EP0687297A1 - An enzyme with arabinanase activity - Google Patents

Abstract

An enzyme exhibiting arabinanase activity, which enzyme is derivable from a strain of Aspergillus aculeatus and which enzyme is useful for the degradation of plant cell wall components.

Description

AN ENZYME WITH ARABINANASE ACTIVITY

FIELD OF INVENTION

The present invention relates to an enzyme with arabinanase activity, a method of producing the enzyme, and an enzyme preparation containing the enzyme.

BACKGROUND OF THE INVENTION

Pectic polymers are important constituents of plant primary cell walls. Such polymers include galacturonan, rhamnogalacturonan, galactan, arabinan and arabinogalactan. Of these, arabinan are composed of a backbone of α-L-arabinose subunits linked α-(l->5) to each other and side chains linked α-(l->3) or α-(l->2) to the backbone. Enzymes which are capable of degrading arabinan and other constituents of pectic polymers are important for the food industry, primarily in fruit and vegetable processing such as fruit juice production or wine making, where their ability to catalyse the degradation of the backbone or side chains of the pectic polymer is utilised.

An assortment of different enzymes capable of degrading pectic polymers is known to be present in various microorganisms such as Aspergillus niger. For instance, Aspergillus niger is known to produce three different arabinan-degrading enzymes, an α-L- arabinanase and two α-L-arabinofuranosidases (Ro bouts et al., Carbohydrate Polymers 9., 1988, p. 25) .

For many purposes, it would be desirable to provide each of the enzymes capable of degrading plant cell wall components present in, for instance, commercial preparations containing a number of different such enzymes (an example of such a preparation is Pectinex Ultra SP^®, prepared from Aspergillus aculeatus. available from Novo Nordisk A/S) in a form free from other components. In this way, it would be possible to produce enzyme preparations adapted to specific purposes, such preparations either containing a single plant cell wall component-degrading enzyme or arbitrary combinations thereof. To serve this end, it is convenient to provide single-component enzymes by recombinant DNA techniques.

EP 506 190 (Gist-Brocades) describe the preparation of a recombinant arabinan-degrading enzyme from Aspergillus niger.

SUMMARY OF THE INVENTION

It is an object of the present invention to prepare single- component arabinanases.

Accordingly, the present invention relates to an enzyme exhibiting arabinanase activity, which enzyme is derivable from a strain of Aspergillus aculeatus and encoded by the following DNA sequence

CATCTCAGACGCTTAAACACCATGTACTCCCTCCTCACTGCATTGTCGGTGCCGCTCCTGGC AGGCCTGGCTCATGGCTACGCCAACCCCGGCTCCTGCTCCGGTTCCTGCAACGTCCATGACCC AGCCTTGATCGTCCGCGAGTCGGACGGCAAATACTTCCGTTTCTCGACCGGCAACGAGATTT CCTATGCCTCTGCCTCCTCCATCAACGGTCCGTGGACCGCCATTGGATCCGTGGTGCCTGCC GGATCTAAGATCGACCTGTCCGGCAACACTGACCTCTGGGCCCCCGATCTTAGCTACGTCGA TGGGACCTACTACTGCCTCTACTCCGTCTCGACCTTTGGCTCCCAGGACTCTGCCATTGGAGTG GCCTCGTCCACCACGATGGAGCTGAACACCTGGACCGACCACGGGTCCGTGGGCGTCGCCTC CTCGTCCTCTAAGAACTACAACGCCATCGACGGCAACCTCCTCGTGGACGGCAGCTCATATT ACCTCCAGTTCGGCTCCTTCTGGGGCGATATCTACCAGGTCAAGATGGCCTCGCCCCTCAAG ACGGCCGGCTCGGCCTCCTACAACATCGCCTACAACGCGACGGGCACCCACTCGGAGGAGGGCT CCTACTTGTTCAAGTACGGCAGCTACTACTATCTCTTCTTCTCGTCGGGCACCTGCTGCGGC TACGACACCTCCCGCCCGGCCCAGGGCGAGGAGTACAAGATCATGGTCTGCCGCTCCACCAG CGCGACCGGCGGATTTGTGGACAAGAATGGCAATGCTTGCACGGAAAGTGGCGGCACGATTG TGCTCGCCAGTCACGGCACCGTCTATGGACCGGGTGGACAGGGCGTGTATGACGACCCGACCTA CGGCCCTGTGCTCTACTACCACTATGTCGACACCACCATTGGTTACGCCGATGACCAGAAGC TGTTTGGGTGGAACACCATTGACTTCTCGAGTGGCTGGCCTGTTGTGTAGGTGACTACTAGG TAAACTAGGGGGTGAATATGGTTGTAAATAGGTGGAACTGCAGATGTAAATAGTTTAGCTCT GGTTATAAGTGCCAATTTGAAGAGTAGATCAGTGTGGAAAAAA (SEQ ID NO:l) or a derivative of said sequence encoding a polypeptide with arabinanase activity.

In the present context, the term "derivative" is intended to include modifications of the DNA sequence shown above, such as nucleotide substitutions which do not give rise to another a ino acid sequence of the arabinanase but which correspond to the codon usage of the host organism into which the DNA construct is introduced or nucleotide substitutions which do give rise to a different amino acid sequence and therefore, possibly, a different protein structure which might give rise to a arabinanase mutant with different properties than the native enzyme. Other examples of possible modifications are insertion of one or more codons into the sequence, addition of one or more codons at either end of the sequence, or deletion of one or more codons at either end or within the sequence.

It was surprisingly found that the arabinanase enzyme encoded by SEQ ID N0:1 has a pH optimum and degradation pattern which differs considerably from that of the A. niger arabinanase disclosed in EP 506 190, cf. G. Beldman et al., rβf. Thus, the pH optimum of the present enzyme has been determined to be about 5.5, making the arabinanase enzyme of the present invention more suitable for the treatment of vegetable material with a higher pH, e.g. a neutral pH, such as, for instance, animal feed.

DETAILED DESCRIPTION OF THE INVENTION

The enzyme of the invention may be isolated by a general method involving

cloning, in suitable vectors, a DNA library from Aspergillus aculeatus. transforming suitable yeast host cells with said vectors, - culturing the host cells under suitable conditions to express any enzyme of interest encoded by a clone in the DNA library, and screening for positive clones by determining any arabinanase activity of the enzyme produced by such clones.

A more detailed description of this screening method is given in Example 1 below.

The DNA sequence coding for the enzyme may for instance be isolated by screening a cDNA library of Aspergillus aculeatus , e.g strain CBS 101.43, publicly available from the Centraalbureau voor Schimmelcultureε, Delft, NL, and selecting for clones expressing the appropriate enzyme activity (i.e. arabinanase activity as defined by the ability of the enzyme to hydrolyse glycosidic bonds in arabinan) . The appropriate DNA sequence may then be isolated from the clone by standard procedures, e.g. as described in Example 1.

The DNA sequence may subsequently be inserted into a recombinant expression vector. This may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.

In the vector, the DNA sequence encoding the arabinanase should be operably connected to a suitable promoter and terminator sequence. The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell. The procedures used to ligate the DNA sequences coding for the arabinanase, the promoter and the terminator, respectively, and to insert them into suitable vectors are well known to persons skilled in the art (cf., for instance, Sambrook et al., Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, NY, 1989) .

The host cell which is transformed with the DNA sequence encoding the enzyme of the invention is preferably a eukaryotic cell, in particular a fungal cell such as a yeast or filamentous fungal cell. In particular, the cell may belong to a species of Aspergillus. most preferably Aspergillus orvzae or Aspergillus niger. Fungal cells may be transformed by a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known per se. The use of Aspergillus as a host microorganism is described in EP 238 023 (of Novo Nordisk A/S) , the contents of which are hereby incorporated by reference. The host cell may also be a yeast cell, e.g. a strain of Saccharomvces. in particular Saccharomyces cerevisiae.

In a still further aspect, the present invention relates to a method of producing an enzyme according to the invention, wherein a suitable host cell transformed with a DNA sequence encoding the enzyme is cultured under conditions permitting the production of the enzyme, and the resulting enzyme is recovered from the culture.

The medium used to culture the transformed host cells may be any conventional medium suitable for growing the host cells in question. The expressed arabinanase may conveniently be secreted into the culture medium and may be recovered therefrom by well- known procedures including separating the cells from the medium by centrifugation or filtration, precipitating proteinaceous components of the medium by means of a salt such as ammonium sulphate, followed by chromatographic procedures such as ion exchange chromatography, affinity chromatography; or the like.

In a still further aspect, the present invention relates to an enzyme preparation useful for the degradation of plant cell wall components, said preparation being enriched in an enzyme exhibiting arabinanase activity as described above.

The enzyme preparation according to the invention is preferably used as an agent for degradation or modification of plant cell wall components. At present, degradation of plant cell walls is the most preferred use of the arabinanase according to the invention, due to the high plant cell wall degradation activity.

The enzyme preparation may also comprise one or more other enzymes capable of degrading plant cell wall components, such as a pectin lyase, pectate lyase, galactanase, pectin methylesterase, xylanase, endoglucanase, pectin acetylesterase, rha nogalacturonase or polygalacturonase. The preparation may further comprise enzymes exhibiting exo-activity against the same substrates as the above-mentioned endo-enzymes, e.g. α- arabinosidase.

The enzyme preparation may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry preparation. For instance, the enzyme preparation may be in the form of a granulate or a microgranulate. The enzyme to be included in the preparation may be stabilized in accordance with methods known in the art.

Examples are given below of preferred uses of an enzyme preparation of the invention comprising an enzyme exhibiting arabinanase activity, optionally in combination with one or more other enzymes. The dosage of the enzyme preparation of the invention and other conditions under which the preparation is used may be determined on the basis of methods known in the art.

The enzyme preparation may be used for the treatment of pectin containing plant material, e.g. obtained from soy beans, sugar beets, apples or pears, so as to reduce the viscosity and thus improve the processing or appearance of the plant material in question. The viscosity reduction may be obtained by treating the pectin-containing plant material with an enzyme preparation of the invention under suitable conditions for full or partial degradation of the pectin-containing material. For instance, the enzyme preparation may be used for de-pectinization and viscosity reduction in vegetable or fruit juice, especially in apple or pear juice. This may be accomplished by treating the fruit or vegetable juice with an enzyme preparation of the invention in an amount effective for degrading pectin-containing material contained in the fruit or vegetable juice. The arabinanase may also be used to prevent formation of haze in fruit juice such as apple juice, in which haze formation is often caused by the precipitation of arabinan.

The enzyme preparation may be used in the treatment of mash from fruits and vegetables in order to improve the extractability or degradability of the mash. For instance, the enzyme preparation may be used in the treatment of mash from apples and pears for juice production, and in the mash treatment of grapes for wine production.

By means of an enzyme preparation of the invention it is possible to regulate the consistency and appearance of processed fruit or vegetables. Thus, the consistency and appearance have been shown to be a product of the actual combination of enzymes used for the processing, i.e. the nature of the enzymes (especially pectin degrading enzyme(s) ) with which the arabinanase of the invention is combined.

Examples of products with specific properties which may be produced by use of an enzyme preparation of the invention include clear juice, e.g. from apples, pears or berries, cloud stable juice, e.g. from apples, pears, berries, citrus, or tomatoes, and purees, e.g. from carrots and tomatoes.

From the foregoing disclosure it will be apparent that the arabinanase of the invention may be produced as a single component essentially free from other enzyme activities such as pectin esterase and/or pectin lyase activity, normally found to be present in commercially available arabinanase containing pectinolytic preparations.

For this reason the use of the arabinanase of the invention is especially advantageous for purposes in which the action of such other enzyme activities are undesirable. Examples of such purposes include the production of cloud stable juices and the production of purees. In these productions, the presence of, e.g., pectin esterase normally found as a side-activity in conventional pectinolytic enzyme preparations results in a decreased stability of the cloud in cloud stable juice or causes syneresis in puree.

Furthermore, due to its substantial purity the arabinanase of the invention can be used to modify pectin in such a way that the parts of the pectin which contains arabinan will be degraded. If pectin esterase or pectin lyase activities were present, e.g. as it is the case for the enzyme preparation described in WO 89/12648, a more extensive degradation of the pectin would be obtained with a resulting reduction in the viscosifying ability of the pectin. By using the arabinanase of the invention, calcium mediated gel formation during e.g. mixing procedures may be prevented and the viscosifying ability of highly esterified pectin may be reduced only slightly.

The arabinanase may also be used to prepare arabinose-containing oligomers. These oligomers may be produced by hydrolysis of arabinan or by release of arabino-oligomers from more complex structures such as beet pectin or more or less whole cell wall structures. Such arabino-oligomers may be used as bulking agents and added to different types of food or feed.

The arabinanase of the invention can alone or together with other enzymes be used to improve the digestibility of pectin containing animal feed, e.g. feed prepared from soya beans, sugar beets or rape seeds. For this purpose, an enzyme preparation of the invention is added to the feed.

Furthermore, the arabinanase can as such or in combination with other enzymes be used for the removal of pectic substances from plant fibres, which removal is essential, e.g. in the production of textile fibres or other cellulosic materials. For this purpose plant fibre material is treated with a suitable amount of the arabinanase of the invention under suitable conditions for obtaining full or partial degradation of pectic substances associated with the plant fibre material.

The invention is described in further detail in the following examples which are not in any way intended to limit the scope of the invention as claimed.

EXAMPLES

Materials and Methods

Donor organism: mRNA was isolated from Aspergillus aculeatus. CBS 101.43, grown in a soy-containing fermentation medium with agitation to ensure sufficient aeration. Mycelia were harvested after 3-5 days' growth, immediately frozen in liquid nitrogen and stored at -80^βC.

Yeast strains: The Saccharomvces cerevisiae strain used was yNG231 (MAT alpha, leu2, ura3-52, his4-539, pep4-delta 1, cir+) or JG169 (MATα; ura 3-52; leu 2-3, 112; his 3-D200; pep 4-113; prcl::HIS3; prbl:: LEU2; cir+) .

Construction of an expression plasmid: The commercially available plasmid pYES II (Invitrogen) was cut with Spel, filled in with Klenow DNA polymerase + dNTP and cut with Clal. The DNA was size fractionated on an agarose gel, and a fragment of about 2000 bp was purified by electroelution. The same plasmid was cut with Clal/PvuII, and a fragment of about 3400 bp was purified by electroelution. The two fragments were ligated to a blunt-ended Sphl/EcoRI fragment containing the yeast TPI promoter. This fragment was isolated from a plasmid in which the TPI promoter from S_i. cerevisiae (cf. T. Albers and G. Kawasaki, J. Mol. Appl. Genet, i, 1982, pp. 419-434) was slightly modified: an internal SphI site was removed by deleting the four bp constituting the core of this site. Furthermore, redundant sequences upstream of the promoter were removed by Ball exonuclease treatment followed by addition of a SphI linker. Finally, an EcoRI linker was added at position -10. After these modifications, the promoter is included in a Sphl-EcoRI fragment. Its effeciency compared to the original promoter appears to be unaffected by the modifications. The resulting plasmid pYHD17- is shown in Fig. 1.

Preparation of RNase-free glassware, tips and solutions: All glassware used in RNA isolations was baked at + 220 °C for at least 12 h. Eppendorf tubes, pipet tips and plastic columns were treated in 0.1 % diethylpyrocarbonate (DEPC) in EtOH for 12 h, and autoclaved. All buffers and water (except Tris-containing buffers) were treated with 0.1 % DEPC for 12 h at 37 °C, and autoclaved.

Extraction of total RNA: The total RNA was prepared by extraction with guanidiniu thiocyanate followed by ultracentrifugation through a 5.7 M CsCl cushion (Chirgwin et al.. 1979) using the following modifications. The frozen mycelia were ground in liquid N₂ to fine powder with a mortar and a pestle, followed by grinding in a precooled coffee mill, and immediately suspended in 5 vols of RNA extraction buffer (4 M GuSCN, 0.5 % Na-laurylsarcosine, 25 mM Na-citrate, pH 7.0, 0.1 M β-mercaptoethanol) . The mixture was stirred for 30 min. at RT° and centrifuged (30 in., 5000 rpm, RT° , Heraeus Megafuge 1.0 R) to pellet the cell debris. The supernatant was collected, carefully layered onto a 5.7 M CsCl cushion (5.7 M CsCl, 0.1 M EDTA, pH 7.5, 0.1 % DEPC; autoclaved prior to use) using 26.5 ml supernatant per 12.0 ml CsCl cushion, and centrifuged to obtain the total RNA (Beckman, SW 28 rotor, 25 000 rpm, RT°, 24h) . After centrifugation the supernatant was carefully removed and the bottom of the tube containing the RNA pellet was cut off and rinsed with 70 % EtOH. The total RNA pellet was transferred into an Eppendorf tube, suspended in 500 μl TE, pH 7.6 (if difficult, heat occasionally for 5 min at 65 °C) , phenol extracted and precipitated with ethanol for 12 h at - 20 °C (2.5 vols EtOH, 0.1 vol 3M NaAc, pH 5.2). The RNA was collected by centrifugation, washed in 70 % EtOH, and resuspended in a minimum volume of DEPC-DIW. The RNA concentration was determined by measuring OD _260/280*

Isolation of poly(A)⁺RNA: The poly(A)⁺ RNAs were isolated by oligo(dT)-cellulose affinity chromatography (Aviv & Leder, 1972). Typically, 0.2 g of oligo(dT) cellulose (Boehringer Mannheim) was preswollen in 10 ml of 1 x column loading buffer (20 mM Tris-Cl, pH 7.6, 0.5 M NaCl, 1 mM EDTA, 0.1 % SDS) , loaded onto a DEPC-treated, plugged plastic column (Poly Prep Chromatography Column, Bio Rad) , and equilibrated with 20 ml 1 x loading buffer. The total RNA was heated at 65 ^'c for 8 min. , quenched on ice for 5 min, and after addition of 1 vol 2 x column loading buffer to the RNA sample loaded onto the column. The eluate was collected and reloaded 2-3 times by heating the sample as above and quenching on ice prior to each loading. The oligo(dT) column was washed with 10 vols of 1 x loading buffer, then with 3 vols of medium salt buffer (20 mM Tris-Cl, pH 7.6, 0.1 M NaCl, 1 mM EDTA, 0.1 % SDS), followed by elution of the poly(A)⁺ RNA with 3 vols of elution buffer (10 mM Tris-Cl, pH 7.6, 1 mM EDTA, 0.05 % SDS) preheated to + 65 °C, by collecting 500 μl fractions. The OD₂₆₀ was read for each collected fraction, and the mRNA containing fractions were pooled and ethanol precipitated at - 20 °C for 12 h. The poly(A)⁺ RNA was collected by centrifugation, resuspended in DEPC-DIW and stored in 5-10 μg aliquots at - 80 °C.

Northern blot analysis: The poly(A)⁺ RNAs (5 g/sample) from various mycelia were electrophoresed in 1.2 agarose-2.2 M formaldehyde gels (Sambrook et al., 1989) and blotted to nylon membranes (Hybond-N, Amersha ) with 10 x SSC (Sambrook et al. , 1989) as transfer buffer. Three random-primed ³P-labeled cDNA probes (Sambrook et al., 1989) were used in individual hybridizations: 1) a 1.3 kb Not I-Spe I fragment for polygalacturonase I from A. aculeatus , 2) a 1.3 kb Not I-Spe I fragment encoding endoglucanase I from A. aculeatus and 3) a 1.2 kb Eag I fragment for galactanase I from A. aculeatus. Northern hybridizations were carried out in 5 x SSC (Sambrook et al., 1989), 5 x Denhardt' s solution (Sambrook et al., 1989), 0.5 % SDS (w/v) and 100 μg/ml denatured salmon sperm DNA with a probe concentration of ca. 2 ng/ml for 16 h at 65 °C followed by washes in 5 x SSC at 65 °C (2 x 15 min), 2 x SSC, 0.5 % SDS (l x 30 min), 0.2 x SSC, 0.5 % SDS (1 X 30 min-), and 5 x SSC (.2 x 15 min) . After autoradiography at - 80 "C for 12 h, the probe # 1 was removed from the filter according to the manufacturer' s instructions and rehybridized with probe #2, and eventually with probe #3. The RNA ladder from Bethesda Research Laboratories was used as a size marker.

cDNA synthesis:

First strand synthesis: Double-stranded cDNA was synthesized from 5 μg of A. aculeatus poly(A)⁺ RNA by the RNase H method (Gubler & Hoffman 1983, Sambrook et al., 1989) using the hair- pin modification. The poly(A)⁺RNA (5 μg in 5 μl of DEPC-treated water) was heated at 70 "C for 8 min., quenched on ice, and combined in a final volume of 50 μl with reverse transcriptase buffer (50 mM Tris-Cl, pH 8.3, 75 mM KC1, 3 mM MgC12, 10 mM DTT, Bethesda Research Laboratories) containing 1 mM each dNTP (Pharmacia) , 40 units of human placental ribonuclease inhibitor (RNasin, Promega) , 10 μg of oligo(dT)₁₂.₁₈ primer (Pharmacia) and 1000 units of Superscript II RNase H- reverse transcriptase (Bethesda Research Laboratories) . First-strand cDNA was synthesized by incubating the reaction mixture at 45 °C for 1 h.

Second strand synthesis: After synthesis 30 μl of 10 mM Tris-Cl, pH 7.5, 1 mM EDTA was added, and the RNArcDNA hybrids were ethanol precipitated for 12 h at - 20 "C by addition of 40 μg glycogen carrier (Boehringer Mannheim) 0.2 vols 10 M NH₄Ac and 2.5 vols 96 % EtOH. The hybrids were recovered by centrifugation, washed in 70 % EtOH, air dried and resuspended in 250 μl of second strand buffer (20 mM Tris-Cl, pH 7.4, 90 mM KC1, 4.6 mM MgC12, 10 mM (NH₄)₂S0₄, 16 μM BNAD⁺) containing 100 μM each dNTP, 44 units of E. coli DNA polymerase I (Amersham) , 6.25 units of RNase H (Bethesda Research Laboratories) and 10.5 units of E. coli DNA ligase (New England Biolabs) . Second strand cDNA synthesis was performed by incubating the reaction tube at 16 °C for 3 h, and the reaction was stopped by addition of EDTA to 20 mM final concentration followed by phenol extraction.

Mung bean nuclease treatment: The double-stranded (ds) cDNA was ethanol precipitated at - 20 "C for 12 h by addition of 2 vols of 96 % EtOH, 0.1 vol 3 M NaAc, pH 5.2, recovered by centrifugation, washed in 70 % EtOH, dried (SpeedVac) , and resuspended in 30 μl of Mung bean nuclease buffer (30 mM NaAc, pH 4.6, 300 mM NaCl, 1 mM ZnS04, 0.35 mM DTT, 2 % glycerol) containing 36 units of Mung bean nuclease (Bethesda Research Laboratories) . The single-stranded hair-pin DNA was clipped by incubating the reaction at 30 °C for 30 min, followed by addition of 70 μl 10 mM Tris-Cl, pH 7.5, 1 mM EDTA, phenol extraction, and ethanol precipitation with 2 vols of 96 % EtOH and 0.1 vol 3M NaAc, pH 5.2 at - 20 °C for 12 h.

Blunt-ending with T4 DNA polymerase: The ds cDNA was blunt-ended with T4 DNA polymerase in 50 μl of T4 DNA polymerase buffer (20 mM Tris-acetate, pH 7.9, 10 mM MgAc, 50 mM KAc, l mM DTT) containing 0.5 mM each dNTP and 7.5 units of T4 DNA polymerase (Invitrogen) by incubating the reaction mixture at + 37 °C for 15 min. The reaction was stopped by addition of EDTA to 20 mM final concentration, followed by phenol extraction and ethanol precipitation.

Adaptor ligation and size selection: After the fill-in reaction the cDNA was ligated to non-palindromic BstX I adaptors (1 μg/μl, Invitrogen) in 30 μl of ligation buffer (50 mM Tris-Cl, pH 7.8, 10 mM MgCl2, 10 mM DTT, 1 mM ATP, 25 μg/ml bovine serum albumin) containing 600 pmol BstX I adaptors and 5 units of T4 ligase (Invitrogen) by incubating the reaction mix at + 16 °C for 12 h. The reaction was stopped by heating at + 70 °C for 5 min, and the adapted cDNA was size-fractionated by agarose gel electrophoresis (0.8 % HSB-agarose, FMC) to separate unligated adaptors and small cDNAs. The cDNA was size-selected with a cut- off at 0.7 kb, and the cDNA was electroeluted from the agarose gel in 10 mM Tris-Cl, pH 7.5, 1 mM EDTA for 1 h at 100 volts, phenol extracted and ethanol precipitated at - 20 °C for 12 h as above.

Construction of cDNA libraries: The adapted, ds cDNA was recovered by centrifugation, washed in 70 % EtOH and resuspended in 25 ml DIW. Prior to large-scale library ligation, four test ligations were carried out in 10 μl of ligation buffer (same as above) each containing 1 μl ds cDNA (reaction tubes #1 - #3) , 2 units of T4 ligase (Invitrogen) and 50 ng (tube #1) , 100 ng (tube #2) and 200 ng (tubes #3 and #4) Bst XI cleaved yeast expression vector either pYES 2.0 vector Invitrogen or yHD13) . The ligation reactions were performed by incubation at + 16 oC for 12 h, heated at 70 "C for 5 min, and 1 μl of each ligation electroporated (200 Ω, 2.5 kV, 25 μF) to 40 μl competent E. coli 1061 cells (OD600 = 0.9 in 1 liter LB-broth, washed twice in cold DIW, once in 20 ml of 10 % glycerol, resuspended in 2 ml 10 % glycerol) . After addition of 1 ml SOC to each transformation mix, the cells were grown at + 37 °C for 1 h , 50 μl plated on LB + ampicillin plates (100 μg/ml) and grown at + 37 °C for 12h.

Using the optimal conditions a large-scale ligation was set up in 40 μl of ligation buffer containing 9 units of T4 ligase, and the reaction was incubated at + 16 °C for 12 h. The ligation reaction was stopped by heating at 70 °C for 5 min, ethanol precipitated at - 20 "C for 12 h, recovered by centrifugation and resuspended in 10 μl DIW. One μl aliquots were transformed into electrocompetent E. coli 1061 cells using the same electroporation conditions as above, and the transformed cells were titered and the library plated on LB + ampicillin plates with 5000-7000 c.f.u./plate. To each plate was added 3 ml of medium. The bacteria were scraped off, 1 ml glycerol was added and stored at -80°C as pools. The remaining 2 ml were used for DNA isolation. If the amount of DNA was insufficient to give the required number of yeast transformants, large scale DNA was prepared from 500 ml medium (TB) inoculated with 50 μl of -80°C bacterial stock propagated overnight.

Construction of yeast libraries: To ensure that all the bacterial clones were tested in yeast, a number of yeast transformants 5 times larger than the number of bacterial clones in the original pools was set as the limit.

One μl aliquots of purified plasmid DNA (100 ng/μl) from individual pools were electroporated (200 Ω, 1.5 kV, 25 μF) into 40 μl competent S. cerevisiae JG 169 cells (OD600 = 1.5 in 500 ml YPD, washed twice in cold DIW, once in cold 1 M sorbitol, resuspended in 0.5 ml 1 M sorbitol, Becker & Guarante, 1991). After addition of 1 ml 1M cold sorbitol, 80 μl aliquots were plated on SC + glucose - uracil to give 250-400 c.f.u./plate and incubated at 30 °C for 3 - 5 days.

Construction of an Aspergillus expression vector: the vector pHD414 is a derivative of the plasmid p775 (described in EP 238 023) . In contrast to this plasmid, pHD 414 has a string of unique restriction sites between the promoter and the terminator. The plasmid was constructed by removal of an approximately 200 bp long fragment (containing undesirable RE sites) at the 3-end of the terminator, and subsequent removal of an approximately 250 bp long fragment at the 5'end of the promoter, also containing undesirable sites. The 200 bp region was removed by cleavage with Narl (positioned in the pUC vector) and Xbal (just 3 ^• to the terminator) , subsequent filling in the generated ends with Klenow DNA polymerase -t-dNTP, purification of the vector fragment on gel and religation of the vector fragment. This plasmid was called pHD413. pHD413 was cut with StuI (positioned in the 5'end of the promoter) and PvuII (in the pUC vector) , fractionated on gel and religated. The plasmid pHD 414 is shown in Fig. 2.

Preparation of carrier DNA: 100 g salmon-sperm DNA was weighed out and dissolved overnight in 10 ml 10 mM Tris-Cl, 1 mM EDTA, pH 7,5 (TE) . The solution was then sonicated in a plastic container in ice water until it was no longer viscous. The solution was then phenol extracted and EtOH precipitated, and the pellet was washed and resuspended in 5 ml TE. The suspension was EtOH precipitated, and the pellet was washed and resuspend in 5 ml TE. The OD₂₆₀ was measured, and the suspension was diluted with TE to 10 mg/ml.

Media:

YPD: 10 g yeast extract, 20 g peptone, H₂0 to 810 ml. Autoclaved, 90 ml 20% glucose (sterile filtered) added.

10 x Basal salt: 66.8 g yeast nitrogen base, 100 g succinic acid, 60 g NaOH, H₂0 ad 1000 ml, sterile filtered.

SC-URA: 90 ml 10 x Basal salt, 22.5 ml 20 % casamino acids, 9 ml 1% tryptophan, H₂0 ad 806 ml, autoclaved, 3.6 ml 5% threonine and 90 ml 20% glucose or 20% galactose added.

SC-H broth: 7.5 g/1 yeast nitrogen base without amino acids, 11.3 g/1 succinic acid, 6.8 g/1 NaOH, 5.6 g/1 casamino acids without vitamins, 0.1 g/1 tryptophan. Autoclaved for 20 min. at 121°C. After autoclaving, 10 ml of a 30% galactose solution, 5 ml of a 30% glucose solution and 0.4 ml of a 5% threonine solution were added per 100 ml medium.

SC-H agar: 7.5 g/1 yeast nitrogen base without amino acids, 11.3 g/1 succinic acid, 6.8 g/1 NaOH, 5.6 g/1 casamino acids without vitamins, 0.1 g/1 tryptophan, and 20 g/1 agar (Bacto) . Autoclaved for 20 min. at 121°C. After autoclaving, 55 ml of a 22% galactose solution and 1.8 ml of a 5% threonine solution were added per 450 ml agar.

YNB-1 agar: 3.3 g/1 KH₂P0₄, 16.7 g/1 agar, pH adjusted to 7. Autoclaved for 20 min. at 121°C. After autoclaving, 25 ml of a 13.6% yeast nitrogen base without amino acids, 25 ml of a 40% glucose solution, 1.5 ml of a 1% L-leucine solution and 1.5 ml of a 1% histidine solution were added per 450 ml agar.

YNB-1 broth: Composition as YNB-1 agar, but without the agar.

AZCL debranched arabinan: available from Megazyme, Australia.

Characterization of an enzyme of the invention: SDS-PAGE Electrophoresis: SDS-PAGE electrophoresis was performed in a Mini-Leak 4 electrophoresis unit (Kem-En-Tec, Copenhagen) as a modified version of the Laemli procedure (Laemmli, 1970) . Briefly, the separation gel was cast with 12% acryla ide; 0.2%

BIS acrylamide; 0.1% SDS; 0.375 M Tris pH 8.8; 0.04% APS

(ammonium-persulphate) & 0.04% TEMED. After 6-15 hours of polymerization the stacking gel was cast with 4.5% w/w

Acrylamide; 0.075% BIS-acrylamide; 0.1% SDS; 66.5 mM Tris pH 6.8; 0.4% w/w APS (ammonium persulphate) & 0.4% TEMED. The electrode chambers are filled with running buffer : 25 mM Tris-base; 0.192 M glycine & 0.05% SDS, whereafter the samples containing sample buffer are loaded, and the gel is run at 2-4 itiA/gel for over-night running and 10-30 mA/gel for fast running. The gel is subsequently removed and stained by Coomassie staining.

Isoelectric focusing: Isoelectric focusing is carried out on Ampholine PAG plates pH 3.5-9.5 (Pharmacia, Upsala) on a Multiphor electrophoresis unit according to the manufactures instructions. After electrophoresis the gel is Coomassie stained. Coomassie staining: The gel is carefully removed from the glass plates and incubated on a slowly rotating shaking table in approximately 100 ml of the following solutions:

Coomassie staining:

1) 30 min in 40% v/v ethanol; 5% v/v acetic acid

2) 30 min in 40% v/v ethanol; 5% v/v acetic acid + 0.1% Commassie R250

3) Destaining in 30 min in 40% v/v ethanol; 5% v/v acetic acid until background is sufficiently reduced.

4) Finally the gel is incubated in preserving solution : 5% v/v acetic acid; 10% v/v ethanol; 5% v/v glycerol and air dried between two sheets of cellophane membrane.

Standard incubations: For standard incubations with the enzyme, incubations are carried out in Eppendorf tubes comprising 1 ml of substrate and 10 μl of suitably diluted enzyme. The substrate is debranched arabinan from Megazyme. When the enzyme is added incubation is carried out for 15 min at 30°C (if not otherwise specified) and the enzyme is inactivated at 95°C for 20 minutes. Enzyme incubations are carried out in triplicate. A blank is produced in which enzyme is added but inactivated immediately.

The enzyme activity is measured by determining the amount of reducing sugars released by the enzyme during the 15 minutes of incubation compared to the blank. Reducing sugars are determined by reaction, in microtiter plates, with a PHBAH reagent comprising 0.15 g of para hydroxy benzoic acid hydrazide (Sigma H-9882) , 0.50 g of potassium-sodium tartrate (Merck 8087) and 2% NaOH solution up to 10.0 ml.

pH optimum is measured as described above in 0.1 M citrate/tri sodium phosphate buffers of varying pH.

Temperature optimum is measured by incubating the enzyme at varying temperatures for 15 minutes in 0.1 M citrate buffer, pH 5.5. Km and specific activity are measured by carrying out incubations in 0.1 M citrate buffer, pH 5.5, at substrate concentrations (S) ranging from 0.025 to 1.5% debranched arabinan measure the reaction rate (v) , picture S/v as a function of S, carry out linear regression analysis, finding the slope (=1/Vmax) and the intercept (Km/Vmax) and calculating Km and the specific activity (=Vmax/E) , where E is the amount of enzyme added.

Example 1

A library from A. aculeatus consisting of approx. 1.5 x 10⁶ individual clones in 150 pools was constructed.

DNA was isolated from 20 individual clones from the library and subjected to analysis for cDNA insertion. The insertion frequency was found to be >90 % and the average insert size was approximately I400bp.

DNA from some of the pools was transformed into yeast, and 50- 100 plates containing 200-500 yeast colonies were obtained from each pool. After 3-5 days of growth, the agar plates were replica plated onto several sets of agar plates. One set of plates containing 0.1% AZCL debranched arabinan (Megazyme) was then incubated for 3-5 days at 30°C for detection of arabinanase activity. Positive colonies were identified as colonies surrounded by a blue halo. Alternatively, one set of plates was incubated for 3-5 days at 30"C before overlayering with an arabinan overlayer gel containing 0.1% AZCL debranched arabinan (Megazyme) and 1% agarose in a buffer with an appropriate pH. After incubation for 1-2 days at 30°C, positive colonies were identified as colonies surrounded by a blue halo.

Cells from enzyme-positive colonies were spread for single colony isolation on agar, and an enzyme-producing single colony was selected for each of the arabinanase-producing colonies identified. Characterization of positive clones: The positive clones were obtained as single colonies, the cDNA inserts were amplified directly from the yeast colony using biotinylated polylinker primers, purified by magnetic beads (Dynabead M-280, Dynal) system and characterized individually by sequencing the 5' -end of each cDNA clone using the chain-termination method (Sanger et al., 1977) and the Sequenase system (United States Biochemical) . The partial DNA sequence of the enzyme gene is shown in claim 3.

Isolation of a cDNA gene for expression in Aspergillus: In order to avoid PCR errors in the gene to be cloned, the cDNA was isolated from the yeast plasmid by standard procedures as described below.

One or more of the arabinanase-producing colonies was inoculated into 20 ml YNB-1 broth in a 50 ml glass test tube. The tube was shaken for 2 days at 30^βC. The cells were harvested by centrifugation for 10 min. at 3000 rpm.

The cells were resuspended in 1 ml 0.9 M sorbitol, 0.1 M EDTA, pH 7.5. The pellet was transferred to an Eppendorf tube, and spun for 30 seconds at full speed. The cells were resuspended in 0.4 ml 0.9 M sorbitol, 0.1 M EDTA, 14 mM 3-mercaptoethanol. 100 μl 2 mg/ml Zymolase was added, and the suspension was incubated at 37°C for 30 minutes and spun for 30 seconds. The pellet (spheroplasts) was resuspended in 0.4 ml TE. 90 μl of (1.5 ml 0.5 M EDTA pH 8.0, 0.6 ml 2 M Tris-Cl pH 8.0, 0.6 ml 10% SDS) was added, and the suspension was incubated at 65"C for 30 minutes. 80 μl 5 M KOAc was added, and the suspension was incubated on ice for at least 60 minutes and spun for 15 minutes at full speed. The supernatant was transferred to a fresh tube which was filled with EtOH (room temp.) followed by thorough but gentle mixing and spinning for 30 seconds. The pellet was washed with cold 70% ETOH, spun for 30 seconds and dried at room temperature. The pellet was resuspended in 50 μl TE and spun for 15 minutes. The supernatant was transferred to a fresh tube. 2.5 μl 10 mg/ml RNase was added, followed by incubation at 37°C for 30 minutes and addition of 500 μl isopropanol with gentle mixing. The mixture was spun for 30 seconds, and the supernatant was removed. The pellet was rinsed with cold 96% EtOH and dried at room temperature. The DNA was dissolved in 50 μl water to a final concentration of approximately 100 μl/ml.

The DNA was transformed into E.coli. by standard procedures. Two E. coli colonies were isolated from each of the transformations and analysed with the restriction enzymes Hindlll and Xbal which excised the DNA insert. DNA from one of these clones was retransformed into yeast strain JG169.

The DNA sequences of several of the positive clones were partially determined. The partial DNA sequence of the arabinanase is shown in claim 3.

Example 2

In order to express the genes in Aspergillus. cDNA is isolated from one or more transformants by digestion with Hindlll/Xbal or other appropriate restriction enzymes, size fractionation on a gel and purification and subsequently ligated to digested pHD414, resulting in the plasmid pAral. After amplification in E. coli. the plasmids are transformed into A^. orvzae or A^. niger according to the general procedure described below.

Transformation of Aspergillus oryzae or Aspergillus niger (general procedure)

100 ml of YPD (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1981) is inoculated with spores of A. orvzae or A. niger and incubated with shaking at 37°C for about 2 days. The mycelium is harvested by filtration through miracloth and washed with 200 ml of 0.6 M MgS0₄. The mycelium is suspended in 15 ml of 1.2 M MgS0₄. 10 mM NaH₂P0₄, pH = 5.8. The suspension is cooled on ice and 1 ml of buffer containing 120 mg of Novozym ® 234, batch 1687 is added. After 5 minutes 1 ml of 12 mg/ml BSA (Sigma type H25) is added and incubation with gentle agitation continued for 1.5-2.5 hours at 37°C until a large number of protoplasts is visible in a sample inspected under the microscope.

The suspension is filtered through miracloth, the filtrate transferred to a sterile tube and overlayered with 5 ml of 0.6 M sorbitol, 100 mM Tris-HCl, pH = 7.0. Centrifugation is performed for 15 minutes at 100 g and the protoplasts are collected from the top of the MgS0₄ cushion. 2 volumes of STC (1.2 M sorbitol, 10 mM Tris-HCl, pH = 7.5. 10 mM CaCl₂) are added to the protoplast suspension and the mixture is centrifugated for 5 minutes at 1000 g. The protoplast pellet is resuspended in 3 ml of STC and repelleted. This is repeated. Finally the protoplasts are resuspended in 0.2-1 ml of STC.

100 μl of protoplast suspension is mixed with 5-25 μg of the appropriate DNA in 10 μl of STC. Protoplasts are mixed with p3SR2 (an A. nidulans amdS gene carrying plasmid) . The mixture is left at room temperature for 25 minutes. 0.2 ml of 60% PEG 4000 (BDH 29576). 10 mM CaCl₂ and 10 mM Tris-HCl, pH = 7.5 is added and carefully mixed (twice) and finally 0.85 ml of the same solution is added and carefully mixed. The mixture is left at room temperature for 25 minutes, spun at 2500 g for 15 minutes and the pellet is resuspended in 2 ml of 1.2 M sorbitol. After one more sedimentation the protoplasts are spread on the appropriate plates. Protoplasts are spread on minimal plates (Cove, Biochem.Biophys.Acta 113 (1966) 51-56) containing 1.0 M sucrose, pH = 7.0, 10 mM acetamide as nitrogen source and 20 mM CsCl to inhibit background growth. After incubation for 4-7 days at 37°C spores are picked and spread for single colonies. This procedure is repeated and spores of a single colony after the second reisolation is stored as a defined transformant.

Test of A. orvzae transformants

Each of the transformants were inoculated on FG-4 agar in the centre of a Petri dish. After 5 days of incubation at 30°C, 4 mm diameter plugs were removed by means of a corkscrew. The plugs were embedded in an arabinan overlayer gel, containing 0.1% AZCL debranched arabinan and 1% agarose in a buffer with an appropriate pH, and incubated overnight at 40°C. The arabinanase activity was identified as described above. Some of the transformants had halos which were significantly larger than the Aspergillus oryzae background. This demonstrates efficient expression of arabinanase in Aspergillus orvzae. The 8 transformants with the highest arabinanase activity were selected and inoculated and maintained on YPG-agar.

Each of the 8 selected transformants were inoculated from YPG- agar slants on 500 ml shake flask with FG-4 and MDU-2 media. After 3-5 days of fermentation with sufficient agitation to ensure good aeration, the culture broths were centrifuged for 10 minutes at 2000 g and the supernatants were analyzed.

A volume of 15 μl of each supernatant was applied to 4 mm diameter holes punched out in a 0.1% AZCL debranched arabinan overlayer gel (25 ml in a 13 cm diameter Petri dish) . The arabinanase activity was identified by the formation of a blue halo on incubation.

Fed batch fermentation

Subsequently the arabinanase was produced by fed batch fermentation of A. oryzae expressing the enzyme. The medium used for the fermentation comprised maltodextrin as a carbon source, urea as a nitrogen source and yeast extract.

The fed batch fermentation was performed by inoculating a shake flask culture of the A. oryzae host cells in question into a medium comprising 3.5% of the carbon source and 0.5% of the nitrogen source. After 24 hours of cultivation at pH 5.0 and 34°C the continuous supply of additional carbon and nitrogen sources were initiated. The carbon source was kept as the limiting factor and it was secured that oxygen was present in excess. The fed batch cultivation was continued for 4 days, after which the enzyme could be recovered. For characterization, the enzyme was purified by ion exchange chromatographic methods well known in the art.

Purification of arabinanase

The culture supernatant from the fed batch fermentation of A_^. orvzae of A. niger expressing the arabinanase was centrifuged and filtered through a 0.2 μm filter to remove the mycelia. 35- 50 ml of the filtered supernatant was ultrafiltered in a Filtron ultracette or Amicon ultrafiltration device with a 10 kD membrane to obtain a 10-fold concentration. The concentrate was diluted 100 times in 20 mM Tris, pH8.0, in two successive rounds of ultrafiltration in the same device. The ultrafiltrated sample was loaded at 1.5 ml/min. on a Pharmacia HR16/10 Fast Flow Q Sepharose anion exchange column equilibrated in 20 mM Tris, pH 8.0. After the sample was applied, the column was washed with two column volumes of 20 mM Tris, pH 8.0, and bound proteins were eluted with a linear increasing NaCl gradient from 0 to 0.8 M NaCl in 20 mM Tris, pH 8.0. 5 ml fractions were collected and assayed for arabinanase activity as described above.

The arabinanase eluted at approximately 0.55 M NaCl. The arabinanase in the recovered fractions was not completely pure. For further purification, the arabinanase-containing fractions were therefore pooled and concentrated by ultrafiltration in an Amicon ultrafiltration device with a 10 kD membrane to obtain a 10-fold concentration. The concentrate was diluted 100 times in 20 mM citrate buffer, pH 4.0, in two successive rounds of ultrafiltration in the same device. The ultrafiltrated sample was loaded at 1 ml/min. on a Pharmacia HR10/20 Fast Flow S Sepharose cation exchange column equilibrated in 20 mM, pH 4.0. After the sample was applied, the column was washed with two column volumes of 20 mM citrate, pH 4.0, and bound proteins were eluted with a linear increasing NaCl gradient from 0 to 0.4 M NaCl in 20 mM citrate, pH 4.0. The arabinanase eluted at approximately 0.15 M NaCl. The arabinanase contained in this fraction was more than 95% pure, and was used in the subsequent characterization.

Characterization of arabinanase

The pH optimum of the thus purified arabinanase, determined as described above, was about 5.5 (cf. Fig. 3) which corresponds to the pH optimum obtained by Beldman et al., supra. The molecular weight of the arabinanase was determined to be 38.8 kD by SDS- PAGE. This value is somewhat lower than the 45 kD reported by Beldman et al., but it is more in line with the theoretically calculated value of 34.065 kD. The discrepancies between the molecular weight reported by Beldman et al. and the molecular weight determined by the present inventors may be explained by the different electrophoretic techniques employed. The enzyme was glycosylated as determined by Western blotting with a glycan-specific lectin. The presence of carbohydrate moieties may explain the discrepancy between the observed molecular weight and the calculated value. The isolelectric point was measured to 4.3 which is in accordance with the theoretically calculated value of 4.357. The temperature optimum, determined as described above, is about 50°C (cf. Fig. 4) and temperatures above 50°C partly inactivate the enzyme within 15 minutes. The Km was found to be in the range of 0.03-0.10 and the specific activity was in the range of 64-71 μmol/min./mg enzyme protein.

REFERENCES

Aviv, H. & Leder, P. 1972. Proc. Natl. Acad. Sci. U. S. A. 69: 1408-1412.

Becker, D. M. & Guarante, L. 1991. Methods Enzymol. 194: 182- 187.

G. Beldman et al., Carbohydrate Polymers 3., 1993, pp. 159-168.

Chirgwin, J. M. , Przybyla, A. E., MacDonald, R. J. & Rutter, W. J. 1979. Biochemistry 18: 5294-5299.

Gubler, U. & Hoffman, B. J. 1983. Gene 25: 263-269.

Laemmli, U.K., 1970, "Cleavage of structural proteins during the assembly of the head of bacteriophage T4"., Nature, 227, p. 680- 685.

Sambrook, J., Fritsch, E. F. & Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab., Cold Spring Harbor, NY.

SEQUENCE LISTING

(1) GENERAL INPOBMATION:

(i) APPLICANT:

(A) NAME: Novo Nordisk ^s

(B) STREET: Novo Alle

(C) CITY: Bagsvaerd

(E) COUNTRY: Denmark

(F) POSTAL CODE (ZIP) : 2880

(G) T TFrPHπMRi +454444 8888 (H) TEIEEAX: +4544493256

(ii) TITLE OF INVENTION: An Enzyme with Arabinanase Activity

(iii) NUMBER OF SEQUENCES: 1

(iv) OCMEUTER READABLE FORM:

(A) MEDIUM TΪPE: Floppy disk

(B) CCMTOTER: IEM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25 (EPO)

(2) INPOEMAΠON FOR SEQ ID NO: 1:

(i) SEQUENCE C.HA ACTE ISTICS:

(A) LENGTH: 1104 base pairs

(B) TYPE: nucleic acid

(C) ST ANDEENESS: single

(D) TOPOIOGY: linear

(ii) MDLECUIE TYPE: CENA

(iii) HYPOTHETICAL: NO

(iii) ANTT-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Aspergillus aculeatus

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: CATCTCAGAC GCTTAAACAC CaiGTACTCC CICCrCACrG CATIGTOGGT GCπSCTCCIG 60 GCAGGCCTGG GKΑTGGCTA CGCCAACCCC GGCTCCTGCT COGGTTCCIG CAACGTCCAT 120

GΆ∞CAGCCΓ TGA CGTCOG CGAG?ΓCGGAC GGCAAATACΓ T< GTΓΓCTC GACCGGCAAC i80

GAGATTTCCT ATCCCTCTGC CTCCTCCATC AACGGTCCGT GGACCGCCAT TGGATCCGIG 240

GTGCCTGCCG GATCTAAGAT CGhCCIGK-C GGCAACACTG ACCTCTGGGC CXXCGATCTT 300 AGCΓAOCTCG ATGGGACCTA <__TAC_TGCCTC TACTCXJCTCT CXΆCXTTTGG TCIGCCATTG GAGTGGCCTC GTCCACCACG ATGGAGCΓGA ACACCTGGAC TCOCTGGGOG TCGCCTCCTC GTCCTCTAAG AACΓACAAOG OCATOGACGG GTGGACGGCA GCTCATATTA O^CCAGITC GGCTCCΓTCΓ GGGGCGAIAT AAGATGGCCT CGCCCCTCAA GACGG003GC TCGGCCΓCCT ACAACA CGC AOGGGCACCC ACTCGGAGGA GGGCTCCTAC T GTTCAAGT ACGGCAGCTA TIC ΓCTCGT OGGGCACCTG CIGCGGCIAC GACACCTCCC GCCCGGCCCA TACAAGATCA TGGTC GCCG CTCCACCAGC GCGACCGGOG GATΓ CTGGA TGCΓTGCA CGGAAAGTGG CGGCACGATT GIGCΓCGCCA GΓCACGGCAC COGGGTGGAC AGGGCGTGTA TGACGACCCG ACCTAOGGCC CIGTGCTCTA GTCGACACCA CCATTGGTTA CGCCGAIGAC CAGAAGCTGT TTGGGTGGAA TTCTCGAGTG GCTCGCCIGT TGTGTAGGTG ACTACTAGGT AAACTAGGGG

TTGTAAATAG GTGGAACIGC AGAIGTAAAT AGTTTAGCTC TGGTTATAAG AAGAGTAGAT CAGTGTGGAA AAAA

Claims

1. An enzyme exhibiting arabinanase activity, which enzyme is derivable from a strain of Aspergillus aculeatus and encoded by the following DNA sequence

CATCTCAGACGCTTAAACACCATGTACTCCCTCCTCACTGCATTGTCGGTGCCGCTCCTGGC AGGCCTGGCTCATGGCTACGCCAACCCCGGCTCCTGCTCCGGTTCCTGCAACGTCCATGACCC AGCCTTGATCGTCCGCGAGTCGGACGGCAAATACTTCCGTTTCTCGACCGGCAACGAGATTT CCTATGCCTCTGCCTCCTCCATCAACGGTCCGTGGACCGCCATTGGATCCGTGGTGCCTGCC GGATCTAAGATCGACCTGTCCGGCAACACTGACCTCTGGGCCCCCGATCTTAGCTACGTCGA TGGGACCTACTACTGCCTCTACTCCGTCTCGACCTTTGGCTCCCAGGACTCTGCCATTGGAGTG GCCTCGTCCACCACGATGGAGCTGAACACCTGGACCGACCACGGGTCCGTGGGCGTCGCCTC CTCGTCCTCTAAGAACTACAACGCCATCGACGGCAACCTCCTCGTGGACGGCAGCTCATATT ACCTCCAGTTCGGCTCCTTCTGGGGCGATATCTACCAGGTCAAGATGGCCTCGCCCCTCAAG ACGGCCGGCTCGGCCTCCTACAACATCGCCTACAACGCGACGGGCACCCACTCGGAGGAGGGCT CCTACTTGTTCAAGTACGGCAGCTACTACTATCTCTTCTTCTCGTCGGGCACCTGCTGCGGC TACGACACCTCCCGCCCGGCCCAGGGCGAGGAGTACAAGATCATGGTCTGCCGCTCCACCAG CGCGACCGGCGGATTTGTGGACAAGAATGGCAATGCTTGCACGGAAAGTGGCGGCACGATTG TGCTCGCCAGTCACGGCACCGTCTATGGACCGGGTGGACAGGGCGTGTATGACGACCCGACCTA CGGCCCTGTGCTCTACTACCACTATGTCGACACCACCATTGGTTACGCCGATGACCAGAAGC TGTTTGGGTGGAACACCATTGACTTCTCGAGTGGCTGGCCTGTTGTGTAGGTGACTACTAGG TAAACTAGGGGGTGAATATGGTTGTAAATAGGTGGAACTGCAGATGTAAATAGTTTAGCTCT GGTTATAAGTGCCAATTTGAAGAGTAGATCAGTGTGGAAAAAA (SEQ ID NO:1) or a derivative of said sequence encoding a polypeptide with arabinanase activity.

2. An enzyme according to claim 1, which is encoded by the DNA sequence isolated from a DNA library of Aspergillus aculeatus. CBS 101.43.

3. A recombinant expression vector comprising a DNA sequence encoding an enzyme according to claim 1 or 2.

4. A cell comprising a recombinant expression vector according to claim 3 .

5. A cell according to claim 4, which is a eukaryotic cell, in particular a fungal cell, such as a yeast cell or a filamentous fungal cell.

6. A cell according to claim 5, wherein the cell belongs to a strain of Aspergillus, in particular a strain of Aspergillus niger or Aspergillus oryzae.

7. A method of producing an enzyme exhibiting arabinanase activity, the method comprising culturing a cell according to any of claims 4-6 under conditions permitting the production of the enzyme, and recovering the enzyme from the culture.

8. An enzyme preparation useful for the degradation of plant cell wall components, said preparation being enriched in an enzyme exhibiting arabinanase activity according to claim 1 or 2.

9. A preparation according to claim 8, which additionally comprises a pectin lyase, pectate lyase, xylanase, endoglucanase, pectin acetylesterase, rhamnogalacturonase, polygalacturonase, galactanase or pectin methylesterase.

10. Use of an enzyme exhibiting arabinanase activity according to claim 1 or 2 for the degradation or modification of plant cell wall components.