EP0694072A1

EP0694072A1 - Transposition assembly for gene transfer in eukaryotes

Info

Publication number: EP0694072A1
Application number: EP94913647A
Authority: EP
Inventors: Eric Jacobs
Original assignee: Transgene SA
Current assignee: Transgene SA
Priority date: 1993-04-16
Filing date: 1994-04-14
Publication date: 1996-01-31
Also published as: AU6571994A; FR2703996B1; WO1994024300A1; JPH08508878A; CA2160697A1; US6346414B1; AU686156B2; FR2703996A1

Abstract

A transposition assembly for the transfer of a DNA fragment of interest into the ribosomal nuclear DNA of an eukaryotic cell. An insertion means, an eukaryotic cell and a pharmaceutical composition comprising said transposition assembly, as well as a method for the in vitro transfer of said DNA fragment, are also disclosed.

Description

TRANSPOSITION ASSEMBLY FOR GENE TRANSFER IN EUKARYOTS

The subject of the present invention is a set of transposition allowing the transfer of genes of interest into the genome of a eukaryotic cell or organism. Such a set is particularly useful for the purpose of gene therapy.

Many elements that can be implemented by integrating genes of interest into the eukaryotic genome have been described in the publications of the prior art. The conventional elements are either integrative vectors, for example retroviral vectors, or non-integrative vectors, for example adenoviral vectors. However, these vectors of the prior art do not only have advantages.

Indeed, retroviral vectors integrate randomly in a non-specific way into the cell genome. Thus, the risk of insertional mutagenesis linked either to the inactivation of genes essential to the cell, or to the activation of oncogenes which can give rise to tumor proliferation, should not be overlooked before considering their use in therapy human gene.

As regards the non-integrative vectors, they have drawbacks linked to instability due to their non-integration into the cell genome, which requires their regularly renewed administration. As part of gene therapy intended for humans, this risks posing long-term problems of immunization against the recombinant virus, patients regularly treated.

A third type of method, more recently described, allows the transfer of genes of interest by homologous recombination into a defined site of the cell genome. However, the homologous recombination technique still faces many technical difficulties. In addition, non-homologous recombination events may also occur, so that the risk of insertional mutagenesis remains.

On the other hand, the prior art has long established the organization and expression scheme of ribosomal DNA (rDNA) in eukaryotes (Reeder, Trends Genêt. 1990, 6, 390-395). Generally, rDNA is made up of multiple copies of transcription units arranged in tandems. A transcription unit is made up of the genes coding respectively for the 18S or 16S, 5-8S and 28S or 26S rRNAs, which enter into the constitution of the ribosome (hereinafter referred to as the 18S rRNA gene etc.). Each gene is separated from the next by transcribed sequences, the exact role of which has not yet been defined. The three rRNA genes included in a transcriptional unit are placed under the control of a single promoter located upstream in the non-transcribed region which separates one unit from the next. The rDNA units are transcribed by RNA polymerase I into a long molecule of precursor rRNA (pre rRNA), which is then grown to produce the three main types of rRNA associated with ribosomal subunits.

Numerous publications have reported the frequent presence of foreign genetic elements in the eukaryotic rDNA. Among these genetic elements, mention may be made of class I or II introns and retroposons, for example of class RI, R2 or R3. The presence of these foreign elements can possibly inactivate a fraction of the transcriptional units of rDNA. This does not seem to have serious consequences for the life of the organisms containing them. This phenomenon has mainly been described in Drosophila.

The introns of classes I and II are defined by the existence of conserved sequences forming structural elements characteristic of each of the classes as defined by Cech and Bass (1 86, Annu. Rev. Biochem. 55_, 599-629). Several authors have observed that certain class I and II introns are mobile. They can be copied and transferred specifically into copies of genes which lack them (intron "). This transposition process, at least in most cases, turns out to be specific from the point of view of the region of insertion. Among the sixty class I introns characterized so far, the majority are localized in the mitochondria and chloroplast genes. The prior art mentions, in only three cases, the presence of mobile class I introns in nuclear genes. These introns have been demonstrated in the rRNA genes of three lower eukaryotic species, respectively the 26S rRNA genes of several strains of Tetrahymena (Kan and Gall, 1982, Nucl. Acids Res., 10, 2809-2821) and of the Carolina strain of Physarum polycephal m, (Muscarella and Vogt, 1989, Cell, 56, 443-454; this mobile intron being designated hereafter intron 3) and finally in the 16S rRNA gene of Pneumocystis carinii (Edman et al. , 1988, Nature, 334, 519-522). So far, it has not been possible to demonstrate the presence of introns interrupting the rRNA genes of higher eukaryotes.

The intron 3 of Physarum polycephalum is the best characterized. Its mobility has been demonstrated experimentally (Muscarella and Vogt, 1989, Cell, 56, 443-454). This intron partly codes for a protein of 160 amino acids (Muscarella et al., 1990,

Mol. Cel. Biol., 10, 3386-3396). The putative translation initiation codon is located upstream of the intron, at the 3 'end of the adjacent exon sequence 5' to the intron.

The protein, encoded by intron 3, is an endonuclease which recognizes a target sequence of at least 18 base pairs (bp) present in the insertion region and is capable of cleaving this sequence exactly at the insertion site intron 3 (Muscarella and Vogt, 1989, Cell, 56, 443-454).

The target sequence recognized by the endonuclease comprises the following sequence: 5'CTATGACTCTCTTAAGGTAGCCAAA3 '

It is assumed that the transposition of intron 3 is initiated by the recognition of the particular target sequence by the endonuclease specifically encoded by intron 3, followed by cutting of the two strands of the DNA molecule at this level. particular sequence, thus freeing the insertion site. Then by an exchange of fibers involving the flanking sequences 5 ′ and 3 ′ of the insertion site, copy of the intronic sequence and recombination, intron 3 is inserted into the copy of the intron rRNA gene ", precisely and site -specific. Once intron 3 has been inserted into a copy of the intron gene ", the target sequence recognized by the endonuclease is interrupted by the intronic sequence as follows: 5'CTATGACTCTCT intron 3 TAAGGTAGCCAAA3 '

On the other hand, retroposons also seem to be present in the rDNA of certain eukaryotes. In general, retroposons form a very large and very heterogeneous group, in particular at the level of their nucleotide sequence. By retroposon, we hear elements related to retroviruses, but devoid of "long terminal repeats" (LTR). They include one or more open reading frame (s) capable of coding for proteins having a homology with retroviral proteins, such as for example reverse transcriptase (Jakubczak et al., 1991, Proc. Natl Acad. Sci. USA, 88, 3295-3299).

In a number of non-mammalian eukaryotes, notably insects, retroposons have been found with remarkable insertion specificity, localized at the level of the rRNA genes. The mobility of some of them has been observed. Several families (notably RI, R2 and R3) have been defined as a function of their specific region of insertion into the rRNA genes.

The retroposons of the classes RI and R2 are notably illustrated by the retroposons RIBm and R2Bm of Bombyx ori (Xiong and Eickbush, 1988, Cell, 55, 235-246; Xiong and Eickbush, 1988, Mol. Cell. Biol., 8, 1 14-123; Xiong et al., 1988, Nucl. Ac. Res., 16, 10561-10573) and the RIDm and R2Dm retroposons of Drosophila melanogaster (Jakubczak et al., 1990, J. Mol. Biol., 212, 37-52). They contain an open reading frame capable of coding for a large protein, the central part of which exhibits homology with the family of reverse transcriptases. Xiong and Eickbush (1988, Cell, 55, 235-246) report that the protein encoded by the retroposon R2Bm from Bombyx mori also exhibits endonuclease activity. This nuclease recognizes and cleaves a target sequence contained in the R2Bm insertion region located in the 28S rRNA gene of the insect genome.

A new class of ribosomal retroposons, designated R3, has recently been highlighted. A protein encoded by this element has not yet been characterized. However, the specific insertion region of the R3 element in the rDNA of Scaria coprophila has been described (Kerrebrock et al., J. Mol. Biol., 1989, 210, 1-13).

Besides retroposons, there are a large number of mobile genetic elements which have sometimes been referred to as retroposons by the authors describing them, but which have not yet been shown to code for a protein with homology. with the family of retroviral proteins, in particular reverse transcriptase. This type of element has also been found at the level of well-defined sequences of rRNA genes of the organisms containing them (see for example Back et al., 1984, EMBO J., 3, 2523-2529).

Surprisingly, we have now found that on the one hand the target sequences recognized by the endonucleases encoded by the two mobile genetic elements for which data are available (intron 3 from Physarum polycephalum and retroposon R2Bm from Bombyx mon) and on the other hand the regions of insertion of certain mobile genetic elements which have not yet been shown to code for an endonuclease and which have been disclosed in the prior art (Jakubczak et al., 1991, Proc. Natl. Acad. Sci. USA, 88, 3295-3299; Pask itz and Collins, 1989, Nucleic Acid Res., 17, 8125-8133; Kerrebrock et al., 1989, J. Mol. Biol., 210, 1-13; Kan and Gall, 1982, Nucleic Acid Res., 10, 2809-2821; Edman et al., 1988, Nature, 263, 519- 522), are conserved in the rRNA genes of various mammals, notably humans and mice. Thus, the sequences of the insertion regions of the mobile introns of Telrahymena, of Pneumocystis carinii and of Physarum polycephalum, and of the retroposons R2Bm of Bombyx mori, and R3 of Scaria coprophila are conserved identically in the rRNA genes of mammals. In contrast, the sequences of the insertion region of the RIDm and RIBm retroposons are homologous but not identical to a sequence present in the mammalian rSR 28 S gene.

Consequently, the subject of the present invention is a transposition assembly intended for the transfer of a DNA fragment of interest into the genome of a eukaryotic host cell, which comprises an integration cassette, essentially consisting of an element mobile genetics into which said DNA fragment of interest is inserted; said integration cassette being capable of integrating in a site-specific fashion into a specific insertion site located in the ribosomal nuclear DNA of said host cell.

A transposition set according to the invention has the advantage of allowing the integration of a DNA fragment of interest in a defined and nonessential region of the cell genome. Such a set is particularly useful for the purposes of gene therapy.

For the purposes of the present invention, the integration cassette must contain a mobile genetic element which has the capacity to integrate by a site-specific mechanism, into nuclear rDNA, in particular at the level of the 28S, 18S rRNA gene. or 5-8S. More specifically, this mobile genetic element must integrate into an insertion site located in an insertion region whose sequence is conserved identically or not in the nuclear rDNA of the host cell.

For a better understanding, it is specified that the term "insertion site" defines the place between 2 nucleotides where a mobile genetic element is inserted. Likewise, by "insertion region" is meant the nucleotide sequences 5 'and 3' of the insertion site which are required for site-specific transposition. In general, each mobile genetic element has a specific insertion region. As mentioned previously for the RIBm and RIDm retroposons, it the region of insertion into the host cell is not required to contain the sequences of the region of natural insertion (in the organism of origin) identical. Thus, the sequence of the insertion region of said mobile genetic element in the eukaryotic host cell will have a degree of homology with the sequence of the natural insertion region greater than 80%, advantageously greater than 90% and preferably greater than 95%.

The mobile genetic element is advantageously selected from mobile introns of class I or II, and retroposons such as retroposons of class RI R2 or R3.

A mobile genetic element can consist of a functional fragment or a variant of said element. By functional fragment is meant any fragment that has retained the ability to integrate with the complete element. A variant may include one or more mutations with respect to the element's natural nucleotide sequence, in particular the substitution, addition or deletion of one or more nucleotide (s), provided that these mutations do not alter their function.

More specifically, the mobile genetic element is selected from:

the intron 3 of Physarum polycephalum, strain Caroîina, a fragment or a variant of said intron, the mobile intron class I of Telrahymena, a fragment or a variant of said intron, the mobile intron class I of Pneumocystis carinii, a fragment or variant of said intron, the retroposon R2Bm of Bombyx mori, a fragment or a variant of said retroposon and, the retroposon R3 of Scaria coprophila, a fragment or a variant of said retroposon.

The presence in this mobile genetic element, of all or part of an open reading frame capable of coding for an integrase, is a preferred characteristic.

In general, by integrase is meant a protein having an enzymatic activity allowing it to participate directly or indirectly in the transposition of the mobile genetic element specifically at its insertion site in the nuclear rDNA of a eukaryotic cell.

Advantageously, the integrase can be constituted in particular by: (1) a protein exhibiting endonuclease activity capable of recognizing a specific target sequence included in the insertion region of the mobile genetic element which codes for it and of cleaving said target sequence, or

(2) a protein exhibiting homology with the family of reverse transcriptases.

Mention may be made, for example, of the endonuclease partially encoded by intron 3 of Physarum popycephalum. This endonuclease initiates the transposition of intron 3 by recognizing its target sequence and cleaving the DNA molecule at this specific sequence.

Mention may also be made of the protein encoded by the retroposon R2Bm from Bombyx mori. The endonuclease activity of said protein is probably involved in the transposition of R2Bm at its specific insertion region but by a mechanism which is not known to date.

The DNA fragment of interest can be introduced into the mobile genetic element by conventional techniques of genetic engineering. It can be integrated into or outside the open reading frame coding for a possible integrase.

According to a particularly advantageous aspect of the invention, the DNA fragment of interest is inserted into the open reading frame, in order to prevent the expression of the integrase. This introduces security to avoid the uncontrolled propagation of the integration cassette into the genome of the host cell.

In this case, the specific integrase of the mobile genetic element used in the transposition assembly according to the invention must be supplied to the host cell in a transient manner for a time long enough to allow the transposition of the cassette. integration in its specific region of insertion. The means of supplying a protein to a eukaryotic cell in trans are numerous and known to those skilled in the art.

For example, the transposition assembly according to the invention can be introduced into a vector (as defined below), further comprising a cassette for expression of the specific integrase of the mobile genetic element present in the transposition set.

Alternatively, the eukaryotic host cell can be transfected in parallel with a helper vector comprising an integrase expression cassette or the integrase can be supplied to the host cell in purified form. The DNA fragment of interest can be any fragment capable of being transcribed into RNA to produce an antisense RNA, for example an RNA sequence complementary to a pathogenic gene capable of forming a duplex with a pathogenic transcript in order to inhibit translation into pathogenic protein. A pathogenic gene is: (1) a gene which is not present in eukaryotic cells, for example a gene present in the genome of a pathogenic organism (bacteria, virus or parasite), or (2) a homologous gene or a mutated homologous gene, for example an oncogene, which is present but normally not expressed in normal eukaryotic cells and whose abnormally induced expression can cause a disease such as cancer.

Alternatively, the DNA fragment of interest can code for a protein of interest and, preferably, a protein whose absence of expression or expression in abnormal amount or in mutant form is associated with a disease. genetic.

The DNA fragment of interest can code for a mature protein or a precursor thereof. In the first case, it comprises the coding sequence for a mature protein allowing expression of the protein intracellularly. In the latter case, the DNA fragment of interest can also include a signal sequence allowing the secretion of said protein from the host cell. The DNA fragment of interest can code for a chimeric protein originating from the fusion of sequences of various origins.

Examples of proteins that can be encoded by the DNA fragment of interest include:

cytokines, such as alpha interferon, gamma interferon and different types of growth factors, membrane receptors, such as receptors involved in the transmission of surface signals inside cells and receptors recognized by organisms pathogens, such as the CD4 receptor present on the surface of T lymphocytes and recognized by the envelope glycoprotein of the HIV virus (Human Immunodeficiency Virus), - enzymes, such as ribonucleases and thymidine kinase (TK) of the simplex virus herpes type I (HSV-1). The latter has a higher affinity compared to the mammalian cell enzyme TK for certain nucleoside analogues, such as acyclovir or gancyclovir. The TK-HSV-1 enzyme converts analogs to precursors of nucleotides. These toxic precursors will therefore be incorporated into the DNA of cells in the replicating state. This incorporation makes it possible to specifically kill dividing cells, such as cancer cells, - inhibitors of enzymatic activity, such as alpha antitrypsin, antithrombin III, protein C and inhibitors of proteases specific for a pathogenic organism , coagulation factors, like factor VIII, factor IX and thrombin, - proteins participating in ion channels, like protein CFTR

(Cystic Fibrosis Transmembrane Conductance Regulator), proteins capable of inhibiting the activity of a protein produced by a pathogenic gene, such as the tumor suppressor antigen p53, variants of pathogenic proteins mutated so as to alter their biological function, as trans-dominant mutants of the TAT regulatory protein of the HIV virus capable of competing with the native viral protein for binding to the target sequence, preventing the activation of expression of viral genes and, antigenic epitopes allowing increase the immunity of the host cell.

The DNA fragment of interest can be mutated in order to allow the expression of a protein of interest whose biological properties are modified, for example a variant of the alpha antitrypsin whose methionine residue at position 358 of the active site has been replaced by a leucine. Such a variant is functional under oxidation conditions such as ignition conditions.

Once the integration cassette has been introduced into the rDNA of the host cell, the DNA fragment of interest can be placed under the control of the promoter of the transcriptional unit of the rDNA of the host cell. Alternatively, the DNA fragment of interest can be placed under the control of appropriate expression elements inserted into the mobile genetic element. Expression here means transcription into RNA and / or translation of this RNA into protein.

According to this alternative, the expression control elements notably comprise an appropriate promoter. Such promoters are well known to those skilled in the art and are inserted upstream of the DNA fragment of interest by conventional techniques of genetic engineering. The promoter selected can be a promoter recognized by RNA polymerase I, so as to promote the expression of the DNA fragment of interest, after integration of the integration cassette into the rRNA genes of the eukaryotic host cell. For example, the DNA fragment of interest can be placed under the control of the regulatory elements included in the non-transcribed regions of the rDNA involved in the transcription of the rRNA genes. Such promoters will be chosen so as to be functional in the eukaryotic host cell which has been retained.

Alternatively, the promoter chosen can be a promoter recognized by RNA polymerase II. Such promoters are well known to those skilled in the art. The promoter can be isolated from a cell gene or from a virus. It can be ubiquitous allowing permanent expression of the DNA fragment of interest in all types of host cells. The term promoter also includes a regulatable promoter, for example a tissue-specific promoter. Mention may in particular be made of the promoter of the HMG gene (Hydroxy-Methyl-Glutaryl coenzyme A reductase), of the TK gene of the HSV-1 virus, of the SV40 virus (Simian virus 40), the EIII and MLP (Major Late Promoter) promoters of the adenovirus, the LTR of the MoMuLV virus (Moloney Murine Leukemia Virus), the promoter of the FIX gene conferring a liver-specific expression or the promoter of the immunoglobulin genes specific for lymphocyte cells.

Advantageously, the transposition assembly comprises, in addition to an integration cassette, elements allowing or promoting the site-specific integration of this cassette. According to a particular embodiment of the invention, in particular when the mobile genetic element used is a class I or II mobile intron, the transposition assembly according to the invention also comprises:

at 5 'to the integration cassette, a region of at most 10kb, having at least 80% homology with the sequences of the rRNA gene of the host cell immediately adjacent at 5' to said insertion site; and - at 3 'of the integration cassette, a region of at most 10kb, having at least 80% homology with the sequences of the rRNA gene of the host cell immediately adjacent at 3' to said insertion site.

Indeed, it may be advantageous to place said integration cassette in an rDNA environment, particularly when the transposition involves a fiber exchange phenomenon as has been shown in particular for intron 3. The fiber exchange involves the intron donor sequences ^"1" (from the transposition set) and recipient intron "sequences (from the host cell). Only the integration cassette will be transposed into the genome of the host cell. The sequences of the rRNA gene immediately adjacent 5 'and 3' from the insertion site are involved only in the transposition process.

In order to favor the transposition of the integration cassette, it is preferable to have perfect homology between the donor and recipient sequences involved in the exchange of fiber. Thus, a preferred transposition set will further include:

at 5 'to the integration cassette, a region of at most 10kb, having 100% homology with the sequences of the rRNA gene of the host cell immediately adjacent at 5' to said insertion site; and at 3 'to the integration cassette, a region of at most 10kb, having 100% homology with the sequences of the rRNA gene of the host cell immediately adjacent at 3' to said insertion site.

The sequences of the rRNA gene immediately adjacent 5 ′ and 3 ′ to the insertion site can be isolated according to conventional techniques of genetic engineering, for example by cloning or PCR (Polymerase Chain Reaction) or chemical synthesis. More particularly, these sequences will have a length of at most 10 kb, advantageously of at most 3 kb and preferably of at most 0.4 kb.

The present invention also relates to a means for introducing a transposition assembly according to the invention into a eukaryotic cell. Such means of introducing a nucleic acid into a eukaryotic cell are generally known to those skilled in the art.

For the purposes of the present invention, the transposition assembly according to the invention can be introduced into an introduction means selected from delivery vehicles of the liposome and synthetic cationic lipid type and the cloning and expression vectors conventionally used in eukaryotic cells. Encapsulation in a delivery vehicle and techniques of cloning into vectors are conventional techniques known to those skilled in the art. However, other protocols allowing the introduction of a nucleic acid into a cell can also be used, such as for example calcium phosphate precipitation, the DEAE dextran technique, direct injection of the nucleic acid into a cell or the bombardment of nucleic acid-covered gold microparticles in animal cells. The nucleic acid can be introduced in supercoiled, circular or linear form.

Advantageously, the means of introduction according to the invention is a vector comprising the elements suitable for its maintenance in the host cell during a long enough to allow the transfer of the integration cassette into the insertion region. Such a vector must be able to enter an upper eukaryotic cell, preferably to remain in extrachromosomal form and to remain in the cell for a time long enough to allow the transposition of the integration cassette into the genome of the cell. host. Such a vector can be in the form of a plasmid or a viral vector.

Preferably, the introduction means according to the invention is a vector of non-integrative type. Mention may be made of a vector derived from the herpes simplex virus or from an adenovirus. In a particularly preferred manner, the means of introduction according to the invention is a vector derived from an adenovirus, such as for example adenovirus type 5.

According to an advantageous mode and as mentioned above, the introduction means according to the invention may also contain an expression cassette allowing the production of the specific integrase of the transposition assembly.

Such an expression cassette comprises the DNA fragment coding for said integrase, placed under the control of appropriate elements allowing its expression. By appropriate elements allowing its expression is meant all of the elements allowing the transcription of said DNA fragment into mRNA and the translation of mRNA into protein. These elements include in particular an appropriate promoter, preferably a promoter recognized by RNA polymerase II and allowing a strong and ubiquitous expression, for example the promoter SV40.

The means of introduction according to the invention may also comprise an expression cassette allowing the expression of a selection gene, allowing the detection and the isolation of the host cells comprising said means of introduction. In the context of the invention, the gene encoding the selection marker can be under the control of appropriate elements allowing its expression in the host cell, as defined above.

The invention also relates to a process //; in vitro transfer of a DNA fragment of interest into the genome of a eukaryotic host cell at the level of ribosomal nuclear DNA, according to which a transposition assembly according to the invention or a means is introduced into said host cell of introduction according to the invention.

Advantageously, it is also possible to provide, in the in vitro method according to the invention, the specific integrase of the transposition assembly according to the invention to the host cell. The invention also relates to a eukaryotic cell comprising a transposition assembly according to the invention or an introduction means according to the invention. Said cell will advantageously be a mammalian cell, and preferably a human cell.

The present invention also relates to a pharmaceutical composition comprising, as therapeutic agent, a transposition assembly according to the invention, a means of introduction according to the invention or a cell according to the invention, in association with an acceptable carrier of from a pharmaceutical point of view.

The pharmaceutical composition according to the invention is in particular intended for the preventive or curative treatment of diseases such as:

- genetic diseases, such as for example hemophilia or cystic fibrosis, cancers, such as for example those induced by oncogenes or viruses, retroviral diseases, such as for example AIDS (acquired immunodeficiency syndrome), and Recurrent viral diseases, such as viral infections caused by the herpes virus.

A pharmaceutical composition according to the invention can be manufactured in a conventional manner. In particular, a therapeutically effective amount of a therapeutic agent is combined with a carrier such as a diluent. A composition according to the invention can be administered by any conventional route used in the field of art, in particular by subcutaneous route, by intramuscular route, by intravenous route or by intra-tracheal route. The administration can take place in single dose or repeated one or more times after a certain interval of interval. The appropriate route and dosage will vary depending on various parameters, for example, the individual being treated or the DNA fragment of interest. A pharmaceutical composition may further comprise a pharmaceutically acceptable adjuvant.

Advantageously, the pharmaceutical composition according to the invention further comprises an integrase or an integrase expression cassette. The invention also extends to a treatment method according to which a therapeutically effective amount of a transposition set according to the invention is administered, a means of introduction according to the invention or a cell according to the invention to a patient needing such treatment.

The invention is illustrated below with reference to FIG. 1 which schematically represents a transposition assembly (1) (large white box) which comprises from 5 'to 3': the sequences of the rRNA gene (6) (hatched box) 5 'from the insertion site (5) (black lines), an integration cassette (3) (small white box) consisting of a mobile genetic element (4) (horizontally striped box) into which is inserted a DNA fragment of interest (2) (dotted box) and the sequences of the rRNA gene (7) (hatched box) 3 'to the insertion site (5).

EXAMPLES:

EXAMPLE 1 Construction of a transposition assembly for site-specific integration into the 28 S rRNA genes of a human cell, using the intron 3 of Physarum polycephalum strain Carolina.

The example refers to a set of transposition which includes

(1) intron 3 modified so as to create a unique Xhol restriction site in the intronic sequence. The Xhol site will make it possible to introduce a DNA fragment of any interest. Indeed, the DNA fragment of interest can be isolated so as to present cohesive ends compatible with the ends generated by Xhol digestion (restriction fragment Λ77θI or Sali or Xhol-Sall or addition of linkers Xhol and / or Sali or site-directed mutagenesis to create the required Xhol and / or Sali sites). Alternatively, the Xhol cloning site can be treated, for example with Mung bean nuclease, in order to generate blunt ends between which any blunt-ended DNA fragment of interest can be cloned. The 0.94 kb DNA fragment comprising the intron 3 can be isolated in particular by cloning, PCR or chemically synthesized, and

(2) the sequences immediately adjacent 5 'and 3' to the insertion site of intron 3. These sequences are isolated from the human 28S rRNA gene comprising the insertion region of intron 3 perfectly conserved. Thus the mobile intron will be placed in an rDNA environment. The exchange of fibers will involve perfectly homologous sequences since both of human origin (donor sequences of the integration cassette and recipient sequences of the human host cell). The immediately adjacent 5 ′ and 3 ′ sequences can be isolated in particular by cloning, PCR or chemically synthesized. 1. Cloning by PCR of the sequences immediately adjacent at 5 'and 3' to the insertion site of intron 3 from the human rSRNA 28S gene.

Primers were defined using the sequence of the human 28S rRNA gene included in the DNAstar database (reference: HUMRGM, the reported sequence going from position + 1 to position + 5025). The insertion site and the insertion region of intron 3 have been located (as reported in Muscarella and Vogt, 1989, Cell, 56, 443-454). The insertion site is between nucleotides 3742 and 3743 of the human 28S rRNA gene.

A first DNA fragment corresponding to the fragment going from position 2324 to position 3742 of the human 28S rRNA gene is generated by PCR. The primer corresponding to the coding strand (position 2324 to 2349) is reported in SEQ ID NO: 1. It also has a free 5 ′ end carrying the HindIII and Nhel sites. The reverse primer is described in SEQ ID NO: 2 and has a 5 'end including the Spel and Xbal sites. The amplification is carried out with Thermus Aquaticus polymerase (Perkin Elmer Cetus) according to the standard conditions indicated by the manufacturer. Conventionally prepared human DNA is used as a matrix. The amplified product is checked on agarose gel and sequenced.

The second fragment of human 28S rRNA gene is also isolated by PCR. This is the portion of the gene going from position 3743 to 4438. The two oligonucleotides used are reported in SEQ ID NO: 3 and 4. The first primer has a Spel site at its 5 ′ end while the 'reverse primer contains from 5' to 3 'the EcoRI, NAel and Bgfll sites. The amplification reaction is carried out using human genomic ADΝ prepared conventionally, under the standard conditions commonly used by those skilled in the art. The PCR fragment thus generated is verified on agarose gel and sequence.

The fragment comprising 1kb of human sequences immediately adjacent 5 ′ to the insertion site of intron 3 is digested with the enzymes HindIII and Spel. The fragment comprising the sequences immediately adjacent at 3 ′ is digested with Spel and EcoRI. The two fragments are then ligated into the plasmid pUC 19 (Yanisch-Perron et al., 1985, Gene, 33, 103-1 19) previously digested with HwdlII and EcoRI. The ligation mixture is transformed into the Escherichia coli 5K strain (E. coli 5K) giving rise to the plasmid pΗRΕI.

2. Cloning of the intron 3 of modified Physarum polycephalum. Intron 3 (0.94kb) is isolated by the PCR technique. The primers are established from the sequence data reported in the literature (Muscarella et al, 1990, Mol. Cell. Biol., 10, 3386-3996; Johansen et al, 1992, Curr. Genêt., 22, 297-304 ). The primers are described in SEQ ID NO: 5 and 6. They both include a Kpnl site in their 5 'region.

The amplification reaction is carried out from a genomic DNA library of Physarum polycephalum, Carolina strain (Muscarella and Vogt, 1989, Cell, 56, 443-454), applying the standard conditions known to man of job. After amplification, the size of the fragment obtained is checked on agarose gel and its sequence verified.

The PCR fragment is digested with Kpn1 and cloned into the Kpnl site of the vector pUC19 to give pINEI.

The pINEI vector is digested with Nhel, a unique site located in intron 3 of Physarum polycephalum. The linearized pINEI vector is treated with Mung bean nuclease and ligated to a Λ7? OI linker (Stratagene). The resulting vector is designated pINEII and therefore has a unique Xhol site for the insertion of a DNA fragment of interest.

3. Insertion of Physarum polycephalum intron 3 (XhoD into a human 28 S rRNA gene environment

The KpnI fragment obtained by digestion of pINEII is treated with T4 polymerase to give a blunt-ended fragment whose 5 'and 3' ends correspond exactly to those of the intron.

At the same time, pHREI is digested with the enzymes Xbal and Spel, then treated with Mung bean nuclease (according to the technique reported in Sambrook et al, 1989, Cold Spring Harbor Press). This generates a large fragment comprising the majority of the pHREI vector, the blunt ends of which correspond respectively to the nucleotides in position 3742 and 3743 of the human 28S rRNA gene.

The fragment from pINEII comprising the intron 3 of Physarum polycephalum is ligated to the vector pHREI treated as indicated above, to give the vector pHREII. After introduction of a DNA fragment of interest, the pHREI vector will therefore comprise a transposition assembly allowing the insertion of an integration cassette (intron 3 comprising a DNA fragment of interest) in the rRNA gene 28S human. EXAMPLE 2 Construction of an adenoviral vector for the integration of the neomycin (neo ~) gene into the human genome.

An adenoviral vector is constructed comprising:

(1) the intron 3 of Physarum polycephalum (Xho ⁺ ) at the level of which a first expression cassette allowing the expression of the neo gene is introduced,

(2) a second expression cassette, that of the site-specific endonuclease TPpo, coded in part by intron 3. The second expression cassette will allow the production of the endonuclease IPpo for a time long enough to allow transposition of the integration cassette into the genome of the host cell. The codon initiating translation of IPpo is located in the 5 'exon sequence of intron 3 in the rRNA 26S gene of Physarum polycephalum. The sequence immediately adjacent 5 ′ to the insertion site isolated from the human 28S rRNA gene does not contain the initiating ATG present in the equivalent region in Physarum, and

(3) Elements suitable for the maintenance of the vector in the host cell for a time long enough to allow the transposition of the integration cassette.

1. Construction of the IPpo expression cassette.

A 167 nucleotide fragment containing the poly A region of SV40 (Fitzgerald and Shenk, 1981, Cell, 24, 251-260) is synthesized in the form of an H / ^' /.dIII- EcoRI fragment using a automatic synthesizer (Milligen 7500). A Bglïl site is introduced just upstream from the EcoRI site.

A HindIII-BamHI fragment of pMSG-CAT (Pharmacia) comprising the early promoter of the SV40 virus is isolated. The synthetic fragment H dlII-EcoRI and the fragment H / ^' / jdlII-Zto / wΗI are introduced into a derivative of the vector pUC19 (Hindlll ⁰ ) digested with Bam I and EcoRI. The derivative is obtained after digestion of pUC19 with HwdlII and treatment with T4 polymerase. The vector obtained is designated pSV40ΕI.

A DNA fragment comprising the sequence coding for the IPpo nuclease is isolated in the form of a PCR fragment. The sequence reported in the prior art (Muscarella et al., 1990, Mol. Cell. Biol, 10, 3386-3396) made it possible to define two primers, which are respectively described in SΕQ ID NO: 7 and 8. The 2 oligonucleotides have a HwdlII site at their 5 'end. The amplification is carried out under standard conditions known to those skilled in the art from a genomic DNA library of Physarum polycephalum, strain Carolina.

The PCR fragment generated, after verification on agarose gel and sequencing, is digested with HwdlII and introduced into the unique HwdlII site of the vector pSV40EI. A clone is identified having a correct orientation of the sequence coding for IPpo with respect to the SV40 promoter. The clone is designated pSV40EII.

2. Cloning of the IPpo endonuclease expression cassette into the vector pΗREII.

The vector pΗREII is digested with BgHΛ and treated with T4 polymerase. The vector pSV40EIl is digested by the enzymes Psû and BgRl. The Pstl-BgHl fragment comprising the IPpo expression cassette is treated with Mung bean nuclease. Then the fragment thus treated is ligated to the vector pΗREII giving rise to pΗREIII.

3. Introduction of the cassette for expression of a DNA fragment of interest into intron 3.

The first expression cassette for the DNA fragment of interest comprises in sequence from 5 'to 3' respectively:

(1) the TK promoter of the ΗSV virus,

(2) the neomycin gene, and

(3) the polyA region of the SV40 virus.

The 1.1 kb Xho -Sall fragment comprising said expression cassette is isolated from the plasmid pMClneo (Stratagene), is cloned into the vector pΗREIII linearized by Xhol. The resulting vector is designated pΗRE IV.

4. Cloning into an adenoviral vector and infection of host cells.

The Christmas fragment is isolated from the vector pΗREIV comprising the transposition assembly (intron 3 into which the first neo expression cassette is introduced, flanked by the adjacent 5 ′ and 3 ′ sequences of the human ARΝ 28S gene) and the second cassette. expression of IPpo. The purified fragment is treated with T4 polymerase before being inserted into the vector pXCX2 (Spessot et al., 1989, Virology, 168, 378-387).

The resulting vector is used to generate a recombinant adenovirus by conventional methods, such as, for example, the method reported in Spessot and al. (1989, Virology, 168, 378-387). The recombinant adenoviral vector is constructed from a type 5 adenovirus deletion mutant (Thimmappaye et al. 1982, Cell, 31, 543-551). The recombinant adenoviral vector thus obtained is used to infect human cells in culture.

The cells are cultured under conventional conditions known to those skilled in the art. 48 hours after infection, the cells are placed in a culture medium containing neomycin.

The presence of the neo gene in the cells can be checked by their neomycin resistance phenotype and verified by Southern blot. The site-specific insertion of the integration cassette into the cell genome can be verified by PCR. Use will preferably be made of a primer complementary to a sequence of the human 28S rRNA gene not present in the transposition set (5 ′ to position 2324 or 3 ′ to position 4438) and a primer complementary to a sequence of the integration cassette normally not present in the cell genome (for example intron 3 or the expression cassette for the neo gene). A PCR fragment of a defined size will be obtained only in the event of site-specific integration of the integration cassette into the human 28S rRNA gene.

EXAMPLE 3 Construction of a plasmid vector (episomaP replicative for the integration of the neomycin gene into the human genome.

The Nhel fragment of Example 2.4 is inserted into the vector pREP4 (Grager et al., 1989, Gene, 81, 385-294; Invitrogen Corporation, British Bio-Technology Products LTD, Oxon, UK; reference V 004-50) at the level of the single Nλel site.

The resulting vector is transfected into a human cell line in culture as indicated in Yates et al. (1985, Nature, 313, 812-815). By way of indication, mention is made of line 293, a human embryonic kidney line, available from ATCC. 48 hours after transfection the cells are placed in a selective culture medium. The presence of the neo gene integrated into the cell genome is verified as described in Example 2.4. LIST OF SEQUENCES

(1) GENERAL INFORMATION:

(i) DEPOSITOR:

(A) NAME: Transgene S.A.

(B) STREET: 11 rue de Molsheim

(C) CITY: Strasbourg

(E) COUNTRY: France

(F) POSTAL CODE: 67082

(G) TELEPHONE: (33) 88 27 91 00 (H) FAX: (33) 88 22 58 07

(ii) TITLE OF THE INVENTION: Transposition assembly intended for the transfer of a gene of interest into the genome of a eukaryotic cell.

(iii) NUMBER OF SEQUENCES: 8

(iv) COMPUTER-READABLE FORM:

(A) TYPE OF SUPPORT: Tape

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS / MS-DOS

(D) SOFTWARE: Patentin Release # 1.0, Version # 1.25 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 44 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: DNA (genomics)

(iii) HYPOTHETIC: NO

(iii) ANTI-SENSE: NO

(vi) ORIGIN:

(A) ORGANISM: synthetic oligonucleotide

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: GGGAAAAGCT TGCTAGCGGA TCTTGGTGGT AGTAGCAAAT ATTC 44

(2) INFORMATION FOR SEQ ID NO: 2:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 42 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: DNA (genomics)

(iii) HYPOTHETIC: NO

(iii) ANTI-SENSE: YES

(vi) ORIGIN:

(A) ORGANISM: synthetic oligonucleotide (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: CCCCAAACTA GTTCTAGAGA GAGTCATAGT TACTCCCGCC GT 42

(2) INFORMATION FOR SEQ ID NO: 3:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 37 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: DNA (genomics)

(iii) HYPOTHETIC: NO

(iii) ANTI-SENSE: NO

(vi) ORIGIN:

(A) ORGANISM: synthetic oligonucleotide

(Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: CCCCAAACTA GTAAGGTAGC CAAATGCCTC GTCATCT 37

(2) INFORMATION FOR SEQ ID NO: 4:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 48 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: DNA (genomics)

(iii) HYPOTHETIC: NO

(iii) ANTI-SENSE: YES

(vi) ORIGIN:

(A) ORGANISM: synthetic oligonucleotide

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4: AAAAGGGAAT TCGCTAGCAG ATCTCTGCTT CACAATGATA GGAAGAGC 48

(2) INFORMATION FOR SEQ ID NO: 5:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 33 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: DNA (genomics)

(iii) HYPOTHETIC: NO

(iii) ANTI-SENSE: NO

(vi) ORIGIN:

(A) ORGANISM: synthetic oligonucleotide (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: TTTGGGGTAC CCACCCCCTT AAATATGGCG CTC 33

(2) INFORMATION FOR SEQ ID NO: 6:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: DNA (genomics)

(iii) HYPOTHETIC: NO

(iii) ANTI-SENSE: YES

(vi) ORIGIN:

(A) ORGANISM: synthetic oligonucleotide

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: TTTGGGGTAC CGCTGATTCC AAACTCGGGT G 31

(2) INFORMATION FOR SEQ ID NO: 7:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: DNA (genomics)

(iii) HYPOTHETIC: NO

(iii) ANTI-SENSE: NO

(vi) ORIGIN:

(A) ORGANISM: synthetic oligonucleotide

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: CCCCAAAGCT TAAACAAACC ACCGCATGGA 30

(2) INFORMATION FOR SEQ ID NO: 8:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 34 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: DNA (genomics)

(iii) HYPOTHETIC: NO

(iii) ANTI-SENSE: YES

(vi) ORIGIN:

(A) ORGANISM: synthetic oligonucleotide (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8: CCCAAAAGCT TCAGTGCTCT GGATGTTAAA ATGG 34

Claims

claims

1. A transposition assembly (1) intended for the transfer of a DNA fragment of interest (2) into the genome of a eukaryotic host cell, which comprises an integration cassette (3), essentially consisting of a mobile genetic element (4) into which said DNA fragment of interest is inserted; said integration cassette being capable of integrating in a site-specific fashion into a specific insertion site (5) located in the ribosomal nuclear DNA of said host cell.

2. A transposition assembly according to claim 1, in which the mobile genetic element is selected from the group comprising class I or II introns and class RI, R2 or R3 retroposons.

3. A transposition set according to claim 2, in which the mobile genetic element is selected from: intron 3 of Physarum polycephalum, Carolina strain, a fragment or a variant of said intron, the mobile intron of class I of Tetrahymena , a fragment or a variant of said intron, the mobile class I intron of Pneumocystis carinii, a fragment or a variant of said intron, the retroposon R2Bm of Bombyx mori, a fragment or a variant of said retroposon and, the retroposon R3 of Scaria coprophila , a fragment or a variant of said retroposon.

4. A transposition assembly according to any one of claims 1 to 3, in which the mobile genetic element comprises all or part of an open reading frame coding for an integrase.

5. A transposition assembly according to claim 4, in which the DNA fragment of interest is inserted into the open reading frame coding for said integrase.

6. A transposition assembly according to any one of claims 1 to 5, in which the DNA fragment of interest is capable of being transcribed into RNA to produce an antisense RNA or after translation of said RNA, to produce a protein of interest.

7. A transposition assembly according to claim 6, in which the DNA fragment of interest is also placed under the control of appropriate elements allowing the expression of said DNA fragment in the eukaryotic host cell.

8. A transposition assembly according to claim 7, in which the appropriate elements comprise a promoter, said promoter being selected from the group of promoters recognized by RNA polymerase I and by RNA polymerase II.

9. A transposition assembly according to any one of claims 1 to 8, which further comprises:

at 5 'of the integration cassette a region of at most 10kb (6), having at least 80% homology with the sequences of the rRNA gene of the host cell immediately adjacent at 5' to said insertion site; and

at 3 'to the integration cassette, a region of at most 10kb (7), having at least 80% homology with the sequences of the rRNA gene of the host cell immediately adjacent at 3' to said insertion site.

10. A transposition assembly according to claim 9, which further comprises:

at 5 'to the integration cassette, a region of at most 10kb, having 100% homology with the sequences of the rRNA gene of the host cell immediately adjacent at 5' to said insertion site; and

at 3 'of the integration cassette, a region of at most 10kb, having 100% homology with the sequences of the rRNA gene of the host cell immediately adjacent at 3' to said insertion site.

11. Means of introduction into a eukaryotic cell of a transposition assembly according to any one of claims 1 to 10.

12. Means of introduction according to claim 11, selected from delivery vehicles of the liposome and synthetic cationic lipid type and the vectors for cloning and expression.

13. The introduction means according to claim 12, wherein said introduction means is a vector comprising the elements suitable for its maintenance in the host cell for a time long enough to allow the transfer of the integration cassette into the region. of insertion.

14. A means of introduction according to claim 13, in which the vector is a vector of non-integrative type.

15. A means of introduction according to claim 14, in which the vector is a vector derived from an adenovirus.

16. A means of introduction according to any one of claims 1 1 to 15, in which the vector also contains an expression cassette allowing the production of the specific integrase of the transposition set.

17. A means of introduction according to any one of claims 1 1 to 16, in which the vector also contains an expression cassette allowing the expression of a selection gene.

18. In vitro method for transferring a DNA fragment of interest into the genome of a eukaryotic host cell at the level of ribosomal nuclear DNA, according to which a transposition assembly is introduced into said host cell according to the any one of claims 1 to 10 or an introduction means according to any one of claims 1 1 to 17.

19. The method of claim 18, wherein the specific integrase of the transposition set is further provided to the host cell.

20. Eukaryotic cell comprising a transposition assembly according to any one of claims 1 to 10 or an introduction means according to any one of claims 1 1 to 17.

21. A eukaryotic cell according to claim 20, wherein said cell is a mammalian cell.

22. A eukaryotic cell according to claim 21, according to which said cell is a human cell.

23. Pharmaceutical composition comprising, as therapeutic agent, a transposition assembly according to any one of claims 1 to 10, an introduction means according to any one of claims 11 to 17 or a cell according to any one claims 20 to 22, in association with a pharmaceutically acceptable carrier.

24. The pharmaceutical composition according to claim 23, further comprising an integrase or an integrase expression cassette.