EP0615546A1 - Region of cytoplasmic domain of the human interleukin-4 receptor, as antagonists of il-4 - Google Patents

Abstract

Human IL-4 antagonists based on a critical region of the cytoplasmic domain of the human IL-4 receptor. The invention also relates to compositions and methods for inhibiting the biological activity of human IL-4.

Description

REGION OF CYTOPLASMIC DOMAIN OF THE HUMAN INTERLEUKIN-4 RECEPTOR, AS ANTAGONISTS OF IL-4

This invention relates to antagonists of human interleukin-4 that are based upon a critical region of the 5 cytoplasmic domain of the human interleukin-4 receptor.

BACKGROUND OF THE INVENΗON

Interleukin-4 (IL-4) is a protein which affects a broad spectrum of hematopoietic cells [Strober et al., Pediatr. Res. 24:549 (1988)]. IL-4 enhances a number of activities in 0 human beings, including macrophage function, IgGl and IgE production, and the proliferation of immunoglobulin- stimulated B cells, antigen-stimulated T cells and erythropoietin-stimulated red blood cell progenitors. It also increases the proliferation of IL-3-stimulated mast cells.

5 Together with IgE, mast cells play a central role in allergic reactions. Mast cells are granule-containing connective tissue cells which are located proximally to capillaries throughout the body, with especially high concentrations in the lungs, skin and gastrointestinal and 0 genitourinary tracts. Following exposure to an antigenic substance, mast cells degranulate and release chemical mediators such as histamine, serotonin, heparin, prostaglandins etc. to produce an allergic reaction.

Allergic reactions, e.g., to dust, pollen or organic 5 detritus, may cause minor discomfort through allergic rhinitis, sneezing or tearing, or more serious problems. More serious reactions, e.g., asthma or food or drug allergies, may cause severe discomfort or medical problems. Some very severe reactions such as anaphy lactic shock can be life threatening. In 1989, 46 million Americans suffered from some allergy: 25 million from hayfever, 9 million from asthma and 12 million from other allergies.

D -4 exerts biological effects through cell surface-specific receptors on target cells. Binding analyses have demonstrated that relatively small numbers (up to about 5,000 receptors/cell) of a single class of high affinity IL-4 receptor (Kd = 20-100 pM) are expressed on many types of iurine and human cells of hemopoietic and nonhemopoietic origin. See, e.g., papers by Ohara et al. [Nature 325:531

(1987)], Nakajima et al. [J. Immunol. 139:114 (1987)], Park et al. iProc. Natl. Acad. Sci. USA 84:1669 (1987)], Park et al. [J. Exp. Med. 166:416 (1987)], Cabrillat et al. [Biochem. Biophys. Res. Commun. 149:995 (1987)] and Lowenthal et al. [/. Immunol. 140:456 (1988)].

Cross-linking studies have led to the characterization of a family of IL-4 binding proteins having molecular weights of 140, 80 and 70 kilodaltons [Park et al., J. Exp. Med. 166:416 (1987); Park et al, J. Cell. Biochem. Suppl. 72A:111 (1988)]. The relationship between these various binding proteins, however, is unclear.

Recently, cDNAs encoding mouse and human IL-4 receptor components have been isolated [Mosley et al., Cell 59:335 (1989); Harada et al, Proc. Natl. Acad. Sci. USA 57:857 (1990); Idzerda et al., J. Exp. Med. 171 -Ml (1990); Galizzi et al., Intl. Immunol. 2 :669 (1990)], and it has been discovered that these receptors belong to the recently described cytokine receptor family [Bazan, Biochem. Biophys. Res. Commun. 164:788 (1989)]. The cloned IL-4 receptor cDNAs express high affinity binding sites on transfected COS7 cells and encode a binding protein of approximately 130-140 kilodaltons, as measured by ^■■■25I-IL-4 cross -linking. Despite extensive characterization of the biological properties of IL-4 and its receptor, little is known about the mechanism of signal transduction induced by IL-4.

Because of the induction by IL-4 of IgE production, mast cell proliferation and other biological effects, antagonists of IL-4 may be useful for the treatment of allergies. In view of the substantial number of individuals afflicted by allergies, there is a great need for such antagonists.

SUMMARY OF THE INVENTION

The present invention fills this need by providing

IL-4 antagonists, compositions and methods for inhibiting the biological activity of human IL-4.

More particularly, this invention provides antagonists of human IL-4 that mimic or comprise an amino acid sequence of a region of the cytoplasmic domain of the human IL-4 receptor, which region has an amino acid sequence defined by the sequence of SEQ ID NO: 1.

This invention further provides pharmaceutical compositions comprising one or more antagonists of human IL-4 that mimic or comprise an amino acid sequence of a region of the cytoplasmic domain of the human IL-4 receptor, which region has an amino acid sequence defined by the sequence of SEQ ID NO: 1, and a physiologically acceptable carrier.

This invention still further provides methods for inhibiting the biological activity of human IL-4 comprising contacting cells bearing receptors for human IL-4 with an antagonist of human IL-4 that mimics or comprises an amino acid sequence of a region of the cytoplasmic domain of the human IL-4 receptor, which region has an amino acid sequence defined by the sequence of SEQ ID NO: 1.

In one embodiment of this invention, the antagonists are polypeptides which contain from about 20 to about 41 amino acid residues and comprise the amino acid sequence defined by SEQ ID NO: 3.

BRIEF DESCRIPTION OF THE FIGURES

This invention can be more readily understood by reference to the accompanying Figures, in which:

Fig. 1 shows a side-by-side comparison of amino acid sequences of regions of the cytoplasmic domains of the mouse and human IL-4 receptors which are critical to the biological activity of IL-4. Also shown schematically are five synthetic polypeptides, the amino acid sequences of which are based upon the human receptor sequence.

Fig. 2 is a graphical representation of the effect of varying amounts of the five synthetic polypeptides of Fig. 1 on the proliferation of Ba/F3 cells transfected with human IL-4 receptor cDNA. Percent maximal proliferation rate is shown as a function of polypeptide concentration.

Fig. 3 is a graphical representation of the effect of certain synthetic polypeptides on the rate of proliferation of Ba/F3 cells expressing various kinds of receptors. Percent maximal proliferation rate is shown as a function of polypeptide concentration.

DESCRIPTION OF THE INVENTION

All references cited herein are hereby incorporated in their entirety by reference. The IL-4 antagonists of this invention can potentially be used to treat any medical condition caused by IL-4, such as allergies. They can also be used to elucidate the mechanism of action of IL-4 and to identify cellular elements involved in the induction of biological activity by IL-4. The understanding of the mechanism and the identification of such elements can provide bases for the rational design of drugs that can augment or inhibit the biological activity of IL-4.

As used herein, the term "antagonist" is defined as a substance that blocks or inhibits one or more of the known biological activities of IL-4. One such biological activity, the stimulation of cell proliferation, is illustrated herein.

Through DNA deletion studies described below, it has surprisingly been found that there is a critical region in the cytoplasmic domain of the human IL-4 receptor, interaction with which by as yet uncharacterized intracellular material(s) appears to be essential for the induction of cellular proliferation by IL-4. This critical region is highly conserved in mouse and human IL-4 receptors but lacks homology with other cytokine receptors.

The conserved, critical region of the mouse and human IL-4 receptors is shown in Fig. 1 , where the sequences of the two proteins are aligned to show maximum homology. Standard single-letter abbreviations are used, with connecting lines showing homologous amino acid residues. The full amino acid sequences of the critical region in the human and mouse IL-4 receptors are also defined in SEQ ID NOs: 1 and 2, respectively.

Also shown schematically in Fig. 1 are five synthetic polypeptides which have amino acid sequences based on the human sequence, except for additional or substitute amino acid residues that are specifically indicated. The complete amino sequences of polypeptides 1 through 5 in Fig. 1 are defined by the sequences of SEQ ID NOs: 3 through 7, respectively.

Surprisingly, it has been found that polypeptides having amino acid sequences corresponding to the sequence of the critical region of the human IL-4 receptor can be taken up by cells and thereby inhibit the proliferative activity of IL-4. The mechanism by which this inhibition occurs is not known, but an understanding of the mechanism of action is not essential to the practice of this invention. It is hypothesized that this region is involved in interactions with intracellular components of a signal transduction pathway.

As explained in the Example below, two polypeptides have been shown to inhibit the stimulation of cell proliferation by IL-4. One polypeptide has an amino acid sequence corresponding to a critical region of the human IL-4 receptor, as defined in SEQ ID NO: 1. The other inhibitory polypeptide has a sequence corresponding to the 20 amino- terminal residues of the sequence defined by SEQ ID NO: 1. The sequence of this smaller polypeptide is defined by SEQ ID NO: 3.

From the foregoing, it should be clear that any polypeptide comprising the smaller critical sequence (defined by SEQ ID NO: 3) will inhibit the cell proliferative activity of IL-4. Thus this invention encompasses not only the two exemplary polypeptides, but also others that are intermediate in length (i.e., those which contain in addition to the 20-residue core sequence, one or more of amino acid residues 21-40 of SEQ ID NO: 1) and inhibit a biological activity of IL-4.

The polypeptide antagonists of the invention can be synthesized by a suitable method such as by exclusive solid phase synthesis, partial solid phase methods, fragment condensation or classical solution synthesis. The polypeptides are preferably prepared by solid phase peptide synthesis as described, e.g., by Merrifield [J. Am. Chem. Soc. 85:2149 (1963); Science 232:341 (1986)] and Atherton et al. (Solid Phase Peptide Synthesis: A Practical Approach, 1989, IRL Press, Oxford). The synthesis is carried out with amino acids that are protected at the alpha-amino terminus. Trifunctional amino acids with labile side-chains are also protected with suitable groups to prevent undesired chemical reactions from occurring during the assembly of the polypeptides. The alpha-amino protecting group is selectively removed to allow subsequent reaction to take place at the amino-terminus. The conditions for the removal of the alpha-amino protecting group do not remove the side-chain protecting groups.

The alpha-amino protecting groups are those known to be useful in the art of stepwise polypeptide synthesis. Included are acyl type protecting groups (e.g., formyl, trifluoroacetyl, acetyl), aromatic urethane type protecting groups [e.g., benzyloxycarbonyl (Cbz), substituted benzyloxycarbonyl and 9-fluorenylmethyloxycarbonyl (Fmoc)], aliphatic urethane protecting groups (e.g., t-butyloxycarbonyl (Boc), isopropyloxycarbonyl, cyclohexyloxycarbonyl) and alkyl type protecting groups (e.g., benzyl, triphenylmethyl). The preferred protecting group is Boc. The side-chain protecting groups for Tyr include tetrahydropyranyl, tert-butyl, trityl, benzyl, Cbz, 4-Br-Cbz and 2,6-dichlorobenzyl. The preferred side-chain protecting group for Tyr is 2,6-dichlorobenzyl. The side-chain protecting groups for Asp include benzyl, 2,6-dichlorobenzyl, methyl, ethyl and cyclohexyl. The preferred side-chain protecting group for Asp is cyclohexyl. The side-chain protecting groups for Thr and Ser include acetyl, benzoyl, trityl, tetrahydropyranyl, benzyl, 2,6-dichlorobenzyl and Cbz. The preferred protecting group for Thr and Ser is benzyl. The side-chain protecting groups for Arg include nitro, Tos, Cbz, adamantyloxycarbonyl and Boc. The preferred protecting group for Arg is Tos. The side-chain amino group of Lys may be protected with Cbz, 2-Cl-Cbz, Tos or Boc. The 2-Cl-Cbz group is the preferred protecting group for Lys.

The side-chain protecting groups selected should remain intact during coupling and not be removed during the deprotection of the amino-terminus protecting group or during coupling conditions. The side-chain protecting groups should also be removable upon the completion of synthesis, using reaction conditions that will not alter the finished polypeptide.

Solid phase synthesis is usually carried out from the carboxy-terminus by coupling the alpha-amino protected (side-chain protected) amino acid to a suitable solid support. An ester linkage is formed when the attachment is made to a chloromethyl or hydroxymethyl resin, and the resulting polypeptide will have a free carboxyl group at the C-terminus. Alternatively, when a benzhydrylamine or p-methylbenz- hydrylamine resin is used, an amide bond is formed and the resulting polypeptide will have a carboxamide group at the C-terminus. These resins are commercially available, and their preparation has described by Stewart et al., Solid Phase Peptide Synthesis (2nd Edition), Pierce Chemical Co., Rockford, IL., 1984.

The C-terminal amino acid, protected at the side- chain if necessary and at the alpha-amino group, is coupled to the benzhydrylamine resin using various activating agents including dicyclohexylcarbodiimide (DCC), N,N'- diisopropylcarbodiimide and carbonyldiimidazole. Following the attachment to the resin support, the alpha-amino protecting group is removed using trifluoroacetic acid (TFA) or HC1 in dioxane at a temperature between 0° and 25°C. Dimethylsulfide is added to the TFA after the introduction of methionine (Met) to suppress possible S-alkylation. After removal of the alpha-amino protecting group, the remaining protected amino acids are coupled stepwise in the required order to obtain the desired sequence.

Various activating agents can be used for the coupling reactions including DCC, N,N'-diisopropyl- carbodiimide, benzotriazol- 1 -yl-oxy-tris-(dimethylamino)- phosphonium hexafluorophosphate (BOP) and DCC- hydroxybenzotriazole (HOBt). Each protected amino acid is used in excess (>2.0 equivalents), and the couplings are usually carried out in N-methylpyrrolidone (NMP) or in DMF, CH2CI2 or mixtures thereof. The extent of completion of the coupling reaction is monitored at each stage, e.g., by the ninhydrin reaction as described by Kaiser et al., Anal. Biochem., 34 :595 (1970). In cases where incomplete coupling is found, the coupling reaction is repeated. The coupling reactions can be performed automatically with commercially available instruments.

After the entire assembly of the desired polypeptide, the polypeptide-resin is cleaved with a reagent such as liquid HF for 1-2 hours at 0°C, which cleaves the polypeptide from the resin and removes all side-chain protecting groups. A scavenger such as anisole is usually used with the liquid HF to prevent cations formed during the cleavage fom alkylating the amino acid residues present in the polypeptide. The polypeptide-resin may be deprotected with TFA/dithioethane prior to cleavage if desired.

Side-chain to side-chain cyclization on the solid support typically requires the use of an orthogonal protection scheme which enables selective cleavage of the side-chain functions of acidic amino acids (e.g., Asp) and the basic amino acids (e.g., Lys). The 9-fluorenylmethyl (Fm) protecting group for the side-chain of Asp and the 9-fluorenylmethyloxy- carbonyl (Fmoc) protecting group for the side-chain of Lys can be used for this purpose. In these cases, the side-chain protecting groups of the Boc-protected polypeptide-resin are selectively removed with piperidine in DMF. Cyclization is achieved on the solid support using various activating agents including DCC, DCC/HOBt or BOP. The HF reaction is carried out on the cyclized polypeptide-resin as described above.

Recombinant DNA methodology can also be used to prepare polypeptide antagonists. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 1989, Cold Spring Harbor Press, Cold Spring Harbor, New York. The known genetic code, tailored if desired for more efficient expression in a given host organism, can be used to synthesize oligonucleotides encoding the desired amino acid sequences. The phosphoramidite solid support method of Matteucci et al. [J. Am. Chem. Soc. 705 :3185 (1981)], the method of Yoo et al. [J. Bio Chem. 764:17078 (1989)], or other well known methods can be used for such synthesis. The resulting oligonucleotides can be inserted into an appropriate vector and expressed in a compatible host organism. Alternatively, standard molecular biology techniques can be used to permit engineering of an appropriate gene for efficient expression, including tandemly repeated segments having convenient protease sites for later cleavage and processing.

The polypeptides can be purified using HPLC, gel filtration, ion exchange and partition chromatography, countercurrent distribution or other known methods.

The present invention also encompasses polypeptide analogs and mimetics, as well as other polypeptides comprising amino acid sequences which differ slightly from the sequence defined by SEQ ID NO: 3. Such other polypeptides are a part of this invention if they (a) have an amino acid sequence that is substantially identical to the sequence defined by SEQ ID NO: 3 and (b) have the ability to inhibit one or more of the biological activities of IL-4.

Substantial identity of amino acid sequences means that the sequences are identical or differ by one or more amino acid alterations (deletions, additions, substitutions) that do not substantially impair inhibitory activity. For example, polypeptide antagonists produced in prokaryotic expression systems may also contain an additional N-terminal methionine residue, as is well known in the art. Any polypeptide antagonist meeting the substantial identity requirement is included, whether post-translationally modified, e.g., glycosylated, or not.

Polypeptides, polypeptide mimetics or analogs used in this invention should preferably produce at least about 50% inhibition of one of the biological activities of IL-4 in cells bearing IL-4 receptors. More preferably, the degree of inhibition will be at least about 70% and, most preferably, at least about 90%.

The IL-4 antagonists of this invention also include antibodies or fragments thereof which may interact with the defined critical region. The use and generation of fragments of antibodies is well known, e.g., Fab fragments [Tijssen, Practice and Theory of Enzyme Immunoassays (Elsevier, Amsterdam, 1985)], Fv fragments [Hochman et al., Biochemistry 12 : 1 130 (1973); Sharon et al., Biochemistry 15: 1591 (1976); Ehrlich et al., U.S. Patent No. 4,355,023] and antibody half molecules (Auditore-Hargreaves, U.S. Patent No. 4,470,925).

Hybridomas and monoclonal antibodies can be produced by standard methods [Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976)], using one of the defined polypeptide antagonists as the antigen. Preferably, the immunogenicity of the polypeptides is increased by combination with an adjuvant and/or by conversion to a larger form prior to immunization of a suitable host animal.

A wide variety of suitable adjuvants is well known in the art. The immunogenicity of the polypeptides can also be enhanced by using standard methods to cross-link the polypeptides or to couple them to an immunogenic carrier molecule such as keyhole limpet hemocyanin or a mammalian serum protein such as human or bovine gammaglobulin, or humarf, bovine or rabbit serum albumin. Preferably, but not necessarily, the protein carrier will be foreign to the host animal in which antibodies against the polypeptides are to be elicited.

Once a hybridoma producing the desired monoclonal antibody is obtained, the above-mentioned antibody fragments can be made.

Alternatively, DNA encoding the antibody can be cloned and sequenced, and techniques can be used to produce interspecific monoclonal antibodies wherein the binding region of one species is combined with a non-binding region of the antibody of another species [Liu et al., Proc. Natl. Acad. Sci. USA 84:3439 (1987)]. For example, the CDRs from a rodent monoclonal antibody can be grafted onto a human antibody, thereby "humanizing" the rodent antibody [Riechmann et al., Nature 332:323 (1988)]. More particularly, the CDRs can be grafted into a human antibody variable region with or without human constant regions. Such methodology has been used, e.g., to humanize a mouse monoclonal antibody against the p55 (Tac) subunit of the human interleukin-2 receptor [Queen et al., Proc. Natl. Acad. Sci. USA 56: 10029 (1989)]. Fragments of such humanized antibodies can also be made.

Once the CDRs of the heavy and light chains of the monoclonal antibody have been identified, such sequence information can be used to design non-peptide mimetic compounds which mimic the functional properties of the antibody. Methods for producing such mimetic compounds have been described, e.g., by Saragovi et al. [Science 253 :192 (1991)]. CDR sequence information can also be used to produce single-chain binding proteins comprising linked CDRs from the light and/or heavy chain variable regions, as described by Bird et al. [Science 242 :423 (1988)], or biosynthetic antibody binding sites (BABS), as described by Huston et al. [Proc. Natl. Acad. Sci. USA 55:5879 (1988)]. Single-domain antibodies comprising isolated heavy-chain variable domains [Ward et al., Nature 341 :544 (1989)] can also be prepared using the sequence information.

Because of their smaller size and more ready uptake by cells, the antibody-based IL-4 antagonists used in this invention are preferably antibody fragments, BABS, mimetic compounds or single-domain antibodies. The use of humanized antibody sequences is also preferred.

Pharmaceutical compositions can be prepared using the IL-4 antagonists of the present invention. Such compositions, which can be used to treat IL-4-related diseases, can be prepared by admixing an effective amount of one or more of the antagonists and a physiologically acceptable carrier.

Useful pharmaceutical carriers can be any compatible, non-toxic substance suitable for delivering the compositions of the invention to a patient. Sterile water, alcohol, fats, waxes, and inert solids may be included in a carrier. Pharmaceutically acceptable adjuvants (buffering agents, dispersing agents) may also be incorporated into the pharmaceutical composition. Generally, compositions useful for parenteral administration of such drugs are well known; e.g. Remington's Pharmaceutical Science, 15th Ed. (Mack

Publishing Company, Easton, PA, 1980). Single-dose packaging will often be preferred, e.g., in sterile form.

Alternatively, compositions of the invention may be introduced into a patient's body by implantable drug delivery systems [Urquhart et al., Ann. Rev. Pharmacol.

Toxicol. 24:199 (1984)]. Such carriers are well known to those skilled in the art.

Because the IL-4 antagonists must be taken up by the target cells, it may be desirable to incorporate the antagonists into vehicles that can facilitate such uptake. For example, the antagonists can be incorporated into liposomes. The polypeptide antagonists can also be delivered by standard gene therapy techniques, includir-z, e.g., direct DNA injection into tissues, the use of recombinant viral vectors and implantation of transfected cells. See, e.g., Rosenberg, J. Clin. Oncol. 20:180-199 (1992).

Determination of the appropriate dosage of an antagonist of the invention for a particular situation is within the skill of the art. Generally, treatment is initiated with smaller dosages that are less than optimum. Thereafter, the dosage is increased by small increments until the optimum effect under the circumstances is reached. For convenience, the total daily dosage may be divided and administered in portions during the day if desired.

The amount and frequency of administration of the antagonists and the pharmaceutically acceptable salts thereof will be regulated according to the judgment of the attending clinician, taking into account such factors as age, condition and size of the patient and severity of the symptom(s) being treated .

EXAMPLE

The present invention can be illustrated by the following, non-limiting example. Unless otherwise specified, percentages given below for solids in solid mixtures, liquids in liquids, and solids in liquids are on a wt/wt, vol/vol and wt/vol basis, respectively.

General Approach

DNA mutation analyses were used to identify the critical signal transduction region of the cytoplasmic domain of the human IL-4 receptor. Consistent with previous reports using murine CTLL cells [Idzerda et al., J. Exp. Med. 277 : 861 (1990)], the full-length human IL-4 receptor was shown to be capable of growth signal transduction when stably transfected into the murine pro-B cell line, Ba/F3. By systematically deleting discrete regions of the intracellular domain of the IL-4 receptor, a short segment encoding 41 amino acid residues was identified which is critical for signal transduction in this system. These results also demonstrate that high affinity binding to IL-4 can still be observed on stable transfectants expressing a mutant IL-4 receptor cDNA which is not capable of growth signal transduction, and that such cells are capable of internalizing IL-4.

Materials and Methods

Cell Culture

Ba/F3 cells (kindly provided by Dr. Mary Collins, IRC-Chester Beatty Laboratories, London) were maintained in RPMI1640 medium supplemented with 10% fetal calf serum (FCS), 10 mM HEPES (pH 7.4), 50 μg/ml streptomycin and 50 U/ml penicillin, and silk worm-derived recombinant mouse IL-3 (100 U/ml) [Miyajima et al., Gene 55:273 (1987)]. A unit of IL-3 was defined as the amount of protein per milliliter that produced 50% saturating activity in the MC/9 assay [Yokota et al, Proc. Natl. Acad. Sci. USA 52 :1070 (1984)]. Stable transfectants of Ba/F3 cells were cultured in the same medium supplemented with 400 μg/ml G418.

Plasmid Construction

The n eo -resistant gene was introduced into a mammalian expression vector, pME18S, containing the human IL-4 receptor cDNA [Galizzi et al, Int. Immunol 2:669 (1990)]. Vector pME18SneøIL-4R-N was constructed by cutting pME18SneσIL-4 with Nhel and NotI, and filling in with Klenow fragment followed by ligation. For the construction of pME18SneoIL-4R-M2, a 1.65 kilobase MscI-EcoRI fragment of human IL-4R was prepared by EcoRI digestion and partial MscI cleavage and inserted into the EcoRI and NotI sites of pME18Sneø vector in which the NotI end was filled in with klenow fragment.

For the construction of pME18SneoIL-4R-Ml, a 1.15 kilobase MscI-EcoRI fragment of human IL-4 receptor cDNA was ligated into pME18Sneø vector as described above. pME18SneσIL-4R-P was constructed by inserting a 1.4 kilobase Plel (filled in)-EcoRI fragment of human IL-4 receptor cDNA into the EcoRI and NotI (filled in) sites ofpMEI8Sneσ as described above. ρME18SIL-4R-S was constructed by inserting a 0.9 kilobase Sau3AI (filled in)-EcoRI fragment of human IL-4 receptor cDNA into EcoRI and NotI (filled in) sites of pME18Sneø vector as described above. To construct internal deletion mutants of human L-R, unique EcoRV and Sspl restriction sites were generated using an in vitro mutagenesis kit (Promega). Briefly, the EcoRI-Xbal-digested human IL-4 receptor cDNA was inserted into the pSELECT vector, and single-stranded template was isolated. Annealing of the mutagenic oligonucleotides and second-strand synthesis was performed according to the manual provided. The following oligonucleotides were synthesized on an Applied Biosynthesis 380A DNA synthesizer:

EcoRV, AGAGCAGCAGGGATATCTTCCAGGAGGGAA,

Sspl, CATGGGGGAGTCAAATATTCTTCCACCTTC, and used to construct two mutant cDNAs; pSELECTIL-4R-E contained an EcoRV site and pSELECT!L-4R-ES contained an EcoRI site and a Sspl site. pME18S/zeøIL-4R-lDl was constructed by isolating EcoRI-MscI fragment and the

EcoRV-Xbal fragment from ρSELECTIL-4R-E and inserting into the the EcoRI-Xbal-cleaved pMEl SSneo vector. pME18SneoIL- 4R-ID2 was constructed by isolating the EcoRI-EcoRV fragment and the Sspl-Xbal fragment from pSELECTIL-4R-ES and inserting them into the EcoRI-Xbal cleaved pMEl&Sneo vector as described above. The mutant cDNAs were sequenced by the dideoxy sequencing method to confirm the introduced mutation.

Transfection

Plasmid DNAs were transfected into Ba/F3 cells by the electroporation method. Briefly, ten million cells growing exponentially were harvested, washed twice with PBS and resuspended in PBS (1 x 10^ cells/ml). One hundred micrograms of cDNA linearized with Kpnl and 400 μg of tRNA were added to 0.8 ml of cell suspension and kept on ice for 15 minutes. Electroporation was carried out at 960 μF and 400 V using a Gene pulser (Bio-Rad). After an electric pulse was applied, cells were kept on ice for 10 minutes, and cultured with Ba/F3 culture medium as described above. After 2 days culture, transfectants were selected in 1.5 mg/ml G418. Stable transfectants were maintained in 400 μg/ml G418.

Binding Assays

Radiolabeling of E. •. '/-derived human IL-4 and binding assays were carried out as previously described [Galizzi et al, Int. Immunol 2:669 (1990)]. Briefly, exponentially growing cells were harvested, washed twice with binding medium (RPMI 1640 containing 2% BSA, 20 mM HEPES, pH 7.4, and 0.5% NaN3), and resuspended in binding medium. Aliquots of cells were incubated with various concentrations of 12^I-IL-4 in 200 μl of binding medium for 3 hr at 4°C. Free and cell-bound 125I-IL-4 were separated by centrifugation through an oil gradient as described previously [Lowenthal et al, J. Immunol. 140:456 (1988)]. Nonspecific binding was measured using a 150-fold molar excess of unlabeled IL-4. Binding data were analyzed with the LIGAND program.

125Γ.IL-4 Cross-linking

Cells (1 x K) ) were incubated with 150 pM of 125l-IL-4 in binding medium for 2 hr at 4°C. Cells were then washed twice with RPMI 1640 containing 50 mM HEPES (pH 7.4), resuspended with 1 ml of PBS containing 50 mM HEPES (pH 8.0), and bis-(sulfosuccinimidyl) suberate (BS³,

Pierce) to a final concentration of 0.2 mM. After 30 minutes at 4°C, the reaction was stopped by the addition of 50 μl of 1 M TrisHCl (pH 8.0), and lysed with 100 μl of 1% Triton X-100 containing 140 mM NaCl, 50 mM HEPES (pH 7.4), 2 mM phenylmethyl-sulfonyl fluoride, 1 μM Pepstatin A, 1 mM iodoacetamide, 1 mM 1,10-o-phenanthroline, and 5 mM EDTA for 30 minutes at 4°C. Cell lysates were then centrifuged at 12,000 x g for 15 minutes, and the supenatants were analyzed by SDS-PAGE as previously described [Galizzi et al, Int. Immunol. 2:669 (1990)].

Proliferation Assays

Proliferation assays were performed by incubating cells (1 x 10⁵) in microtiter plates at 37°C in 100 μl of RPMI 1640 supplemented with 10% FCS with various concentrations of recombinant human 1L-4 or murine IL-4. To test the specificity of these responses, some experiments included the addition of monoclonal antibodies which specifically blocked human IL-4 (provided from Dr. John Abrams in DNAX Research Institute) added at a final concentration of 100 μg/ml. After 42 hr incubation, 10 μl of a 5 mg/ml solution of 3- {4,5-dimethythiazol-2-yl } -2,5-diphenyltetrazolium bromide-tetrazolium (MTT) were added to each well followed by a further incubation at 37 °C for 6 hr. The optical density was measured as previously described [Lowenthal et al , J. Immunol. 140:456 (1988)].

IL-4 Internalization

IL-4 internalization was measured as described previously [Galizzi et al, J. Biol. Chem. 264:6984 (1989)] with slight modifications. Ba/F3 transfectants (1 x 10? cells/ml) were initially incubated for 5 minutes at 37°C in RPMI 1640 medium containing 2% BSA, 20 mM HEPES (pH 7.4), and 100 μM chloroquine to prevent subsequent degradation of internalized IL-4. Cells were then incubated at 4°C with 150 pM ! 25l-IL-4. After 3 hr incubation, cells were washed twice with ice-cold medium and resuspended at 4 x 10 cells/ml in prewarmed (37°C) medium. At various times, two aliquots (50 μl) of the cell suspension were removed. One aliquot was adjusted to pH 3.2 for 10 minutes by the addition of 150 μl of 0J M glycine-HCl, 0.15 M NaCl buffer (pH 2.7). The ceiis were then centrifuged through an oil layer. The radioactivity levels in both the cell pellet and in the supernatant above the oil layer were measured to determine the amount of acid-resistant (i.e., internalized) IL-4 and the amount of acid-sensitive (i.e., cell surface-bound and dissociated) IL-4, respectively. The other aliquot was immediately centrifuged through the oil layer, and the radioactivity in the supernatant was measured to determine the level of dissociated IL-4. The level of cell surface-bound IL-4 was calculated by subtracting the level of dissociated IL-4 from the level of cell surface-bound and dissociated IL-4.

Results

Expression of Functional Human IL-4 Receptors on a Murine Pro-B Cell Line.

Idzerda et al. [J. Exp. Med. 777:861 (1990)] have shown that expression of the cloned human IL-4 receptor cDNA in the murine T cell line CTLL conferred responsiveness to human IL-4. An IL-3 dependent murine proB cell line, Ba/F3, was selected as a recipient cell for human IL-4 receptor transfections, since Ba/F3 cells proliferate in response to murine E -4 as measured by the MTT method, grow very rapidly, and incorporate exogenous DNA efficiently.

Ba/F3 cells were transfected by electroporation with an expression plasmid, pME18SneohIL-4R containing the G418 resistance gene, and stable transfectants were subsequently selected with G418. Several clones were examined for responsiveness to human-IL-4. It was found that whereas the original Ba/F3 cells responded only to murine IL-4, several stable transfectants responded in a dose-dependent manner to both human and murine IL-4. Anti-human IL-4 antibody blocked the effect of human IL-4 on Ba/F3 stable transfectants, but had no effect on murine IL-4-induced Ba/F3 growth.

Binding of ^{1 2}5l labeled ' uman IL-4 (125l-hIL-4) to the human IL-4 receptor expressed on stable transfectants was examined by Scatchard analysis. On the parental cells, no significant binding of ^•* 25l-hIL-4 was observed. However, the stable transfectant, F-2, expressed 180 human 1L-4 receptors/cell with a dissociation constant for human 1L-4 of 23 pM, a binding affinity which was consistent with values previously reported for native human IL-4 receptors [Galizzi et al, J. Biol. Chem. 264:6984 (1989)].

A second clone, F-4, expressed 140 human

IL4 receptors/cell with a dissociation constant of 25 pM. Collectively, these results demonstrated that the human IL-4 receptor could be expressed on the cell surface of murine Ba/F3 cells, and that this receptor was functional in terms of its ability to transduce a biological response to human 1L-4.

Expression and Function of Human lL-4 Receptor Terminal Deletion Mutants

To dissect the region of the cytoplasmic domain responsible for transducing the above human IL-4-mediated biological response, a series of human IL-4 receptor cDNAs was constructed which were deleted in various regions of the cytoplasmic domain, and these mutants were introduced into the expression vector, pME18S«eø. While the full length human IL-4 receptor cDNA has 569 amino acid residues in the cytoplasmic domain, the five deletion mutants, designated

N-, M-2-, P-, M-1-, and S-mutants, had 374, 266, 176, 99, and 8 amino acid residues in the cytoplasmic domain, respectively. These mutant cDNAs were then transfected into Ba/F3 cells, and several neomycin resistant stable transfectants were characterized.

It was found that the Ba/F3 transfectants which expressed the N-mutant and M-2-mutant cDNAs proliferated in response to human IL-4, whereas transfectants with the shorter M-l -mutant and S-mutant cDNAs failed to respond to human IL-4. The response of Ba/F3 transfectants expressing the P-mutant cDNA to human IL-4 was lower than that of the N- or M-2-mutants, although still significantly above background. These results suggested that the critical region of the cytoplasmic domain of the human IL-4 receptor for growth signal transduction in pro B cells was located between the Sau3Al site (S-) and the Plel site (P-), and probably close to the Plel site.

This conclusion was dependent on all five deletion mutants expressing significant numbers of high affinity binding sites for human IL-4. To test this, human IL-4 receptor expression level was analyzed on each of the deletion mutant stable transfectants by both binding assay and affinity cross-linking using 12-5l-hIL-4. Equilibrium binding studies showed that all transfectants expressed high affinity binding sites for human IL-4, as can be seen in Table 1.

Table 1 Expression of Human IL-4 Receptors on Ba/F3 Cells Transfected with Truncated Human IL-4R Plasmids

Kd(pM)

23

19

1 13 20

21 59

39

41

34 24

22 65

The dissociation constants of human IL-4 receptors expressed by the mutant transfectants were consistent with the values on transfectants expressing the full length human IL-4 receptor cDNA, indicating that the cytoplasmic domain of the IL-4 receptor is not essential for high affinity IL-4 binding.

In chemical cross-linking experiments, an appropriate complex of truncated human 1L-4 receptor and -* 25l-hIL-4 was detectable on each of the transfectants. Cross-linking of ^{1 25}I-hIL-4 to the intact human IL-4 receptor showed a 130 kilodalton band which could not be distinguished from the cross-linking band expressed on a human hemopoietic cell line, TF1 cells. The five mutant cDNAs, N-, M-2-, P-, M-l- and S-, were calculated to encode proteins which were approximately 20, 30, 40, 47 and 57 kilodaltons shorter, respectively, than the intact human IL-4 receptor. Transfectants expressing N- and M-2-mutants displayed human IL4 receptors exhibiting the predicted molecular sizes (110 and 100 kilodaltons, respectively). However, transfectants from P-, M-1-, and S-mutants expressed shorter human IL-4 receptor than the predicted molecular sizes (73, 65 and 55 kilodaltons, respectively).

The size difference (approximately 18 kilodaltons) between the predicted molecular weight and observed molecular weight in these three mutant human IL-4 receptors may be due to glycosylation within the cytoplasmic domain. Indeed, there is one potential N-glycosylation site located between the P- and M-2- restriction sites. Interestingly, two additional cross -linking bands (70 and 80 kilodaltons) were also observed which had been reported previously [Galizzi et al, J. Biol Chem. 265:439 (1990)]. These two bands appeared at constant molecular weight in all the mutant human IL-4 receptors, suggesting that they are more likely to be unaltered proteins which associate with the IL-4 receptor rather than degradation products of the full-length receptor as originally predicted.

Expression and Function of Human IL-4 Receptor Internal Deletion Mutants

The above results suggested that the critical signal transducing region of the IL-4 receptor for IL-4-induced growth in pro B cells was located between the P- and M-l- sites of the cytoplasmic domain of this receptor. To further define this region, two internal deletion mutant cDNAs were constructed. Mutant ID-1 lacked all residues between amino acids 433 and 473, and ID-2 lacked all residues between amino acids 394 and 432 from the carboxyl terminus. Several stable Ba/F3 transfectants expressing ID-l and ID-2 mutant human IL-4 receptor cDNAs were obtained and examined for human IL-4 induced proliferation, -^• -^■■-^•-' I-hIL-4 binding and cross-linking. Further detailed analysis in this manner will allow more precise definition of the boundaries of the critical segments.

A number of transfectants expressing 1D-2 cDNA were 'able to respond to hlL-4, while transfectants expressing ID-l cDNA failed to respond to human 1L-4. Scatchard analysis revealed that transfectants expressing ID-l and ID-2 mutant cDNAs exhibited comparable numbers of human IL-4 binding sites per cell. The results of this analysis are shown in Table 2.

Table 2 Expression of Human IL-4 Receptors on Ba/F3 Cells Transfected Internally Deleted Human IL-4R Plasmids

Cells Receptor Numbers Kd(pM)

(sites/cell)

66 61

27 20 The results of chemical cross-linking studies showed that transfectants with ID-l and ID -2 mutant human IL-4 receptor cDNAs both expressed truncated human IL-4 receptors. This indicated that the critical region of the human IL-4 receptor for growth signal transduction in pro B cells is located between amino acids 433 and 473 from the carboxyl terminus. This region is moderately conserved between murine and human IL-4 receptors.

Ligand Internalization by Mutant Human 1L-4 Receptors

Previous studies showed that human IL-4 is internalized after binding to the human IL-4 receptor [Galizzi et al, J. Biol Chem. 264:6984 (1989)]. To evaluate the relationship between ligand internalization and growth signal transduction, ligand internalization was analyzed in each of the mutant Ba/F3 transfectants described above. As a result of these analyses, it was found that each of the above transfectants expressing mutant human IL-4 receptor cDNAs, including those incapable of growth signal transduction, was able to internalize ¹²⁵I-hIL-4, reaching plateau internalization at approximately 10 minutes. These results indicated that ligand internalization does not correlate with growth signal transduction and, indeed, that the cytoplasmic domain of the human IL-4 receptor is not required for ligand internalization.

Polypeptide Antagonists of IL-4

As has been explained above, there is a critical region of the human IL-4 receptor cytoplasmic domain which is essential for growth signal transduction following the binding of IL-4 to the high affinity receptor on the surface of the cell. Surprisingly, it has been found that polypeptides comprising the amino acid sequence of the core of this critical region (defined by SEQ ID NO: 3) are able to enter cells and to inhibit transduction of the proliferation signal of IL-4 bound to cells transfected with wild-type human IL-4 receptor cDNA.

This is shown in Fig. 2, the data of which were produced by carrying out a proliferation assay as described above using Ba/F3 cells transfected with pME18SneohIL-4R. The transfected cells were incubated in the presence of the indicated concentrations of polypeptide 1 (open squares), 2 (filled squares), 3 (open triangles), 4 (filled triangles) and 5 (filled circles), as defined in the legend to Fig. 1 and in SEQ ID NOs: 3 through 7, respectively, of the Sequence Listing.

As can be seen in Fig. 2, polypeptide No. 1 (SEQ ID NO: 3) produced significant inhibition of the stimulation of proliferation by IL-4. Inhibition was complete at the higher concentrations of this polypeptide, which contained the core sequence of the critical receptor region. In the present experiment, the other polypeptides showed essentially no inhibitory activity, although the activities were occasionally variable.

To further demonstrate inhibitory activity by an antagonist of the invention, the effect of varying levels of a synthetic polypeptide having an amino acid sequence defined by SEQ ID NO: 1 (critical region polypeptide) was investigated. This polypeptide contained the core sequence (SEQ ID NO: 3) plus additional C-terminal amino acid residues. The effect of another synthetic polypeptide having an amino acid sequence corresponding to that of the 30 C-terminal residues of the human IL-4 receptor (C-terminal polypeptide) was also investigated. The results are shown in Fig. 3.

Ba/F3 transfectants expressing human IL-4 receptors were stimulated as described above with 10 ng/ml human IL-4 in the presence of either the critical region polypeptide (open squares) or the C-terminal polypeptide (filled triangles), at the indicated concentrations. Ba/F3 transfectants expressing chimeric receptors which had the human IL-4 receptor extracellular domain and the human IL-2 receptor β chain in the cytoplasmic domain and transduced the human IL-2 signal upon IL-4 binding were stimulated with 10 ng/ml human IL-4 in the presence of the critical region polypeptide (filled squares). Ba/F3 transfectants expressing a human IL-2 receptor β chain were stimulated with 10 ng/ml human IL-2 (open triangles), and parental Ba/F3 cells were stimulated with 10 ng/ml mouse IL-3, both in the presence of varying amounts of the critical region polypeptide (filled circles).

All of the cells were incubated for 24 hours. MTT was added during the last 4 hours of the incubation, after which the optical densities (O.D.) were measured. Proliferation rate (%) = (a-b)/(c-b) x 100, where a = O.D. produced by a factor in the presence of a polypeptide, b = O.D. in the presence of medium alone, and c = O.D. produced by a factor in the absence of any polypeptide.

As can be seen in Fig. 3, the critical region polypeptide inhibited proliferation much more than did the C-terminal polypeptide in cells that expressed the human IL-4 receptor and were stimulated by IL-4. The critical region polypeptide had relatively little effect on any of the other cells.

Many modifications and variations of this invention can be made without departing from its spirit and scope, as will become apparent to those skilled in the art. The specific embodiments described herein are offered by way of example only, and the invention is to be limited only by the terms of the appended claims. SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Harada, Nobuyuki

Izuhara, Kenji Miyajima, Atsushi Howard, Maureen

(ii) TITLE OF INVENTION: Antagonists of Human lnterleukin-4

(iii) NUMBER OF SEQUENCES: 7

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: DNAX Research Institute

(B) STREET: 901 California Avenue

(C) CITY: Palo Alto

(D) STATE: California

(E) COUNTRY: USA

(F) ZIP: 94304

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: Apple Macintosh (C) OPERATING SYSTEM: Macintosh 6.0.5

(D) SOFTWARE: Microsoft Word 4.00B

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 07/803,621

(B) FILING DATE: 27-NOV-91

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Ching, Edwin P.

(B) REGISTRATION NUMBER: 34,090

(C) REFERENCE DOCKET NUMBER: DX0245K

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 415-496-1204

(B) TELEFAX: 415-496-1200

(C) TELEX: (2) INFORMATION FOR SEQ ID NO: 1 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 41 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 :

Pro Glu Ser lie Ser Val Val Arg Cys Val Glu Leu Phe Glu Ala Pro 1 5 10 15

Val Glu Cys Glu Glu Glu Glu Glu Val Glu Glu Glu Lys Gly Ser Phe

20 25 30

Cys Ala Ser Pro Glu Ser Ser Arg Asp 35 40

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 44 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Pro Glu Asn Val Ser Val Ser Val Val Arg Cys Met Glu Leu Phe Glu 1 5 10 15

Ala Pro Val Gin Asn Val Glu Glu Glu Glu Asp Glu lie Val Lys Glu 20 25 30 Asp Leu Ser Met Ser Pro Glu Asn Ser Gly Gly Cys 35 40

(2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

Pro Glu Ser lie Ser Val Val Arg Cys Val Glu Leu Phe Glu Ala Pro 1 5 10 15

Val Glu Cys Glu 20

(2) INFORMATION FOR SEQ ID NO: 4:

(0 SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: Val Glu Leu Phe C_ι Ala Pro Val Glu Cys Glu Glu Glu Glu Glu Val 1 5 10 15

Glu Glu Glu Lys 20

(2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

Val Glu Leu Phe Glu Ala Pro Val Glu Cys Glu Glu Glu Glu Glu Val 1 5 10 15 Glu Glu Glu Glu

20

(2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

Glu Glu Glu Val Glu Glu Glu Lys Gly Ser Phe Cys Ala Ser Pro Glu 1 5 10 15

Ser Ser Asp Arg 20

(2) INFORMATION FOR SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: Glu Glu Glu Val Glu Glu Glu Glu Gly Ser Phe Cys Ala Ser Pro Glu 1 5 10 15

Ser Ser Asp Arg 20

Claims

WHAT IS CLAIMED IS:

1. An antagonist of human IL-4 that mimics or comprises an amino acid sequence of a region of the cytoplasmic domain of the human 1L-4 receptor, which region has an amino acid sequence defined by the sequence of SEQ ID NO: l.

2. The antagonist of claim 1 which is a polypeptide that contains from about 20 to about 41 amino acid residues and comprises the amino acid sequence defined by SEQ ID NO: 3.

3. The polypeptide of claim 2 which has an amino acid sequence defined by SEQ ID NO: 1 or SEQ ID NO: 3.

4. A pharmaceutical composition comprising one or more antagonists of human IL-4 that mimic or comprise an amino acid sequence of a region of the cytoplasmic domain of the human IL-4 receptor, which region has an amino acid sequence defined by the sequence of SEQ ID NO: 1, and a pharmaceutically acceptable carrier.

5. The pharmaceutical composition of claim 4 in which the antagonist is a polypeptide that contains from about

20 to about 41 amino acid residues and comprises the amino acid sequence defined by SEQ ID NO: 3.

6. The pharmaceutical composition of claim 5 in which the polypeptide has an amino acid sequence defined by SEQ ID NO: 1 or SEQ ID NO: 3.

7. A method for inhibiting the biological activity of human IL-4 comprising contacting cells bearing receptors for human IL-4 with an antagonist of human IL-4 that mimics or comprises an amino acid sequence of a region of the cytoplasmic domain of the human IL-4 receptor, which region has an amino acid sequence defined by the sequence of SEQ ID NO: 1.

8. The method of claim 7 in which the antagonist is a polypeptide that contains from about 20 to about 41 amino acid residues and comprises the amino acid sequence defined by SEQ ID NO: 3.

9. The method of claim 8 in which the polypeptide has an amino acid sequence defined by SEQ ID NO: 1 or SEQ ID NO: 3.