EP0579597A1 - Nucleic acid probes useful for the detection of mycobacterium tuberculosis - Google Patents

Abstract

A method of detecting the presence of M. tuberculosis in a biological sample is described, which comprises: (a) treating the cells contained in the sample in order to expose cellular nucleic acids; (b) incubating the cellular nucleic acids with a labeled probe specific for M. tuberculosis under conditions and for a period guaranteeing that the hybridization takes place; and (c) detecting the presence of the labeled and hybridized probe specific for M. tuberculosis. A polypeptide derived from M. tuberculosis is also described.

Description

Description

NUCLEIC ACID PROBES USEFUL FOR THE DETECTION OF MYCOBACTERIUM TUBERCULOSIS

Technical Field

The present invention relates generally to the field of medical diagnostics and, more specifically, to DNA sequences suitable for generating polypeptides and DNA or RNA hybridization probes, as well as a method for identifying the presence of M. tuberculosis in a biological sample.

Background of the Invention

Tuberculosis is an infectious disease which has affected humanity since ancient times. The etiological cause of tuberculosis, Mycobacterium tuberculosis, was discovered more than 100 years ago, and since that time substantial research efforts have been made to diagnose and treat this disease. Nevertheless, even today tuberculosis is a problem, especially in developing countries. The World Health Organization has estimated that at least 30 million people are affected by tuberculosis. Additionally, there are about 10 million new cases each year, and a mortality rate of about 3 million per year.

The causative agent of tuberculosis, Mycobacterium tuberculosis, is a slender, straight or slightly bent rod with rounded ends. The bacilli vary in length from 1 to 4μm and in width from 02 to 0.5 μm, are acid-fast, nonmotile, nonsporogenous, and nonencapsulated. Mycobacteria, in general, are characterized by their acid-fastness, which is due to high lipid content and physical integrity of the cell wall. Mycobacteria may be characterized microscopically after staining with acid-fast stains such as Ziehl-Neelsen, Kinyoun or Auramine-O stains. However, a microscopic examination after staining for acid-fast bacilli cannot differentiate between M. tuberculosis and other acid-fast mycobacteria. To overcome this difficulty, and to make an accurate diagnosis of tuberculosis, a sample is normally cultured for about 4 to 6 weeks at 35°C in a 5%-10% CO2 incubator. Thereafter, the cultured sample is subjected to a barrage of biochemical tests, resulting in the differential identification of M. tuberculosis. See Zinsser Microbiology. Joklik et al. (eds.), Appleton-Century-Crafts, N.Y., 1980, p.677.

The time required to identify M. tuberculosis may be reduced with the radiometric determination method of BACTEC (Johnston Laboratories, Inc., Towson, Md.). The BACTEC radiometric blood culture system was adapted for the detection of mycobacteria. Briefly, bacteria other tha* mycobacteria are cleared from the sample with 2% NaOH-N-acetyl-L-cysteine. Samples are then grown on Middlebrook 7H12 medium containing ¹⁴C palmitic acid. At the same time, another aliquot of the clinical sample is inoculated in a BACTEC bottle containing NAP -nitro-o-acetylamino-^-hydrojg ropiophenone) which inhibits the growth of M. tuberculosis. The samples are tested twice weekly on a BACTEC 460, which detects the production of ^Cθ2 due to the metabolism of **C palmitic acid, and which also calculates a growth index (GI). When the GI reaches 100, a sample of the vial content is stained with Auramine-O to confirm the presence of acid-fast bacilli. Thus, presence of M. tuberculosis may be confirmed using the BACTEC method based upon the GI, the lack of growth in NAP, and presence of acid-fast bacilli. Although faster than conventional culture methods, this method is still disadvantageous because it can take from 3 to 43 days to confirm the presence of M. tuberculosis. Additionally, this method is disadvantageous because it requires the use of dangerous radioactive isotopes in clinical laboratories, which are generally not properly equipped to handle such isotopes.

Another more recent diagnostic method for M. tuberculosis is available from Gen-Probe, San Diego, California. This method provides a probe which is an ¹²^I labeled oligonucleotide made from the sequence of a gene that encodes M. tuberculosis ribosomal RNA Samples are prepared by removing the colonies to be tested from 4-week old cultures, and sonicating them to break open the cells. The radiolabeled probe is added, followed by successive washes to remove unbound probe. Confirmation of M. tuberculosis is based upon the presence of bound probes, which may be detected due to their radiolabeling. One disadvantage of this test is that a laboratory culture must first be obtained from a biological sample, which may take as long as 4 weeks. A second disadvantage is the use of radioactive iodine in a clinical laboratory. The present invention provides a rapid test which identifies the presence of M. tuberculosis in a either a laboratory culture or clinical sample, without requiring the use of radioactive isotopes. In addition, other related advantages are provided.

Sumipary of the Invention

Briefly stated, the present invention provides a labeled probe comprising at least a portion of the nucleotide sequence of Figure 2 from nucleic acid number 1 to nucleic acid number 323, the probe being capable of specifically hybridizing to nucleic acids from M. tuberculosis. For purposes of the present invention, a portion of a nucleotide sequence includes at least 14 nucleotides. Within one embodiment of this invention, the labeled probe is selected from the group consisting of ³²P-dCIP, biotin-dATP, and digoxigenin-dUTP.

Within another aspect of the present invention, a method for detecting the presence of M. tuberculosis in a biological sample is provided, comprising the steps of: (a) treating cells contained within the biological sample to expose cellular nucleic acids; (b) incubating the cellular nucleic acids with a labeled M. tuberculosis specific probe comprising at least a portion of the nucleotide sequence of Figure 2 from nucleic acid number 1 to nucleic acid number 323, under conditions and for a time sufficient for hybridization to occur; and (c) detecting the presence of the hybridized, labeled M. tuberculosis specific probe. Within another aspect of the present invention, a method for detecting the presence of M. tuberculosis in a biological sample is provided, comprising the steps of: (a) treating cells contained within the biological sample to expose cellular nucleic acids; (b) amplifying a selected cellular nucleic acid sequence; (c) incubating the amplified cellular nucleic acid sequence with a labeled M. tuberculosis specific probe comprising at least a portion of the nucleotide sequence of Figure 2 from nucleic acid number 1 to nucleic acid number 323, under conditions and for a time sufficient for hybridization to occur; and (c) detecting the presence of the hybridized, labeled M. tuberculosis specific probe. Within an embodiment of either of the above two methods, the cells contained within the biological sample are immobilized onto a solid support which is preferably prehybridized.

Within another aspect of the present invention, a labeled probe is provided comprising at least a portion of the nucleotide sequence of Figure 1 from nucleic acid number 1 to nucleic acid number 959, the probe being capable of specifically hybridizing to nucleic acids from M. tuberculosis. This probe may be utilized within various aspects of the present invention as described above.

These and other aspects of the present invention will become evident upon reference to following detailed description and attached drawings.

Brief Description of the Drawings

Figure 1 illustrates the nucleotide sequence of the 959 base pair insert from clone ASK-58. Figure 2 illustrates the nucleotide sequence of the 323 base pair insert from clone ASK-58-4.

Detailed Description of the Invention DNA sequences suitable for generating polypeptides and DNA or

RNA hybridization probes, as well as a method for the rapid detection of as few as two M. tuberc losis organisms within a biological sample are provided. Within the context of the present invention, organisms in the M. tuberculosis complex (including M. mi ro . M. afncanum, M. bovis, and M. bovis BCG) which are approximately 100% homologous to M. tuberculosis may also be detected. Additionally, within the context of the present invention, biological samples include cell cultures and clinical samples including, among others, biological fluids such as sputum, urine, gastric fluid, cerebrospinal fluid, surgically excised tissues, and histological tissue sections. Through the efforts of the present invention, the DNA sequences were chosen from sequences unique to M. tuberculosis. In order to obtain these DNA sequences, DNA is first purified from M. tuberculosis cultures. M. tuberculosis is available in culture from many sources, including, among others, the American Type Culture Collection (ATCC), Rockville, Maryland, U.S . M. tuberculosis may be cultured in any media known in the art capable of growing mycobacteria, including egg-potato based medias (e.g., Lowenstein-Jensen), or agar based medias (e.g., Middlebrook 7H-10). These medias are available from PML Microbiologicals, Tualatin, Oregon. The culture should be grown in an atmosphere of about 5%-10% CO2. Particularly preferred conditions for growing M. tuberculosis include growth in Middlebrook 7H-9 broth supplemented with oleic acid, albumin, dextrose, and catalase (OADC, Difco, Gaithersburg, Md.), incubation in an atmosphere of about 5% CO2, and a temperature of about 37°C. Due to its very slow growth rate, between 3 and 6 weeks are required to grow a culture of M. tuberculosis. The mycobacteria are then removed from culture, and treated so as to liberate DNA. If the mycobacteria are grown in broth, cycloserine is added 24 hours before harvesting. The culture is heat inactivated and then centrifuged to pellet the mycobacteria. In order to release the DNA, the cells are resuspended and lysed by any of a number of methods well known to those of skill in the art (see Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory Press, pp. 1.34-1.39, 1989). Particularly preferred is the use of sodium dodecyl sulfate (SDS) and lysozyme to lyse the bacteria, followed by phenol extraction, ethanol precipitation, and treatment with TI RNase and RNase A in order to purify the DNA.

The mycobacterial DNA is then fractionated. Particularly preferred is the use of restriction enzymes well known in the art which are capable of digesting the DNA, for example, Eco RI. Once the mycobacterial DNA has been digested, DNA fractions of the appropriate size may be selected through the use of agarose gel electrophoresis followed by electroelution. It is preferred that the mycobacterial DNA fractions be about 200 to 4,000 b.p. in length, and more ideally, between about 500 and 3,000 b.p. in length. The same restriction enzymes used to digest mycobacterial DNA are also used to digest plasmid DNA, thus allowing insertion and ligation of the mycobacterial DNA into the plasmid through the use of cohesive termini. The digested plasmid and mycobacterial DNA fractions of the appropriate size may then be ligated with T4 ligase, and transfected into E. coli using procedures well known in the art Any of the plasmids well known in the art may be used as a vector for the M. tuberculosis digests, although plasmid pT7T3 18U (Pharmacia LKB Biotechnology Inc., Piscataway, N J.) is particularly preferred. This plasmid has ampicillin resistance and .-galactosidase genes, T3 and T7 transcriptional promoters, and sequences for the universal and reverse primers which allow double stranded DNA sequencing. Additionally, this plasmid has the polycloning site of bactenophage M13 and the Fl origin, which allows the production of sequenceable single stranded DNA from the plasmid. Transfection of E coli with this plasmid results in colonies which can grow on media containing ampicillin. Additionally, transfected E. coli which contain plasmids with DNA inserts may be identified by the formation of white colonies on two times yeast tryptone media (2YT) with IPTG and BlueGal. Insertion of a foreign DNA fragment into the polycloning site of the plasmid results in white colonies on 2YT plates due to the production of an amino- terminal fragment that is not capable of α-complementation (see Sambrook et al., supra at pp. 1.85-1.86). Colonies which contain plasmids with appropriate inserts may then be screened using conventional techniques. Particularly preferred is the use of hybridization via methods which are well known in the art (see, for example, Sambrook et al., supra at pp. 1.90-1.104). Briefly, white colonies are replica plated and screened for positives with ^2 labeled nick translated M. tuberculosis DNA, and for negatives with ^2p labeled nick translated DNA from mycobacteria other than tuberculosis (MOTT), including M. avium-mtracellulare, M. kansasu, M. scrofulaceum, M. chelonae and M. marinium. The mycobacteria other than tuberculosis may be grown using media well known in the art, and the DNA purified using methods as described above for M tuberculosis.

Isolation of plasmids from colonies which hybridize to

M. tuberculosis and not to other mycobacteria may then be accomplished in order to ascertain the size of the insert and to ensure its specificity. Particularly preferred is the miniprep alkali method (see Sambrook, supra at pp. 125 to 1.28).

Briefly, the plasmids are digested with the same restriction enzyme as used for insertion, and run on a gel so that the insert size can be determined. The DNA may be transferred to nylon membranes using the transfer alkali method in a VacuGene¹" apparatus (LKB-Phaπnacia, Bromma, Sweden). The DNA insert which is bound to the nylon membrane is then tested for hybridization to labeled

M. tuberculosis DNA and mycobacteria other than tuberculosis (MOTT). An insert which hybridizes to M. tuberculosis DNA and not to MOTT may be used to develop DNA sequences suitable for hybridization probes. Additionally, as discussed below, open reading frames of the DNA sequence may be used to generate polypeptides.

In order to further confirm specificity, the insert containing clone may be further characterized. Briefly, M. tuberculosis and MOTT DNA is digested with the same restriction enzyme as used above, preferably Eco RI. Thereafter, the digested mycobacterial DNA is analyzed by agarose gel electrophoresis. The DNA is then transferred from the gel to a nylon membrane and is tested for hybridization with the radiolabeled insert

Positive clones may then be grown on a larger scale, in order to prepare large quantities of the plasmid. Methods for preparing large scale preparations of plasmid DNA are well known in the art. (See, for example, Sambrook et al., supra at pp. 133-1.39.) Briefly, the E. coli is grown using any media capable of supporting the growth of the bacteria. Particularly preferred is Terrific Broth (see Sambrook et al., supra at p. A2, 1989). The cells may then be lysed and the DNA extracted and purified as described above. Retrieval of the insert in the plasmid may then be accomplished.

The plasmid is digested with the same restriction enzyme as was initially used to fractionate and insert the M. tuberculosis DNA into the plasmid. The insert is then isolated from the other plasmidic DNA by agarose gel electrophoresis.

The isolated DNA insert may be further fractionated using a different restriction enzyme, such as Bam HI, and once again selected for its specificity to M. tuberculosis with the above hybridization and cloning methods. Additionally, the specificity of the insert for M tuberculosis may be confirmed as described above.

Once the DNA insert has been isolated it may be sequenced using any of the methods well known in the art. Particularly preferred are the enzymatic method of Sanger et al. ("DNA Sequencing with Chain-Terminating Inhibitors," Proc. Nat'l. Acad. Sci. 24:5463, 1977), and the chemical degradation method of Maxam and Gilbert ("A New Method for Sequencing DNA," Proc. Nat'l. Acad. SεL 24:560, 1977).

The DNA sequence of the insert may be used to: (I) generate polypeptides, or (II) develop hybridization probes and amplification primers suitable for detecting M. tuberculosis DNA or RNA in biological samples,

I. Polypeptide Generation

The DNA sequence of the insert is analyzed for open reading frames. Open reading frames are determined by searching the DNA sequences for initiation codons such as AUG. Sequences following initiation codons may be transcribed and translated by the cell to express a polypeptide. Thus, DNA sequence found within an open reading frame may be used to generate polypeptides, either by synthetically constructing the polypeptides, or, by recombinantly expressing the polypeptide from a host cell. The peptide may then be purified using techniques well known in the art, such as High Pressure Liquid Chromatography (HPLC). The purified polypeptide may be used for several purposes. For example, the polypeptide may be used as a source of antigen to generate monoclonal or polyclonal antibodies by methods well known in the art for use within an Enzyme-Linked Immunosorbant Assay (ELISA). Such an assay may be used to test the serum of individuals for the presence of antibodies against the tuberculosis antigens.

Another application is the use of the purified polypeptide for intradermal injection, in order to test for previous immunological exposure to M. tuberculosis. Within this method, polypeptide is purified and prepared for intradermal administration using techniques well known in the art Similar to the PPD test a rash which develops in the area surrounding the intradermal injection site indicates an immune response to the polypeptide. Thus, a positive response indicates previous immunological exposure to M. tuberculosis. π. Hybridization Probes

DNA sequences derived from M. tuberculosis may also be used to develop primers for amplification, and probes for detecting M. tuberculosis DNA or RNA As noted above, one of ordinary skill in the art can use the DNA sequence of the present invention to construct either RNA or DNA probes capable of specifically hybridizing to nucleic acid sequences from M. tuberculosis. For purposes of the present invention, probes are "capable of specifically hybridizing to M. tuberculosis DNA" if they hybridize under conditions of about 5 to 6 times SSC, and at a temperature of 64°C to 68°C. Particularly preferred conditions are about 6 X SSC (1M Nad) and 65°C.

The probes need not be perfectly complementary to the M. tuberculosis sequence to which they hybridize. As much as about 30% of the probe may be mismatched as compared to M. tuberculosis nucleic acid sequences, and nevertheless allow detection of the presence of M. tuberculosis. If an amplification system such as Qβ replicase or Polymerase Chain Reaction (PCR) is used, the probe may be selected such that it is between the two primers used for amplification. The probe may have as few as about 14 nucleotides, usually about 24 nucleotides, and as many as 323 or more nucleotides. The probe may be chosen from a portion of the nucleotide sequence of Figure 2, from nucleic acid number 1, to nucleic acid number 323, or, alternatively, from a portion of the 959 b.p. insert of Figure 1.

The probes may be constructed and labeled using techniques well known in the art Shorter probes of, for example, 24 bases may be generated synthetically. Longer probes of about 75 to about 283 bases are preferably generated by Qβ replicase or PCR amplification in the presence of the labeled precursors such as ³²P-dCTP, digoxigenin-dUTP or biotin-dATP. Probes of 323 bases or longer may be generated directly by growing a transfected cell, purifying the relevant sequence, and labeling the probe by the random primer method. Probes may be labeled with any detection system known in the art, including, among others, radioactive markers, fluorescent markers, enzymatic markers, and chromogenic markers. Preferred labels include ³²P-dCIP, digoxigenin-dUTP, and biotin-dATP. Digoxigenin-dUTP is particularly preferred because of its sensitivity, and because it allows detection of the target sequences without a radioactive label. Within a preferred embodiment, digoxigenin-dUTP is incorporated into a 24 base oligonucleotide probe through the use of terminal deoxynucleotidyl transferase. The hybridization probe may be used directly to confirm the presence of either M. tuberculosis DNA or RNA in laboratory cell cultures using techniques well known to those of ordinary skill in the art. Briefly, the cells are treated to expose cellular nucleic acids as described above. The cellular nucleic acids are then incubated with a labeled M. tuberculosis specific probe, under conditions and for a time sufficient for hybridization to occur, followed by the detection of the hybridized, labeled, M. tuberculosis specific probe.

In biological samples other than cell cultures, such as sputum, M. tuberculosis is present in only relatively few numbers. Thus, in order to enhance detection, it is preferred that an amplification system be used to increase the quantity of M. tuberculosis DNA or RNA Various methods are known in the art, including: RNA amplification (see Lizardi et al., Bio/Technology &1197- 1202, 1988); and DNA amplification with PCR (see Mullis et al., U.S. Patent No. 4,683,195; Mullis et al., U.S. Patent No.4,683-202; and Mullis et al., U.S. Patent No.4,800,159, which are incorporated herein by reference).

Primers for DNA amplification with Taq polymerase (Polymerase Chain Reaction or "PCR"), should be selected from DNA sequences which are highly specific and form stable duplexes with the target sequence. The primers should also be non-complementary, especially at the 3' end, should not form dimers with themselves or other primers, and should not form secondaiy structures or duplexes with other regions of the DNA In general, primers of about 24 nucleotides in length are preferred, and may be easily synthesized using techniques well known in the art In order to amplify a selected cellular nucleic acid sequence, primers are chosen from both ends of the sequence, preferably from portions of the nucleotide sequence of Figure 2, from nucleic acid number 1 to nucleic acid number 323. However, primers may also be chosen from other sequences within the 959 b.p. fragment of Figure 1.

Once DNA primers and probes have been selected and constructed, biological samples such as sputum or laboratory cultures may be tested for the presence of M. tuberculosis.

Where the biological sample is a clinical sample, such as sputum, the first sample is first submitted to liquefaction, decontamination, concentration, (see Ratnam and March, Journal of Clinical Microbiology. 23_(3):582-585, 1986) and DNA extraction using any of a number of established procedures. Within one method, the concentrated sputum is brought up to a volume of 300 μl with TE buffer, followed by the addition of 300 mg of glass beads 200 microns in diameter (Sigma Chemical Co., St Louis, Mo.). One mg of lysozyme is added and sufficient SDS is added to bring the sample to a final concentration of 1%. The samples are incubated at 37°C for 60 minutes, followed by sonication at 70°C for 15 minutes. The samples are phenol extracted, ethanol precipitated and treated with Tl RNase and RNase A. A second phenol extraction and ethanol precipitation may be performed to ensure purity.

Within a second method, 100 μl of decontaminated and concentrated sputum, 22 μl of TE buffer, and 50 μl of 3.3% lysozyme, are incubated at 95°C for 15 minutes. Next 30 μl of 20% SDS is added and incubated at 65^CC for 15 minutes, followed by the addition of 100 μl of 5M sodium perchlorate and incubation at room temperature for 5 minutes. The sample is then extracted with chloroform/isoamyl alcohol and ethanol precipitated.

Within a third method, the decontaminated and concentrated sputum is suspended in a final concentration of 0.1 M NaOH, 2 M NaCl and 0.5% SDS and incubated at 95 °C for 15 minutes. After phenol extraction, the DNA is ethanol precipitated and redissolved in H2O.

Subsequently, the selected cellular nucleic acid sequence from the purified sample is amplified with the above-described primers using techniques well known in the art Briefly, polymerase chain reaction is based on the use of a DNA polymerase from Thermus aquaticus (Taq polymerase) which is thermostable at 95°C. A DNA sample is denatured at 95°C in order to generate single strand DNA. Specific primers, as described above, are annealed at 37°C- 70°C, depending on the proportion of AT/GC of the primers. The primers are extended at 72°C with Taq polymerase in order to generate the opposite strand to the template. These three steps constitute a cycle. After each cycle, the target DNA is doubled, resulting in at least 10 -fold increase in DNA after 25 cycles.

The amplified sample is then transferred to a solid support such as nylon membrane, and tested with a specific labeled probe as described above, for hybridization. Within one embodiment the samples are transferred to a nylon filter using a Bio-Dot^β apparatus (Bio-Rad, Richmond, Calif.). The filter is then prehybridized for one hour using procedures well known in the art (see Sambrook et al., supra at p. A 1.102), and hybridized overnight with a digoxigenin-dUTP labeled 24 base oligonucleotide probe. After overnight incubation and washing of the filter, positive dot blots may be detected with an alkaline phosphatase conjugated anti-digoxigenin antibody, followed by awash of the filter and addition of a chromogenic substrate such as BOP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium). As an alternative to the above DNA-based PCR amplification/hybridization method, is an RNA based amplification (see Lizardi etal., Bio/Technologv 6:1197-1202, 1988; Kramer et al., Nature 222:401-402, 1989; and Lomeli et al., Clinical Chemistry 25(9):1826-1831, 1989; see also Kramer et al., U.S. Patent No. 4,786,600, which is incorporated herein by reference). RNA amplification is based on the fact that some RNA bacteriophages (specifically, Qβ) replicate through the actions of an RNA-directed RNA polymerase. This polymerase, *Qβ replicase" will replicate sequences which are embedded within its normal template (MDV-1), despite the additional length. Techniques for amplifying a selected cellular nucleic acid sequence using Qβ replicase are well known to one of ordinary skill in the art Briefly, cells within a biological sample are treated to expose cellular nucleic acids. A selected cellular nucleic acid sequence may then be amplified with Qβ replicase. As above, the sequence may be selected either from a portion of the nucleotide sequence of Figure 2, from nucleic acid number 1 to nucleic acid number 323, or from a sequence of the 959 b.p. fragment of Figure 1. A radiolabeled probe may then be used to detect the presence of amplified RNA using methods as described above.

An alternative to the above amplification/hybridization method is the use of nucleic add compositions with scissile linkages as described by Duck et al. (U.S. Patent No.4,876,187) which is incorporated herein by reference. Briefly, a probe is prepared which is complementary to a target nudeotide sequence which is selected from a portion of the nucleic add sequence of Figure 2. In a preferred embodiment the target is DNA and the probe contains labeled DNA on one end, from 1 to 4 RNA nucleotides near the center, and DNA on the other end which is capable of binding to a solid support The probe is then incubated under hybridizing conditions to a sample, allowing the target sequence, if present to bind to the probe. The mixture is then treated with a complex such as endoribonuclease H which deaves the RNA center. If the probe has not hybridized to the target sequence, the labeled DNA will separate from the DNA attached to the solid support Thus, when the solid support is removed from the reaction mixture, the loss of label may be detected.

As will be evident to one of ordinary skill in the art, other amplification strategies which are presently being developed may also be utilized within the context of the present invention (see, for example, Horn et al., Nucleic Adds Research I2(17):6959-6967, 1989; Qyve et al., J. of Bioluminescence & Chem. 4:357-366, 1989; and Urden et al., Clinical Chemistry 2≤(8):1571- 1575, 1989). The following examples are offered by way of illustration, and not by way of limitation.

EXAMPLES

EXAMPLE 1

DETERMINATION OF DNA SEQUENCES OF Mycobacterium tuberculosis SUITABLE FOR USE AS DNA PRIMERS AND DNA PROBES

Cloning of M. tuberculosis DNA

Mycobacterium tuberculosis H37 Rv strain TMC 1 was obtained from the Trudeau Institute, Saranac Lake, New York U.SΛ. The mycobacteria were grown as a stationary culture in Middlebrook 7H9 broth supplemented with

OADC enrichment in batches of 200 ml, in an atmosphere of 5% carbon dioxide at 37°C for about 6 weeks. Cycloserine was added (1 mg/ml), then, 24 hours later, the cultures were heated at 70°C for 15 minutes, and centrifuged at 6000 rpm in a

Sorval SS34 rotor for 10 minutes. The pellet was resuspended in TE buffer and freshly prepared lysozyme (1 mg/ml), and incubated at 37°C for 60 minutes. SDS was added to make the solution 1%, followed by incubation for an additional hour. DNA from the lysed mycobacteria was then phenol extracted twice and ethanol predpitated. The DNA was treated with Tl RNase (1 unit per O.D.) plus

RNase A (100 μg/ml), and incubated for 30 minutes at 37°C. The DNA solution was then made 35 M ammonium acetate and ethanol predpitated. The DNA was predpitated by centrifugation at 15,000 x g, and resuspended in TE buffer to a final concentration of 1 mg/ml.

The purified M. tuberculosis DNA was digested with 10 U/μg Eco RI, and run on a 0.7% agarose gel. Fragments between 200 and 4000 b.p. were electroeluted and purified with Geneclean^1* (Bio 101, La Jolla, Calif.). Plasmid pT7T3 18U (Pharmada) was also digested with Eco RI, dephosphorylated with bacterial alkaline phosphatase, and mixed with total or enriched Eco RI digested M. tuberculosis at a molar ratio of 3:1. The samples were ligated with T4 ligase at 26°C for 4 hours, and transfeded into E coli MN522. The cells were spread onto ampicillin plates with IPTG and BlueGal. White colonies were retrieved and screened for M. tuberculosis inserts. Screening of M. tuberculosis Inserts

About ten thousand recombinants (white colonies) were obtained from the cloning experiments. Three thousand colonies were picked and transferred to nitrocellulose filters for hybridization with total M. tuberculosis DNA labeled with ³²P-dCIP by random primer.

Seven replica plates of the white colonies were prepared on nitrocellulose by using a colony hybridization filter device MV 082/0 (Schleicher & Schuell). The nitrocellulose was prehybridized with 10 X Denharts solution, 6 X SSPE, 1 5% SDS and 50 g/ml salmon testes DNA at 65°C for 3 hours. Mycobacterial DNA was prepared for hybridization from cultures of M. tuberculosis as well as from cultures of mycobacteria other than tuberculosis (MOTT). The MOTT function as negative controls, and include M. avium- intrace ulare, M. kansasii, M. chelonae, M. marinum, M. simiae and M. avium- inraceUulare/M. scrofidaceum (MAIS). DNA was prepared by the above- described purification method, followed by ³²P-dCTP random primer labeling of the DNA Oligonucleotides were separated from the labeled DNA by spun- column chromatography using DNA grade Sephadex G-50 (Phaπnada, Uppsala, Sweden). (See also, Maniatis et al. Molecular Cloning, Coldspring Harbor Laboratory, p.466, 1982). The labeled DNA was denatured to single stranded form by incubation at 100°C for 10 minutes. The labeled DNA was used at a concentration of 10" CPM/ml, and 160 μl were used for each square centimeter of filter. Hybridization was performed in a solution containing 10% dextransulfate, 1 M NaCl, 1% SDS and 100 μg/ml denatured salmon testes DNA at an incubation temperature was 65°C for 16 hours. After hybridization, the filters were washed with 6 X SSPE, 05% SDS for 15 minutes at room temperature; a second wash was performed with 1 X SSPE, 1% SDS at 37°C for 30 minutes; the last wash was performed with 0.1% SSPE, 1% SDS at 65°C for 30 minutes. After the washes, the filters were allowed to dry at room temperature. The filters were then autoradiographed on Kodak X-Omat RP¹" film (Eastman Kodak, Rochester, N.Y.) and two intensifying screens (Dupont Cronex¹", Hi-Plus Dupont, Wilmington, Del.) at -70°C for 24 hours.

Colonies which were positive for M. tuberculosis and negative for MOTT were grown in 2YT media with ampicillin. The plasmids were then isolated using the miniprep alkali method (see Sambrook, supra at pp. 1.25-128), digested with Eco RI and analyzed in a 0.7% agarose gel in order to determine the presence of an insert. The insert was transferred to nylon membrane and hybridized with ³ P-dCTP random primer labeled M. tuberculosis DNA. After hybridization, the probe was removed and the filters were rehybridized with a mixture of M. avium-υttraceuulare andilf. scrofulaceum.

A clonal colony was selected which contains an insert which hybridizes to M. tuberculosis DNA and not to MOTT. The sequence of this clone (ASK 58) was determined, and is set forth in Figure 1. ASK-58 has been deposited with the ATCC under accession number 68197.

In order to investigate the specifidty of the ASK-58, 10 μg of DNA from tuberculosis and MOTT were digested with 10 U/μg Eco RI for 2 hours at 37°C. The samples were loaded in a 0.7% agarose gel and run in TBE buffer at 70 volts. At the end of the electrophoresis, the gel was stained with 05 μg/ml ethidium bromide. The gel was treated with 0-25 N HQ for 4 minutes. The DNA was transferred to nylon membranes (Hybond-N^1*, Amersham) in a Vacugene™ apparatus (LKB-Pharmada, Bromma, Sweden) using 0.4 N NaOH, 15 M NaCl for 45 minutes at a pressure of 50 cm H2O. The membrane was dried at room temperature, and then for 20 minutes at 80°C in a vacuum oven. The membranes were hybridized with the purified insert of the clone, which was labeled with ³²P- dCTP by the random primer method. Only the sample of M. tuberculosis DNA generates a band at the level of the 959 b.p. area; the rest of the MOTT samples were negative.

Preparation Of Shorter Inserts

The ASK-58 done was then grown in 1 liter volume using Terrific broth (Focus 9:2). Cells were lysed by the alkali method, phenol extracted, and ethanol predpitated. The samples were then treated with Tl RNase, pancreatic RNase and 35 M ammonium acetate. The final concentration was adjusted to l μg/ul. The 959 b.p. insert of clone ASK-58 was digested with Bam HI, generating three fragments which were approximately 120, 323 and 460 b.p. in length. Each one of these fragments were labeled with ³²P-dCIP random primer and tested for hybridization against mycobacteria, including: M. tuberculosis, M. avium-intracelhilare and mycobarteria of the group skotochromogen and photochromogen. The 323 b.p. fragment hybridized only with M. tuberculosis.

The 323 b.p. fragment was subcloned in pT7T3 18U in the Eco RI, Bam HI site generating subclone ASK-58-4. DNA purified from M. tuberculosis, as well as from MOTT were digested with Bam HI and Eco RI and electrophoresed in a 0.7% agarose gel. A Southern blot was prepared and hybridized with random primer labeled insert from clone ASK-58-4 (323 b.p.); only M. tuberculosis hybridized generating a single band in the area of the 959 b.p. In order to test the speάfidty of clone ASK-58-4, 216 DNA samples purified from cultures (see Table I) were analyzed by hybridization using the insert of clone ASK-58-4 as probe.

TABLE I

MYCOBACTERIA CULTURES

TOTAL 216

*MAIS * Mycobacteria, avium-intracellulare-scrofulaceum group.

As indicated in Table II below, all 103 samples of M. tuberculosis gave a positive signal, the other 113 samples did not hybridize. Similar results were obtained using either ³²P-dCTP or digoxigenin-dUTP as labeling agent. TABLE II

CORRELATION BETWEEN MYCOBACTERIA CULTURES AND DNA PROBE

Primer and Probe Construction

The DNA sequence of ASK-58-4 (323 b.p.) was determined using the chain termination method and Sequenase^®, version 2.0 (modified T7 DNA polymerase) or with Taq Polyme^ase^1,' (Taq Track¹" sequencing system, Promega

Corp., Madison, Wis.)

Once the DNA sequence of clone ASK-58-4 had been determined, primers suitable for amplification of M. tuberculosis DNA may be synthetically generated. In order to amplify a fragment 283 base pairs in length, primer 1, 5'

CAAGGCTTCAATTCCGGTGATGCC, located at the beginning of the fragment and primer 2, 5' TGGTCCGGTTCATACTCGGGCTGG, located at the end of the fragment were generated. The construction of primer 3, 5'

TCACCGCGATAACCGTGCGCGACG, allows amplification of a fragment from primer 1, to primer 3, 141 base pairs in length. The construction of primer 4,

5' TTCACCGGCTCTCCGCTGAAGGAA, allows amplification of a fragment from primer 1 to primer 4, a total of 76 base pairs.

A 323 b.p. probe was prepared by growing clone ASK-58-4 and purifying the insert on an agarose gel. The insert was eluted off the gel and random primer labeled with digoxigenin-dUTP. A 24 base oligonucleotide probe

(corresponding to the sequence of primer 4 above) was prepared by synthetically constructing the probe, followed by labeling with digoxigenin-dUTP through the use of terminal deoxynucleotidyl transferase.

EXAMPLE 2

A Analysis Of Biological Samples with a 323 Base Pair Probe

Sputum samples from patients suspected of having tuberculosis were obtained and submitted to liquefaction, decontamination and concentration using established procedures. Briefly, the sputum sample was decontaminated and concentrated, according to the method of Ratnam et al., Journal of Clinical Microbiology 22: 582-585, 1986, followed by heat inactivation at 95°C for 10 minutes. Next 100 μl of the treated sputum, 220 μl of TE buffer, and 50 μl of 33% lysozyme were transferred to an Eppendorf tube and incubated at 65°C for 15 minutes. Thirty microlitςrs of 20% SDS were then added, and incubated at 65°C for 15 minutes, followed by the addition of 100 μl of 5M sodium perchlorate and incubation at room temperature for 5 minutes. The sample was then extracted with chloroform/isoamyl alcohol and ethanol predpitated, and resuspended in 25 μl of TE buffer. Polymerase chain reaction (PCR) was performed in a volume of

100 μl with 200 mM of dATP, dCIP, dTTP and dGTP, 2 μM MgCl, 1 μM each of primer 1 and 2 as described above, and 25 U of Taq Polymerase¹'¹. The reaction was covered with 100 μl of mineral oil, and denatured at 95°C for 7 minutes. The primers were annealed at 70°C for 1-5 minutes. The extension reaction was done at 72°C for 1 minute. Twenty-five cycles were completed in a Perkin-Elmer thermocyder.

Ten percent of the PCR product was analyzed in a 2% agarose gel. The gel was stained with ethidium bromide in order to confirm the presence of a band of about 283 b.p. The remainder of the PCR product was brought to 0.2 N with the addition of NaOH, and incubated at room temperature for 10 minutes. The sample was then transferred to nylon membrane in a Bio-Dot^β apparatus, and prehybridized for one hour. A 323 base pair probe was then prepared as described above, and labeled with digoxigenin-dUTP through the use of terminal deoxynucleotidyl transferase. The probe was allowed to hybridize overnight at 65°C. The filters were then washed for 20 minutes in 6 X SSPE at room temperature, and then 3 times at 40°C with 6 X SSPE buffer. The filters were readed for 30 minutes with alkaline phosphatase conjugated anti-digoxigenin, and washed. The filters were then reacted with BOP/NTB. Positive samples develop a purple color

One hundred and thirty-nine sputum samples, and 140 culture samples were tested by the above PCR method, and confirmed by traditional culture-based methods. The results are set forth below in Tables in and IV.

TABLE III

AMPLIFICATION OF DNA SEQUENCES OF . Tuberculosis FROM CULTURES

TABLE IV

AMPLIFICATION OF DNA SEQUENCES OF M. Tuberculosis FROM SPUTUM

B. Amplification bv primers 1 and 2. and Hybridization with a 24 base oligonucleotide probe

Sputum samples and biological cultures were purified and amplified described above in part A The PCR produd was hybridized as above with the 24 base probe 5' TTCACCGGCTCTCCGCTGAAGGAA, which was labeled with digoxigenin-dUTP. Positive samples were detected as above, with alkaline phosphatase conjugated anti-digoxigenin antibody followed by washing and addition of BOP/NTB. Analysis of PCR and culture correlated perfectly. Of 14 sputum samples tested, 11 samples tested positive by both PCR and culture, and 3 samples tested negative by both PCR and culture. Of 16 cell cultures that were tested, three cultures (M. tuberculosis) tested positive for M. tuberculosis by both PCR and culture, and 13 cell cultures from MOTT tested negative for M. tuberculosis by both PCR and culture.

EXAMPLE ? Hybridization and detection of Mycobacterium tuberculosis through the use of a disposable microfiltration unit.

Ten positive and ten negative samples were prepared as described above. Briefly, the samples were first inactivated at 95°C for 10 minutes. One hundred microliters of the treated samples, 220 μl of TE buffer, and 50 μl of 33% lysozyme were then transferred to an Eppendorf tube and incubated at 65^*C for 15 minutes, followed by the addition of 100 μl of 5M sodium perchlorate and incubation at room temperature for 5 minutes. The sample was then extracted with chloroform/isoamyl alcohol and ethanol predpitated, and resuspended in 25 μl of TE buffer.

Polymerase chain reaction (PCR) was performed in a volume of 100 μl with 200 mM of dATP, dCTP, dTTP and dGTP, 2 μM Mgd, 1 μM each of primer 1 and 2 as described above, and 25 U of Taq Polymerase¹¹¹. The reaction was covered with 100 μl of mineral oil, and denatured at 95^*C for 7 minutes. The primers were annealed at 70* C for 1.5 minutes. The extension reaction was performed at 72 ^*C for 1 minute. Thirty-five cycles were completed in a Perkin- Elmer thermocyder.

Ten percent of the PCR produd was analyzed in a 2% agarose gel. The gel was stained with ethidium bromide in order to confirm the presence of a band of about 283 b.p.

The remainder of the PCR product was brought to 0.2 N with the addition of NaOH, and incubated at room temperature for 15 minutes. The sample was loaded onto a microfiltration unit (either a CENTREX Disposable

Microfilter Unit (Schleicher & Schuell, Keene, New Hampshire), or a Ultrafree- MC^W filter unit 0.4 ml Durapore (0.45 urn) (Millipore, Bedford, Mass.) and centrifuged for 10 minutes at 2000 rpm. The filter unit was then dryed in a vacuum oven 80°C for 10 minutes.

Three hundred microliters of prehybridization solution (see Maniatis, supra) was placed in the microcentrifuge tube and incubated for 15 minutes at 65 *C. The 323 b.p. probe (prepared as described above) was then denatured at 95^*C for 8 minutes, placed on ice for 2 minutes, and then transfered to the microfiltration unit and incubated at 65^*C for 60 minutes.

Detection of the probe was accomplished utilizing commerdally aavailable reagents (Genius^w-system, Boehringer Mannheim, Indianapolis,

Indiana). Briefly, after incubation, the probe was removed from the microfiltration unit by washing with 1 ml of buffer I (100 mM Tris-HCl, 150 mM

NaCl, pH 7.5) for 1 minute, followed by incubation with buffer π (0.7% blocking reagent in buffer 1) for 10 minutes. The microfiltration unit was then washed again with buffer I for 1 minute, then 100 μl of antibody (anti-digoxigenin antibody conjugated to alkaline phosphatase, diluted 1:5000 in buffer I) was added to the microfiltration unit and incubated for 25 minutes. Next the microfiltration unit was washed twice with buffer I for one minute each, then equilibrated with buffer in (100 mM Tris-HCl, 150 mM NaCl, 50 mM MgQ^ pH 95) for two minutes. Presence of the probe was deteded by one of the following methods:

A Detection with Nitro Blue Tetrazolium Chloride (NTB)

A NTB solution was prepared (112 μl NTB, 8.8 μl X-Phosphate, and

25 μl buffer HI), placed into the microfiltration unit and incubated in the dark for color development The reaction was stopped after 45 minutes with the addition of a buffer containing lOmM Tris-HCl, and 1 mM EDTA). Presence of color indicated a positive sample.

B. Chemiluminescent Detection Alternatively, presence of the probe (through detection of the alkaline phosphatase conjugated antibody) was determined by utilizing Lumi-Phos 530 (Lumigen Inc., Detroit Michigan). Lumi-Phos 530 contains 033 mM 4- methoxy-4-(3-phosphatephenyl)-spiro (l,2-dioxetane-3,2'-adamantine) disodium salt 750mM 2-amino-2-methyl-l-propanol buffer (pH 9.6), 0.88 mM MgC , 1.13 mM cethyltrimethyl ammonium bromide, and 0.035 mM fluorescein surfactant.

Briefly, 100 μl of prewarmed Lumi-Phos was added to the microfiltration unit and incubated for 1 minute. The solution was then removed, and the microfiltration unit was disasembled to remove the filter membrane. The filter membrane was wrapped in Saran¹" wrap and incubated at 37 *C for 30 minutes.

Luminenscence was deteded either by exposing the membrane to X-ray film (Kodak XAR) for 5 minutes, or by taking a picture with film such as Polaroid's fast film (Polaroid 612).

C. Results

Out of 10 positive and 10 negative samples tested, the probe had a specifidty and sensitivity of 100%.

EXAMPLE 4

Seletfion and Generation of Polypeptides

The DNA sequence of done ASK 58-4 was analyzed to determine the presence of open reading frames. One open reading frame was located from nudeic add number 45 to nudeic add number 204 of Figure 2. This sequence codes for the following polypeptide of 52 amino adds, which was depicted using conventional one letter codes (see Table V).

MPAASRGLRP TFLQRRAGEL VGIGDIPQRA HLSVAHGYRG DPRRHRPIPV DPG

From the foregoing, it will be appredated that although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Claims

Claims

1. A labeled probe comprising at least a portion of the nucleotide sequence of Figure 2 from nucleic add number 1 to nudeic add number 323, said probe being capable of specifically hybridizing to nucleic adds from . tuberculosis.

2. The labeled probe of claim 1 wherein said label is seleded from the group consisting of ³²P-dCTP, biotin-dATP, and digoxigenin-dUTP.

3. A method for detecting the presence of M. tuberculosis in a biological sample, comprising:

(a) treating cells contained within the biological sample to expose cellular nucleic adds;

(b) incubating the cellular nudeic adds with a labeled M. tuberculosis specific probe comprising at least a portion of the nucleotide sequence of Figure 2 from nucleic add number 1 to nucleic add number 323, under conditions and for a time suffident for hybridization to occur; and

(c) detecting the presence of the hybridized, labeled M. tuberculosis spedδc probe.

4. A method for detecting the presence of M. tuberculosis in a biological sample, comprising:

(a) treating cells contained within the biological sample to expose cellular nudeic adds;

(b) amplifying a selected cellular nucleic add sequence;

(c) incubating the amplified nucleic add sequence with a labeled M. tuberculosis specific probe comprising at least a portion of the nucleotide sequence of Figure 2 from nucleic add number 1 to nudeic acid number 323, under conditions and for a time suffident for hybridization to occur; and

(d) detecting the presence of the hybridized, labeled M. tuberculosis specific probe.

5. The method of claims 3 or 4 including, prior to the step of treating, immobilizing the cells contained within the biological sample onto a solid support.

6. The method of claim 5 including, prior to the step of immobilizing, prehybridizing the solid support.

7. The method of claims 3 or 4 wherein the label is seleded from the group consisting of ³²P-dCTP, biotin-dATP, and digoxigenin-dUTP.

8. The method of claims 3 or 4 wherein said biological sample is selected from the group consisting of a cell culture, sputum, surgically excised tissue, urine, gastric fluid, cerebrospinal fluid, and a histological tissue section.

9. A polypeptide comprising the amino add sequence:

MPAASRGLR? TFLQRRAGEL VGIGDIPQRA HLSVAHGYRG DPRRHRPIPV DPG

10. A labeled probe comprising at least a portion of the nucleotide sequence of Figure 1 from nucleic add number 1 to nucleic add number 959, said probe being capable of specifically hybridizing to nucleic adds from M. tuberculosis.

11. A method for detecting the presence of M. tuberculosis in a biological sample, comprising:

(a) treating cells contained within the biological sample to expose cellular nudeic adds;

(b) amplifying a selected cellular nucleic add sequence;

(c) incubating the amplified nucleic add sequence with a labeled M. tuberculosis specific probe comprising at least a portion of the nucleotide sequence of Figure 1 from nucleic add number 1 to nucleic add number 959, under conditions and for a time suffident for hybridization to occur; and

(d) detecting the presence of the hybridized, labeled M. tuberculosis spedfic probe.