EP0665891A1

EP0665891A1 - Genetic moderation or restoration of plant phenotypes

Info

Publication number: EP0665891A1
Application number: EP93922959A
Authority: EP
Inventors: Adrianus Johannes Van Tunen; Josephus Nicolaas Maria Mol; Petrus Josephus Maria Van Den Elzen
Original assignee: Mogen International NV
Current assignee: Syngenta Mogen BV
Priority date: 1992-10-15
Filing date: 1993-10-15
Publication date: 1995-08-09
Also published as: WO1994009143A1; AU674029B2; CA2146113A1; AU5178093A

Abstract

The present invention provides a process for the restoration of a plant phenotype that is altered due to a first transgene which when expressed inhibits expression of an endogenous plant gene, the process comprising introducing into said plant, or progeny thereof, a second transgene which encodes a protein or polypeptide that is capable of substituting the function of the protein or polypeptide product encoded by the said endogenous gene and wherein the nucleotide sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 90 %.

Description

Genetic moderation or restoration of plant phenotypes

FIELD OF THE INVENTION

The present invention relates to genetically transformed plants, methods for obtaining genetically transformed plants and recombinant DNA for use therein. The invention further relates to a method for restoring a plant phenotype previous- ly altered due to the expression of a transgene in that plant.

BACKGROUND ART The European Patent Application 344 029 A2 describes a method for restoring male-fertility in plants that are male- sterile due to the expression of a first transgene encoding Barnase in the tapetal cell layer of said plants, which method comprises the introduction into the same plant of a second transgene encoding Barstar which is expressed at least in all those cells wherein the first transgene is expressed. In the Barnase/Barstar system for altering and restoring plant phenotype the first transgene, the Barnase gene is believed to interfere with a large number of endogenous gene products in a non-specific way, rather than by interaction with a preselected endogenous gene product. The restoration of male-fertility is based on a direct interaction of Barstar with Barnase. In general terms, fertility restoration accor¬ ding to this system is based on direct interaction of the restoration gene product with the sterility gene product in the plant cell. This is one of the best described phenotype restoration systems known in the art. However, a drawback of the Barnase/Barstar system is that its application is limited to phenotypes which allow disruption of cell structures by cell death. Phenotypes that require more subtle modification of plant cell functioning, such as alteration of flower colour, fruit ripening, and the like, are outside the scope of this system.

Many systems for altering plant phenotypes are based on inhibition of endogenous plant genes. Examples thereof include but are not limited to disease-resistance, flower co- lour, fruit-ripening, male-sterility, and the like. It is an object of the invention to provide a phenotype restoration or moderation system that can be used when plant phenotypes^' have been altered due to the expression of a transgene capable of inhibiting expression of a particular endogenous gene.

SUMMARY OF THE INVENTION The present invention provides a process for the resto ration of a plant phenotype that is altered due to a first transgene which when expressed inhibits expression of an endogenous plant gene, by introducing into said plant, or progeny thereof, a second transgene which when expressed is capable of neutralising or partially neutralizing the effec caused by the first transgene, whereby said second transgen is expressed at least in those cells involved in the altere phenotype. Preferred in a process according to the inventio is a second transgene which encodes a protein or polypeptid gene product that is capable of substituting the function o the protein or polypeptide product encoded by the said endogenous gene and wherein the nucleotide sequence identit of the transcripts encoded by the second transgene and the first transgene is less than 90%, preferably less than 80%, yet more preferably said second transgene encodes a protein or polypeptide gene product that is not identical in amino acid sequence to the endogenous gene product and wherein th nucleotide sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 75%. According to a special preferred embodiment said secon transgene is obtainable from a different plant species.

The invention further provides a process for the resto ration of fertility in a plant that is male-sterile due to first transgene which when expressed inhibits expression of an endogenous plant gene required for pollen development or functioning, by introducing into said plant a second trans¬ gene capable of neutralising the effect caused by the first transgene, whereby said second transgene is expressed in al cells in which the first transgene is expressed. Preferred a process according to the invention said second transgene encodes a protein or polypeptide gene product that is capab of substituting the function of the protein or polypeptide product encoded by the said endogenous gene and wherein the nucleotide sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 90% , preferably less than 80%, more preferably said second transgene encodes a protein or polypeptide gene product tha is not identical in its amino acid sequence to the endogeno gene product and wherein the nucleotide sequence identity o the transcripts encoded by the second transgene and the fir transgene is less than 75%.

According to a special preferred embodiment said secon transgene is obtainable from a different plant species. According to a special embodiment the process accordin to the invention said first transgene is an antisense gene which when expressed inhibits expression of an endogenous flavonoid biosynthesis gene and said second transgene encod a flavonoid biosynthesis enzyme capable of substituting the function of the corresponding flavonoid biosynthesis enzyme encoded by the said endogenous gene. Preferred according to this embodiment is a first transgene which is an antisense gene inhibiting expression of an endogenous chalcone syntha gene and said second transgene encodes a chalcone synthase capable of substituting the function of the chalcone syntha encoded by the said endogenous gene. Especially preferred first transgenes and second transgenes for the restoration moderation of male-fertility are those obtainable from tabl 1 in this specification. Preferred in a process according to the invention is t process wherein said second transgene is introduced into th progeny of said plant by cross-pollination of a parent of said plant with pollen comprising said second transgene.

The invention further provides a process for obtaining fertile hybrid seed of a self-fertilizing plant species, comprising the steps of cross-pollinating a plant S which i male-sterile due to a transgene which when expressed inhibi expression of an endogenous gene required for normal pollen development or functioning, with a plant R which is male- fertile and comprises a transgene that encodes a protein or polypeptide product capable of substituting the function of the protein or polypeptide product encoded by the said endogenous gene. Preferred according to this process is a first transgene which is an antisense chalcone synthase gen the endogenous gene is a chalcone synthase gene, and the second transgene encodes chalcone synthase, wherein the nucleic acid sequence identity of the transcripts encoded b the second transgene and the first transgene is less than 90%, preferably less than 80%, more preferably less than 75 The invention also comprises fertile hybrid seed obtained by a process according to the invention, as well a plants obtained from fertile hybrid seed, as well as parts the plants, such as a bulb, flower, fruit, leaf, pollen, ro or root culture, seed, stalk, tuber or microtuber, and the like.

The invention further comprises plants, as well as par thereof, which harbour a chimeric gene which when expressed produces a protein or polypeptide product capable of substi tuting the function of a polypeptide or protein encoded by endogenous gene of said plant, wherein the nucleotide sequence identity of the transcripts encoded by the transge and the endogenous gene is less than 90%, preferably less than 80%, more preferably less than 75%.

DESCRIPTION OF THE FIGURES Figure 1. A representation of plasmid MIP289 harbourin an expression cassette with multiple cloning site, which ca be suitably used to insert foreign genes and antisense gene for expression in anthers of plant cells; CHI PB: chalcone iso erase B promoter; NOS tail: transcription termination signal derived from the nopaline synthase gene of Acrrobacte rium. Figure 2. Same plasmid as in figure 1, wherein the expression cassette contains a hybrid promoter based on the 35S promoter of cauliflower mosaic virus, and a so-called anther box (for details of promoter, vide Van der Meer, et al, 1992, sub) Figure 3. Crossing scheme for obtaining fully male- fertile hybrid seed according to the invention; plant S (Ssrr) : maternal male-sterile line heterozygous for the sterility gene which when expressed inhibits expression of endogenous plant gene required for pollen development or functioning; plant R: pollinator line heterozygous for a restoration transgene capable of neutralising the effect caused by the first transgene.

Figure 4. Similar crossing as in Figure 3, except for the pollinator line which is homozygous for the restoration gene.

Figure 5. Binary vector pFBP125. This is a pBIN19 based vector with an insert comprising a chs gene from Arabidopsis thaliana between a hybrid promoter fragment comprising the CaMV 35S RNA promoter in which an anther-box (AB) has been inserted, and the nos-termination region of Agrobacterium tumefaciens.

Figure 6. Binary vector pFBP130. This is a pBIN19 based vector with an insert comprising an chs gene from Arabidopsi thaliana between a promoter fragment of the chs-A gene of Petunia hvbrida and the nos-termination region of Agrobacte¬ rium tumefaciens.

Figure 7. Southern analysis of plant DNA of several petunia lines containing: (a) petunia anti-sense chs con- struct (T29) , (b) Arabidopsis sense chs gene construct (- T36004), (c) both constructs (a) and (b) (T38002 and T38007) and wild-type (W115) probed with ³²P-labelled Arabidopsis chs DNA (o/n exposure -80 degr. Celsius) . The Arabidopsis chs genes are clearly visible in T38002 (several strong bands) , T38007 (several strong bands) and T36004 (one strong upper band) , whereas there is only slight cross-hybridization with the endogenous petunia chs genes or antisense petunia chs genes (faint bands in the lanes of T38002, T38007, T29 and 115 and the antisense gene in T29) .

Figure 8. Northern analysis of messenger RNA of the same plants as in Fig. 7, including now T38005. Probed with petunia chs DNA; 6 days exposure -80 degr. Celsius) . The chs RNA are clearly visible in the lanes of T36004 and W115 as expected. In none of the antisense plant lines (T29, T38002, T38005, T38007) could a petunia RNA be detected, as could have been expected as well.

Figure 9. Northern analysis as in Figure 8, except that the blot was probed with Arabidopsis chs DNA, o/n exposure at - degrees Celsius. At o/n exposure the Arabidopsis chs MRNA i only detected in the lane of T36004. However, upon gross overexposure some very faint bands could be detected in the lanes of the double transgenic lines T38002, T38005 and T38007.

DETAILED DESCRIPTION The instant invention will be illustrated by outlining in more detail the findings that are obtained when performi experiments aimed at restoration of male-fertility in plant that were made male-sterile by the expression in the tapeta cell layers of a chalcone synthase transgene which was plac in the reverse orientation with respect to the promoter. Th details of the gene constructs and the male-sterile plants obtained therewith are described in Van der Meer et al. _f (1992, The Plant Cell , 253-262).

It was shown that expression of an antisense CHS gene the anthers of transgenic plants caused inhibition of norma pollen functioning as a result of which the plant were unab to self-pollinate. The transgenic male-sterile plants were found to be entirely female-fertile and could be made to se seed by cross-pollination with a male-fertile pollinator line. It was concluded that the antisense chs plants can be suitably used for the production of hybrid crops.

In the experiments that underlie the present invention male-sterile Petunia hybrida plant S which is transgenic fo an antisense CHS gene from Petunia hybrida under the contro of regulatory sequences that provide for expression of the transgene in anthers of the plants, is cross-fertilised wit a Petunia hybrida plant R that contains a transgene obtaina ble from the chs gene of Arabidopsis thaliana which is unde the control of regulatory sequences that provide for ex¬ pression of the transgene in anthers of the plants. Of the pollinator plants R, harbouring only the transge ne from Arabidopsis thaliana the majority is not male-steril as might have been expected from the finding that transgenes can inhibit the expression of resident genes encoding homolo gous gene products. This so-called co-suppressive effect has been established for a number of genes including a chs transgene obtainable from Petunia hybrida and re-introduced into petunia plants (Napoli C. et aJL. , 1990, The Plant Cell 2 , 279-289; Van der Meer I. et al. , 1992, Plant Cell 4_, 253- 262) . It has also been disclosed that expression of a chs transgene placed in the sense direction under the control of its promoter gives rise to male-sterile plants, just as expression of an antisense chs gene does, provided expressio of the transgenes occurs at least in the tapetal cell layer of the anthers of the plants (PCT/NL92/00075, which is herewith incorporated by reference in this specification, with the proviso that the definitions in that application do not apply to the description of this invention and the claim attached thereto at present or after amendment) . The finding that the introduction of a divergent chs gene, such as the one from Arabidopsis. does not markedly inhibit the production of chalcone synthase in the transgeni plants indicates, that significant co-suppressive effects ar absent if a transgene is selected that encodes a transcript that is sufficiently divergent from the endogenous gene transcript.

The crossing of male-sterile plant S, which is heterozy gous for the sterility gene (Ssrr) with plant R, homozygous for the restoration gene (ssRR) yields hybrid seed SR of which 50% contains in addition to the endogenous chs gene an the Arabidopsis chs gene in the sense orientation, the antisense chs gene from Petunia hybrida. Contrary to expecta tion, it will be found, that a percentage of the progeny plants grown from the hybrid seed (50% SsRr; 50% ssRr) harbouring both the transgenes is again capable of self- fertilization in spite of the fact that about 50% also inherited the sterility gene.

To establish the nature of the restored phenotype a transcript specific primer extension experiment is carried out on CDNA obtained from young anthers. Attempts to visuali ze radioactive extension products corresponding to the first (petunia chs) transgene transcript fails, which can be expected in view cf the restored phenotype. Applying equal radio-illumination times it is also impossible to detect the presence of the endogenous chs gene transcript, whereas an extension product of about 1.4 kb obtained with the primers represented as SEQIDNO: 1 and SEQIDNO: 2 corresponding to Arabidopsis chs transgene transcript can be clearly detecte under these conditions. The corollary of these experiments i that the endogenous gene transcript and the almost identical petunia transgene transcript interact, presumably by basepai ring, as a consequence whereof these transcripts are not expressed and probably degraded in the plant nucleus. It is presumably due to the nucleic acid sequence divergence of t Arabidopsis transgene with respect to both the endogenous petunia gene, as well as the petunia transgene, that the former does not interact with any of the transcripts encode by the latter two genes. The nucleic acid sequences of the Arabidopsis transgene and the Petunia gene transcripts diff at least 30% in the protein encoding region, presumably eve more if the non-translated regions of the transcript are taken into account. Hence, the nucleic acid divergence of t transcript is deemed responsible for its translatability in the plant cell, thereby producing a fully active chalcone synthase which substitutes the endogenous chalcone synthase. As a result male-fertility is restored in a percentage of t progeny plants despite the fact that about 50% thereof contain the sterility transgene. Apparently, the high degree of nucleic acid sequence identity of the first (petunia) chs transgene antisense transcript and the endogenous (petunia) chs transcript favours the interaction of these molecules, probably causin them to be degraded, while the second chs transgene trans- cript from Arabidopsis thaliana which is at the most 75% identical on the nucleic acid level (see Table 1) , is pro¬ duced in sufficient quantities to be translated into a full functional (heterologous) chalcone synthase capable of restoring the plant's altered phenotype. We therefore main- tain that the restoration of the male-fertility phenotype is due to complementatii on the enzyme level.

This is believed to be the first observation of partial phenotype restoration, or phenotype moderation, in plants, wherein the production of an endogenous protein product is blocked and wherein the function of that protein product is substituted by a protein product similar (not necessarily identical) on the amino acid level, but encoded by a nucleotide sequence which is different on the nucleic acid level. This finding may have interesting applications i the genetic modification, restoration, or moderation of plan phenotypes, in and outside the area of hybrid seed produc¬ tion. For example, it is now feasible to silence endogenous enzymes, and substitute such enzymes by enzymes with differ- ent properties, such as a different substrate specificity, mode of regulation, and the like. Such substitutions may bring about subtle, yet interesting, changes in the biochemi cal pathway in which the endogenous enzyme is involved.

The various aspects of the invention are outlined in more detail below.

The invention can be worked with any phenotype alterati on system that involves an inhibitory gene of the antisense type, such as described in EP 240 208 A2, directed against a endogenous gene. Evenly so, it can be worked with an inhibi- tory gene of the sense type, which work by the as yet not fully understood mechanism referred to as co-suppression, disclosed in Napoli et al.. , 1990, supra. Examples of such phenotypes include, but are not limited to disease-resis¬ tance, drought-resistance, flower colour, fruit ripening, a the like.

The restoration gene must encode a transcript that is sufficiently divergent from both the endogenous gene trans¬ cript as well as the inhibitory transgene transcript and yet encodes a protein or polypeptide capable of substituting the function of the endogenous gene product. Phenotype resto¬ ration can be made absolute. Alternatively, phenotype resto¬ ration may be made not absolute; in this case it is preferre to speak of partial phenotype restoration or 'phenotype moderation'. If absolute phenotype restoration is aimed at. the divergence of the transcript must diverge preferably by more than 20%, that is the nucleic acid identity of the restoration transcript with either the inhibitory transgene transcript or the endogenous gene transcript does not exceed 80%, preferably it does not exceed 75%. Depending on the level of moderation desired, optimal moderation can be achieved by making transgenes with different levels of divergence and selecting the desired phenotype. In case phenotype restoration is not required to be absolute, or desired to be not absolute, divergence of the restoration transgene transcript should not exceed 20%, preferably it should not exceed 10%. The latter is referred to as phenotyp moderation.

Likewise, phenotype alteration systems that involve inhibitory genes of the ribozyme type directed as sequence specific endo-ribonucleases against an endogenous gene trans cript, as disclosed in US Patent 4,987,071, may be restored with a transgene according to the invention, with the provis that the restoration gene encodes a transcript that is lacking the recognition and/or cleavage consensus of the ribozyme. Phenotype moderation should be possible using this kind of inhibitory transgenes as well, although manipulating the recognition and cleavage sequence of the restoration gen to affect its affinity for the ribozyme may require some trial and error.

The choice of the restoration gene

As a rule the restoration gene must not give rise to a transcript that is identical to the endogenous gene trans- cript. Preferably, the restoration gene transcribed region i as much divergent from the transcribed region of the endoge¬ nous gene as possible, while the protein product encoded by said transcript is identical, or almost identical. It is wel known in the art that each amino acid can be encoded by a more than one codon; this fact, referred to as the degenerac of the genetic code, stems from the fact that there are abou 20 different amino acids, which are encoded by triplets of four different bases, yielding a total of 64 possible codons Three codons comprise stop signals for translation, so that in actual fact 61 codon specify about 20 amino acids. Roughl spoken, every third base may be changed in a coding region without affecting the amino acid sequence of the protein. This means that the transcribed region of a restoration gene can at least diverge 33% from the endogenous gene. But, sinc a gene transcript generally comprises non-translated regions flanking the coding region on both sides, even further nucleic acid divergence may be achieved in order to avoid interaction of the restoration gene transcript with the endogenous gene transcript or the first transgene transcript Furthermore, still greater divergence may be achieved i one takes into account the fact that two proteins may differ in their amino acid sequence, while retaining their physiolo gical activity in the plant cell. Although it is not esta- blished to what extent this may be, it may be assumed that proteins which have conservative amino acid replacements in 10% of their amino acids, will still be capable of performin their physiological role. Altogether, it will be clear to someone skilled in the art that a restoration gene according to the present invention need not be more identical to its endogenous counterpart than about 40-50% on the nucleic acid level.

Some aspects of the invention will be further illustra¬ ted with male-sterility as exemplifying phenotype.

Obtention of a male-sterile maternal line S

Any male-sterile plant phenotype that is due to expres¬ sion of an inhibitory gene of one of the types mentioned in the preceding paragraphs can be restored by a restoration gene according to the invention.

Typical examples of how genes can be identified that ar essential for pollen development or pollen functioning is given inter alia in WO89/10396 and WO90/08828. Once such genes are isolated they can be expressed or overexpressed in the sense or antisense orientation in those cells required for pollen development or functioning. In order to achieve expression in those cells that are necessary for pollen development, genes are placed under the control of promoters that are expressed in stamen cells (including filaments and anthers) , or more specifically in anthers, or even more specifically in tapetal cell layers thereof. A distinction should be made to sterility genes that are disruptive to general plant cell functioning or viability on the one hand, and genes that disrupt plant metabolism to the extent that i disrupt pollen development or functioning without drasticall affecting plant viability on the other hand. The antisense chalcone synthase gene is one of the latter category; conse¬ quently, it is not necessary for the latter type sterility gene to be expressed exclusively in stamen cells through the use of stamen-specific promoters. Sterility genes of the former type, i.e. the general plant cell disrupters, must no be effective inside plant structures essential for survival of the plant. Methods for isolating promoters that provide for proper expression patterns of these genes are also described in both W089/10396 and WO90/08828, which are herewith deemed incorporated by reference.

For reasons of illustration the maternal male-sterile line is represented as being heterozygous for the sterility gene. However, it will be clear that fully fertile hybrid seed can be obtained also if the maternal line is homozygous for the sterility gene. International Patent Application PCT/NL92/00075, discloses a method for obtaining homozygous male-sterile plants, by selfing male-sterile plants harbou- ring one copy of an antisense chs gene, whereby the pollen that are arrested in their development are made to germinate on pistils in the presence of flavonoids. The seed obtained from this selfing can be grown into homozygous male-sterile maternal plant lines, which can optionally be propagated jLn vitro first, and then used as such in hybrid seed productio by cross-pollination with a pollinator line, which may be heterozygous or homozygous for the restoration gene accordi to the invention.

Plant transformation

Introduction of sterility genes, herbicide resistance genes or restoration genes into plants, is achieved by a an one of the following techniques, the choice of which is not critical to the present invention. Generally, useful methods are the calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al. , 1982, Nature 296. 72-74; Negrutiu I. gt al, June 1987, Plant Mol. Biol. 8., 363-373) , electroporation of protoplasts (Shillito R.D. et al. , 1985 Bio/Technol. 2, 1099-1102), microinjection into plant material (Crossway A. et al. , 1986, Mol. Gen. Genet. 202. 179-185) , (DNA or RNA-coated) particle bombard¬ ment of various plant material (Klein T.M. et al.. , 1987, Nature 327. 70) , infection with viruses and the like. Preferred according to the invention is the use of

Agrobacterium-mediated DNA transfer. Especially preferred is the use of the so-called binary vector technology as disclo¬ sed in EP-A 120 516 and U.S. Patent 4,940,838).

Subsequently, receptive plant cells or are selected for the presence of one or more markers which are encoded by plant expressible genes co-transferred with the plant expres sible gene according to the invention, whereafter the trans¬ formed material is regenerated into a whole plant. Alternati vely, pollen cells are transformed, for instance by coated- particle acceleration, and used to pollinate receptive plants.

Although considered somewhat more recalcitrant towards genetic transformation, monocotyledonous plants are amenable to transformation and fertile transgenic plants can be regenerated from transformed cells. Presently, preferred methods for transformation of monocots are microprojectile bombardment of explants or suspension cells, and direct DNA uptake or electroporation (Shimamoto, et al. 1989, Nature 338. 274-276) . Transgenic maize plants have been obtained by introducing the Streptomyces hygroscopicus bar-gene, which encodes phosphinothricin acetyltransferase (an enzyme which inactivates the herbicide phosphinothricin) , into embryogeni cells of a maize suspension culture by microprojectile bombardment (Gordon-Kamm et al., 1990, Plant Cell, 2., 603- 618) . The introduction of genetic material into aleurone protoplasts of other monocot crops such as wheat and barley has been reported (Lee, 1989, Plant Mol. Biol. 13., 21-30). Wheat plants have been regenerated from embryogenic suspensi on culture by selecting only the aged compact and nodular embryogenic callus tissues for the establishment of the embryogenic suspension cultures (Vasil I., et al, 1990, Bio/Technol. 8., 429-434). Herbicide resistant fertile wheat plants were obtained by microprojectile bombardment of regenerable embryogenic callus (Vasil V. et al, 1992, Bi- o/technol. .10, 667-674) .The combination with transformation systems for these crops enables the application of the present invention to monocots.

Monocotyledonous plants, including commercially impor- tant crops such as corn are also amenable to DNA transfer by Agrobacterium strains (Gould J, Michael D, Hasegawa O, Ulian EC, Peterson G, Smith RH, (1991) Plant. Physiol. 95, 426- 434) .

Marker genes

Suitable marker genes that can be used to select or screen for transformed cells, can be selected from any one o the following non-limitative list: neomycin phosphotransphe- rase genes conferring resistance to kanamycin (EP-B 131 623) the hygromycin resistance gene (EP 186 425 A2) the

Glutathione-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides (EP-A 256 223), glutamine synthetase conferring upon overexpression resistan ce to glutamine synthetase inhibitors such as phosphinothri- cin (W087/05327) , the acetyl transferase gene from Streptomy ces viridochromogenes conferring resistance to the selective agent phosphinothricin (EP-A 275 957) , the gene encoding a 5 enolshikimate-3-phosphate synthase (EPSPS) conferring tole¬ rance to N-phosphonomethylglycine, the bar gene conferring resistance against Bialaphos (e.g. W091/02071) , and the like The actual choice of the marker is not crucial as long as it is functional (i.e. selective) in combination with the plant cells of choice.

The marker gene and the gene of interest do not necessa rily have to be linked, since co-transformation of unlinked genes (U.S. Patent 4,399,216) is also an efficient process i plant transformation.

Gene expression The expression pattern required for the restoration gen depends on the expression pattern of the inhibitory transge¬ ne. The latter in its turn is dependent on the phenotype alteration aimed at. Thus, for modifying the fruit ripening phenotype in a plant, an inhibitory gene bringing about said alteration must at least be expressed in the fruits of said plant. Restoration or moderation can be achieved by an expression pattern that comprises at least the expression pattern of the inhibitory transgene.

Multiple transgenic plants

To obtain transgenic plants harbouring more than one gene a number of alternatives are available, the actual choice of which is not material to the present invention: A. the use of one recombinant polynucleotide, e.g a plasmid, with a number of modified genes physically coupled to one selection marker gene.

B. Cross-pollination of transgenic plants which are already capable of expressing one or more chi eric genes coupled to gene encoding a selection marker, with pollen from, a trans¬ genic plant which contains one or more gene constructions coupled to another selection marker. Afterwards the seed, which is obtained by this crossing, is selected on the basis of the presence of the two markers. The plants obtained from the selected seeds can afterwards be used for further cros¬ sing.

C. The use of a number of various recombinant polynucleoti- des, e.g. plasmids, each having one or more chimeric genes and one other selection marker. If the frequency of cotrans- formation is high, then selection on the basis of only one marker is sufficient. In other cases, the selection on the basis of more than one marker is preferred.

D. Consecutive transformations of transgenic plants with new additional genes and selection marker genes. E. Combinations of the above mentioned strategies.

The actual strategy is not critical with respect to the described invention.

selection of hybrid seed It is known in the art that, the need to separate hybri seed from non-hybrid seed can be avoided if the self-pollina tors can be destroyed, for example by using an antibiotic, preferably a herbicide. This requires that the maternal male sterile line is resistant to this antibiotic or herbicide du to the presence of transgene coding therefor.

The herbicide resistance gene may be introduced into th maternal line simultaneously with the sterility gene accor¬ ding to the invention by genetic transformation with a ulti gene construct. However, the herbicide resistance gene may b introduced into the maternal line after the introduction of the sterility gene.

It may be advantageous to introduce the herbicide resistance trait into the plant intended to use as maternal parent line prior to the introduction of the sterility gene. This simplifies the creation of plants that are homozygous for the herbicide resistance phenotype which may be advanta¬ geous. Then, plants provided subsequently with the sterility gene, may be cross-pollinated with a pollinator plant contai ning a restoration gene according to the invention. Suitable herbicides can be selected from any one listed under the heading marker genes.

Advantages and industrial application The process according to the invention is particularly useful for the production of hybrid progeny that is fully male-fertile.

In a conventional process of producing hybrids from self-fertilising crops a transgenic (heterozygous) nuclear male-sterile plant line S (Ssrr) may be crossed with a male- fertile plant line R (ssrr) to yield hybrids that are 50% fertile (ssrr) and 50% sterile (Ssrr) . Consequently, if such hybrid crops were grown in the field directly, 50% of the acreage would consist of plants that must be cross-fertilise in order to set seed, which may have significant yield reducing effects for those crops that rely on the setting o fruit or seed for their commercial value. Examples of such crops include but are not limited to cereals and oil seed rape. Thus, the present invention is especially suitable for the hybridization of naturally self-fertilizing crops by crossing a maternal line which is male-sterile due to the expression of a first transgene capable of inhibiting expres sion of an endogenous plant gene essential to normal pollen functioning, and a pollinator line containing a second transgene capable of neutralising the effect caused by the first transgene. Although 50% of the hybrid progeny is heterozygous for the sterility gene, the presence of the restoration or moderation gene ensures fertility of the progeny that is closer to that of the wild type lines.

The specific advantages of this hybridization system reside in the fact that it can be used in combination with any sterility system that makes use of transgenes inhibitory to endogenous genes. As a consequence the phenotype can be determined predominantly by the nature of the gene product, rather than the specificity of the expression pattern.

All references cited in this specification are indicati ve of the level of skill in the art to which the invention pertains. All publications, whether patents or otherwise, referred to previously or later in this specification are herein incorporated by reference as if each of them was individually incorporated by reference.

The Examples given below are just given for purpo- ses of illustration and do not intend in any way to limit th scope of the invention.

EXAMPLE 1 Construction of a chiPB/as-chs and a chalcone isomerase B promoter chs gene construct (chiPB/chs-At)

The chiPB/as-chs construct comprises a chs cDNA fragmen from Petunia hybrida fused in the antisense orientation to a chalcone isomerase B promoter fragment. The chiPB/chs-At construct comprises a chs cDNA fragment from Arabidopsis thaliana fused in the sense orientation to a chalcone isomerase B promoter fragment.

A 1.7 kb promoter fragment from the anther-specific chiP_B promoter (Tunen, A.J. Van., Mur, L.A., Brouns, G.A. , Rienstra, J.D., Koes, R.E. and Mol J.N.M., 1990, The Plant Cell 2., 393-401) and a 0.2 kb NOS tail isolated from plasmid pBIlOl.l (Jefferson, R.A., Kavanagh, T.A. , and Bevan, M.W. (1987). EMBO J. 6_, 3901-3907) are cloned into the plasmid pUC19 (Messing, J. , 1978, Recombinant DNA Technical Bulletin NIH Publication No. 79-99, 2 , 43-48) yielding the recombinan plasmid MIP289 (Figure 1) .

A 1.4 kb BamHI chs fragment is isolated from plasmid pTS21 (Van der Meer et al. , 1992, supra) and cloned into plasmid MIP289 digested with BamHI. A clone with the chs fragment in an antisense orientation is selected on the basi of the asymmetric SstI restriction enzyme site. Subsequently this fragment is subcloned as a Hindlll/EcoRI fragment into the binary vector Binl9 (Bevan, M. (1984) Nucl. Acid Res. 12. 8711-8712) yielding plasmid pAS8. To isolate a full size Arabidopsis chs cDNA, single stranded cDNA is synthesized on 10 μg RNA isolated from youn Arabidopsis thaliana ecotype Landsberg erecta flower buds, b priming with an 17-mer oligo-dT primer (Maniatis, T., Fritsc h, E.F., and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual (Cold Spring Harbour, NY: Cold Spring

Harbour Laboratory) . A set of two additional primers based o (Feinbaum, R.L. , and Ausubel, F.M. (1988). Mol. Cel. Biol. 8. 1985-1992) with the sequence based on the 5' region (primer = SEQIDNO: 1; GCGGATCCGTATACTATAATGGTGATGG) and 3' region (primer II = SEQIDNO: 2; GAGGATCCTTAGAGAGGAACGCTGTGCAAGAC) o the Arabidopsis chs gene are used for the initial polymerase chain reaction (PCR) analysis. The PCR reaction is performed in 100 μl PCR buffer (10 mM Tris, pH 8.3, 50mM KC1, 2.5 mM MgCl₂) containing 50 pmole primers, and 200 μM of each deoxy nucleotide triphosphate. Amplification involved 30 cycles of a standard cycle for homologous primers. Amplified CDNA is fractionated on a 1% agarose gel and a 1.4 kb band is iso¬ lated and subcloned as a BamHI fragment (sites present in th 5' and 3' primers) in pAS8 after digestion with BamHI to remove the petunia chs CDNA. The orientation and proper cloning of the Arabidopsis chs CDNA into PAS8/BamHI is checked by a detailed restriction enzyme analysis and sequence analysis; the correct plasmid is called pAS9. Example 2 Transformation of tobacco plants The plasmids pAS8 and pAS9 are transferred from E. coli JM83 (Messing et al, 1978, supra) to Agrobacterium tumefa- ciens strain LBA 4404 (Hoekema A. et al.. , 1983, Nature 303: 179-180) by triparental mating (Rogers, S.G., and Fraley, R.T., 1985, Science 227, 1229-1231), using a strain contai¬ ning plasmid pRK2013 (Ditta et al.. , 1980, Proc. Nat. Ac. Sc USA, 12., 7347-7351) . Transformed tobacco plants are obtaine by the standard leaf-disc transformation method (Horsch et al. , 1985, Science 227. 1229-1231). After cultivation with the A. tumefaciens strains harbouring either pAS8 or pAS9, the tobacco leaf discs are grown on MS plates containing 3 μg/ml kinetin, 500 μg carbenicillin and 200 μg kanamycin. Plants obtained are checked for transformation on the basis of resistance for kanamycin and by Southern blot analysis using an npt fragment as a probe. After shoot and root induction plants are put on soil and transferred to the greenhouse. Plants are grown under in the greenhouse at 21* at a 16 hours light, 8 hours dark regime.

Example 3 Analysis of transgenic plants expressing the antisense chs construct Transgenic tobacco plants containing the chimeric pA gene construct (Petunia antisense chs) are investigated f fertility by self-pollination. At least one plant is almo completely sterile and shows a seed set of less than 1% selfings. Furthermore the pollen grains of this plant a morphologically aberrant, as was also published by Van d Meer et &!. (1991) and are not able to germinate in an vitro germination assay. This plant is designated SI a contains only one copy of construct pAS8 in its genome.

Example 4

Analysis of transgenic plants expressing the chimeric Arabi dopsis chs construct From a number of 15 transgenic tobacco plants containi plasmid pAS9, one plant expressing the Arabidopsis chs cD in young anthers is selected by RNAse protection experiment using RNA isolated from young anthers. This plant is designa ted Rl.

Example 5

Crossing of SI and Rl restores fertility A cross is made between SI (genotype Ssrr) and R (genotype ssRr) and the offspring of this cross is grown t mature plants. Based on their genotype four classes of plant can be distinguished: Ssrr, SsRr, ssRr, and ssrr (see als Figure 2) . It can be observed that plants containing th restoration gene, i.e. the Arabidopsis chs gene (SsRr) ar able to set seed after self-pollination despite the presenc of a sterility gene (Ss) . Light-microscopical analysis show that these plants have pollen that are morphologically norma whereas Ssrr plants have aberrant pollen. All plants contai ning both the sterility gene construct pAS8 and the restora tion gene construct pAS9 show restoration of fertility as ca be demonstrated by self-pollination experiments. In a contro cross between SI and an untransformed tobacco plant only 50 of the offspring is able to set seed after self-pollinatio as can be expected on the basis of the fact that SI has copy of construct pAS8 integrated in its genome.

EXAMPLE 6

The following table provides data about chalcon synthase genes from various plant species and the nuclei acid identity of the amino acid coding regions: referenc sequence is Petunia hybrida V30 chalcone synthase gene. Bes match is given at a minimum sequence of 1000 bp.

TABLE 1

source

P. hybrida V30

P. hybrida

P. hybrida P. hybrida

P. hvbrida

P. hybrida

Boldface: gene fragments that are used as sterility an restoration gene respectively, in this disclosure.

Other suitable combinations of sterility genes and restora tion genes can be selected from this table.

EXAMPLE 7 Partial fertility restoration in male-sterile plants by re- transforming male-sterile plants with a divergent restoratio gene construct

Petunia W115 plants were transformed with a sterilit gene construct comprising the promoter region of the petuni chs gene linked to the coding region of the petunia chs gen in antisense orientation. This gene construct, designate VIP176 (Krol A.R. van der et al. , 1990, Plant Molecula Biology .14., 457-466) was used to transform the petunia lin W115 and a self-sterile plant was selected and designate T17002. This self-sterile flavonoid depleted plant, T17002 was cross-pollinated with a W115 plant and among the progen a plant was selected, which was kanamycin sensitive but stil self-sterile and depleted for flavonoids; this plant wa designated T29. This sterile, kanamycin sensitive plant, T29 was used for a second transformation with pFBP125 (P_C8MV35SAB

^CHSAt, yielding the 39000 plants ' ^not discussed further) or PFBP13 (^P _{CHS pet}/^CHS _At, rendering the 38000 plants, see below).

This approach was successful as 7 transgenic 3800 plants were obtained which contain both the sterility gen construct (chs-antisense from petunia) as well as the restor ation construct (sense-chs from Arabidopsis) . Of these plant 5 had flavonol production in the corolla; 2 out these plants were male-fertile (inter alia T38005) . In order to obtain data about the functionality of th Arabidopsis CHS-enzyme in petunia plants, W115 plants wer transformed with Agrobacterium strains harbouring pFBP12 (yielding the 36000 plants, see below) . Of 15 transforme plants, 4 plants over-produced flavonols as compared to wild type (W115) (inter alia T36004, see Table 2).

Plant lines were tested for the presence of the con structs by Southern analysis. Expression of the genes wa verified by Northern analysis.

Table 2 summarizes the results for 6 petunia lines: fro top to bottom are given Southern data, obtained by probin with petunia chs probes and Arabidopsis chs probes; Norther data, obtained by probing with both aforementioned probes corolla pigmentation (flavonol staining) ; and fertilit determination. The genetic backgrounds of the petunia line are as follows: W115 - wild-type petunia plants (non-trans genic) ; T29 - P_CaHV35SAB-antisense petunia chs (transgenic fo sterility gene); T38002, T38005, T38002 - P_chs-antisens petunia chs + P_ch£-A.thaiiana chs (transgenic for sterilit gene and restoration gene) ; T36004 - P_CαMV35;:ΛD-A. thaliana ch (transgenic for the restoration gene only) .

As indicated in the table lines W115, which is 100 fertile, and T29, which is entirely unable to self-pollinate performed as expected (see PCT/NL92/00075) . The double transgenic lines T38002, T38005 and T38007, which contai both the sterility gene and the fertility gene, had only partially restored fertility; for T38005 seed-set was abou 10-20% of the wild-type W115. These data correspond well wit the presence of only slight amounts of flavonols (see below) Moreover, the presence of flavonols was dependent on th presence of the Arabidopsis chs gene, as was confirmed b Southern data using the Arabidopsis chs PCR fragment as probe. The Arabidopsis chs probe was only weakly capable o cross-hybridizing with the petunia chs gene and vice vers (Fig. 7). The Northern data on mRNA of corolla's corresponded wit the Southern data, except that the Arabidopsis chs-messenge RNA of plant lines T38002, T38005 and T38007, when probe with the Arabidopsis chs-probe. could only be detected afte gross over-exposure; this is probably due to weak expressio of the Pchs-Arabidopsis chs gene construct in corolla's. Th Northern data for lines T38002, T38005 and T38007 seem i accordance with production of low amounts of flavonoles i these lines, which, in turn, might explain the fact that th sterility was restored only partially (only 10-20% seed se for T38005 as compared to W115) . In order to restore fertil ity it is necessary that the restoration gene construct (suc as in pFBP125 and pFBP130) is expressed in either the mal reproductive organs or the female reproductive organs or i both. Although expression of the restoration gene in corol la's provides an initial indication of fertility restoratio it will be necessary to establish^" expression of the Arabidop sis gene in either of the reproductive organs. We anticipat that the T38005 plant expresses the Arabidopsis gene i either of the reproductive organs, and Northern analysis i in progress- to confirm this.

The proper functioning of the Arabidopsis CHS-enzyme wa established by comparing flavonol production in W115 wit T36004, which contains, in addition to its endogenous chs gene, copies of the Arabidopsis chs-gene. As is indicated corolla's of T36004 produced fc more flavonols (+++ = dar orange, after staining for flavonols) than W115 corolla's ( = pale orange) . As expected, male-sterile line T29 did no produce detectable amounts of flavonols (- — purely whit corolla's), whereas the corolla's of T38002, T38005, whic was partially fertility-restoxad, and T38007 produced sligh amounts of flavonols in the corolla (+/- = beige or very pal orange) .

The high flavonol level? ^served in corolla's of T3600 correspond well with the N . hern data obtained for tha plant line, indicating abundant levels of the Arabidopsi chs-messenger RNA in these li (see Fig. 9) . It is, there fore, clear that the Arabid- s CHS-enzyme is fully func tional in petunia plants a.ι in principle, capable o substituting the function of endogenous CHS.

Deposited microorganisms

On October 14, 1993, two E. coli JM101 strains, on harbouring pFBP125, and one harbouring pFBP130 have bee deposited at the Centraal Bureau voor Schimmelcultures

Baarn, The Netherlands, under accession number CBS 543.93 an

CBS 544.93, respectively.

¹ See also Figure 7.

² A signal was detected only after gross over-exposure; see also Figure 8 and 9.

³ Selfed seed is used for linkage analysis in an out-crossing in order to establish agreement of the presence of the petunia antisense gene (self-sterile) , the sense Arabidopsis chs gene (male- fertile, both the petunia antisense chs and the Arabidopsis chs gene (partially male-fertile) , and no transgenes (fertile) .

⁴ T36004 is crossed with homozygous T29 to perform a similar kind of linkage analysis.

5 Flavonol staining is specific for quercetin and dihydro-kaempferol (aglykones) and is performed according to Sheahan J.J. and Rechnitz G.A., 1992, BioTechniques 1 , No. 6, 880-883.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: M3GEN International N.V.

(B) STREET: Einsteiπweg 97

(C) CITY: LEIDEN

(D) STATE: Zuid-Holland

(E) COUNTRY: The Netherlands

(F) POSTAL CODE (ZIP) : NL-2333 CB

(G) TELEHΪONE: (0)31.71.258282 (H) TELEFAX: (0)31.71.221471

(ii) TITLE OF INVENTION: Genetic Restoration of Plant Phenotypes

(iii) NUMBER OF SEQUENCES: 2

(iv) CCMEUTER READABIE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) CCMTOTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFIWARE: Patentin Release #1.0, Version #1.25 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE OlARACIERISTICS:

(A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOFOIOGY: linear

(ii) MDIECULE TYPE: CENA to mRNA (iii) HYPOTHETICAL: YES

(Vi) ORIGINAL SOURCE:

(A) ORGANISM: Arabidopsis thaliana

(B) STRAIN: landsberg ereσta (F) TISSUE TYPE: Flower buds

(x) KJELΓCAΠON INFORMATION:

(A) AUTHORS: Feinbaum, R L

Ausubel, F M

(B) TITLE: Transcriptional regulation of the Arabidcpsis thaliana chalcone synthase gene

(C) JOURNAL: Mol. Cell. Biol.

(D) VOLUME: 8

(F) PAGES: 1985-1992

(G) DATE: 1988

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: GOGGATCOGT AIACIAIAAT GGTGATGG 28

(2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS:

(A) IENCTH: 32 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOPOIOGY: linear

(ii) MDIECULE TYPE: cENA to mRNA (iii) HYPOIHETICAL: YES

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Arabidopsis thaliana

(B) STRAIN: landsberg erecta (F) TISSUE TYPE: flower buds

(x) HJELTCAΠON INFORMATION:

(A) AUTHORS: Feiribaum, R L

Ausubel, F M

(B) TTTLE: Transcriptional regulation of the Arabidopsis thaliana chalcone synthase

(C) JOURNAL: Mol. Cell. Biol.

(D) VOLUME: 8

(F) PAGES: 1985-1992

(G) DATE: 1988

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: GAGGATCCTT AGAGAGGAAC GCTGTGCAAG AC 32

Claims

1. A process for the restoration of a plant phenotype

that is altered due to a first transgene which when expressed inhibits expression of an endogenous plant gene, by introducing into said plant, or progeny thereof, a second transgene which when expressed is capable of neutralising or partially neutralizing the effect caused by the first transgene, whereby said second transgene is expressed at least in those cells involved in the altered phenotype.

2. A process according to claim 1, wherein said second transgene encodes a protein or polypeptide gene product that is capable of substituting the function of the protein or polypeptide product encoded by the said endogenous gene and wherein the nucleotide sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 90%.

3. A process according to claim 2, wherein the nucleotide sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 80%.

4. A process according to claim 3, wherein the said second transgene encodes a protein or polypeptide gene product that is not identical in amino acid sequence to the endogenous gene product and wherein the nucleotide sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 75%.

5. A process according to any one of the claims 1-4, wherein said second transgene is obtainable from a different plant species.

6. A process for the restoration of fertility in a plant that is male-sterile due to a first transgene which when expressed inhibits expression of an endogenous plant gene required for pollen development or functioning,

by introducing into said plant a second transgene capable of neutralising the effect caused by the first transgene, whereby said second transgene is expressed in all cells in which the first transgene is expressed.

7. A process according to claim 6, wherein said second transgene encodes a protein or polypeptide gene product that is capable of substituting the function of the protein or polypeptide product encoded by the said endogenous gene and wherein the nucleotide sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 90%.

8. A process according to claim 7, wherein the nucleotide sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 80%.

9. A process according to claim 8, wherein the said second transgene encodes a protein or polypeptide gene product that is not identical in its amino acid sequence to the endogenous gene product and wherein the nucleotide sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 75%.

10. A process according to claim 6-9, wherein said second transgene is obtainable from a different plant species.

11. A process according to any one of the claims 6 to 10, wherein said first transgene is an antisense gene which when expressed inhibits expression of an endogenous flavonoid biosynthesis gene and said second transgene encodes a flavonoid biosynthesis enzyme capable of substituting the function of the corresponding flavonoid biosynthesis enzyme encoded by the said endogenous gene.

12. A process according to claim 11, wherein said first transgene is an antisense gene inhibiting expression of an endogenous chalcone synthase gene and said second transgene encodes a chalcone synthase capable of substituting the function of the chalcone synthase encoded by the said endogenous gene.

13. A process according to any one of the claims 7 - 12, wherein said first and said second transgene are selected from the group consisting of the chalcone synthase genes obtainable from table 1 in this specification.

14. A process according to any one of the claims 1 to 13, wherein said second transgene is introduced into the progeny of said plant by cross- pollination of a parent of said plant with pollen comprising said second transgene.

15. A process for obtaining fertile hybrid seed of a self-fertilizing plant species, cαrprising the steps of cross-pollinating a plant A which is male-sterile due to a transgene which when expressed inhibits expression of an endogenous gene required for normal pollen development or functioning, with a plant B which is male-fertile and comprises a transgene that encodes a protein or polypeptide product capable of substituting the function of the protein or polypeptide product encoded by the said endogenous gene.

16. The process of claim 15, wherein the first transgene is an antisense chalcone synthase gene, the endogenous gene is a chalcone synthase gene, and the second transgene encodes chalcone synthase, wherein the nucleic acid sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 90%.

17. The process of claim 16, herein the nucleic acid sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 80%.

18. The process of claim 17, wherein the nucleic acid sequence identity of the transcripts encoded by the second transgene and the first transgene is less than 75%.

19. Fertile hybrid seed obtained by the process of claim 15.

20. Plants obtained from seed of claim 19, as well as parts of the plants, such as a bulb, flower, fruit, leaf, pollen, root or root culture, seed, stalk, tuber or microtuber, and the like.

21. A plant, as well as parts thereof, which harbour a chimeric gene which when expressed produces a protein or polypeptide product capable of substituting the function of a polypeptide or protein encoded by an endogenous gene of said plant, wherein the nucleotide sequence identity of the transcripts encoded by the transgene and the endogenous gene is less than 90%.

22. The plant and plant parts of claim 21, wherein the nucleotide sequence identity of the transcripts encoded by the transgene and the endogenous gene is less than 80%.

23. The plant and plant parts of claim 22, wherein the nucleotide sequence identity of the transcripts encoded by the transgene and the endogenous gene is less than 75%.