EP0720652A1 - Receptor recognition factors, protein sequences and methods of use thereof - Google Patents

Abstract

Receptor recognition factors exist that recognize the specific cell receptor to which a specific ligand has been bound, and that may thereby signal and/or initiate the binding of the transcription factor to the DNA site. The receptor recognition factor is in one instance, a part of a transcription factor, and also may interact with other transcription factors to cause them to activate and travel to the nucleus for DNA binding. The receptor recognition factor appears to be second-messenger-independent in its activity, as overt perturbations in second messenger concentrations are of no effect. The concept of the invention is illustrated by the results of studies conducted with interferon (IFN)-stimulated gene transcription, and particularly, the activation caused by both IFNα and IFNη. Specific DNA and amino acid sequences for various human and murine receptor recognition factors are provided, as are polypeptide fragments of two of the ISGF-3 genes, and antibodies have also been prepared and tested. The polypeptides confirm direct involvement of tyrosine kinase in intracellular message transmission. Numerous diagnostic and therapeutic materials and utilities are also disclosed.

Description

RECEPTOR RECOGNITION FACTORS, PROTEIN SEQUENCES AND METHODS OF USE THEREOF

RELATED PUBLICATIONS

The Applicants are authors or co-authors of several articles directed to the subject matter of the present invention. (1) Darnell et al. ,"Interferon-Dependent Transcriptional Activation: Signal Transduction Without Second Messenger Involvement?" THE NEW BIOLOGIST, 2(10): 1-4, (1990); (2) X. Fu et al., "ISGF3, The Transcriptional Activator Induced by Interferon α, Consists of Multiple Interacting Polypeptide Chains" PROC. NATL. ACAD. SCI. USA, 87:8555-8559 (1990); (3) D.S. Kessler et al., "IFNα Regulates Nuclear Translocation and DNA-Binding Affinity of ISGF3, A Multimeric Transcriptional Activator" GENES AND DEVELOPMENT, 4: 1753 (1990); (4) C. Schindler et al., "Interferon-Dependent Tyrosine Phosphorylation of a Latent Cytoplasmic Transcription Factor" Science, 257:809-812 (1992); (5) Ke Shuai et al. , "Interferon-γ triggers transcription through cytoplasmic tyrosine phosphorylation of a 91 kD DNA binding protein" Science, 258: 1808 (1992); and (6) International Patent Publication No. WO 93/19179, "IFN RECEPTORS RECOGNITION FACTORS, PROTEIN SEQUENCES AND METHODS OF USE THEREOF, " published 30 September 1993.

TECHNICAL FIELD OF THE INVENTION

The present invention relates generally to intracellular receptor recognition proteins or factors (i.e. groups of proteins), and to methods and compositions including such factors or the antibodies reactive toward them, or analogs thereof in assays and for diagnosing, preventing and/or treating cellular debilitation, derangement or dysfunction. More particularly, the present invention relates to particular molecules that exhibit both receptor recognition and message delivery via DNA binding in an interferon-dependent manner, and specifically that directly participate both in the interaction with the liganded receptor at the cell surface and in the activity of transcription in the nucleus as a DNA binding protein. The invention likewise relates to the antibodies and other entities that are specific to this factor and that would thereby selectively modulate its activity.

BACKGROUND OF THE INVENTION

There are several possible pathways of signal transduction that might be followed after a polypeptide ligand binds to its cognate cell surface receptor. Within minutes of such ligand-receptor interaction, genes that were previously quiescent are rapidly transcribed (Murdoch et al., 1982; Lamer et al., 1984; Friedman et al., 1984; Greenberg and Ziff, 1984; Greenberg et al., 1985). One of the most physiologically important, yet poorly understood, aspects of these immediate transcriptional responses is their specificity: the set of genes activated, for example, by platelet-derived growth factor (PDGF), does not completely overlap with the one activated by nerve growth factor (NGF) or tumor necrosis factor (TNF) (Cochran et al. , 1983; Greenberg et al., 1985; Almendral et al., 1988; Lee et al. , 1990). The interferons (IFN) activate sets of other genes entirely. Even IFNα and IFN₇, whose presence results in the slowing of cell growth and in an increased resistance to viruses (Tamm et al., 1987) do not activate exactly the same set of genes (Larner et al. , 1984; Friedman et al., 1984; Celis et al. , 1987, 1985; Larner et al. , 1986).

The current hypotheses related to signal transduction pathways in the cytoplasm do not adequately explain the high degree of specificity observed in polypeptide- dependent transcriptional responses. The most commonly discussed pathways of signal transduction that might ultimately lead to the nucleus depend on properties of cell surface receptors containing tyrosine kinase domains [for example, PDGF, epidermal growth factor (EGF), colony-stimulating factor (CSF), insulin-like growth factor-1 (IGF-1); see Gill, 1990; Hunter, 1990) or of receptors that interact with G-proteins (Gilman, 1987). These two groups of receptors mediate changes- in the intracellular concentrations of second messengers that, in turn, activate one of a series of protein phosphokinases, resulting in a cascade of phosphorylations (or dephosphorylations) of cytoplasmic proteins.

It has been widely conjectured that the cascade of phosphorylations secondary to changes in intracellular second messenger levels is responsible for variations in the rates of transcription of particular genes (Bourne, 1988, 1990; Berridge, 1987; Gill, 1990; Hunter, 1990). However, there are at least two reasons to question the suggestion that global changes in second messengers participate in the chain of events leading to specific transcriptional responses dependent on specific receptor occupation by polypeptide ligands.

First, there is a limited number of second messengers (cAMP, diacyl glycerol, phosphoinositides, and Ca²⁺ are the most prominently discussed), whereas the number of known cell surface receptor-ligand pairs of only the tyrosine kinase and G-protein varieties, for example, already greatly outnumbers the list of second messengers, and could easily stretch into the hundreds (Gill, 1990; Hunter, 1990). In addition, since many different receptors can coexist on one cell type at any instant, a cell can be called upon to respond simultaneously to two or more different ligands with an individually specific transcriptional response each involving a different set of target genes. Second, a number of receptors for polypeptide ligands are now known that have neither tyrosine kinase domains nor any structure suggesting interaction with G-proteins. These include the receptors for interleukin-2 (IL-2) (Leonard et al. , 1985), IFNα (Uze et al. , 1990), IFN₇ (Aguet et al., 1988), NGF (Johnson et al. , 1986), and growth hormone (Leung et al. , 1987). The binding of each of these receptors to its specific ligand has been demonstrated to stimulate transcription of a specific set of genes. For these reasons it seems unlikely that global intracellular fluctuations in a limited set of second messengers are integral to the pathway of specific, polypeptide ligand- dependent, immediate transcriptional responses. International Patent Publication No. WO 93/19179 (30 September 1993, by James E. Darnell, Jr. et al.) disclosed the existence of receptor recognition factors, now termed signal transducers and activators of transcription (STAT). The nucleotide sequences of cDNA encoding receptor recognition factors having molecular weights of 113 kD (i.e. , 113 kD protein, Statl l3, or Stat2), 91 kD (i.e. , 91 kD protein, Stat91 , or Static*) and 84 kD (i.e. , 84 kD protein, Stat84, or Statl/3) are reiterated herein in SEQ ID NOS: l , 3, and 5, respectively; the corresponding deduced amino acid sequences of the STAT proteins are shown in SEQ ID NOS:2, 4, and 6, respectively. Stat84 was found to be a truncated form of Stat91. There is 42% amino acid sequence similarity between Statl 13 and Stat91/84 in an overlapping 715 amino acid sequence, including four leucine and one valine heptad repeats in the middle helix region, and several tyrosine residues were conserved near the ends of both proteins. The receptor recognition proteins thus possess multiple properties, among them: 1) recognizing and being activated during such recognition by receptors; 2) being translocated to the nucleus by an inhibitable process (e.g. , NaF inhibits translocation); and 3) combining with transcription activating proteins or acting themselves as transcription activation proteins, and that all of these properties are possessed by the proteins described herein. In particular, the proteins are activated by binding of interferons to receptors on cells, in particular interferon-α (all three Stat proteins) and interferon-γ (Stat91).

SUMMARY OF THE INVENTION

In accordance with the present invention, additional members of the family of receptor recognition factors (also termed herein signal transducers and activators of transcription - STAT) have been further characterized that appear to interact directly with receptors that have been occupied by their ligand on cellular surfaces, and which in turn either become active transcription factors, or activate or directly associate with transcription factors that enter die cells' nucleus and specifically binds on predetermined sites and thereby activates the genes. It should be noted that the receptor recognition proteins thus possess multiple properties, among them: 1) recognizing and being activated during such recognition by receptors; 2) being translocated to the nucleus by an inhibitable process (eg. NaF inhibits translocation); and 3) combining with transcription activating proteins or acting themselves as transcription activation proteins, and that all of these properties are possessed by the proteins described herein.

A further property of the receptor recognition factors is dimerization to form homodimers or heterodimers upon activation by phosphorylation of tyrosine. In a specific embodiment, infra, Stat91 and Stat84 form homodimers and a Stat91- Stat84 heterodimer. Accordingly, the present invention is directed to such dimers, which can form spontaneously by phosphorylation of the STAT protein, or which can be prepared synthetically by chemically cross-linking two like or unlike STAT proteins.

The present invention further relates to receptor recognition factors that are functionally active fragments of the 91 kD receptor recognition factor, particularly such fragments that contain an amino acid residue corresponding to the tyrosine 701 residue, and preferably that contain a corresponding phosphotyrosine residue. In a different embodiment, the functionally active fragments further comprises the SH2 domain, particularly the SH2 domain that has a residue corresponding to an arginine-602 residue. It is envisioned that such functionally active receptor recognition factors comprise at least about 8 amino acid residues.

The invention contemplates inhibitory fragments of the 91 kD protein. In one embodiment, the SH2 domain of the 91 kD protein can competitively inhibit phosphorylation of the whole protein or fragment thereof containing tyrosine 701.

In another embodiment, an inhibitory fragment can compete with the 91 kD protein for binding to a tyrosine kinase. Such an inhibitory fragment may contain a residue corresponding to tyrosine 701. The receptor recognition factor is proteinaceous in composition and is believed to be present in the cytoplasm. The recognition factor is not demonstrably affected by concentrations of second messengers, however does exhibit direct interaction with tyrosine kinase domains, although it exhibits no apparent interaction with G- proteins. More particularly, the 91 kD human interferon (IFN)-γ factor (hence, formerly also termed "GAF"), represented by SEQ ID NO:4 directly interacts with DNA after acquiring phosphate on tyrosine located at position 701 of the amino acid sequence.

The recognition factor is now known to comprise several proteinaceous substituents, in the instance of IFNα and IFNγ. Three proteins derived from the factor ISGF-3 have been successfully sequenced and their sequences are set forth in SEQ ID NOS: l , 2; SEQ ID NOS:3, 4; and SEQ ID NOS:5, 6, herein (see International Patent Publication No. WO 93/19179). The present invention is therefore particularly directed to additional members of the STAT family, including a murine gene encoding the 91 kD protein (SEQ ID NO:4) has been identified and sequenced. The nucleotide sequence (SEQ ID NO:7) and deduced amino acid sequence (SEQ ID NO: 8) of the murine homolog of SEQ ID NO:4 are shown in FIGURE lA-lC.

In a further embodiment, murine genes encoding homologs of the recognition factor have been successfully sequenced and cloned into plasmids. A gene in plasmid 13sfl has the nucleotide sequence (SEQ ID NO:9) and deduced amino acid sequence (SEQ ID NO: 10) as shown in FIGURE 2A-D. A gene in plasmid 19sf6 has the nucleotide sequence (SEQ ID NO: 11) and deduced amino acid sequence (SEQ ID NO: 12) shown in FIGURE 3A-E.

It is particularly noteworthy that the protein sequence of SEQ ID NO: 2 and the sequence of the proteins of SEQ ID NO:4 and SEQ ID NO:6 derive, respectively, from two different but related genes. Moreover, the protein sequence of FIGURE 1 (SEQ ID NO: 8) derives from a murine gene that is analogous to the gene encoding the protein of SEQ ID NO:4. Of further note is that the protein sequences of FIGURES 2 (SEQ ID NO: 10) and 3 (SEQ ID NO: 12) derive from two genes that are different from, but related to, the protein of FIGURE 1 (FIG ID NO:8). It is clear from these discoveries that a family of genes exists, and that further family members likewise exist. Accordingly, as demonstrated herein, by use of hybridization techniques, additional such family members will be found.

Further, the capacity of such family members to function in the manner of the receptor recognition factors disclosed, herein may be assessed by determining those ligand that cause the phosphorylation of the particular family members.

In its broadest aspect, the present invention extends to a receptor recognition factor implicated in the transcriptional stimulation of genes in target cells in response to the binding of a specific polypeptide ligand to its cellular receptor on said target cell, said receptor recognition factor having the following characteristics: a) apparent direct interaction with the ligand-bound receptor complex and activation of one or more transcription factors capable of binding with a specific gene; b) an activity demonstrably unaffected by the presence or concentration of second messengers; c) direct interaction with tyrosine kinase domains; and d) a perceived absence of interaction with G-proteins.

In a further aspect, the receptor recognition (STAT) protein forms a dimer upon activation by phosphorylation.

In a specific example, the receptor recognition factor represented by SEQ ID NO:4 possesses the added capability of acting as a translation protein and, in particular, as a DNA binding protein in response to interferon-7 stimulation. This discovery presages an expanded role for the proteins in question, and other proteins and like factors that have heretofore been characterized as receptor recognition factors. It is therefore apparent that a single factor may indeed provide the nexus between the liganded receptor at the cell surface and direct participation in DNA transcriptional activity in the nucleus. This pleiotypic factor has the following characteristics: a) It interacts with an interferon-γ-bound receptor kinase complex; b) It is a tyrosine kinase substrate; and c) When phosphorylated, it serves as a DNA binding protein.

More particularly, the factor represented by SEQ ID NO:4 is interferon-dependent in its activity and is responsive to interferon stimulation, particularly that of interferon-γ. It has further been discovered that activation of the factor represented by SEQ ID NO:4 requires phosphorylation of tyrosine-701 of the protein. In particular, phosphorylation of tyrosine-701 is required for nuclear transport, DNA binding, and transcription activation. Furthermore, tyrosine phosphorylation requires the presence of a functionally active SH2 domain in the protein. Preferably, such SH2 domain contains an amino acid residue corresponding to an arginine at position 602 of the protein.

In a still further aspect, the present invention extends to a receptor recognition factor interactive with a liganded interferon receptor, which receptor recognition factor possesses the following characteristics: a) it is present in cytoplasm; b) it undergoes tyrosine phosphorylation upon treatment of cells with IFNα or IFN₇; c) it activates transcription of an interferon stimulated gene; d) it stimulates either an ISRE-dependent or a gamma activated site (GAS)-dependent transcription in vivo; e) it interacts with IFN cellular receptors, and f) it undergoes nuclear translocation upon stimulation of the IFN cellular receptors with IFN. The factor of the invention represented by SEQ ID NO:4 appears to act in similar fashion to an earlier determined site-specific DNA binding protein that is interferon-7 dependent and that has been earlier called the 7 activating factor (GAF). Specifically, interferon-7-dependent activation of this factor occurs without new protein synthesis and appears within minutes of interferon-7 treatment, achieves maximum extent between 15 and 30 minutes thereafter, and then disappears after 2-3 hours. These further characteristics of identification and action assist in the evaluation of the present factor for applications having both diagnostic and therapeutic significance.

In a particular embodiment, the present invention relates to all members of the herein disclosed family of receptor recognition factors, specifically the proteins whose sequences are represented by one or more of SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12.

The present invention also relates to a recombinant DNA molecule or cloned gene, or a degenerate variant thereof, which encodes a receptor recognition factor, or a fragment thereof, that possesses a molecular weight of about 113 kD and an amino acid sequence set forth in FIGURE 1 (SEQ ID NO:8). In yet another embodiment, the receptor recognition factor has an amino acid sequence set forth in FIGURE 2 (SEQ ID NO: 10); preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding such receptor recognition factor has a nucleotide sequence or is complementary to a DNA sequence shown in FIGURE 2 (SEQ ID NO:9). In still another embodiment, the receptor recognition factor has an amino acid sequence set forth in FIGURE 3 (SEQ ID NO: 12); preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding such receptor recognition factor has a nucleotide sequence or is complementary to a DNA sequence shown in FIGURE 3 (SEQ ID NO: 1 1). The human and murine DNA sequences of the receptor recognition factors of the present invention or portions thereof, may be prepared as probes to screen for complementary sequences and genomic clones in the same or alternate species. The present invention extends to probes so prepared that may be provided for screening cDNA and genomic libraries for the receptor recognition factors. For example, the probes may be prepared with a variety of known vectors, such as the phage λ vector. The present invention also includes the preparation of plasmids including such vectors, and the use of the DNA sequences to construct vectors expressing antisense RNA or ribozymes which would attack the mRNAs of any or all of the DNA sequences set forth in FIGURES 1 , 2, and 3 (SEQ ID NOS:7, 9, and 11 , respectively). Correspondingly, the preparation of antisense RNA and ribozymes are included herein.

The present invention also includes receptor recognition factor proteins having the activities noted herein, and that display the amino acid sequences set forth and described above and selected from SEQ ID NO:8, SEQ ID NO: 10 and SEQ ID

NO: 12.

In a further embodiment of the invention, the full DNA sequence of the recombinant DNA molecule or cloned gene so determined may be operatively linked to an expression control sequence which may be introduced into an appropriate host. The invention accordingly extends to unicellular hosts transformed with the cloned gene or recombinant DNA molecule comprising a DNA sequence encoding the present receptor recognition factor(s), and more particularly, the complete DNA sequence determined from the sequences set forth above and in SEQ ID NO:7, SEQ ID NO:9 and SEQ ID NO- 11.

According to other preferred features of certain preferred embodiments of the present invention, a recombinant expression system is provided to produce biologically active animal or human receptor recognition factor. The present invention naturally contemplates several means for preparation of the recognition factor, including as illustrated herein known recombinant techniques, and the invention is accordingly intended to cover such synthetic preparations within its scope. The isolation of the cDNA amino acid sequences disclosed herein facilitates the reproduction of the recognition factor by such recombinant techniques, and accordingly, the invention extends to expression vectors prepared from the disclosed DNA sequences for expression in host systems by recombinant DNA techniques, and to the resulting transformed hosts.

The invention includes an assay system for screening of potential drugs effective to modulate transcriptional activity of target mammalian cells by interrupting or potentiating the recognition factor or factors. In one instance, the test drug could be administered to a cellular sample with the ligand that activates the receptor recognition factor, or an extract containing the activated recognition factor, to determine its effect upon the binding activity of the recognition factor to any chemical sample (including DNA), or to the test drug, by comparison with a control.

The assay system could more importantly be adapted to identify drugs or other entities that are capable of binding to the receptor recognition and/or transcription factors or proteins, either in the cytoplasm or in the nucleus, thereby inhibiting or potentiating transcriptional activity. Such assay would be useful in the development of drugs that would be specific against particular cellular activity, or that would potentiate such activity, in time or in level of activity. For example, such drugs might be used to modulate cellular response to shock, or to treat other pathologies, as for example, in making IFN more potent against cancer.

In yet a further embodiment, the invention contemplates antagonists of the activity of a receptor recognition factor (STAT). In particular, an agent or molecule that inhibits dimerization (homodimerization or heterodimεrization) can be used to block transcription activation effected by an activated, phosphorylated STAT protein. In a specific embodiment, the antagonist can be a peptide having the sequence of a portion of an SH2 domain of a STAT protein, or the phosphotyrosine domain of a STAT protein, or both. If the peptide contains both regions, preferably the regions are located in tandem, more preferably with the SH2 domain portion N-terminal to the phosphotyrosine portion. In a specific example, infra, such peptides are shown to be capable of disrupting dimerization of STAT proteins.

The diagnostic utility of the present invention extends to the use of the present receptor recognition factors in assays to screen for tyrosine kinase inhibitors. Because the activity of the receptor recognition-transcriptional activation proteins described herein must maintain tyrosine phosphorylation, they can and presumably are dephosphorylated by specific tyrosine phosphatases. Blocking of the specific phosphatase is therefore an avenue of pharmacological intervention that would potentiate the activity of the receptor recognition proteins.

The present invention likewise extends to the development of antibodies against the receptor recognition factor(s), including naturally raised and recombinantly prepared antibodies. For example, the antibodies could be used to screen expression libraries to obtain the gene or genes that encode the receptor recognition factor(s). Such antibodies could include both polyclonal and monoclonal antibodies prepared by known genetic techniques, as well as bi- specific (chimeric) antibodies, and antibodies including other functionalities suiting them for additional diagnostic use conjunctive with their capability of modulating transcriptional activity.

In particular, antibodies against specifically phosphorylated factors can be selected and are included within the scope of the present invention for their particular ability in following activated protein. Thus, activity of the recognition factors or of the specific polypeptides believed to be causally connected thereto may therefore be followed directly by the assay techniques discussed later on, through the use of an appropriately labeled quantity of the recognition factor or antibodies or analogs thereof.

Thus, the receptor recognition factors, their analogs and/or analogs, and any antagonists or antibodies that may be raised thereto, are capable of use in connection with various diagnostic techniques, including immunoassays, such as a radioimmunoassay, using for example, an antibody to the receptor recognition factor that has been labeled by either radioactive addition, reduction with sodium borohydride, or radioiodination.

In a further embodiment, the present invention relates to certain therapeutic methods which would be based upon the activity of the recognition factor(s), its (or their) subunits, or active fragments thereof, or upon agents or other drugs determined to possess the same activity. A first therapeutic method is associated with the prevention of the manifestations of conditions causally related to or following from the binding activity of the recognition factor or its subunits, and comprises administering an agent capable of modulating the production and/or activity of the recognition factor or subunits thereof, either individually or in mixture with each other in an amount effective to prevent the development of those conditions in the host. For example, drugs or other binding partners to the receptor recognition/transcription factors or proteins may be administered to inhibit or potentiate transcriptional activity, as in the potentiation of interferon in cancer therapy. Also, the blockade of the action of specific tyrosine phosphatases in the dephosphorylation of activated (phosphorylated) recognition/transcription factors or proteins presents a method for potentiating the activity of the receptor recognition factor or protein that would concomitantly potentiate therapies based on receptor recognition factor /protein activation.

More specifically, the therapeutic method generally referred to herein could include the method for the treatment of various pathologies or other cellular dysfunctions and derangements by the administration of pharmaceutical compositions that may comprise effective inhibitors or enhancers of activation of the recognition factor or its subunits, or other equally effective drugs developed for instance by a drug screening assay prepared and used in accordance with a further aspect of the present invention. For example, drugs or other binding partners to the receptor recognition/transcription factor or proteins, as represented by SEQ ID NO:8, 10, or 12, may be administered to inhibit or potentiate transcriptional activity, as in the potentiation of interferon in cancer therapy. Also, the blockade of the action of specific tyrosine phosphatases in the dephosphorylation of activated (phosphorylated) recognition/transcription factor or protein presents a method for potentiating the activity of the receptor recognition factor or protein that would concomitantly potentiate therapies based on receptor recognition factor/protein activation. Correspondingly, the inhibition or blockade of the activation or binding of the recognition/transcription factor would affect MHC Class II expression and consequently, would promote immunosuppression. Materials exhibiting this activity, as illustrated later on herein by staurosporine,. may be useful in instances such as the treatment of autoimmune diseases and graft rejection, where a degree of immunosuppression is desirable.

In particular, the proteins of ISGF-3 whose sequences are presented in SEQ ID NOS:8, 10, or 12 herein, their antibodies, agonists, antagonists, or active fragments thereof, could be prepared in pharmaceutical formulations for administration in instances wherein interferon therapy is appropriate, such as to treat chronic viral hepatitis, hairy cell leukemia, and for use of interferon in adjuvant therapy. The specificity of the receptor proteins hereof would make it possible to better manage the aftereffects of current interferon therapy, and would thereby make it possible to apply interferon as a general antiviral agent.

Accordingly, it is a principal object of the present invention to provide a novel member of the family of receptor recognition factors, and subunits of such a novel receptor recognition factor, in purified form that exhibits certain characteristics and activities associated with transcriptional promotion of cellular activity. Is a particular object of the invention to provide fragments of such receptor recognition factors that inhibit activities of the factors.

It is a further object of the present invention to provide antibodies to the receptor recognition factor and its subunits, and methods for their preparation, including recombinant means.

It is a further object of the present invention to provide a method for detecting the presence of the receptor recognition factor and its subunits in mammals in which invasive, spontaneous, or idiopathic pathological states are suspected to be present.

It is a further object of the present invention to provide a method and associated assay system for screening substances such as drugs, agents and the like, potentially effective in either mimicking the activity or combating the adverse effects of the recognition factor and/or its subunits in mammals.

It is a still further object of the present invention to provide a method for the treatment of mammals to control the amount or activity of the recognition factor or subunits thereof, so as to alter the adverse consequences of such presence or activity, or where beneficial, to enhance such activity.

It is a still further object of the present invention to provide a method for the treatment of mammals to control the amount or activity of the recognition factor or its subunits, so as to treat or avert the adverse consequences of invasive, spontaneous or idiopathic pathological states.

It is a still further object of the present invention to provide pharmaceutical compositions for use in therapeutic methods which comprise or are based upon the recognition factor, its subunits, their binding partner(s), or upon agents or drugs that control the production, or that mimic or antagonize the activities of the recognition factors. Other objects and advantages will become apparent to those skilled in the art from a review of the ensuing description which proceeds with reference to the following illustrative drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGURE 1 depicts (A) the deduced amino acid sequence (SEQ ID NO: 8) of and (B-C) the DNA sequence (SEQ ID NO: 7) encoding the murine 91 kD intracellular receptor recognition factor.

FIGURE 2 depicts (A) the deduced amino acid sequence (SEQ ID NO: 10) of and (B-D) the DNA sequence (SEQ ID NO: 9) encoding the 13sfl intracellular receptor recognition factor.

FIGURE 3 depicts (A) the deduced amino acid sequence (SEQ ID NO: 12) of and (B-E) the DNA sequence (SEQ ID NO: 1 1) encoding the 19sf6 intracellular receptor recognition factor.

FIGURE 4 presents identification of the phosphotyrosine residue in the 91 kd protein. (A) Tryptic phosphopeptide map of ³²P-91 kD protein from IFN-7-treated FS2 cells. Phosphoamino acid analysis indicated that only peptide X contains phosphotyrosine (31). (B) Edman degradation of peptide X (32). The position of the PTH-P-Tyr marker detected by ultraviolet light is indicated. (C) Schematic diagram showing the site of the phosphotyrosine residue in the 91 kD protein. HR, heptapeptide repeat; SH2, Src homology domain 2; and SH3, Src homology domain 3. (D) The synthetic peptide LDGPKGTGYIKTELI (SEQ ID NO: 13), which was phosphorylated with ³²P-labeled tyrosine, was digested with trypsin and analyzed by 2D peptide mapping either alone (left panel) or mixed with the same amount of ³²P-labeled peptide X (right panel). Ori, origin. The synthetic peptide (10 μg) (obtained from Genetics) was incubated with 1 U of p45^{v abl} (Oncogene Science), in 50 mM Hepes (pH 7.4), 0.1 mM EDTA, 0.015 % Brij 35, 0.1 mM ATP, 10 mM MgCl₂ and 2 μCl of [₇-³²P]ATP for 30 min. at 30°C. The ³²P- labeled peptide was subjected to electrophoresis at pH 3.5 on a thin layer chromatography plate and purified. Tryptic digestion of ³²P-labeled peptide was done as described (32).

Human FS2 cells were labeled with [³²P]orthophosphate (Du Pont) for 3 hours in phosphate-free medium and subsequently treated with IFN-7 for 10 min. Cell lysates were immunoprecipitated with antiserum to the COOH-terminal 35 amino acids of 91 kD (anti-91T) and separated by SDA-polyacrylamide gel electrophoresis (PAGE) (7% gel). The ³²P-labeled 91 kD band was excised and subjected to tryptic mapping (31). Edman degradation was done as described (32, 33) with minor modifications. Peptide X (600 counts per minute) was taken through five cycles of Edman degradation. Samples from each cycle and an equivalent amount of untreated peptide X were analyzed by electrophoresis at pH 3.5. The PTH-P-Tyr marker was synthesized as described (31).

FIGURE 5 presents an analysis of phosphorylation of the 91 and 84 kD proteins in established cell lines. (A) Protein immunoblot analysis with antiserum to the 91 kD protein (anti-91) of whole-cell extracts from parental 2fTGH cells (lanes 1 and 4); mutant U3 cells lacking the 91 and 84 kD proteins (lanes 2 and 3); U3 cells expressing the 91 kD protein (C91 , lane 6), the 84 kD protein (C84, lane 7), or the Tyr^7w mutant MNC-ty (Cty, lane 5). (B) Tryptic peptide map of the 84 kD protein. C84 cells were labeled with [³²P]orthophosphate for 3 hours and then treated with IFN-7 for 10 min.; immunoprecipitation with anti-91 and tryptic peptide mapping of the ³²P-labeled 84-kDa protein was done as described

(FIGURE 4). (C) Proteins in whole-cell lysates from 2fTGH (lanes 3, 4, 7 and 8) and Cty (lanes 1 , 2, 5 and 6) cells were immunoprecipitated with anti-91T (31) and separated by SDA-PAGE (7% gel). The blot was then probed with a mAb to phosphotyrosine 4G10 (UB1, lanes 1 through 4). The blot was stripped and reprobed with anti-91T (lanes 5 through 8). U3A cells (5 x 10⁵) (30) were transfected with 4 μg of expression vector and 16 μg of pBSK (Strategene) plasmid by the calcium phosphate procedure (35). Cells were selected in Dulbecco's modified Eagle's medium containing G418 (0.5 mg/ml) (Gibco, BRL). 48 hours after transfection, individual colonies were screened for the expression of appropriate proteins by protein immunoblotting. Cell lines were maintained in the presence of G418 (0.2 mg/ml). Expression vectors using the cytomegalovirus promoter and encoding the 91 or 84 kD protein were constructed by insertion of the cDNA into the Notl-BamHl cloning site of an expression vector pMNC (35). The TAT codon for Tyr⁷⁰¹ was changed to TIT by standard mutagenesis procedure with the polymerase chain reaction (PCR) (36, 37). The sequence was verified by DNA sequencing (U.S. Biochemical, Cleveland, Ohio). Molecular sizes are indicated to the left (A) or to the right (C) in kilodaltons.

FIGURE 6 presents data relating to DNA binding and nuclear localization of the 91 and 84 kD proteins. (A) DNA binding and translocation to the nucleus of the 91 and 84 kD proteins. Gel mobility-shift analysis of whole-cell extracts from Cty (lanes 1 and 2), 2fTGH (lanes 3 and 4), U3A (lanes 5 and 6), C91 (lanes 7 and 8), and C84 (lanes 9 and 10) cells treated with IFN-7 for 15 min (+) or untreated (-). A 21 nucleotide oligomer containing the GAS sequence from the Ly-6E gene (34) was labeled and used as a probe for shift assays as described (31). (B) Nuclear localization tested by immunofluorescence. Cells from stable cell lines C91 (a and b), C84 (c and d), and Cty (e and f) were stained with anti-91T (a,b,e, and f) and anti-91 (c and d) as described (31). Untreated, a, c, and e; IFN-7 for 30 min, b, d, and f.

FIGURE 7 presents an analysis of transcriptional activation. An oligonucleotide corresponding to the herpes simplex virus thymidine kinase (TK) promoter from - 35 to + 10 was fused to the Hindlll site of pZLUC, a luciferase reporter construct (TK-LUC). One copy of the 91 kD binding site [a 21 nucleotide oligomer from the Ly-6E gene (34)] was inserted into the BamHl cloning site of TK-LUC (GAS- LUC). U3 cells were transfected by the calcium phosphate method as described (FIGURE 5) with 4 μg of each construct. The cells were also transfected with 4 μg of pMNC alone (35) (MNC) or pMNC encoding the 91 kD protein (MNC-91 ) or the 84 kD protein (MNC-84) or the Tyr⁷⁰¹ mutant of the 91 kD protein (MNC- ty). Lane 1 , MNC-91 + GAS-LUC; lane 2, MNC-84 + GAS-LUC; lane 3, MNC + GAS-LUC; lane 4, MNC-ty + GAS-LUC; lane 4 MNC-91 + TK-LUC; and lane 6, GAS-LUC. Relative transfection efficiencies were monitored by inclusion of a β-galactosidase expression plasmid (pCMVβ, Promega). Then, 36 hours after transfection, cells were treated with IFN-7 (5 ng/ml) for 6 hours, collected, and assayed for luciferase activities (Promega). (A) Data shown are taken from one representative experiment and represent the relative luciferase activity in cells treated with IFN-7 as compared with that from untreated cells

(arbitrarily set to 1 U). (The luciferase assay was corrected for relative expression of a β-galactosidase). Each transfection was independently repeated at least three times. (B) Cell lysates from these same transfections were analyzed for the expression of proteins by protein immunoblotting with anti-91.

FIGURE 8 demonstrates that R^6U2 in the 91 kD protein SH2 domain is required for tyrosine phosphorylation. a) Western blot analysis of whole cell extracts from mutant U3A cell line (lane 3); parental 2fTGH cell line (lane 4); or U3A-derived cell lines transfected with an expression vector containing an R⁶⁰²- > Leu⁶⁰² mutation (lanes 1 and 2). Antibody used was anti-91 , which recognizes both the 91 and 84 kD proteins (15, 31). b) Immunoprecipitates with anti-91T antibody were subjected to 7.5 % SDS-PAGE and probed with an anti-phosphotyrosine antibody. Mutagenesis was carried out by standard PCR procedure. The CGG codon for Arg⁶⁰² was mutated to CTG, which encodes Leu. Transfection and selection of stable cell lines was described in Figures 4-7 and Examples 3 and 4.

FIGURE 9. Determination of molecular weights of Stat91 and phospho Stat91 by native gel analysis. A) Western blot analysis of fractions from affinity purification. Extracts from human FS2 fibroblasts treated with IFN-7 (Ext), the unbound fraction (Flow), the fraction washed with Buffer AO.2 (AO.2), and the bound fraction eluted with buffer AO.8(AO.8) were immunoblotted with anti-91T. B) Native gel analysis. Phosphorylated Stat91 (the AO.8 fraction from A) and uπphosphorylated Stat91 (the Flow fraction from A) were analyzed on 4.5 % , 5.5 % , 6.5 % and 7.5 % native polyacrylamide gels followed by immunoblotting with anti-91T. The top of gels (TOP) and the migration position of bromophenol blue (BPB) are indicated. C) Ferguson plots. The relative mobilities (Rm) of the Stat91 and phospho Stat91 were obtained from Figure IB (see Experimental Procedures). Closed circle: Chicken egg albumin (*** 45kD); Cross: Bovine serum albumin, monomer (66 kD); Open square: Bovine serum albumin, dimer (132 kD); Open circle: Urease, trimer (272 kD); Open triangle: Unphosphorylated Stat91 ; Closed triangle: Phosphorylated Stat91. D) Determination of molecular weights from the standard curve. The molecular weights of phosphorylated and unphosphorylated Stat91 proteins (indicated as closed and open arrows, respectively) were obtained by extrapolation of their retardation coefficients.

FIGURE 10. Determination of molecular weights by glycerol gradients.

A) Western blot analysis. Extracts from human Bud8 fibroblasts treated with IFN- 7 (the rightmost lane) and every other fraction from fraction 16 to 34 were analyzed on 7.5 % SDS-PAGE followed by immunoblotting with anti-91T. The peak of phosphorylated Stat91 (fraction 20) and the peak of unphosphorylated Stat91 (fraction 30) were indicated by a closed and open arrow, respectively.

B) Mobility shift analysis. Every other fractions from the gradients were analyzed. C) Graphic representation of the data from A and B. Peak fraction numbers of protein standards are plotted versus their molecular weight. The position of peaks (of phosphorylated and unphosphorylated Stat91 protein are indicated by the closed and open arrows, respectively. Standards are ferritin (Fer, 440 kD), catalase (Cat, 232 kD), ferritin half unit (Fer 1/2, 220 kD), aldolase (Aid, 158 kD), bovine serum albumin (BSA, 68 kD).

FIGURE 11. Stat91 in cell extracts binds DNA as a dimer. A) Western blot analysis. Extracts from stable cell lines expressing either Stat84 (C84), or Stat91L (C91L) or both (Cmx) were analyzed on 7.5 % SDS-PAGE followed by immunoblotting with anti-91. B) Gel mobility shift analysis. Extracts from stable cell lines (Fig 3 A) untreated (-) or treated with IFN-7(+) were analyzed. The positions of Stat91 homodimer (91 L), Stat84 homodimer (84), and the heterodimer (84*91) are indicated.

FIGURE 12. Formation of heterodimer by denaturation and renaturation. Cytoplasmic (Left Panel) or nuclear extracts (Right Panel) from IFN-7-treated cell lines expressing either Stat84 (C84) or Stat91 (C91) were analyzed by gel mobility shift assays. +: with addition; -: without addition; D/R: samples were subjected to guanidinium hydrochloride denaturation and renaturation treatment.

FIGURE 13. Diagrammatic representation of dissociation and reassociation analysis.

FIGURE 14. Dissociation-reassociation analysis with peptides. Gel mobility shift analysis with IFN-7 treated nuclear extracts from cell lines expressing Stat91L (C91L, lane 15) or Stat84 (C84, lane 14) or mixture of both (lane 1-13, 16-18) in the presence of increasing concentrations of various peptides. 91-Y, unphosphorylated peptide from Stat91 (LDGPKGTGYIKTELI) (SEQ ID NO: 15); 91Y-p, phosphotyrosyl peptide from Stat91 (GY*IKTE) (SEQ ID NO: 16); 113Y- p, phosphotyrosyl peptide with high binding affinity to Src SH2 domain (EPQY*EEIPIYL, Songyang et al. , 1993, Cell 72:767-778) (SEQ ID NO: 18). Final concentrations of peptides added: 1 μM (lane 8), 4 μM (lane 2,5, 11), 10 μM (lane 9), 40 μM (lane 3, 6, 10, 12, 14-18), 160 μM (lane 4, 7, 13). +: with addition; -: without addition. Right panel: antiserum tests for identity of gel-shift bands.

FIGURE 15. Dissociation-reassociation analysis with GST fusion proteins. A) SDS-PAGE (12%) analysis of purified GST fusion proteins as visualized by Commasie blue. GST-91 SH3, native SH2 domain of Stat91; GST-91 mSH2, R^6t'² to L⁶"² mutant; GST-91 SH3, SH3 domain of Stat91 ; GST Src SH2, the SH2 domain of src protein. Same amounts (1 μg) of each fusion proteins were loaded. Protein markers were run in lane 1 as indicated. B) Dissociation-reassociation analysis. Dissociating agents were GST fusion proteins purified from bacterial expression as shown above. Final concentrations of fusion proteins added are 0.5 μM (lanes 2, 5, 8, 11 , 14), 2.5 μM (lanes 3, 6, 9, 12, 15) and 5 μM (lanes 4, 7, 10, 13, 17, 18). +: with addition; -: without addition; FP: fusion proteins.

FIGURE 16. Comparison of Stat91 SH2 structure with known SH2 structures. The Stat91 sequence is disclosed herein (SEQ ID NO:4). The structures used for the other SH2s are Src (Waksman et al., 1992, Nature 358:646-653) (SEQ ID

NO: 19), Abl (Overduin et al., 1992, Proc. Natl. Acad. Sci. USA 89: 11673-77 and

1992, Cell 70:697-704) (SEQ ID NO:20, Lck (Eck et al.. 1993. Nature 362:87- 91 ) (SEQ ID NO:21), and p85αN (Booker et al. , 1992, Nature 358:684-687) (SEQ ID NO:22). The alignment of the determined structures is by direct coordinate superimposition of the backbone structures. The names of secondary structural features and significant residues is based on the scheme of Eck et al.,

1993. The boundaries and extents of the structure features are indicated by [ — ]. The starting numbers for the parent sequences are shown in parentheses. Experimentally determined structurally conserved regions are from Src, p85α, and Abl (Cowburn, unpublished). The root mean square deviation of three- dimensionally aligned structures differs by less than 1 Angstrom for the backbone non-hydrogen atoms in the sections marked by the XXX.

DETAILED DESCRIPTION

In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g. , Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory Manual" (1982); "DNA Cloning: A Practical Approach, " Volumes I and II (D.N. Glover ed. 1985); "Oligonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgins eds. (1985)]; "Transcription And Translation" [B.D. Hames & S.J. Higgins, eds. (1984)]; "Animal Cell Culture" [R.I. Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984).

Therefore, if appearing herein, the following terms shall have the definitions set out below.

The terms "receptor recognition factor", "receptor recognition-tyrosine kinase factor", "receptor recognition factor /tyrosine kinase substrate", "receptor recognition/transcription factor", "recognition factor" , "recognition factor protein(s)", "signal transducers and activators of transcription", "STAT", and any variants not specifically listed, may be used herein interchangeably, and as used throughout the present application and claims refer to proteinaceous material including single or multiple proteins, and extends to those proteins having the amino acid sequence data described herein and presented in FIGURE 1 (SEQ ID NO:8), FIGURE 2 (SEQ ID NO: 10), and in FIGURE 3 (SEQ ID NO: 12), and the profile of activities set forth herein and in the Claims. Accordingly, proteins displaying substantially equivalent or altered activity are likewise contemplated. These modifications may be deliberate, for example, such as modifications obtained through site-directed mutagenesis, or may be accidental, such as those obtained through mutations in hosts that are producers of the complex or its named subunits. Also, the terms "receptor recognition factor", "recognition factor", "recognition factor protein(s)", "signal transducers and activators of transcription", and "STAT" are intended to include within their scope proteins specifically recited herein as well as all substantially homologous analogs and allelic variations.

The amino acid residues described herein are preferred to be in the "L" isomeric form. However, residues in the "D" isomeric form can be substituted for any L- amino acid residue, as long as the desired functional property of immunoglobulin- binding is retained by the polypeptide. NH2 refers to the free amino group present at the amino terminus of a polypeptide. COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide. In keeping with standard polypeptide nomenclature, J. Biol. Chem. , 243:3552-59 (1969), abbreviations for amino acid residues are shown in the following Table of Correspondence:

TABLE OF CORRESPONDENCE

SYMBOL AMINO ACID

1 -Letter 3-Letter

Y Tyr tyrosine

G Gly glycine

F Phe phenylalanine

M Met methionine

A Ala alanine

S Ser serine

I He isoleucine

L Leu leucine

T Thr threonine

V Val valine

P Pro proline

K Lys lysine

H His histidine

Q Gin glutamine

E Glu glutamic acid

W Trp tryptophan

R Arg arginine

D Asp aspartic acid

N Asn asparagine

C Cys cysteine

It should be noted that all amino-acid residue sequences are represented herein by formulae whose left and right orientation is in the conventional direction of amino- terminus to carboxy-terminus. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino-acid residues. The above Table is presented to correlate the three-letter and one-letter notations which may appear alternately herein.

A "DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form, or a double- stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g. , restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e. , the strand having a sequence homologous to the mRNA).

A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.

Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell. A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes. Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences. An "expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence, e.g. , and enhancer or suppressor element. A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.

A DNA sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence. The term "operatively linked" includes having an appropriate start signal (e.g. , ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.

The term "standard hybridization conditions" refers to salt and temperature conditions substantially equivalent to 5 x SSC and 65 °C for both hybridization and wash. A "signal sequence" can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct the polypeptide to the cell surface or secrete the polypeptide into the media, and this signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.

The term "oligonucleotide", as used herein in referring to the probe of the present invention, is defined as a molecule comprised of two or more ribonucleotides, preferably more than three. Its exact size will depend upon many factors which, in turn, depend upon the ultimate function and use of the oligonucleotide.

The term "primer" as used herein refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e. , in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH. The primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon many factors, including temperature, source of primer and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.

The primers herein are selected to be "substantially" complementary to different strands of a particular target DNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the strand to hybridize therewith and thereby form the template for the synthesis of the extension product.

A cell has been "transformed" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.

Two DNA sequences are "substantially homologous" when at least about 75 % (preferably at least about 80% , and most preferably at least about 90 or 95 %) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g. , Maniatis et al., supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra. A "heterologous" region of the DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

An "antibody" is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope. The term encompasses polyclonal, monoclonal, and chimeric antibodies, the last mentioned described in further detail in U.S. Patent Nos. 4,816,397 and 4,816,567. An "antibody combining site" is that structural portion of an antibody molecule comprised of heavy and light chain variable and hypervariable regions that specifically binds antigen. The phrase "antibody molecule" in its various grammatical forms as used herein contemplates both an intact immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule. Exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules and those portions of an immunoglobulin molecule that contains the paratope. including those portions known in the art as Fab, Fab', F(ab')₂ and F(v), which portions are preferred for use in the therapeutic methods described herein. The phrase "monoclonal antibody" in its various grammatical forms refers to an antibody having only one species of antibody combining site capable of immunoreacting with a particular antigen. A monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreacts. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen; e.g., a bispecific (chimeric) monoclonal antibody. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to prevent, and preferably reduce by at least about 30 percent, more preferably by at least 50 percent, most preferably by at least 90 percent, a clinically significant change in the S phase activity of a target cellular mass, or other feature of pathology such as for example, elevated blood pressure, fever or white cell count as may attend its presence and activity.

In its primary aspect, the present invention concerns the identification of novel receptor recognition factors, and the isolation and sequencing of a particular receptor recognition factor proteins, that are believed to be present in cytoplasm and that serves as a signal transducer between a particular cellular receptor having bound thereto an equally specific polypeptide ligand, and the comparably specific transcription factor that enters the nucleus of the cell and interacts with a specific DNA binding site for the activation of the gene to promote the predetermined response to the particular polypeptide stimulus. The present disclosure confirms that specific and individual receptor recognition factors exist that correspond to known stimuli such as tumor necrosis factor, nerve growth factor, platelet-derived growth factor and the like. Specific evidence of this is set forth herein with respect to the interferons α and y (IFNα and IFN7).

A further property of the receptor recognition factors (also termed herein signal transducers and activators of transcription ~ STAT) is dimerization to form homodimers or heterodimers upon activation by phosphorylation of tyrosine. In a specific embodiment, infra, Stat91 and Stat84 form homodimers and a Stat91- Stat84 heterodimer. Accordingly, the present invention is directed to such dimers, which can form spontaneously by phosphorylation of the STAT protein, or which can be prepared synthetically by chemically cross-linking two like or unlike STAT proteins.

The present receptor recognition factor is likewise noteworthy in that it appears not to be demonstrably affected by fluctuations in second messenger activity and concentration. The receptor recognition factor proteins appear to act as a substrate for tyrosine kinase domains, however do not appear to interact with G-proteins, and therefore do not appear to be second messengers.

A particular receptor recognition factor identified herein by SEQ ID NO:4, Stat91 or Statlα, has been determined to be present in cytoplasm and serves as a signal transducer and a specific transcription factor in response to IFN-7 stimulation that enters the nucleus of the cell and interacts directly with a specific DNA binding site for the activation of the gene to promote the predetermined response to the particular polypeptide stimulus. This particular factor also acts as a translation protein and, in particular, as a DNA binding protein in response to interferon-7 stimulation. This factor is likewise noteworthy in that it has the following characteristics: a) It interacts with an interferon-7-bound receptor kinase complex; b) It is a tyrosine kinase substrate; and c) When phosphorylated, it serves as a DNA binding protein.

More particularly, the factor of SEQ ID NO:4 directly interacts with DNA after acquiring phosphate on tyrosine located at position 701 of the amino acid sequence. Also, interferon-7-dependent activation of this factor occurs without new protein synthesis and appears within minutes of interferon-7 treatment, achieves maximum extent between 15 and 30 minutes thereafter, and then disappears after 2-3 hours.

Stat 91 is more particularly characterized by at least one of the following additional characteristics: d) Phosphorylation of tyrosine-701 is required for nuclear transport; e) Phosphorylation of tyrosine-701 is required for DNA binding; f) Phosphorylation of tyrosine-701 is required for transcription activation; g) A functional SH2 domain is required for tyrosine-701 phosphorylation.

Yet a further property of the present factor is its ability to dimerize when phosphorylated. Accordingly, a further property of the receptor recognition factors (also termed herein signal transducers and activators of transcription ~ STAT) is dimerization to form homodimers or heterodimers upon activation by phosphorylation of tyrosine. In a specific embodiment, infra, Stat91 and Stat84 form homodimers and a Stat91-Stat84 heterodimer. Accordingly, the present invention is directed to such dimers. which can form spontaneously by phosphorylation of the STAT protein, or which can be prepared synthetically by chemically cross-linking two like or unlike STAT proteins.

The present invention further relates to receptor recognition factors that are functionally active fragments, e.g.. as exemplified herein with fragments of the 91 kD receptor recognition factor, particularly such fragments that contain an amino acid residue corresponding to the tyrosine 701 residue, and preferably that contain a corresponding phosphotyrosine residue. In a different embodiment, the functionally active fragments further comprises the SH2 domain, particularly the SH2 domain that has a residue corresponding to an arginine-602 residue of the 91- kD receptor recognition factor. It is envisioned that such functionally active receptor recognition factors comprise at least about 8 amino acid residues. The invention contemplates inhibitory fragments of such receptor recognition proteins, e.g. , as exemplified herein with respect to the 91 kD protein. In one embodiment, the SH2 domain of the 91 kD protein can competitively inhibit phosphorylation of the whole protein or fragment thereof containing tyrosine 701. In another embodiment, an inhibitory fragment can compete with the 91 kD protein for binding to a tyrosine kinase. Such an inhibitory fragment may contain a residue corresponding to tyrosine 701.

In yet a further embodiment, the invention contemplates antagonists of the activity of a receptor recognition factor (STAT). In particular, an agent or molecule that inhibits dimerization (homodimerization or heterodimerization) can be used to block transcription activation effected by an activated, phosphorylated STAT protein. In a specific embodiment, the antagonist can be a peptide having the sequence of a portion of an SH2 domain of a STAT protein, or the phosphotyrosine domain of a STAT protein, or both. If the peptide contains both regions, preferably the regions are located in tandem, more preferably with the SH2 domain portion N-terminal to the phosphotyrosine portion. In a specific example, infra, such peptides are shown to be capable of disrupting dimerization of STAT proteins.

Subsequent to the filing of the initial applications directed to the present invention, the inventors have termed each member of the family of receptor recognition factors as a signal transducer and activator of transcription (STAT) protein. Each STAT protein is designated by the apparent molecular weight (e.g. , Statl 13, Stat91 , Stat84. etc.), or by the order in which it has been identified (e.g. , Statlα [Stat91], StatljS [Stat84], Stat2 [Statl 13], Stat3 [a murine protein also termed 19sf6],, and Stat4 [a murine STAT protein also termed 13sfl]). As will be readily appreciated by one of ordinary skill in the art, the choice of name has no effect on the intrinsic characteristics of the factors described herein, which were first disclosed in International Patent Publication No. WO 93/19179, published 30 September 1993. The present inventors have chosen to adopt this newly derived terminology herein as a convenience to the skilled artisan who is familiar with the subsequently published papers relating to the same, and in accordance with the proposal to harmonize the terminology for the novel class of proteins, and nucleic acids encoding the proteins, disclosed by the instant inventors. The terms [molecular weight] kd receptor recognition factor, Stat[molecular weight], and Stat[number] are used herein interchangeably, and have the meanings given above. For example, the terms 91 kd protein, Stat91 , and Statlα refer to the same protein, and in the appropriate context refer to the nucleic acid molecule encoding such protein.

As stated above, the present invention also relates to a recombinant DNA molecule or cloned gene, or a degenerate variant thereof, which encodes a receptor recognition factor, or a fragment thereof, that has a molecular weight of about 91 kD and the amino acid sequence set forth in FIGURE 1 (SEQ ID NO:8); preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding the 91 kD receptor recognition factor has a nucleotide sequence or is complementary to a DNA sequence shown in FIGURE 1 (SEQ ID NO: 8). In yet another embodiment, the receptor recognition factor has an amino acid sequence set forth in FIGURE 2 (SEQ ID NO: 10); preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding such receptor recognition factor has a nucleotide sequence or is complementary to a DNA sequence shown in FIGURE 2 (SEQ ID NO:9). In still another embodiment, the receptor recognition factor has an amino acid sequence set forth in FIGURE 3 (SEQ ID NO: 12); preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding such receptor recognition factor has a nucleotide sequence or is complementary to a DNA sequence shown in FIGURE 3 (SEQ ID NO: 11).

The possibilities both diagnostic and therapeutic that are raised by the existence of the receptor recognition factor or factors, derive from the fact that the factors appear to participate in direct and causal protein-protein interaction between the receptor that is occupied by its ligand, and those factors that thereafter directly interface with the gene and effect transcription and accordingly gene activation. As suggested earlier and elaborated further on herein, the present invention contemplates pharmaceutical intervention in the cascade of reactions in which the receptor recognition factor is implicated, to modulate the activity initiated by the stimulus bound to the cellular receptor.

Thus, in instances where it is desired to reduce or inhibit the gene activity resulting from a particular stimulus or factor, an appropriate inhibitor of the receptor recognition factor could be introduced to block the interaction of the receptor recognition factor with those factors causally connected with gene activation. Correspondingly, instances where insufficient gene activation is taking place could be remedied by the introduction of additional quantities of the receptor recognition factor or its chemical or pharmaceutical cognates, analogs, fragments and the like.

As discussed earlier, the recognition factors or their binding partners or other ligands or agents exhibiting either mimicry or antagonism to the recognition factors or control over their production, may be prepared in pharmaceutical compositions, with a suitable carrier and at a strength effective for administration by various means to a patient experiencing an adverse medical condition associated specific transcriptional stimulation for the treatment thereof. A variety of administrative techniques may be utilized, among them parenteral techniques such as subcutaneous, intravenous and intraperitoneal injections, catheterizations and the like. Average quantities of the recognition factors or their subunits may vary and in particular should be based upon the recommendations and prescription of a qualified physician or veterinarian.

Also, antibodies including both polyclonal and monoclonal antibodies, and drugs that modulate the production or activity of the recognition factors and/or their subunits may possess certain diagnostic applications and may for example, be utilized for the purpose of detecting and/or measuring conditions such as viral infection or the like. For example, the recognition factor or its subunits may be used to produce both polyclonal and monoclonal antibodies to themselves in a variety of cellular media, by such well known techniques as immunization of rabbit using Complete and Incomplete Freund's Adjuvant and the hybridoma technique utilizing, for example, fused mouse spleen lymphocytes and myeloma cells, respectively. These techniques have been described in numerous publications in great detail, e.g. , International Patent Publication WO 93/19179, and do not bear repeating here.

Likewise, small molecules that mimic or antagonize the activity(ies) of the receptor recognition factors of the invention may be discovered or synthesized, and may be used in diagnostic and/or therapeutic protocols.

As suggested earlier, the diagnostic method of the present invention comprises examining a cellular sample or medium by means of an assay including an effective amount of an antagonist to a receptor recognition factor/protein, such as an anti-recognition factor antibody, preferably an affinity-purified polyclonal antibody, and more preferably a mAb. In addition, it is preferable for the anti- recognition factor antibody molecules used herein be in the form of Fab, Fab', F(ab')₂ or F(v) portions or whole antibody molecules. As previously discussed, patients capable of benefiting from this method include those suffering from cancer, a pre-cancerous lesion, a viral infection or other like pathological derangement. Methods for isolating the recognition factor and inducing anti- recognition factor antibodies and for determining and optimizing the ability of anti- recognition factor antibodies to assist in the examination of the target cells are all well-known in the art.

The present invention further contemplates therapeutic compositions useful in practicing the therapeutic methods of this invention. A subject therapeutic composition includes, in admixture, a pharmaceutically acceptable excipient (carrier) and one or more of a receptor recognition factor, polypeptide analog thereof or fragment thereof, as described herein as an active ingredient. In a preferred embodiment, the composition comprises an antigen capable of modulating the specific binding of the present recognition factor within a target cell.

The preparation of therapeutic compositions which contain polypeptides, analogs or active fragments as active ingredients is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions, however, solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared. The preparation can also be emulsified. The active therapeutic ingredient is often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents which enhance the effectiveness of the active ingredient.

A polypeptide, analog or active fragment can be formulated into the therapeutic composition as neutralized pharmaceutically acceptable salt forms.

Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide or antibody molecule) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed from the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.

The therapeutic polypeptide-, analog- or active fragment-containing compositions are conventionally administered intravenously, as by injection of a unit dose, for example. The term "unit dose" when used in reference to a therapeutic composition of the present invention refers to physically discrete units suitable as unitary dosage for humans, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent; i.e., carrier, or vehicle.

The compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount. The quantity to be administered depends on the subject to be treated, capacity of the subject's immune system to utilize the active ingredient, and degree of inhibition or neutralization of recognition factor binding capacity desired. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosages may range from about 0.1 to 20, preferably about 0.5 to about 10, and more preferably one to several, milligrams of active ingredient per kilogram body weight of individual per day and depend on the route of administration. Suitable regimes for initial administration and booster shots are also variable, but are typified by an initial administration followed by repeated doses at one or more hour intervals by a subsequent injection or other administration. Alternatively, continuous intravenous infusion sufficient to maintain concentrations of ten nanomolar to ten micromolar in the blood are contemplated.

The therapeutic compositions may further include an effective amount of the factor/factor synthesis promoter antagonist or analog thereof, and one or more of the following active ingredients: an antibiotic, a steroid. Exemplary formulations are well known in the art, e.g., as disclosed in International Patent Publication WO 93/19179.

Another feature of this invention is the expression of the DNA sequences disclosed herein. As is well known in the art, DNA sequences may be expressed by operatively linking them to an expression control sequence in an appropriate expression vector and employing that expression vector to transform an appropriate unicellular host.

Such operative linking of a DNA sequence of this invention to an expression control sequence, of course, includes, if not already part of the DNA sequence, the provision of an initiation codon, ATG, in the correct reading frame upstream of the DNA sequence.

A wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and Synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g. , E. coli plasmids col El, pCRl , pBR322, pMB9 and their derivatives, plasmids such as RP4; phage DNAS, e.g., the numerous derivatives of phage λ, e.g., NM989, and other phage DNA, e.g. , M13 and

Filamentous single stranded phage DNA; yeast plasmids such as the 2μ plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAS, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.

Any of a wide variety of expression control sequences - sequences that control the expression of a DNA sequence operatively linked to it ~ may be used in these vectors to express the DNA sequences of this invention. Such useful expression control sequences include, for example, the early or late promoters of SV40,

CMV, vaccinia, polyoma or adenovirus, the lac system, the trp system, the TAC system, the 7RC system, the LTR system, the major operator and promoter regions of phage λ, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g. , Pho5), the promoters of the yeast α-mating factors, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.

A wide variety of unicellular host cells are also useful in expressing the DNA sequences of this invention. These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptomyces, fungi such as yeasts, and animal cells, such as CHO, Rl.l, B-W and L-M cells, African Green Monkey kidney cells (e.g., COS 1 , COS 7, BSC1 , BSC40, and BMT10), insect cells (e.g., Sf9), and human cells and plant cells in tissue culture.

Alternatively, a genes encoding a receptor recognition factor of the invention may be incorporated in a transgenic expression vector, e.g. , one of the well known retroviral vectors, for in vivo or ex vivo transfection of cells for gene therapy.

It will be understood that not all vectors, expression control sequences and hosts will function equally well to express the DNA sequences of this invention. Neither will all hosts function equally well with the same expression system. However, one skilled in the art will be able to select the proper vectors, expression control sequences, and hosts without undue experimentation to accomplish the desired expression without departing from the scope of this invention. For example, in selecting a vector, the host must be considered because the vector must function in it. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, will also be considered.

In selecting an expression control sequence, a variety of factors will normally be considered. These include, for example, the relative strength of the system, its controllability, and its compatibility with the particular DNA sequence or gene to be expressed, particularly as regards potential secondary structures. Suitable unicellular hosts will be selected by consideration of, e.g., their compatibility with the chosen vector, their secretion characteristics, their ability to fold proteins correctly, and their fermentation requirements, as well as the toxicity to the host of the product encoded by the DNA sequences to be expressed, and the ease of purification of the expression products.

Considering these and other factors a person skilled in the art will be able to construct a variety of vector/expression control sequence/host combinations that will express the DNA sequences of this invention on fermentation or in large scale animal culture.

It is further intended that receptor recognition factor analogs may be prepared from nucleotide sequences of the protein complex/subunit derived within the scope of the present invention. Analogs, such as fragments, may be produced, for example, by pepsin digestion of receptor recognition factor material. Other analogs, such as muteins, can be produced by standard site-directed mutagenesis of receptor recognition factor coding sequences. Analogs exhibiting "receptor recognition factor activity" such as small molecules, whether functioning as promoters or inhibitors, may be identified by known in vivo and/or in vitro assays.

As mentioned above, a DNA sequence encoding receptor recognition factor can be prepared synthetically rather than cloned. The DNA sequence can be designed with the appropriate codons for the receptor recognition factor amino acid sequence. In general, one will select preferred codons for the intended host if the sequence will be used for expression. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g., Edge, Nature, 292:756 (1981); Nambair et al., Science, 223:1299 (1984); Jay et al., J. Biol. Chem. , 259:6311 (1984).

Synthetic DNA sequences allow convenient construction of genes which will express receptor recognition factor analogs or "muteins". Alternatively, DNA encoding muteins can be made by site-directed mutagenesis of native receptor recognition factor genes or cDNAs, and muteins can be made directly using conventional polypeptide synthesis.

A general method for site-specific incorporation of unnatural amino acids into proteins is described in Christopher J. Noren, Spencer J. Anthony-Cahill, Michael C. Griffith, Peter G. Schultz, Science, 244:182-188 (April 1989). This method may be used to create analogs with unnatural amino acids.

The present invention extends to the preparation of antisense nucleotides and ribozymes that may be used to interfere with the expression of the receptor recognition proteins at the translational level. This approach utilizes antisense nucleic acid and ribozymes to block translation of a specific mRNA, either by masking that mRNA with an antisense nucleic acid or cleaving it with a ribozyme. Antisense and ribozyme technology are well known in the art, and have been described in many publications, e.g. , International Patent Publication WO 93/19179.

The present invention also relates to a variety of diagnostic applications, including methods for detecting the presence of stimuli such as the earlier referenced polypeptide ligands, by reference to their ability to elicit the activities which are mediated by the present receptor recognition factor.

As mentioned earlier, the receptor recognition factor can be used to produce antibodies to itself by a variety of known techniques, and such antibodies could then be isolated and utilized as in tests for the presence of particular transcriptional activity in suspect target cells. Many assay procedures, or formats, are well known in the art. The "competitive" procedure is described in U.S. Patent Nos. 3,654,090 and 3,850,752. The "sandwich" procedure, is described in U.S. Patent Nos. RE 31,006 and 4,016,043. Still other procedures are known such as the "double antibody", or "DASP" procedure. In each instance, the receptor recognition factor forms complexes with one or more antibody(ies) or binding partners and one member of the complex is labeled with a detectable label. The fact that a complex has formed and, if desired, the amount thereof, can be determined by known methods applicable to the detection of labels.

The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals which fluoresce when exposed to ultraviolet light, and others. A number of fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine and auramine. The receptor recognition factor or its binding partner(s) can also be labeled with a radioactive element or with an enzyme. The radioactive label can be detected by any of the currently available counting procedures. The preferred isotope may be selected from ³H, ¹⁴C, ³ P, ³⁵S, ³⁶C1, ⁵¹Cr, ⁵⁷Co, ⁵⁸Co, ⁵⁹Fe, ⁹ Y, ¹²⁵I, ^13II, and ¹⁸⁶Re. Enzyme labels are likewise useful, and can be detected by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques.

A particular assay system developed and utilized in accordance with the present invention, is known as a receptor assay. In a receptor assay, the material to be assayed is appropriately labeled and then certain cellular test colonies are inoculated with a quantity of both the labeled and unlabeled material after which binding studies are conducted to determine the extent to which the labeled material binds to the cell receptors. In this way, differences in affinity between materials can be ascertained.

Accordingly, a purified quantity of the receptor recognition factor may be . radiolabeled and combined, for example, with antibodies or other inhibitors thereto, after which binding studies would be carried out. Solutions would then be prepared that contain various quantities of labeled and unlabeled uncombined receptor recognition factor, and cell samples would then be inoculated and thereafter incubated. The resulting cell monolayers are then washed, solubilized and then counted in a gamma counter for a length of time sufficient to yield a standard error of < 5 % . These data are then subjected to Scatchard analysis after which observations and conclusions regarding material activity can be drawn. While the foregoing is exemplary, it illustrates the manner in which a receptor assay may be performed and utilized, in the instance where the cellular binding ability of the assayed material may serve as a distinguishing characteristic.

An assay useful and contemplated in accordance with the present invention is known as a "cis/trans" assay. Briefly, this assay employs two genetic constructs, one of which is typically a plasmid that continually expresses a particular receptor of interest when transfected into an appropriate cell line, and the second of which is a plasmid that expresses a reporter such as luciferase, under the control of a receptor/1 igand complex. Thus, for example, if it is desired to evaluate a compound as a ligand for a particular receptor, one of the plasmids would be a construct that results in expression of the receptor in the chosen cell line, while the second plasmid would possess a promoter linked to the luciferase gene in which the response element to the particular receptor is inserted. If the compound under test is an agonist for the receptor, the ligand will complex with the receptor, and the resulting complex will bind the response element and initiate transcription of the luciferase gene. The resulting chemiluminescence is then measured photometrically, and dose response curves are obtained and compared to those of known ligands. The foregoing protocol is described in detail in U.S. Patent No. 4,981 ,784 and PCT International Publication No. WO 88/03168, for which purpose the artisan is referred.

In a further embodiment of this invention, commercial test kits suitable for use by a medical specialist may be prepared to determine the presence or absence of predetermined transcriptional activity or predetermined transcriptional activity capability in suspected target cells. In accordance with the testing techniques discussed above, one class of such kits will contain at least the labeled receptor recognition factor or its binding partner, for instance an antibody specific thereto, and directions, of course, depending upon the method selected, e.g., "competitive", "sandwich", "DASP" and the like. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.

Accordingly, a test kit may be prepared for the demonstration of the presence or capability of cells for predetermined transcriptional activity, comprising:

(a) a predetermined amount of at least one labeled immunochemically reactive component obtained by the direct or indirect attachment of the present receptor recognition factor or a specific binding partner thereto, to a detectable label;

(b) other reagents; and (c) directions for use of said kit.

More specifically, the diagnostic test kit may comprise:

(a) a known amount of the receptor recognition factor as described above (or a binding partner) generally bound to a solid phase to form an immunosorbent, or in the alternative, bound to a suitable tag, or plural such end products, etc. (or their binding partners) one of each;

(b) if necessary, other reagents; and

(c) directions for use of said test kit.

In a further variation, the test kit may be prepared and used for the purposes stated above, which operates according to a predetermined protocol (e.g. "competitive", "sandwich", "double antibody" , etc.), and comprises:

(a) a labeled component which has been obtained by coupling the receptor recognition factor to a detectable label; (b) one or more additional immunochemical reagents of which at least one reagent is a ligand or an immobilized ligand, which ligand is selected from the group consisting of:

(i) a ligand capable of binding with the labeled component (a); (ii) a ligand capable of binding with a binding partner of the labeled component (a); (iii) a ligand capable of binding with at least one of the component(s) to be determined; and

(iv) a ligand capable of binding with at least one of the binding partners of at least one of the component(s) to be determined; and

(c) directions for the performance of a protocol for the detection and/or determination of one or more components of an immunochemical reaction between the receptor recognition factor and a specific binding partner thereto.

In accordance with the above, an assay system for screening potential drugs effective to modulate the activity of the receptor recognition factor may be prepared. The receptor recognition factor may be introduced into a test system, and the prospective drug may also be introduced into the resulting cell culture, and the culture thereafter examined to observe any changes in the transcriptional activity of the cells, due either to the addition of the prospective drug alone, or- due to the effect of added quantities of the known receptor recognition factor.

The present invention may be better understood by reference to the following Examples, which are provided by way of exemplification and not limitation.

EXAMPLE 1 : IDENTIFICATION OF MURINE 91 KD PROTEIN

A fragment of the gene encoding the human 91 kD protein was used to screen a murine thymus and spleen cDNA library for homologous proteins. The screening assay yielded a highly homologous gene encoding a murine polypeptide that is greater than 95 % homologous to the human 91 kD protein. The nucleic acid and deduced amino acid sequence of the murine 91 kD protein are shown in Figure 1A-1C, and SEQ ID NO:7 (nucleotide sequence) and SEQ ID NO: 8 (amino acid sequence). EXAMPLE 2: ADDITIONAL MEMBERS OF THE STAT PROTEIN FAMILY

Using a 300 nuclide fragment amplified by PCR from the SH2 region of the murine 91kD protein gene, murine genes encoding two additional members of the 113-91 family of receptor recognition factor proteins were isolated from a murine splenic/thymic cDNA library according to the method of Sambrook et al. (1989, Molecular Cloning, A Laboratory Manual, 2nd. ed., Cold Spring Harbor Press: Cold Spring Harbor, New York) constructed in the ZAP vector. Hybridization was carried out at 42 °C and washed at 42 °C before the first exposure (Church and Gilbert, 1984, Proc. Natl. Acad. Sci. USA 81 : 1991-95). Then the filters were washed in 2X SSC, 0.1 % SDS at 65 °C for a second exposure. Statl clones survived the 65 °C washing, whereas Stat3 and Stat4 clones were identified as plaques that lost signals at 65 °C. The plaques were purified and subcloned according to Stratagene commercial protocols.

This probe was chosen to screen for other STAT family members because, while Statl and Stat2 SH2 domains are quite similar over the entire 100 to 120 amino acid region, only the amino terminal half of the STAT SH2 domains strongly resemble the SH2 regions found in other proteins.

The two genes have been cloned into plasmids 13sfl and 19sf6. The nucleotide sequence, and deduced amino acid sequence, for the 13sfl and 19sf6 genes are shown in Figures 2 and 3, respectively. These proteins are alternatively termed Stat4 and Stat3, respectively.

Comparison with the sequence of Stat91 (Statl) and Statl 13 (Stat2) shows several highly conserved regions, including the putative SH3 and SH2 domains. The conserved amino acid stretches likely point to conserved domains that enable these proteins to carry out transcription activation functions. Stat3, like Statl (Stat91), is widely expressed, while Stat4 expression is limited to the testes, thymus, and spleen. Stat3 has been found to be activated as a DNA binding protein through phosphorylation on tyrosine in cells treated with EGF or IL-6, but not after IFN-₇, treatment.

Both the 13sfl and 19sf6 genes share a significant homology with the genes encoding the human and murine 91 kD protein. There is corresponding homology between the deduced amino acid sequences of the 13sfl and 19sf6 proteins and the amino acid sequences of the human and murine 91 kD proteins, although not the greater than 95 % amino acid homology that is found between the murine and human 91 kD proteins. Thus, though clearly of the same family as the 91 kD protein, the 13sfl and 19sf6 genes encode distinct proteins.

The chromosomal locations of the murine STAT proteins (1-4) have been determined: Statl and Stat4 are located in the centromeric region of mouse chromosome 1 (corresponding to human 2q 32-34q); the two other genes are on other chromosomes.

Southern analysis using probes derived from 13sfl and 19sf6 on human genomic libraries have established that genes corresponding to the murine 13sfl and 19sf6 genes are found in humans.

Tissue distribution of mRNA expression of these genes was evaluated by Northern hybridization analysis. The results of this distribution analysis are shown in the following Table.

TABLE DISTRIBUTION OF mRNA EXPRESSION OF 13sfl, 19sf6, 91 kD PROTEINS

ORGAN 13sfl 19sf6 91 KD

BRAIN - + -

HEART - + + + -

KIDNEY - - -

LIVER - + +

LUNG - - -

SPLEEN + + + + + +

TESTIS + + + + + + N.A.

THYMUS + + + + + + + ^'

EMBRYO (16d) not found found found

Northern analysis demonstrates that there is variation in the tissue distribution of expression of the mRNAs encoded by these genes. The variation and tissue distribution indicates that the specific genes encode proteins that are responsive to different factors, as would be expected in accordance with the present invention. The actual ligand, the binding of which induces phosphorylation of the newly discovered factors, will be readily determinable based on the tissue distribution evidence described above.

To determine whether the Stat3 and Stat4 proteins were present in cells, protein blots were carried out with antisera against each protein. The antisera were obtained by subcloning amino acids 688 to 727 of Stat3 and 678 to 743 of Stat4 to pGEXlλt (Pharmacia) by PCR with oligonucleotides based on the boundary sequence plus restriction sites (BamHI at the 5' end and EcoRI at the 3' end), allowing for in-frame fusion with GST. One milligram of each antigen was used for the immunization and three booster injections were given 4 weeks apart. Anti- Stat3 and anti-Stat4 sera were used 1 : 1000 in Western blots using standard protocols. To avoid cross reactivity of the antisera, antibodies were raised against the C-terminal of Stat3 and Stat4, the less homologous region of the protein.

These proteins were unambiguously found in several tissues where the mRNA wan known to be present. Protein expression was checked in several cell lines as well. A protein of 89 kD reactive with Stat4 antiserum was expressed in 70Z cells, a preB cell line, but not in many other cell lines. Stat3 was highly expressed, predominantly as a 97 kD protein, in 70Z, HT2 (a mouse helper T cell clone), and U937 (a macrophage-derived cell).

To prove that the full length functional cDNA clones of Stat3 and Stat4 were obtained, the open reading frames of each cDNA was independently (i.e. , separately) cloned into the Rc/CMV expression vector (Invitrogen) downstream of a CMV promoter. The resulting plasmids were transfected into COS1 cells and proteins were extracted 60 hrs post-transfection and examined by Western blot after electrophoresis. Untransfected COS1 cells expressed a low level of 97 kD Stat3 protein but did not express a detectable level of Stat4. Upon transfection of the Stat3-expressing plasmid, the 97 kD Stat3 was increased at least 10-fold. And 89 kD protein antigenically related to Stat3. found as a minor band in most cell line extracts, was also increased post-transfection. This protein therefore appears to represent another form of Stat3 protein, or an antigenically similar protein whose synthesis is stimulated by Stat3. Transfection with Stat4 led to the expression of a 89 kD reactive band indistinguishable in size form the p89 Stat4 found in 70Z cell extracts. DISCUSSION

As mentioned earlier, the observation and conclusion underlying the present invention were crystallized from a consideration of the results of certain investigations with particular stimuli. Particularly, the present disclosure is illustrated by the results of work on protein factors that govern transcriptional control of IFNα-stimulated genes, as well as more recent data on the regulation of transcription of genes stimulated by IFN7. The present disclosure is further illustrated by the identification of related genes encoding protein factors responsive to as yet unknown factors. It is expected that the murine 91 kD protein is responsive to IFN-7.

For example, the above represents evidence that the 91 kD protein is the tyrosine kinase target when IFN7 is the ligand. Thus two different ligands acting through two different receptors both use these family members. With only a . modest number of family members and combinatorial use in response to different ligands, this family of proteins becomes an even more likely possibility to represent a general link between ligand-occupied receptors and transcriptional control of specific genes in the nucleus.

It is proposed and shown by the foregoing that other members of the 113-91 protein family will be and have been identified as phosphorylation targets in response to other ligands. If as is believed, the tyrosine phosphorylation site on proteins in this family is conserved, one can then easily determine which family members are activated (phosphorylated), and likewise the particular extracellular polypeptide ligand to which that family member is responding. The modifications of these proteins (phosphorylation and dephosphorylation) enables the preparation and use of assays for determining the effectiveness of pharmaceuticals in potentiating or preventing intracellular responses to various polypeptides, and suctø assays are accordingly contemplated within the scope of the present invention. Earlier work has concluded that DNA binding protein was activated in the cell cytoplasm in response to IFN-7 treatment and that this protein stimulated transcription of the GBP gene (10, 14). In the present work, with the aid of antisera to proteins originally studied in connection with IFN-α gene stimulation (7,12, 15), the 91 kD ISGF-3 protein has been assigned a prominent role in IFN-7 gene stimulation as well. The evidence for this conclusion included: 1) antisera specific to the 91 kD protein affected the IFN-7 dependent gel-shift complex, and 2) A 91 kD protein could be cross-linked to the GAS IFN-7 activated site. 3) A ³⁵S-labeled 91 kD protein and a 91 kD immunoreactive protein specifically purified with the gel-shift complex. 4) The 91 kD protein is an IFN-7 dependent tyrosine kinase substrate as indeed it had earlier proved to be in response to IFN-α (15). 5) The 91 kD protein but not the 113 kD protein moved to the nucleus in response to IFN-7 treatment. None of these experiments prove but do strongly suggest that the same 91 kD protein acts differently in different DNA binding complexes that are triggered by either IFN-α or IFN-7.

These results strongly support the hypothesis originated from studies on IFN-α that polypeptide cell surface receptors report their occupation by extracellular ligand to latent cytoplasmic proteins that after activation move to the nucleus to trigger transcription (4, 15,21). Furthermore, because cytoplasmic phosphorylation and factor activation is so rapid it appears likely that the functional receptor complexes contain tyrosine kinase activity. Since the IFN-7 receptor chain that has been cloned thus far (22) has no hint of possessing intrinsic kinase activity, perhaps some other molecule with tyrosine kinase activity couples with the IFN-7 receptor. Two recent results with other receptors suggest possible parallels to the situation with the IFN receptors. The trk protein which has an intracellular tyrosine kinase domain, associates with the NGF receptor when that receptor is occupied (23). In addition, the lck protein, a member of the src family of tyrosine kinases, is co-precipitated with the T cell receptor (24). It is possible to predict that signal transduction to the nucleus through these two receptors could involve latent cytoplasmic substrates that form part of activated transcription factors. In any event, it seems possible that there are kinases like trk or lck associated with the IFN-7 receptor or with IFN-α receptor.

With regard to the effect of phosphorylation on the 91 kD protein, it was something of a surprise that after IFN-7 treatment the 91 kD protein becomes a DNA binding protein. Its role must be different in response to IFN-α treatment. Tyrosine is also phosphorylated on tyrosine and joins a complex with the 113 and 84 kD proteins but as judged by UV cross-linking studies (7), the 91 kD protein does not contact DNA.

In addition to becoming a DNA binding protein it is clear that the 91 kD protein is specifically translocated the nucleus in the wake of IFN-7 stimulation.

EXAMPLE 3: TYROSINE 701 IS PHOSPHORYLATED IN THE 91 kD PROTEIN

It has previously been shown that IFN-7 stimulates phosphorylation of the 91 kD protein. Thermolysin digestion of ³²P-labeled 91 kD protein from IFN-7-treated cells yielded a single peptide labeled on tyrosine. The 91 kD protein contains 19 tyrosines (12). and to determine the location of the phosphorylated residue or residues, a tryptic digest of ³²P-labeled 91 kD protein from IFN-7-treated cells (FIGURE 4 A) was examined. IFN-7 induced phosphorylation of a single tryptic peptide (X) on tyrosine. Peptide X was recovered and stepwise Edman degradation done. The labeled phosphotyrosine was released in the fourth degradative cycle (FIGURE 4B). Computer alignment of all the potential tryptic peptides showed a single peptide (amino acids 698 to 703) in which tyrosine was the fourth amino acid, revealing this peptide as the major candidate for IFN-7- stimulated tyrosine kinase action (FIGURE 4C). Note that the original sequence of the 91 kD protein omitted an 11 amino acid segment from residues 261 to 271. Thus, the putative phosphorylated peptide contained a single tyrosine at residue 701 , confirming the expectation of phosphorylation at tyrosine 690 under the incorrect numbering system. A synthetic peptide corresponding to amino acids 693 to 707 was prepared. This peptide was exposed to purified p43^{v abl} protein kinase [Oncogene Science (27)] and [7-³²P]adenosine triphosphate (ATP). Although labeling was inefficient, only tyrosine was phosphorylated. The labeled synthetic phosphopeptide was cleaved with trypsin, and the resulting peptide migrated identically with peptide X during 2D peptide mapping. Thus, we conclude that Tyr⁷⁰¹ is the single residue in the 91 kD protein that is tyrosine phosphorylated in response to IFN-7.

EXAMPLE 4: FUNCTIONAL IMPORTANCE OF TYR⁷"¹ PHOSPHORYLATION

To test the functional importance of phosphorylation of Tyr⁷"¹, the TAT codon for tyrosine was changed to TTT, which encodes phenylalanine. The wild-type and mutant DNAs were inserted into an expression vector. The gene encoding the 91 kD protein produces two mRNAs with different 3' ends (12). The two mRNAs are translated to produce the 91 kD protein and the 84 kD protein, respectively. An expression vector containing complementary DNA (cDNA) encoding the 84 kD protein was also constructed.

These constructs were introduced by permanent transfection into U3A cells, which do not respond to IFN-α or IFN-7 (28, 29) because they do not express the 84 kD protein or the 91 kD protein. Full-length 91 kD protein restores the ability of these cells to respond to IFN-α and IFN-7, as tested by IFN-induced accumulation of mRNA from endogenous genes. The 84 kD protein restores the accumulation of IFN-α-responsive mRNA but not IFN-7-responsive mRNA (30).

Three cell lines were studied: C91 (expressing the 91 kD protein), Cty (expressing the 91 kD protein in which Tyr⁷"¹ was changed to Phe), and C84 (expressing the 84 kD protein) (FIGURE 5A). A monoclonal antibody (mAb) to phosphotyrosine was used to detect IFN-7-dependent tyrosine phosphorylation in protein immunoblots. The mutant 91 kD protein was not phosphorylated on tyrosine in response to IFN-7, whereas the 91 kD protein from either the wild- type parental cell (2fTGH) or the C91 cell was phosphorylated on tyrosine when treated with IFN-7 (FIGURE 5C). This experiment confirmed that residue 701 is the sole site on the 91 kD that is phosphorylated on tyrosine in response to IFN-7.

An experiment was performed to determined whether the 84 kD protein was phosphorylated on the same site as the 91 kD protein. C84 cells were labeled with ³²P and treated with IFN-7; the ³²P-labeled 84 kD protein was immunoprecipitated and cleaved with trypsin. The resulting tryptic phosphopeptides were analyzed by 2D phosphopeptide mapping (FIGURE 5B). A major spot was identified that migrated similarly to peptide X from the 91 kD protein (FIGURE 4A). When mixed, the two peptides migrated identically. Thus, it was concluded that the 84 kD protein is also tyrosine phosphorylated on Tyr⁷⁰¹ in response to IFN-7.

The function of the 91 kD protein and the 84 kD proteins and the Tyr⁷⁰¹ → Phe⁷⁰¹ mutant was tested in various steps in the signal transduction pathway that results in IFN-7-dependent gene activation. Removal of phosphate from the 91 kD protein phosphoprotein by calf intestinal phosphatase or inhibition of in vivo phosphorylation with staurosporine abolishes the 91 kD protein DNA binding activity. The IFN-7-dependent DNA protein complex, GAF, was detected in the wild-type parental cells (2fTGH) and in C91 cells (FIGURE 6A). The C84 cells also responded to IFN-7, yielding a DNA-protein complex that migrated somewhat faster, as would be expected for a smaller protein (FIGURE 6A). In contrast, cells expressing the Tyr⁷⁰¹ mutant (Cty) failed to produce an IFN-7-dependent DNA binding protein.

IFN-7-induced translocation to the nucleus was also tested. Immunofluorescence in C91 or C84 cells detected throughout the cell before IFN-7 treatment increased in the nucleus after IFN-7 treatment (FIGURE 6). In contrast, the Tyr⁷⁰¹ mutant protein did not move to the nucleus in response to IFN-7, suggesting that phosphorylation on Tyr⁷"¹ is required for the nuclear translocation of the 91 kD protein (FIGURE 6). U3 cells were transiently transfected with the 91 and 84 kD proteins, and the Tyr⁷"¹ mutant protein, and the transcriptional response to IFN-7 was measured in these cells. A target gene was constructed containing luciferase as the reporter and bearing one copy of the binding site for the 91 kD phosphoprotein upstream of an RNA start site otherwise lacking promoter elements. Cells transfected with the target gene and the wild-type 91 kD protein expression vector showed a 5- to 10- fold stimulation of luciferase expression when treated with IFN-7 (FIGURE 7). The IFN-7-dependent transcriptional activation required the presence of the 91 kD protein; IFN-7 did not enhance transcription in U3A cells transfected with the reporter vector alone or a vector lacking the GAS site. Cells transfected with the reporter vector and the Tyr⁷"¹ mutant did not respond to IFN-7, suggesting a requirement for phosphorylation for gene activation. Protein immunoblot analysis indicted that the 91 kD, 84 kD, and Tyr⁷"¹ mutant proteins were expressed during the transient transfection (FIGURE 7). Similar experiments done in human kidney 293 cells support the same conclusion. The results with transient transfections are in accord with findings that in U3A cells accumulation of mRNA from endogenous cellular genes in response to IFN-7 requires the 91 kD protein (30). In those experiments, also, the 84 kD protein failed to direct the IFN-7 response.

EXAMPLE 5: THE ARG ⁶"² RESIDUE IN THE 91KD SH2 DOMAIN IS REQUIRED FOR TYROSINE PHOSPHORYLATION

The 91 kD protein has a sequence from Try⁵⁷² to Pro⁶⁷" that resembles SH2 domains (38), amino acid regions known bind tightly to tyrosine phosphates (39). Since ligand activated kinases often present a phosphotyrosine to a substrate, we tested the requirement for the SH2 domain in the 91 kD protein in ligand-mediated phosphorylation. The Arg¹⁵⁵ residue in the v-src SH2 domain is crucial for direct interaction between a phosphotyrosine residue in the SH2 domain (40, 41) and Arg⁶⁰² of the kD protein is in a comparable position within the SH2 homology (38). We therefore changed the 91kD protein cDNA to encode Leu⁶"² instead of Arg⁶"² and inserted the new sequence into an expression vector. U3A cells, an IFN-α and IFN-7 unresponsive cell line (29) which lacks the mRNA for the 91kD protein and 84kD proteins (30) were transfected with expression vectors. Two stable cell lines were selected that express the Arg⁶"²- > Leu mutuant protein. The mutuant protein immunoprecipitated from these cell lines was not phosphorylated on tyrosine in response to IFN-7 (Figure 8b); thus a functional SH2 domain is required for the tyrosine phosphorylation of the 91kD protein suggesting that the kinase to which the substrate binds might in its active state have a tyrosine phosphate.

DISCUSSION

As mentioned earlier, the observation and conclusion underlying the present invention were crystallized from a consideration of the results of certain investigations with particular stimuli. Particularly, the present disclosure is illustrated by the results of work on protein factors that govern transcriptional control of IFNα-stimulated genes, as well as more recent data on the regulation of transcription of genes stimulated by IFN7.

For example, the above represents evidence that the 91kD protein is the tyrosine kinase target when IFN7 is the ligand. Thus two different ligands acting through two different receptors both use these family members. With only a modest number of family members and combinatorial use in response to different ligands, this family of proteins becomes an even more likely possibility to represent a general link between ligand-occupied receptors and transcriptional control of specific genes in the nucleus.

It is proposed that other members of the 113-91 protein family will be identified as phosphorylation targets in response to other ligands. If as is believed, the tyrosine phosphorylation site on proteins in this family is conserved, one can then easily determine which family members are activated (phosphorylated), and likewise the particular extracellular polypeptide ligand to which that family member is responding. The modifications of these proteins (phosphorylation and dephosphorylation) enables the preparation and use of assays for determining the effectiveness of pharmaceuticals in potentiating or preventing intracellular responses to various polypeptides, and such assays are accordingly contemplated within the scope of the present invention.

Earlier work has concluded that DNA binding protein was activated in the cell cytoplasm in response to IFN-7 treatment and that this protein stimulated transcription of the GBP gene (10,14). In the present work, with the aid of antisera to proteins originally studied in connection with IFN-α gene stimulation (7, 12, 15), the 91 kD ISGF-3 protein has been assigned a prominent role in IFN-7 gene stimulation as well. The evidence for this conclusion included: 1) antisera specific to the 91 kD protein affected the IFN-7 dependent gel-shift complex, and 2) A 91 kD protein could be cross-linked to the GAS IFN-7 activated site. 3) A ³⁵S-labeled 91 kD protein and a 91 kD immunoreactive protein specifically purified with the gel-shift complex. 4) The 91 kD protein is an IFN-7 dependent tyrosine kinase substrate as indeed it had earlier proved to be in response to IFN-α (15). 5) The 91 kD protein but not the 113 kD protein moved to the nucleus in response to IFN-7 treatment. These experiments prove but do strongly suggest that the same 91 kD protein acts differently in different DNA binding complexes that are triggered by either IFN-α or IFN-7.

These results strongly support the hypothesis originated from studies on IFN-α that polypeptide cell surface receptors report their occupation by extracellular ligand to latent cytoplasmic proteins that after activation move to the nucleus to trigger transcription (4, 15,21). Furthermore, because cytoplasmic phosphorylation and factor activation is so rapid it appears likely that the functional receptor complexes contain tyrosine kinase activity. Since the IFN-7 receptor chain that has been cloned thus far (22) has no hint of possessing intrinsic kinase activity, perhaps some other molecule with tyrosine kinase activity couples with the IFN-7 receptor. Two recent results with other receptors suggest possible parallels to the situation with the IFN receptors. The trk protein which has an intracellular tyrosine kinase domain, associates with the NGF receptor when that receptor is occupied (23). In addition, the lck protein, a member of the src family of tyrosine kinases, is co-precipitated with the T cell receptor (24). It is possible to predict that signal transduction to the nucleus through these two receptors could involve latent cytoplasmic substrates that form part of activated transcription factors. In any event, it seems possible that there are kinases like trk or lck associated with the IFN-7 receptor or with IFN-α receptor.

With regard to the effect of phosphorylation on the 91 kD protein, it was something of a surprise that after IFN-7 treatment the 91 kD protein becomes a DNA binding protein. Its role must be different in response to IFN-α treatment. There it is also phosphorylated on tyrosine and joins a complex with the 113 and 84 kD proteins but as judged by UV cross-linking studies (7), the 91 kD protein does not contact DNA.

In addition to becoming a DNA binding protein it is clear that the 91 kD protein is specifically translocated the nucleus in the wake of IFN-7 stimulation. While the present work strongly implicates the 91 kD protein as important in the immediate IFN-7 transcriptional response of the GBP gene, two points should also be clear. First, it is not known whether the 91 kD protein acts on its own to activate transcription. Second, it is not known how widely used the 91 kD protein is in the immediate IFN-7 transcriptional response. Only a few genes have been studied that are activated immediately by IFN-7 without new protein synthesis. It is at present uncertain whether activation of these genes operates through the 91 kD binding site.

The present examples demonstrate that phosphorylation of Tyr⁷⁰¹ on the 91 kD protein induces nuclear translocation and DNA binding of the protein. Presumably, the phosphorylated 91 kD protein directly or indirectly activates transcription in response to IFN-8. This function of the phospho-91 kD protein has been indirectly confirmed by the inability of a non-phosphorylated mutant 91 kD protein to induce transcription.

It was found that endogenous genes normally induced by IFN-7 cannot be induced in U3A cells complemented with the Tyr-Phe⁷"¹ mutant protein. However, U3A cells respond to IFN-α when transfected with either the 91 or 84 kD proteins. Thus, the 84 kD protein can fulfill the required role in the multimeric ISGF-3 complex induced by IFN-7 in which either the 84 or 91 kD protein joins with the 113 kD protein and a 48 kD DNA binding protein (30). Cells reconstituted with the Tyr-Phe⁷"¹ mutant protein cannot form ISGF-3 nor do IFN-α-induced mRNAs accumulate in such cells.

After IFN-7 treatment, the 84 kD protein acts in parallel with the 91 kD protein up to the point of gene activation: the 84 kD protein can be phosphorylated and translocated and binds to DNA. However, only the 91 kD protein acts by itself as a direct DNA binding protein capable of transcriptional activation. These results suggest that the 38 COOH-terminal amino acids of the 91 kD are essential for activation of transcription through a GAS site. It is possible that the 84 kD protein functions to regular activity of the 94 kD protein.

EXAMPLE 6: DIMERIZATION OF PHOSPHORYLATED STAT91

Stat91 (a 91 kD protein that acts as a signal transducer and activator of transcription) is inactive in the cytoplasm of untreated cells but is activated by phosphorylation on tyrosine in response to a number of polypeptide ligands- including IFN-α and IFN-7. This example reports that inactive Stat91 in the cytoplasm of untreated cells is a monomer and upon IFN-7 induced phosphorylation it forms a stable homodimer. The dimer is capable of binding to a specific DNA sequence directing transcription. Dissociation and reassociation assays show that dimerization of Stat91 is mediated through SH2-phosphotyrosyl peptide interactions. Dimerization involving SH2 recognition of specific phosphotyrosyl peptides may well provide a prototype for interactions among family members of STAT proteins to form different transcription complexes and Jak2 for the IFN-7 pathway (42, 43, 44). These kinases themselves become tyrosine phosphorylated to carry out specific signaling events.

Materials and Methods

Cell Culture. Human 2fTGH, U3A cells were maintained in DMEM medium supplied with 10% bovine calf serum. U3A cell lines supplemented with various Stat91 protein constructs were maintained in 0.1 mg/ml G418 (Gibco, BRL). Stable cell lines were selected as described (45). IFN-7(5 ng/ml, gift from Amgen) treatment of cells was for 15 min. unless otherwise noted.

Plasmid Constructions. Expression construct MNC-84 was made by insertion of the cDNA into the Not I-Bam HI cloning site of an expression vector PMNC (45, 35). MNC-91L was made by insertion of the Stat91 cDNA into the Not I -Bam HI cloning sites of pMNC without the stop codon at the end, resulting the production of a long form of Stat91 with a C-terminal tag of 34 amino acids encoded by PMNC vector.

GST fusion protein expression plasmids were constructed by the using the pGEX- 2T vector (Pharmacia). GST-91SH2 encodes amino acids 573 to 672 of Stat91; GST-91mSH2 encodes amino acids 573 to 672 of Stat91 with an Arg-602- > Leu- 602 mutation: and GST-91SH3 encodes amino acids 506 to 564 of Stat91.

DNA Transfection. DNA transfection was carried by the calcium phosphate method, and stable cell lines were selected in Dulbecco's modified Eagle's medium containing G418 (0.5 mg/ml, Gibco), as described (45). Preparation of Cell Extracts. Crude whole cell extracts were prepared as described (31). Cytoplasmic and nuclear extracts were prepared essentially as described (46).

Affinity Purification. Affinity purification with a biotinylated oligonucleotide was described (31). The sequence of the biotinylated GAS oligonucleotide was from the Ly6E gene promoter (34).

Nondenaturing Polyacrylamide Gel Analysis. A nondenatured protein molecular weight marker kit with a range of molecular weights from 14 to 545 kD was obtained from Sigma. Determining molecular weights using nondenaturing polyacrylamide gel was carried out following the manufacturer's procedure, which is a modification of the methods of Bryan and Davis (47, 48). Phosphorylated and unphosphorylated Stat91 samples obtained from affinity purification using a biotinylated GAS oligonucleotide (31) were resuspended in a buffer containing 10 mM Tris (pH 6.7), 16% glycerol, 0.04% bromphenol blue (BPB). The mixtures were analyzed on 4.5%. 5.5%, 6.5 %, and 7.5. % native gels side by side with standard markers using a Bio-Rad mini-Protean II Cell electrophoresis system. Electrophoresis was stopped when the dye (BPB) reached the bottom of the gels. The molecular size markers were revealed by Coomassie blue staining. Phosphorylated and unphosphorylated Stat91 samples were detected by immunoblotting with anti-91T.

Glycerol Gradient Analysis. Cells extracts (Bud 8) were mixed with protein standards (Pharmacia) and subjected to centrifugation through preformed 10%- 40% glycerol gradients for 40 hours at 40,000 rpm in an SW41 rotor as described (6).

Gel Mobility Shift Assays. Gel mobility shift assays were carried out as described (34). An oligonucleotide corresponding to the GAS element from the human FC7RI receptor gene (Pearse et al. 1993) was synthesized and used for gel mobility shift assays. The oligonucleotide has the following sequence: 5'GATCGAGATGTATTTCCCAGAAAAG3' (SEQ ID NO: 14).

Synthesis of Peptides. Solid phase peptide synthesis was used with either a DuPont RAMPS multiple synthesizer or by manual synthesis. C-terminal amino attached to Wang resin were obtained from DuPont/NEN. All amino acids were coupled as the N-Fmoc pentafluorophenyl esters (Advanced Chemtech), except for N-Fmoc, PO-dimethyl-L-phosphotyrosine (Bachem). Double couplings were used. Cleavage from resin and deprotection used thioanisol/m-cresol/TFA/TMSBr at 4°C for 16 hr. Purification used C-18 column HPLC with 0.1 % TFA/acetonitrile gradients. Peptides were characterized by *H and ³¹P NMR, and by Mass Spec, and were greater than 95 % pure.

Guanidium Hydrochloride Treatment. Extracts were incubated with guanidium hydrochloride (final concentration was 0.4 to 0.6 M) for two min. at room temperature and then diluted with gel shift buffer (final concentration of guanidium hydrochloride was 100 mM) and incubated at room temperature for 15 min. ³ P- labeled GAS oligonucleotide probe was then added directly to the mixture followed by gel mobility shift assay.

Dissociation-reassociation Analysis. Extracts were incubated with various concentrations of peptides or fusion proteins, and ³²P-labeled GAS oligonucleotide probe in gel shift buffer was then added to promote the formation of protein- DNA complex followed by mobility shift analysis. This assay did not involve guanidium hydrochloride treatment.

Preparation of Fusion Proteins. Bacterially expressed GST fusion proteins were purified using standard techniques, as described in Birge et al., 1992. Fusion proteins were quantified by O.D. absorbance at 280nm. Aliquotes were frozen at -70°C. Results

Detection of Ligand Induced Dimer Formation of Stat91 in Solution. In untreated cells, Stat91 is not phosphorylated on tyrosine. Treatment with IFN-7 leads within minutes to tyrosine phosphorylation and activation of DNA binding capacity. The phosphorylated form migrates more slowly during electrophoresis under denaturing conditions affording a simple assay for the phosphoprotein (31).

To determine the native molecular weights of the phosphorylated and unphosphorylated forms of Stat91 , we separated them by affinity purification using a biotinylated deoxyoligonucleotide containing a GAS sequence (interferon gamma activation site) (Figure 9A). The separation of phosphorylated Stat91 from the unphosphorylated form was efficient as almost all detectable phosphorylated form could bind to the GAS site while unphosphorylated Stat91 remained unbound. To determine the molecular weights of the purified phosphorylated Stat91 and unphosphorylated Stat91, samples of each were then subjected to electrophoresis through a set of nondenaturing gels containing various concentrations of acrylamide followed by Western blot analysis (Figure 9B). Native protein size markers (Sigma) were included in the analysis.

This technique was originally described by Bryan (48) and was recently used for dimer analysis (49). The logic of the technique is that increasing gel concentrations affect the migration of larger proteins more than smaller proteins, and the analysis is not affected by modifications such as protein phosphorylation (49).

A function of the relative mobilities (Rm) was plotted versus the concentration of acrylamide for each sample to construct Ferguson plots (Figure 9C). The logarithm of the retardation coefficient (calculated from Figure 9C) of each sample was then plotted against the logarithm of the relevant molecular weight range

(Figure 9D). By extrapolation of its retardation coefficient (Figure 9D), the native molecular weight of Stat91 from untreated cells was estimated to be approximately 95 kD, while tyrosine phosphorylated Stat91 was estimated to be about twice as large, or approximately 180 kD. Because the calculated molecular weight from amino acid sequence of Stat91 is 87 kD, and Stat91 migrates on denaturing SDA gels with an apparent molecular weight of 91 kD (see supra, and refs. 12 and 45), we concluded that in solution, unphosphorylated Stat91 existed as a monomer while tyrosine phosphorylated Stat91 is a dimer.

We also employed glycerol gradient analysis to estimate the native molecular weights of both phosphorylated and unphosphorylated Stat91 (Figure 10). Whole cell extract of fibroblast cells (Bud8) treated with IFN-7 were prepared and subjected to sedimentation through a 10-40% glycerol gradient. Fractions from the gradient were collected and analyzed by both immunoblotting and gel mobility shift analysis (Figure 10A and 10B). As expected, two electrophoretic forms of Stat91 could be detected by immunoblotting (Figure 10A): the slow-migrating form (tyrosine phosphorylated) and the fast-migrating form (unphosphorylated; Figure 10A). The phosphorylated Stat91 sedimented more rapidly than the unphosphorylated form. Again, using molecular weight markers, the native molecular weight of the unphosphorylated form of Stat91 appeared to be about 90 kD while the tyrosine phosphorylated form of Stat91 was about 180kD (Figure 10C), supporting the conclusion that unphosphorylated Stat91 existed as a monomer in solution while the tyrosine phosphorylated form exists as a dimer. When fractions from the glycerol gradients were analyzed by electrophoretic mobility shift analysis (Figure 10B), the peak of the phosphorylated form of Stat91 correlated well with the DNA-binding activity of Stat91. Thus only the phosphorylated dimer ic Stat91 has the sequence-specific DNA recognition capacity.

Stat91 Binds DNA as a Dimer. Long or short versions of DNA binding protein can produce, respectively, a slower or a faster migrating band during gel retardation assays. Finding intermediate gel shift bands produced by mixing two different sized species provides evidence of dimerization of the DNA binding proteins. Since Stat91 requires specific tyrosine phosphorylation in ligand-treated cells for its DNA binding, we sought evidence of formation of such heterodimers, first in transfected cells. An expression vector (MNC911) encoding Stat91L, a recombinant form of Stat91 containing an additional 34 amino acid carboxyl terminal tag was generated. [The extra amino acids were encoded by a segment of DNA sequence from plasmid pMNC (see Materials and Methods).] A Stat84 expression vector (MNC84) was also available (45). From somatic cell genetic experiments, mutant human cell lines (U3) are known that lack the Stat91/84 mRNA and proteins (29,30). The U3 cells were therefore separately transfected with vectors encoding Stat84 (MNC84) or Stat91L (MNC91L) or a mixture of both vectors. Permanent transfectants expressing Stat84 (C84), Stat91L (C91L) or both proteins (Cmx) were isolated (Figure 11 A).

Mobility shift analysis was performed with extracts from these stable cell lines (Figure 1 IB). Extracts of IFN-γ-treated C84 cells produced a faster migrating gel shift band than extracts of treated C91L cells. Most importantly, extracts from IFN-7-treated Cmx cells expressing both Stat84 and Stat91L proteins formed an additional intermediate gel shift band. Anti-91 , an antiserum against the C- terminal 38 amino acids of Stat91 (12) that are absent in Stat84, specifically removed the top two shift bands seen with the Cmx extracts. Anti-91, an antiserum against amino acids 609 to 716 (15) that recognizes both Stat91L and Stat84, proteins inhibited the binding of all three shift bands. Thus, the middle band formed by extracts of the Cmx cells is clearly identified as a heterodimer of Stat84 and Stat91L. We concluded that both Stat91 and Stat84 bind DNA as homodimers and, if present in the same cell, will form heterodimers.

We next wanted to detect the formation of dimers in vitro. When cytoplasmic or nuclear extracts of IFN-7-treated C84 or C91L cells were mixed and analyzed (Figure 12), only the fast or slow migrating gel shift bands were observed. Thus it appeared that once formed in vivo, the dimers were stable. To promote the formation of protein interchange between the subunits of the dimer, a mixture of either cytoplasmic or nuclear extracts of IFN-7-treated C84 or C91L cells were subjected mild denaturation-renaturation treatment: extracts were made 0.5 M with respect to guanidium hydrochloride for two minutes and then diluted for renaturation and subsequently used for gel retardation analysis. The formation of heterodimer was clearly detected after this treatment. When extracts from either C84 cells alone or C91L cells alone were subjected to the same treatment, the intermediate band did not form. The intermediate band was again proven by antiserum treatment to consist of Stat84/Stat91L dimer (data not shown).

This experiment defined conditions under which the dimer was stable, but also showed that dissociation and reassociation of the dimer in vitro was possible. Since guanidium hydrochloride is known to disrupt only non-covalent chemical bonds, it seemed that Stat91 (or Stat84) homodimerization was mediated through non-covalent interactions.

Dimerization of Stat91 Involves Phosphotyrosyl Peptide and SH2 Interactions. Based on the results described above, we devised a dissociation-reassociation assay in the absence of guanidium hydrochloride to explore the possible nature of interactions involved in dimer formation (Figure 13). When the short and the long forms of a homodimer are mixed with a dissociating agent (e.g. , a peptide containing the putative dimerization domain), the subunits of the dimer should dissociate (in a concentration dependent fashion) due to the interaction of the agent with the dimerization domain(s) of the protein. When a specific DNA probe is subsequently added to the mixture to drive the formation of a stable protein^'-DNA complex, the detection of any reassociated or remaining dimers can be assayed. In the presence of low concentration of the dissociating agent, addition of DNA to form the stable protein-DNA complex should lead to the detection of homodimers as well as heterodimers. At high concentration of the dissociating agent, subunits- of the dimer may not be able to re-form and no DNA-protein complexes would be detected (Figure 13). The Stat91 sequence contains an SH2 domain (amino acids 569 to 700, see discussion below), and we knew that Tyr-701 was the single phosphorylated tyrosine residue required for DNA binding activity (supra, 45). Furthermore, we have observed that phosphotyrosine at 10 mM, but not phosphoserine or phosphothreonine, could prevent the formation of Stat91-DNA complex. We therefore sought evidence that the dimerization of Stat91 involved specific SH2- phosphotyrosine interaction using the dissociation and reassociation assay.

In order to evaluate the role of the SH2-phosphotyrosine in dimerization, two peptides fragments of Stat91 corresponding to segments of the SH2 and phosphotyrosing domains of Stat91 were prepared: a non-phosphorylated peptide (91 Y), LDGPKGTGYIKTELI (SEQ ID NO: 15) (corresponding to amino acids 693-707), and a phosphotyrosyl peptide (91Y-p), GY*IKTE (SEQ ID NO: 16) (representing residues 700-705).

Activated Stat84 or Stat91L was obtained from IFN-7-treated C84 or C91L cells and mixed in the presence of various concentrations of the peptides followed by gel mobility shift analysis. The non-phosphorylated peptide had no effect on the presence of the two gel shift bands characteristic of Stat84 or Stat91L homodimers (Figure 14, lane 2-4). In contrast, the phosphorylated peptide (91Y-p) at the concentration of 4 μM clearly promoted the exchange between the subunits of Stat84 dimers and Stat91L dimers to form heterodimers (Figure 14. lane 5). At a higher concentration (160 μM), peptide 91Y-p but not the unphosphorylated peptide dissociated the dimers and blocked the formation of DNA protein complexes (Figure 14, lane 7).

When cells are treated with IFN-α both Stat91 (or 84) and Statl 13 become phosphorylated (15). Antiserum to Statl 13 can precipitate both Statl 13 and Stat91 after IFN-α-treatment but not before, suggesting IFN-α dependent interaction of these two proteins, perhaps as a heterodimer (15). In Statl 13, tyr-690 in the homologous position to Tyr-701 in Stat91 is the single target residue for phosphorylation. Amino acids downstream of the affected tyrosine residue show some homology between the two proteins. We therefore prepared a phosphotyrosyl peptide of Statl 13 (113Y-p), KVNLQERRKY*LKHR (SEQ ID NO: 17) [amino acids 681 to 694; (38)]. At concentrations similar to 91Y-p, 113Y-p also promoted the exchange of subunits between the Stat84 and Stat91L, while at a high concentration (40μM), 113Y-p prevented the gel shift bands almost completely (Figure 14, lane 8-10).

We prepared a phosphotyrosyl peptide (SrcY-p), EPQY*EEIPIYL (SEQ ID

NO: 18) which is known to interact with the Src SH2 domain with a high affinity (50). This peptide showed no effect on the Stat91 dimer formation (Figure 14, lane 11-13). Thus, it seems that Stat91 dimerization involves SH2 interaction with tyrosine residues in specific peptide sequence.

To test further the specificity of Stat91 dimerization mediated through specific- phosphotyrosyl-peptide SH2 interaction, a fusion product of glutathione-S- transferase with the Stat91-SH2 domain (GST-91SH2) was prepared (Figure 15A) and used in the in vitro dissociation reassociation assay. At concentrations of 0.5 to 5 μM, the Stat91-SH2 domain promoted the formation of a heterodimer (Figure 15B, lanes 5-7). In contrast, neither GST alone, nor fusion products with a mutant (R⁶⁰²- > L⁶⁰²) Stat91-SH2 domain (GST 91mSH2) that renders Stat91 non¬ functional in vivo, a Stat91 SH3 domain (GST-91SH3), nor the Src SH2 domain (GST-SrcSH2), induced the exchange of subunits between the Stat84 and Stat91L homodimers (Figure 15B).

Discussion

The initial sequence analysis of the Stat91 and Statl 13 proteins revealed the presence of SH2 like domains (see 13,38). Further it was found that STAT proteins themselves are phosphorylated on single tyrosine residues during their activation (15,31). Single amino acid mutations either removing the Stat91 phosphorylation site, Tyr-701 , or converting Arg-702 to Leu in the highly conserved "pocket" region of the SH2 domain abolished the activity of Stat91 (45). Thus it seemed highly likely that one possible role of the STAT SH2 domains would be to bind the phosphotyrosine residues in one of the JAK kinases.

Since the activated STATs have phosphotyrosine residues and SH2 domains, a second suggested role for SH2 domains was in protein-protein interactions within the STAT family. By two physical criteria — electrophoresis in native gels and sedimentation on gradients ~ Stat91 in untreated cells is a monomer and in treated cells is a dimer (Figures 9-11). Since phosphotyrosyl peptides from Stat91 or Statl 13 and the SH2 domain of Stat91 could efficiently promote the formation of heterodimers between Stat91L and Stat84 in a disassociation and reassociation assay, we conclude that dimerization of Stat91 involves SH2-phosphotyrosyl peptide interactions.

The possibility of an SH2 domain in Stat91 was indicated initially by the presence of highly conserved amino acid stretches between the Stat91 and Statl 13 sequences in the 569 to 700 residue region, several of which, especially the FLLR sequence in the amino terminal end of the region, are characteristic of -SH2 domains. The C-terminal half of the SH2 domains are less well conserved in general (39); this was also true for the STAT proteins compared to other proteins, although Stat91 and Statl 13 are quite similar in this region (38, 13, Figure 16). The available structures of lck, src, abl, and p85a SH2's permit identification of structurally conserved regions (SCR's), and detailed alignment of amino acid sequences of several proteins (Figure 16) is based on these.

The characteristic W (in βAl) is preceded by hydrophilic residues and is followed by hydrophobic residues in Stat91, but alignment to the W seems justified, even if the small beta sheet of which the W is part is shifted in Stat91. The three positively charged residues contributing to the phosphotyrosyl binding site are at the positions indicated as alphaA2, betaB5, and betaD5. Figure 16 shows an alignment which accomplishes this by insertions in the 'AA' and 'CD' regions. This is a different alignment from that previously suggested (38), and gives a satisfactory alignment in the (beta)D region, although, like the previous alignment, it is obviously considerably less similar to the other SH2's in the C-terminus.

This alignment suggests that the SH2 domain in the Stat91 would end in the vicinity of residue 700. In such an alignment, the Tyr-701 occurs almost immediately after the SH2 domain: a distance too short to allow an intramolecular phosphotyrosine -SH2 interaction. Since the data presented earlier strongly implicate that an SH2-phosphotyrosine interaction is involved in dimerization, such an interaction is likely to be between two phospho Stat91 subunits as a reciprocal pTyr -SH2 interaction.

The apparent stability of Stat91 dimer may be due to a high association rate coupled with a high dissociation rate of SH2-phosphotyrosyl peptide interactions as suggested (Felder et al. , 1993, Mol. Cell Biol. 13: 1449-1455) coupled with interactions between other domains of Stat91 that may contribute stability to the Stat91 dimer. Interference by homologous phosphopeptides with the -SH2- phosphotyrosine interaction would then lower stability sufficiently to allow complete dissociation and heterodimerization.

The dimer formation between phospho Stat91 is the first case in eukaryotes where dimer formation is regulated by phosphorylation, and the only one thus far dependent on tyrosine phosphorylation. We anticipate that dimerization with the STAT protein family will be important. It seems likely that in cells treated with IFN-α, there is Statl 13-Stat91 interaction (15). This may well be mediated through SH2 and phosphotyrosyl peptide interactions as described above, leading to a complex (a probable dimer of Stat91 -Statl 13) which joins with a 48 kD DNA binding protein (a member of another family of DNA binding factors) to make a complex capable of binding to a different DNA site. Furthermore, two mouse cDNAs which encode other STAT family members that have conserved the same general structure features observed in the Stat91 and Statl 13 molecules have recently been cloned (see Example 2, Supra). Thus the specificity of STAT- containing complexes will almost surely be affected by which proteins are phosphorylated and then available for dimer formation.

The following is a list of references related to the above disclosure and particularly to the experimental procedures and discussions. The references are numbered to correspond to like number references that appear hereinabove.

1. Larner, A. C, Jonak, G., Cheng, Y. S. , Korant, B. , Knight, E. and Darnell, J. E., Jr. (1984). Proc. Nad. Acad. Sci. USA 81:6733-6737; Larner, A. C , Chaudhuri, A. and Darnell, J. E. (1986). J. Biol. Chem. 261:453-459.

2. Friedman, R. L. , Manly, S. P. , McMahon, M., Kerr, I. M. and Stark, G. R. (1984). Cell 38:745-755.

3. Levy, D. E., Kessler, D. S., Pine, R., Reich, N. and Darnell, J. E. (1988). Genes & Dev. 2:383-392.

4. Levy, D. E., Kessler, D. S., Pine, R., and Darnell, J. E. (1989). Genes & Dev. 3: 1362-1371.

5. Dale, T. C, Iman, A. M. A., Kerr, I. M. and Stark, G. R. (1989): Proc. Natl. Acad. Sci. 86: 1203-1207.

6. Kessler, D. S., Veals, S. A. , Fu, X.-Y.. and Levy, D. E. (1990). Genes & Dev. 4: 1753-1765. 7. Fu, X. -Y. , Kessler, D. S. , Veals, S. A., Levy, D. E. and Darnell, J. E. (1990). Proc. Natl. Acad. Sci. USA 87:8555-8559.

8. Lew, D. J. , Decker, T. , and Darnell, J. E. (1989). Mol. Cell. Biol. 9:5404-5411.

9. Decker, T. , Lew, D. J. , Cheng, Y.-S. , Levy, D. E. and Darnell, J. E. (1989). EMBO J. 8:2009-2014.

10. Decker, T., Lew, D. J., Mirkovitch, J. and Darnell, J. E. , 1991. EMBO J. 10:927-932.

11. Veals, S. A., Schindler, C. W. , Fu, X.-Y., Leonard, D. , Darnell, J. E. and Levy, D. E. (1992). Mol. Cell. Biol. 12.

12. Schindler, C, Fu, X.-Y., Improta, T., Aebersold, R. and Darnell, J. E. (1992). Proc. Natl. Acad. Sci. USA 89:7836-7389.

13. Fu, X.-Y., Schindler, C , Improta, T. , Aebersold, R. and Darnell, J. E. (1992). Proc. Natl. Acad. Sci. USA 89:7840-7389.

14. Lew, D. J. , Decker, T. and Darnell, J. E. (1991). Mol. Cell. Biol. 11: 182-191.

15. Schindler, C, Shuai, K., Fu, X.-Y. , Prezioso, V. and Darnell, J. E. (1992). Science 257:809-812.

16. Garner, M. M. and Revan, A. (1981). Nuc. Acids Res. 9:3047-3059; Fried, A., and Crothers, D. M. (1981) ibid 6505-6525. 17. Celis, J. E., Justessen, J. , Madsun, P. S., Lovmand, J. , Ratz, G. P. and Celis, A. (1987). Leukemia 1:800-813.

18. Chodosh, L. A. , Carthew, R. W. and Sharp, P. A. (1986). Mol. Cell Biol. 6:4723-4733.

19. Reich, N. and Pfeffer, L. M. (1990). Proc. Natl. Acad. Sci. USA 87:8761-8765.

20. Kessler, D. S. and Levy, D. (1991). J. Biol. Chem. 266: 23471-23476.

21. Levy, D., and Darnell, J. E. (1990). The New Biologist 2:r)2→\-9Υ&.

22. Aguet, J. M., Denbie, Z. and Merlin, G. (1986). Cell 55:273-280.

23. Kaplan, D. R. , Martin-Zanca, D. and Parada, L. F. (1991). Nature 350: 158-160; Hempstead, G., Kapland, D., Martin-Zanca, D. , Parada, L. F. and Chao, M. (1991). Nature 350:678-683.

24. Veillette, A.. Bookman, M. A.. Horak, E. M., and Bolen, J. B. (1988). Cell 55:301-308; Rudd, C. E. et al. (1988). Proc. Natl. Acad. Sci. USA 85:5190-5194.

25. Evans, R. K., Johnson, J. D. and Haley, B. E. (1986). Proc. Natl. Acad. Sci. USA 83:5382-5386.

26. Walaas, S. I. and Nairn, A. C. (1989). J. of Mol. Neurosci. 1: 117-127.

28. Pellegrini, S. , John, J., Shearer, M., Kerr, I.M. , and Stark, G.R. (1989).- Mol. Cell. Biol. 9:4605. 29. McKendry, R. et al. (1991). Proc. Natl. Acad. Sci. U.S.A. 88: 11455.

30. Muller, M. et al. (1993), EMBO. J.

31. Shuai, K. , Schindler, C, Prezioso, V., and Darnell, J.E., Jr. (1992). Science 258: 1808.

32. Boyle, W.J., van der Geer, and Hunter, T. (1991). Methods Enzymol. 202: 110.

33. Walaas, S.I. , and Nairn, A.C. (1989). J. Mol. Neurosci. 1: 117.

34. Khan, K.D. et al. (1993). Proc. Natl. Acad. Sci. U.S.A. 90:6806.

35. Qufeshi, S.A. et al. (1991). J. Biol. Chem. 266:20594.

36. Kawasaki, E. , (1990). In PRC Protco Is: A Guide to Methods and Applications. Innis, M., Gelfand, D., Sinisky, J., & White, T., Eds. (San Diego, CA: Academic Press), p. 119.

37. Brasier, A.R. , Tata, J.E., and Habener. J.F. (1989). Biotechniques 7:1116.

38. Fu, X.-Y. (1992). Cell 70:323-335.

39. Koch, C.A. , Anderson, D. Moran, M.F. , Ellis, C. and Pawson, T. (1991). Science 252:668-674.

40. Waksman, G. et al. (1992). Nature 358:646-653. 41. Overduin, M. Rios, C.B., Mayer, B.J. , Baltimore, D. and Cowburn, D. (1992). Cell 70:697-704.

42. Velazquez et al. (1992). Cell 70:313.

43. Muller et al. (1993). Nature 366: 129-135.

44. Watling et al. (1993). Nature 366: 166.

45. Shuai, K. , Stark, G.R. , Kerr, I. M. , and Darnell, J.E. (1993). Science

261 : 1744.

46. Dignam et al. (1983). Nucl. Acids Res. 11: 1475.

47. Davis, B.J. (1964). Ann. N Y. Acad. Sci. 121:404.

48. Bryan, J.K. (1977). Anal. Biochem. 78:513.

49. Amster-Choder, O. and Wright, A. (1992). Science 257:1395.

50. Songyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W.G., King, F., Roberts, T., Ratnofsky, et al. (1993). Cell 72:767.

This invention may be embodied in other forms or carried out in other way^'s without departing from the spirit or essential characteristics thereof. The present disclosure is therefore to be considered as in all respects illustrative and not restrictive, the scope of the invention being indicated by the appended Claims, and all changes which come within the meaning and range of equivalency are intended to be embraced therein. SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: The Rockefeller University

(ii) TITLE OF INVENTION: RECEPTOR RECOGNITION FACTORS, PROTEIN SEQUENCES AND METHODS OF USE THEREOF

(iii) NUMBER OF SEQUENCES: 22

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Klauber & Jackson

(B) STREET: 11 Hackensack Avenue

(C) CITY: Hackensack

(D) STATE: New Jersey

(E) COUNTRY: USA

(F) ZIP: 07601

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: WO not yet assigned

(B) FILING DATE: 26-SEP-1994

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/212,185

(B) FILING DATE: ll-MAR-1994

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/212,184

(B) FILING DATE: 11-MAR-1994

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/126,588

(B) FILING DATE: 24-SEP-1993

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/126,595

(B) FILING DATE: 24-SEP-1993

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Jackson Esq., David A.

(B) REGISTRATION NUMBER: 26,742

(C) REFERENCE/DOCKET NUMBER: 600-1-073 PCT

(ix) TELECOMMUNICATION INFORMATION: (A) ^"TELEPHONE: 201 487-5800

(B) TELEFAX: 201 343-1684

(C) TELEX: 133521

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3268 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: both

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens

(vii) IMMEDIATE SOURCE:

(B) CLONE: HeLa

(ix) FEATURE:

(A) NAME/KEY: CDS

<B) LOCATION: 25..2577

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

ACTGCAACCC TAATCAGAGC CCAA ATG GCG CAG TGG GAA ATG CTG CAG AAT 51

Met Ala Gin Trp Glu Met Leu Gin Asn 1 5

CTT GAC AGC CCC TTT CAG GAT CAG CTG CAC CAG CTT TAC TCG CAC AGC 99 Leu Asp Ser Pro Phe Gin Asp Gin Leu His Gin Leu Tyr Ser His Ser 10 15 20 25

CTC CTG CCT GTG GAC ATT CGA CAG TAC TTG GCT GTC TGG ATT GAA GAC 147 Leu Leu Pro Val Asp lie Arg Gin Tyr Leu Ala Val Trp lie Glu Asp 30 35 40

CAG AAC TGG CAG GAA GCT GCA CTT GGG AGT GAT GAT TCC AAG GCT ACC 195 Gin Asn Trp Gin Glu Ala Ala Leu Gly Ser Asp Asp Ser Lys Ala Thr 45 50 55

ATG CTA TTC TTC CAC TTC TTG GAT CAG CTG AAC TAT GAG TGT GGC CGT 243 Met Leu Phe Phe His Phe Leu Asp Gin Leu Asn Tyr Glu Cys Gly Arg 60 65 70

TGC AGC CAG GAC CCA GAG TCC TTG TTG CTG CAG CAC AAT TTG CGG AAA 291 Cys Ser Gin Asp Pro Glu Ser Leu Leu Leu Gin His Asn Leu Arg Lys 75 80 85

TTC TGC CGG GAC ATT CAG CCC TTT TCC CAG GAT CCT ACC CAG TTG GCT 339 Phe Cys Arg Asp lie Gin Pro Phe Ser Gin Asp Pro Thr Gin Leu Ala 90 95 100 105

GAG ATG ATC TTT AAC CTC CTT CTG GAA GAA AAA AGA ATT TTG ATC CAG 387 Glu Met lie Phe Asn Leu Leu Leu Glu Glu Lys Arg lie Leu lie Gin 110 115 120

GCT CAG AGG GCC CAA TTG GAA CAA GGA GAG CCA GTT CTC GAA ACA CCT 435 Ala Gin Arg Ala Gin Leu Glu Gin Gly Glu Pro Val Leu Glu Thr Pro 125 130 135

GTG GAG AGC CAG CAA CAT GAG ATT GAA TCC CGG ATC CTG GAT TTA AGG 483 Val Glu Ser Gin Gin His Glu lie Glu Ser Arg lie Leu Asp Leu Arg 140 145 150

GCT ATG ATG GAG AAG CTG GTA AAA TCC ATC AGC CAA CTG AAA GAC CAG 531 Ala Met Met Glu Lys Leu Val Lys Ser lie Ser Gin Leu Lys Asp Gin 155 160 165

CAG GAT GTC TTC TGC TTC CGA TAT AAG ATC CAG GCC AAA GGG AAG ACA . 579 Gin Asp Val Phe Cys Phe Arg Tyr Lys lie Gin Ala Lys Gly Lys Thr 170 175 180 185 CCC TCT CTG GAC CCC CAT CAG ACC AAA GAG CAG AAG ATT CTG CAG GAA 627

Pro Ser Leu Asp Pro His Gin Thr Lys Glu Gin Lys He Leu Gin Glu 190 195 200

ACT CTC AAT GAA CTG GAC AAA AGG AGA AAG GAG GTG CTG GAT GCC TCC 675

Thr Leu Asn Glu Leu Asp Lys Arg Arg Lys Glu Val Leu Asp Ala Ser 205 210 215

AAA GCA CTG CTA GGC CGA TTA ACT ACC CTA ATC GAG CTA CTG CTG CCA 723

Lys Ala Leu Leu Gly Arg Leu Thr Thr Leu He Glu Leu Leu Leu Pro 220 225 230

AAG TTG GAG GAG TGG AAG GCC CAG CAG CAA AAA GCC TGC ATC AGA GCT 771

Lys Leu Glu Glu Trp Lys Ala Gin Gin Gin Lys Ala Cys He Arg Ala 235 240 245

CCC ATT GAC CAC GGG TTG GAA CAG CTG GAG ACA TGG TTC ACA GCT GGA 819

Pro He Asp His Gly Leu Glu Gin Leu Glu Thr Trp Phe Thr Ala Gly

250 255 260 265

GCA AAG CTG TTG TTT CAC CTG AGG CAG CTG CTG AAG GAG CTG AAG GGA 867

Ala Lys Leu Leu Phe His Leu Arg Gin Leu Leu Lys Glu Leu Lys Gly 270 275 280

CTG AGT TGC CTG GTT AGC TAT CAG GAT GAC CCT CTG ACC AAA GGG GTG 915

Leu Ser Cys Leu Val Ser Tyr Gin Asp Asp Pro Leu Thr Lys Gly Val 285 290 295

GAC CTA CGC AAC GCC CAG GTC ACA GAG TTG CTA CAG CGT CTG CTC CAC 963

Asp Leu Arg Asn Ala Gin Val Thr Glu Leu Leu Gin Arg Leu Leu His 300 305 310

AGA GCC TTT GTG GTA GAA ACC CAG CCC TGC ATG CCC CAA ACT CCC CAT 1011

Arg Ala Phe Val Val Glu Thr Gin Pro Cys Met Pro Gin Thr Pro His 315 320 325

CGA CCC CTC ATC CTC AAG ACT GGC AGC AAG TTC ACC GTC CGA ACA AGG 1059

Arg Pro Leu He Leu Lys Thr Gly Ser Lys Phe Thr Val Arg Thr Arg

330 335 340 345

CTG CTG GTG AGA CTC CAG GAA GGC AAT GAG TCA CTG ACT GTG GAA GTC 1107

Leu Leu Val Arg Leu Gin Glu Gly Asn Glu Ser Leu Thr Val Glu Val 350 355 360

TCC ATT GAC AGG AAT CCT CCT CAA TTA CAA GGC TTC CGG AAG TTC AAC 1155

Ser He Asp Arg Asn Pro Pro Gin Leu Gin Gly Phe Arg Lys Phe Asn 365 370 375

ATT CTG ACT TCA AAC CAG AAA ACT TTG ACC CCC GAG AAG GGG CAG AGT 1203

He Leu Thr Ser Asn Gin Lys Thr Leu Thr Pro Glu Lys Gly Gin Ser 380 385 390

CAG GGT TTG ATT TGG GAC TTT GGT TAC CTG ACT CTG GTG GAG CAA CGT 1251

Gin Gly Leu He Trp Asp Phe Gly Tyr Leu Thr Leu Val Glu Gin Arg 395 400 405

TCA GGT GGT TCA GGA AAG GGC AGC AAT AAG GGG CCA CTA GGT GTG ACA 1299

Ser Gly Gly Ser Gly Lys Gly Ser Asn Lys Gly Pro Leu Gly Val Thr

410 415 420 425

GAG GAA CTG CAC ATC ATC AGC TTC ACG GTC AAA TAT ACC TAC CAG GGT ^" 1347

Glu Glu Leu His He He Ser Phe Thr Val Lys Tyr Thr Tyr Gin Gly 430 435 440

CTG AAG CAG GAG CTG AAA ACG GAC ACC CTC CCT GTG GTG ATT ATT TCC 1395

Leu Lys Gin Glu Leu Lys Thr Asp Thr Leu Pro Val Val He He Ser 445 450 455 AAC ATG AAC CAG CTC TCA ATT GCC TGG GCT TCA GTT CTC TGG TTC AAT 1443 Asn Met Asn Gin Leu Ser He Ala Trp Ala Ser Val Leu Trp Phe Asn 460 465 470

TTG CTC AGC CCA AAC CTT CAG AAC CAG CAG TTC TTC TCC AAC CCC CCC 1491 Leu Leu Ser Pro Asn Leu Gin Asn Gin Gin Phe Phe Ser Asn Pro Pro 475 480 485

AAG GCC CCC TGG AGC TTG CTG GGC CCT GCT CTC AGT TGG CAG TTC TCC 1539 Lys Ala Pro Trp Ser Leu Leu Gly Pro Ala Leu Ser Trp Gin Phe Ser 490 495 500 505

TCC TAT GTT GGC CGA GGC CTC AAC TCA GAC CAG CTG AGC ATG CTG AGA 1587 Ser Tyr Val Gly Arg Gly Leu Asn Ser Asp Gin Leu Ser Met Leu Arg 510 515 520

AAC AAG CTG TTC GGG CAG AAC TGT AGG ACT GAG GAT CCA TTA TTG TCC 1635 Asn Lys Leu Phe Gly Gin Asn Cys Arg Thr Glu Asp Pro Leu Leu Ser 525 530 535

TGG GCT GAC TTC ACT AAG CGA GAG AGC CCT CCT GGC AAG TTA CCA TTC 1683 Trp Ala Asp Phe Thr Lys Arg Glu Ser Pro Pro Gly Lys Leu Pro Phe 540 545 550

TGG ACA TGG CTG GAC AAA ATT CTG GAG TTG GTA CAT GAC CAC CTG AAG 1731 Trp Thr Trp Leu Asp Lys He Leu Glu Leu Val His Asp His Leu Lys 555 560 565

GAT CTC TGG AAT GAT GGA CGC ATC ATG GGC TTT GTG AGT CGG AGC CAG 1779 Asp Leu Trp Asn Asp Gly Arg He Met Gly Phe Val Ser Arg Ser Gin 570 575 580 585

GAG CGC CGG CTG CTG AAG AAG ACC ATG TCT GGC ACC TTT CTA CTG CGC 1827 Glu Arg Arg Leu Leu Lys Lys Thr Met Ser Gly Thr Phe Leu Leu Arg 590 595 600

TTC AGT GAA TCG TCA GAA GGG GGC ATT ACC TGC TCC TGG GTG GAG CAC 1875 Phe Ser Glu Ser Ser Glu Gly Gly He Thr Cys Ser Trp Val Glu His 605 610 615

CAG GAT GAT GAC AAG GTG CTC ATC TAC TCT GTG CAA CCG TAC ACG AAG 1923 Gin Asp Asp Asp Lys Val Leu He Tyr Ser Val Gin Pro Tyr Thr Lys 620 625 630

GAG GTG CTG CAG TCA CTC CCG CTG ACT GAA ATC ATC CGC CAT TAC CAG 1971 Glu Val Leu Gin Ser Leu Pro Leu Thr Glu He He Arg His Tyr Gin 635 640 645

TTG CTC ACT GAG GAG AAT ATA CCT GAA AAC CCA CTG CGC TTC CTC TAT 2019 Leu Leu Thr Glu Glu Asn He Pro Glu Asn Pro Leu Arg Phe Leu Tyr 650 655 660 665

CCC CGA ATC CCC CGG GAT GAA GCT TTT GGG TGC TAC TAC CAG GAG AAA 2067 Pro Arg He Pro Arg Asp Glu Ala Phe Gly Cys Tyr Tyr Gin Glu Lys 670 675 680

GTT AAT CTC CAG GAA CGG AGG AAA TAC CTG AAA CAC AGG CTC ATT GTG 2115 Val Asn Leu Gin Glu Arg Arg Lys Tyr Leu Lys His Arg Leu He Val 685 690 695

GTC TCT AAT AGA CAG GTG GAT GAA CTG CAA CAA CCG CTG GAG CTT AAG 2163 Val Ser Asn Arg Gin Val Asp Glu Leu Gin Gin Pro Leu Glu Leu Lys 700 705 710

CCA GAG CCA GAG CTG GAG TCA TTA GAG CTG GAA CTA GGG CTG GTG CCA 2211 Pro Glu Pro Glu Leu Glu Ser Leu Glu Leu Glu Leu Gly Leu Val Pro 715 720 725 GAG CCA GAG CTC AGC CTG GAC TTA GAG CCA CTG CTG AAG GCA GGG CTG 2259 Glu Pro Glu Leu Ser Leu Asp Leu Glu Pro Leu Leu Lys Ala Gly Leu 730 735 740 745

GAT CTG GGG CCA GAG CTA GAG TCT GTG CTG GAG TCC ACT CTG GAG CCT 2307 Asp Leu Gly Pro Glu Leu Glu Ser Val Leu Glu Ser Thr Leu Glu Pro 750 755 760

GTG ATA GAG CCC ACA CTA TGC ATG GTA TCA CAA ACA GTG CCA GAG CCA 2355 Val He Glu Pro Thr Leu Cys Met Val Ser Gin Thr Val Pro Glu Pro 765 770 775

GAC CAA GGA CCT GTA TCA CAG CCA GTG CCA GAG CCA GAT TTG CCC TGT 2403 Asp Gin Gly Pro Val Ser Gin Pro Val Pro Glu Pro Asp Leu Pro Cys 780 785 790

GAT CTG AGA CAT TTG AAC ACT GAG CCA ATG GAA ATC TTC AGA AAC TGT 2451 Asp Leu Arg His Leu Asn Thr Glu Pro Met Glu He Phe Arg Asn Cys 795 800 805

GTA AAG ATT GAA GAA ATC ATG CCG AAT GGT GAC CCA CTG TTG GCT GGC 2499 Val Lys He Glu Glu He Met Pro Asn Gly Asp Pro Leu Leu Ala Gly 810 815 820 825

CAG AAC ACC GTG GAT GAG GTT TAC GTC TCC CGC CCC AGC CAC TTC TAC 2547 Gin Asn Thr Val Asp Glu Val Tyr Val Ser Arg Pro Ser His Phe Tyr 830 835 840

ACT GAT GGA CCC TTG ATG CCT TCT GAC TTC TAGGAACCAC ATTTCCTCTG 2597 Thr Asp Gly Pro Leu Met Pro Ser Asp Phe 845 850

TTCTTTTCAT ATCTCTTTGC CCTTCCTACT CCTCATAGCA TGATATTGTT CTCCAAGGAT 2657

GGGAATCAGG CATGTGTCCC TTCCAAGCTG TGTTAACTGT TCAAACTCAG GCCTGTGTGA 2717

CTCCATTGGG GTGAGAGGTG AAAGCATAAC ATGGGTACAG AGGGGACAAC AATGAATCAG 2777

AACAGATGCT GAGCCATAGG TCTAAATAGG ATCCTGGAGG CTGCCTGCTG TGCTGGGAGG 2837

TATAGGGGTC CTGGGGGCAG GCCAGGGCAG TTGACAGGTA CTTGGAGGGC TCAGGGCAGT 2897

GGCTTCTTTC CAGTATGGAA GGATTTCAAC ATTTTAATAG TTGGTTAGGC TAAACTGGTG 2957

CATACTGGCA TTGGCCTTGG TGGGGAGCAC AGACACAGGA TAGGACTCCA TTTCTTTCTT 3017

CCATTCCTTC ATGTCTAGGA TAACTTGCTT TCTTCTTTCC TTTACTCCTG GCTCAAGCCC 3077

TGAATTTCTT CTTTTCCTGC AGGGGTTGAG AGCTTTCTGC CTTAGCCTAC CATGTGAAAC 3137

TCTACCCTGA AGAAAGGGAT GGATAGGAAG TAGACCTCTT TTTCTTACCA GTCTCCTCCC 3197

CTACTCTGCC CCCTAAGCTG GCTGTACCTG TTCCTCCCCC ATAAAATGAT CCTGCCAATC 3257

TAAAAAAAAA A 3268

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 851 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Ala Gin Trp Glu Met Leu Gin Asn Leu Asp Ser Pro Phe Gin Asp 1 5 10 15

Gin Leu His Gin Leu Tyr Ser His Ser Leu Leu Pro Val Asp He Arg 20 25 30

Gin Tyr Leu Ala Val Trp He Glu Asp Gin Asn Trp Gin Glu Ala Ala 35 40 45

Leu Gly Ser Asp Asp Ser Lys Ala Thr Met Leu Phe Phe His Phe Leu 50 55 60

Asp Gin Leu Asn Tyr Glu Cys Gly Arg Cys Ser Gin Asp Pro Glu Ser 65 70 75 80

Leu Leu Leu Gin His Asn Leu Arg Lys Phe Cys Arg Asp He Gin Pro 85 90 95

Phe Ser Gin Asp Pro Thr Gin Leu Ala Glu Met He Phe Asn Leu Leu 100 105 110

Leu Glu Glu Lys Arg He Leu He Gin Ala Gin Arg Ala Gin Leu Glu 115 120 125

Gin Gly Glu Pro Val Leu Glu Thr Pro Val Glu Ser Gin Gin His Glu 130 135 140

He Glu Ser Arg He Leu Asp Leu Arg Ala Met Met Glu Lys Leu Val 145 150 155 160

Lys Ser He Ser Gin Leu Lys Asp Gin Gin Asp Val Phe Cys Phe Arg 165 170 175

Tyr Lys He Gin Ala Lys Gly Lys Thr Pro Ser Leu Asp Pro His Gin 180 185 190

Thr Lys Glu Gin Lys He Leu Gin Glu Thr Leu Asn Glu Leu Asp Lys 195 200 205

Arg Arg Lys Glu Val Leu Asp Ala Ser Lys Ala Leu Leu Gly Arg Leu 210 215 220

Thr Thr Leu He Glu Leu Leu Leu Pro Lys Leu Glu Glu Trp Lys Ala 225 230 235 240

Gin Gin Gin Lys Ala Cys He Arg Ala Pro He Asp His Gly Leu Glu 245 250 255

Gin Leu Glu Thr Trp Phe Thr Ala Gly Ala Lys Leu Leu Phe His Leu 260 265 270

Arg Gin Leu Leu Lys Glu Leu Lys Gly Leu Ser Cys Leu Val Ser Tyr 275 280 285

Gin Asp Asp Pro Leu Thr Lys Gly Val Asp Leu Arg Asn Ala Gin Val 290 295 300

Thr Glu Leu Leu Gin Arg Leu Leu His Arg Ala Phe Val Val Glu Thr 305 310 315 320

Gin Pro Cys Met Pro Gin Thr Pro His Arg Pro Leu He Leu Lys Thr 325 330 335

Gly Ser Lys Phe Thr Val Arg Thr Arg Leu Leu Val Arg Leu Gin Glu 340 345 350

Gly Asn Glu Ser Leu Thr Val Glu Val Ser He Asp Arg Asn Pro Pro 355 360 365

Gin Leu Gin Gly Phe Arg Lys Phe Asn He Leu Thr Ser Asn Gin Lys 370 375 380

Thr Leu Thr Pro Glu Lys Gly Gin Ser Gin Gly Leu He Trp Asp Phe 385 390 395 400

Gly Tyr Leu Thr Leu Val Glu Gin Arg Ser Gly Gly Ser Gly Lys Gly 405 410 415

Ser Asn Lys Gly Pro Leu Gly Val Thr Glu Glu Leu His He He Ser 420 425 430

Phe Thr Val Lys Tyr Thr Tyr Gin Gly Leu Lys Gin Glu Leu Lys Thr 435 440 445

Asp Thr Leu Pro Val Val He He Ser Asn Met Asn Gin Leu Ser He 450 455 460

Ala Trp Ala Ser Val Leu Trp Phe Asn Leu Leu Ser Pro Asn Leu Gin 465 470 475 480

Asn Gin Gin Phe Phe Ser Asn Pro Pro Lys Ala Pro Trp Ser Leu Leu 485 490 495

Gly Pro Ala Leu Ser Trp Gin Phe Ser Ser Tyr Val Gly Arg Gly Leu 500 505 510

Asn Ser Asp Gin Leu Ser Met Leu Arg Asn Lys Leu Phe Gly Gin Asn 515 520 525

Cys Arg Thr Glu Asp Pro Leu Leu Ser Trp Ala Asp Phe Thr Lys Arg 530 535 540

Glu Ser Pro Pro Gly Lys Leu Pro Phe Trp Thr Trp Leu Asp Lys He 545 550 555 560

Leu Glu Leu Val His Asp His Leu Lys Asp Leu Trp Asn Asp Gly Arg 565 570 575

He Met Gly Phe Val Ser Arg Ser Gin Glu Arg Arg Leu Leu Lys Lys 580 585 590

Thr Met Ser Gly Thr Phe Leu Leu Arg Phe Ser Glu Ser Ser Glu Gly 595 600 605

Gly He Thr Cys Ser Trp Val Glu His Gin Asp Asp Asp Lys Val Leu 610 615 620

He Tyr Ser Val Gin Pro Tyr Thr Lys Glu Val Leu Gin Ser Leu Pro 625 ^• 630 635 640

Leu Thr Glu He He Arg His Tyr Gin Leu Leu Thr Glu Glu Asn He 645 650 655

Pro Glu Asn Pro Leu Arg Phe Leu Tyr Pro Arg He Pro Arg Asp Glu 660 665 670

Ala Phe Gly Cys Tyr Tyr Gin Glu Lys Val Asn Leu Gin Glu Arg Arg 675 680 685

Lys Tyr Leu Lys His Arg Leu He Val Val Ser Asn Arg Gin Val Asp 690 695 700

Glu Leu Gin Gin Pro Leu Glu Leu Lys Pro Glu Pro Glu Leu Glu Ser 705 710 715 720 Leu Glu Leu Glu Leu Gly Leu Val Pro Glu Pro Glu Leu Ser Leu Asp 725 730 735

Leu Glu Pro Leu Leu Lys Ala Gly Leu Asp Leu Gly Pro Glu Leu Glu 740 745 750

Ser Val Leu Glu Ser Thr Leu Glu Pro Val He Glu Pro Thr Leu Cys 755 760 765

Met Val Ser Gin Thr Val Pro Glu Pro Asp Gin Gly Pro Val Ser Gin 770 775 780

Pro Val Pro Glu Pro Asp Leu Pro Cys Asp Leu Arg His Leu Asn Thr 785 790 795 800

Glu Pro Met Glu He Phe Arg Asn Cys Val Lys He Glu Glu He Met 805 810 815

Pro Asn Gly Asp Pro Leu Leu Ala Gly Gin Asn Thr Val Asp Glu Val 820 825 830

Tyr Val Ser Arg Pro Ser His Phe Tyr Thr Asp Gly Pro Leu Met Pro 835 840 845

Ser Asp Phe 850

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3943 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: both

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens

(vii) IMMEDIATE SOURCE:

(B) CLONE: Human Stat91

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 197..2449

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

ATTAAACCTC TCGCCGAGCC CCTCCGCAGA CTCTGCGCCG GAAAGTTTCA TTTGCTGTAT 60

GCCATCCTCG AGAGCTGTCT AGGTTAACGT TCGCACTCTG TGTATATAAC CTCGACAGTC 120

TTGGCACCTA ACGTGCTGTG CGTAGCTGCT CCTTTGGTTG AATCCCCAGG CCCTTGTTGG 180

GGCACAAGGT GGCAGG ATG TCT CAG TGG TAC GAA CTT CAG CAG CTT GAC 229

Met Ser Gin Trp Tyr Glu Leu Gin Gin Leu Asp 1 5 10

TCA AAA TTC CTG GAG CAG GTT CAC CAG CTT TAT GAT GAC AGT TTT CCC 277 Ser Lys Phe Leu Glu Gin Val His Gin Leu Tyr Asp Asp Ser Phe Pro 15 20 25 ATG GAA ATC AGA CAG TAC CTG GCA CAG TGG TTA GAA AAG CAA GAC TGG 325 Met Glu He Arg Gin Tyr Leu Ala Gin Trp Leu Glu Lys Gin Asp Trp 30 35 40

GAG CAC GCT GCC AAT GAT GTT TCA TTT GCC ACC ATC CGT TTT CAT GAC 373 Glu His Ala Ala Asn Asp Val Ser Phe Ala Thr He Arg Phe His Asp 45 50 55

CTC CTG TCA CAG CTG GAT GAT CAA TAT AGT CGC TTT TCT TTG GAG AAT 421 Leu Leu Ser Gin Leu Asp Asp Gin Tyr Ser Arg Phe Ser Leu Glu Asn 60 65 70 75

AAC TTC TTG CTA CAG CAT AAC ATA AGG AAA AGC AAG CGT AAT CTT CAG 469 Asn Phe Leu Leu Gin His Asn He Arg Lys Ser Lys Arg Asn Leu Gin 80 85 90

GAT AAT TTT CAG GAA GAC CCA ATC CAG ATG TCT ATG ATC ATT TAC AGC 517 Asp Asn Phe Gin Glu Asp Pro He Gin Met Ser Met He He Tyr Ser 95 100 105

TGT CTG AAG GAA GAA AGG AAA ATT CTG GAA AAC GCC CAG AGA TTT AAT 565 Cys Leu Lys Glu Glu Arg Lys He Leu Glu Asn Ala Gin Arg Phe Asn 110 115 120

CAG GCT CAG TCG GGG AAT ATT CAG AGC ACA GTG ATG TTA GAC AAA CAG 613 Gin Ala Gin Ser Gly Asn He Gin Ser Thr Val Met Leu Asp Lys Gin 125 130 135

AAA GAG CTT GAC AGT AAA GTC AGA AAT GTG AAG GAC AAG GTT ATG TGT 661 Lys Glu Leu Asp Ser Lys Val Arg Asn Val Lys Asp Lys Val Met Cys 140 145 150 155

ATA GAG CAT GAA ATC AAG AGC CTG GAA GAT TTA CAA GAT GAA TAT GAC 709 He Glu His Glu He Lys Ser Leu Glu Asp Leu Gin Asp Glu Tyr Asp 160 165 170

TTC AAA TGC AAA ACC TTG CAG AAC AGA GAA CAC GAG ACC AAT GGT GTG 757 Phe Lys Cys Lys Thr Leu Gin Asn Arg Glu His Glu Thr Asn Gly Val 175 180 185

GCA AAG AGT GAT CAG AAA CAA GAA CAG CTG TTA CTC AAG AAG ATG TAT 805 Ala Lys Ser Asp Gin Lys Gin Glu Gin Leu Leu Leu Lys Lys Met Tyr 190 195 200

TTA ATG CTT GAC AAT AAG AGA AAG GAA GTA GTT CAC AAA ATA ATA GAG 853 Leu Met Leu Asp Asn Lys Arg Lys Glu Val Val His Lys He He Glu 205 210 215

TTG CTG AAT GTC ACT GAA CTT ACC CAG AAT GCC CTG ATT AAT GAT GAA 901 Leu Leu Asn Val Thr Glu Leu Thr Gin Asn Ala Leu He Asn Asp Glu 220 225 230 235

CTA GTG GAG TGG AAG CGG AGA CAG CAG AGC GCC TGT ATT GGG GGG CCG 949 Leu Val Glu Trp Lys Arg Arg Gin Gin Ser Ala Cys He Gly Gly Pro 240 245 250

CCC AAT GCT TGC TTG GAT CAG CTG CAG AAC TGG TTC ACT ATA GTT GCG 997 Pro Asn Ala Cys Leu Asp Gin Leu Gin Asn Trp Phe Thr He Val Ala 255 260 265

GAG AGT CTG CAG CAA GTT CGG CAG CAG CTT AAA AAG TTG GAG GAA TTG ^" 1045 Glu Ser Leu Gin Gin Val Arg Gin Gin Leu Lys Lys Leu Glu Glu Leu 270 275 280

GAA CAG AAA TAC ACC TAC GAA CAT GAC CCT ATC ACA AAA AAC AAA CAA 1093 Glu Gin Lys Tyr Thr Tyr Glu His Asp Pro He Thr Lys Asn Lys Gin 285 290 295 GTG TTA TGG GAC CGC ACC TTC AGT CTT TTC CAG CAG CTC ATT CAG AGC 1141 Val Leu Trp Asp Arg Thr Phe Ser Leu Phe Gin Gin Leu He Gin Ser 300 305 310 315

TCG TTT GTG GTG GAA AGA CAG CCC TGC ATG CCA ACG CAC CCT CAG AGG 1189 Ser Phe Val Val Glu Arg Gin Pro Cys Met Pro Thr His Pro Gin Arg 320 325 330

CCG CTG GTC TTG AAG ACA GGG GTC CAG TTC ACT GTG AAG TTG AGA CTG 1237 Pro Leu Val Leu Lys Thr Gly Val Gin Phe Thr Val Lys Leu Arg Leu 335 340 345

TTG GTG AAA TTG CAA GAG CTG AAT TAT AAT TTG AAA GTC AAA GTC TTA 1285 Leu Val Lys Leu Gin Glu Leu Asn Tyr Asn Leu Lys Val Lys Val Leu 350 355 360

TTT GAT AAA GAT GTG AAT GAG AGA AAT ACA GTA AAA GGA TTT AGG AAG 1333 Phe Asp Lys Asp Val Asn Glu Arg Asn Thr Val Lys Gly Phe Arg Lys 365 370 375

TTC AAC ATT TTG GGC ACG CAC ACA AAA GTG ATG AAC ATG GAG GAG TCC 1381 Phe Asn He Leu Gly Thr His Thr Lys Val Met Asn Met Glu Glu Ser 380 385 390 395

ACC AAT GGC AGT CTG GCG GCT GAA TTT CGG CAC CTG CAA TTG AAA GAA 1429 Thr Asn Gly Ser Leu Ala Ala Glu Phe Arg His Leu Gin Leu Lys Glu 400 405 410

CAG AAA AAT GCT GGC ACC AGA ACG AAT GAG GGT CCT CTC ATC GTT ACT 1477 Gin Lys Asn Ala Gly Thr Arg Thr Asn Glu Gly Pro Leu He Val Thr 415 420 425

GAA GAG CTT CAC TCC CTT AGT TTT GAA ACC CAA TTG TGC CAG CCT GGT 1525 Glu Glu Leu His Ser Leu Ser Phe Glu Thr Gin Leu Cys Gin Pro Gly 430 435 440

TTG GTA ATT GAC CTC GAG ACG ACC TCT CTG CCC GTT GTG GTG ATC TCC 1573 Leu Val He Asp Leu Glu Thr Thr Ser Leu Pro Val Val Val He Ser 445 450 455

AAC GTC AGC CAG CTC CCG AGC GGT TGG GCC TCC ATC CTT TGG TAC AAC 1621 Asn Val Ser Gin Leu Pro Ser Gly Trp Ala Ser He Leu Trp Tyr Asn 460 465 470 475

ATG CTG GTG GCG GAA CCC AGG AAT CTG TCC TTC TTC CTG ACT CCA CCA 1669 Met Leu Val Ala Glu Pro Arg Asn Leu Ser Phe Phe Leu Thr Pro Pro 480 485 490

TGT GCA CGA TGG GCT CAG CTT TCA GAA GTG CTG AGT TGG CAG TTT TCT 1717 Cys Ala Arg Trp Ala Gin Leu Ser Glu Val Leu Ser Trp Gin Phe Ser 495 500 505

TCT GTC ACC AAA AGA GGT CTC AAT GTG GAC CAG CTG AAC ATG TTG GGA 1765 Ser Val Thr Lys Arg Gly Leu Asn Val Asp Gin Leu Asn Met Leu Gly 510 515 520

GAG AAG CTT CTT GGT CCT AAC GCC AGC CCC GAT GGT CTC ATT CCG TGG 1813 Glu Lys Leu Leu Gly Pro Asn Ala Ser Pro Asp Gly Leu He Pro Trp 525 530 535

ACG AGG TTT TGT AAG GAA AAT ATA AAT GAT AAA AAT TTT CCC TTC TGG - 1861 Thr Arg Phe Cys Lys Glu Asn He Asn Asp Lys Asn Phe Pro Phe Trp 540 545 550 555

CTT TGG ATT GAA AGC ATC CTA GAA CTC ATT AAA AAA CAC CTG CTC CCT 1909 Leu Trp He Glu Ser He Leu Glu Leu He Lys Lys His Leu Leu Pro 560 565 570 CTC TGG AAT GAT GGG TGC ATC ATG GGC TTC ATC AGC AAG GAG CGA GAG 1957 Leu Trp Asn Asp Gly Cys He Met Gly Phe He Ser Lys Glu Arg Glu 575 580 585

CGT GCC CTG TTG AAG GAC CAG CAG CCG GGG ACC TTC CTG CTG CGG TTC 2005 Arg Ala Leu Leu Lys Asp Gin Gin Pro Gly Thr Phe Leu Leu Arg Phe 590 595 600

AGT GAG AGC TCC CGG GAA GGG GCC ATC ACA TTC ACA TGG GTG GAG CGG 2053 Ser Glu Ser Ser Arg Glu Gly Ala He Thr Phe Thr Trp Val Glu Arg 605 610 615

TCC CAG AAC GGA GGC GAA CCT GAC TTC CAT GCG GTT GAA CCC TAC ACG 2101 Ser Gin Asn Gly Gly Glu Pro Asp Phe His Ala Val Glu Pro Tyr Thr 620 625 630 635

AAG AAA GAA CTT TCT GCT GTT ACT TTC CCT GAC ATC ATT CGC AAT TAC 2149 Lys Lys Glu Leu Ser Ala Val Thr Phe Pro Asp He He Arg Asn Tyr 640 645 650

AAA GTC ATG GCT GCT GAG AAT ATT CCT GAG AAT CCC CTG AAG TAT CTG 2197 Lys Val Met Ala Ala Glu Asn He Pro Glu Asn Pro Leu Lys Tyr Leu 655 660 665

TAT CCA AAT ATT GAC AAA GAC CAT GCC TTT GGA AAG TAT TAC TCC AGG 2245 Tyr Pro Asn He Asp Lys Asp His Ala Phe Gly Lys Tyr Tyr Ser Arg 670 675 680

CCA AAG GAA GCA CCA GAG CCA ATG GAA CTT GAT GGC CCT AAA GGA ACT 2293 Pro Lys Glu Ala Pro Glu Pro Met Glu Leu Asp Gly Pro Lys Gly Thr 685 690 695

GGA TAT ATC AAG ACT GAG TTG ATT TCT GTG TCT GAA GTT CAC CCT TCT 2341 Gly Tyr He Lys Thr Glu Leu He Ser Val Ser Glu Val His Pro Ser 700 705 710 715

AGA CTT CAG ACC ACA GAC AAC CTG CTC CCC ATG TCT CCT GAG GAG TTT 2389^" Arg Leu Gin Thr Thr Asp Asn Leu Leu Pro Met Ser Pro Glu Glu Phe 720 725 730

GAC GAG GTG TCT CGG ATA GTG GGC TCT GTA GAA TTC GAC AGT ATG ATG 2437 Asp Glu Val Ser Arg He Val Gly Ser Val Glu Phe Asp Ser Met Met 735 740 745

AAC ACA GTA TAGAGCATGA ATTTTTTTCA TCTTCTCTGG CGACAGTTTT 2486

Asn Thr Val 750

CCTTCTCATC TGTGATTCCC TCCTGCTACT CTGTTCCTTC ACATCCTGTG TTTCTAGGGA 2546

AATGAAAGAA AGGCCAGCAA ATTCGCTGCA ACCTGTTGAT AGCAAGTGAA TTTTTCTCTA 2606

ACTCAGAAAC ATCAGTTACT CTGAAGGGCA TCATGCATCT TACTGAAGGT AAAATTGAAA 2666

GGCATTCTCT GAAGAGTGGG TTTCACAAGT GAAAAACATC CAGATACACC CAAAGTATCA 2726

GGACGAGAAT GAGGGTCCTT TGGGAAAGGA GAAGTTAAGC AACATCTAGC AAATGTTATG 2786

CATAAAGTCA GTGCCCAACT GTTATAGGTT GTTGGATAAA TCAGTGGTTA TTTAGGGAAC 2846

TGCTTGACGT AGGAACGGTA AATTTCTGTG GGAGAATTCT TACATGTTTT CTTTGCTTTA 2906

AGTGTAACTG GCAGTTTTCC ATTGGTTTAC CTGTGAAATA GTTCAAAGCC AAGTTTATAT 2966

ACAATTATAT CAGTCCTCTT TCAAAGGTAG CCATCATGGA TCTGGTAGGG GGAAAATGTG 3026

TATTTTATTA CATCTTTCAC ATTGGCTATT TAAAGACAAA GACAAATTCT GTTTCTTGAG 3086 AAGAGAACAT TTCCAAATTC ACAAGTTGTG TTTGATATCC AAAGCTGAAT ACATTCTGCT 3146

TTCATCTTGG TCACATACAA TTATTTTTAC AGTTCTCCCA AGGGAGTTAG GCTATTCACA 3206

ACCACTCATT CAAAAGTTGA AATTAACCAT AGATGTAGAT AAACTCAGAA ATTTAATTCA 3266

TGTTTCTTAA ATGGGCTACT TTGTCCTTTT TGTTATTAGG GTGGTATTTA GTCTATTAGC 3326

CACAAAATTG GGAAAGGAGT AGAAAAAGCA GTAACTGACA ACTTGAATAA TACACCAGAG 3386

ATAATATGAG AATCAGATCA TTTCAAAACT CATTTCCTAT GTAACTGCAT TGAGAACTGC 3446

ATATGTTTCG CTGATATATG TGTTTTTCAC ATTTGCGAAT GGTTCCATTC TCTCTCCTGT 3506

ACTTTTTCCA GACACTTTTT TGAGTGGATG ATGTTTCGTG AAGTATACTG TATTTTTACC 3566

TTTTTCCTTC CTTATCACTG ACACAAAAAG TAGATTAAGA GATGGGTTTG ACAAGGTTCT 3626

TCCCTTTTAC ATACTGCTGT CTATGTGGCT GTATCTTGTT TTTCCACTAC TGCTACCACA 3686

ACTATATTAT CATGCAAATG CTGTATTCTT CTTTGGTGGA GATAAAGATT TCTTGAGTTT 3746

TGTTTTAAAA TTAAAGCTAA AGTATCTGTA TTGCATTAAA TATAATATCG ACACAGTGCT 3806

TTCCGTGGCA CTGCATACAA TCTGAGGCCT CCTCTCTCAG TTTTTATATA GATGGCGAGA 3866

ACCTAAGTTT CAGTTGATTT TACAATTGAA ATGACTAAAA AACAAAGAAG ACAACATTAA 3926

AAACAATATT GTTTCTA 3943

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 750 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Met Ser Gin Trp Tyr Glu Leu Gin Gin Leu Asp Ser Lys Phe Leu Glu 1 5 10 15

Gin Val His Gin Leu Tyr Asp Asp Ser Phe Pro Met Glu He Arg Gin 20 25 30

Tyr Leu Ala Gin Trp Leu Glu Lys Gin Asp Trp Glu His Ala Ala Asn 35 40 45

Asp Val Ser Phe Ala Thr He Arg Phe His Asp Leu Leu Ser Gin Leu 50 55 60

Asp Asp Gin Tyr Ser Arg Phe Ser Leu Glu Asn Asn Phe Leu Leu Gin 65 70 75 80

His Asn He Arg Lys Ser Lys Arg Asn Leu Gin Asp Asn Phe Gin Glu 85 90 95

Asp Pro He Gin Met Ser Met He He Tyr Ser Cys Leu Lys Glu Glu 100 105 110

Arg Lys He Leu Glu Asn Ala Gin Arg Phe Asn Gin Ala Gin Ser Gly 115 120 125 Asn He Gin Ser Thr Val Met Leu Asp Lys Gin Lys Glu Leu Asp Ser 130 135 140

Lys Val Arg Asn Val Lys Asp Lys Val Met Cys He Glu His Glu He 145 150 155 160

Lys Ser Leu Glu Asp Leu Gin Asp Glu Tyr Asp Phe Lys Cys Lys Thr 165 170 175

Leu Gin Asn Arg Glu His Glu Thr Asn Gly Val Ala Lys Ser Asp Gin 180 185 190

Lys Gin Glu Gin Leu Leu Leu Lys Lys Met Tyr Leu Met Leu Asp Asn 195 200 205

Lys Arg Lys Glu Val Val His Lys He He Glu Leu Leu Asn Val Thr 210 215 220

Glu Leu Thr Gin Asn Ala Leu He Asn Asp Glu Leu Val Glu Trp Lys 225 230 235 240

Arg Arg Gin Gin Ser Ala Cys He Gly Gly Pro Pro Asn Ala Cys Leu 245 250 255

Asp Gin Leu Gin Asn Trp Phe Thr He Val Ala Glu Ser Leu Gin Gin 260 265 270

Val Arg Gin Gin Leu Lys Lys Leu Glu Glu Leu Glu Gin Lys Tyr Thr 275 280 285

Tyr Glu His Asp Pro He Thr Lys Asn Lys Gin Val Leu Trp Asp Arg 290 295 300

Thr Phe Ser Leu Phe Gin Gin Leu He Gin Ser Ser Phe Val Val Glu 305 310 315 320

Arg Gin Pro Cys Met Pro Thr His Pro Gin Arg Pro Leu Val Leu Lys 325 330 335

Thr Gly Val Gin Phe Thr Val Lys Leu Arg Leu Leu Val Lys Leu Gin 340 345 350

Glu Leu Asn Tyr Asn Leu Lys Val Lys Val Leu Phe Asp Lys Asp Val 355 360 365

Asn Glu Arg Asn Thr Val Lys Gly Phe Arg Lys Phe Asn He Leu Gly 370 375 380

Thr His Thr Lys Val Met Asn Met Glu Glu Ser Thr Asn Gly Ser Leu 385 390 395 400

Ala Ala Glu Phe Arg His Leu Gin Leu Lys Glu Gin Lys Asn Ala Gly 405 410 415

Thr Arg Thr Asn Glu Gly Pro Leu He Val Thr Glu Glu Leu His Ser 420 425 430

Leu Ser Phe Glu Thr Gin Leu Cys Gin Pro Gly Leu Val He Asp Leu 435 440 445

Glu Thr Thr Ser Leu Pro Val Val Val He Ser Asn Val Ser Gin Leu 450 455 460

Pro Ser Gly Trp Ala Ser He Leu Trp Tyr Asn Met Leu Val Ala Glu 465 470 475 480 Pro Arg Asn Leu Ser Phe Phe Leu Thr Pro Pro Cys Ala Arg Trp Ala 485 490 495

Gin Leu Ser Glu Val Leu Ser Trp Gin Phe Ser Ser Val Thr Lys Arg 500 505 510

Gly Leu Asn Val Asp Gin Leu Asn Met Leu Gly Glu Lys Leu Leu Gly 515 520 525

Pro Asn Ala Ser Pro Asp Gly Leu He Pro Trp Thr Arg Phe Cys Lys 530 535 540

Glu Asn He Asn Asp Lys Asn Phe Pro Phe Trp Leu Trp He Glu Ser 545 550 555 560

He Leu Glu Leu He Lys Lys His Leu Leu Pro Leu Trp Asn Asp Gly 565 570 575

Cys He Met Gly Phe He Ser Lys Glu Arg Glu Arg Ala Leu Leu Lys 580 585 590

Asp Gin Gin Pro Gly Thr Phe Leu Leu Arg Phe Ser Glu Ser Ser Arg 595 600 605

Glu Gly Ala He Thr Phe Thr Trp Val Glu Arg Ser Gin Asn Gly Gly 610 615 620

Glu Pro Asp Phe His Ala Val Glu Pro Tyr Thr Lys Lys Glu Leu Ser 625 630 635 640

Ala Val Thr Phe Pro Asp He He Arg Asn Tyr Lys Val Met Ala Ala 645 650 655

Glu Asn He Pro Glu Asn Pro Leu Lys Tyr Leu Tyr Pro Asn He Asp 660 665 670

Lys Asp His Ala Phe Gly Lys Tyr Tyr Ser Arg Pro Lys Glu Ala Pro 675 680 685

Glu Pro Met Glu Leu Asp Gly Pro Lys Gly Thr Gly Tyr He Lys Thr 690 695 700

Glu Leu He Ser Val Ser Glu Val His Pro Ser Arg Leu Gin Thr Thr 705 710 715 720

Asp Asn Leu Leu Pro Met Ser Pro Glu Glu Phe Asp Glu Val Ser Arg 725 730 735

He Val Gly Ser Val Glu Phe Asp Ser Met Met Asn Thr Val 740 745 750

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2607 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: both

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapiens

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 197..2335

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

ATTAAACCTC TCGCCGAGCC CCTCCGCAGA CTCTGCGCCG GAAAGTTTCA TTTGCTGTAT 60

GCCATCCTCG AGAGCTGTCT AGGTTAACGT TCGCACTCTG TGTATATAAC CTCGACAGTC 120

TTGGCACCTA ACGTGCTGTG CGTAGCTGCT CCTTTGGTTG AATCCCCAGG CCCTTGTTGG 180

GGCACAAGGT GGCAGG ATG TCT CAG TGG TAC GAA CTT CAG CAG CTT GAC 229

Met Ser Gin Trp Tyr Glu Leu Gin Gin Leu Asp 1 5 10

TCA AAA TTC CTG GAG CAG GTT CAC CAG CTT TAT GAT GAC AGT TTT CCC 277 Ser Lys Phe Leu Glu Gin Val His Gin Leu Tyr Asp Asp Ser Phe Pro 15 20 25

ATG GAA ATC AGA CAG TAC CTG GCA CAG TGG TTA GAA AAG CAA GAC TGG 325 Met Glu He Arg Gin Tyr Leu Ala Gin Trp Leu Glu Lys Gin Asp Trp 30 35 40

GAG CAC GCT GCC AAT GAT GTT TCA TTT GCC ACC ATC CGT TTT CAT GAC 373 Glu His Ala Ala Asn Asp Val Ser Phe Ala Thr He Arg Phe His Asp 45 50 55

CTC CTG TCA CAG CTG GAT GAT CAA TAT AGT CGC TTT TCT TTG GAG AAT 421 Leu Leu Ser Gin Leu Asp Asp Gin Tyr Ser Arg Phe Ser Leu Glu Asn 60 65 70 75

AAC TTC TTG CTA CAG CAT AAC ATA AGG AAA AGC AAG CGT AAT CTT CAG 469 Asn Phe Leu Leu Gin His Asn He Arg Lys Ser Lys Arg Asn Leu Gin 80 85 90

GAT AAT TTT CAG GAA GAC CCA ATC CAG ATG TCT ATG ATC ATT TAC AGC 517 Asp Asn Phe Gin Glu Asp Pro He Gin Met Ser Met He He Tyr Ser 95 100 105

TGT CTG AAG GAA GAA AGG AAA ATT CTG GAA AAC GCC CAG AGA TTT AAT 565 Cys Leu Lys Glu Glu Arg Lys He Leu Glu Asn Ala Gin Arg Phe Asn 110 115 120

CAG GCT CAG TCG GGG AAT ATT CAG AGC ACA GTG ATG TTA GAC AAA CAG 613 Gin Ala Gin Ser Gly Asn He Gin Ser Thr Val Met Leu Asp Lys Gin 125 130 135

AAA GAG CTT GAC AGT AAA GTC AGA AAT GTG AAG GAC AAG GTT ATG TGT 661 Lys Glu Leu Asp Ser Lys Val Arg Asn Val Lys Asp Lys Val Met Cys 140 145 150 155

ATA GAG CAT GAA ATC AAG AGC CTG GAA GAT TTA CAA GAT GAA TAT GAC 709 He Glu His Glu He Lys Ser Leu Glu Asp Leu Gin Asp Glu Tyr Asp 160 165 170

TTC AAA TGC AAA ACC TTG CAG AAC AGA GAA CAC GAG ACC AAT GGT GTG 757 Phe Lys Cys Lys Thr Leu Gin Asn Arg Glu His Glu Thr Asn Gly Val 175 180 185

GCA AAG AGT GAT CAG AAA CAA GAA CAG CTG TTA CTC AAG AAG ATG TAT 805 Ala Lys Ser Asp Gin Lys Gin Glu Gin Leu Leu Leu Lys Lys Met Tyr 190 195 200 TTA ATG CTT GAC AAT AAG AGA AAG GAA GTA GTT CAC AAA ATA ATA GAG 853 Leu Met Leu Asp Asn Lys Arg Lys Glu Val Val His Lys He He Glu 205 210 215

TTG CTG AAT GTC ACT GAA CTT ACC CAG AAT GCC CTG ATT AAT GAT GAA 901 Leu Leu Asn Val Thr Glu Leu Thr Gin Asn Ala Leu He Asn Asp Glu 220 225 230 235

CTA GTG GAG TGG AAG CGG AGA CAG CAG AGC GCC TGT ATT GGG GGG CCG 949 Leu Val Glu Trp Lys Arg Arg Gin Gin Ser Ala Cys He Gly Gly Pro 240 245 250

CCC AAT GCT TGC TTG GAT CAG CTG CAG AAC TGG TTC ACT ATA GTT GCG 997 Pro Asn Ala Cys Leu Asp Gin Leu Gin Asn Trp Phe Thr He Val Ala 255 260 265

GAG AGT CTG CAG CAA GTT CGG CAG CAG CTT AAA AAG TTG GAG GAA TTG 1045 Glu Ser Leu Gin Gin Val Arg Gin Gin Leu Lys Lys Leu Glu Glu Leu 270 275 280

GAA CAG AAA TAC ACC TAC GAA CAT GAC CCT ATC ACA AAA AAC AAA CAA 1093 Glu Gin Lys Tyr Thr Tyr Glu His Asp Pro He Thr Lys Asn Lys Gin 285 290 295

GTG TTA TGG GAC CGC ACC TTC AGT CTT TTC CAG CAG CTC ATT CAG AGC 1141 Val Leu Trp Asp Arg Thr Phe Ser Leu Phe Gin Gin Leu He Gin Ser 300 305 310 315

TCG TTT GTG GTG GAA AGA CAG CCC TGC ATG CCA ACG CAC CCT CAG AGG 1189 Ser Phe Val Val Glu Arg Gin Pro Cys Met Pro Thr His Pro Gin Arg 320 ^" 325 330

CCG CTG GTC TTG AAG ACA GGG GTC CAG TTC ACT GTG AAG TTG AGA CTG 1237 Pro Leu Val Leu Lys Thr Gly Val Gin Phe Thr Val Lys Leu Arg Leu 335 340 345

TTG GTG AAA TTG CAA GAG CTG AAT TAT AAT TTG AAA GTC AAA GTC TTA 1285 Leu Val Lys Leu Gin Glu Leu Asn Tyr Asn Leu Lys Val Lys Val Leu 350 355 360

TTT GAT AAA GAT GTG AAT GAG AGA AAT ACA GTA AAA GGA TTT AGG AAG 1333 Phe Asp Lys Asp Val Asn Glu Arg Asn Thr Val Lys Gly Phe Arg Lys 365 370 375

TTC AAC ATT TTG GGC ACG CAC ACA AAA GTG ATG AAC ATG GAG GAG TCC 1381 Phe Asn He Leu Gly Thr His Thr Lys Val Met Asn Met Glu Glu Ser 380 385 390 395

ACC AAT GGC AGT CTG GCG GCT GAA TTT CGG CAC CTG CAA TTG AAA GAA 1429 Thr Asn Gly Ser Leu Ala Ala Glu Phe Arg His Leu Gin Leu Lys Glu 400 405 410

CAG AAA AAT GCT GGC ACC AGA ACG AAT GAG GGT CCT CTC ATC GTT ACT 1477 Gin Lys Asn Ala Gly Thr Arg Thr Asn Glu Gly Pro Leu He Val Thr 415 420 425

GAA GAG CTT CAC TCC CTT AGT TTT GAA ACC CAA TTG TGC CAG CCT GGT 1525 Glu Glu Leu His Ser Leu Ser Phe Glu Thr Gin Leu Cys Gin Pro Gly 430 435 440

TTG GTA ATT GAC CTC GAG ACG ACC TCT CTG CCC GTT GTG GTG ATC TCC ^' 1573 Leu Val He Asp Leu Glu Thr Thr Ser Leu Pro Val Val Val He Ser 445 450 455

AAC GTC AGC CAG CTC CCG AGC GGT TGG GCC TCC ATC CTT TGG TAC AAC 1621 Asn Val Ser Gin Leu Pro Ser Gly Trp Ala Ser He Leu Trp Tyr Asn 460 465 470 475 ATG CTG GTG GCG GAA CCC AGG AAT CTG TCC TTC TTC CTG ACT CCA CCA 1669 Met Leu Val Ala Glu Pro Arg Asn Leu Ser Phe Phe Leu Thr Pro Pro 480 485 490

TGT GCA CGA TGG GCT CAG CTT TCA GAA GTG CTG AGT TGG CAG TTT TCT 1717 Cys Ala Arg Trp Ala Gin Leu Ser Glu Val Leu Ser Trp Gin Phe Ser 495 500 505

TCT GTC ACC AAA AGA GGT CTC AAT GTG GAC CAG CTG AAC ATG TTG GGA 1765 Ser Val Thr Lys Arg Gly Leu Asn Val Asp Gin Leu Asn Met Leu Gly 510 515 520

GAG AAG CTT CTT GGT CCT AAC GCC AGC CCC GAT GGT CTC ATT CCG TGG 1813 Glu Lys Leu Leu Gly Pro Asn Ala Ser Pro Asp Gly Leu He Pro Trp 525 530 535

ACG AGG TTT TGT AAG GAA AAT ATA AAT GAT AAA AAT TTT CCC TTC TGG 1861 Thr Arg Phe Cys Lys Glu Asn He Asn Asp Lys Asn Phe Pro Phe Trp 540 545 550 555

CTT TGG ATT GAA AGC ATC CTA GAA CTC ATT AAA AAA CAC CTG CTC CCT 1909 Leu Trp He Glu Ser He Leu Glu Leu He Lys Lys His Leu Leu Pro 560 565 570

CTC TGG AAT GAT GGG TGC ATC ATG GGC TTC ATC AGC AAG GAG CGA GAG 1957 Leu Trp Asn Asp Gly Cys He Met Gly Phe He Ser Lys Glu Arg Glu 575 580 585

CGT GCC CTG TTG AAG GAC CAG CAG CCG GGG ACC TTC CTG CTG CGG TTC 2005 Arg Ala Leu Leu Lys Asp Gin Gin Pro Gly Thr Phe Leu Leu Arg Phe 590 595 600

AGT GAG AGC TCC CGG GAA GGG GCC ATC ACA TTC ACA TGG GTG GAG CGG 2053 Ser Glu Ser Ser Arg Glu Gly Ala He Thr Phe Thr Trp Val Glu Arg 605 610 615

TCC CAG AAC GGA GGC GAA CCT GAC TTC CAT GCG GTT GAA CCC TAC ACG 2101 Ser Gin Asn Gly Gly Glu Pro Asp Phe His Ala Val Glu Pro Tyr Thr 620 625 630 635

AAG AAA GAA CTT TCT GCT GTT ACT TTC CCT GAC ATC ATT CGC AAT TAC 2149 Lys Lys Glu Leu Ser Ala Val Thr Phe Pro Asp He He Arg Asn Tyr 640 645 650

AAA GTC ATG GCT GCT GAG AAT ATT CCT GAG AAT CCC CTG AAG TAT CTG 2197 Lys Val Met Ala Ala Glu Asn He Pro Glu Asn Pro Leu Lys Tyr Leu 655 660 665

TAT CCA AAT ATT GAC AAA GAC CAT GCC TTT GGA AAG TAT TAC TCC AGG 2245 Tyr Pro Asn He Asp Lys Asp His Ala Phe Gly Lys Tyr Tyr Ser Arg 670 675 680

CCA AAG GAA GCA CCA GAG CCA ATG GAA CTT GAT GGC CCT AAA GGA ACT 2293 Pro Lys Glu Ala Pro Glu Pro Met Glu Leu Asp Gly Pro Lys Gly Thr 685 690 695

GGA TAT ATC AAG ACT GAG TTG ATT TCT GTG TCT GAA GTG TAAGTGAACA 2342 Gly Tyr He Lys Thr Glu Leu He Ser Val Ser Glu Val 700 705 710

CAGAAGAGTG ACATGTTTAC AAACCTCAAG CCAGCCTTGC TCCTGGCTGG GGCCTGTTGA 2402

AGATGCTTGT ATTTTACTTT TCCATTGTAA TTGCTATCGC CATCACAGCT GAACTTGTTG 2462

AGATCCCCGT GTTACTGCCT ATCAGCATTT TACTACTTTA AAAAAAAAAA AAAAAGCCAA 2522

AAACCAAATT TGTATTTAAG GTATATAAAT TTTCCCAAAA CTGATACCCT TTGAAAAAGT 2582 ATAAATAAAA TGAGCAAAAG TTGAA 2607

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 712 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

Met Ser Gin Trp Tyr Glu Leu Gin Gin Leu Asp Ser Lys Phe Leu Glu 1 5 10 15

Gin Val His Gin Leu Tyr Asp Asp Ser Phe Pro Met Glu He Arg Gin 20 25 30

Tyr Leu Ala Gin Trp Leu Glu Lys Gin Asp Trp Glu His Ala Ala Asn 35 40 45

Asp Val Ser Phe Ala Thr He Arg Phe His Asp Leu Leu Ser Gin Leu 50 55 60

Asp Asp Gin Tyr Ser Arg Phe Ser Leu Glu Asn Asn Phe Leu Leu Gin 65 70 75 80

His Asn He Arg Lys Ser Lys Arg Asn Leu Gin Asp Asn Phe Gin Glu 85 90 95

Asp Pro He Gin Met Ser Met He He Tyr Ser Cys Leu Lys Glu Glu 100 105 110

Arg Lys He Leu Glu Asn Ala Gin Arg Phe Asn Gin Ala Gin Ser Gly 115 120 125

Asn He Gin Ser Thr Val Met Leu Asp Lys Gin Lys Glu Leu Asp Ser 130 135 140

Lys Val Arg Asn Val Lys Asp Lys Val Met Cys He Glu His Glu He 145 150 155 160

Lys Ser Leu Glu Asp Leu Gin Asp Glu Tyr Asp Phe Lys Cys Lys Thr 165 170 175

Leu Gin Asn Arg Glu His Glu Thr Asn Gly Val Ala Lys Ser Asp Gin 180 185 190

Lys Gin Glu Gin Leu Leu Leu Lys Lys Met Tyr Leu Met Leu Asp Asn 195 200 205

Lys Arg Lys Glu Val Val His Lys He He Glu Leu Leu Asn Val Thr 210 215 220

Glu Leu Thr Gin Asn Ala Leu He Asn Asp Glu Leu Val Glu Trp Lys 225 230 235 240

Arg Arg Gin Gin Ser Ala Cys He Gly Gly Pro Pro Asn Ala Cys Leu 245 250 255

Asp Gin Leu Gin Asn Trp Phe Thr He Val Ala Glu Ser Leu Gin Gin 260 265 270

Val Arg Gin Gin Leu Lys Lys Leu Glu Glu Leu Glu Gin Lys Tyr Thr 275 280 285 Tyr Glu His Asp Pro He Thr Lys Asn Lys Gin Val Leu Trp Asp Arg 290 295 300

Thr Phe Ser Leu Phe Gin Gin Leu He Gin Ser Ser Phe Val Val Glu 305 310 315 320

Arg Gin Pro Cys Met Pro Thr His Pro Gin Arg Pro Leu Val Leu Lys 325 330 335

Thr Gly Val Gin Phe Thr Val Lys Leu Arg Leu Leu Val Lys Leu Gin 340 345 350

Glu Leu Asn Tyr Asn Leu Lys Val Lys Val Leu Phe Asp Lys Asp Val 355 360 365

Asn Glu Arg Asn Thr Val Lys Gly Phe Arg Lys Phe Asn He Leu Gly 370 375 380

Thr His Thr Lys Val Met Asn Met Glu Glu Ser Thr Asn Gly Ser Leu 385 390 395 400

Ala Ala Glu Phe Arg His Leu Gin Leu Lys Glu Gin Lys Asn Ala Gly 405 410 415

Thr Arg Thr Asn Glu Gly Pro Leu He Val Thr Glu Glu Leu His Ser 420 425 430

Leu Ser Phe Glu Thr Gin Leu Cys Gin Pro Gly Leu Val He Asp Leu 435 440 445

Glu Thr Thr Ser Leu Pro Val Val Val He Ser Asn Val Ser Gin Leu 450 455 460

Pro Ser Gly Trp Ala Ser He Leu Trp Tyr Asn Met Leu Val Ala Glu 465 470 475 480

Pro Arg Asn Leu Ser Phe Phe Leu Thr Pro Pro Cys Ala Arg Trp Ala 485 490 495

Gin Leu Ser Glu Val Leu Ser Trp Gin Phe Ser Ser Val Thr Lys Arg 500 505 510

Gly Leu Asn Val Asp Gin Leu Asn Met Leu Gly Glu Lys Leu Leu Gly 515 520 525

Pro Asn Ala Ser Pro Asp Gly Leu He Pro Trp Thr Arg Phe Cys Lys 530 535 540

Glu Asn He Asn Asp Lys Asn Phe Pro Phe Trp Leu Trp He Glu Ser 545 550 555 560

He Leu Glu Leu He Lys Lys His Leu Leu Pro Leu Trp Asn Asp Gly 565 570 575

Cys He Met Gly Phe He Ser Lys Glu Arg Glu Arg Ala Leu Leu Lys 580 585 590

Asp Gin Gin Pro Gly Thr Phe Leu Leu Arg Phe Ser Glu Ser Ser Arg 595 600 605

Glu Gly Ala He Thr Phe Thr Trp Val Glu Arg Ser Gin Asn Gly Gly 610 615 620

Glu Pro Asp Phe His Ala Val Glu Pro Tyr Thr Lys Lys Glu Leu Ser 625 630 635 640 Ala Val Thr Phe Pro Asp He He Arg Asn Tyr Lys Val Met Ala Ala 645 650 655

Glu Asn He Pro Glu Asn Pro Leu Lys Tyr Leu Tyr Pro Asn He Asp 660 665 670

Lys Asp His Ala Phe Gly Lys Tyr Tyr Ser Arg Pro Lys Glu Ala Pro 675 680 685

Glu Pro Met Glu Leu Asp Gly Pro Lys Gly Thr Gly Tyr He Lys Thr 690 695 700

Glu Leu He Ser Val Ser Glu Val 705 710

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2277 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: both

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Mouse

(vii) IMMEDIATE SOURCE:

(B) CLONE: Murine Stat91

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 5..2251

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

CAGG ATG TCA CAG TGG TTC GAG CTT CAG CAG CTG GAC TCC AAG TTC CTG 49 Met Ser Gin Trp Phe Glu Leu Gin Gin Leu Asp Ser Lys Phe Leu 1 5 10 15

GAG CAG GTC CAC CAG CTG TAC GAT GAC AGT TTC CCC ATG GAA ATC AGA 97 Glu Gin Val His Gin Leu Tyr Asp Asp Ser Phe Pro Met Glu He Arg 20 25 30

CAG TAC CTG GCC CAG TGG CTG GAA AAG CAA GAC TGG GAG CAC GCT GCC 145 Gin Tyr Leu Ala Gin Trp Leu Glu Lys Gin Asp Trp Glu His Ala Ala 35 40 45

TAT GAT GTC TCG TTT GCG ACC ATC CGC TTC CAT GAC CTC CTC TCA CAG 193 Tyr Asp Val Ser Phe Ala Thr He Arg Phe His Asp Leu Leu Ser Gin 50 55 60

CTG GAC GAC CAG TAC AGC CGC TTT TCT CTG GAG AAT AAT TTC TTG TTG 2 1 Leu Asp Asp Gin Tyr Ser Arg Phe Ser Leu Glu Asn Asn Phe Leu Leu 65 70 75

CAG CAC AAC ATA CGG AAA AGC AAG CGT AAT CTC CAG GAT AAC TTC CAA 289 Gin His Asn He Arg Lys Ser Lys Arg Asn Leu Gin Asp Asn Phe Gin 80 85 90 95 GAA GAT CCC GTA CAG ATG TCC ATG ATC ATC TAC AAC TGT CTG AAG GAA 337 Glu Asp Pro Val Gin Met Ser Met He He Tyr Asn Cys Leu Lys Glu 100 105 110

GAA AGG AAG ATT TTG GAA AAT GCC CAA AGA TTT AAT CAG GCC CAG GAG 385 Glu Arg Lys He Leu Glu Asn Ala Gin Arg Phe Asn Gin Ala Gin Glu 115 120 125

GGA AAT ATT CAG AAC ACT GTG ATG TTA GAT AAA CAG AAG GAG CTG GAC 433 Gly Asn He Gin Asn Thr Val Met Leu Asp Lys Gin Lys Glu Leu Asp 130 135 140

AGT AAA GTC AGA AAT GTG AAG GAT CAA GTC ATG TGC ATA GAG CAG GAA 481 Ser Lys Val Arg Asn Val Lys Asp Gin Val Met Cys He Glu Gin Glu 145 150 155

ATC AAG ACC CTA GAA GAA TTA CAA GAT GAA TAT GAC TTT AAA TGC AAA 529 He Lys Thr Leu Glu Glu Leu Gin Asp Glu Tyr Asp Phe Lys Cys Lys 160 165 170 175

ACC TCT CAG AAC AGA GAA GGT GAA GCC AAT GGT GTG GCG AAG AGC GAC 577 Thr Ser Gin Asn Arg Glu Gly Glu Ala Asn Gly Val Ala Lys Ser Asp 180 185 190

CAA AAA CAG GAA CAG CTG CTG CTC CAC AAG ATG TTT TTA ATG CTT GAC 625 Gin Lys Gin Glu Gin Leu Leu Leu His Lys Met Phe Leu Met Leu Asp 195 200 205

AAT AAG AGA AAG GAG ATA ATT CAC AAA ATC AGA GAG TTG CTG AAT TCC 673 Asn Lys Arg Lys Glu He He His Lys He Arg Glu Leu Leu Asn Ser 210 215 220

ATC GAG CTC ACT CAG AAC ACT CTG ATT AAT GAC GAG CTC GTG GAG TGG 721 He Glu Leu Thr Gin Asn Thr Leu He Asn Asp Glu Leu Val Glu Trp 225 230 235

AAG CGA AGG CAG CAG AGC GCC TGC ATC GGG GGA CCG CCC AAC GCC TGC 769 Lys Arg Arg Gin Gin Ser Ala Cys He Gly Gly Pro Pro Asn Ala Cys 240 245 250 255

CTG GAT CAG CTG CAA ACG TGG TTC ACC ATT GTT GCA GAG ACC CTG CAG 817 Leu Asp Gin Leu Gin Thr Trp Phe Thr He Val Ala Glu Thr Leu Gin 260 265 270

CAG ATC CGT CAG CAG CTT AAA AAG CTG GAG GAG TTG GAA CAG AAA TTC 865 Gin He Arg Gin Gin Leu Lys Lys Leu Glu Glu Leu Glu Gin Lys Phe 275 280 285

ACC TAT GAG CCC GAC CCT ATT ACA AAA AAC AAG CAG GTG TTG TCA GAT 913 Thr Tyr Glu Pro Asp Pro He Thr Lys Asn Lys Gin Val Leu Ser Asp 290 295 300

CGA ACC TTC CTC CTC TTC CAG CAG CTC ATT CAG AGC TCC TTC GTG GTA 961 Arg Thr Phe Leu Leu Phe Gin Gin Leu He Gin Ser Ser Phe Val Val 305 310 315

GAA CGA CAG CCG TGC ATG CCC ACT CAC CCG CAG AGG CCC CTG GTC TTG 1009 Glu Arg Gin Pro Cys Met Pro Thr His Pro Gin Arg Pro Leu Val Leu 320 325 330 335

AAG ACT GGG GTA CAG TTC ACT GTC AAG TCG AGA CTG TTG GTG AAA TTG 1057 Lys Thr Gly Val Gin Phe Thr Val Lys Ser Arg Leu Leu Val Lys Leu 340 345 350

CAA GAG TCG AAT CTA TTA ACG AAA GTG AAA TGT CAC TTT GAC AAA GAT 1105 Gin Glu Ser Asn Leu Leu Thr Lys Val Lys Cys His Phe Asp Lys Asp 355 360 365 GTG AAC GAG AAA AAC ACA GTT AAA GGA TTT CGG AAG TTC AAC ATC TTG 1153 Val Asn Glu Lys Asn Thr Val Lys Gly Phe Arg Lys Phe Asn He Leu 370 375 380

GGT ACG CAC ACA AAA GTG ATG AAC ATG GAA GAA TCC ACC AAC GGA AGT 1201 Gly Thr His Thr Lys Val Met Asn Met Glu Glu Ser Thr Asn Gly Ser 385 390 395

CTG GCA GCT GAG CTC CGA CAC CTG CAA CTG AAG GAA CAG AAA AAC GCT 1249 Leu Ala Ala Glu Leu Arg His Leu Gin Leu Lys Glu Gin Lys Asn Ala 400 405 410 415

GGG AAC AGA ACT AAT GAG GGG CCT CTC ATT GTC ACC GAA GAA CTT CAC 1297 Gly Asn Arg Thr Asn Glu Gly Pro Leu He Val Thr Glu Glu Leu His 420 425 430

TCT CTT AGC TTT GAA ACC CAG TTG TGC CAG CCA GGC TTG GTG ATT GAC 1345 Ser Leu Ser Phe Glu Thr Gin Leu Cys Gin Pro Gly Leu Val He Asp 435 440 445

CTG GAG ACC ACC TCT CTT CCT GTC GTG GTG ATC TCC AAC GTC AGC CAG 1393 Leu Glu Thr Thr Ser Leu Pro Val Val Val He Ser Asn Val Ser Gin 450 455 460

CTC CCC AGT GGC TGG GCG TCT ATC CTG TGG TAC AAC ATG CTG GTG ACA 1441 Leu Pro Ser Gly Trp Ala Ser He Leu Trp Tyr Asn Met Leu Val Thr 465 470 475

GAG CCC AGG AAT CTC TCC TTC TTC CTG AAC CCC CCG TGC GCG TGG TGG 1489 Glu Pro Arg Asn Leu Ser Phe Fhe Leu Asn Pro Pro Cys Ala Trp Trp 480 485 _. 490 495

TCC CAG CTC TCA GAG GTG TTG AGT TGG CAG TTT TCA TCA GTC ACC AAG 1537 Ser Gin Leu Ser Glu Val Leu Ser Trp Gin Phe Ser Ser Val Thr Lys 500 505 510

AGA GGT CTG AAC GCA GAC CAG CTG AGC ATG CTG GGA GAG AAG CTG CTG 1585 Arg Gly Leu Asn Ala Asp Gin Leu Ser Met Leu Gly Glu Lys Leu Leu 515 520 525

GGC CCT AAT GCT GGC CCT GAT GGT CTT ATT CCA TGG ACA AGG TTT TGT 1633 Gly Pro Asn Ala Gly Pro Asp Gly Leu He Pro Trp Thr Arg Phe Cys 530 535 540

AAG GAA AAT ATT AAT GAT AAA AAT TTC TCC TTC TGG CCT TGG ATT GAC 1681 Lys Glu Asn He Asn Asp Lys Asn Phe Ser Phe Trp Pro Trp He Asp 545 550 555

ACC ATC CTA GAG CTC ATT AAG AAC GAC CTG CTG TGC CTC TGG AAT GAT 1729 Thr He Leu Glu Leu He Lys Asn Asp Leu Leu Cys Leu Trp Asn Asp 560 565 570 575

GGG TGC ATT ATG GGC TTC ATC AGC AAG GAG CGA GAA CGC GCT CTG CTC 1777 Gly Cys He Met Gly Phe He Ser Lys Glu Arg Glu Arg Ala Leu Leu 580 585 590

AAG GAC CAG CAG CCA GGG ACG TTC CTG CTT AGA TTC AGT GAG AGC TCC 1825 Lys Asp Gin Gin Pro Gly Thr Phe Leu Leu Arg Phe Ser Glu Ser Ser 595 600 605

CGG GAA GGG GCC ATC ACA TTC ACA TGG GTG GAA CGG TCC CAG AAC GGA - 1873 Arg Glu Gly Ala He Thr Phe Thr Trp Val Glu Arg Ser Gin Asn Gly 610 615 620

GGT GAA CCT GAC TTC CAT GCC GTG GAG CCC TAC ACG AAA AAA GAA CTT 1921 Gly Glu Pro Asp Phe His Ala Val Glu Pro Tyr Thr Lys Lys Glu Leu 625 630 635 TCA GCT GTT ACT TTC CCA GAT ATT ATT CGC AAC TAC AAA GTC ATG GCT 1969

Ser Ala Val Thr Phe Pro Asp He He Arg Asn Tyr Lys Val Met Ala

640 645 650 655

GCC GAG AAC ATA CCA GAG AAT CCC CTG AAG TAT CTG TAC CCC AAT ATT 2017

Ala Glu Asn He Pro Glu Asn Pro Leu Lys Tyr Leu Tyr Pro Asn He 660 665 670

GAC AAA GAC CAC GCC TTT GGG AAG TAT TAT TCC AGA CCA AAG GAA GCA 2065

Asp Lys Asp His Ala Phe Gly Lys Tyr Tyr Ser Arg Pro Lys Glu Ala 675 680 685

CCA GAA CCG ATG GAG CTT GAC GAC CCT AAG CGA ACT GGA TAC ATC AAG 2113

Pro Glu Pro Met Glu Leu Asp Asp Pro Lys Arg Thr Gly Tyr ^'lie Lys 690 695 700

ACT GAG TTG ATT TCT GTG TCT GAA GTC CAC CCT TCT AGA CTT CAG ACC 2161

Thr Glu Leu He Ser Val Ser Glu Val His Pro Ser Arg Leu Gin Thr 705 710 715

ACA GAC AAC CTG CTT CCC ATG TCT CCA GAG GAG TTT GAT GAG ATG TCC 2209

Thr Asp Asn Leu Leu Pro Met Ser Pro Glu Glu Phe Asp Glu Met Ser

720 725 730 735

CGG ATA GTG GGC CCC GAA TTT GAC AGT ATG ATG AGC ACA GTA 2251

Arg He Val Gly Pro Glu Phe Asp Ser Met Met Ser Thr Val 740 745

TAAACACGAA TTTCTCTCTG GCGACA 2277

(2) INFORMATION FOR SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 749 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

Met Ser Gin Trp Phe Glu Leu Gin Gin Leu Asp Ser Lys Phe Leu Glu 1 5 10 15

Gin Val His Gin Leu Tyr Asp Asp Ser Phe Pro Met Glu He Arg Gin 20 25 30

Tyr Leu Ala Gin Trp Leu Glu Lys Gin Asp Trp Glu His Ala Ala Tyr 35 40 45

Asp Val Ser Phe Ala Thr He Arg Phe His Asp Leu Leu Ser Gin Leu 50 55 60

Asp Asp Gin Tyr Ser Arg Phe Ser Leu Glu Asn Asn Phe Leu Leu Gin 65 70 75 80

His Asn He Arg Lys Ser Lys Arg Asn Leu Gin Asp Asn Phe Gin Glu 85 90 95

Asp Pro Val Gin Met Ser Met He He Tyr Asn Cys Leu Lys Glu Glu 100 105 110

Arg Lys He Leu Glu Asn Ala Gin Arg Phe Asn Gin Ala Gin Glu Gly 115 120 125 Asn He Gin Asn Thr Val Met Leu Asp Lys Gin Lys Glu Leu Asp Ser 130 135 140

Lys Val Arg Asn Val Lys Asp Gin Val Met Cys He Glu Gin Glu He 145 150 155 160

Lys Thr Leu Glu Glu Leu Gin Asp Glu Tyr Asp Phe Lys Cys Lys Thr 165 170 175

Ser Gin Asn Arg Glu Gly Glu Ala Asn Gly Val Ala Lys Ser Asp Gin 180 185 190

Lys Gin Glu Gin Leu Leu Leu His Lys Met Phe Leu Met Leu Asp Asn 195 200 205

Lys Arg Lys Glu He He His Lys He Arg Glu Leu Leu Asn Ser He 210 215 220

Glu Leu Thr Gin Asn Thr Leu He Asn Asp Glu Leu Val Glu Trp Lys 225 230 235 240

Arg Arg Gin Gin Ser Ala Cys He Gly Gly Pro Pro Asn Ala Cys Leu 245 250 255

Asp Gin Leu Gin Thr Trp Phe Thr He Val Ala Glu Thr Leu Gin Gin 260 265 270

He Arg Gin Gin Leu Lys Lys Leu Glu Glu Leu Glu Gin Lys Phe Thr 275 280 285

Tyr Glu Pro Asp Pro He Thr Lys Asn Lys Gin Val Leu Ser Asp Arg 290 295 300

Thr Phe Leu Leu Phe Gin Gin Leu He Gin Ser Ser Phe Val Val Glu 305 310 315 320

Arg Gin Pro Cys Met Pro Thr His Pro Gin Arg Pro Leu Val Leu Lys 325 330 335

Thr Gly Val Gin Phe Thr Val Lys Ser Arg Leu Leu Val Lys Leu Gin 340 345 350

Glu Ser Asn Leu Leu Thr Lys Val Lys Cys His Phe Asp Lys Asp Val 355 360 365

Asn Glu Lys Asn Thr Val Lys Gly Phe Arg Lys Phe Asn He Leu Gly 370 375 380

Thr His Thr Lys Val Met Asn Met Glu Glu Ser Thr Asn Gly Ser Leu 385 390 395 400

Ala Ala Glu Leu Arg His Leu Gin Leu Lys Glu Gin Lys Asn Ala Gly 405 410 415

Asn Arg Thr Asn Glu Gly Pro Leu He Val Thr Glu Glu Leu His Ser 420 425 430

Leu Ser Phe Glu Thr Gin Leu Cys Gin Pro Gly Leu Val He Asp Leu 435 440 445

Glu Thr Thr Ser Leu Pro Val Val Val He Ser Asn Val Ser Gin Leu 450 455 460

Pro Ser Gly Trp Ala Ser He Leu Trp Tyr Asn Met Leu Val Thr Glu 465 470 4^5 480 Pro Arg Asn Leu Ser Phe Phe Leu Asn Pro Pro Cys Ala Trp Trp Ser 485 490 495

Gin Leu Ser Glu Val Leu Ser Trp Gin Phe Ser Ser Val Thr Lys Arg 500 505 510

Gly Leu Asn Ala Asp Gin Leu Ser Met Leu Gly Glu Lys Leu Leu Gly 515 520 525

Pro Asn Ala Gly Pro Asp Gly Leu He Pro Trp Thr Arg Phe Cys Lys 530 535 540

Glu Asn He Asn Asp Lys Asn Phe Ser Phe Trp Pro Trp He Asp Thr 545 550 555 560

He Leu Glu Leu He Lys Asn Asp Leu Leu Cys Leu Trp Asn Asp Gly 565 570 575

Cys He Met Gly Phe He Ser Lys Glu Arg Glu Arg Ala Leu Leu Lys 580 585 590

Asp Gin Gin Pro Gly Thr Phe Leu Leu Arg Phe Ser Glu Ser Ser Arg 595 600 605

Glu Gly Ala He Thr Phe Thr Trp Val Glu Arg Ser Gin Asn Gly Gly 610 615 620

Glu Pro Asp Phe His Ala Val Glu Pro Tyr Thr Lys Lys Glu Leu Ser 625 630 635 640

Ala Val Thr Phe Pro Asp He He Arg Asn Tyr Lys Val Met Ala Ala 645 650 655

Glu Asn He Pro Glu Asn Pro Leu Lys Tyr Leu Tyr Pro Asn He Asp 660 665 670

Lys Asp His Ala Phe Gly Lys Tyr Tyr Ser Arg Pro Lys Glu Ala Pro 675 680 685

Glu Pro Met Glu Leu Asp Asp Pro Lys Arg Thr Gly Tyr He Lys Thr 690 695 700

Glu Leu He Ser Val Ser Glu Val His Pro Ser Arg Leu Gin Thr Thr 705 710 715 720

Asp Asn Leu Leu Pro Met Ser Pro Glu Glu Phe Asp Glu Met Ser Arg 725 730 735

He Val Gly Pro Glu Phe Asp Ser Met Met Ser Thr Val 740 745

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2375 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: both

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Mouse (vii) IMMEDIATE SOURCE:

(A) LIBRARY: splenic/thymic

(B) CLONE: Murine 13sfl

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 34..2277

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

TGCCACTACC TGGACGGAGA GAGAGAGAGC AGC ATG TCT CAG TGG AAT CAA GTC 54

Met Ser Gin Trp Asn Gin Val 1 5

CAA CAA TTA GAA ATC AAG TTT TTG GAG CAA GTA GAT CAG TTC TAT GAT 102 Gin Gin Leu Glu He Lys Phe Leu Glu Gin Val Asp Gin Phe Tyr Asp 10 15 20

GAC AAC TTT CCT ATG GAA ATC CGG CAT CTG CTA GCT CAG TGG ATT GAG 150 Asp Asn Phe Pro Met Glu He Arg His Leu Leu Ala Gin Trp He Glu 25 30 35

ACT CAA GAC TGG GAA GTA GCT TCT AAC AAT GAA ACT ATG GCA ACA ATT 198 Thr Gin Asp Trp Glu Val Ala Ser Asn Asn Glu Thr Met Ala Thr He 40 45 50 55

CTG CTT CAA AAC TTA CTA ATA CAA TTG GAT GAA CAG TTG GGG CGG GTT 246 Leu Leu Gin Asn Leu Leu He Gin Leu Asp Glu Gin Leu Gly Arg Val 60 65 70

TCC AAA GAA AAA AAT CTG CTA TTG ATT CAC AAT CTA AAG AGA ATT AGA 294 Ser Lys Glu Lys Asn Leu Leu Leu He His Asn Leu Lys Arg He Arg 75 80 85

AAA GTT CTT CAG GGC AAG TTT CAT GGA AAT CCA ATG CAT GTA GCT GTG 342 Lys Val Leu Gin Gly Lys Phe His Gly Asn Pro Met His Val Ala Val 90 95 100

GTA ATT TCA AAT TGC TTA AGG GAA GAG AGG AGA ATA TTG GCT GCA GCC 390 Val He Ser Asn Cys Leu Arg Glu Glu Arg Arg He Leu Ala Ala Ala 105 110 115

AAC ATG CCT ATC CAG GGA CCT CTG GAG AAA TCC TTA CAG AGT TCT TCA 438 Asn Met Pro He Gin Gly Pro Leu Glu Lys Ser Leu Gin Ser Ser Ser 120 125 130 135

GTT TCT GAA AGA CAA AGG AAT GTG GAA CAC AAA GTG TCT GCC ATT AAA 486 Val Ser Glu Arg Gin Arg Asn Val Glu His Lys Val Ser Ala He Lys 140 145 150

AAC AGT GTG CAG ATG ACA GAA CAA GAT ACC AAA TAC TTA GAA GAC CTG 534 Asn Ser Val Gin Met Thr Glu Gin Asp Thr Lys Tyr Leu Glu Asp Leu 155 160 165

CAA GAT GAG TTT GAC TAC AGG TAT AAA ACA ATT CAG ACA ATG GAT CAG 582 Gin Asp Glu Phe Asp Tyr Arg Tyr Lys Thr He Gin Thr Met Asp Gin 170 175 180

GGT GAC AAA AAC AGT ATC CTG GTG AAC CAG GAA GTT TTG ACA CTG CTG 630 Gly Asp Lys Asn Ser He Leu Val Asn Gin Glu Val Leu Thr Leu Leu 185 190 195

CAA GAA ATG CTT AAT AGT CTG GAC TTC AAG AGA AAG GAA GCA CTC AGT 678 Gin Glu Met Leu Asn Ser Leu Asp Phe Lys Arg Lys Glu Ala Leu Ser 200 205 210 215 AAG ATG ACG CAG ATA GTG AAC GAG ACA GAC CTG CTC ATG AAC AGC ATG 726 Lys Met Thr Gin He Val Asn Glu Thr Asp Leu Leu Met Asn Ser Met 220 225 230

CTT CTA GAA GAG CTG CAG GAC TGG AAA AAG CGG CAC AGG ATT GCC TGC 774 Leu Leu Glu Glu Leu Gin Asp Trp Lys Lys Arg His Arg He Ala Cys 235 240 245

ATT GGT GGC CCG CTC CAC AAT GGG CTG GAC CAG CTT CAG AAC TGC TTT 822 He Gly Gly Pro Leu His Asn Gly Leu Asp Gin Leu Gin Asn Cys Phe 250 255 260

ACC CTA CTG GCA GAG AGT CTT TTC CAA CTC AGA CAG CAA CTG GAG AAA 870 Thr Leu Leu Ala Glu Ser Leu Phe Gin Leu Arg Gin Gin Leu Glu Lys 265 270 275

CTA CAG GAG CAA TCT ACT AAA ATG ACC TAT GAA GGG GAT CCC ATC CCT 918 Leu Gin Glu Gin Ser Thr Lys Met Thr Tyr Glu Gly Asp Pro He Pro 280 285 290 295

GCT CAA AGA GCA CAC CTC CTG GAA AGA GCT ACC TTC CTG ATC TAC AAC 966 Ala Gin Arg Ala His Leu Leu Glu Arg Ala Thr Phe Leu He Tyr Asn 300 305 310

CTT TTC AAG AAC TCA TTT GTG GTC GAG CGA CAC GCA TGC ATG CCA ACG 1014 Leu Phe Lys Asn Ser Phe Val Val Glu Arg His Ala Cys Met Pro Thr 315 320 325

CAC CCT CAG AGG CCG ATG GTA CTT AAA ACC CTC ATT CAG TTC ACT GTA 1062 His Pro Gin Arg Pro Met Val Leu Lys Thr Leu He Gin Phe Thr Val 330 335 340

AAA CTG AGA TTA CTA ATA AAA TTG CCG GAA CTA AAC TAT CAG GTG AAA 1110 Lys Leu Arg Leu Leu He Lys Leu Pro Glu Leu Asn Tyr Gin Val Lys 345 350 355

GTA AAG GCG TCC ATT GAC AAG AAT GTT TCA ACT CTA AGC AAT AGA AGA 1158 Val Lys Ala Ser He Asp Lys Asn Val Ser Thr Leu Ser Asn Arg Arg 360 365 370 375

TTT GTG CTT TGT GGA ACT CAC GTC AAA GCT ATG TCC AGT GAG GAA TCT 1206 Phe Val Leu Cys Gly Thr His Val Lys Ala Met Ser Ser Glu Glu Ser 380 385 390

TCC AAT GGG AGC CTC TCA GTG GAG TTA GAC ATT GCA ACC CAA GGA GAT 1254 Ser Asn Gly Ser Leu Ser Val Glu Leu Asp He Ala Thr Gin Gly Asp 395 400 405

GAA GTG CAG TAC TGG AGT AAA GGA AAC GAG GGC TGC CAC ATG GTG ACA 1302 Glu Val Gin Tyr Trp Ser Lys Gly Asn Glu Gly Cys His Met Val Thr 410 415 420

GAG GAG TTG CAT TCC ATA ACC TTT GAG ACC CAG ATC TGC CTC TAT GGC 1350 Glu Glu Leu His Ser He Thr Phe Glu Thr Gin He Cys Leu Tyr Gly 425 430 435

CTC ACC ATT AAC CTA GAG ACC AGC TCA TTA CCT GTC GTG ATG ATT TCT 1398 Leu Thr He Asn Leu Glu Thr Ser Ser Leu Pro Val Val Met He Ser 440 445 450 455

AAT GTC AGC CAA CTA CCT AAT GCA TGG GCA TCC ATC ATT TGG TAC AAT 1446 Asn Val Ser Gin Leu Pro Asn Ala Trp Ala Ser He He Trp Tyr Asn 460 465 470

GTA TCA ACT AAC GAC TCC CAG AAC TTG GTT TTC TTT AAT AAC CCT CCA 1494 Val Ser Thr Asn Asp Ser Gin Asn Leu Val Phe Phe Asn Asn Pro Pro 475 480 485 TCT GTC ACT TTG GGC CAA CTC CTG GAA GTG ATG AGC TGG CAA TTT TCA 1542 Ser Val Thr Leu Gly Gin Leu Leu Glu Val Met Ser Trp Gin Phe Ser 490 495 500

TCC TAT GTC GGT CGT GGC CTT AAT TCA GAG CAG CTC AAC ATG CTG GCA 1590 Ser Tyr Val Gly Arg Gly Leu Asn Ser Glu Gin Leu Asn Met Leu Ala 505 510 515

GAG AAG CTC ACA GTT CAG TCT AAC TAC AAT GAT GGT CAC CTC ACC TGG 1638 Glu Lys Leu Thr Val Gin Ser Asn Tyr Asn Asp Gly His Leu Thr Trp 520 525 530 535

GCC AAG TTC TGC AAG GAA CAT TTG CCT GGC AAA ACA TTT ACC TTC TGG 1686 Ala Lys Phe Cys Lys Glu His Leu Pro Gly Lys Thr Phe Thr Phe Trp 540 545 550

ACT TGG CTT GAA GCA ATA TTG GAC CTA ATT AAA AAA CAT ATT CTT CCC 1734 Thr Trp Leu Glu Ala He Leu Asp Leu He Lys Lys His He Leu Pro 555 560 565

CTC TGG ATT GAT GGG TAC ATC ATG GGA TTT GTT AGT AAA GAG AAG GAA 1782 Leu Trp He Asp Gly Tyr He Met Gly Phe Val Ser Lys Glu Lys Glu 570 575 580

CGG CTT CTG CTC AAA GAT AAA ATG CCT GGG ACA TTT TTG TTA AGA TTC 1830 Arg Leu Leu Leu Lys Asp Lys Met Pro Gly Thr Phe Leu Leu Arg Phe 585 590 595

AGT GAG AGC CAT CTT GGA GGG ATA ACC TTC ACC TGG GTG GAC CAA TCT 1878 Ser Glu Ser His Leu Gly Gly He Thr Phe Thr Trp Val Asp Gin Ser 600 605 610 615

GAA AAT GGA GAA GTG AGA TTC CAC TCT GTA GAA CCC TAC AAC AAA GGG 1926 Glu Asn Gly Glu Val Arg Phe His Ser Val Glu Pro Tyr Asn Lys Gly 620 625 630

AGA CTG TCG GCT CTG GCC TTC GCT GAC ATC CTG CGA GAC TAC AAG GTT 1974 Arg Leu Ser Ala Leu Ala Phe Ala Asp He Leu Arg Asp Tyr Lys Val 635 640 645

ATC ATG GCT GAA AAC ATC CCT GAA AAC CCT CTG AAG TAC CTC TAC CCT 2022 He Met Ala Glu Asn He Pro Glu Asn Pro Leu Lys Tyr Leu Tyr Pro 650 655 660

GAC ATT CCC AAA GAC AAA GCC TTT GGC AAA CAC TAC AGC TCC CAG CCG 2070 Asp He Pro Lys Asp Lys Ala Phe Gly Lys His Tyr Ser Ser Gin Pro 665 670 675

TGC GAA GTC TCA AGA CCA ACC GAA CGG GGA GAC AAG GGT TAC GTC CCC 2118 Cys Glu Val Ser Arg Pro Thr Glu Arg Gly Asp Lys Gly Tyr Val Pro 680 685 690 695

TCT GTT TTT ATC CCC ATT TCA ACA ATC CGA AGC GAT TCC ACG GAG CCA 2166 Ser Val Phe He Pro He Ser Thr He Arg Ser Asp Ser Thr Glu Pro 700 705 710

CAA TCT CCT TCA GAC CTT CTC CCC ATG TCT CCA AGT GCA TAT GCT GTG 2214 Gin Ser Pro Ser Asp Leu Leu Pro Met Ser Pro Ser Ala Tyr Ala Val 715 720 725

CTG AGA GAA AAC CTG AGC CCA ACG ACA ATT GAA ACT GCA ATG AAT TCC 2262 Leu Arg Glu Asn Leu Ser Pro Thr Thr He Glu Thr Ala Met Asn Ser 730 735 740

CCA TAT TCT GCT GAA TGACGGTGCA AACGGACACT TTAAAGAAGG AAGCAGATGA 2317 Pro Tyr Ser Ala Glu 745 AACTGGAGAG TGTTCTTTAC CATAGATCAC AATTTATTTC TTCGGCTTTG TAAATACC 2375

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 748 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Met Ser Gin Trp Asn Gin Val Gin Gin Leu Glu He Lys Phe Leu Glu 1 5 10 15

Gin Val Asp Gin Phe Tyr Asp Asp Asn Phe Pro Met Glu He Arg His 20 25 30

Leu Leu Ala Gin Trp He Glu Thr Gin Asp Trp Glu Val Ala Ser Asn 35 40 45

Asn Glu Thr Met Ala Thr He Leu Leu Gin Asn Leu Leu He Gin Leu 50 55 60

Asp Glu Gin Leu Gly Arg Val Ser Lys Glu Lys Asn Leu Leu Leu He 65 70 75 80

His Asn Leu Lys Arg He Arg Lys Val Leu Gin Gly Lys Phe His Gly 85 90 95

Asn Pro Met His Val Ala Val Val He Ser Asn Cys Leu Arg Glu Glu 100 105 110

Arg Arg He Leu Ala Ala Ala Asn Met Pro He Gin Gly Pro Leu Glu 115 120 125

Lys Ser Leu Gin Ser Ser Ser Val Ser Glu Arg Gin Arg Asn Val Glu 130 135 140

His Lys Val Ser Ala He Lys Asn Ser Val Gin Met Thr Glu Gin Asp 145 150 155 160

Thr Lys Tyr Leu Glu Asp Leu Gin Asp Glu Phe Asp Tyr Arg Tyr Lys 165 170 175

Thr He Gin Thr Met Asp Gin Gly Asp Lys Asn Ser He Leu Val Asn 180 185 190

Gin Glu Val Leu Thr Leu Leu Gin Glu Met Leu Asn Ser Leu Asp Phe 195 200 205

Lys Arg Lys Glu Ala Leu Ser Lys Met Thr Gin He Val Asn Glu Thr 210 215 220

Asp Leu Leu Met Asn Ser Met Leu Leu Glu Glu Leu Gin Asp Trp Lys 225 230 235 240

Lys Arg His Arg He Ala Cys He Gly Gly Pro Leu His Asn Gly Leu 245 250 255

Asp Gin Leu Gin Asn Cys Phe Thr Leu Leu Ala Glu Ser Leu Phe Gin 260 265 270

Leu Arg Gin Gin Leu Glu Lys Leu Gin Glu Gin Ser Thr Lys Met Thr 275 280 285 Tyr Glu Gly Asp Pro He Pro Ala Gin Arg Ala His Leu Leu Glu Arg 290 295 300

Ala Thr Phe Leu He Tyr Asn Leu Phe Lys Asn Ser Phe Val Val Glu 305 310 315 320

Arg His Ala Cys Met Pro Thr His Pro Gin Arg Pro Met Val Leu Lys 325 330 335

Thr Leu He Gin Phe Thr Val Lys Leu Arg Leu Leu He Lys Leu Pro 340 345 350

Glu Leu Asn Tyr Gin Val Lys Val Lys Ala Ser He Asp Lys Asn Val 355 360 365

Ser Thr Leu Ser Asn Arg Arg Phe Val Leu Cys Gly Thr His Val Lys 370 375 380

Ala Met Ser Ser Glu Glu Ser Ser Asn Gly Ser Leu Ser Val Glu Leu 385 390 395 400

Asp He Ala Thr Gin Gly Asp Glu Val Gin Tyr Trp Ser Lys Gly Asn 405 410 415

Glu Gly Cys His Met Val Thr Glu Glu Leu His Ser He Thr Phe Glu 420 425 430

Thr Gin He Cys Leu Tyr Gly Leu Thr He Asn Leu Glu Thr Ser Ser 435 440 445

Leu Pro Val Val Met He Ser Asn Val Ser Gin Leu Pro Asn Ala Trp 450 455 460

Ala Ser He He Trp Tyr Asn Val Ser Thr Asn Asp Ser Gin Asn Leu 465 470 475 480

Val Phe Phe Asn Asn Pro Pro Ser Val Thr Leu Gly Gin Leu Leu Glu 485 490 495

Val Met Ser Trp Gin Phe Ser Ser Tyr Val Gly Arg Gly Leu Asn Ser 500 505 510

Glu Gin Leu Asn Met Leu Ala Glu Lys Leu Thr Val Gin Ser Asn Tyr 515 520 525

Asn Asp Gly His Leu Thr Trp Ala Lys Phe Cys Lys Glu His Leu Pro 530 535 540

Gly Lys Thr Phe Thr Phe Trp Thr Trp Leu Glu Ala He Leu Asp Leu 545 550 555 560

He Lys Lys His He Leu Pro Leu Trp He Asp Gly Tyr He Met Gly 565 570 575

Phe Val Ser Lys Glu Lys Glu Arg Leu Leu Leu Lys Asp Lys Met Pro 580 585 590

Gly Thr Phe Leu Leu Arg Phe Ser Glu Ser His Leu Gly Gly He Thr 595 600 605

Phe Thr Trp Val Asp Gin Ser Glu Asn Gly Glu Val Arg Phe His Ser 610 615 620

Val Glu Pro Tyr Asn Lys Gly Arg Leu Ser Ala Leu Ala Phe Ala Asp 625 630 635 640 He Leu Arg Asp Tyr Lys Val He Met Ala Glu Asn He Pro Glu Asn 645 650 655

Pro Leu Lys Tyr Leu Tyr Pro Asp He Pro Lys Asp Lys Ala Phe Gly 660 665 670

Lys His Tyr Ser Ser Gin Pro Cys Glu Val Ser Arg Pro Thr Glu Arg 675 680 685

Gly Asp Lys Gly Tyr Val Pro Ser Val Phe He Pro He Ser Thr He 690 695 700

Arg Ser Asp Ser Thr Glu Pro Gin Ser Pro Ser Asp Leu Leu Pro Met 705 710 715 720

Ser Pro Ser Ala Tyr Ala Val Leu Arg Glu Asn Leu Ser Pro Thr Thr 725 730 735

He Glu Thr Ala Met Asn Ser Pro Tyr Ser Ala Glu 740 745

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2869 base pairs

(B⁾ TYPE: nucleic acid

(C) STRANDEDNESS : both

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Mouse

(vii) IMMEDIATE SOURCE:

(A) LIBRARY: splenic/thymic

(B) CLONE: Murine 19sf6

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 69..2378

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

GCCGCGACCA GCCAGGCCGG CCAGTCGGGC TCAGCCCGGA GACAGTCGAG ACCCCTGACT 60

GCAGCAGG ATG GCT CAG TGG AAC CAG CTG CAG CAG CTG GAC ACA CGC TAC 110 Met Ala Gin Trp Asn Gin Leu Gin Gin Leu Asp Thr Arg Tyr 1 5 10

CTG AAG CAG CTG CAC CAG CTG TAC AGC GAC ACG TTC CCC ATG GAG CTG 158 Leu Lys Gin Leu His Gin Leu Tyr Ser Asp Thr Phe Pro Met Glu Leu

15 . 20 25 30

CGG CAG TTC CTG GCA CCT TGG ATT GAG AGT CAA GAC TGG GCA TAT GCA 206 Arg Gin Phe Leu Ala Pro Trp He Glu Ser Gin Asp Trp Ala Tyr Ala 35 40 45

GCC AGC AAA GAG TCA CAT GCC ACG TTG GTG TTT CAT AAT CTC TTG GGT 254 Ala Ser Lys Glu Ser His Ala Thr Leu Val Phe His Asn Leu Leu Gly 50 55 60 GAA ATT GAC CAG CAA TAT AGC CGA TTC CTG CAA GAG TCC AAT GTC CTC 302 Glu He Asp Gin Gin Tyr Ser Arg Phe Leu Gin Glu Ser Asn Val Leu 65 70 75

TAT CAG CAC AAC CTT CGA AGA ATC AAG CAG TTT CTG CAG AGC AGG TAT 350 Tyr Gin His Asn Leu Arg Arg He Lys Gin Phe Leu Gin Ser Arg Tyr 80 85 90

CTT GAG AAG CCA ATG GAA ATT GCC CGG ATC GTG GCC CGA TGC CTG TGG 398 Leu Glu Lys Pro Met Glu He Ala Arg He Val Ala Arg Cys Leu Trp 95 100 105 110

GAA GAG TCT CGC CTC CTC CAG ACG GCA GCC ACG GCA GCC CAG CAA GGG 446 Glu Glu Ser Arg Leu Leu Gin Thr Ala Ala Thr Ala Ala Gin Gin Gly 115 120 125

GGC CAG GCC AAC CAC CCA ACA GCC GCC GTA GTG ACA GAG AAG CAG CAG 494 Gly Gin Ala Asn His Pro Thr Ala Ala Val Val Thr Glu Lys Gin Gin 130 135 140

ATG TTG GAG CAG CAT CTT CAG GAT GTC CGG AAG CGA GTG CAG GAT CTA 542 Met Leu Glu Gin His Leu Gin Asp Val Arg Lys Arg Val Gin Asp Leu 145 150 155

GAA CAG AAA ATG AAG GTG GTG GAG AAC CTC CAG GAC GAC TTT GAT TTC 590 Glu Gin Lys Met Lys Val Val Glu Asn Leu Gin Asp Asp Phe Asp Phe 160 165 170

AAC TAC AAA ACC CTC AAG AGC CAA GGA GAC ATG CAG GAT CTG AAT GGA 638 Asn Tyr Lys Thr Leu Lys Ser Gin Gly Asp Met Gin Asp Leu Asn Gly 175 180 185 190

AAC AAC CAG TCT GTG ACC AGA CAG AAG ATG CAG CAG CTG GAA CAG ATG 686 Asn Asn Gin Ser Val Thr Arg Gin Lys Met Gin Gin Leu Glu Gin Met 195 200 205

CTC ACA GCC CTG GAC CAG ATG CGG AGA AGC ATT GTG AGT GAG CTG GCG 734 Leu Thr Ala Leu Asp Gin Met Arg Arg Ser He Val Ser Glu Leu Ala 210 215 220

GGG CTC TTG TCA GCA ATG GAG TAC GTG CAG AAG ACA CTG ACT GAT GAA 782 Gly Leu Leu Ser Ala Met Glu Tyr Val Gin Lys Thr Leu Thr Asp Glu 225 230 235

GAG CTG GCT GAC TGG AAG AGG CGG CCA GAG ATC GCG TGC ATC GGA GGC 830 Glu Leu Ala Asp Trp Lys Arg Arg Pro Glu He Ala Cys He Gly Gly 240 245 250

CCT CCC AAC ATC TGC CTG GAC CGT CTG GAA AAC TGG ATA ACT TCA TTA 878 Pro Pro Asn He Cys Leu Asp Arg Leu Glu Asn Trp He Thr Ser Leu 255 260 265 270

GCA GAA TCT CAA CTT CAG ACC CGC CAA CAA ATT AAG AAA CTG GAG GAG 926 Ala Glu Ser Gin Leu Gin Thr Arg Gin Gin He Lys Lys Leu Glu Glu 275 280 285

CTG CAG CAG AAA GTG TCC TAC AAG GGC GAC CCT ATC GTG CAG CAC CGG 974 Leu Gin Gin Lys Val Ser Tyr Lys Gly Asp Pro He Val Gin His Arg 290 295 300

CCC ATG CTG GAG GAG AGG ATC GTG GAG CTG TTC AGA AAC TTA ATG AAG 1022 Pro Met Leu Glu Glu Arg He Val Glu Leu Phe Arg Asn Leu Met Lys 305 310 315

AGT GCC TTC GTG GTG GAG CGG CAG CCC TGC ATG CCC ATG CAC CCG GAC 1070 Ser Ala Phe Val Val Glu Arg Gin Pro Cys Met Pro Met His Pro Asp 320 325 330 CGG CCC TTA GTC ATC AAG ACT GGT GTC CAG TTT ACC ACG AAA GTC AGG 1118 Arg Pro Leu Val He Lys Thr Gly Val Gin Phe Thr Thr Lys Val Arg 335 340 345 350

TTG CTG GTC AAA TTT CCT GAG TTG AAT TAT CAG CTT AAA ATT AAA GTG 1166 Leu Leu Val Lys Phe Pro Glu Leu Asn Tyr Gin Leu Lys He Lys Val 355 360 365

TGC ATT GAT AAA GAC TCT GGG GAT GTT GCT GCC CTC AGA GGG TCT CGG 1214 Cys He Asp Lys Asp Ser Gly Asp Val Ala Ala Leu Arg Gly Ser Arg 370 375 380

AAA TTT AAC ATT CTG GGC ACG AAC ACA AAA GTG ATG AAC ATG GAG GAG 1262 Lys Phe Asn He Leu Gly Thr Asn Thr Lys Val Met Asn Met Glu Glu 385 390 395

TCT AAC AAC GGC AGC CTG TCT GCA GAG TTC AAG CAC CTG ACC CTT AGG 1310 Ser Asn Asn Gly Ser Leu Ser Ala Glu Phe Lys His Leu Thr Leu Arg 400 405 410

GAG CAG AGA TGT GGG AAT GGA GGC CGT GCC AAT TGT GAT GCC TCC TTG 1358 Glu Gin Arg Cys Gly Asn Gly Gly Arg Ala Asn Cys Asp Ala Ser Leu 415 420 425 430

ATC GTG ACT GAG GAG CTG CAC CTG ATC ACC TTC GAG ACT GAG GTG TAC 1406 He Val Thr Glu Glu Leu His Leu He Thr Phe Glu Thr Glu Val Tyr 435 440 445

CAC CAA GGC CTC AAG ATT GAC CTA GAG ACC CAC TCC TTG CCA GTT GTG 1454 His Gin Gly Leu Lys He Asp Leu Glu Thr His Ser Leu Pro Val Val 450 455 460

GTG ATC TCC AAC ATC TGT CAG ATG CCA AAT GCT TGG GCA TCA ATC CTG 1502 Val He Ser Asn He Cys Gin Met Pro Asn Ala Trp Ala Ser He Leu 465 470 475

TGG TAT AAC ATG CTG ACC AAT AAC CCC AAG AAC GTG AAC TTC TTC ACT 1550 Trp Tyr Asn Met Leu Thr Asn Asn Pro Lys Asn Val Asn Phe Phe Thr 480 485 490

AAG CCG CCA ATT GGA ACC TGG GAC CAA GTG GCC GAG GTG CTC AGC TGG 1598 Lys Pro Pro He Gly Thr Trp Asp Gin Val Ala Glu Val Leu Ser Trp 495 500 505 510

CAG TTC TCG TCC ACC ACC AAG CGA GGG CTG AGC ATC GAG CAG CTG ACA 1646 Gin Phe Ser Ser Thr Thr Lys Arg Gly Leu Ser He Glu Gin Leu Thr 515 520 525

ACG CTG GCT GAG AAG CTC CTA GGG CCT GGT GTG AAC TAC TCA GGG TGT 1694 Thr Leu Ala Glu Lys Leu Leu Gly Pro Gly Val Asn Tyr Ser Gly Cys 530 535 540

CAG ATC ACA TGG GCT AAA TTC TGC AAA GAA AAC ATG GCT GGC AAG GGC 1742 Gin He Thr Trp Ala Lys Phe Cys Lys Glu Asn Met Ala Gly Lys Gly 545 550 555

TTC TCC TTC TGG GTC TGG CTA GAC AAT ATC ATC GAC CTT GTG AAA AAG 1790 Phe Ser Phe Trp Val Trp Leu Asp Asn He He Asp Leu Val Lys Lys 560 565 570

TAT ATC TTG GCC CTT TGG AAT GAA GGG TAC ATC ATG GGT TTC ATC AGC ^" 1838 Tyr He Leu Ala Leu Trp Asn Glu Gly Tyr He Met Gly Phe He Ser 575 580 585 590

AAG GAG CGG GAG CGG GCC ATC CTA AGC ACA AAG CCC CCG GGC ACC TTC 1886 Lys Glu Arg Glu Arg Ala He Leu Ser Thr Lys Pro Pro Gly Thr Phe 595 600 605 CTA CTG CGC TTC AGC GAG AGC AGC AAA GAA GGA GGG GTC ACT TTC ACT 1934 Leu Leu Arg Phe Ser Glu Ser Ser Lys Glu Gly Gly Val Thr Phe Thr 610 615 620

TGG GTG GAA AAG GAC ATC AGT GGC AAG ACC CAG ATC CAG TCT GTA GAG 1982 Trp Val Glu Lys Asp He Ser Gly Lys Thr Gin He Gin Ser Val Glu 625 630 635

CCA TAC ACC AAG CAG CAG CTG AAC AAC ATG TCA TTT GCT GAA ATC ATC 2030 Pro Tyr Thr Lys Gin Gin Leu Asn Asn Met Ser Phe Ala Glu He He 640 645 650

ATG GGC TAT AAG ATC ATG GAT GCG ACC AAC ATC CTG GTG TCT CCA CTT 2078 Met Gly Tyr Lys He Met Asp Ala Thr Asn He Leu Val Ser Pro Leu 655 660 665 670

GTC TAC CTC TAC CCC GAC ATT CCC AAG GAG GAG GCA TTT GGA AAG TAC 2126 Val Tyr Leu Tyr Pro Asp He Pro Lys Glu Glu Ala Phe Gly Lys Tyr 675 680 685

TGT AGG CCC GAG AGC CAG GAG CAC CCC GAA GCC GAC CCA GGT AGT GCT 2174 Cys Arg Pro Glu Ser Gin Glu His Pro Glu Ala Asp Pro Gly Ser Ala 690 695 700

GCC CCG TAC CTG AAG ACC AAG TTC ATC TGT GTG ACA CCA ACG ACC TGC 2222 Ala Pro Tyr Leu Lys Thr Lys Phe He Cys Val Thr Pro Thr Thr Cys 705 710 715

AGC AAT ACC ATT GAC CTG CCG ATG TCC CCC CGC ACT TTA GAT TCA TTG 2270 Ser Asn Thr He Asp Leu Pro Met Ser Pro Arg Thr Leu Asp Ser Leu 720 725 730

ATG CAG TTT GGA AAT AAC GGT GAA GGT GCT GAG CCC TCA GCA GGA GGG 2318 Met Gin Phe Gly Asn Asn Gly Glu Gly Ala Glu Pro Ser Ala Gly Gly 735 740 745 750

CAG TTT GAG TCG CTC ACG TTT GAC ATG GAT CTG ACC TCG GAG TGT GCT 2366 Gin Phe Glu Ser Leu Thr Phe Asp Met Asp Leu Thr Ser Glu Cys Ala 755 760 765

ACC TCC CCC ATG TGAGGAGCTG AAACCAGAAG CTGCAGAGAC GTGACTTGAG 2418

Thr Ser Pro Met 770

ACACCTGCCC CGTGCTCCAC CCCTAAGCAG CCGAACCCCA TATCGTCTGA AACTCCTAAC 2478

TTTGTGGTTC CAGATTTTTT TTTTTAATTT CCTACTTCTG CTATCTTTGG GCAATCTGGG 2538

CACTTTTTAA AAGAGAGAAA TGAGTGAGTG TGGGTGATAA ACTGTTATGT AAAGAGGAGA 2598

GACCTCTGAG TCTGGGGATG GGGCTGAGAG CAGAAGGGAG GCAAAGGGGA ACACCTCCTG 2658

TCCTGCCCGC CTGCCCTCCT TTTTCAGCAG CTCGGGGGTT GGTTGTTAGA CAAGTGCCTC 2718

CTGGTGCCCA TGGCTACCTG TTGCCCCACT CTGTGAGCTG ATACCCCATT CTGGGAACTC 2778

CTGGCTCTGC ACTTTCAACC TTGCTAATAT CCACATAGAA GCTAGGACTA AGCCCAGGAG 2838

GTTCCTCTTT AAATTAAAAA AAAAAAAAAA A 2869

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 770 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

Met Ala Gin Trp Asn Gin Leu Gin Gin Leu Asp Thr Arg Tyr Leu Lys 1 5 10 15

Gin Leu His Gin Leu Tyr Ser Asp Thr Phe Pro Met Glu Leu Arg Gin 20 25 30

Phe Leu Ala Pro Trp He Glu Ser Gin Asp Trp Ala Tyr Ala Ala Ser 35 40 45

Lys Glu Ser His Ala Thr Leu Val Phe His Asn Leu Leu Gly Glu He 50 55 60

Asp Gin Gin Tyr Ser Arg Phe Leu Gin Glu Ser Asn Val Leu Tyr Gin 65 70 75 80

His Asn Leu Arg Arg He Lys Gin Phe Leu Gin Ser Arg Tyr Leu Glu 85 90 95

Lys Pro Met Glu He Ala Arg He Val Ala Arg Cys Leu Trp Glu Glu 100 105 110

Ser Arg Leu Leu Gin Thr Ala Ala Thr Ala Ala Gin Gin Gly Gly Gin 115 120 125

Ala Asn His Pro Thr Ala Ala Val Val Thr Glu Lys Gin Gin Met Leu 130 135 140

Glu Gin His Leu Gin Asp Val Arg Lys Arg Val Gin Asp Leu Glu Gin 145 150 155 160

Lys Met Lys Val Val Glu Asn Leu Gin Asp Asp Phe Asp Phe Asn Tyr 165 170 175

Lys Thr Leu Lys Ser Gin Gly Asp Met Gin Asp Leu Asn Gly Asn Asn 180 185 190

Gin Ser Val Thr Arg Gin Lys Met Gin Gin Leu Glu Gin Met Leu Thr 195 200 205

Ala Leu Asp Gin Met Arg Arg Ser He Val Ser Glu Leu Ala Gly Leu 210 215 220

Leu Ser Ala Met Glu Tyr Val Gin Lys Thr Leu Thr Asp Glu Glu Leu 225 230 235 240

Ala Asp Trp Lys Arg Arg Pro Glu He Ala Cys He Gly Gly Pro Pro 245 250 255

Asn He Cys Leu Asp Arg Leu Glu Asn Trp He Thr Ser Leu Ala Glu 260 265 270

Ser Gin Leu Gin Thr Arg Gin Gin He Lys Lys Leu Glu Glu Leu Gin 275 280 285

Gin Lys Val Ser Tyr Lys Gly Asp Pro He Val Gin His Arg Pro Met 290 295 300

Leu Glu Glu Arg He Val Glu Leu Phe Arg Asn Leu Met Lys Ser Ala 305 310 315 320

Phe Val Val Glu Arg Gin Pro Cys Met Pro Met His Pro Asp Arg Pro 325 330 335 Leu Val He Lys Thr Gly Val Gin Phe Thr Thr Lys Val Arg Leu Leu 340 345 350

Val Lys Phe Pro Glu Leu Asn Tyr Gin Leu Lys He Lys Val Cys He 355 360 365

Asp Lys Asp Ser Gly Asp Val Ala Ala Leu Arg Gly Ser Arg Lys Phe 370 375 380

Asn He Leu Gly Thr Asn Thr Lys Val Met Asn Met Glu Glu Ser Asn 385 390 395 400

Asn Gly Ser Leu Ser Ala Glu Phe Lys His Leu Thr Leu Arg Glu Gin 405 410 415

Arg Cys Gly Asn Gly Gly Arg Ala Asn Cys Asp Ala Ser Leu He Val 420 425 430

Thr Glu Glu Leu His Leu He Thr Phe Glu Thr Glu Val Tyr His Gin 435 440 445

Gly Leu Lys He Asp Leu Glu Thr His Ser Leu Pro Val Val Val He 450 455 460

Ser Asn He Cys Gin Met Pro Asn Ala Trp Ala Ser He Leu Trp Tyr 465 470 475 480

Asn Met Leu Thr Asn Asn Pro Lys Asn Val Asn Phe Phe Thr Lys Pro 485 490 495

Pro He Gly Thr Trp Asp Gin Val Ala Glu Val Leu Ser Trp Gin Phe 500 505 510

Ser Ser Thr Thr Lys Arg Gly Leu Ser He Glu Gin Leu Thr Thr Leu 515 520 525

Ala Glu Lys Leu Leu Gly Pro Gly Val Asn Tyr Ser Gly Cys Gin He 530 535 540

Thr Trp Ala Lys Phe Cys Lys Glu Asn Met Ala Gly Lys Gly Phe Ser 545 550 555 560

Phe Trp Val Trp Leu Asp Asn He He Asp Leu Val Lys Lys Tyr He 565 570 575

Leu Ala Leu Trp Asn Glu Gly Tyr He Met Gly Phe He Ser Lys Glu 580 585 590

Arg Glu Arg Ala He Leu Ser Thr Lys Pro Pro Gly Thr Phe Leu Leu 595 600 605

Arg Phe Ser Glu Ser Ser Lys Glu Gly Gly Val Thr Phe Thr Trp Val 610 615 620

Glu Lys Asp He Ser Gly Lys Thr Gin He Gin Ser Val Glu Pro Tyr 625 630 635 640

Thr Lys Gin Gin Leu Asn Asn Met Ser Phe Ala Glu He He Met Gly 645 650 655

Tyr Lys He Met Asp Ala Thr Asn He Leu Val Ser Pro Leu Val Tyr 660 665 670

Leu Tyr Pro Asp He Pro Lys Glu Glu Ala Phe Gly Lys Tyr Cys Arg 675 680 685 Pro Glu Ser Gin Glu His Pro Glu Ala Asp Pro Gly Ser Ala Ala Pro 690 695 700

Tyr Leu Lys Thr Lys Phe He Cys Val Thr Pro Thr Thr Cys Ser Asn 705 710 715 720

Thr He Asp Leu Pro Met Ser Pro Arg Thr Leu Asp Ser Leu Met Gin 725 730 735

Phe Gly Asn Asn Gly Glu Gly Ala Glu Pro Ser Ala Gly Gly Gin Phe 740 745 750

Glu Ser Leu Thr Phe Asp Met Asp Leu Thr Ser Glu Cys Ala Thr Ser 755 760 765

Pro Met 770

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: unknown iii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(v) FRAGMENT TYPE: internal

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens

(vii) IMMEDIATE SOURCE:

(B) CLONE: human Stat91

(X) PUBLICATION INFORMATION:

(H) DOCUMENT NUMBER: PCT/US93/02569 (I) FILING DATE: 19-MAR-1993

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:

Leu Asp Gly Pro Lys Gly Thr Gly Tyr He Lys Thr Glu Leu He 1 5 10 15

(2) INFORMATION FOR SEQ ID NO: 14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: GATCGAGATG TATTTCCCAG AAAAG 25

(2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:

Leu Asp Gly Pro Lys Gly Thr Gly Tyr He Lys Thr Glu Leu He 1 5 10 15

(2) INFORMATION FOR SEQ ID NO: 16:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids !B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(v) FRAGMENT TYPE: internal

( i) SEQUENCE DESCRIPTION: SEQ ID NO: 16:

Gly Tyr He Lys Thr Glu 1 5

(2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 14 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

Lys Val Asn Leu Gin Glu Arg Arg Lys Tyr Leu Lys His Arg 1 5 10

(2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 11 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:

Glu Pro Gin Tyr Glu Glu He Pro He Tyr Leu 1 5 10

(2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 105 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (v) FRAGMENT TYPE: internal

(vii) IMMEDIATE SOURCE: (B) CLONE: Src

(x) PUBLICATION INFORMATION:

(A) AUTHORS: aksman, et al .

(C) JOURNAL: Nature

(D) VOLUME: 358

(F) PAGES: 646-653

(G) DATE: 1992

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:

Ala Glu Glu Trp Tyr Phe Gly Lys He Thr Arg Arg Glu Ser Glu Arg 1 5 10 15

Leu Leu Leu Asn Pro Glu Asn Pro Arg Gly Thr Phe Leu Val Arg Glu 20 25 30 Ser Glu Thr Thr Lys Gly Ala Tyr Cys Leu Ser Val Ser Asp Phe Phe 35 40 45

Asp Asn Ala Lys Gly Leu Asn Val Lys His Tyr Lys He Arg Lys Leu 50 55 60

Asp Ser Gly Gly Phe Tyr He Thr Ser Arg Thr Gin Phe Ser Ser Leu 65 70 75 80

Gin Gin Leu Val Ala Tyr Tyr Ser Lys His Ala Asp Gly Leu Cys His 85 90 95

Arg Leu Thr Asn Val Cys Pro Thr Ser 100 105

(2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 99 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(v) FRAGMENT TYPE: internal

(vii) IMMEDIATE SOURCE:

(B) CLONE: Abl

(x) PUBLICATION INFORMATION:

(A) AUTHORS: Overduin, et al .

(C) JOURNAL: Proc. Natl. Acad. Sci. U.S.A.

(D) VOLUME: 89

(F) PAGES: 11673-11677

(G) DATE: 1992

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

Glu Lys His Ser Trp Tyr His Gly Pro Val Ser Arg Asn Ala Ala Glu 1 5 10 15

Tyr Leu Leu Ser Ser Gly He Asn Gly Ser Phe Leu Val Arg Glu Ser 20 25 30

Asp Arg Arg Pro Gly Gin Arg Ser He Ser Leu Arg Tyr Glu Glu Gly 35 40 45

Arg Val Tyr His Tyr Arg He Asn Thr Ala Ser Asp Gly Lys Leu Tyr 50 55 60

Val Ser Ser Glu Ser Arg Phe Asn Thr Leu Ala Glu Leu Val His His 65 70 75 80

His Ser Thr Val Ala Asp Gly Leu He Thr Thr Leu His Tyr Pro Ala 85 90 95

Pro Lys Arg

(2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 102 amino acids

(B) TYPE: amino acid

(CI STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(v) FRAGMENT TYPE: internal

(vii) IMMEDIATE SOURCE:

(B) CLONE: Lck

(x) PUBLICATION INFORMATION: (A) AUTHORS: Eck, et al .

(C) JOURNAL: Nature

(D) VOLUME: 362

(F) PAGES: 87-91

(G) DATE: 1993

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

Trp Phe Phe Lys Asn Leu Ser Arg Lys Asp Ala Glu Arg Gin Leu Leu 1 5 10 15

Ala Pro Gly Asn Thr His Gly Ser Phe Leu He Arg Glu Ser Glu Ser 20 25 30

Thr Ala Gly Ser Phe Ser Leu Ser Val Arg Asp Asp Phe Asp Gin Asn 35 40 45

Gin Gly Glu Val Val Lys His Tyr Lys He Arg Asn Leu Asp Asn Gly 50 55 60

Gly Phe Tyr He Ser Pro Arg He Thr Phe Pro Gly Leu His Asp Leu 65 70 75 80

Val Arg His Tyr Thr Asn Ala Ser Asp Gly Leu Cys Thr Arg Leu Ser 85 90 95

Arg Pro Cys Gin Thr Gin 100

(2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 99 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(v) FRAGMENT TYPE: internal

(vii) IMMEDIATE SOURCE: (B ) CLONE : p85 [alpha] N

(xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 23 :

Gin Asp Ala Glu Trp Tyr Trp Gly Asp He Ser Arg Glu Glu Val Asn 1 5 10 15

Glu Lys Leu Arg Asp Thr Ala Asp Gly Thr Phe Leu Val Arg Asp Ala 20 25 30

Ser Thr Lys Met His Gly Asp Tyr Thr Leu Thr Leu Arg Lys Gly Gly 35 40 45

Asn Asn Lys Leu He Lys He Phe His Arg Asp Gly Lys Tyr Gly Phe 50 55 60

Ser Asp Pro Leu Thr Phe Asn Ser Val Val Glu Leu He Asn His Tyr 65 70 75 80

Arg His Glu Ser Leu Ala Gin Tyr Asn Pro Lys Leu Asp Val Lys Leu 85 90 95

Leu Tyr Pro

Claims

WHAT IS CLAIMED IS:

1 1. A receptor recognition factor implicated in the transcriptional stimulation of

2 genes in target cells in response to the binding of a specific polypeptide ligand to

3 its cellular receptor on said target cell, said receptor recognition factor having the

4 following characteristics:

5 a) apparent direct interaction with the ligand-bound receptor and

6 activation of one or more transcription factors capable of binding with a specific

7 gene;

8 b) an activity demonstrably unaffected by the presence or concentration

9 of second messengers;

10 c) direct interaction with tyrosine kinase domains; l i d) a perceived absence of interaction with G-proteins.

12 e) an amino acid sequence selected from the group consisting of SEQ

13 ID NO:8, SEQ ID NO: 10, and SEQ ID NO: 12.

1 2. The receptor recognition factor of Claim 1 labeled with a detectable label.

• 1 3. The receptor recognition factor of Claim 2 wherein the label is selected

2 from enzymes, chemicals which fluoresce and radioactive elements.

1 4. An antibody to a receptor recognition factor, the factor to which said

2 antibody is raised having the following characteristics:

3 a) apparent direct interaction with the ligand-bound receptor and

4 activation of one or more transcription factors capable of binding with a specific

5 gene;

6 b) an activity demonstrably unaffected by the presence or concentration

7 of second messengers;

8 c) direct interaction with tyrosine kinase domains;

9 d) a perceived absence of interaction with G-proteins; and e) an amino acid sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO: 10, and SEQ ID NO: 12.

5. The antibody of Claim 4 which is a polyclonal antibody.

6. The antibody of Claim 4 which is a monoclonal antibody.

7. An immortal cell line that produces a monoclonal antibody according to Claim 6.

8. The antibody of Claim 4 labeled with a detectable label.

9. The antibody of Claim 8 wherein the label is selected from enzymes, chemicals which fluoresce and radioactive elements.

10. An isolated DNA sequence or degenerate variant thereof, which encodes a receptor recognition factor, or a fragment thereof, selected from the group consisting of: (A) the DNA sequence of SEQ ID NO:7 (FIGURE 1); (B) the DNA sequence of SEQ ID NO:9 (FIGURE 2); (C) the DNA sequence of SEQ ID NO: 11 (FIGURE 3); (D) DNA sequences that hybridize to any of the foregoing DNA sequences under standard hybridization conditions; and (E) DNA sequences that code on expression for an amino acid sequence encoded by any of the foregoing DNA sequences.

11. A recombinant DNA molecule comprising a DNA sequence or degenerate variant thereof, which encodes a receptor recognition factor, or a fragment thereof, selected from the group consisting of: (A) the DNA sequence of SEQ ID NO: 7 (FIGURE 1); (B) the DNA sequence of SEQ ID NO:9 (FIGURE 2); (C) the DNA sequence of SEQ ID NO: 11 (FIGURE 3); (D) DNA sequences that hybridize to any of the foregoing DNA sequences under standard hybridization conditions; and (E) DNA sequences that code on expression for an amino acid sequence encoded by any of the foregoing DNA sequences.

12. The recombinant DNA molecule of either of Claims 10 or 11, wherein said DNA sequence is operatively linked to an expression control sequence.

13. A probe capable of screening for the receptor recognition factor in alternate species prepared from the DNA sequence of Claim 10.

14. A unicellular host transformed with a recombinant DNA molecule comprising a DNA sequence or degenerate variant thereof, which encodes a receptor recognition factor, or a fragment thereof, selected from the group consisting of: (A) the DNA sequence of SEQ ID NO:7 (FIGURE 1); (B) the DNA sequence of SEQ ID NO: 9 (FIGURE 2); (C) the DNA sequence of SEQ ID NO: 11 (FIGURE 3); (D) DNA sequences that hybridize to any of the foregoing DNA sequences under standard hybridization conditions; and (E) DNA sequences that code on expression for an amino acid sequence encoded by any of the foregoing DNA sequences; wherein said DNA sequence is operatively linked to an expression control sequence.

15. A method for detecting the presence or activity of a receptor recognition factor, said receptor recognition factor having an amino acid sequence selected from the group consisting of SEQ ID NO: 8. SEQ ID NO: 10, and SEQ ID NO: 12, wherein said receptor recognition factor is measured by: A. contacting a biological sample from a mammal in which the presence or activity of said receptor recognition factor is suspected with a binding partner of said receptor recognition factor under conditions that allow binding of said receptor recognition factor to said binding partner to occur; and B. detecting whether binding has occurred between said receptor recognition factor from said sample and the binding partner; wherein the detection of binding indicates that presence or activity of said receptor recognition factor in said sample.

16. A method for detecting the presence and activity of a polypeptide ligand associated with a given invasive stimulus in mammals comprising detecting the presence or activity of a receptor recognition factor according to the method of Claim 15, wherein detection of the presence or activity of the receptor recognition factor indicates the presence and activity of a polypeptide ligand associated with a given invasive stimulus in mammals.

17. The method of Claim 16 wherein said invasive stimulus is selected from the group consisting of viral infection, protozoan infection, tumorous mammalian cells, and toxins.

18. A method for detecting the binding sites for a receptor recognition factor, said receptor recognition factor having an amino acid sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO: 10, and SEQ ID NO: 12, wherein the binding sites for said receptor recognition factor are measured by: A. placing a labeled receptor recognition factor sample in contact with a biological sample from a mammal in which binding sites for said receptor recognition factor are suspected; B. examining said biological sample in binding studies for the presence of said labeled receptor recognition factor; wherein the presence of said labeled recognition factor indicates a binding site for a receptor recognition factor.

19. A method of testing the ability of a drug or other entity to modulate the activity of a receptor recognition factor which comprises A. culturing a colony of test cells which has a receptor for the receptor recognition factor in a growth medium containing the receptor recognition factor; B. adding the drug under test; and C. measuring the reactivity of said receptor recognition factor with the receptor on said colony of test cells, wherein said receptor recognition factor has an amino acid sequence selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 12.

20. An assay system for screening drugs and other agents for ability to modulate the production of a receptor recognition factor, comprising: A. culturing an observable cellular test colony inoculated with a drug or agent; B. harvesting a supernatant from said cellular test colony; and C. examining said supernatant for the presence of said receptor recognition factor wherein an increase or a decrease in a level of said receptor recognition factor indicates the ability of a drug to modulate the activity of said receptor recognition factor, said receptor recognition factor having an amino acid sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO: 10, and SEQ ID NO: 12.

21. A test kit for the demonstration of a receptor recognition factor in a eukaryotic cellular sample, comprising: A. a predetermined amount of a detectably labelled specific binding partner of a receptor recognition factor, said receptor recognition factor having the an amino acid sequence selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 12; B. other reagents; and C. directions for use of said kit.

22. A test kit for demonstrating the presence of a receptor recognition factor in a eukaryotic cellular sample, comprising: A. a predetermined amount of a receptor recognition factor, said receptor recognition factor having the an amino acid sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO: 10, and SEQ ID NO: 12; B. a predetermined amount of a specific binding partner of said receptor recognition factor; C. other reagents; and D. directions for use of said kit; wherein either said receptor recognition factor or said specific binding partner are detectably labelled.

23. The test kit of Claim 21 or 22 wherein said labeled immunochemically reactive component is selected from the group consisting of polyclonal antibodies to the receptor recognition factor, monoclonal antibodies to the receptor recognition factor, fragments thereof, and mixtures thereof.

24. Use of a material selected from the group consisting of a receptor recognition factor, an agent capable of promoting the production and/or activity of said receptor recognition factor, an agent capable of mimicking the activity of said receptor recognition factor, an agent capable of inhibiting the production of said receptor recognition factor, and mixtures thereof, or a specific binding partner thereto, said receptor recognition factor having an amino acid sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO: 10, and SEQ ID NO: 12, in the manufacture of a medicament for preventing and/or treating cellular debilitations, derangements and/or dysfunctions and/or other disease states in mammals.

25. The use according to Claim 24 wherein said disease states include chronic viral hepatitis, hairy cell leukemia, and tumorous conditions.

26. A pharmaceutical composition for the treatment of cellular debilitation, derangement and/or dysfunction in mammals, comprising: A. a therapeutically effective amount of a material selected from the group consisting of a receptor recognition factor, an agent capable of promoting the production and/or activity of said receptor recognition factor, an agent capable of mimicking the activity of said receptor recognition factor, an agent capable of inhibiting the production of said receptor recognition factor, and mixtures thereof, or a specific binding partner thereto, said receptor recognition factor having an amino acid sequence selected from the group consisting of SEQ JD NO:8, SEQ ID NO: 10, and SEQ ID NO: 12; and B. a pharmaceutically acceptable carrier.

27. A method of determining the interferon-related pharmacological activity of a compound comprising: administering the compound to non-human a mammal; determining the level of phosphorylated ISGF3 proteins present, wherein said phosphorylated ISGF3 proteins are proteins having an amino acid sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO: 10, and SEQ ID NO: 12; and comparing the level of ISGF3 protein-phosphate to a standard.

28. An antisense nucleic acid against a receptor recognition factor mRNA comprising a nucleic acid sequence hybridizing to said mRNA, wherein said receptor recognition factor has an amino acid sequence selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 12.

29. The antisense nucleic acid of Claim 28 which is RNA or DNA.

30. A recombinant DNA molecule having a DNA sequence which, on transcription, produces an antisense ribonucleic acid against a receptor recognition factor mRNA, said antisense ribonucleic acid comprising an nucleic acid sequence capable of hybridizing to said mRNA, wherein said receptor recognition factor has an amino acid sequence selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 12.

31. A receptor recognition factor-producing cell line transfected with the recombinant DNA molecule of Claim 30.

32. A method for creating a cell line which exhibits reduced expression of a receptor recognition factor, comprising transfecting a recognition factor-producing cell line with a recombinant DNA molecule of claim 30.

33. A ribozyme that cleaves receptor recognition factor mRNA, wherein said receptor recognition factor has an amino acid sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO: 10, and SEQ ID NO: 12.

34. A recombinant DNA molecule having a DNA sequence which, upon transcription, produces the ribozyme of claim 33.

35. A receptor recognition factor-producing cell line transfected with the recombinant DNA molecule of claim 34.

36. A method for creating a cell line which exhibits reduced expression of a receptor recognition factor, comprising transfecting a recognition factor-producing cell line with the recombinant DNA molecule of claim 33.