EP0640096A1 - Universal coronavirus vaccine - Google Patents

Universal coronavirus vaccine

Info

Publication number
EP0640096A1
EP0640096A1 EP93911170A EP93911170A EP0640096A1 EP 0640096 A1 EP0640096 A1 EP 0640096A1 EP 93911170 A EP93911170 A EP 93911170A EP 93911170 A EP93911170 A EP 93911170A EP 0640096 A1 EP0640096 A1 EP 0640096A1
Authority
EP
European Patent Office
Prior art keywords
ala
leu
gin
ser
thr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP93911170A
Other languages
German (de)
French (fr)
Other versions
EP0640096A4 (en
Inventor
Timothy J. Miller
Sharon Klepfer
Albert Paul Reed
Elaine V. Jones
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pfizer Inc
Original Assignee
Pfizer Inc
SmithKline Beecham Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pfizer Inc, SmithKline Beecham Corp filed Critical Pfizer Inc
Publication of EP0640096A1 publication Critical patent/EP0640096A1/en
Publication of EP0640096A4 publication Critical patent/EP0640096A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to a universal vaccine useful to protect different species of animals against infection by different host-specific coronaviruses.
  • Coronaviruses are a family of host-specific enveloped RNA viruses with a single-stranded positive sense genome.
  • Examples of coronaviruses include, but are not limited to: feline infectious peritonitis (FIPV) and feline enteric coronavirus (FECV) which are specific to felines; canine coronavirus (CCV) which is specific to canines; transmissible gastroenteritis coronavirus (TGEV) which is specific to swine; bovine coronavirus (BCV) which is specific to bovine species; human coronavirus which is specific to humans; mouse hepatitis virus (MHV) which is specific to murine species; and infectious bronchitis virus (IBV) which is specific to avian species.
  • FIPV feline infectious peritonitis
  • FECV feline enteric coronavirus
  • CCV canine coronavirus
  • TGEV transmissible gastroenteritis coronavirus
  • BCV bovine coronavirus
  • Coronaviruses share common structural features including a spike or S protein (also referred to as a peplomer protein) .
  • S protein is a glycoprotein which protrudes from the surface of the virus particle.
  • the S protein mediates the binding of virions to the host cell receptor and is involved in membrane fusion. In addition, it is the target of virus neutralizing antibodies.
  • S proteins contain an N-terminal signal sequence, a C-terminal transmembrane segment and potential N-linked glycosylation sites. Comparison of different coronavirus S proteins show little homology, i.e. similarity, at the N terminus and highly conserved amino acid sequences at the C terminus.
  • coronavirus pathogenesis of coronaviruses is determined by the sequences encoded at the N-terminus while the more conserved C-terminus encodes critical structural features common to all coronaviruses.
  • the carboxy terminus of the S protein is believed to be involved in fusion.
  • Vaccines currently available for protection against coronavirus are specific for protection against a given member of the coronavirus family. Such vaccines do not provide cross protection to protect a host against other members of the coronavirus family which are able to infect the species.
  • the present invention relates to a polypeptide comprising an amino acid sequence from the C terminal portion of a coronavirus S protein which has been found to be highly conserved among coronaviruses and which is capable of eliciting a protective immune response. This sequence is referred to as a universal conserved domain.
  • the polypeptides of the present invention have less than a complete amino acid sequence of an S protein.
  • the present invention relates to a vaccine comprising a polypeptide which includes an universal conserved domain and which has less than a complete amino acid sequence of an S protein.
  • the present invention relates to an isolated nucleic acid molecule having a nucleic acid sequence which encodes a polypeptide that includes a universal conserved domain polypeptide and that has less than a complete amino acid sequence of an S protein.
  • the present invention relates to a vaccine comprising a nucleic acid molecule that encodes a polypeptide which includes an universal conserved domain and which has less than a complete amino acid sequence of an S protein.
  • the present invention relates to a method of protecting an animal from infection by a coronavirus comprising administering an amount of a polypeptide effective to elicit a protective immune response.
  • the polypeptide administered in the method comprises a universal conserved domain and has less than a complete amino acid sequence of an S protein.
  • the present invention relates to a method of protecting an animal from infection by a coronavirus comprising administering an amount of a nucleic acid molecule which encodes a polypeptide effective to elicit a protective immune response.
  • the polypeptide encoded by the nucleic acid molecule administered in the method comprises a universal conserved domain and has less than a complete amino acid sequence of an S protein.
  • the present invention a highly conserved region of the spike protein has been identified which, when presented as a vaccine component or product, is useful as a universal immunogen to protect an animal against coronavirus infection.
  • the vaccine of the present invention may be used to vaccinate any animal susceptible to infection by virus that is a member of the coronavirus family. Accordingly, the present invention provides vaccines which can be produced in a single manufacturing process and administered to different species of animals. The cross-protection afforded by vaccines of the present invention eliminates the need to produce different vaccines to protect animals against different members of the coronavirus family.
  • polypeptide is meant to refer to a peptide, polypeptide or protein molecule; a molecule which includes a peptide, polypeptide or protein molecule; or a molecule that contains amino acid residues which are linked by non-peptide bonds.
  • the term "universal conserved domain” (“UCD”) is meant to refer to the identical 124 amino acid segment found in the C terminal portion of S proteins from TGEV, CCV and strains of feline coronaviruses.
  • the term “UCD” is meant to refer to the corresponding amino acid segments of other coronavirus which have different but homologous amino acid sequences. Such corresponding sequences may be identified by their location in the S protein, i.e. downstream of the bulbous N-terminal region and upstream of the transmembrane region and the high level of amino acid sequence similarity to the 124 amino acid sequence described above.
  • UCD is additionally meant to refer to consensus sequences are generated by comparing corresponding sequences and determining the statistically average amino acid residue at a given position in the sequence. Thus, when several different sequences are compared, the most common residue at a given position is assigned to that position in a consensus sequence.
  • UCD sequences suggest that they play a major role in virus structure and/or replication.
  • the region of perfect homology decreases in size as other coronavirus S genes are included in the comparison.
  • bovine and human coronavirus are more closely aligned to the feline, canine and porcine coronavirus S genes in this conserved region than are sequences from the murine and avian coronaviruses.
  • SEQ ID N0:1 is an amino acid sequence from FIPV strain Wsue2 (Virulent, Type II; Genbank accession number X06170) .
  • SEQ ID NO:2 is an amino acid sequence from FIPV strain Df2e2 (Virulent r Type II).
  • SEQ ID NO:3 is an amino acid sequence from FIPV strain Tse2 (Temperature sensitive mutant of Df2) .
  • SEQ ID NO:4 is an amino acid sequence from FECV strain Fecve2 (Avirulent strain 1683).
  • SEQ ID NO:5 is an amino acid sequence from TGEV strain Tgeve2 (Purdue strain; Genbank accession number D00118) .
  • SEQ ID NO:6 is an amino acid sequence from FIPV strain Tgeve2f2 (Miller strain; Genbank accession number M56002) .
  • SEQ ID NO:7 is an amino acid sequence from BCV strain Bcve2 (Genbank accession number M30613) .
  • SEQ ID NO:8 is an amino acid sequence from HCV strain Hcve2 (Genbank accession number X16816) .
  • SEQ ID NO:9 is an amino acid sequence from IBV strain Ibbspi (Genbank accession number X16816) .
  • SEQ ID NO:10 is an amino acid sequence from MHV strain Mhve2a59 (Genbank accession number X51939
  • SEQ ID NO:11 is an amino acid sequence from FIPV strain Mhvs (Genbank accession number X04797)
  • SEQ ID NO:12 is a consensus sequence which has been designed to provide an optimum UCD amino acid sequence.
  • the 124 residue amino acid sequence which is completely conserved in TGEV, CCV and feline coronaviruses is shown in SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 from residue 37 to residue 160.
  • the consensus sequence, SEQ ID NO:12 also contains this 124 amino acid sequence in its entirety from residue 37 to residue 160.
  • This 124 amino acid sequence is currently a preferred UCD sequence of the present invention.
  • the entire 199 amino acid consensus sequence is a preferred UCD-containing peptide.
  • amino acid sequence information from any coronavirus one having ordinary skill in the art can identify the conserved region corresponding to the 124 amino acid sequence found in TGEV, CCV and feline coronaviruses.
  • the amino acid sequences from the C terminal portion of coronaviruses can be compared to identify the sequence which corresponds to the UCD from TGEV, CCV and feline coronaviruses.
  • the procedure is straightforward and can be performed to provide additional UCD sequences .and flanking sequences.
  • Corresponding conserved regions from coronaviruses other than CCV, TGEV and feline coronaviruses may be identified by their location on the S protein and the high level of sequence homology the possess when compared to the 124 amino acid sequence referred to above.
  • An example of such comparison and identification is shown in Table 1 in which sequences from the C terminal regions of various S proteins upstream from the transmembrane region are compared and homologous sequences identified.
  • Widely available computer programs such as PLOTSIMILARITY software (Genetics Computer Group, Madison WI) may be employed to locate a UCD in a coronavirus.
  • such software may be employed to expedite the generation of consensus sequences.
  • the present invention relates to polypeptides which comprise: the 124 amino acid sequence form TGEV, CCV and feline coronaviruses; or the different amino acid sequences from other coronaviruses which correspond to the 124 amino acid sequence; or a consensus sequence generated from comparison of corresponding regions; or immunogenic fragments or immunogenic derivatives thereof.
  • Polypeptides according to the present may further comprise additional flanking sequences from coronavirus or flanking sequences designed as a consensus sequence of the flanking sequences of corresponding regions from different coronaviruses.
  • immunogenic fragment is meant to refer to polypeptides which include an incomplete UCD which is capable of eliciting a protective immune response against coronavirus in an animal susceptible to coronavirus infection.
  • Immunogenic fragments may comprise a sequence having nine or more amino acids from a UCD, and may include additional amino acid sequences.
  • the term "immunogenic derivatives" is meant to refer to molecules which have a UCD or portions thereof with conservative amino acid substitutions and which are capable of eliciting a protective immune response against a coronavirus in an animal susceptible to coronavirus infection.
  • Those having ordinary skill in the art can readily design derivatives having UCD sequences with conservative substitutions for amino acids. For example, following what are referred to as Dayhof's rules for amino acid substitution (Dayhof, M.D. (1978) Nat . B omed. Res . Found . , Washington, D.C. Vol. 5, supp. 3), amino acid residues in a peptide sequence may be substituted with comparable amino acid residues. Such substitutions are well known and are based the upon charge and structural characteristics of each amino acid.
  • polypeptides can be produced by standard methodologies and tested to determine whether they are capable of eliciting, a protective immune response.
  • Sera from vaccinated animals can be analyzed to detect the presence of antibodies capable of inhibiting infection of cells in culture.
  • challenge studies can be performed to determine if animals vaccinated with a polypeptide are protected from subsequent infection by wild type virus.
  • One having ordinary skill in the art can routinely produce and screen fragments and derivatives to determine the effectiveness of such vaccine components to elicit protective immune responses.
  • larger molecules may also be screened by the same means to detect their ability to elicit a protective immune response.
  • the UCD lies near the transmembrane region of the
  • the UCD plays an important role in the function of the S protein and in the formation of infectious virus. Inducing an immune response against this region will interfere with the folding of the S glycoprotein into its proper conformation.
  • the presence of circulating antibodies to this region could bind to either virus or infected cells expressing the glycoprotein on the surface.
  • Virus co plexed with antibody may be unable to bind to receptors on susceptible cells and/or initiate the pathway required to gain entry which involves a conformational change of the S protein. Recognition of this region on the surface of infected cells would target them for clearance.
  • Antibody binding to the conserved region of the S protein surface expressed by infected cells would, most likely, prevent cell fusion and interfere with virus assembly. Regardless of mechanism, an immune response to the UCD of a coronavirus S protein will inhibit virus spread from cell to cell and limit virus infection.
  • Polypeptides according to the present invention comprise less than a complete S protein sequence.
  • the polypeptides do not comprise a complete N- ter inal portion of an S protein and preferably comprise few or no amino acid sequences from the N-terminal bulbous portion of the protein.
  • the polypeptides preferably do not comprise a complete transmembrane domain of an S protein.
  • polypeptides comprise no more than a 400 amino acid sequence upstream (from the C terminus to the N terminus) from about 2 amino acids upstream from the transmembrane domain.
  • polypeptides comprise no more than a 300 amino acid sequence upstream (from the C terminus to the N terminus) from about 5 amino acids upstream from the transmembrane domain.
  • polypeptides which comprise a UCD, or derivatives and/or fragments thereof further comprise flanking sequences of the UCD found in coronavirus.
  • the polypeptide comprises portions of the S protein flanked by and optionally including the heptad repeats reported by deGroot et al . , such as, for example, in FIPV strain WSU 1146 from residues 1067 to 1380.
  • the polypeptide comprises portions of the S protein flanked on the carboxy side by and may also include a leucine zipper motif as reported by Britton.
  • the polypeptide comprises portions of the S protein from about 300 residues upstream of the transmembrane region to about 5 amino acid residues upstream from the transmembrane domain.
  • the polypeptide comprises a UCD about 124 amino acids iri length.
  • the polypeptide comprises an immunogenic fragment of a UCD about 100 amino acids in length.
  • the polypeptide comprises an immunogenic fragment of a UCD about 50 amino acids in length.
  • the polypeptide comprises an immunogenic fragment of a UCD about 25 amino acids in length.
  • the polypeptide comprises an immunogenic fragment of a UCD about 15 amino acids in length.
  • the polypeptide comprises an immunogenic fragment of a UCD about 10 amino acids in length.
  • a UCD comprises amino acid residues 37-160 of SEQ ID NO:12. Additional preferred embodiments comprise SEQ ID NO:12.
  • Other preferred embodiments of the invention comprise SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.
  • Other preferred embodiments comprise SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 or SEQ ID NO:11.
  • polypeptide of the present invention may also be included in the polypeptide of the present invention.
  • additional peptide segments may comprise other immunogenic targets from coronavirus and/or other pathogens, and/or they may be provided for improved stability, UCD epitope presentation or production/purification facilitation.
  • the resulting polypeptide is considered a chimeric or fusion polypeptides.
  • Vaccines according to the present invention can be employed to vaccinate animals against infection by coronaviruses or at least to prevent the clinical symptoms associated with such infections. Such vaccines will provide protection against multiple coronaviruses and cross species protection. Vaccines may be produced which are either protein-based or nucleic acid-based. In both cases, the vaccinated animal is exposed to an immunogenic polypeptide which comprises a UCD. A protective immune response is elicited which is sufficient to protect the animal against coronavirus.
  • Vaccines according to the present invention can be either: a) compositions which comprise a polypeptide that includes a universal conserved domain; or b) compositions which comprise a nucleic acid molecule that includes a nucleotide sequence which encodes a polypeptide that includes a universal conserved domain.
  • the polypeptide is not a complete S protein and it elicits a protective immune response in animals.
  • polypeptides having a UCD may by produced using standard techniques including recombinant DNA techniques for protein production or by peptide synthesis.
  • polypeptides used in subunit vaccines according to the present invention are produced by recombinant DNA methodology.
  • nucleic acid sequences of coronavirus S genes are widely known. One having ordinary skill in the art may routinely obtain DNA that encodes a polypeptide including a UCD using standard techniques and widely available starting materials.
  • the nucleotide and amino acid sequences for S proteins from several types and strains of coronaviruses can be found in the co-owned published PCT application PCT/US91/08525 which claims priority to U.S. Patent Application Serial Numbers 613,066 and 698,927; each of these applications are incorporated herein by reference.
  • Nucleotide and amino acid sequences of S proteins can also be found in published European Patent Applications publication numbers: 0,524,672 Al; 0,411,684 A2; 0,264,979 Al; 0,138,242 Al; and application number EP 91 30 3737. Each of these European patent applications are incorporated herein by reference.
  • nucleotide and amino acid sequences of S proteins from several coronaviruses as well as nucleotide and amino acid sequences of a consensus sequence is disclosed in the co- owned, co-pending patent application: which is filed on the same day as the present application; which is entitled "Compositions and Methods for Vaccinating Coronaviruses"; which names the same inventors as the present application (Miller, Timothy J. ; Jones, Elaine V.; Reed, Albert P.; and Klepfer, Sharon R) ; which has been designated docket number H85009-1 by Applicants; and which is incorporated herein by reference.
  • Nucleic acid molecules encoding some or all of an S protein from a coronavirus may be generated by a variety of techniques. For such molecules, a nucleotide sequence that encodes a UCD may be identified. Using, for example, Polymerase Chain Reaction (PCR) methodology, primers flanking both sides the region of interest may be designed and used, to produce multiple copies of the UCD routinely. Alternatively, using restriction enzymes, a UCD may be isolated from DNA encoding an S protein. Moreover, nucleic acid molecules that encode a UCD may also be synthesized using techniques well known to those having ordinary skill in the art.
  • PCR Polymerase Chain Reaction
  • plasmid pSE420 Invitrogen, San Diego, CA
  • the commercially available plasmid pYES2 may be used for production of a DNA encoding a polypeptide including a UCD in E . coli .
  • the commercially available plasmid pYES2 may be used for production of a DNA encoding a polypeptide including a UCD in E . coli .
  • the commercially available MaxBacTM (Invitrogen, San Diego, CA) complete baculovirus expression system may, for example, be used for production in insect cells.
  • the commercially available plasmid pcDNA I (Invitrogen, San Diego, CA) may, for example, be used for production in mammalian cells such as Chinese Hamster Ovary cells.
  • One having ordinary skill in the art can use these commercial expression vectors and systems or others to produce a polypeptide including a UCD using routine techniques and readily available starting materials. (See e . g.
  • the desired proteins can be prepared in both prokaryotic and eukaryotic systems, resulting in a spectrum of processed forms of the protein.
  • the particulars for the construction of expression systems suitable for desired hosts are known to those in the art.
  • the DNA encoding the polypeptide is suitably ligated into the expression vector of choice.
  • the DNA is operably linked to all regulatory elements which are necessary for expression of the DNA in the selected host.
  • One having ordinary skill in the art can, using well known techniques, prepare express-ion vectors for recombinant production of the polypeptide.
  • the expression vector including the DNA that encodes the polypeptide comprising a UCD is used to transform the compatible host which is then cultured and maintained under conditions wherein expression of the foreign DNA takes place.
  • the protein of the present invention thus produced is recovered from the culture, either by lysing the cells or from the culture medium as appropriate and known to those in the art.
  • One having ordinary skill in the art can, using well known techniques, isolate the polypeptide that includes a UCD produced using such expression systems.
  • subunitvaccines comprise a polypeptide the includes a UCD but which is not a complete S protein and a pharmaceutically acceptable carrier or diluent.
  • the vaccine may comprise additional immunogenic proteins, additional vaccine components such as non-subunit vaccines, and/or an adjuvant.
  • nucleic acid molecule based i.e. recombinant vaccines
  • a nucleotide sequences which encode polypeptides that include a UCD is inserted into a vector and administered to the animal.
  • the vector delivers genetic material to the animal where it is transcribed and translated to produce the immunogenic polypeptide.
  • Vectors for use as vaccines are well known and include non-pathogenic viruses and prokaryotic organisms. Suitable vectors for delivering genetic material are readily available or may be produced from readily available starting materials using standard techniques. Two examples of vectors useful for delivering genetic material as a vaccine are the recombinant pox vectors or non-pathogenic - IS -
  • the nucleotide sequence that encodes the immunogenic polypeptide is operably linked to regulatory elements required for expression and inserted within the vector. Alternatively, it is incorporated into the vector at a site where it is placed under the control of the necessary regulatory elements already present in the vector. Naked DNA may also be used as a vaccine delivery system.
  • Recombinant vaccines may be used in combination with other vaccines.
  • the genetic material which encodes the polypeptide that comprises the UCD may further comprise additional coding sequences which encode other peptide sequences capable of eliciting an immunogenic response against coronavirus or another pathogen.
  • Both subunit and recombinant vaccines may be formulated following accepted convention using buffers, stabilizers, preservative, solubilizers and compositions used to facilitate sustained release.
  • additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose.
  • Stabilizers include gelatin and albumin.
  • Adjuvants such as aluminum or magnesium hydroxide may be employed.
  • Vaccines may be maintained in solution or, in some cases, particularly recombinant vaccines, lyophilized. Lyophilized vaccine may be stored conveniently and combined with sterile solution before administration.
  • the amount of polypeptide administered depends upon such factors as the size of the polypeptide, the species, age, weight, and general physical characteristics of the animal, and by the composition of the vaccine. Determination of optimum dosage for each parameter may be made by routine methods.
  • subunit vaccines according to the present invention contain between 0.05-5000 micrograms of polypeptide per milliliter of sterile solution, preferably 10-1000 micrograms.
  • recombinant vaccines according to the c o present invention contain between 10 -10 infectious units per milliliter of sterile solution. About .5-2 milliliter of polypeptide-containing solution is administered.
  • Subunit vaccines and genetic material basedvaccines may be administered by an appropriate route such as, for example, by oral, intranasal, intramuscular, intraperitoneal or subcutaneous administration. In some embodiments, intranasal or subcutaneous administration is preferred. Subsequent to initial vaccination, animals may be boosted by revaccination.
  • Example 1 Cloning of Coronavirus conserveed Region in pMGl The bacterial expression vector, pMG-1, allows a gene expressing a foreign protein to be fused to a partial sequence of the NS1 gene from influenza virus, the first 81 encoding amino acids thereof. This vector is described in European Patent Application No. 366,238, published May 2, 1990, which is incorporated herein by reference.
  • the upstream primer contains Ncol and Ndel restriction sites and initiates amplification at base pair 3406 (amino acid 1115) , and is SEQ ID NO:13:
  • the downstream primer contains a StuI site and terminates amplification at base pair 3777 (amino acid 1238) , and is SEQ
  • Example 2 Cloning of Coronavirus conserveed Region in pSCll Vaccinia recombinants were engineered to contain the
  • MOLECULE TYPE protein
  • MOLECULE TYPE cDNA
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:13:

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A universal vaccine is disclosed which elicits a protective immune response in different host species and against different coronaviruses. A polypeptide which elicits protective antibodies against a homologous sequence found in the C terminal portion of coronavirus S proteins is disclosed. Vaccines comprising either the polypeptide or nucleic acids which encode the polypeptide are also disclosed. Methods of protecting a host against coronavirus infection are disclosed.

Description

Universal Coronavirus Vaccine
Cross reference to related applications
This application is a continuation-in-part application of U.S. application serial number 07/882,171, filed May 8, 1992, pending, which is a continuation-in-part of U.S. application serial number 07/698,927, filed May 13, 1991, which is a continuation-in-part of U.S. application serial number 07/613,066, filed November 14, 1990, each of which is incorporated herein by reference.
Field of the invention
The present invention relates to a universal vaccine useful to protect different species of animals against infection by different host-specific coronaviruses.
Background of the invention Coronaviruses are a family of host-specific enveloped RNA viruses with a single-stranded positive sense genome. Examples of coronaviruses include, but are not limited to: feline infectious peritonitis (FIPV) and feline enteric coronavirus (FECV) which are specific to felines; canine coronavirus (CCV) which is specific to canines; transmissible gastroenteritis coronavirus (TGEV) which is specific to swine; bovine coronavirus (BCV) which is specific to bovine species; human coronavirus which is specific to humans; mouse hepatitis virus (MHV) which is specific to murine species; and infectious bronchitis virus (IBV) which is specific to avian species. These host-specific coronaviruses cannot cross infect different species of animals. Viral infection of the host by a coronavirus can cause symptoms ranging from mild enteritis to severe debilating disease to, in some cases, death.
Coronaviruses share common structural features including a spike or S protein (also referred to as a peplomer protein) . The S protein is a glycoprotein which protrudes from the surface of the virus particle. The S protein mediates the binding of virions to the host cell receptor and is involved in membrane fusion. In addition, it is the target of virus neutralizing antibodies. S proteins contain an N-terminal signal sequence, a C-terminal transmembrane segment and potential N-linked glycosylation sites. Comparison of different coronavirus S proteins show little homology, i.e. similarity, at the N terminus and highly conserved amino acid sequences at the C terminus. Because the tissue tropism and disease symptomatology is quite varied among this virus family, it is speculated that the pathogenesis of coronaviruses is determined by the sequences encoded at the N-terminus while the more conserved C-terminus encodes critical structural features common to all coronaviruses. The carboxy terminus of the S protein is believed to be involved in fusion.
The structure of the S protein has been studied. Cavanagh (1983) J". Gen . Virol . 64:2577-2583, which is incorporated herein by reference, proposed a model for the coronavirus spike in which the C-terminal half of the protein forms its stalk and the N-terminal half, its bulbous protein. deGroot et al . r (1987) J. Mol . Biol . 197:, which is incorporated herein by reference, have postulated a model in which a coiled-coil structure forms the connection between the globular part of the S protein and the viral membrane. This model is based on the occurrence of heptad repeats, i.e., a periodicity (a-b-c-d-e-f-g) in which the amino acids are hydrophobic. Britton (1991) Nature 353:394, which is incorporated herein by reference, reported the presence of a leucine zipper motif at the carboxyl end of the S glycoprotein of coronaviruses for which the spike sequence is available: TGEV FS772/70 (amino acids 1342-1377) , FIPV WSU 1146 (amino acids 1345-1380) , MHV A59 (amino acids 1217-1252) , human coronavirus 229E (amino acids 1067-1102) , BCV Mebus (amino acids 1266-1294) , and infectious bronchitis virus Beaudette (amino acids 1059-1079) . The leucine zipper motif terminates ten residues upstream of the conserved K P motif preceding the transmembrane domain.
Efforts have been made to develop vaccines against various host-specific coronaviruses. Attempts have been made with varying success to develop attenuated live virus vaccines, inactivated vaccines, subunit vaccines and recombinant nucleic acid based vaccines. In each case, the vaccine developed did not cross-protect other host animals.
Vaccines currently available for protection against coronavirus are specific for protection against a given member of the coronavirus family. Such vaccines do not provide cross protection to protect a host against other members of the coronavirus family which are able to infect the species.
Furthermore, such vaccines do not cross protect other animals against coronaviruses for which they are susceptible to infection.
There is a need for a vaccine which can protect against coronavirus infection. In particular, there is a need for a vaccine which can be useful to protect a host species against different coronaviruses and there is a need for a vaccine which can be useful to protect different host species against different coronaviruses.
Summary of the invention
The present invention relates to a polypeptide comprising an amino acid sequence from the C terminal portion of a coronavirus S protein which has been found to be highly conserved among coronaviruses and which is capable of eliciting a protective immune response. This sequence is referred to as a universal conserved domain. The polypeptides of the present invention have less than a complete amino acid sequence of an S protein.
The present invention relates to a vaccine comprising a polypeptide which includes an universal conserved domain and which has less than a complete amino acid sequence of an S protein. The present invention relates to an isolated nucleic acid molecule having a nucleic acid sequence which encodes a polypeptide that includes a universal conserved domain polypeptide and that has less than a complete amino acid sequence of an S protein.
The present invention relates to a vaccine comprising a nucleic acid molecule that encodes a polypeptide which includes an universal conserved domain and which has less than a complete amino acid sequence of an S protein. The present invention relates to a method of protecting an animal from infection by a coronavirus comprising administering an amount of a polypeptide effective to elicit a protective immune response. The polypeptide administered in the method comprises a universal conserved domain and has less than a complete amino acid sequence of an S protein.
The present invention relates to a method of protecting an animal from infection by a coronavirus comprising administering an amount of a nucleic acid molecule which encodes a polypeptide effective to elicit a protective immune response. The polypeptide encoded by the nucleic acid molecule administered in the method comprises a universal conserved domain and has less than a complete amino acid sequence of an S protein.
Detailed description of the invention
According to the present invention, a highly conserved region of the spike protein has been identified which, when presented as a vaccine component or product, is useful as a universal immunogen to protect an animal against coronavirus infection. The vaccine of the present invention may be used to vaccinate any animal susceptible to infection by virus that is a member of the coronavirus family. Accordingly, the present invention provides vaccines which can be produced in a single manufacturing process and administered to different species of animals. The cross-protection afforded by vaccines of the present invention eliminates the need to produce different vaccines to protect animals against different members of the coronavirus family.
As used herein, the term "polypeptide" is meant to refer to a peptide, polypeptide or protein molecule; a molecule which includes a peptide, polypeptide or protein molecule; or a molecule that contains amino acid residues which are linked by non-peptide bonds.
As used herein, the term "universal conserved domain" ("UCD") is meant to refer to the identical 124 amino acid segment found in the C terminal portion of S proteins from TGEV, CCV and strains of feline coronaviruses. In addition, the term "UCD" is meant to refer to the corresponding amino acid segments of other coronavirus which have different but homologous amino acid sequences. Such corresponding sequences may be identified by their location in the S protein, i.e. downstream of the bulbous N-terminal region and upstream of the transmembrane region and the high level of amino acid sequence similarity to the 124 amino acid sequence described above. Furthermore, the term "UCD" is additionally meant to refer to consensus sequences are generated by comparing corresponding sequences and determining the statistically average amino acid residue at a given position in the sequence. Thus, when several different sequences are compared, the most common residue at a given position is assigned to that position in a consensus sequence.
The conservation of UCD sequences suggests that they play a major role in virus structure and/or replication. The region of perfect homology decreases in size as other coronavirus S genes are included in the comparison. For example, bovine and human coronavirus are more closely aligned to the feline, canine and porcine coronavirus S genes in this conserved region than are sequences from the murine and avian coronaviruses.
Table 1 contains a comparison of corresponding amino acid sequences from the C terminal portion of various coronaviruses. SEQ ID N0:1 is an amino acid sequence from FIPV strain Wsue2 (Virulent, Type II; Genbank accession number X06170) . SEQ ID NO:2 is an amino acid sequence from FIPV strain Df2e2 (Virulent r Type II). SEQ ID NO:3 is an amino acid sequence from FIPV strain Tse2 (Temperature sensitive mutant of Df2) . SEQ ID NO:4 is an amino acid sequence from FECV strain Fecve2 (Avirulent strain 1683). SEQ ID NO:5 is an amino acid sequence from TGEV strain Tgeve2 (Purdue strain; Genbank accession number D00118) . SEQ ID NO:6 is an amino acid sequence from FIPV strain Tgeve2f2 (Miller strain; Genbank accession number M56002) . SEQ ID NO:7 is an amino acid sequence from BCV strain Bcve2 (Genbank accession number M30613) . SEQ ID NO:8 is an amino acid sequence from HCV strain Hcve2 (Genbank accession number X16816) . SEQ ID NO:9 is an amino acid sequence from IBV strain Ibbspi (Genbank accession number X16816) . SEQ ID NO:10 is an amino acid sequence from MHV strain Mhve2a59 (Genbank accession number X51939 SEQ ID NO:11 is an amino acid sequence from FIPV strain Mhvs (Genbank accession number X04797) . SEQ ID NO:12 is a consensus sequence which has been designed to provide an optimum UCD amino acid sequence. The 124 residue amino acid sequence which is completely conserved in TGEV, CCV and feline coronaviruses is shown in SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 from residue 37 to residue 160. The consensus sequence, SEQ ID NO:12, also contains this 124 amino acid sequence in its entirety from residue 37 to residue 160. This 124 amino acid sequence is currently a preferred UCD sequence of the present invention. The entire 199 amino acid consensus sequence is a preferred UCD-containing peptide.
Using amino acid sequence information from any coronavirus, one having ordinary skill in the art can identify the conserved region corresponding to the 124 amino acid sequence found in TGEV, CCV and feline coronaviruses. As exemplified in Table 1, the amino acid sequences from the C terminal portion of coronaviruses can be compared to identify the sequence which corresponds to the UCD from TGEV, CCV and feline coronaviruses. The procedure is straightforward and can be performed to provide additional UCD sequences .and flanking sequences.
Corresponding conserved regions from coronaviruses other than CCV, TGEV and feline coronaviruses may be identified by their location on the S protein and the high level of sequence homology the possess when compared to the 124 amino acid sequence referred to above. An example of such comparison and identification is shown in Table 1 in which sequences from the C terminal regions of various S proteins upstream from the transmembrane region are compared and homologous sequences identified. Widely available computer programs such as PLOTSIMILARITY software (Genetics Computer Group, Madison WI) may be employed to locate a UCD in a coronavirus. In addition, such software may be employed to expedite the generation of consensus sequences. This software relies on the principles originally set out by Wilbur and Lipman and later refined by Smith and Waterman and by Needleman and Wunsch. Using these well known guidelines, having ordinary skill in the art may compare sequences and arrive at the statistically average or most common residue occupying a given position. The PLOTSIMILARITY software automates this function. Consensus sequences are thus generated. In addition to the consensus sequence provided as SEQ ID NO:12, a different consensus sequence derived from a comparison of corresponding sequences is disclosed in the co- owned, co-pending patent application: which is filed on the same day as the present application; which is entitled "Compositions and Methods for Vaccinating Coronaviruses"; which names the same inventors as the present application (Miller, Timothy J.; Jones, Elaine V.; Reed, Albert P.; and Klepfer, Sharon R) ; which has been designated docket number H85009-1 by Applicants; and which is incorporated herein by reference. Accordingly, the present invention relates to polypeptides which comprise a UCD or a fragment or a derivative thereof. That is, the present invention relates to polypeptides which comprise: the 124 amino acid sequence form TGEV, CCV and feline coronaviruses; or the different amino acid sequences from other coronaviruses which correspond to the 124 amino acid sequence; or a consensus sequence generated from comparison of corresponding regions; or immunogenic fragments or immunogenic derivatives thereof.
Polypeptides according to the present may further comprise additional flanking sequences from coronavirus or flanking sequences designed as a consensus sequence of the flanking sequences of corresponding regions from different coronaviruses.
As used herein, the term "immunogenic fragment" is meant to refer to polypeptides which include an incomplete UCD which is capable of eliciting a protective immune response against coronavirus in an animal susceptible to coronavirus infection. Immunogenic fragments may comprise a sequence having nine or more amino acids from a UCD, and may include additional amino acid sequences.
As used herein, the term "immunogenic derivatives" is meant to refer to molecules which have a UCD or portions thereof with conservative amino acid substitutions and which are capable of eliciting a protective immune response against a coronavirus in an animal susceptible to coronavirus infection. Those having ordinary skill in the art can readily design derivatives having UCD sequences with conservative substitutions for amino acids. For example, following what are referred to as Dayhof's rules for amino acid substitution (Dayhof, M.D. (1978) Nat . B omed. Res . Found . , Washington, D.C. Vol. 5, supp. 3), amino acid residues in a peptide sequence may be substituted with comparable amino acid residues. Such substitutions are well known and are based the upon charge and structural characteristics of each amino acid.
Using standard procedures and readily available starting materials, one having ordinary skill in the art can determine whether a fragment and derivative is an immunogenic fragment or an immunogenic derivative, respectively. Briefly, polypeptides can be produced by standard methodologies and tested to determine whether they are capable of eliciting, a protective immune response. Sera from vaccinated animals can be analyzed to detect the presence of antibodies capable of inhibiting infection of cells in culture. Furthermore, challenge studies can be performed to determine if animals vaccinated with a polypeptide are protected from subsequent infection by wild type virus. One having ordinary skill in the art can routinely produce and screen fragments and derivatives to determine the effectiveness of such vaccine components to elicit protective immune responses. Similarly, larger molecules may also be screened by the same means to detect their ability to elicit a protective immune response.
The UCD lies near the transmembrane region of the
S protein. Because this region of the S protein is purported to be involved in the secondary structure of the glycoprotein, in receptor binding and in virus-induced cell fusion, the UCD plays an important role in the function of the S protein and in the formation of infectious virus. Inducing an immune response against this region will interfere with the folding of the S glycoprotein into its proper conformation. The presence of circulating antibodies to this region could bind to either virus or infected cells expressing the glycoprotein on the surface. Virus co plexed with antibody may be unable to bind to receptors on susceptible cells and/or initiate the pathway required to gain entry which involves a conformational change of the S protein. Recognition of this region on the surface of infected cells would target them for clearance. Antibody binding to the conserved region of the S protein surface expressed by infected cells would, most likely, prevent cell fusion and interfere with virus assembly. Regardless of mechanism, an immune response to the UCD of a coronavirus S protein will inhibit virus spread from cell to cell and limit virus infection.
Polypeptides according to the present invention comprise less than a complete S protein sequence. In particular, the polypeptides do not comprise a complete N- ter inal portion of an S protein and preferably comprise few or no amino acid sequences from the N-terminal bulbous portion of the protein. Furthermore, the polypeptides preferably do not comprise a complete transmembrane domain of an S protein. In some preferred embodiments, polypeptides comprise no more than a 400 amino acid sequence upstream (from the C terminus to the N terminus) from about 2 amino acids upstream from the transmembrane domain. In some preferred embodiments, polypeptides comprise no more than a 300 amino acid sequence upstream (from the C terminus to the N terminus) from about 5 amino acids upstream from the transmembrane domain.
In some preferred embodiments, polypeptides which comprise a UCD, or derivatives and/or fragments thereof further comprise flanking sequences of the UCD found in coronavirus. For example, in some preferred embodiments, the polypeptide comprises portions of the S protein flanked by and optionally including the heptad repeats reported by deGroot et al . , such as, for example, in FIPV strain WSU 1146 from residues 1067 to 1380. In some preferred embodiments, the polypeptide comprises portions of the S protein flanked on the carboxy side by and may also include a leucine zipper motif as reported by Britton. In some preferred embodiments, the polypeptide comprises portions of the S protein from about 300 residues upstream of the transmembrane region to about 5 amino acid residues upstream from the transmembrane domain. In some preferred embodiments, the polypeptide comprises a UCD about 124 amino acids iri length. In some preferred embodiments, the polypeptide comprises an immunogenic fragment of a UCD about 100 amino acids in length. In some preferred embodiments, the polypeptide comprises an immunogenic fragment of a UCD about 50 amino acids in length. In some preferred embodiments, the polypeptide comprises an immunogenic fragment of a UCD about 25 amino acids in length. In some preferred embodiments, the polypeptide comprises an immunogenic fragment of a UCD about 15 amino acids in length. In some preferred embodiments, the polypeptide comprises an immunogenic fragment of a UCD about 10 amino acids in length. In some preferred embodiments, a UCD comprises amino acid residues 37-160 of SEQ ID NO:12. Additional preferred embodiments comprise SEQ ID NO:12. Other preferred embodiments of the invention comprise SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5. Other preferred embodiments comprise SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 or SEQ ID NO:11.
In addition to a UCD and, optionally, additional flanking segments from an S protein, other peptide segments may also be included in the polypeptide of the present invention. Such additional peptide segments may comprise other immunogenic targets from coronavirus and/or other pathogens, and/or they may be provided for improved stability, UCD epitope presentation or production/purification facilitation. The resulting polypeptide is considered a chimeric or fusion polypeptides.
Vaccines according to the present invention can be employed to vaccinate animals against infection by coronaviruses or at least to prevent the clinical symptoms associated with such infections. Such vaccines will provide protection against multiple coronaviruses and cross species protection. Vaccines may be produced which are either protein-based or nucleic acid-based. In both cases, the vaccinated animal is exposed to an immunogenic polypeptide which comprises a UCD. A protective immune response is elicited which is sufficient to protect the animal against coronavirus.
Vaccines according to the present invention can be either: a) compositions which comprise a polypeptide that includes a universal conserved domain; or b) compositions which comprise a nucleic acid molecule that includes a nucleotide sequence which encodes a polypeptide that includes a universal conserved domain. In both types of vaccines, the polypeptide is not a complete S protein and it elicits a protective immune response in animals. In protein based, i.e. subunit vaccines, polypeptides having a UCD may by produced using standard techniques including recombinant DNA techniques for protein production or by peptide synthesis. In preferred embodiments, polypeptides used in subunit vaccines according to the present invention are produced by recombinant DNA methodology.
The nucleic acid sequences of coronavirus S genes are widely known. One having ordinary skill in the art may routinely obtain DNA that encodes a polypeptide including a UCD using standard techniques and widely available starting materials. The nucleotide and amino acid sequences for S proteins from several types and strains of coronaviruses can be found in the co-owned published PCT application PCT/US91/08525 which claims priority to U.S. Patent Application Serial Numbers 613,066 and 698,927; each of these applications are incorporated herein by reference. Nucleotide and amino acid sequences of S proteins can also be found in published European Patent Applications publication numbers: 0,524,672 Al; 0,411,684 A2; 0,264,979 Al; 0,138,242 Al; and application number EP 91 30 3737. Each of these European patent applications are incorporated herein by reference. In addition, nucleotide and amino acid sequences of S proteins from several coronaviruses as well as nucleotide and amino acid sequences of a consensus sequence is disclosed in the co- owned, co-pending patent application: which is filed on the same day as the present application; which is entitled "Compositions and Methods for Vaccinating Coronaviruses"; which names the same inventors as the present application (Miller, Timothy J. ; Jones, Elaine V.; Reed, Albert P.; and Klepfer, Sharon R) ; which has been designated docket number H85009-1 by Applicants; and which is incorporated herein by reference.
Nucleic acid molecules encoding some or all of an S protein from a coronavirus may be generated by a variety of techniques. For such molecules, a nucleotide sequence that encodes a UCD may be identified. Using, for example, Polymerase Chain Reaction (PCR) methodology, primers flanking both sides the region of interest may be designed and used, to produce multiple copies of the UCD routinely. Alternatively, using restriction enzymes, a UCD may be isolated from DNA encoding an S protein. Moreover, nucleic acid molecules that encode a UCD may also be synthesized using techniques well known to those having ordinary skill in the art.
One having ordinary skill in the art can, using well known techniques, insert such DNA molecules into a commercially available expression vector for use in well known expression systems. For example, the commercially available plasmid pSE420 (Invitrogen, San Diego, CA) may be used for production of a DNA encoding a polypeptide including a UCD in E . coli . The commercially available plasmid pYES2
(Invitrogen, San Diego, CA) may, for example, be used for production in S . cerevisiae strains of yeast. The commercially available MaxBac™ (Invitrogen, San Diego, CA) complete baculovirus expression system may, for example, be used for production in insect cells. The commercially available plasmid pcDNA I (Invitrogen, San Diego, CA) may, for example, be used for production in mammalian cells such as Chinese Hamster Ovary cells. One having ordinary skill in the art can use these commercial expression vectors and systems or others to produce a polypeptide including a UCD using routine techniques and readily available starting materials. (See e . g. , Sambrook et al., Molecular Cloning a Laboratory Manual , Second Ed. Cold Spring Harbor Press (1989) which is incorporated herein by reference.) Thus, the desired proteins can be prepared in both prokaryotic and eukaryotic systems, resulting in a spectrum of processed forms of the protein. The particulars for the construction of expression systems suitable for desired hosts are known to those in the art. Briefly, for recombinant production of the protein, the DNA encoding the polypeptide is suitably ligated into the expression vector of choice. The DNA is operably linked to all regulatory elements which are necessary for expression of the DNA in the selected host. One having ordinary skill in the art can, using well known techniques, prepare express-ion vectors for recombinant production of the polypeptide.
The expression vector including the DNA that encodes the polypeptide comprising a UCD is used to transform the compatible host which is then cultured and maintained under conditions wherein expression of the foreign DNA takes place. The protein of the present invention thus produced is recovered from the culture, either by lysing the cells or from the culture medium as appropriate and known to those in the art. One having ordinary skill in the art can, using well known techniques, isolate the polypeptide that includes a UCD produced using such expression systems.
In addition to producing these proteins by recombinant techniques, automated peptide synthesizers may also be employed to produce polypeptides that include a UCD. Such techniques are well known to those having ordinary skill in the art and are useful if derivatives which have substitutions not provided for in DNA-encoded protein production. Subunitvaccines according to the invention comprise a polypeptide the includes a UCD but which is not a complete S protein and a pharmaceutically acceptable carrier or diluent. Optionally, the vaccine may comprise additional immunogenic proteins, additional vaccine components such as non-subunit vaccines, and/or an adjuvant.
In nucleic acid molecule based, i.e. recombinant vaccines, a nucleotide sequences which encode polypeptides that include a UCD is inserted into a vector and administered to the animal. The vector delivers genetic material to the animal where it is transcribed and translated to produce the immunogenic polypeptide. Vectors for use as vaccines are well known and include non-pathogenic viruses and prokaryotic organisms. Suitable vectors for delivering genetic material are readily available or may be produced from readily available starting materials using standard techniques. Two examples of vectors useful for delivering genetic material as a vaccine are the recombinant pox vectors or non-pathogenic - IS -
Salmonella strains. The nucleotide sequence that encodes the immunogenic polypeptide is operably linked to regulatory elements required for expression and inserted within the vector. Alternatively, it is incorporated into the vector at a site where it is placed under the control of the necessary regulatory elements already present in the vector. Naked DNA may also be used as a vaccine delivery system.
Recombinant vaccines may be used in combination with other vaccines. Further, the genetic material which encodes the polypeptide that comprises the UCD may further comprise additional coding sequences which encode other peptide sequences capable of eliciting an immunogenic response against coronavirus or another pathogen.
Both subunit and recombinant vaccines may be formulated following accepted convention using buffers, stabilizers, preservative, solubilizers and compositions used to facilitate sustained release. Generally, additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose. Stabilizers include gelatin and albumin. Adjuvants such as aluminum or magnesium hydroxide may be employed. Vaccines may be maintained in solution or, in some cases, particularly recombinant vaccines, lyophilized. Lyophilized vaccine may be stored conveniently and combined with sterile solution before administration. The amount of polypeptide administered depends upon such factors as the size of the polypeptide, the species, age, weight, and general physical characteristics of the animal, and by the composition of the vaccine. Determination of optimum dosage for each parameter may be made by routine methods. Generally, subunit vaccines according to the present invention contain between 0.05-5000 micrograms of polypeptide per milliliter of sterile solution, preferably 10-1000 micrograms. Generally, recombinant vaccines according to the c o present invention contain between 10 -10 infectious units per milliliter of sterile solution. About .5-2 milliliter of polypeptide-containing solution is administered. Subunit vaccines and genetic material basedvaccines may be administered by an appropriate route such as, for example, by oral, intranasal, intramuscular, intraperitoneal or subcutaneous administration. In some embodiments, intranasal or subcutaneous administration is preferred. Subsequent to initial vaccination, animals may be boosted by revaccination.
Examples
Example 1 Cloning of Coronavirus Conserved Region in pMGl The bacterial expression vector, pMG-1, allows a gene expressing a foreign protein to be fused to a partial sequence of the NS1 gene from influenza virus, the first 81 encoding amino acids thereof. This vector is described in European Patent Application No. 366,238, published May 2, 1990, which is incorporated herein by reference.
Primers were designed to amplify a S gene region encoding amino acids 1115-1238 of the DF2 FIPV strain for expression in this vector as follows. The upstream primer contains Ncol and Ndel restriction sites and initiates amplification at base pair 3406 (amino acid 1115) , and is SEQ ID NO:13:
5'-
GTTGTCAACACACCATGGATCATATGCAAGGGCAAGCTTTAAGTCACCTTACA. Ncol Ndel The downstream primer contains a StuI site and terminates amplification at base pair 3777 (amino acid 1238) , and is SEQ
ID NO: 14:
5'-AAATACCTGAGGCCTCCAAGCTGTTACAGTTTCATAAGCTGT. StuI The amplified fragment (412 bp) was cloned into the pT7 Blue vector according to the manufacturer's instructions. A plasmid containing amino acids 1115-1238 in pT7 Blue was digested with Ncol/StuI, the 412 base pair insert isolated, and ligated overnight at 15°C to plasmid vector pMGl digested with Ncol/StuI and dephosphorylated. Host cells AR120 and AR58 were transformed with the ligation mix and the presence of insert bearing clones was confirmed by diagnostic restriction enzyme digestions.
Example 2 - Cloning of Coronavirus Conserved Region in pSCll Vaccinia recombinants were engineered to contain the
1115-1238 amino acid conserved region of WT DF2 FIPV. The conserved region was cloned into the vaccinia expression vector pSCll by blunt-ending the 412 base pairs Ncol/StuI fragment isolated from the pT7 Blue clone described in Example 12, end-filling by incubation with Klenow polymerase, and inserting it into the Smal site downstream of the 7.5K vaccinia promoter. The ligation mix was transformed into HB101 host cells. Full-length clones were identified and oriented with respect to vector by BamHI and Seal digests of mini-prep DNAs, respectively.
Table 1
1 50 sue2 NITQAFGKVN DAIHQTSQGL ATVAKALAKV QDWNTQGQA LSHLTVQLQN Df2e2 NITQAFGKVN DAIHQTSQGL ATVAKALAKV QDWNTQGQA LSHLTVQLQN Tse2 NITQAFGKVN DAIHQTSQGL ATVAKALAKV QDWNTQGQA LSHLTVQLQN Fecve2 NITQAFGKVN DAIHQTSQGL ATVAKALAKV QDWNTQGQA LSHLTVQLQN Tgeve2 NITQAFGKVN DAIHQTSQGL ATVAKALAKV QDWNTQGQA LSHLTVQLQN Tgeve2f2 NITQAFGKVN DAIHQTSQGL ATVAKALAKV QDWNTQGQA LSHLTVQLQN Bcve2 AIQEGFDATN S ALVKI QAWNANAEA LNNLLQQLSN Hcve2 NIVDAFTGVN DAITQTSQAL QTVATALNKI QDWNQQGNS LNHLTSQLRQ Ibbapi HMQE GF RSTSLALQQI QDWSKQSAI LTETMASLNK Mhve2a59 AIQDGFDATN S ALGKI QSWNANAEA LNNLLNQLSN Mhvs AIQEGFDATN S ALGKI QSWNANAEA LNNLLNQLSN CONSENSUS NITQAFGKVN DAIHQTS.GL ATVAKALAKV QDWNTQGQA LSHLTVQLGN
51 100
Wsue2 NFQAISSSIS DIYNRLDELS ADAQVDRLIT GRLTALNAFV SQTLTRQAEV
Df2e2 NFQAISSSIS DIYNRLDELS ADAQVDRLIT GRLTALNAFV SQTLTRQAEV
Tse2 NFQAISSSIS DIYNRLDELS ADAQVDRLIT GRLTALNAFV SQTLTRQAEV
Fecve2 NFQAISSSIS DIYNRLDELS ADAQVDRLIT GRLTALNAFV SQTLTRQAEV Tgeve2 NFQAISSSIS DIYNRLDELS ADAQVDRLIT GRLTALNAFV SQTLTRQAEV
Tgeve2f2 NFQAISSSIS DIYNRLDELS ADAQVDRLIT GRLTALNAFV SQTLTRQAEV
Bcve2 RFGAISSSLQ EILSRLDALE AQAQIDRLIN GRLTALNVYV SQQLSDSTLV
Hcve2 NFQAISSSIQ AIYDRLDTIQ ADQQVDRLIT GRLAALNVFV SHTLTKYTEV
Ibbspi NFGAISSVIQ EIUQQFDAIQ ANAQVDRLIT GRLSSLSVLA SAKQAEUIRV Mhve2a59 RFGAISASLQ EILTRLEAVE AKAQIDRLIN GRLTALNAYI SKQLSDSTLI
Mhvs RFGAISASLQ EILTRLDAVE AKAQIDRLIN GRLTALNAYI SKQLSDSTLI
CONSENSUS NFQAISSSIS DIYNRLDELS ADAQVDRLIT GRLTALNAFV SQTLTRQAEV
101 150
Wsue2 RASRQLAKDK VNECVRSQSQ RFGFCGNGTH LFSLANAAPN GMIFFHTVLL Df2e2 RASRQLAKDK VNECVRSQSQ RFGFCGNGTH LFSLANAAPN GMIFFHTVLL Tse2 RASRQLAKDK VNECVRSQSQ RFGFCGNGTH LFSLANAAPN GMIFFHTVLL Fecve2 RASRQLAKDK VNECVRSQSQ RFGFCGNGTH LFSLANAAPN GMIFFHTVLL Tgevβ2 RASRQLAKDK VNECVRSQSQ RFGFCGNGTH LFSLANAAPN GMIFFHTVLL Tgeve2f2 RASRQLAKDK VNECVRSQSQ RFGFCGNGTH LFSLANAAPN GMIFFHTVLL Bcve2 KFSAAQAMEK VNECVKSQSS RINFCGNGNH IISLVQNAPY GLYFIHFSYV Hcve2 RASRQLAQQK VNECVKSQSK RYGFCGNGTH IFSIVNAAPE GLVFLHTVLL Ibbspi SQQRELATQK INECVKSQSI RYSFCGNGRH VLTIPQNAPN GIVFIHFSYT Mhve2a59 KVSAAQAIEK VNECVKSQTT RINFCGNGNH ILSLVQNAPY GLYFIHFSYV Mhvs KFSAAQAIEK VNECVKSQTT RINFCGNGNH ILSLVQNAPY GLCFIHFSYV CONSENSUS RASRQLAKDK VNECVRSQSQ RFGFCGNGTH LFSLANAAPN GMIFFHTVLL
151 200
Wsue2 PTAYETVTA SGICASDGDR TFGLWKDVQ LTLFRNLDDK FYLTPRTMYQ
Df2e2 PTAYETVTAW SGICASDGDR TFGLWKDVQ LTLFRNLDDK FYLTPRTMYQ
Tse2 PTAYETVTAW SGICASDGDR TFGLWKDVQ LTLFRNLDDK FYLTPRTMYQ Fecve2 PTAYETVTAW SGICASDGDR TFGLWKDVQ LTLFRNLDDK FYLTPRTMYQ
Tgeve2 PTAYETVTAW SGICASDGDR TFGLWKDVQ LTLFRNLDDK FYLTPRTMYQ
Tgeve2f2 PTAYETVTAW SGICASDGDR TFGLWKDVQ LTLFRNLDDK FYLTPRTMYQ
Bcve2 PTKYVTAKYS PGLCIA.GDR GIA PK SGYFVNVNNT WMFTGSGYYY
Hcve2 PTQYKDVEAW SGLC...VDG TNGYVLRQPN LALYKE.GNY YRITSRIMFE Ibbspi PDSFVNVTAI VGFCVKPANA SQUAIVPANG RGIFIQVNGS YYITARDMYM
Mhve2a59 PISFTTANVS PGLCIS.GDR GLA PK AGYFVQDDGE WKFTGSSYYY
Mhvs PTSFKTANVS PGLCIS.GDR GLA PK AGYFVQDNGE WKFTGSNYYY
CONSENSUS PTAYETVTAW PGICASDGDR TFGLWKDVQ LTLFRNLDDK FYLTPRTMYQ SEQUENCE LISTING
(1.) GENERAL INFORMATION:
(i) APPLICANT: Miller, Timothy J. Jones, Elaine V. Reed, Albert P.
Klepfer, Sharon R.
(ii) TITLE OF INVENTION: Universal Coronavirus Vaccine
(iii) NUMBER OF SEQUENCES: 14 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SmithKline Beecham Corporation
(B) STREET: 709 Swedeland Road
(C) CITY: King of Prussia
(D) STATE: PA (E) COUNTRY: USA
(F) ZIP: 19406-2799
(V) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 07/882,171
(B) FILING DATE: 08-MAY-1992
(vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: US 07/698,927
(B) FILING DATE: 13-MAY-1991
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 07/613,066
(B) FILING DATE: 14-NOV-1990 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Schreck, Patricia A.
(B) REGISTRATION NUMBER: 33,777
(C) REFERENCE/DOCKET NUMBER: SBC/PAS/WW001
(2) INFORMATION FOR SEQ ID Nθ:l: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 200 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
Asn lie Thr Gin Ala Phe Gly Lys Val Asn Asp Ala lie His Gin Thr 1 5 10 15 Ser Gin Gly Leu Ala Thr Val Ala Lys Ala Leu Ala Lys Val Gin Asp. 20 25 30
Val Val Asn Thr Gin Gly Gin Ala Leu Ser His Leu Thr Val Gin Leu 35 40 45 Gin Asn Asn Phe Gin Ala lie Ser Ser Ser lie Ser Asp lie Tyr Asn 50 55 60
Arg Leu Asp Gl Leu Ser Ala Asp Ala Gin Val Asp Arg Leu lie Thr 65 70 75 80
Gly Arg Leu Thr Ala Leu Asn Ala Phe Val Ser Gin Thr Leu Thr Arg 85 90 95
Gin Ala Glu Val Arg Ala Ser Arg Gin Leu Ala Lys Asp Lys Val Asn 100 105 110
Glu Cys Val Arg Ser Gin Ser Gin Arg Phe Gly Phe Cys Gly Asn Gly 115 120 125 Thr His Leu Phe Ser Leu Ala Asn Ala Ala Pro Asn Gly Met lie Phe 130 135 140
Phe His Thr Val Leu Leu Pro Thr Ala Tyr Glu Thr Val Thr Ala Trp 145 150 155 160
Ser Gly He Cys Ala Ser Asp Gly Asp Arg Thr Phe Gly Leu Val Val 165 170 175
Lys Asp Val Gin Leu Thr Leu Phe Arg Asn Leu Asp Asp Lys Phe Tyr 180 185 190
Leu Thr Pro Arg Thr Met Tyr Gin 195 200 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS i
(A) LENGTH: 200 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Asn He Thr Gin Ala Phe Gly Lys Val Asn Asp Ala He His Gin Thr 1 5 10 15
Ser Gin Gly Leu Ala Thr Val Ala Lys Ala Leu Ala Lys Val Gin Asp 20 25 30
Val Val Asn Thr Gin Gly Gin Ala Leu Ser His Leu Thr Val Gin Leu 35 40 45
Gin Asn Asn Phe Gin Ala He Ser Ser Ser He Ser Asp He Tyr Asn 50 55 60 Arg Leu Asp Glu Leu Ser Ala Asp Ala Gin Val Asp Arg Leu He Thr 65 70 75 80
Gly Arg Leu Thr Ala Leu Asn Ala Phe Val Ser Gin Thr Leu Thr Arg 85 90 95 Gin Ala Glu Val Arg Ala Ser Arg Gin Leu Ala Lys Asp Lys Val Asn 100 105 110
Glu Cys Val Arg Ser Gin Ser Gin Arg Phe Gly Phe Cys Gly Asn Gly 115 120 125 Thr His Leu Phe Ser Leu Ala Asn Ala Ala Pro Asn Gly Met He Phe 130 135 140
Phe His Thr Val Leu Leu Pro Thr Ala Tyr Glu Thr Val Thr Ala Trp 145 150 155 160
Ser Gly He Cys Ala Ser Asp Gly Asp Arg Thr Phe Gly Leu Val Val 165 170 175
Lys Asp Val Gin Leu Thr Leu Phe Arg Asn Leu Asp Asp Lys Phe Tyr 180 185 190
Leu Thr Pro Arg Thr Met Tyr Gin 195 200 (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 200 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
Asn He Thr Gin Ala Phe Gly Lys Val Asn Asp Ala He His Gin Thr 1 5 10 15
Ser Gin Gly Leu Ala Thr Val Ala Lys Ala Leu Ala Lys Val Gin Asp 20 25 30
Val Val Asn Thr Gin Gly Gin Ala Leu Ser His Leu Thr Val Gin Leu 35 40 45
Gin Asn Asn Phe Gin Ala He Ser Ser Ser He Ser Asp He Tyr Asn 50 55 60 Arg Leu Asp Glu Leu Ser Ala Asp Ala Gin Val Asp Arg Leu He Thr 65 70 75 80
Gly Arg Leu Thr Ala Leu Asn Ala Phe Val Ser Gin Thr Leu Thr Arg 85 90 95
Gin Ala Glu Val Arg Ala Ser Arg Gin Leu Ala Lys Asp Lys Val Asn 100 105 110
Glu Cys Val Arg Ser Gin Ser Gin Arg Phe Gly Phe Cys Gly Asn Gly 115 120 125
Thr His Leu Phe Ser Leu Ala Asn Ala Ala Pro Asn Gly Met He Phe 130 135 140 Phe His Thr Val Leu Leu Pro Thr Ala Tyr Glu Thr Val Thr Ala Trp 145 150 155 160
Ser Gly He Cys Ala Ser Asp Gly Asp Arg Thr Phe Gly Leu Val Val 165 170 175 - 22 -
Lys Asp Val Gin Leu Thr Leu Phe Arg Asn Leu Asp Asp Lys Phe Tyr 180 185 190
Leu Thr Pro Arg Thr Met Tyr Gin 195 200 (2) INFORMATION FOR SEQ ID Nθϊ4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 200 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Asn He Thr Gin Ala Phe Gly Lys Val Asn Asp Ala He His Gin Thr 1 5 10 15
Ser Gin Gly Leu Ala Thr Val Ala Lys Ala Leu Ala Lys Val Gin Asp 20 25 30
Val Val Asn Thr Gin Gly Gin Ala Leu Ser His Leu Thr Val Gin Leu 35 40 45
Gin Asn Asn Phe Gin Ala He Ser Ser Ser He Ser Asp He Tyr Asn 50 55 60 Arg Leu Asp Glu Leu Ser Ala Asp Ala Gin Val Asp Arg Leu He Thr 65 70 75 80
Gly Arg Leu Thr Ala Leu Asn Ala Phe Val Ser Gin Thr Leu Thr Arg 85 90 95
Gin Ala Glu Val Arg Ala Ser Arg Gin Leu Ala Lys Asp Lys Val Asn 100 105 110
Glu Cys Val Arg Ser Gin Ser Gin Arg Phe Gly Phe Cys Gly Asn Gly 115 120 125
Thr His Leu Phe Ser Leu Ala Asn Ala Ala Pro Asn Gly Met He Phe 130 135 140 Phe His Thr Val Leu Leu Pro Thr Ala Tyr Glu Thr Val Thr Ala Trp 145 150 155 160
Ser Gly He Cys Ala Ser Asp Gly Asp Arg Thr Phe Gly Leu Val Val 165 170 175
Lys Asp Val Gin Leu Thr Leu Phe Arg Asn Leu Asp Asp Lys Phe Tyr 180 185 190
Leu Thr Pro Arg Thr Met Tyr Gin 195 200
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 200 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
Asn He Thr Gin Ala Phe Gly Lys Val Asn Asp Ala He His Gin Thr 1 5 10 15
Ser Gin Gly Leu Ala Thr Val Ala Lys Ala Leu Ala Lys Val Gin Asp 20 25 30
Val Val Asn Thr Gin Gly Gin Ala Leu Ser His Leu Thr Val Gin Leu 35 40 45
Gin Asn Asn Phe Gin Ala He Ser Ser Ser He Ser Asp He Tyr Asn 50 55 60 Arg Leu Asp Glu Leu Ser Ala Asp Ala Gin Val Asp Arg Leu He Thr 65 70 75 80
Gly Arg Leu Thr Ala Leu Asn Ala Phe Val Ser Gin Thr Leu Thr Arg 85 90 95
Gin Ala Glu Val Arg Ala Ser Arg Gin Leu Ala Lys Asp Lys Val Asn 100 105 110
Glu Cys Val Arg Ser Gin Ser Gin Arg Phe Gly Phe Cys Gly Asn Gly 115 120 125
Thr His Leu Phe Ser Leu Ala Asn Ala Ala Pro Asn Gly Met He Phe 130 135 140 Phe His Thr Val Leu Leu Pro Thr Ala Tyr Glu Thr Val Thr Ala Trp 145 150 155 160
Ser Gly He Cys Ala Ser Asp Gly Asp Arg Thr Phe Gly Leu Val Val 165 170 175
Lys Asp Val Gin Leu Thr Leu Phe Arg Asn Leu Asp Asp Lys Phe Tyr 180 185 190
Leu Thr Pro Arg Thr Met Tyr Gin 195 200
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 200 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: Asn He Thr Gin Ala Phe Gly Lys Val Asn Asp Ala He His Gin Thr 1 5 10 15
Ser Gin Gly Leu Ala Thr Val Ala Lys Ala Leu Ala Lys Val Gin Asp 20 25 30
Val Val Asn Thr Gin Gly Gin Ala Leu Ser His Leu Thr Val Gin Leu 35 40 45
Gin Asn Asn Phe Gin Ala He Ser Ser Ser He Ser Asp He Tyr Asn 50 55 60 Arg Leu Asp Glu Leu Ser Ala Asp Ala Gin Val Asp Arg Leu He Thr 65 70 75 80
Gly Arg Leu Thr Ala Leu Asn Ala Phe Val Ser Gin Thr Leu Thr Arg 85 90 95 Gin Ala Glu Val Arg Ala Ser Arg Gin Leu Ala Lys Asp Lys Val Asn
100 105 110
Glu Cys Val Arg Ser Gin Ser Gin Arg Phe Gly Phe Cys Gly Asn Gly 115 120 125
Thr His Leu Phe Ser Leu Ala Asn Ala Ala Pro Asn Gly Met He Phe 130 135 140
Phe His Thr Val Leu Leu Pro Thr Ala Tyr Glu Thr Val Thr Ala Trp 145 150 155 160
Ser Gly He Cys Ala Ser Asp Gly Asp Arg Thr Phe Gly Leu Val Val 165 170 175 Lys Asp Val Gin Leu Thr Leu Phe Arg Asn Leu Asp Asp Lys Phe Tyr
180 185 190
Leu Thr Pro Arg Thr Met Tyr Gin 195 200
(2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTHi 179 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID Nθ:7:
Ala He Gin Glu Gly Phe Asp Ala Thr Asn Ser Ala Leu Val Lys He 1 5 10 15
Gin Ala Val Val Asn Ala Asn Ala Glu Ala Leu Asn Asn Leu Leu Gin 20 25 30 Gin Leu Ser Asn Arg Phe Gly Ala He Ser Ser Ser Leu Gin Glu He 35 40 45
Leu Ser Arg Leu Asp Ala Leu Glu Ala Gin Ala Gin He Asp Arg Leu 50 55 60
He Asn Gly Arg Leu Thr Ala Leu Asn Val Tyr Val Ser Gin Gin Leu 65 70 75 80
Ser Asp Ser Thr Leu Val Lys Phe Ser Ala Ala Gin Ala Met Glu Lys 85 90 95
Val Asn Glu Cys Val Lys Ser Gin Ser Ser Arg He Asn Phe Gly Asn 100 105 110 Gly Asn His He He Ser Leu Val Gin Asn Ala Pro Tyr Gly Leu Tyr 115 120 125
Phe He His Phe Ser Tyr Val Pro Thr Lys Tyr Val Thr Ala Lys Tyr 130 135 140 Ser Pro Gly Leu Cys He Ala Gly Asp Arg Gly He Ala Pro Lys Ser- 145 150 155 160
Gly Tyr Phe Val Asn Val Asn Asn Thr Trp Met Phe Thr Gly Ser Gly 165 170 175 Tyr Tyr Tyr
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 196 amino acids (B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Asn He Val Asp Ala Phe Thr Gly Val Asn Asp Ala He Thr Gin Thr 1 5 10 15
Ser Gin Ala Leu Gin Thr Val Ala Thr Ala Leu Asn Lys He Gin Asp 20 25 30
Val Val Asn Gin Gin Gly Asn Ser Leu Asn His Leu Thr Ser Gin Leu 35 40 45 Arg Gin Asn Phe Gin Ala He Ser Ser Ser He Gin Ala He Tyr Asp 50 55 60
Arg Leu Asp Thr He Gin Ala Asp Gin Gin Val Asp Arg Leu He Thr 65 70 75 80
Gly Arg Leu Ala Ala Leu Asn Val Phe Val Ser His Thr Leu Thr Lys 85 90 95
Tyr Thr Glu Val Arg Ala Ser Arg Gin Leu Ala Gin Gin Lys Val Asn 100 105 110
Glu Cys Val Lys Ser Gin Ser Lys Arg Tyr Gly Phe Cys Gly Asn Gly 115 120 125 Thr His He Phe Ser He Val Asn Ala Ala Pro Glu Gly Leu Val Phe 130 135 140
Leu His Thr Val Leu Leu Pro Thr Gin Tyr Lys Asp Val Glu Ala Trp 145 150 155 160
Ser Gly Leu Cys Val Asp Gly Thr Asn Gly Tyr Val Leu Arg Gin Pro 165 170 175
Asn Leu Ala Leu Tyr Lys Glu Gly Asn Tyr Tyr Arg He Thr Ser Arg 180 185 190
He Met Phe Glu 195 (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 183 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
His Met Gin Glu Gly Phe Arg Ser Thr Ser Leu Ala Leu Gin Gin He 1 5 10 15 Gin Asp Val Val Ser Lys Gin Ser Ala He Leu Thr Glu Thr Met Ala
20 25 30
Ser Leu Asn Lys Asn Phe Gly Ala He Ser Ser Val He Gin Glu He 35 40 45
Gin Gin Phe Asp Ala He Gin Ala Asn Ala Gin Val Asp Arg Leu He 50 55 60
Thr Gly Arg Leu Ser Ser Leu Ser Val Leu Ala Ser Ala Lys Gin Ala 65 70 75 80
Glu He Arg Val Ser Gin Gin Arg Glu Leu Ala Thr Gin Lys He Asn 85 90 95 Glu Cys Val Lys Ser Gin Ser He Arg Tyr Ser Phe Cys Gly Asn Gly
100 105 110
Arg His Val Leu Thr He Pro Gin Asn Ala Pro Asn Gly He Val Phe 115 120 125
He His Phe Ser Tyr Thr Pro Asp Ser Phe Val Asn Val Thr Ala He 130 135 140
Val Gly Phe Cys Val Lys Pro Ala Asn Ala Ser Gin Ala He Val Pro 145 150 155 160
Ala Asn Gly Arg Gly He Phe He Gin Val Asn Gly Ser Tyr Tyr He 165 170 175 Thr Ala Arg Asp Met Tyr Met
180
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 180 amino acids (B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Ala He Gin Asp Gly Phe Asp Ala Thr Asn Ser Ala Leu Gly Lys He 1 5 10 15
Gin Ser Val Val Asn Ala Asn Ala Glu Ala Leu Asn Asn Leu Leu Asn 20 25 30
Gin Leu Ser Asn Arg Phe Gly Ala He Ser Ala Ser Leu Gin Glu He 35 40 45 Leu Thr Arg Leu Glu Ala Val Glu Ala Lys Ala Gin He Asp Arg Leu 50 55 60 He Asn Gly Arg Leu Thr Ala Leu Asn Ala Tyr He Ser Lys Gin Leu . 65 70 75 80
Ser Asp Ser Thr Leu He Lys Val Ser Ala Ala Gin Ala He Glu Lys 85 90 95 Val Asn Glu Cys Val Lys Ser Gin Thr Thr Arg He Asn Phe Cys Gly
100 105 110
Asn Gly Asn His He Leu Ser Leu Val Gin Asn Ala Pro Tyr Gly Leu 115 120 125
Tyr Phe He His Phe Ser Tyr Val Pro He Ser Phe Thr Thr Ala Asn 130 135 140
Val Ser Pro Gly Leu Cys He Ser Gly Asp Arg Gly Leu Ala Pro Lys 145 150 155 160
Ala Gly Tyr Phe Val Gin Asp Asp Gly Glu Trp Lys Phe Thr Gly Ser 165 170 175 Ser Tyr Tyr Tyr
180
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 180 amino acids (B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
Ala He Gin Glu Gly Phe Asp Ala Thr Asn Ser Ala Leu Gly Lys He 1 5 10 15
Gin Ser Val Val Asn Ala Asn Ala Glu Ala Leu Asn Asn Leu Leu Asn 20 25 30
Gin Leu Ser Asn Arg Phe Gly Ala He Ser Ala Ser Leu Gin Glu He 35 40 45 Leu Thr Arg Leu Asp Ala Val Glu Ala Lys Ala Gin He Asp Arg Leu 50 55 60
He Asn Gly Arg Leu Thr Ala Leu Asn Ala Tyr He Ser Lys Gin Leu 65 70 75 80
Ser Asp Ser Thr Leu He Lys Phe Ser Ala Ala Gin Ala He Glu Lys 85 90 95
Val Asn Glu Cys Val Lys Ser Gin Thr Thr Arg He Asn Phe Cys Gly 100 105 110
Asn Gly Asn His He Leu Ser Leu Val Gin Asn Ala Pro Tyr Gly Leu 115 120 125 Cys Phe He His Phe Ser Tyr Val Pro Thr Ser Phe Lys Thr Ala Asn 130 135 140
Val Ser Pro Gly Leu Cys He Ser Gly Asp Arg Gly Leu Ala Pro Lys 145 150 155 160 Ala Gly Tyr Phe Val Gin Asp Asn Gly Glu Trp Lys Phe Thr Gly Ser 165 170 175
Asn Tyr Tyr Tyr 180 (2) INFORMATION FOR SEQ ID NOtl2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 199 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Asn He Thr Gin Ala Phe Gly Lys Val Asn Asp Ala He His Gin Thr 1 5 10 15
Ser Gly Leu Ala Thr Val Ala Lys Ala Leu Ala Lys Val Gin Asp Val 20 25 30
Val Asn Thr Gin Gly Gin Ala Leu Ser His Leu Thr Val Gin Leu Gly 35 40 45
Asn Asn Phe Gin Ala He Ser Ser Ser He Ser Asp He Tyr Asn Arg 50 55 60 Leu Asp Glu Leu Ser Ala Asp Ala Gin Val Asp Arg Leu He Thr Gly 65 70 75 80
Arg Leu Thr Ala Leu Asn Ala Phe Val Ser Gin Thr Leu Thr Arg Gin 85 90 95
Ala Glu Val Arg Ala Ser Arg Gin Leu Ala Lys Asp Lys Val Asn Glu 100 105 110
Cys Val Arg Ser Gin Ser Gin Arg Phe Gly Phe Cys Gly Asn Gly Thr 115 120 125
His Leu Phe Ser Leu Ala Asn Ala Ala Pro Asn Gly Met He Phe Phe 130 135 140 His Thr Val Leu Leu Pro Thr Ala Tyr Glu Thr Val Thr Ala Trp Pro 145 150 155 160
Gly He Cys Ala Ser Asp Gly Asp Arg Thr Phe Gly Leu Val Val Lys 165 170 175
Asp Val Gin Leu Thr Leu Phe Arg Asn Leu Asp Asp Lys Phe Tyr Leu 180 185 190
Thr Pro Arg Thr Met Tyr Gin 195
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 53 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GTTGTCAACA CACCATGGAT CATATGCAAG GGCAAGCTTT AAGTCACCTT ACA 53
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE. TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
AAATACCTGA GGCCTCCAAG CTGTTACAGT TTCATAAGCT GT 42

Claims

Claims
1. A polypeptide comprising a universal conserved domain of a coronavirus or an immunogenic fragment or derivative thereof; said polypeptide having less than a complete amino acid sequence of said S protein.
2. A vaccine comprising a pharmaceutically acceptable carrier or diluent and a polypeptide comprising a universal conserved domain of a coronavirus or an immunogenic fragment or derivative thereof; said polypeptide having less than a complete amino acid sequence of said S protein.
3. A nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide comprising a universal conserved domain of a coronavirus or an immunogenic fragment or derivative thereof; said polypeptide having less than a complete amino acid sequence of said S protein.
4. A recombinant vaccine comprising a nucleic acid molecule, said nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide comprising a universal conserved domain of a coronavirus or an immunogenic fragment or derivative thereof; said polypeptide having less than a complete amino acid sequence of said S protein.
5. Amethod of protecting an animal against coronavirus comprising administering a polypeptide comprising a universal conserved domain of a coronavirus or an immunogenic fragment or derivative thereof; said polypeptide having less than a complete amino acid sequence of said S protein.
6. Amethod of protecting an animal against coronavirus comprising administering a nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide comprising a universal conserved domain of a coronavirus or an immunogenic fragment or derivative thereof; said polypeptide having less than a complete amino acid sequence of said S protein.
EP93911170A 1992-05-08 1993-05-07 Universal coronavirus vaccine. Withdrawn EP0640096A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US882171 1986-07-07
US88217192A 1992-05-08 1992-05-08
PCT/US1993/004365 WO1993023421A1 (en) 1992-05-08 1993-05-07 Universal coronavirus vaccine

Publications (2)

Publication Number Publication Date
EP0640096A1 true EP0640096A1 (en) 1995-03-01
EP0640096A4 EP0640096A4 (en) 1997-01-15

Family

ID=25380027

Family Applications (2)

Application Number Title Priority Date Filing Date
EP93911185A Withdrawn EP0640097A4 (en) 1992-05-08 1993-05-07 Compositions and methods for vaccination against coronaviruses.
EP93911170A Withdrawn EP0640096A4 (en) 1992-05-08 1993-05-07 Universal coronavirus vaccine.

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP93911185A Withdrawn EP0640097A4 (en) 1992-05-08 1993-05-07 Compositions and methods for vaccination against coronaviruses.

Country Status (5)

Country Link
EP (2) EP0640097A4 (en)
JP (2) JPH07508176A (en)
AU (2) AU678970B2 (en)
CA (2) CA2135201A1 (en)
WO (2) WO1993023421A1 (en)

Families Citing this family (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993023423A1 (en) * 1992-05-08 1993-11-25 Smithkline Beecham Corporation Canine coronavirus s gene and uses therefor
US5484719A (en) 1991-08-26 1996-01-16 Edible Vaccines, Inc. Vaccines produced and administered through edible plants
US5612487A (en) * 1991-08-26 1997-03-18 Edible Vaccines, Inc. Anti-viral vaccines expressed in plants
US6034298A (en) * 1991-08-26 2000-03-07 Prodigene, Inc. Vaccines expressed in plants
WO1993023421A1 (en) * 1992-05-08 1993-11-25 Smithkline Beecham Corporation Universal coronavirus vaccine
EP0612532A3 (en) * 1993-02-26 1998-02-04 Solvay Animal Health, Inc. Canine coronavirus vaccine from feline enteric coronavirus
AU721367B2 (en) * 1993-02-26 2000-06-29 Wyeth Holdings Corporation Canine coronavirus vaccine from feline enteric coronavirus
GB2316681B (en) * 1993-09-16 1998-04-15 Dimminaco Ag Sa Ltd Antigenically active proteins/polypeptides and coronavirus vaccines containing the same
FR2724385B1 (en) * 1994-08-29 1996-12-13 Rhone Merieux FELINE INFECTIOUS PERITONITIS VACCINE.
CA2232023A1 (en) * 1995-09-15 1997-03-20 John A. Howard Expression cassettes and methods for delivery of animal vaccines
WO1998027433A1 (en) * 1996-12-18 1998-06-25 Engene Biotechnologies, Inc A specific diagnostic for antibodies to feline infectious peritonitis virus
AU1408499A (en) * 1997-11-14 1999-06-07 Thomas P. Brown Compositions and methods to prevent turkey enteritis
WO2001009290A2 (en) * 1999-07-30 2001-02-08 Laboratorio Avi-Mex, S.A. De C.V. Avian infectious bronchitis virus serotype
FR2828405B1 (en) * 2001-08-09 2005-06-24 Virbac Sa ANTI-CORONAVIRUS VACCINE
TW200510450A (en) * 2003-07-21 2005-03-16 Nat Inst Health Soluble fragments of the SARS-CoV spike glycoprotein
US7605135B2 (en) * 2003-11-10 2009-10-20 The University Of Hong Kong Baicalin as a treatment for SARS infection
ITMI20111182A1 (en) 2011-06-28 2012-12-29 Canio Buonavoglia VACCINE FOR CORONAVIRUS CANINO
WO2015143335A1 (en) * 2014-03-20 2015-09-24 The University Of North Carolina At Chapel Hill Methods and compositions for chimeric coronavirus spike proteins
CN113248576A (en) * 2020-02-12 2021-08-13 北京科兴中维生物技术有限公司 Nucleic acid vaccine for coronavirus and preparation method thereof
US20240009297A1 (en) * 2020-07-24 2024-01-11 Soligenix, Inc. Antibody/Adjuvant Compositions and Methods of Immune Response Generation against Coronaviruses
CN113072626B (en) * 2021-04-25 2023-05-05 龙岩学院 Cat coronavirus S recombinant protein and preparation method thereof
CN113238048B (en) * 2021-05-11 2024-03-15 抗码(苏州)生物科技有限公司 Diagnostic markers and their use in differentiating between new coronavirus infection and new coronavirus inactivated vaccination
CN113292640B (en) * 2021-06-18 2021-12-24 国药中生生物技术研究院有限公司 Novel recombinant coronavirus RBD trimer protein vaccine capable of generating broad-spectrum cross-neutralization activity, and preparation method and application thereof
CN114478716B (en) * 2021-12-28 2024-05-28 梅州市人民医院(梅州市医学科学院) Polypeptide combination and application thereof in novel coronavirus antibody detection
CN114773487B (en) * 2022-05-31 2024-07-02 湖南大学 Influenza virus and novel coronavirus fusion recombinant protein vaccine immunogen and preparation method thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991002752A1 (en) * 1989-08-22 1991-03-07 Veterinary Infectious Disease Organization Bovine coronavirus polypeptides and vaccines
WO1993023422A1 (en) * 1992-05-08 1993-11-25 Smithkline Beecham Corporation Compositions and methods for vaccination against coronaviruses
WO1993023423A1 (en) * 1992-05-08 1993-11-25 Smithkline Beecham Corporation Canine coronavirus s gene and uses therefor

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0264979A1 (en) * 1986-09-05 1988-04-27 Duphar International Research B.V New antigenically active proteins and peptides, and feline infectious peritonitis virus (FIPV) vaccines
CA2005291C (en) * 1988-12-30 1999-01-26 Beverly Dale Feline infectious peritonitis virus diagnostic tools
NZ240558A (en) * 1990-11-14 1994-11-25 Smithkline Beecham Corp Recombinant feline coronavirus s proteins useful in diagnosis and vaccination against feline peritonitis virus disease

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991002752A1 (en) * 1989-08-22 1991-03-07 Veterinary Infectious Disease Organization Bovine coronavirus polypeptides and vaccines
WO1993023422A1 (en) * 1992-05-08 1993-11-25 Smithkline Beecham Corporation Compositions and methods for vaccination against coronaviruses
WO1993023423A1 (en) * 1992-05-08 1993-11-25 Smithkline Beecham Corporation Canine coronavirus s gene and uses therefor

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF GENERAL VIROLOGY, vol. 75, 1994, pages 1789-1794, XP002015276 J.G. WESSELING ET AL: "Nucleotide sequence and expression of the spike (S) gene of canine coronavirrus and comparison with the S proteins of feline and porcine coronaviruses " *
NATURE, vol. 353, 1990, pages 394-394, XP002016107 P. BRITTON: "Coronavirus motif" *
See also references of WO9323421A1 *

Also Published As

Publication number Publication date
WO1993023422A1 (en) 1993-11-25
WO1993023421A1 (en) 1993-11-25
EP0640096A4 (en) 1997-01-15
AU678971B2 (en) 1997-06-19
AU678970B2 (en) 1997-06-19
JPH07508176A (en) 1995-09-14
CA2135201A1 (en) 1993-11-25
CA2134898A1 (en) 1993-11-25
AU4240493A (en) 1993-12-13
EP0640097A4 (en) 1997-01-15
JPH08501931A (en) 1996-03-05
AU4241093A (en) 1993-12-13
EP0640097A1 (en) 1995-03-01

Similar Documents

Publication Publication Date Title
WO1993023421A1 (en) Universal coronavirus vaccine
US11969467B2 (en) Nucleic acid vaccine against the SARS-CoV-2 coronavirus
KR102482994B1 (en) Vaccine composition for preventing or treating infection of SARS-CoV-2
EP1525313B1 (en) Canine respiratory coronavirus (crcv) spike protein, polymerase and hemaggllutinin/esterase
CN111088283A (en) mVSV viral vector, viral vector vaccine thereof and mVSV-mediated novel coronary pneumonia vaccine
JP2004313196A (en) Composition and method for vaccination against coronavirus
CN117957016A (en) SARS-COV-2 and influenza combined vaccine
KR100889423B1 (en) Fusion protein of porcine reproductive and respiratory syndrome virus as prrs vaccine
EP3541419B1 (en) Immunogenic composition for mers coronavirus infection
EP0640098B1 (en) Canine coronavirus s gene and uses therefor
WO2023130089A1 (en) Recombinant polypeptides containing at least one immunogenic fragment and antibody fc region and uses thereof
US20230302119A1 (en) Stabilized Corona Virus Spike Protein Fusion Proteins
CZ292283B6 (en) Isolated DNA code sequence, vector, host cell, protein, pharmaceutical composition and vaccine
US6602504B2 (en) Canine coronavirus S gene and uses therefor
KR100768051B1 (en) A nucleic acid construct encoding a processing component derived from the n-terminal region of the hepatitis virus orf2, and an antigenic polypeptide
EP4172197A2 (en) Recombinant polypeptides containing at least one immunogenic fragment and antibody fc region and uses thereof
KR20220040423A (en) Vaccine composition for preventing or treating infection of SARS-CoV-2 comprising a recombinant protein
KR20230132816A (en) Replication-competent adenovirus type 4 SARS-COV-2 vaccine and uses thereof
CN114634579A (en) Genetically engineered vaccine for resisting new coronavirus

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19941122

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: PFIZER INC.

A4 Supplementary search report drawn up and despatched

Effective date: 19961126

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 19990901

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20000905