labeling or of extended single strands (primers) (e.g. based on the principle of surface plasmon resonance) direct evidence is also possible. If labeled primers or mononucleotides are used for the multiplication reaction, the hybridization with a detectably labeled nucleic acid probe is omitted. An approach is also conceivable in which a higher temperature is maintained in the approach and the surface, which assumes lower temperatures necessary for further steps.

Since the application according to the invention of the method for the propagation of the nucleic acids practically takes place on a surface, we introduce the term 2D amplification for this propagation reaction.

The invention also relates to a device which can be used for use in the machining method mentioned above. In particular, the subject of the invention is a device for processing nucleic acids by means of a temperature regulating element, this element being suitable for regulating the temperature of the surface and the immediately adjacent surroundings and wherein means for processing the nucleic acids can be bound to this. These agents can be oligonucleotides and serve, for example, as primers. This device preferably contains a cooling element and a heating element, the arrangement preferably being as in the processing method described above. This device is preferably very small. For example, it can have a thickness of <5 mm and an area of <10 cm ² . The elements therein, such as the cooling element or the heating element, are simple components. Therefore, this device is excellently suitable for single use (disposable), which can reduce the inherent contamination risk for reusable. If the device is to be suitable for multiple use, it is also possible to separate the heating element from the space containing the reaction mixture by means of a very thin component and to make this component separable from the device. A new component can then be used for a further processing stage.

The invention also relates to a device for processing nucleic acids which contains a control element for time-dependent temperature regulation and a device according to the invention. The control element of a so-called thermal cycler according to EP-A-0236 069 can be used as the control element, but control based on the principle of inkjet printers is preferred, since they have a higher control speed. The control element must be able to heat the heating element at predetermined intervals until the surroundings of the surface have a sufficient temperature. Likewise, it must be able to the cooling element to provide cooling on the surface at predetermined intervals. For this purpose, for example, a cooling liquid can be passed through the device. If the heat capacity of the heating element is low, but the heat output is relatively high, continuous cooling is also possible. As a surface you can use different forms in an ohmic temperature-controlled version of this device, which are heated depending on the voltage and the duration of the current flow. In a different version, the surface to be tempered is located on a preferably black base, preferably a plastic film, which is heated from the distal surface to be tempered by a laser beam, preferably an infrared laser. Both the surface to be tempered and the heat-absorbing and heat-conducting material can be attached to a support surface, preferably infrared-transparent glass.

The device according to the invention can have a wide variety of embodiments. For example, it can be designed for immersion in a vessel. However, it can also be designed such that the liquid containing the nucleic acid to be processed can be dripped onto the surface or filled into a vessel formed by the surface. This reaction space can also be closed after the liquid has been poured in, so that contamination problems can be reduced.

One embodiment of the invention is a method for increasing nucleic acids. As in example 3, e.g. B. an amplification reaction called polymerase chain reaction with subsequent detection.

Another embodiment of the method according to the invention is a method for enriching nucleic acids e.g. B. by hybridization. In the case of primers with sufficient specificity covalently adsorbed on the surface, by preselecting the hybridization temperature, given a known composition (ionic composition, concentration of reagents) of the reaction solution to be analyzed, a hybridization temperature can be specified such that a specific binding of the nucleic acid to be analyzed is specified to the primers used for hybridization which are covalently bound to the surface. This method can be used for this

a) to carry out an exact evaluation of the actual hybridization temperature,

b) to carry out an exact concentration of the nucleic acids to be analyzed in the reaction mixture, c) to test for the presence of cross-hybridizing sequences.

This short list is not exhaustive.

This method can also be used to transfer nucleic acids from one solution to another. Then hybridization takes place in the first vessel (low temperature) and denaturation (higher temperature) takes place in the second vessel.

Another embodiment of the present invention is a method for sequencing nucleic acids. One possible application of the invention in connection with sequence analyzes is the so-called mini-sequence analysis. The exact sequence determination of the nucleic acid nucleotide adjacent to the primer can be carried out by adding only dideoxynucleotides and no deoxynucleotides for sequencing in the solution provided for sequencing. The four possible dideoxynucleotides ddATP, ddCTP, ddGTP and ddTTP are labeled with different fluorescent markers. In any case, the incorporation of the next nucleotide leads to the termination of the sequence reaction and after the extended primer located on the surface has been agreed, the sequence of the nucleotide on the primer can be determined by analyzing the specific fluorescence.

A special case of the possibilities of using the present invention is a method for sequencing nucleic acids which have previously been amplified in a PCR reaction. After amplification, the amplified product is covalently bound to the reactive surface in double-stranded form via the primer. By briefly going through a high-temperature phase, this amplificate is present in single-stranded form through denaturation, can be cleaned by transferring it into a washing solution, and can then be used again by transferring it to a sequencing reaction for subsequent sequencing. This sequencing is particularly efficient since only single-stranded matrix material is now available, to which a pair of sequencers will bind particularly efficiently. The sequencing reaction then again results in a double-stranded molecule, the labeled (sequenced) half of which is now available for analysis by gel chromatography. When using differently labeled (with different fluorescent markers dideoxynucleotides) all four reactions necessary for a sequence analysis can be carried out at once, in the conventional method this analysis must be repeated four times. The present invention is explained in more detail with reference to the accompanying figures:

FIG. 1 shows the construction diagram of a device (1) according to the invention, which is immersed in a reaction vessel (3) filled with reaction mixture (2). The device contains a cooling element (4) and a heating element (5) which can be heated by means of electricity. Oligonucleotides (6) are covalently bound to the surface of the heating element. Both the cooling and the heating element can be regulated via connections (7; 8) on control units.

FIG. 2 shows an exemplary temperature profile for an amplification reaction according to the type of PCR. In a first phase (A) the nucleic acids are denatured at a temperature slightly below 100 ° C. In a phase (B) the hybridization of the nucleic acids to be amplified with the immobilized oligonucleotides takes place on the solid phase at about 50 ° C. In a third phase (C) the primers are extended at about 70 ° C using the nucleic acid as a template.

FIG. 3 shows the reactions taking place in the immediate vicinity of the surface (phases A to C). For phase (A) three isotherms are shown in their schematic course, for phase (B) and (C) only one isotherm each. In phase (A) the nucleic acids are denatured and diffuse single-stranded over a certain time, in phase (B) templates and primers hybridize and in phase (C) primers are extended along the matrices.

FIG. 4 shows a possible prototype of a surface temperature control suitable for the application according to the invention.

The heating unit, which contains the exchangeable heated gold surfaces as well as the physical requirements for cooling or heating (coolant connection, power connection), is connected to the actual measuring units (1) by means of plug connections (7; 8) with the brackets also attached to them Reaction vessels (11) are attached, in which the matrix molecules, buffer components and primers necessary for carrying out the reaction are in solution and the polymerase is present.

The sensors (9), here in the form of a test strip, contain, for example, gold surfaces (5) in FIG. 4, which do not have to be coated with the same primers (6).

FIG. 5 shows enlargements of the measuring units with exchangeable test strips from FIG. 4, the measuring unit (1, consisting of 9 and 10) comprising the electronic connection and cooling unit (upper, gray part of the illustration) and the test strip (= measuring sleeve) stands. A cross section through this measuring unit is shown in the lower part of the figure, on which the cooling circuit (4) used for cooling with stirring mechanism (12) and cooling liquid (13) as well as the reaction surfaces (5, 6) with electronic connection can recognize. In the right part of the figure below, a further enlargement of the cathode connection of the gold membrane (5) with a support and separation filter (14) and an adhesive layer for the oligonucleotides (6) can be seen.

FIG. 6 consists of a schematic drawing of the temperature gradient which forms in the immediate vicinity of the adhesive layer with oligonucleotides and the temperature profile to be expected, here using the example of a 3-stage PCR in which the temperatures are 96 ° for 0.1 seconds, 54 ° for 0.5 seconds and 72 ° are also shown for 0.5 seconds.

The following examples are intended to illustrate the invention:

Example 1:

Production of a cyclically temperable surface (variant a).

An exemplary cyclically temperable gold surface can be obtained by milling two approximately 1 mm wide and 3 mm long elongated holes parallel to one another at a distance of 3 mm in a thin circuit board. On the one side that faces the solution and is therefore called the proximal side, these elongated holes are conductively connected to one another by vapor deposition with gold. On the distal side, one of these elongated holes is connected to the anode via the printed circuit board traces, and the other is also connected to the cathode via the printed circuit board runs.

The gold layer on the proximal side is applied by applying a mask of the desired size, in this case 3 x 3 mm flush, over the two longitudinal surfaces. The inside of the longitudinal surface is galvanically coated with copper up to the surface. In the following vapor deposition process, which is carried out as is customary in the industry, the two electrically conductive longitudinal holes are now coated with a gold layer a few μm thick. The coating process is described below:

The gold surface was produced by vapor deposition on "Lexan" polycarbonate foils (manufacturer: General Electric, thickness 0.75 mm) with the dimensions 8x8 cm over a metal mask (d = 0.5 mm, aluminum) in a Leybold high vacuum coating system (Univex 450). The surfaces lie at regular intervals, which allow the steaming plate to be disassembled into several units. The layer thickness of the gold is 300 nm. In a further step, the multi-gold sports plate was coated with "thinned" biotinthiol binding layers to form a hydrophobic SAM layer. The biotin thiol compound (HS-C12-DADOO-biotin; N, N "- (12-mercaptodc ^ ecylyl-biotmylyl ^ jT-diaminoethyl-glycol diether; 2.94 mg; 5x10-5 m) and the diluent (12-mercaptoundecanol, 9.2 mg, 4.5x10 "^ m) were dissolved in 100 ml of ethanol pa. The freshly coated polycarbonate foils were immersed in this solution. After 4 hours the plates were removed, washed twice with ethanol pa and immediately coated with streptavidin. For this the gold spots and the S AM-coated foils were immersed in a streptavidin solution (concentration streptavidin: 0.5 mg / ml in 0.05 M potassium phosphate buffer pH 7.2) for 1 h. The surfaces treated in this way were then washed with a washing solution (50 mM potassium phosphate buffer pH 7.2, 2% sucrose, 0.9% NaCl, 0.3% Rmderserumalbumin fraction H) treated and then dried for 20 h (25 ° C and 40% humidity).

The very thin thickness of the gold layer results in a very small conductive gold cross section (3 mm x 3 μm over a distance of 3 mm). This gold layer therefore represents a relatively high resistance compared to the conductor tracks.

The conductor tracks are now connected to a power supplier which, with the aid of a computer, allows the ohmic induced temperature of the gold surface to be checked.

Production of a cyclically temperable surface (variant b)

In a variant for the production of a cyclically temperature-controllable surface, the cover layer, which isolates the measuring meander from platinum, of a generally commercially available platinum temperature sensor (PT 100) is vapor-coated with a gold layer. If you connect this measuring sensor to a regulator-controlled voltage source, this sensor can also be used as a thermal source for the evaporated gold layer. To do this, it is necessary to forward the current and voltage at the platinum sensor to a controller via an analog divider. The controlled variable of the controller is the resistance of the heated platinum element, which permits exact temperature control when the gold surface temperature has been normalized with the temperature of the platinum meander.

Example 2:

An exemplary device for measuring the surface temperature of the gold foil (variant a).

A gold foil according to Example 1, variant a, is covered with a mask which allows the gold foil to be vapor-deposited with an approximately 1 mm wide gold thread which extends beyond this gold surface and can be connected to a measuring point. Another mask, the vapor deposition with a second thread, e.g. B. from nickel, bismuth or another alloy suitable for temperature measurement, is also provided. The metal thread lies at the same point on the gold surface as the gold thread at (200 nm thick), but separates in its course when it leaves the gold surface to be tempered and leads as a separate metal thread (300 nm thick) to a second measuring point. This arrangement of the measuring probes made of gold and a further metal or alloy suitable for temperature measurement allows the measurement of the thermal voltage (2.2 mV / 100 ° Kalvin) in the area of the gold foil where the two Probe thread overlap. The temperature at the cold junction is measured with a thermal precision PT 1000 element (accuracy> 1%) and standardized to 10 V (0 V corresponds to 0 °, 10 V corresponds to 100 °), only amplified and also to 10 V standardized. The sum of both temperatures is formed in a sum amplifier and used for the electronic control of the respective surface temperature.

Example 2b

An exemplary device for measuring the surface temperature of the gold surface from example 1, variant b.

For the exact determination of the surface temperature of the gold layer, there is the possibility of pressing the surfaces of two gold-vaporized PT 100 measuring sensors as described in example 1, variant b, in such a way that half of the gold-vaporized surfaces of the heating sensor and the Measuring sensor cover each other and the remaining area is in the surrounding medium. If only one sensor is used for measurement and the other for heating, then the temperature of the gold surfaces can be calculated exactly. The temperature at the surface of the sensors corresponds exactly to the mean value of the temperature of the heated and of the unheated sensor, both of which can be precisely defined via resistance measurements. In this way, using a temperature sensor used for the measurement, a whole series of temperable surfaces can be calibrated and prepared for carrying out PCR reactions. The temperature gradient of two surfaces arranged in this way is approximately 3 ° C. between the heated and unheated surface.

Example 3:

Carrying out a two-stage PCR with a surface-fixed primer.

An exemplary implementation of a polymerase chain reaction uses a surface-fixed, biotin-labeled primer (5 -GAAGGGAGGAAGGAGGGAGCGGAC-3 '). This primer is coupled via its biotin group located at the 5 'end to a surface streptavidin or gold streptavidin surface. The molar amount of streptavidin or biotin / square millimeter is approximately 0.2 pmol / mm ² . There are nanogram amounts or less of the following double or single-stranded template molecule in solution (only one strand cited: 5'-GAAGGGAGGAAGGAGGGAGCGGACGTCCACCACCACCCAACCACCCCACCC -3 ') and a counterprimer in the concentration of between 0.5 μM to 2 μM. The reaction takes place in commercially available PCR buffer (Boehringer Mannheim, package insert for the enzyme, 8th edition, ID number 1146165) at 1.5 mMMg ²⁺ . A commercially available Taq DNA polymerase (Boehringer Mannheim, ID number 1146165) was used as the polymerase in a concentration of 20 nM. The counterprimer present in solution (5 3GGTGGGGTGGTTGGGTGGTGGTG-3 ') was digoxigenin-labeled at its 5' end (patent EP 0324474).

The PCR reaction took place at a constant solution temperature of 68 ° and a primer-coated surface which varied cyclically between 96 and 68 °. The cyclical duration of the higher temperature varied in our example between 0.1 seconds, 10 seconds and 1 minute, that of the lower temperature between 0.5 seconds, 20 seconds and 1 minute.

After the cyclic temperature control had ended, the solution was cooled to room temperature, only the complementary elongated biotin and elongated digoxigenin-labeled primers hybridizing with one another and forming double-stranded DNA fragments. After washing with PCR buffer solution, the surfaces were reacted with anti-Dig-POD, incubated for 30 minutes, washed again and treated with ABTS (staining protocol according to package insert item 3 for the Boehringer Mannheim reverse transcriptase assay, non-radioactive, ID number 1468120). The resulting colored product was quantified in an ELISA photometer at a wavelength of 405/490 nanometers. The extinction values obtained demonstrate an amplification of a region of the template, measured as an extended counterprimer, which hybridizes to the primer coupled to the solid phase. In typical experiments, we obtained extinction values around 0.4 when measured in an elisa reader and after correction for the digoxigenin-free blank. In control experiments without a template, the values were 0.04 after correction of the blank value, and in controls without polymerase or without increasing the temperature, the values were 0.07 in the complete reaction mixture. Even heating the surface for several minutes (5 minutes) did not raise the ambient temperature in the constant-temperature solution by more than 7 C, even if a significantly larger (100-fold) surface (3 cm ² ) was heated. Example 4:

Production of a device according to the invention

An exemplary device according to this invention consists of three structural units. These three structural units are:

1. the heatable and temperature-regulatable surface penetrating into the liquid reaction medium,

2. order the components necessary for heating and cooling

3. the electronic controls are connected.

The element surface described in this example consists of a thin gold foil with a thickness of less than half a millimeter, which is firmly connected to a streptavidin layer. The biotin-labeled oligonucleotides necessary for the further processing steps can in turn be attached to this dextran layer by affinity coupling. These oligonucleotides are then covalently coupled to the surface via their 5'-phosphate end and thus have a reactive 3 'end which is accessible to enzymes.

This gold foil, which can be structurally stabilized by a supporting plastic net, and which has a reactive surface of about 5 x 5 mm, also serves as a heating element, since it is connected to an electrical power source which, when current flows, spontaneously heats this gold foil leads. The cooling element is located distal to the reaction batch, behind the gold foil. In this case, the cooling element consists of a plastic channel with a 7 mm wide surface bordering the gold foil. The channel is 2 mm deep and extends over the entire length of the part of the device referred to here as the sensor, which in this case comprises the heating and cooling elements and the reactive surface. This channel extends from one end of the sensor to the other end of the sensor to which the reactive surface is attached and back by enclosing a web separating the two channels. In this, to be referred to as a cooling loop component, a suitable cooling liquid, for. B. water circulated. The entire unit is cast in hard plastic and recyclable, i. H. both the gold foil and the plastic are recyclable.

The control of both the heating of the reactive surface, as well as the circulation speed and pre-cooling temperature of the cooling liquid is carried out via an electronic third component, which is attached outside the sensor, made. This third unit also includes the storage container and the connection connections for the cooling liquid. In this third unit there is also a micropump, which is responsible for circulating the coolant. By flanging the coolant hoses onto the measuring unit and by connecting the power supply to the reactive surface, the sensor is ready for use. Both the individual temperature ranges and the duration of their action on this surface can be preselected via an input unit which is attached to the surface of the control unit and has a digital display.

Example 5:

Carrying out a propagation reaction using the device according to the invention.

The example of an application of the device according to the invention here is an amplification reaction, referred to as a polymerase chain reaction, from a predetermined nucleic acid sequence. For this nucleic acid sequence, two primers with a length of 16 bases each, which code at a distance of 4 nucleotides to one another, have been selected. One primer is identical in its sequence, the other complementary to the analyzing sequence. The primer referred to here as identical is coupled to the reactive surface via its biotin residue present at the 5 'end. The other, complementary primer and all other reagents that are usually used in a so-called PCR reaction are added to the reaction mixture. The reaction is started by entering the corresponding reaction temperatures which should prevail in the immediate vicinity of the reactive surface and by immersing the reactive surface or the sensor (see Example 4) in the reaction mixture. The temperature changes in the reactive surface are programmed so that 50 heating and cooling cycles can be carried out in about 1 minute. By subsequently immersing the sensor in a solution with distilled water and briefly heating, the surface is cleaned of all non-covalently bound reaction partners. The surface cleaned in this way, which now only contains primer molecules and extended primer molecules, is introduced for analysis, together with the sensor, into a device which, according to the principle of plasmon resonance, allows a direct determination of the amount of the extended product. Reference list

1. Device according to the invention, measuring unit

2. Reaction mixture

3. Reaction vessel

4. Cooling element

5. Heating element / surface

6. Oligonucleotides

7. Connections for cooling element

8. Connections for heating element

9. interchangeable sensor

10. Electronics connection and cooling unit

11. Bracket for reaction vessel

12. Stirrer

13. Coolant

14. Support and separation filters (separation of the coolant)

Claims

1. A method for processing nucleic acids in a reaction mixture, characterized in that the temperature of the surface adjacent to the reaction mixture and its immediate surroundings is regulated, but the main space of the reaction mixture remains essentially isothermal.

2. The method according to claim 1, wherein at least one working step has a temperature that differs from the reaction mixture.

3. The method according to claim 2, characterized in that a temperature-changing work step is used for thermal denaturation.

4. The method according to claim 2, characterized in that a temperature-changing step serves to hybridize nucleic acids.

5. The method according to claim 2, characterized in that a temperature changing step serves to extend the template molecule.

6. The method according to claim 2, characterized in that different steps serve the target sequence-dependent amplification of a template molecule.

7. The method according to claim 1, characterized in that reactants are present bound to a surface and are thus suitable for detection of the processing and propagation results.

8. The method according to claim 1, characterized in that means for processing nucleic acids can be bound to a surface.

9. The method according to any one of claims 1 and / or 8, characterized in that these agents are oligonucleotides.

10. The method according to any one of claims 1 and / or 7 and / or 8, characterized gekenn¬ characterized in that there are further means for processing nucleic acids in a reaction mixture.

11. The method according to claim 1 and or 6, characterized in that a detection of specific sequences after hybridization with labeled nucleic acids or labelable nucleic acids is possible.

12. The method according to claim 6, characterized in that non-temperature-resistant DNA polymerases can be used for the multiplication (amplification).

13. The method according to claim 6, characterized in that temperature-resistant DNA polymerases can be used for the amplification (amplification).

14. The method according to claim 6, characterized in that RNA-dependent RNA polymerase can be used for the amplification (amplification).

15. The method according to claim 6, characterized in that for the amplification (amplification) RNA-dependent DNA polymerase can be used.

16. The method according to claim 6, characterized in that for the multiplication (processing) DNA ligase can be used.

17. The method according to one or more of claims 1, 6, 8, 9, 10, characterized ge indicates that means for processing nucleic acids are brought to a surface.

18. The method according to one or more of claims 1, 8, 9, 10, 16, 17, characterized in that at least one of the reactions involved in the processing, which takes place at elevated temperature, takes place on a surface.

19. The method according to claim 1 and / or 6, characterized in that the measurement solution is largely independent of volume, d. H. This method for processing and multiplying nucleic acids can be carried out in both very small and very large volumes.

20. The method according to claim 1 is increased by convection or movement.

21. Device for processing nucleic acids with the aid of a temperature regulation element, characterized in that the device is suitable for regulating the temperature of the surface and the immediately adjacent environment and that means for processing the nucleic acids can be bound to it.

22. The apparatus according to claim 21, characterized in that a suitability for use for methods according to claims 1 to 20 can be used.

23. A device for processing nucleic acids according to claim 21 and / or 22, characterized in that the surface projecting into the reaction medium can be cooled and / or heated.

24. The device according to claim 21 and / or 22, characterized in that the temperature-regulating surface has been prepared by chemical or physical treatment for receiving reactants in accordance with claim 1.

25. The device according to claim 21, characterized in that the temperature of the surface is regulated by a control unit.

26. The device according to claims 21, 22 or 24, characterized in that a time-coordinated regulation of the temperature changes can be carried out.

27. The device according to claims 21, 22 or 24, characterized in that a heating element has a low and a cooling element have a high heat capacity.

28. The apparatus according to claim 21, 22, characterized in that a surface is suitable for a direct expansion of the processing and propagation results.

29. The device according to claim 24, characterized in that the temperature-regulated surface consists of a film made of thermally conductive material, preferably metal, preferably gold.

30. The device according to claim 21, 22 or 24, characterized in that the cooling of the temperature-regulated surface is carried out on the distal side of the reaction mixture.

31. The device according to claim 21, 22 or 24, characterized in that the heating element is identical to the reactive surface, which surface can be specially treated.

32. Apparatus according to claim 21, 22 or 24 and 30 and 31, characterized gekenn¬ characterized in that nucleic acids can be fixed on the surface of the heating element.

33. Apparatus according to claim 32, characterized in that the fixing takes place via averaging structures to the heating element.

34. Device according to claim 33, characterized in that this fixation can take place via averaging structures both via chemical and biospecific binding.

35. Apparatus according to claim 21 or 22, characterized in that nucleic acids only temporarily associate in the immediate vicinity of the surface or dwell there.

36. Device according to claim 35, characterized in that this association of nucleic acids on the reactive surface is ensured by the binding of these nucleic acids to magnetobeads or the adsorption of these nucleic acids on magneto beads.

37. Apparatus according to claim 35 or 36, characterized in that an inducible magnetic field is used to attract said magnetobeads.

38. The method according to claim 21 or 22, characterized in that the device, which contains heating and cooling elements, can only be used once in order to prevent contamination.

39. Apparatus according to claim 21 or 22, characterized in that the entire device is reusable, and only the surface or its holder has to be replaced for individual operations.

40. Apparatus according to claim 24, characterized in that the temperature-controlled surface is ohmic heated.

41. Apparatus according to claim 24, characterized in that the temperature-regulated surface is heated by rays, preferably infrared rays and again preferably laser-generated infrared rays.