EP0659213A1 - Growth hormone antagonists - Google Patents

Abstract

The present invention relates to growth inhibitory antagonists of bovine growth hormone obtained by mutation of the third alpha helix of that protein. These novel hormones may be administered exogenously to animals, or transgenic animals may be made that express the antagonist and thereby exhibited a reduced growth phenotype.

Description

GROWTH HORMONE ANTAGONISTS

This application is a continuation-in-part of U 07/693,305, filed May 1, 1991, now pending, which is continuation-in-part of PCT/US90/05874, filed October 12, 19 which is a continuation-in-part of USSN 07/419,561, fi October 12, 1989, all of which are hereby incorporated reference herein.

BACKGROUND OF THE INVENTION

Field of the Invention

This invention relates to novel growth hormo especially bovine growth hormone, muteins which inhibit growth of animals or otherwise antagonize the effects endogenous growth hormone. These analogues may be expressed transgenic animals which thereby acquire a "reduced grow phenotype.

Information Disclosure Statement

Bovine growth hormone (GH) is a protein of 191 am acids that is naturally synthesized in the anterior pituita The molecular weight of the mature protein is about 22, daltons, but it is initially made as a pre-growth hormone w an extra 26 amino acids on the amino terminal. This leader signal peptide) is normally cleaved during secretion of hormone by bovine pituitary cells. Several forms of the mat protein have been found in nature. The N-terminal can v (due to variation in the site of cleavage during secretion) that the mature protein begins with either NH₂ -Ala-Phe-Pro NH₂-Phe-Pro. Additionally, the amino acid at position 126 be either leucine or valine, apparently as a result of alle variation in the bovine population.

Exogenous administration of bGH to cattle increa milk production, feed efficiency, growth rate, and the lean- fat ratio, and decreases fattening time. bGH has been produced by recombinant DNA techniqu see e.g., Fraser, U.S. 4,443,539 (yeast); Buell, EP Ap 103,395 (bacteria); Krivl, EP Appl. 193,515 (bacteri Kopchick, EP Appl. 161,640 (encapsulated mouse cells implan into animals); DeBoer, EP Appl. 75,444 (bacteria; gene modif to eliminate harmful secondary structure) and this facilitated the production of analogues of bGH by site-speci mutagenesis. Thus, Aviv, GB 2,073,245 describes production Met Pro (des Ala) bGH, Met Arg (des Ala) bGH, Met-Glu-Gly ( Ala) bGH, and des (Ala¹Phe²-Pro³ -Ala*) bGH i coli. Bre et al., PNAS (USA) 85:3367-71 (1988) reported preparation the bGH mutant K112L, which extended the hydrophobic face the third alpha helix of bGH. The 96-133 fragment of t mutant was also prepared.

The biological activity of proteolytic fragments bGH has also been studied. Brems, et al., Biochemist 26.-7774 (1987); Swislocki, et al., Endocrinology, 87: (1970); Paladini, et al., TIBS, 256 (Nov. 1979). The fragm of bGH containing amino acids 96-133 is superior in gro promoting assays to bGH 1-95 and bGH 151-191. Hara, et al Biochemistry, 17:550 (1978); Sonenberg, U.S. Patent N 3,664,925 and 4,056,520; Chen and Sonenberg, J. Biol. Che 250:2510-14 (1977) . An octapeptide derived from the ami terminal of hGH has been shown to have hypoglycemic activit see Ng, et al., Diabetes, 23:943-949 (1974), but it has effect on growth. Similar results were observed with t fragment bGH (96-133). Graf, et al., Eur. J. Biochem., 64:33 340 (1976); Hara, et al., Biochem., 17:550-56 (1978).

Analogues of bGH have varied in growth-promoti activity, as have the known analogues of other growth hormone However, a growth hormone analogue having growth-inhibito activity has not previously been reported. A variety of transgenic animals have been produ Hammer, et al., Nature, 315:680-683 (1985) (rabbits, sheep pigs) . Certain of these animals have been caused to expres growth hormone, and increased growth of such transgenic ani has been reported. Palmiter, et al., Nature 300:611 (19 microinjected the male pronucleus of fertilized mouse eggs a DNA fragment containing the promoter of the mo metallothionein-I gene fused to the structural gene of growth hormone. Several of the transgenic mice developed f the genetically modified zygote exhibited a growth r substantially higher than that of control mice. (In effe the genetically modified mouse serves as a test environment determining the effect of the hor one on animal growt Later, Palmiter, et al., Science, 222:809 (1983) demonstra that a similar enhancement of growth could be obtained transgenic mice bearing an expressible human growth horm gene. A like effect is observed when human growth horm releasing factor is expressed in transgenic mice. Hammer, al., Nature, 315:413 (1985).

Bovine growth hormone has also been expressed transgenic animals. McGrane, et al. J. Biol. Chem., 263:1144

(1988); Kopchick, et al., Brazil. J. Genetics, 12:37

(1989) . However, transgenic animals characterized by exogenous gene which confers a reduced growth phenotype w hitherto unknown.

SUMMARY OF THE INVENTION

The present invention relates to proteins which substantially homologous with a vertebrate growth hormone have growth-inhibitory activity.

We have discovered that mutation of Gly¹¹⁹ in bGH Arg ("G119R"), Pro ("G119P"), Lys ("G119K"), Trp ("G119W") Leu ("G119L"), or the homologous Gly¹²⁰ in hGH to Arg or T results in a mutein (mutant protein or peptide fragm thereof) which has growth-inhibitory activity in vertebrat especially mammals. This novel hormone may be administered mammals (or other vertebrates) , in particular humans bovines, when growth inhibition is desirable.

In one embodiment of the invention, the hormone produced exogenously and administered to the subject. In v of the size of the hormone, it is preferably produced expression in a suitable host of a gene coding for it. Such gene is most readily prepared by site-specific mutagenesis o bGH gene. However, the hormone may also be produced by ot techniques, such as by condensation of fragments of native with a synthetic peptide carrying the replacement amino aci If a peptide fragment has the desired growth-inhibito activity, it may be prepared in toto by a Merrifield-ty synthesis.

In a second embodiment of the invention, this gene introduced into a prenatal form of a mammal by kno techniques, and the prenatal form is developed into transgenic mammal which expresses a reduced growth phenotyp Conceivably, a mammal could be genetically modified aft birt , i.e., "gene therapy".

Thus, growth-inhibited animals may be produced eith by administration of the growth inhibitory hormone of th invention in pharmaceutical form, or by genetic transformati of a prenatal or postnatal form of the animal.

The growth-inhibitory hormone, or the gene encodi it, is useful in the production of small animals for use research facilities where space is restricted, as pets for p lovers with limited quarters, and as livestock for farme having small tracts. The hormone may also be useful in t treatment of human gigantism, and in research on gigantism a dwarfism, in the treatment of diabetes and its sequelae, in control of cholesterol, and in the prevention and treatment certain cancers.

Characteristically, patients with poorly control diabetes have been found to have high levels of circulat growth hormone. See, e.g., Lundbaek, et al., Lancet, 2:13 (1970) . It has been speculated that high levels of gro hormone may contribute to poor diabetic control, as opposed being merely a consequence thereof. Press, et al., New Engl J. Med., 310:810-14 (1984). Attempts have been made to inhi growth hormone release by means of somatostatin analogu However, use of growth hormone antagonists has not b reported previously. Thus, a further aspect of the pres invention is the use of the disclosed GH antagonists to impr diabetic control.

Among the complications of diabetes are retinopat nephropathy and angiopathy. Diabetic retinopathy is belie to arise as a result of the proliferation of microvascu endothelial cells in the retina. Human growth hormone is kn to stimulate proliferation of microvascular endothelial cel See Rymaszewski, et al., Proc. Nat. Acad. Sci. USA 88:617 (1991) . The growth hormone antagonists of the pres invention may therefore be useful in countering the adve effects of elevated levels of endogenous growth hormone microvascular tissues, such as the retina, in diabetics, or other individuals experiencing excessive growth horm levels.

Glomerulosclerosis occurs in a variety of glomeru diseases, including diabetic nephropathy. The cause unknown, but mesangial cell proliferation precedes accompanies mesangial sclerosis. Thus, dysregulation resident glomerular cells may be an important issue in development of glomerulosclerosis (Doi, et al., Am. J. Patho 137:541, 1990) . Transgenic mice which express bGH have been shown have enlarged glomeruli which progressed to a state glomerulosclerosis. Thus, GH has been implicated in development of diabetic glomerulosclerosis (Doi, et al., 1 and Bell, Am. J. Med. Sci., 301:195, 1991). A GH antagon could . alleviate the GH-dependent effect on the cells of diabetic kidney, and thereby be useful in the prevention treatment of glomerulosclerosis.

While growth hormones have not previously b implicated in hypercholesterolemia, in another embodiment, antagonists are used to reduce serum cholesterol levels.

It has been suggested that long-activity somatosta analogues may have value in the control of breast and prost cancers. Manni, Biotherapy, 4:31-36 (1992). Ma hypothesizes that they could inhibit tumor growth by a numb of mechanisms, including inhibiting growth hormone secretio Growth hormone is implicated because it is lactogenic a because it elevates IGF-1 levels. We suggest that the grow hormone antagonists of the present invention may be used in t treatment of cancers whose growth is facilitated by endogeno growth hormone or IGF-1.

In general, these antagonists are therapeutically prophylactically useful in countering the adverse effects growth hormones, both endogenous hormones and hormon administered clinically.

In the course of our work, we have discovered correlation between the ability of mouse L cells to secrete t protein and the protein having an effect (positive or negativ on growth rate in a transgenic animal. The use of an L ce secretion assay to identify growth-modulating proteins is al a part of this invention. The appended claims are hereby incorporated reference as a further enumeration of the prefer embodiments. All patents and publications cited in t specification are incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 Amino acid sequence of bGH (G119R) nucleotide sequence of the gene encoding this analogue. alpha helices are marked and the amino acids are numbered, w number 1 being the first amino acid of the mature protein. boldfaced bases and amino acids are those mutagenized in G119R mutant.

Figure 2 General strategy of oligonucleotide direc mutagenesis. pBGHIO 6 was used as the parental vector. contains mouse metallothionein I transcriptional regulat sequences (MT-1) fused to the bGH gene (BamHI joined w Bglll) which contains five exons (shaded boxes I-V) and int A. This fusion gene was incorporated into pBR322 at the Ec site. The pBR322 origin of replication (ORI) , ampicill resistant gene (Amp) , as well as the bGH translation st (ATG) and stop (TAG) codons are indicated. 5¹ and 3' no translated regions are shown in hatching. The nucleoti sequence between restriction sites Tthllll and Xmal is show Substitution mutations are indicated. One silent mutation also indicated (*) which created a unique BamHI site. T position of the principal amino acid residues mutated in o experiments (115, 117, 119, 122) are indicated.

Figure 3 is an idealized surface net (cylindric plot) representa ion of most of the third alpha helix of bovi growth hormone. The surface net is produced by projection the helix onto a coaxial cylindrical sheet of paper, cutti this paper parallel to the helical axis and flattening it. T volumes of the amino acids are given in parentheses. A dash line indicates the cleft or depression formed by Alal22-Glyll Aspll5. Figure 4 is a plot of the secondary struc prediction (alpha-helix, beta-sheet, reverse turn, random c for amino acids 108-127 of bovine growth hormone (a) wild- (b) the mutant G119R and (c) the mutant A122D. These p were generated by the "Micro-Genie" program.

Figure 5 Scatchard plots of data from competi binding experiments for wild type bGH and bGH-M8 using m liver membrane preparations. The ordinate represents the r of bound to free bGH and the abscissa the concentration total bGH bound. Each point represents the mean of f experiments which were carried out in triplicate.

Figure 6 provides a growth rate comparison am control (non-transgenic) , G119R, G119L, G119K and G119P mi illustrating the growth-inhibitory effect of these mutants.

Figure 7 presents an axial view of the third al helix (109-126) of bGH, showing its a phipathic tendenci Hydrophobic amino acid sectors are shaded by dots; hydrophi amino acids are indicated by open sectors; the glycine sect a neutral amino acid, by slanted lines. The residue numb and hydrophilicity values (Hopp and Wood scale) are given.

Figure 8 presents side views of the third alpha he of wild type (left) and G119R mutant (right) bGHs projected the plane in which the side chain of the Arginine-119 of mutant G119R lies. The glycine 119 residue found at the bot of the cleft is indicated by an arrow.

The views were prepared by use of molecular modell software (QUANTA and CHARMm, Polygene, Waltham, Massachusett USA) .

Figure 9 compares serum glucose, urea/nitrogen, and triglyceride levels of control mice, transgenic bGH-M8 (E117L G119R, A122D) -producing mice, and transgenic wtbGH-producing mice, of both sexes.

Fiσure 10 compares serum cholesterol for transge wtbGH-producing mice, control mice, and transgenic bGH- producing mice, of both sexes.

Fiσure 11 plots GPDH activity against bGH-M8 dos in a competitive inhibition assay for the antagonism of ability of GH (here, wild-type bGH) to promote differentiation of preadipocytes (NIH 3T3-F442A cells) .

Fiσure 12 compares of the effect of bGH and bGH-M8 the differentiation of 3T3-F442A cells. At confluence, ce were incubated with increasing concentrations of bGH or bGH- Cells were harvested on day 8 for determination of G activity. The experiment was repeated twice with simi results. Each bar represents the mean value obtained f triplicate assays. The error bar represents the stand division.

Figure 13 shows the relationship between serum analog concentrations and the growth ratio of transgenic m (TG)/nontransgenic (NTG) . The ordinate represents bGH anal concentrations in serum. The abscissa represents the gro ratio of TG/NTG mice.

Fiσure 14 shows the relationship between serum h analog concentrations and the growth ratio of transgenic mi (TG)/nontransgenic (NTG) . The ordinate represents bGH anal concentrations in serum. The abscissa represents the grow ratio of TG/NTG mice.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention relates to growth hormo antagonists, especially growth inhibitors, which are peptid or proteins having a similarity in sequence and seconda structure to a vertebrate growth hormone, including but limited to mammalian growth hormones, especially human bovine growth hormones. Preferably, the compound comprises alpha helix having an amino acid sequence homology of at le about 50% with the third alpha helix of a vertebrate gro hormone, especially bovine or human growth hormone. Ot alpha helices of the native hormone may be omitted if this be done without loss of growth-inhibitory and/or other gro hormone antagonist activity. The use of the term "antagoni is in a functional sense and is not intended to limit invention to compounds having a particular mechanism action.

The overall percentage homology of bovine gro hormone with other mammalian growth hormones is high: porc (92%) , ovine (99%) , human (66%) , and rat (87%) . Insofar as third alpha helix (amino acid sequence homologous to 109-126) is concerned, the percentage homology is comparable the overall figure: porcine (94%) , ovine (94%) , human (66% and rat (94%) .

The secondary structure of a polypeptide is a regul arrangement of a linear segment of the polypeptide chain. T most commonly encountered secondary structures are the bet sheets and the alpha-helices. See Schulz and Schime Principles of Protein Structure 69 (Springer-Verlag: 1979 The alpha helix is stabilized by hydrogen bonding betwe peptide amide and carbonyl groups of residues separated by single turn of the helix. Secondary structure predictions a based on observation of the frequency of occurrence of t amino acid in a beta-sheet, alpha-helix, etc. in a prote having a known three dimensional structure.

The three-dimensional structure of porcine grow hormone has been determined by X-ray diffraction and compar to that of other growth hormones. Abdel-Meguid, et al., Pro Nat. Acad. Sci., £4:6434 (1987). Like the other grow hormones thus studied, it is a single domain protein arran as a four helix bundle with the helices in an antiparal relationship. Its four helixes are made up of residues 7- 75-87, 106-127 and 152-183. For X-ray studies of bGH and h see Bell, et al., J. Biol. Chem. , 260:8520-25 (1985) and DeV et al., Science, 255:306-312 (1992). The three-dimensio structures of other growth hormones may be deduced comparison of the sequences with due regard for the second structure tendencies of substituted amino acids.

Bovine growth hormone is 93% homologous at the am acid sequence level with porcine growth hormone, and bG structure has been deduced by study of the two sequences and the structure of porcine growth hormone. Its four al helixes have been reported to be assumed by amino acids 4- 66-80, 108-127 and 150-179. The third alpha helix of bGH defined as amino acids 106-129. However, it will be noted t the ends of this helix have a less marked alpha heli secondary structure than does the central region, which is 1 126. The exact bounds of the third alpha helix may differ other GH's, depending on the alpha helical tendencies of "and" amino acids. The conformation is reasonably consist with the predictions made by Chen and Sonenberg, Biochemist .16.:2110 (1977) using the method of Chou and Fasm Biochemistry, 13:222 (1974) (AAs 10-34, 66-87, 111-127, 1 191) .

The amino acid sequence of the growth hormo isolated from various vertebrate species are highly conserv In a comparison of flounder growth hormone with other gro hormones, including bGH, Watahiki, et al., J. Biol. Che 264:312 (1989) identified five conserved regions. Watahik conserved region GD4 comprises the stretch LKDLEEGIIJALMRELED bovine growth hormone, i.e., residues 113 to 129. Watahik Figure 3 identifies residues conserved among the GHs residues predicted to be important for the manifestation growth-promoting activity. Studying Watahiki's GD4 consensus region, seve families of growth hormones may be discerned. The first fam (I) comprises cGH, rGH, pGH oGH, bGH, and hGH. These be with LKDLEEGI. They then continue with IQA (cGH, rGH, pG ILA (oGH, bGH) or IQT (hGH) . All members of family I t conclude GD4 with LMRELED (except for rGH, LMQELED, and h LMGRLED) . The second family (II) comprises fGH, yGH, tGH sGH. These have the consensus sequence LS (E/D) LK (M G(L/I) (L/G/H/N) (K/L) LI (E/T/R/I) (A/G) (N/S) QD.

Four amino acids in GD4 are conserved among all the growth hormones noted by Watahiki: Leu 113, Leu 116, G 119, Leu 123 and Asp 12 (numbering according to the b sequence) . Of the amino acids nearest Gly 119 on the face the third alpha helix, Aspll5 is strongly conserved (replac by Glu in the fish hormones) ; Leu 116 is invariant, Glu 118 conserved among the mammals and birds, but replaced by Met, T or Val in fish; lie 120 is almost invariant (replaced by Leu fGH) , and Ala 122 is well conserved, especially in mammals a birds (replaced by Thr in hGH and Leu or Lys in fish GHs) . ( should be understood that the present invention is not limit to mutants in which these conservations are maintained.)

It has been shown that a recombinant molecu containing a hGH- (1-134) fragment linked to a human placent lactogen- (141-191) fragment retained full hGH immunologic activity and binding affinity to GH receptors isolated fr rabbit liver. Russell, et al., J. Biol. Chem., 256: 296-3 (1981) . By using the homolog-scanning mutagenesis techniqu gene fragments of homologous hormones -i.e., human placent lactogen or human prolactin - were systematically substitut throughout the hGH gene, thus producing various chimer hormones. Cunningham, et al., Science, 243_:1330-36 (1989). comparison of the binding affinities of these mutants GHs a wild-type hGH to a cloned liver hGH receptor led to t conclusion that there were three discontinuous polypeptid determinants in hGH involved in receptor binding. They w located at the NH₂ terminus, COOH terminus, and within a l between amino acid residues 54 and 74. These putative bind domains were further analyzed by an alanine-scann mutagenesis technique in which alanine residues w systematically substituted throughout those regions. Am acid residues at positions 10, 58, 64, 68, 172, 174, 175 176 of hGH were shown to be important for GH receptor bindi However, none of the mutant GHs were reported to inhi growth. Cunningham, et al., Science, 244:1081-85 (1989).

The present invention is not limited to the mutat of the third alpha helix of bovine or human growth hormo Rather, it encompasses the mutation of the third alpha helix any mammalian or other vertebrate growth hormone, includi but not limited to, the growth hormones whose sequences given in Watahiki (1989) : flounder, yellowtail, tuna, salm chicken, rat, porcine, ovine, bovine and human growth hormon Expression of mutants of other growth hormones is facilita by the availability of genes encoding the latter. See, e. Goeddel, Nature, 281:544-683 (1979) (hGH).

The concept of a polypeptide which is substantia homologous to bovine growth hormone is deemed to include ( is not limited to) any polypeptide which differs from bovine human growth hormone by (a) a substitution at an amino a corresponding to amino acids 115 or 119 of bovine gro hormone, (b) a substitution at an amino acid corresponding an amino acid of bovine or human growth hormone which is conserved among the vertebrate growth hormones, especially t replacement of that amino acid by one found at the site i different growth hormone, and/or (c) truncation of amino aci 1- 95 and/or 134-191. (Conserved amino acids are identified Watahiki, et al., 1979.) Thus, all non-bovine vertebra growth hormones are "substantially homologous" with bovi and/or human growth hormone. Preferably, the polypeptide is least about 50% homologous, more preferably at least 8 homologous, with bovine or human growth hormone in subsequence substantially corresponding to the third al helix (approximately, residues 106-129) of bGH, and m preferably over the entire length of the polypeptide (ignor extraneous non-bGH-related fusions to the amino- or carbo terminal) .

The compound is considered to be growth-inhibitory the growth of test animals of at least one vertebrate spec which are treated with the compound (or which have b genetically engineered to express it themselves) significantly (at a 0.95 confidence level) slower than growth of control animals (the term "significant" being used its statistical sense) . Preferably, it is growth-inhibitory a plurality of species, or at least in humans and/or bovin Growth hormones have considerable interspecies cros reactivity. Gill, et al., Biotechnology, 3.:643 (1985) report that recombinant chicken and bovine growth hormones accelera growth in juvenile pacific salmon.

It is known that certain fragments of growth hormon also have growth-promoting activity, and it is expected th the growth-inhibitory peptides (the term is used hereafter include proteins) of the present invention need not be as lar as bGH. Preferably, the peptides are at least 11 amino aci long (three turns of an alpha helix) and more preferably least 50 amino acids long. These peptides may retain t growth inhibiting action of, e.g., bGH (G119R) , yet lack othe undesirable biological activities of the native size mutan They may also have more desirable pharmacokinet characteristics.

The growth inhibitory peptides of the prese invention may also be larger than bGH, provided that t additional amino acids do not result in the compound bei unable to reduce the growth rate of a vertebrate. While the mechanism of action of applicant's gro inhibitory peptides is not known, it is believed that t function as antagonists to wild-type growth hormo endogenously produced by the target animal. We have sh that, e.g., bGH (G119R) and bGH (G119R, E117L, A122D) , b competitively inhibit the binding of wild type bGH to li membrane preparations. Thus, it is believed that the compo has a net result of inhibiting growth because its grow promoting activity is substantially less than that of wild t growth hormones (and perhaps is negligible) yet it can displ from growth hormone receptor (GHR) sites the endogenous nat growth hormone (whose stimulation of growth would have b more pronounced) . However, applicants are not bound by t theory.

DeVos, et al., Science, 255:306 (1992) examined complex of hGH and the extracellular domain of its recep (hGHR) by X-ray diffraction. The first receptor-binding reg of hGH is concave and is formed mainly by residues on expo faces of helix 4, but also by exposed residues of helix 1 residues in the region connecting helices 1 and 2. The sec receptor-binding region comprises the exposed sides of heli 1 and 3 and is relatively flat. The role of the helix 3 shown best in DeVos¹ Fig. 5; there is a significant decrease solvent accessibility around hGH E119 upon complex formati The complex had the form hGH (hGHR)₂; that is, the recep dimerizes to interact with hGH. It is possible that our antagonists interfere with this dimerization.

Preferably, the compounds of the present inventi have an ED50 which is less than about 10 times the ED50 of wi type bGH in an assay of the ability of the compound to displa radiolabeled wild type bGH from a liver membrane preparati made as described below. More preferably, the compounds ha an ED50 at least comparable to that of wild type bGH. Mo preferably, the compounds have a higher affinity for grow hormone receptors than does the growth hormone native to animal receiving the compound. For purification characterization of a human growth hormone receptor, see Leu et al.. Nature, 330:537-43 (1987).

A GH mutein may be considered an antagonist, even it lacks growth-inhibitory activity, if it antagonizes anot GH-mediated activity, e.g., its diabetogen glomerulosclerotic, hypercholesterolemic, or tumorige activities.

The preferred growth-inhibitory peptides characterized by a modification of the surface topography the third alpha helix. It will be seen from Figure 3 that the third alpha helix of "wild-type" bovine growth hormo there is a surface cleft or depression beginning, at Aspartate-115, deepening at the Glycine-119, and ending w the Alanine-122. All of the mutants prepared so far, b those which retain the wild-type growth-promoting activity those which do not, are consistent with the theory that grow promoting activity requires the presence of this cleft depression and that, if the center of this cleft is "filled by substitution of amino acids with bulkier side chains, mutein inhibits the growth of the subject.

Mutations which substantially destabilize the alph helix are undesirable since they may result in the loss of a growth-related activity. We have observed such loss in t case of several mutations which were expected to disrupt t alpha helix.

For a discussion of alpha helix formers and breaker see Chou and Fasman, supra. Glu, Ala and Leu are the preferr alpha helix formers while Pro and Gly are characterized strong helix breakers. Substitutions which introduce stro alpha helix breakers are less desirable, but may be tolerat in a particular case, such as the end of the helix. T secondary structures of our analogues have been predicted us the "Micro Genie" computer program, which uses the algorithm Gamier, et al., J. Biol. Chem., 120:97-120 (1978).

With respect to amino acid 119, glycine is both smallest amino acid residue and the one least favorable alpha-helix formation. Thus, it is believed that any ot amino acid may be substituted for it without destabilizing alpha helix, while at the same time filling in aforementioned cleft. All of the G¹¹⁹ bGH substitutions tes resulted in a "small animal" phenotype. These substituti were arginine (a large, positively charged AA) , proline cyclic aliphatic AA) , lysine (a large, positively charged A tryptophan (a large aromatic AA) and leucine (a larg nonpolar, aliphatic AA) . In hGH, the homologous glycine is position 119. Substitution of arginine or tryptophan result in an antagonist, however, hGH G120A retained growth-promoti activity. Consequently, it is presently believed that th glycine, which is conserved in all vertebrate GHs, may replaced by any amino acid other than alanine (the seco smallest amino acid) , and more preferably by any amino ac which is at least as large as proline (the smallest replaceme amino acid known to result in a "small" animal phenotype) . T deletion of G¹¹⁹ is also known to result in a "small" anim phenotype.

Modification of position 115 is suggested by o "cleft" theory. The aspartate at position 115 may be replac by a bulkier amino acid which does not destroy the alpha heli Preferably, the replacement amino acid has a size greater th that of glutamate. The amino acids histidine, methionin isoleucine, leucine, lysine, arginine, phenylalanine, tyrosi and tryptophan are substantially larger than glutamate. these, His, Met, Leu and Trp are more preferred because th combine the advantages of bulk with a reasonably stro alphahelical propensity. Note, however, that the wild- ype G is the strongest alpha-helix former of all of the amino acid The D115A mutant of bGH is not a GH antagonist, but Alanine smaller than Aspartic Acid, so this is not probative of value of replacing Aspll5 with a bulkier amino acid.

It is possible that G119A might lead to a "sma phenotype if coupled with other mutations, e.g., at 115 122.

It is possible to systematically screen for t effect of all possible amino acid substitutions at positi 115 and 119. (There are 20² -1 or 399 combinatori possibilities.) DNA which encodes bGH and is degenerate these positions, so as to there encode all possible ami acids, or only those with acceptable alpha-helic propensities, is prepared, e.g., by a "dirty bottle" synthesi Phage are prepared, as taught by Ladner, et al PCT/US89/03731, W090/02809, which display the mutant bGHs as domain of a chimeric coat protein. The phage are incubat with a chromatographic support bearing a growth hormo receptor. (For the techniques of isolating growth hormo receptors, see Leung, et al., Nature 330:537 (1987) a Spencer, et al., J. Biol. Chem., 263:7862 (1988)). Nati bGH is also incubated with the support, before, during or aft the phage incubation. Bound phage are recovered, amplified a examined to determine the sequence of the mutant bGH (usual by sequencing the corresponding gene in the phage genome) These mutants have demonstrated the ability to compete wi wild type bGH for a growth hormone receptor. Their ability antagonize GH activity in vivo is then confirmed by, e.g. administering them directly to an animal or by preparing suitable transgenic animal, or by the in vitro assay describ in Example 7. This approach may be extended, if desired, other amino acid positions in the third alpha helix. Ami acids which are particularly preferred for screening are t six amino acids spatially nearest bGH's Glyll9, that is Alal22, Leul23, Ilel20, Leullδ, Aspll5 and Glullδ. It shoul be noted that Bass, et al., Proteins: Structure, Function an Genetics, 8:309-314 (1990), prepared "hormone phage" w express and display hGH-genelll fusion proteins and which bound by anti-hGH monoclonal antibodies. Moreover, it possible to separate phage bearing Wt-hGH from phage bea the low affinity hGH mutant R64A by means of affi chromatography (using the extracellular domain of the receptor bound to nonporous oxirane beads) .

Besides the mutations at position 119, which deemed necessary to impart the desired growth-inhibi activity, additional mutations are possible which will l the growth-inhibitory activity or other antagonist acti intact. These mutations may take the form of single multiple substitutions, deletions, or insertions, nonessential regions of the polypeptide. For example, i possible to alter another amino acid in the alpha h provided that the substitution does not destroy the a helix. Preferably, such alterations replace an amino acid one of similar size and polarity. It may be advantageou modify amino acids flanking the primary mutation site 119 order to increase the alpha-helical propensities of sequence, particularly if the mutation at 119 is one expe to destabilize the helix.

The following table may be helpful in identif candidate mutants:

Several of the cited references provide guidance to where and where not the polypeptide will tolera mutagenesis. Watahiki, et al. (1989) compared the sequences flounder, yellowtail, tuna, salmon, chicken, rat, porcin ovine, bovine and human growth hormones. He identified fi conserved domains which he labeled GD1-GD5. Mutations in the conserved domains are more likely to affect activity; G corresponds to the third alpha helix of bGH. In mutating known GH antagonist with the desire to retain inhibito activity, mutations outside the conserved domains are mo prudent. However, mutations in these conserved regions, carefully chosen, may be tolerated; for example, the mutatio E117L does not modify the activity of either wild-type bGH or bGH G119R mutant. Note that not only substitutions, but als insertions and deletions, are suggested by the example of th cognate hormones.

Abdel-Meguid, et al. (1987) determined the 3D structure of recombinant methionyl porcine growth hormone, an suggested that it revealed the "general three-dimensional fold of the growth hormones. The 3D-structure can be used t identify interior and surface residues; generally speaking proteins mutated at surface residues (other than the recepto binding site) are more likely to remain functional. However Creighton and Chothia, Nature, 339:14 (1989) discuss th toleration of mutations at buried residues. The structure ma also be used to determine flexible surface "loops"; protein are more tolerant of deletions and insertions in such regions.

Cunningham, et al. (1989) used homolog-scannin mutagenesis to identify the epitopes of hGH for its clone liver receptor. Only variant hormones having mutation regions C(54-74), F(164-190), and, to a lesser extent, A(ll exhibited reduced binding affinity. Cunningham and We Science, 244:1081 (1989) used a related technique, alan scanning mutagenesis, to further study these regions. N however, that binding to the receptor utilized by Cunningha not necessarily critical to the growth-promoting or gro inhibitory activity of the mutant.

For example, it seems likely that major amino- carboxy-terminal truncations can be made without adv effects on growth-inhibitory activity, since the 96- fragment of bGH ( 112L) is understood to retain bioactivi Truncations may be generated by gene modification or exopeptidase treatment.

In terms of the kinds of substitutions which may made, one may look first to analyses of the frequencies amino acid changes between homologous proteins of differ organisms, such as those presented in Table 1-2 of Schulz Schimer, su#ra and Figure 3-9 of Creighton, supra. Based such analyses, we define conservative substitutions exchanges within the groups set forth below:

I small aliphatic, nonpolar or slightly polar residues -Ala, Ser, Thr (Pro, Gly)

II negatively charged residues and their amides Asp Glu Gin

III positively charged residues - His Arg Lys

IV large aliphatic nonpolar residues - Met Leu He Val (Cys)

V large aromatic residues - Phe Tyr Trp

Three residues are parenthesized because of th special roles in protein architecture. Gly is the only resi without a side chain and therefore imparts flexibility to chain. Pro has an unusual geometry which tightly constra the chain. Cys can participate in disulfide bonds which h proteins into a particular folding; the four cysteines of are highly conserved. Note that Schulz and Schimer would me I and II above. Note also that Tyr, because of its hydro bonding potential, has some kinship with Ser, Thr, etc.

Within the growth hormone family itself, we see wide variety of substitutions of other amino acids for residues of bGH. For example, among the vertebrate GHs forth in Watahiki, et al., (1989), Pro appears 6 times in b The first Pro is not substituted, but is absent from sGH. second is replaced by Leu in fGH; Thr in yGH and tGH. third is replaced by Leu in fGH, He in yGH and tGH, Val sGH. The fourth Pro is conserved. The fifth Pro is replac by Phe in fGH; Ser in yGH. The sixth Pro is replaced by Phe fGH, yGH and tGH, and Leu in sGH. Overall, Pro is replaced times by Phe, 3 times by Leu, 2 times each by Thr and He, a once each by Val and Ser. When this analysis is extended to a amino acids of bGH, we obtain the following tallies: Ala (14; 2 conserved) ->

Thr (14) . Ser (11) , Asp (7) , He (4) , Glu (4) , Glv (4) . Val (3), Gin (3), Leu (3), Lys (2), Phe (1) , Asn (1) ]

Asp (10; 2 conserved) ->

Tyr (6) , Asn (4) , Val (4) , Glu (3) . Lys (2) , A (2) , Gly (2) , Thr (1) . Ser (1) , Phe (1) , Ala (1)

Glu (13; 2 conserved) ->

Asp (14) , Lys (10), Gin (4) , Ala (3), Pro (2), Thr (2) , Asn (1) . Ser (1) , Val (1) , Met (1) , A (1) , Gly (1)

Phe (13; 3 conserved) ->

Tyr (7) . Leu (6), Asn (6), Ser (5), Gin (3), H (2), Gly (2), His (1), Thr (1), Val (1) Gly (10; 1 conserved) ->

Arg (9), Glu (8), Asp (7), Val (4), Pro (4) . (4) . Asn (3), Phe (3), Asp (2), His (1), Thr (1), Tyr (1) , Ala (1)

His (3; 1 conserved) ->

Arσ (l) , Asn (1) , Tyr (1) , Asp (1)

He (7)->

Gin (7), Asn (5), Leu (4) . Phe (4), Val (4) . Ala (2), Ser (1), Arg (1)

Lys (12; 2 conserved) ->

Ser (11), Arσ (7) . Gly (4), Gin (2), Leu (2), Asn (1)

Leu (27; 11 conserved) ->

Ser (11) , Val (9) . Asn (7) , Met (7) . Gin (7) , Arg (4), Glu (4), Phe (3), Tyr (3), Gly (1), (1), His (1)

Met (4)->

He (7) . Ala (4), Thr (3), Ser (3), Leu (1) . (1), Val (1)

Asn (6) - >

He (8), His (4), Aso (3) , Gin (3) . Glu (2) , Ser (1)

Pro (6; 1 conserved) ->

Phe (4), Leu (3), Thr (2) . He (2), Val (1), Ser (1)

Gin (11; 1 conserved) ->

Leu (13), Arg (6), Lys (5), Ser (4), Glu (4) . His (1) , Gly (1) , Asp (1) . Pro (1) Arg (13; 1 conserved) ->

Lys (11) , Ser (9), Thr (7), He (3), Glu (2), Gly (2), Asn (2), His (2) . Val (1), Gin (1), (1), Ala (1)

Ser (13; 3 conserved) ->

Ala (8) . Asn (8) , Gin (4) , Leu (4) , Glv (3) , (2), Asp (2), Thr (2) , Arσ (1), Val (1)

Thr (12; 1 conserved) ->

Ser (14) . Ala (13) , Val (7) , Tyr (5) , Phe (4)

He (4), Met (3), Leu (3), Pro (2) , Asn (2), G ill

Val (6)->

Ala (4) , Ser (4) , He (3) - Thr (2) , Gin (6) , G (2) , Met (2) . Leu (1) . Lys (1)

Tyr (6)->

Leu (5), Pro (4), Gin (3) _f. Phe (2) . Glu (1), S (1)

Note that the above figures are not normalized adjust for the relative frequencies of occurrence of t various amino acids. We further note that in our o mutagenesis experiments, changing Lys 112 to Leu or Lys 114 Trp (Ml) , Glu to Gly (E126G) or Leu (M4) , or Ala to Thr (A122 did not alter activity, while changing Lys, Glu or Leu to P abolished activity.

The present invention is not limited to a particular method of producing the desired GH antagonists Preferably, these antagonists are produced by first altering gene encoding a vertebrate GH (e.g., bGH or hGH) having th "native" third alpha helix by site-specific mutagenesis, an then cloning and expressing the altered gene in a suitabl host. Molecular biology techniques are described in, e. Sambrook, et al., Molecular Cloning: A Laboratory Manual ( Spring Harbor Lab Press; 2nd ed. , 1989). The gene may b genomic origin, it may be cDNA prepared from bGH messenger it may be synthetic, or it may be a combination thereof. the amino acid sequence of bGH and for the cDNA sequence of bGH gene, see Miller, et al., J. Biol. Chem., 255:7521 (1980). For the genomic bGH sequence, see Woychick, et a Nucleic Acids Res., 10:7197-7210 (1982). The cDNA sequence hGH is given by Chang, et al., Gene, 55:189 (1987) and DeNo et al., Nucleic Acid Res. 9:3719 (1981), and the genomic sequence is in Robbins, et al., Cell, 29:623 (1982).

The host may be any convenient organism, includin bacterial, yeast, or mammalian cell. The gene is opera linked to a promoter functional in the host. A constitut promoter would activate gene expression in a general mann i.e., in many tissue and at all times during development. regulatable promoter may be activated in a tissue or c specific manner, at precise time during development, or response to changes in the environment. A constitut promoter is' usually employed when larger amounts of g product (usually protein) is required or when the gene prod is required in many cells of many tissues. A regulata promoter is utilized when one gene product is required in small number of cells of a particular tissue or at a given t during development.

The expression system may be engineered so that antagonist is secreted into the culture medium, or the h cells may be grown to a high cell density and then lysed release the compound.

One method suitable for the purification of

(G119R) and the like is described in Leung, et a

Endocrinology, 119:1489-1496 (1986). Essentially, t procedure involves purification by (a) ammonium sulf precipitation, (b) fractionation on DEAE-cellulose (or equivalent ion-exchange column), and (c) gel filtration (e. on a Sephadex G-25 and/or Sephacryl S-200 column) . Ot _. procedures applicable to purification of growth hormone-rela compounds are set forth in Reichert, Jr., "Purification Anterior Pituitary Hormones: Bovine, Rat and Rabbit," Me Enzymol., 37:360 et seq. (Academic Press, N.Y.:197 Polyclonal or monoclonal antibodies which specifica recognize the protein of interest may also be used in t purification process.

The purified antagonist may then be combined wi compatible, nontoxic pharmaceutical excipients a administered to an animal, e.g. to treat a conditi characterized by an excessive growth rate. (The term "anima is intended to include humans.) In the case of administrati to nonhuman animals, it may be preferable to incorporate t drug into the animal's feed, possibly in a prepared combinati of drug and nutritional material ready for use by the farme The antagonist may be administered orally or parenteral (including intravenously, subcutaneously and intramuscularl to humans, in any suitable pharmaceutical dosage form. In t case. of treatment of retinopathy, it may be administer directly to the eye by means of a conventional ocul pharmaceutical form. An effective dosage and treatme protocol may be determined by conventional means, starting wi a low dose in laboratory animals and then increasing the dosa while monitoring the effects, and systematically varying t dosage regimen as well. The trial dosages would be chos after consideration of the clinical literature with respect administration of growth hormones, and of somatostatin ( growth hormone release inhibitor) .

In another embodiment, the gene is introduced into host cell which is developed into genetically transformed cell of a transgenic animal. Linearized DNA bearing the growt hormone antagonist gene may be introduced into a gamete, o microinjected into the pronuclei of fertilized eggs, into cytoplasm, into the nuclei of two-cell embryos, into indivi cells of a blastocyst, or into the blastocoel cavity. (Som these targets may be reached by electroporation instea microinjection.) Alternatively, a retrovirus bearing the may be constructed and used to infect preimplantation emb or tissue culture cells (e.g., embryonic stem cells) which be aggregated with such embryos. In either case, genetically modified zygote, after a brief in v cultivation, is implanted into a foster mother and carried term. For "gene therapy" post partum, see Cline, et Nature, 284:422-425 (1980); Williamson, Nature, 298:416 (1982) . Again, the gene is operably linked to a prom functional in the host, and the promoter may be constitutiv regulatable. Preferably, expression is regulated so abnor embryonic or fetal development is avoided.

The invention is further illustrated, with limitation, by the following examples.

Example 1: Generation of Mutations Conferring the Red

Growth Phenotype

MATERIALS AND METHODS

The plasmid, pBGH-10delta6, was derived from pBGH and contains the complete coding region of bGH and intron Bovine growth hormone introns B, C and D are absent (Figure This plasmid encodes "wild type" bGH, and its expression controlled by a 1700 base pair segment of the mo metallothionein I transcriptional regulatory sequence.

Plasmids pBGH-10delta6-G¹¹⁹R and pBGH-lOdeltaδ-E¹¹

G¹¹⁹R, A¹²²D were derived from pBGH-10delta6 and were genera by segment-directed mutagenesis using complement oligonucleotides to replace the DNA between the Tthllll s

(found near the 3' end of Exon IV) and the Xma I site (loca near the 5' end of Exon V) . The other mutations descri herein were generated similarly.

The complementary oligonucleotides used for pBGHIO delta 6-G:¹¹⁹R were:

5' TGTCTATGAGAAGCTGAAGGACCTGGAGGAAAGGATCCTGGCCTGATGCGGGAGCTG AGATGGCACCCC 3'; 73-MER) and (5•CCGGGGGGTGCCATCTTCCAGCTCCCGC C-AGGGCC-AGGATCCTTTCCTCCAGGTCCTTI-^GCTTCTCATAGACA 3'; 76-MER) .

The complementary oligonucleotides used for pBGH10delta6-E¹¹⁷ G¹¹⁹R, A¹²²D were:

(5'GTGTCTATGAGAAGCTGAAGGACCTGCTGGAAAGGATCCTGGACCTGATGCGGGAGC GAAGATGGCACCCC 3' ; 73-mer) and 5• CCGGGGGGTGCCATCTTCCAGCTCCC ATC-AGGTC(--AGGATCCTTTCC-AGC-AGGTCCTTCΑGCTTCTC-ATAGAC-A 76-mer) . These oligonucleotides hybridize as follows:

G119R

GT GTC TAT GAG AAG CTG AAG GAC CTG GAG GAA AGG ATC CTG GCC ACA CAG ATA CTC TTC GAC TTC CTG GAC CTC CTT TCC TAG GAC CGG Arg Val Tyr Glu Lys Leu Lys Asp Leu Glu Glu Arg He Leu Ala

CTG ATG CGG GAG CTG GAA GAT GGC ACC CC

GAC TAC GCC CTC GAC CTT CTA CCG TGG GGG GCC

Leu Met Arg Glu Leu

E117L, G119R, A-122D

GT GTC TAT GAG AAG CTG AAG GAC CTG CTG GAA AGG ATC CTG GAC ACA CAG ATA CTC TTC GAC TTC CTG GAC GTC CTT TCC TAG GAC CGG Arg Val Tyr Glu Lys Leu Lys Asp Leu Leu Glu Arg He Leu Asp

CTG ATG CGG GAG CTG GAA GAT GGC ACC CC

GAC TAC GCC CTC GAC CTT CTA CCG TGG GGG GCC

Leu Met Arg Glu Leu

These oligonucleotides encode DNA changes whi result in the substitutions of arginine for glycine at positi 119 in pBGH-10delta6-G119R; and leucine for glutamate position 117, arginine for glycine at position 119 aspartate for alanine at position 122 in pBGH-lOdeltaδ-E¹¹ G¹¹⁹R, and A¹²²D. These amino acids were chosen because t have hydrophilic (arginine and aspartic acid) or hydropho (leucine) character [See Hopp and Woods, PNAS (USA), 78:3824 (1981)], positively (arginine) or negatively (aspartic ac charged side chains [See Kaiser and Kezdy, Science ac 223:249-55 (1984)], and high c-helical-forming potential [ Chou and Fasman, Ann. Rev. Biochem., 47:251-76 (197 furthering generation of an idealized amphiphilic a-helix [ Margalit, et al., J. Immunol., 138:2213-29 (1987); Brems, al., Biochemistry 26:7774-78 (1987); Kaiser and Kezdy, sup Chen, et al., PNAS (USA), 87:5061-65 (July 1990]. In additi these oligonucleotide duplexes encode a silent base-pair cha designed to create a unique BamHI restriction site wh simplified screening procedures. The oligonucleotides w annealed and subcloned between the Tthllll and Xmal sites us standard procedures (Maniatis et al.. Molecular Cloning (C Spring Harbor: (1982)). Mutant plasmid DNA's were identif by digestion with BamHI restriction site which simplif screening procedures. The oligonucleotides were annealed subcloned between the Tthllll and Xmal sites using stand procedures (Maniatis et al. , Molecular Cloning (Cold Spr Harbor: 1982). Mutant plasmid DNA's were identified digestion with BamHI.

The nucleotide sequence of the mutated bovine gro hormone target regions were determined by using the dideoxy chain-termination method with modified T7 DNA polymer

(Sequenase, United States Biochemical; Sanger et al.. P

(USA), 74:5463-67 (1977)). Oligonucleotide primers for man

DNA sequencing were synthesized using the DuPont Coder #300 synthesizer and purified by denaturing polyacrylami.de electrophoresis, passive elution and concentration by etha precipitation. The oligonucleotide primers used for the dir sequencing analysis of the two mutants was the following: 18

(5'AAATTTGTCATAGGTCTG 3'). Briefly, l-3μg of doublestran plasmid DNA was denatured in the presence of 0.2N NaOH, and 20 pmoles of oligonucleotide primer was allowed to ann (65°C, 2 min. followed by 30 min. slow cool) to the denatu template. A two-step polymerization was performed by using modified T7 DNA polymerase which extends the oligonucleoti primed chain in the presence of dNTP's and deoxyadenos triotriphosphate (>1000 Ci/mmole, Amersham) followed transfer of equal aliquots into each of four speci dideoxynucleotide mixes which randomly terminate ch elongation. Following addition of a formamide terminat buffer to each reaction, the samples were incubated at 80°C 2 min. and the DNA sequence was determined after s fractionation of the four sets of fragments by polyacrylamide/8M urea electrophoresis and autoradiography.

Example 2: Expression in Mamma^"Iian Cells in Culture

Using the in vitro mutagenesis protocols describ above, two mutant bGH genes were generated initially: o converts glycine¹¹⁹ to arginine ("G119R") and the seco converts glutamate¹¹⁷ to leucine, glycine¹¹⁹ to arginine, a alanine¹²² to aspartate (E117L, G119R, A122D) .

The plasmids encoding these mutations as well as wi type bGH DNA (pBGHlOdelta) were transiently introduced in cultured mouse L cells, which were subsequently analyzed f bGH expression. Following "western analysis", protein bands approximately 22,000 daltons were observed for wild type b and bGH derived from the two mutant genes.

Mouse L cells were maintained in DMEM (Gibco) pl 10% calf serum and 25 μ/ml gentamicin (Gibco) . In this study, modification of a previously described transfection procedu was employed (Lopata et al. , Nucleic. Acids Res., 12:5707-57 (1984)) . Briefly, 2μg of plasmid DNA was added to 1.0 ml DMEM containing 0.2mg DEAE-dextran. This solution was added approximately 10⁶ cells in a 35-mm tissue culture plate whi had been washed previously with 2.Oml of DMEM. Follo incubation of the cells for 1 hour at 37°C, the DNA-D dextran solution was removed and the cells "shocked" for seconds with 2.0ml of 10% DMSO in Hepes buffered saline, room temperature. Subsequently, the "shock" solution removed and cells washed with 2.0ml DMEM. Media containing Nu-Serum (Collaborative Research) plus 50μg/ml gentamicin changed daily. Culture fluids were stored at -20°C. For binding assays, transfected cells were incubated in DMEM m serum for 16 hours, after which the culture fluids were rem and frozen at -20°C.

Sodium dodecyl sulfate (SDS) PAGE analyses secreted bGH have been described (Kopchick et al.. DNA, 4:2 (1985); Kelder et al.. Gene. 76:75-80 (1989). In this st we used a polyclonal anti-bGH serum for "western" analysis.

Example 3: Growth Hormone Receptor Binding Studies

Culture fluids lacking serum were collected cells transfected by pBGH-10delta6 (wild type bGH) and mutant bGH genes. Following lyophilization of the cul media and bGH concentration determinations, competi membrane binding studies were carried out as previo described (Smith & Talamants, .J. Biol. Chem., 262:2213 (1987) ) . Liver membrane preparations from C57BL/6JxSJL hy mice of either sex (60-120 days old) were homogenized wit Brinkman Polytron in 4 volumes (w/v) of 0.3M sucrose, l EDTA, 50mM Hepes, O.lmM TPCK and lmM PMSF at pH 8.0. The a step and all the following protocols were carried out at 4 The homogenate was centrifuged at 20,000xg for 30 min. and supernatant was centrifuged at 100,000xg for 1 hour. pellets were washed once with lOmM Hepes, pH 8.0 recentrifuged. These pellets were resuspended in lOmM Hep pH 8.0, to a protein concentration of.approximately 50mg/ The membranes were aliquoted, frozen on dry ice, and stored -20°C. Membrane protein concentrations were determined by Lowry protein assay (Lowry et al., J. Biol. Chem., 193:265- (1951) ) .

Competitive binding assays were performed using following protocol. Microsomal membranes corresponding three mgs. protein were incubated with 30,000 cpm/tube ¹²⁵ι

(Cambridge Medical Diagnostics) and unlabeled bGH ranging f

0.3ml assay buffer (20mM Hepes, lOmM CaCl₂ 0.1% BSA, and 0.

NaN₃ pH 8.0) . All assays were performed in triplicate. Af overnight incubation at room temperature, membrane bo hormone was separated from free hormone by the addition of 1 of ice cold assay buffer followed by centrifugation at 10,00 for 20 min. Membrane pellets were then assayed radioactivity. Specifically bound radioactivity was determi by subtraction from the value produced by incubation membranes with 5μg unlabeled bGH (Smith and Talamants, 1987) .

Effective doses which resulted in 50% displacem

(ED50) of ¹²⁵I-bGH from the membrane preparations we determined. Mutant bGH encoded by pBGH-10delta6-G¹¹⁹R a pBGHlOdelta 6-E¹¹⁷L, G¹¹⁹R, A¹²²D revealed an ED50 val similar to wild type bGH.

Example 4: Tra-αsgen±c Mouse Production Pilot Study

A series of transgenic mouse lines which contain wi type and mutant bGH genes were produced by standa microinjection techniques (McGrane et al. , 1988) . D extraction from mouse tails, dot blots, and ser determinations was as described (McGrane et al. , 1988) .

The genes contain the transcriptional regulato sequences of the mouse metallothionein I promoter which h been shown to be active in liver tissue as well as oth tissues of the transgenic mouse (Palmiter et al.. Natur 300:611-615 (1982)). Offspring generated by the microinjecti procedure were assayed for bGH DNA by slot blot hybridizati analysis. Mouse lines were generated which con approximately one copy of the recombinant bGH DNA seque derived from pBGH-10delta6, (wild type), pBGH-lOdeltaδ-G¹ and pBGH10delta6-E¹¹⁷L, G¹¹⁹R, A^{1 2}D. Serum from transg animals were assayed for bGH levels by the Western techni All mice which expressed the wild type bGH transgene in s also possessed a corresponding enhanced growth rate. which expressed mutant bGH (G¹¹⁹R or E¹¹⁷L, G¹¹⁹R, A¹²²D) serum were dramatically and significantly smaller. After e weeks' growth, the growth ratio for wild type bGH transg mice relative to control littermates was 1.5 while the r for the two bGH mutant mice to control littermates was - In the case of the triple mutant, we generated 10 founder that express the mutated bGH gene. The growth ratio bet the transgenic and nontransgenic littermates ranged from to 1.00. The degree of suppression of growth was dire related to the serum levels of the mutated bGH. Three foun have been bred that pass the trait to offspring; ~50% of t offspring are positive for the gene and possess corresponding small phenotype.

It has been demonstrated that many activities of are mediated through a family of peptides known as insulin- growth factors (IGF) , in particular IGF-1, which is believe be produced primarily in the liver following GH binding to receptor(s) . (See Truesch, et al., Ann. Rev. Physi 47:44367 (1985); Zapt, et al. , Harm. Res., 24:121-130 (1986 IGF-1 has been shown to decrease GH production in the pituit by a classical negative feedback mechanism. (Leung, et Endocrinology, 119:1489-96 (1986)). One hypothesis to expl the growth suppression in pBGH10Δ6-M8 transgenic mice is t bGH-M8 is active as an in vivo antagonist to mouse GH (mG thereby suppressing mouse IGF-1 production. If this is t then one would expect not only a reduction in serum mouse IG levels in bGH M8 transgenic mice but also an increase in production in the pituitary. We have found that the IG levels in the serum of the "small" transgenic mice are ~ those of normal non-transgenic mice while mice containing w type bGH (large mice) have approximately 2x the IGF-1 levels non-transgenic mice. Results from immunoblot analysis of wh pituitary glands taken from bGH-M8 transgenic mice, transgenic mice, and their nontransgenic littermates sugg that the pituitary glands in those growth-suppressed m contain higher levels of mGH relative to their nontransge littermates. In contrast, mGH levels in bGH transgenic m were largely depressed because mouse serum IGFl levels w increased up to twice as much as levels in serum of th nontransgenic littermates. Palmiter, et al., Science, 222:80 14 (1983) . Together, these results indicate that the alter bGH molecules are acting as an antagonist to endogenous mou GH. Thus, it is the first example to our knowledge of an vivo growth hormone antagonist and the first example uncoupling of growth-promoting and receptor-binding activiti of GHs.

Example 5: Screening of other Muteins of bGH and hGH

By similar procedures, muteins of bGH and hGH wi alterations in the third alpha helix have been prepared a tested for secretion in L cells, and, in selected cases, the effect on the growth of transgenic mice, with the followi results.

The mutants are described by giving the origin amino acid, its position in the amino acid sequence of bGH, a the replacement amino acid, with the amino acids set for according to the internationally accepted single letter cod George, et al., Protein Seq. Data Anal., 1:27-39 (1987).

A first set of mutated bGH genes, when expressed transgenic mice, resulted in animals with a growth rati similar to that of mice which express wild type bGH (i.e., 1.59 - 1.72) . We have referred to these analogs as "ful functional agonists" (Table I) . A second set of mutated bGH genes, when expressed transgenic mice, resulted in mice with a growth ratio smal than those animals which express wild type bGH (i.e., bet 1.29 -1.35) . We refer to these bGH analogs as "part functional agonists" and have listed them in Table II.

A third set of mutated bGH genes, when expressed transgenic mice, resulted in animals with a growth ra similar to nontransgenic mice (i.e., - 1.0). We refer to th analogs as "non-functional agonists" (Table III) .

A fourth set of mutated bGH genes, when expressed transgenic mice, resulted in mice with a growth ratio between 0.57 and 1.0 (Table IV). The growth ratio of the m was negatively correlated with the serum level of the analog, i.e., as the serum level of the bgh analog increas the growth ratio of the animals decreased. This correlation shown graphically in Figure 13.

Also, these analogs, when expressed to NIH-3 preadipocytes, did not result in stimulation of preadipocy differentiation; however, native GH will promote t differentiation (Fig. 12) . In fact, these analogs w antagonize the ability of wild type GH to promote preadipoc differentiation (Fig. 11) . We have referred to these anal as "functional antagonists" (Table IV) .

We have also generated transgenic mice which expr either wild type hGH, hGH G120A, hGH G120R and hGH G120W (Ta V . Mice which express hGH G120A show a growth enhan phenotype similar to mice which express wild type hGH (Ta V) . We call this hGH analog a "functional agonist." contrast, substitution of R or W for G at position 120 in h and subsequent expression in transgenic mice, results animals with a growth ratio between 0.73 and 0.96 (Table and whose level of serum hGH analogs is negatively correla with the growth phenotype; i.e., as the serum levels of t hGH 120 analogs increase, the growth ratios decrease. T correlation is shown in Figure 14. Therefore, like the analogs which act as "functional antagonist, " we termed th hGH 120 analogs as "functional antagonist." It is important note that the glycine residue in bGH at position 119 is homologue of the glycine residue in hGH at position 120. T are both located in the central portion of the third a-helix

A subset of bGH analogs is presented in Table VI which we have evaluated their ability to be secreted follow transfection of the mutated DNA into mouse L cells. Transge animals have not been generated which contain these muta DNAs.

The mutant K112L, K114W shows the effect of expand the hydrophobic face of the helix. This mutant affects ani growth much as does wild type growth hormone.

The mutations K114P, E118P and L121P (and vari combinations thereof) apparently destroy the alpha hel (Proline is a strong alpha helix breaker.) The growth-relat biological activity is abolished. The mutation E126G is special case; glycine is a helix breaker, but position 126 at the end of the helix so the normal biological activity retained. With G119P, however, one strong helix breaker w substituted for an even stronger one; the alpha helix w apparently preserved.

The third alpha helix of wild type growth hormo diverges from a perfect amphiphilic alpha helix at thr positions. First, at 117, Glu is a hydrophilic amino acid the hydrophobic face. Second, at 119, Gly is a neutral ami acid in the hydrophilic face. Finally, at 122, Ala is hydrophobic amino acid in the hydrophilic face. The mutatio E117L, G119R and A122D, separately or in combination, increa the amphiphilic character of the helix. G119R additiona increases the alpha-helical tendencies of the sequence.

Our initial hypothesis was that the growth-inhibit activity of the mutants G119R and E117L/G119R/A122D associated with the increased amphipathicity of the third al helix. We have since developed evidence that amphipathicity of the third alpha helix is largely irrelev to that activity.

(1) The single E117L, like wt bGH, produced la animals.

(2) Mutant G119P produced the small animal phenot even though proline is as . hydrophilic glycine.

(3) Mutant G119L produced the small animal phenot even though leucine is hydrophobic and theref disrupts the hydrophilic face of the helix.

(4) Mutant E111L/G119W/R125L produced the sm animal phenotype even though all three mutati disrupt the hydrophilic face of the helix.

(5) The single A122D produces a mutein which has effect on growth.

Thus, in one embodiment, the present invent relates to mutations of the third alpha helix which result growth-inhibitory activity yet reduce or leave unchanged amphiphilic character of the helix.

Additional growth hormone antagonists may identified by systematically varying the codon corresponding G119 in bGH, so as to express the 18 other mutants having single amino acid change at this position. This is read accomplished by synthesizing oligonucleotides differing f those set forth in Example 1 at codon 119 so as to encode desired alternative amino acid. Similarly, one may alter homologous glycine reside in the third alpha helix of ot GHs, e.g., the G¹²⁰ of hGH. By similar means, variations the codons corresponding to other amino acids of the th alpha helix of a GH are investigated.

Example 6: Anticholesteroleππc activity of Growth Horm Antagonists

Procedures for Clinical Chemistry Tests:

Blood samples were obtained from mouse tails. samples were allowed to clot at room temperature for 5 minu and were then centrifuged and the serum was collected frozen at -20°C until analysis. Total Cholesterol (T Triglyceride (TR) , Glucose (GL) , and Blood Urea Nitrogen (B were analyzed on a Kodak Ektache DT 60 Analyzer using d multilayered, self-contained elements specific for each tes 10 μl of serum was pipetted on individual slides specific f each test and were analyzed using colorimetric measurement reflectance spectrophotometry methods and compared to dai Quality Control reference samples.

Results:

There is no significant difference in blood glucos serum urea/nitrogen and serum triglyceride levels between bGH transgenic mice and their nontransgenic littermates. Howeve total serum cholesterol levels in bGH-M8 transgenic mice a significantly decreased (P<0.05) as compared to the nontransgenic littermates and bGH transgenic mice.

Example 7: In Vitro Bioassay for Growth Hormone Antogoni Activity

Studies of growth hormone have shown that it promot the formation of adipose from preadipose 3T3 cells. Murikaw et al., Cell 29:789 (1982). Glycerophosphate dehydrogena (GPDH) has been used as a differentiation marker for th GHinduced adipose conversion. Wise and Green, J. Biol. Chem. 254:273-75 (1979); Nixon and Green, Endocrinology, 114:52 (1984); Pairault and Green, Proc. Nat. Acad. Sci. (US 76:5138 (1979).

We have adapted this assay to determine whether a mutant acts as a GH antagonist. Both bGH and bGH-M8 bind receptors on these preadipocytes with a Kd value of lOmM. W exposed to native sequence bovine growth hormone (30 pM) cultured for seven days, the preadipocytes differentiate GPDH activity is stimulated. If the bGH mutant is added culture medium containing wild-type bGH, there is dosedependent reduction in GPDH activity and therefo presumably, in adipose conversion (Figure 11) .

This assay is a convenient screening tool identifying potential GH antagonists.

Example 8:

Mice transgenic for the wild type bGH gene are kn to develop progressive severe glomerulosclerosis and increa glomerular size. Doi, et al., Am. J. Path., 137: 541- (199); Resce, et al., Lab. Invest., 65: 601-5 (1991); Doi, al., Am. J. Path., 131: 398-403 (1988); see also Stewart, al., Endocrinology, 130: 405-414 (1992). This is not merel function of body size, as bGH-Mll mice (i.e., L121P, E1 mutants) , whose mutant bGH does not enhance growth, a exhibit glumerulosclerosis. In bGH-M8 (G119R) mice, howev which had reduced serum IGF-1, body size, and glomerular s relative to nontransgenic mice, glomerulosclerosis was absen

Summary of growth ratio comparisons between transgenic m expressing bGH analogs and their non-transgenic littermates 6 to 8 weeks of age. Table 1. Transgenic mice which express the following analogs exhbited phenotypes similar to transgenic mice wh express wild type bGH (we have termed these analogs "f functional agonists")^*

* There is no correlation between serum levels of these analogs and the growth phenotypes. These mutated bGH genes expressed in mouse L cells and the secretion pattern is simil to the wild type bGH.

Table II. Transgenic mice which express the following b analogs exhibited phenotypes smaller than transgenic mice whi express wild type bGH, however, large than non-transgenic mi (we have termed these analogs "partial functional agonists)^*

bGH n Mean Growth Ratio SD

WT-bGH 7 1.61 0.14

D115A 3 1.35 0.15

L123I 3 1.29 0.13

* There is no correlation between serum levels of these b analogs and the growth phenotypes. These mutated bGH genes a expressed in and secreted by mouse L cells with the patte similar to wild type bGH.

Note that for the purposes of Tables I-VI, the characterizat of a mutein as "functional" or "non-functional" is in context of its effect on growth.

Table III. Transgenic mice which express the following analogs exhibited phenotypes similar to their non-transge littermates (we have termed these analogs as "non-functio agonists")^*

bGH Analogs n Mean Growth Ratio SD

K114P,E118P 9 1.01 0.09 L121P,E126G 11 0.94 0.06 A122D 9 0.90 0.11

^* There is no correlation between levels of bGH analogs serum and the growth phenotypes. These mutated bGH genes expressed in and secreted by mouse L cells with the excepti of bGH-K114P,E118P and bGH-L121P,E126G which are not secre by mouse L cells.

Table IV. Transgenic mice whish express the following analogs exhibited phenotypes smaller than non-transge littermates (we have termed these analogs as "functio antagonists")^*

bGH Serum bGH Growth Rati Analogs Animal # Sex (ug/ml) (Two Month)

E117L,G119R, A122D 6 F 3.4

15 M 3.3

32 F 3.7

51 F 5.1

55 M 2.1

65 F 0.6

67 F 0.6

70 F 3.3

71 F 2.6

89 F 1.8

G119R 25 M 0.5

28^* M 0.9

49^* M 6.0

53 M 1.5

94 F 0.2

138 F 3.0

G119P 2.0 0.81

G119K 0.5 0.84 0.4 0.95 4.0 0.78 5.0 0.59

G119L 6.5 0.81 0.5 1.0 G119W 16 M 8.0 0.64

G119Δ 0.5 0.96

0.5 0.90

8.0 0.75 0.5 0.90

* The level of mouse growth suppression is correlated w serum levels of analogs (see Fig. 13) . These mutated bGH ge are expressed in and secreted mouse L cells. The secret pattern is similar to wild type bGH.

Table V. Summary of transgenic mice which express hGH ge encoding single amino acid substitutions at position 120* (h G120A is a "full-functional agonist". hGH-G120R and hGH-G1 serve as "functional antagonists")

* bGH Gly 119 is in a position equivalent to hGH Gly 1 Therefore, we refer to hGH Gly 120 consistently with literature.

** The level of growth suppression is correlated with se levels of hGH analogs (see Fig. 14)

Table VI. Summary of mutated bGH genes expressed in mous cell without transgenic mice dats.

bGH Analogs L-Cell Secretion

Wild type bGH +

V109D,YlllD,L116R,L121R,M124K -

E111L,G119W,R125L +

E111L,G119W,L121R,M124K +

V109D,Y110D,L116K,R125L +

M8 (E117L,G119R,A122D)

Claims

Claims

1. A growth hormone antagonist peptide or protein at least 11 amino acids, comprising an alpha helix which substantially homologous with but not identical to the th alpha helix of bovine growth hormone (bGH) , or human gro hormone hGH wherein at least one of the differences from third alpha helix of bGH or hGH is at a residue correspond to residue 119 of wild type bGH or 120 of wild type hGH, s peptide or protein being capable of antagonizing at least biological activity of a vertebrate growth hormone, and bein protein other than the single substitution bGH mutants G11 G119K, G119L and G119R or the triple substitution bGH mut E117L, G119R, A122D.

2. A peptide or protein according to claim 1, s peptide or protein being substantially homologous with bov or human growth hormone.

3. The peptide or protein of claim 2 wherein amino acid corresponding to amino acid 119 of wild type bGH amino acid 120 or wild type hGH is selected from the gr consisting of all naturally occurring amino acids exc glycine and alanine.

4. The peptide or protein of claim 2 wherei difference is the deletion of the amino acid corresponding bGH G^{1 1 9} or hGH G¹²° .

5. A recombinant DNA molecule comprising a ge including a sequence encoding the peptide or protein of any claims 1-4, and further comprising a promoter operably link to said gene.

6. A host cell transformed by the reccbinant D molecule of claim 5.

7. A nonhuman transgenic animal comprisin plurality of transformed cells according to claim 6.

8. The animal of claim 13, said animal exhibiti reduced growth rate as compared to control animals.

9. A method of producing a growth hormone antago peptide or protein which comprises providing cells beari gene including a sequence encoding a peptide or prot according to claim 1 with conditions conducive to expression of said gene, whereby said protein is produced usable or recoverable form.

10. A pharmaceutical composition comprising peptide or protein of claim 1 and a pharmaceutically accepta carrier.

11. Use of a growth hormone antagonist peptide protein of at least 11 amino acids, comprising an alpha he which is substantially homologous with but not identical to third alpha helix of bovine growth hormone *bGH) or hu growth hormone (hGH) , wherein at least one of the differen from said third alpha helix of bGH or hGH is at a resi corresponding to bGH G¹¹⁹ or hGH G¹²° , said peptide or prot being capable of antagonizing at least the biological activ of a human or animal growth hormone, in the manufacture o composition for the prevention or treatment of a condition said human or animal which is characterized by the level said biological activity being excessive.

12. Use of a recombinant DNA molecule capable expressing in a suitable host cell, a growth hormone antagoni peptide or protein of at least 11 _* amino acids, comprising alpha helix which is substantially homologous with but n identical to the third alpha helix of bovine growth hormo (bGH) or human growth hormone (hGH) , wherein at least one the differences from said third alpha helix of bGH or hGH is a residue corresponding to bGH G^{1 1 9} or hGH G¹²° , said pept or protein being capable of antagonizing at least biological activity of a human or animal growth hormone, in manufacture of a composition for the prevention or treatment a condition of said human or animal which is characterized the level of said biological activity being excessive.

13. Use according to claims 11 or 12 where t biological activity is the stimulation of growth and t peptide or protein has a growth-inhibitory effect.

14. Use according to claims 11 or 12 wherein t conditon is diabetes.

15. Use according to claim 14 wherein the biologic activity causes damage to microvascular tissues such as retin endothelial cells.

16. Use according to claim 14 wherein the biologic activity contributes to the development of glomerulosclerosis

17. Use according to claims 11 or 12 wherein t condition is excessive levels of serum cholesterol and t peptide or protein has a hupocholesterolemic effect.

18. Use according to claims 11 or 12 wherein t biological activity is tumorigenic.