EP0568641A1 - Regulation of nucleic acid translation - Google Patents

Abstract

The invention relates to a sensitive RNA molecule encoding, in one or more protein coding regions, a polypeptide, and comprising a regulatory domain, a substrate region and a ribosome recognition sequence. The sensitive RNA molecule has an inhibitory region in the regulatory domain, said regulatory domain is complementary to both a substrate region of the sensitive RNA molecule and a non-inhibitory region of an indicator nucleic acid. such that, in the presence of the indicator nucleic acid, the inhibitory and substrate regions form a base pair domain whose formation reduces the level of translation of one or more protein coding regions in the sensitive RNA molecule compared to the level of translation of the coding region of proteins observed in the presence of the indicator nucleic acid. The non-inhibitory region of the indicator nucleic acid is complementary in sequence to the inhibitory region of the sensitive RNA molecule so that when the non-inhibitory region has a base pair with the inhibitory region, the translation of a Protein coding region of sensitive RNA is increased relative to the level of translation of this protein coding region observed in the absence of the indicator nucleic acid.

Description

DESCRIPTION

Regulation of Nucleic Acid Translation

Background of the Invention

The invention relates to the regulation of RNA translation.

Antisense RNA is RNA whose sequence is complementary to that of a particular RNA molecule (see, e.g. , Kimelman et al., Cell 5 :687, 1989; Melton, Proc. Natl. Acad. Sci. USA. jB2.:144, 1985). In vivo, antisense RNA corresponding to a particular gene is usually produced by an artificial gene which has been engineered to transcribe the normally untranscribed strand of the chosen gene. Such an engin¬ eered gene is easily generated by reversing the orienta¬ tion of the transcribed DNA in the normal gene.

Antisense RNA blocks the production of the polypep- tide encoded by its complementary sense RNA. This inhibi- tion of translation is thought to occur because an RNA- RNA duplex is formed which cannot be translated. Anti¬ sense RNA has been used to control production of manganous superoxide dismutase in human embryonic kidney cells (Wong, et al., Cell 5£__.:923, 1989), amyloid β protein pre- cursor in human fibroblasts (Saitoh, et al., Cell 58:615, 1989) , and ribulose biphosphate carboxylase in tobacco plants (Rodermal et al. , Cell 5_5:673) . In Xenopus oocytes antisense RNA is thought to cause modification of the RNA molecules to which it hybridizes and this modification is thought to cause rapid degradation of the RNA (Kimelman et al. , supra) . Antisense RNA and endogenous RNAse H have been used to block cyclin production in Xenopus oocytes cell extracts (Minshull et al. , Cell .56:947, 1989).

Summary of the Invention The invention features an RNA molecule, termed a responsive RNA molecule which, when present in a cell, responds to the presence of other nucleic acids. By "responds" is meant that the responsive RNA molecule will be translated to form one or more polypeptides in the presence of certain nucleic acids (which can hybridize to the responsive RNA) and will not be significantly trans- lated to form these polypeptides in the absence of such nucleic acids. Such a responsive RNA molecule will gener¬ ally encode one or more polypeptide molecules, the pro¬ duction of which depends on translation of that responsive RNA molecule. Generally, translation of the responsive RNA molecule, and thus production of polypeptide, will not occur in any particular cell unless a specific nucleic acid, termed a signal nucleic acid, is also present within that cell.

A responsive RNA can be used to kill or injure spe- cific cells within a population of cells. For example, a responsive RNA may encode a toxin molecule which is pro¬ duced from the responsive RNA only when the responsive RNA molecule within a given cell is exposed to a signal nucleic acid indicative of a condition (e.g.. infection with a harmful virus such as HIV-I) requiring that the cell be killed. More specifically, the responsive RNA molecule may encode a cytotoxic protein such as cholera toxin, diptheria toxin, ricin and the hok, gef, RelF or flm gene products of E. coli, and translation of the responsive RNA molecule and production of cytotoxic protein occurs only when the responsive RNA molecule is present within a cell which is infected with HIV-I. Here, an RNA molecule specific to HIV-I serves as the signal nucleic acid and interacts with the responsive RNA mole- cule to allow translation of the toxin-encoding sequences of the responsive RNA molecule.

A responsive RNA molecule is produced by designing a polypeptide-encoding RNA which, in the absence of a signal nucleic acid, has a structure which prevents translation. One type of responsive RNA molecule can fold to form a base-paired domain, e.g. , which, when sufficiently stable, prevents translation by preventing the tranεlational machinery of a cell from reading the nucleotide sequence of the RNA. A specific example of a responsive RNA mole¬ cule of this type has a domain which encodes the desired polypeptide (or "protein-coding region") and a regulatory domain (i.e.. a domain which includes regulatory elements including an inhibitor region, inverted repeats and nucle- ation regions) . The regulatory domain may be located anywhere in the responsive RNA molecule so long as the sequence of the elements of the regulatory domain are selected so as not to interfere with the activity of the coded polypeptide. The inhibitor region is complementary in sequence to both a substrate region (which can include portions of either the protein-coding region and/or a leader region which is the non-translated RNA 5' of the protein-coding region) and to a region of the signal nucleic acid referred to as an anti-inhibitor region. In the absence of the signal nucleic acid, the inhibitory region of the responsive RNA molecule hybridizes to the substrate region of responsive RNA molecule forming an intramolecular base-paired domain which prevents or reduces translation. When the signal nucleic acid is present, the anti-inhibitor region competes with the substrate region for binding to the inhibitor region. Formation of an intermolecular base-paired domain between the anti-inhibitor region of the signal nucleic acid and the inhibitor region of the responsive RNA prevents for¬ mation of a base-paired region with the protein-coding region; under these circumstances the protein-coding region(s) can be translated. A second type of responsive RNA molecule has an intervening sequence or "intron", the presence of which prevents translation of one or more "exons". Introns do not code for the desired polypeptides. Segments of the RNA which code for desired polypeptides are called "exons" as are non-coding sequences (e.g.. the leader region, secretory signal sequences, polyA tails, and the like) that remain after the splicing reaction. This second type of responsive RNA molecule is designed so that it can undergo a splicing reaction under desired conditions (e.g. , in the presence of a specific RNA molecule) which removes the intron and joins the two flanking portions of the RNA molecule, thus forming a molecule which is the proper template for the active polypeptide. It is the regulation of this splicing reaction which in turn regu¬ lates translation. This second type of responsive RNA molecule is similar to the first type of responsive RNA molecule in that it has an inhibitor region which is complementary in sequence to both the anti-inhibitor region of a signal nucleic acid and to a substrate region within the responsive RNA molecule. In this second type of responsive RNA, the substrate region is not necessarily part of an exon, but rather contains a region which is essential to the self-splicing reaction. When the sub¬ strate region is base-paired to the inhibitor region, the self-splicing reaction cannot occur, thus translation is prevented. In contrast, when a signal nucleic acid is present, its anti-inhibitor region hybridizes to the inhibitor region of the responsive RNA forming an inter- molecular base-paired domain, which prevents intramole¬ cular base-pairing between the inhibitor region and the substrate region. Under these circumstances, the sub- strate region is free to participate in the splicing reaction, the intron is removed, and translation of properly joined exons can occur.

Thus, in a first aspect the invention features a responsive RNA molecule which encodes, in one or more protein-coding regions, a polypeptide, and which includes a regulatory domain, a substrate region, and a ribosome recognition sequence, e.g. , a ribosome binding site, a translation initiation site, and all non-coding regions necessary for the translation of an RNA. This responsive RNA molecule has an inhibitor region in the regulatory domain which is complementary to both a substrate region of the responsive RNA molecule and to an anti-inhibitor region of a signal nucleic acid such that, in the absence of the signal nucleic acid, the inhibitor and substrate regions form a base-paired domain which reduces the level of translation of the responsive RNA molecule compared to that level observed in the presence of a signal nucleic acid.

The "regulatory domain" is a region of the responsive RNA molecule which will regulate the level of translation of the responsive RNA molecule dependent upon the presence of the signal nucleic acid. The regulatory region includes the inhibitor region, inverted repeats and nucle- ation regions. A "ribosome recognition sequence" is a region of an RNA molecule that is required in order for translation to begin at a given initiation codon (typi- cally AUG) . Such a site is recognized by a ribosome and bound by the ribosome prior to the initiation of transla¬ tion of the RNA. In procaryotes, the ribosome recognition sequence is a ribosome binding site and includes a purine- rich sequence centered about 10 nucleotides 5• to the initiation codon (Shine and Dalgarno, Proc. Natl. Acad. Sci. USA 21:1342, 1974) . For eucaryotes, the sequence A/G NNAUGG described by Kozak (Kozak, J. Cell Biol. 108:229, 1989) is the minimal ribosome recognition sequence required for initiation of translation. This sequence includes the AUG initiation codon.

The "signal nucleic acid" is a nucleic acid (e.g.. a viral RNA) which is indicative of a condition under which it is desirable to produce the polypeptide encoded by the responsive RNA molecule. A "base-paired" domain is a region over which the nucleotides of two regions of nucleic acid are hydrogen bonded to each other. The term includes bonding of less than all contiguous nucleotides of such regions.

The "substrate region" is a region of the responsive RNA molecule which when base-paired reduces the level of translation of one or more of the protein-coding regions in the responsive RNA molecule. The "inhibitor region" is a region of the responsive RNA molecule which when base-paired to the substrate region reduces the level of translation of one or more protein-coding regions in the responsive RNA molecule. The "anti-inhibitor region" is a region of the signal nucleic acid which when base-paired to the inhibitory region increases the level of translation of one or more protein-coding regions of the responsive RNA molecule compared to that observed in the absence of the signal nucleic acid molecule. These three regions interact to regulate the level of translation of the responsive RNA molecule and are selected to ensure appropriate levels of polypeptide production dependent upon the presence of the signal nucleic acid. By "appropriate level" is meant that in the absence of the signal nucleic acid the level of polypeptide is sufficiently low to have little or no effect on the physi¬ ology of the cell, and in the presence of the signal nucleic acid the level of polypeptide is sufficiently high to reduce viability of the cell. The level of translation of the responsive RNA can be determined by standard proce¬ dures. Generally, a low level of translation is one in which less than 0.1% of the polypeptide produced by a cell is polypeptide encoded by the responsive RNA molecule. In preferred embodiments, the substrate region is part of an exon or a leader region or overlaps the junc¬ tion between the two (which includes the ribosome recog¬ nition sequence, and the initiation codon) , or includes a region necessary for the self-splicing reaction. In a procaryotic system, it is preferred to have the substrate region include the ribosome binding site and the initi≥- * tion codon, (e.g. , by overlapping the junction between the leader region and the protein-coding region) . The pro¬ caryotic ribosome binds at the ribosome binding site unless this site is occluded. Once bound, the ribosome will translate the exon and, in the process, unwind the proposed substrate-inhibitor region. Occluding the ribo-

SUBSTIT some binding site and the initiation codon with the substrate-inhibitor hybrid region may eliminate the translation of a procaryotic message in this type of model. (See Figs. ID and IG.) For eucaryotes, the 4OS subunit of the eucaryotic ribosome binds at the 5'-end of a capped mRNA and "scans" down the message in search of the first initiation codon (see generally Kozak, J. Cell. Biol. 108:229. 1989). In this process, all but extremely stable hybrids .i.e.. those having a free energy of formation of <-50 kcal/mol) are unwound and scanned through (Kozak, Proc. Natl. Acad. Sci. USA 82:2850, 1986). Thus, to inhibit scanning of the 4OS subunit to the translation initiation site, the inhi¬ bitor region must form an extensive hybrid with the sub- strate region (which may include the ribosome recognition sequence and/or the initiation codon) in which the base- paired region has a free energy of formation that is -50 kcal/mol or lower. Thus, it is preferred that the inhi¬ bitor region be located downstream (3¹) of the ribosome recognition sequence (in the exon or perhaps nearer the 3' end of the message) so that the interaction between the inhibitor region and the anti-inhibitor signal RNA (which would have a similar if not lower free energy of forma¬ tion) would not also prevent movement of the 4OS ribosomal subunit to the initiation site (see, Figs. IF, IG, and 1H) . Accordingly, in a eucaryotic system, having the self-splicing intron interrupt the protein-coding region is preferred.

As used herein an "intron" is a domain of the respon- sive RNA molecule which is separate from the exons. Preferably the intron is an RNA molecule having catalytic activity including RNA cleavage and ligation activity. It is preferred that such an intron be able to self splice and thus is chosen from a group I or group II intron, such as that present in Tetrahymena thermophila.

In more preferred embodiments, the responsive RNA molecule is purified, and the responsive RNA encodes a polypeptide which modifies cell viability, cell prolifer¬ ation, transcription of DNA, translation of RNA, or repli¬ cation of DNA, e.g.. the responsive RNA molecule encodes a polypeptide which has diphtheria toxin activity or ribo- nuclease activity.

"Purified RNA" is RNA isolated from one or more com¬ ponents of the environment in which it naturally occurs. For example, the RNA is present in a cell in which it does not naturally occur. Preferably it is provided as a homogeneous solution of nucleic acid.

In other preferred embodiments, the substrate region includes the 5'-splice junction of the intron; the intron reduces the level of translation of the exons compared to the level of translation in the absence of the intron; the intron is located between the ribosome recognition sequence and a 5*-most exon or between two exons. Even more preferably, the intron overlaps at its 5'-end a 5"-splice junction, and at its 3'-end a 3'-splice junc¬ tion; the intron catalyzes two cleavage reactions, one within the 5'-splice junction and one within the 3'-splice junction; the intron is a self-splicing intron; the sub¬ strate region includes the 5'-splice junction; and the inhibitor region interferes with the cleavage reaction within the 5'-splice junction. A "5¹-splice junction" refers to the sequence over¬ lapping or abutting the 5•-end of an intron which is required for a splicing reaction. A "3'-splice junction" refers to the sequence at the 3'-end of an ir.cron which is required for a splicing reaction. Such splice junctions overlap the ends of a self-splicing intron such as those bordering the intervening sequence of Tetrahymena thermophila.

A "self-splicing intron" is a piece of RNA which contains all of the sequences required except for the necessary abutting splice junction sequences for the intron to excise itself from a larger piece of RNA and to join the two pieces of RNA that flanked the intron prior to the excision reaction. That is, the intron is able to cleave and ligate two portions of an RNA molecule.

In yet more preferred embodiments, the signal nucleic acid is single stranded, e.g.. it is viral RNA. Examples of responsive RNA include Tetrahymena RNA which has been modified, for example, by nucleotide changes at positions -14, -19, -21, -22, -23 and/or -24 relative to the 5'-splice site.

In a related aspect the invention features a method for interfering with the growth of a cell harboring a signal nucleic acid by introducing a responsive RNA molecule as described above into the cell.

In a related aspect the invention features a DNA molecule encoding the above responsive RNA molecules. Other features and advantages of the invention will be apparent from the following description of the pre¬ ferred embodiments thereof, and from the claims.

Description of the Preferred Embodiments

The drawings are first briefly described.

Brief Description of the Drawings

Figs. 1, 1A and IB are schematic drawings of a responsive RNA molecule. The thin line represents the leader region, the thick line represents a protein-coding region, a series of short vertical lines indicates a base- paired domain, and the boxes above and below these lines indicate various features of the RNA. Specifically, in Fig. 1A the responsive RNA is drawn so as to depict intra¬ molecular base-pairing which prevents translation; and in Fig. IB the responsive RNA molecule is depicted as hybri- dized to a signal nucleic acid.

Fig. 1C depicts a second variation of this type of responsive RNA molecule; in Fig. ID the responsive RNA molecule is drawn to depict the intramolecular base- pairing that prevents translation; and in Fig. IE the responsive RNA molecule is hybridized to a signal nucleic acid.

Fig. IF depicts a third variation of a responsive RNA molecule; in Fig. IG this responsive RNA molecule is drawn to show the intramolecular base-pairing which prevents translation; and in Fig. 1H the responsive RNA molecule is hybridized to a signal nucleic acid.

Figs. 2, 2A, 2B, and 2C are schematic drawings of a responsive RNA molecule which includes a self-splicing intron. The thin line represents a leader region, the broken line represents a self-splicing intron, the thick line represents an exon, a series of short vertical lines indicates a base-paired domain, and the boxes above and below these lines represent various features of the RNA. Specifically, in Fig. 2A the responsive RNA molecule is drawn so as to depict the intramolecular base-pairing which prevents self-splicing; in Fig. 2B the responsive RNA molecule is depicted as hybridized to a signal nucleic acid; and Fig. 2C depicts the spliced molecule produced by the self-splicing reaction.

Figs. 2D, 2E, 2F and 2G depict a variation of the type of responsive RNA molecule shown in Figs. 2-2C. In Fig. 2D, a self-splicing intron separates the polypeptide- coding sequence in the responsive RNA molecule; in Fig. 2E, the responsive RNA molecule is drawn to depict the intramolecular base-pairing which prevents self- splicing; in Fig. 2F, the responsive RNA molecule is hybridized to a signal nucleic acid; and in Fig. 2G, the spliced molecule produced by the self-splicing reaction is depicted.

Fig. 3 depicts P(l) and P(-l) stem-loop structures at or just upstream of the 5¹ exon-intervening sequence (IVS) junction of Tetrahymena thermophila. The IVS (uppercase) contains the internal guide sequence (boxed) which can hybridize with the end of the 5' exon (lowercase) to form the P(l) stem-loop, the conformation required at the 5'-splice site (shown by filled-in triangle) for self- splicing. The alternative structure P(-l) , which does not support self-splicing, is formed by hybridization between a portion of the P(l) stem (boldface) with an upstream 5' exon sequence (overlined) . The sequence shown at the top is that for RNA from the parent plasmid pTETBLU. The lower three RNA structures represent modified P(-l) stem- loops from three mutant plasmids that were made by sequence changes (shaded) in the 5' exon. Calculated free energies at 37^βC for each of these structures are given. Fig. 4 is a photograph of a polyacrylamide gel show¬ ing the results of i vitro transcription reactions car¬ ried out in the presence of [α³²P]CTP using the parent plasmid (pTETBLU) and the three splicing mutants (pTET14, PTET1419, pTET21-24) as templates. Each set of three lanes represents the transcription products before (0) and after (15 or 60 min) the change to splicing conditions. The template used is given above each set of lanes, and the restriction enzyme used to linearize the template is shown at the top. For this and the following two figures, FL denotes the full-length precursor RNA and LE indicates ligated exons. The positions of linear IVS RNA (L-IVS) and circular IVS RNA (C-IVS) are also indicated, as are the shortened forms of L-IVS in which 15 or 19 nt have been removed from the 5' end by the circularization reac- tion (L-15 and L-19, respectively). An asterisk denotes an RNA thought to be the product of 3'-splice site hydrol¬ ysis (i.e.. a 5' exon-IVS fragment). An as yet unidenti¬ fied small RNA product is also indicated (<) .

Fig. 5 is a photograph of a polyacrylamide gel show- ing the results of experiments in which gel-purified pTET1419 RNA was incubated under splicing conditions in the absence (0) or presence of the given concentrations of either of two signal RNAs (4S or 4S3) for 15 or 60 min. The resultant products were analyzed on a 4% denaturing polyacrylamide gel and are indicated in Fig. 5.

Fig. 6 is a photograph of a polyacrylamide gel show¬ ing the results of experiments in which gel-purified pTETBLU RNA or pTET21-24 RNA (10 nM) was incubated in splicing buffer at 4 or 37^βC. Where indicated, Mg²⁺ was added to 5 mM to initiate the splicing reaction. For pTET21-24, splicing was initiated in the absence or pres- ence of either of two signal RNAs specific for the pTET21- 24 sequence (8S4 or 12S) . When present, the concentration of the signal RNA is 1 μM. The resulting products, ana¬ lyzed on a 4% denaturing polyacrylamide gel, are labeled as in Fig. 4. Templates used for transcription were lin- earized with either EcoRI or BamHI as indicated at the top. An additional product seen when the EcoRI-runoff precursor is incubated under splicing conditions in the presence of signal RNA is indicated with a dot. A short RNA product (<) seen when pTET21-24 is incubated under splicing conditions in the absence of a signal RNA is marked with an arrowhead. This same RNA product is also visualized in Fig. 4.

Responsive RNA Molecules

Responsive RNA molecules are generally described above. Below are presented specific examples to illus¬ trate these molecules to those of ordinary skill in the art. These examples are not limiting to this invention.

Example 1; Responsive RNA Molecules Without Introns

A first type of responsive RNA molecule is illus- trated in Fig. 1. One portion of this molecule, the protein-coding region encodes a polypeptide whose produc¬ tion is desired only in the presence of a signal nucleic acid. Another portion of the molecule, the regulatory domain, includes an inhibitor region which is complemen- tary in sequence to a substrate region within the protein- coding region. The inhibitor region can base pair with the substrate region to form a base-paired domain which blocks translation of the protein-coding region. The substrate region can be a part of the protein-coding region, part of the leader region, or overlap the junction between the two.

Referring to Fig. 1, responsive RNA molecule 10 has a 5'-end 12, and a 3'-end 14. Adjacent to 5'-end 12 is a leader region 26 and regulatory domain 16; adjacent to 3'-end 14 is a protein-coding region 18. Within regula¬ tory domain 16 is an inhibitor region 20; within protein- coding region 18 is a substrate region 22. At the 5¹ of protein-coding region 18 is a ribosome recognition sequence 21 and an initiation codon 23.

Referring to Fig. 1A, inhibitor region 20 hybridizes to substrate region 22 to form a base-paired domain 28. Such base-pairing within responsive RNA molecule 10 inhi¬ bits translation of the protein-coding region of the responsive RNA molecule.

The inhibition of translation is relieved by the presence of a signal nucleic acid, a region of which, referred to as the anti-inhibitor, is complementary to the inhibitor region of the responsive RNA. The anti- inhibitor region of the signal nucleic acid competes with the substrate region of the responsive RNA molecule for hybridization (base pairing) with the inhibitor region of the responsive RNA molecule. Under these circumstances there is no base pair formation with the substrate region, translation occurs and the desired polypeptide is produced.

For example, referring to Fig. IB, signal nucleic acid 30 has a 3*-end 32, a 5'-end 34, and an anti- inhibitor region 36 complementary in sequence to inhibitor region 20 of responsive RNA molecule 10. Hybridization of anti-inhibitor region 36 with inhibitor region 20 forms base-paired domain 38 and prevents hybridization of inhi¬ bitor region 20 to substrate region 22. Under these cir¬ cumstances, translation of protein-coding region 18 occurs.

In a variation of this type of responsive RNA mole¬ cule, the substrate region is not entirely contained within the protein-coding region but extends upstream of the protein-coding region into the leader region. Spe¬ cifically, the responsive RNA molecule depicted in Fig. 1C has a substrate region 22 which includes the ribosome recognition sequence 21 and the initiation codon 23. Referring to Fig. ID, substrate region 22 base-pairs to inhibitor region 20 forming intramolecular base-paired region 28. In a procaryotic system, this configuration physically blocks a ribosome from interacting with the ribosome binding site and the initiation site, and trans¬ lation is inhibited. Referring to Fig. IE, the anti- inhibitor region 36 of the signal nucleic acid 30 is hybridized to the inhibitor region 20 to form base-paired region 38. In this configuration, a procaryotic ribosome initiates translation and the desired polypeptide is produced.

In another variation of this type of responsive RNA molecule, the inhibitor region is located downstream of the substrate region. The inhibitor region can be within the protein-coding region itself, as diagrammed in this figure, or located in a region 3' of the protein-coding region. In Fig. IF, the responsive RNA molecule is depicted as having a substrate region 22 that includes ribosome recognition sequence 21 and initiation codon 23 and has an inhibitor region 20 located 3' of the substrate region. Referring to Fig. IG, the inhibitor region, 20, base-pairs with the substrate region 22 forming intramole¬ cular base-paired region 28. In this configuration, a scanning eucaryotic ribosomal subunit cannot invade or bind to the base-paired domain to initiate translation provided this basepairing interaction is sufficiently strong. In Fig. 1H, the anti-inhibitor region 36 of sig¬ nal nucleic acid 30 is hybridized to inhibitor region 20 forming base-paired region 38. A eucaryotic ribosome can scan to the proper initiation codon (provided there are no other upstream initiation codons) and initiate transla¬ tion. Translation of the polypeptide occurs, with dis- ruption of base-paired region 38 by the translating ribosome.

Since the inhibitor region of the responsive RNA must be complementary to both the substrate region of the responsive RNA, and the anti-inhibitor region of the tar¬ get nucleic acid, the sequences of these three regions must be chosen to allow suitable regulation of translation of the responsive RNA. This does not mean that the sequence of the substrate region must be identical to the sequence of the anti-inhibitor region. Neither of the two base-paired domains which can form need to be perfectly base-paired .i.e.. all contiguous bases along the domains are base-paired) , nor do they have to be the same length. There is flexibility in the selection of the anti- inhibitor region so long as the region is specific enough to indicate when translation must occur. For example, if the signal to which the responsive RNA responds is the presence of HIV-I within a cell, any specific nucleic acid sequence of HIV-I could be chosen, and of course, one is limited in selecting a nucleic acid sequence present in HIV-I. The sequence of the substrate region is chosen to create a responsive RNA molecule which produces a biologi¬ cally active polypeptide. Since the substrate region may include portions of a protein-coding region, any modifica- tion of its sequence must preserve a significant amount of the activity of the encoded polypeptide. The degeneracy of the genetic code allows for changes in the sequence of the protein-coding region which do not affect the sequence of the encoded polypeptide. Because guanosine can base- pair with uridine as well as with cytosine there is addi¬ tional flexibility in the sequences which can be used. In addition, since conservative amino acid changes at one or more positions in proteins often do not eliminate activity of the protein the number of useful sequences is increased substantially.

The base-paired domain formed by hybridization of the inhibitor region to the substrate region must be stable enough so that it will not be disrupted by nucleic acids other than the signal nucleic acid, which may also be present within the cell. For example, if the inhibitor region and the substrate region are complementary over only four contiguous nucleotides, any single stranded nucleic acid that includes that four base sequence could compete with the substrate region for hybridization to the inhibitor region, and if the nucleic acid including this sequence was present at a high enough concentration inhi- bition of translation would be relieved. Generally, the base-paired domain formed by the hybridization of the substrate region to the inhibitor region should include at least 12, and preferably 15, contiguous nucleotides in order for the molecule to respond to only the signal nucleic acid.

The responsive RNA molecule can include a region that will allow the signal nucleic acid to more readily hybri¬ dize to the inhibitor region. This additional region is called a nucleation region and consists of a number of nucleotides immediately adjacent to the inhibitor region and complementary to the sequence of the signal nucleic acid such that the nucleation region and the inhibitor together form a region of extended complementarity with the signal nucleic acid. The nucleation region provides a single stranded region that is readily available for hybridization to the signal nucleic acid. Base-pair formation over this region will tend to favor displacement of the substrate region from the inhibitor region by posi¬ tioning the anti-inhibitor region correctly for hybridiza- tion to the inhibitor region. In addition, such a nuclea¬ tion region will increase the stability of the base- paired region formed with a signal nucleic acid.

The regulatory domain may also include a region that will disfavor hybridization of non-specific nucleic acids (i.e.. nucleic acids other than the signal nucleic acid) to the region immediately adjacent to the inhibitor domain. This region is referred to as an inverted repeat and can fold to forma hairpin structure.

The detailed nature of the inhibitor region, the sub¬ strate region, and the anti-inhibitor region will depend, in part, on how tightly translation is to be regulated. The more stable the intramolecular base-paired domain formed by hybridization of the inhibitor region to the substrate region, the more translation will be inhibited. For RNA-RNA duplexes, the stability of a base-paired domain depends on the number of nucleotides actually base- paired within a contiguous region of nucleotides, the number of mismatches within a generally base-paired domain, and the nucleotide composition of the base-paired domain. Intramolecular base-pair formation depends on the distance between the two regions to be base-paired. For example, when there are too few nucleotides between the two regions, torsional-type constraints can prevent base pair formation. Those in the art are well aware of how these parameters can be adjusted in order to make a more or less stable base-paired domain. The stability of the intramolecular base-paired domain can be adjusted depen¬ dent upon the level of translation that is desired at any given level of signal nucleic acid. The level of transla¬ tion depends on the proportion of responsive RNA molecules in which the inhibitor region is hybridized to the sub¬ strate region. This proportion, in the presence of the signal nucleic acid, depends on the proportion of the responsive RNA molecules in which the inhibitor region is hybridized to the anti-inhibitor region of the signal nucleic acid. Those in the art will appreciate that the amount of each duplex which forms depends on the relative stability of the two duplexes as well as the amount of signal nucleic acid and responsive RNA present in a given cell. If a highly toxic molecule is encoded by the responsive RNA then a high degree of regulation is required. For example, if the active subunit of cholera toxin is encoded, only a few molecules are required to kill a cell. In this case translation must be completely inhibited in the absence of signal nucleic acid. This is best ensured by having almost complete complementarity of the substrate and the inhibitor regions, e.g. , 85% comple- mentarity of a 20 nucleotide region. Expression occurs only when a highly complementary signal RNA is present, having e.g.. 100% complementarity to the inhibitor region over a 25 nucleotide region.

The inhibitor region may be on the 5'-side or the 3'-side of the protein-coding region or within the protein-coding region itself. If the responsive RNA molecule is subject to exonucleolytic degradation, this should be taken into account when designing the molecule. Thus, if the molecule is degraded beginning at the 3'-end it would be best to locate the inhibitor region at the 5'-end of the molecule in order to prevent formation of a molecule containing all of the sequences required for translation but lacking an inhibitor region.

Example 2: Responsive RNA Molecules With Self-Splicing Introns

A second type of responsive RNA molecule includes a self-splicing intron which prevents production of the desired polypeptide. The intron can be removed by a splicing reaction, and the spliced molecule serves as a template for the production of the desired polypeptide. A signal nucleic acid regulates translation of this type of responsive RNA molecule, but the regulation is achieved indirectly by using the signal nucleic acid to regulate the splicing reaction. In order for this type of regula- tion to work the responsive RNA molecule must, in the absence of the signal nucleic acid, fold so as to form an intramolecular base-paired domain which prevents splicing. In the presence of the signal nucleic acid an alternative intermolecular base-paired domain forms and splicing occurs. An example of this second type of responsive molecule is illustrated in Fig. 2. This molecule has an intron located between the ribosome recognition sequence and the initiation codon of a single protein-coding region which encodes a desired polypeptide. This intron prevents translation because it places the ribosome recognition sequence too far away from the initiation codon. In this example, the intron is a self-splicing intron derived from the pre-rRNA of Tetrahymena. Introns of this type can fold into a structure which causes two cleavage reactions, one on either side of the intron, and a ligation reaction which joins the portions of the RNA molecule flanking the intron. An essential step in the self-splicing of such introns is hybridization of a region of the intron, referred to as the 5'-splice junction, to a second region of the intron, referred to as an internal guide sequence. Thus, one way the self-splicing activity of the intron can be regulated is by preventing hybridization of the 5'-splice junction to the internal guide sequence. The responsive RNA molecule depicted in Fig. 2 has a regula¬ tory domain which is distinct from the intron and the protein-coding region. This regulatory domain has an inhibitor region which is complementary to the substrate region which in this molecule includes the 5'-splice junction of the self-splicing intron. Intramolecular base pair formation between the inhibitor region and the sub¬ strate region prevents hybridization of the 5'-splice junction to the internal guide sequence, and splicing is prevented. This responsive RNA molecule is designed so that the inhibitor region is also complementary to the anti-inhibitor region of the signal nucleic acid. Thus, in the presence of the signal nucleic acid, the inhibitor region hybridizes to the anti-inhibitor region freeing the 5'-splice junction for participation in the self-splicing reaction.

Referring to Fig. 2, responsive RNA molecule 40 has a 5'-end 42, and a 3 '-end 44. Adjacent to 5'-end 42 is a leader region 49 adjacent to which is a self-splicing intron 48, and then polypeptide-encoding exon 50. Regu¬ latory domain 46 lies within leader region 49. Self- splicing intron 48 thus lies between regulatory domain 46 and exon 50, and is flanked on its 5' side by a ribosome recognition sequence 56, and on its 3' side by an AUG codon 66. An inhibitor region 52 within regulatory domain 46 is complementary to a substrate region 54 at the junc¬ tion between leader region 49 and self-splicing intron 48. Within the regulatory domain, on the 3'-side of the inhi¬ bitor region, is a nucleation region 45 which is contigu¬ ous with the inhibitor region 52 and complementary to a region of the signal nucleic acid immediately adjacent to the anti-inhibitor region referred to as the anti- inhibitor extension. The regulatory region may also include an inverted repeat 47 on the 5'-side of the inhi¬ bitor region. Substrate region 54 includes ribosome recognition sequence 56, a 5'-splice junction 58, and a stabilizer region 60. Self-splicing intron 48 is over- lapped by a 5*-splice junction 58, and a 3*-splice junc¬ tion 64 adjacent to AUG codon 66, and includes an internal guide sequence 62.

Referring to Fig. 2A, when inhibitor region 52 hybri¬ dizes to substrate region 54 a base-paired domain 70 forms preventing 5'-splice junction 58 from interacting with internal guide sequence 62. The inverted repeat can fold so as to create a stabilizer hairpin 63.

In the presence of a signal nucleic acid, an inter- molecular base-paired domain forms between the anti- inhibitor and anti-inhibitor extension regions of the signal nucleic acid and the inhibitor and nucleation regions of the responsive RNA molecule. This interaction frees 5'-splice junction 58 allowing it to interact with internal guide sequence 62. Under these circumstances, a self-splicing reaction occurs. Thus, referring to Fig. 2B, signal nucleic acid 71 having a 3 '-end 72 and a 5'-end 73 includes an anti-inhibitor region 74 and an anti-inhibitor extension 77 which hybridize to inhibitor region 52 and nucleation region 45 forming base-paired domain 75.

The self-splicing reaction removes all of the self- splicing intron. The spliced molecule now can produce the encoded polypeptide from exon 50 because the ribosome recognition sequence is now in close juxtaposition to the initiation codon of the polypeptide encoding exon allowing utilization of the initiation sequence as the first codon of a polypeptide.

Referring to Fig. 2C, spliced molecule 90 includes 5'-end 42, 3'-end 44, leader region 49, exon 50, ribosome recognition sequence 56, initiation codon 66, and fused splice junction 95 containing a small portion of 5' splice junction 58 and a small portion of 3' splice junction 64.

Any intron known to have self-splicing activity can be adapted for use as a responsive RNA molecule. Suitable self-splicing RNA can be derived form the nuclear pre- rRNA of Tetrahymena. the itochondrial pre-rRNA of Saccharomyces and Neurospora. the introns of Argobacterium or Azoarcus. and the mitochondrial pre-mRNA of Saccharo¬ myces or other equivalent group I self-splicing RNAs. Group II introns can also be used in this invention, or any RNA which has at least RNA cleavage activity. RNA ligase activity can be provided by other RNA molecules or their equivalent.

Once a self-splicing RNA has been selected it must be correctly positioned between the ribosome recognition sequence site and the start codon of the polypeptide encoded so that after the self-splicing reaction has occurred the ribosome recognition sequence is positioned correctly relative to the start codon. In eucaryotes translation generally begins at the most 5' AUG of a capped RNA providing that the sequence surrounding the AUG conforms to A/GNNAUGG. Accordingly, the responsive RNA molecule must be designed so that this sequence appears only after splicing has occurred. Moreover, an AUG or other codon in a favorable sequence context can be included in the intron so that it is recognized and used as the 5' most translation initiation site. The inhibi¬ tory effect of this upstream AUG on translation initiation at the downstream site will be relieved only upon removal of the intron by self-splicing, thus ensuring that no scanning ribosomal subunits reach the downstream initia¬ tion site from which translation of the toxic protein would occur. In a variation on this type of responsive RNA mole¬ cule the self-splicing intron is placed so as to interrupt a polypeptide-coding sequence. As illustrated in Fig. 2D, this molecule has an intron located between two exons that together encode the desired polypeptide. If the intron includes a stop codon, translation will be blocked. Even if the intron does not encode a stop codon, translation of the intron may be out-of-frame with the downstream exon and/or will add amino acids to the polypeptide that will likely destroy activity. Removal of the intron results in the fusion of the two exons and formation of a translat¬ able nucleotide sequence coding for a polypeptide having the desired activity.

Referring to Fig. 2D, responsive RNA molecule 40 has a 5'-end 42 and a 3'-end 44. The polypeptide is encoded in two regions, 50 and 51, separated by self-splicing intron 48. Intron 48 is overlapped by a 5'-splice junc¬ tion 58, and a 3'-splice junction 64 and includes internal guide sequence 62. The protein-coding region 50 is pre¬ ceded by a ribosome recognition sequence 56 and a transla- tional initiation codon 66. An inhibitor region 52 lies within exon 50 and is complementary to substrate region 54 which overlaps the 3'-end of region 50 and the 5'-splice junction 58 and includes stabilizer region 60. Flanking the inhibitor region on its 5' side is nucleation region 45 that is contiguous with the inhibitor region and is complementary to regions in the signal nucleic acid imme¬ diately adjacent to the anti-inhibitor region. Referring to Fig. 2E, when the inhibitor region 52 hybridizes to substrate region 54 a base-paired domain 70 forms and thus prevents the 5'-splice junction 58 from interacting with the internal guide sequence 62. Referring to Fig. 2F, signal nucleic acid 71 having a 3'-end 72 and a 5'-end 73 and including an anti- inhibitor region 74 and an anti-inhibitor extension 77 hybridizes to the inhibitor region 52 and nucleation region 45. The intermolecular base-paired domain 75 is formed. Under these circumstances, the 5'-splice junction 58 is free to interact with the internal guide sequence 62 and self-splicing occurs.

Referring to Fig. 2G, the self-splicing reaction removes all of the self-splicing intron 48 leaving the fused spliced junction 95 which contains portions of the 5'-splice junction 58 and the 3'-splice junction 64.

Other strategies, for example, where the substrate and/or inhibitor regions are contained within the intron, may be used so that upon splicing these elements are com- pletely removed. When the substrate or inhibitor domains remain in the protein-coding regions, their sequences must be carefully chosen to preserve the biological activity of the encoded protein. The degeneracy of the genetic code, the possibility of guanosine-uridine base-pairs and con- servative amino acid changes that do not eliminate the protein's activity will all be considered. Moreover, it is known that many proteins contain regions not essential to their inherent activity and that amino acid changes and/or additions in these areas do not result in a drastic loss of biological activity. The placement of the sub¬ strate and/or inhibitor domains in such a region simpli¬ fies the choice of the anti-inhibitor containing signal RNA since changes to the protein-coding sequence might be more easily tolerated. The requirement that the inhibitor region be com¬ plementary to both the anti-inhibitor region and the substrate region places certain constraints on the sequences of these regions. First, as noted above, the substrate region does not have to have the same sequence as the anti-inhibitor region of the signal nucleic acid. Since the anti-inhibitor region can be selected but not altered, the anti-inhibitor region must include a sequence identical to the sequence of the 5'-splice junction. The minimal 5'-splice junction in a Tetrahymena rRNA intron is only four nucleotides long. Since any four nucleotide sequence should occur with a probability of 1/64, many potential anti-inhibitor regions will include the sequence of the 5'-splice junction. It is very likely that many different four-base sequences can serve as a 5'-splice junction provided that the sequence of the internal guide region is adjusted to accommodate the changes in the 5'-splice junction (Zaug et al., Nature 324:430. 1986). While it is suitable for the minimal 5'-splice junction to be able to base pair with the internal guide sequence, a complex with a single mis-match can be functional (Zaug et al, Biochemistry 22∑8924, 1988). The base-paired domain formed by hybridization of the inhibitor region and the substrate region must be more stable than the base-pairing that occurs between the 5'-splice junction and the internal guide sequence during a splicing reaction. This can be accomplished by choosing an inhibitor region and substrate region that will hybri¬ dize to form a base-paired domain longer than that formed by hybridization of 5'-splice junction to the internal guide sequence. The substrate region is designed to include a stabilizer region that extends the homology between the substrate region and the inhibitor region sequence beyond the 5'-splice junction. This stabilizer region can be located just 3' of the 5'-splice junction in the case of self-splicing introns located between the ribosome recognition sequence and the initiation codon. This arrangement ensures that the stabilizer domain will be removed as part of the splicing reaction and will not interfere with the relationship between the ribosome recognition sequence and the initiation codon. The ribo¬ some recognition sequence can also be included within the region which base-pairs with the inhibitor region, but there is no requirement that this be the case. In the case of a self-splicing intron which is inserted between exons which encode portions of the same polypeptide, the stabilizer region should preferably be located within the intron, i.e.. on the 3'-side of the 5'-splice junction so that it will be removed along with the rest of the intron. It is important that the inhibitor/substrate base- paired domain be disrupted only by the signal nucleic acid and not by other nucleic acids present in cell. As dis¬ cussed above, for the first type of responsive RNA mole¬ cule, this means that the intramolecular base-pair forma- tion must be extensive enough to be disrupted only by a unique nucleic acid. This requirement can make it diffi¬ cult for the signal nucleic acid to disrupt the intramole¬ cular duplex. As outlined above, the inclusion of a nucleation region adjacent to the inhibitor region will favor hybridization of the inhibitor region to the anti- inhibitor region.

Many arrangements of the regulatory domain of the self-splicing intron and the exon will be useful. As noted above, the self-splicing intron can be located between two exons; under these circumstances while the most 5' exon of the unspliced molecule can be translated a complete functional polypeptide cannot be produced. The inhibitor region can be located on the 5'- or the 3'- side of the self-splicing intron or possibly within the intron itself. Since RNA is synthesized in the 5' to 3' direc¬ tion, it is preferred to locate the inhibitor region on the 5'-side so that the inhibitor will be synthesized and have an opportunity to hybridize to the 5'-splice junction before the production of the internal guide sequence. The inhibitor could be located on the 3 '-side of the self- splicing intron if folding of the RNA to form the splicing complex is slow compared to rate of synthesis of the inhi¬ bitor region.

It is preferred that the self-splicing reaction be specific and accurate; if the splice occurs at the wrong location, the ribosome binding site will be positioned incorrectly. In the case of a self-splicing intron located between two exons , incorrect splicing may result in an out-of-frame fusion of the polypeptide encoding sequences. Self-splicing introns in which the distance between the internal guide sequence and the 5'-splice junction is relatively short tend to catalyze more accu¬ rate splicing reactions. It is also important to ensure that there are no sequences that will be recognized as alternative 5'-splice junctions. The above described responsive RNA molecules can be prepared by any standard methodology. For example, the RNA can be produced by a transcription of a DNA molecule, either in vivo or in vitro. Generally, the RNA molecule will be produced by construction of a plasmid or viral DNA which includes sequences encoding the responsive molecule, appropriate sequences for regulated transcription of the responsive RNA molecule, and appropriate sequences for replication of the DNA. In constructing the RNA molecule, the general considerations are described above. From a practical viewpoint, it is generally preferred to identify an appropriate RNA molecule having enzymatic activity which is able to cleave itself or other RNA molecules and is preferably able to splice those two RNA molecules together, e.g.. a self-splicing RNA molecule. This RNA molecule is then modified to change the 5'-splice junction and the internal guide sequence as required within the limitations described above so that the 5'-splice junction is complementary to part of the inhibitor region of the responsive RNA molecule. This RNA molecule is then caused to be ligated to RNA which encodes the desired polypeptide and to RNA which includes an appropriate regulatory domain. If required, nucleation sites and inverted repeats can be designed into the regulatory domain.

The experiments discussed in the following Examples 3-7 describe preparation of responsive RNA molecules con- taining inactive introns which can be reactivated by the presence of specific signal RNAs. The responsive RNA molecules were prepared from the self-splicing intron or intervening sequence (IVS) in the rRNA of Tetrahvmena thermophila. For the IVS to self-splice requires the proper folding of the core structure of the IVS RNA. Included in this required conformation is a base-paired region known as P(l) that encompasses the 5'-splice site (Fig. 3). In P(l), the internal guide sequence in the IVS base pairs with the adjacent portion of the 5' exon to form a stable stem-loop structure. The 5'-splice site is located within this stem. The ability of the IVS RNA to self-splice relies on the ability of the P(l) stem to form.

A natural sequence just upstream of the 5'-splice site can also form a hairpin structure with the exon sequence immediately adjacent to the 5'-splice site (Fig. 3) . The stem-loop required for self-splicing, P(l) , and this alternative stem-loop, termed P(-l) , are mutually exclusive since the 5* exon sequence immediately adjacent to the splice site is included in both structures. The alternative stem-loop structure, P(-l) , can be made more stable by extending its stem region. See Woodson and Cech, Biochemistry. .30:2042, 1991, reporting results of a one-nucleotide change in the 5' exon (A to C change at position -14 relative to the 5'-splice site). In that mutant, self-splicing was reported to be decreased. Con¬ versely, RNAs containing mutations in the 5' exon which either diminished the relative strength of P(-l) or abol¬ ished it completely reportedly showed an increase in self- splicing activity. Three mutants which contain sequence changes in the 5* exon, which were predicted to strengthen the alternative structure, P(-l) , were made. In all three mutants, the level of in vitro self-splicing (as judged by the formation of ligated exons) was decreased relative to a parent construct in which the natural 5' exon sequence is present. One mutant, in which the stem of P(-l) has been lengthened by 5 additional base-pairs, exhibits no detectable sel -splicing activity in vitro.

Applicant demonstrated that self-splicing activity can be recovered even in this strong, non-splicing mutant by the addition of signal RNAs complementary to the upstream 5' exon sequence (inhibitor region) involved in the alternative structure. By binding to the 5' portion of the P(-l) stem, these signal RNAs disrupted P(-l) and left the sequence immediately adjacent to the 5'-splice site in single-stranded form, fully capable of hybridizing to the internal guide sequence in an active, self-splicing conformation containing P(l) .

Example 3: Plasmid Construction and DNA Preparation

The source of the IVS-containing fragment used to prepare the responsive RNA molecules was plasmid pTTlA3T7 (obtained from Dr. A. Zaug; equivalent such plasmids are readily constructed and this plasmid is used only for pur¬ poses of illustration of the invention) , which contains the 482-bp Thai fragment of Tetrahγmena thermophila rDNA inserted into the Hindlll site of pT7-2 (U.S. Biochemical Corporation, Cleveland, Ohio) on Hindlll linkers. This fragment contains rDNA sequence corresponding to 32 nt of 5' exon, the 413 nt IVS, and 37 nt of 3 -exon. The Hindlll fragment of pTTlA3T7 was isolated and inserted into the Hindlll site of pTZ19R (United States Biochemical Corporation, Cleveland, OH) to generate a plasmid con¬ taining the IVS and a small portion of the natural rDNA sequence inserted into the first few codons of the lacZ' gene, the α-complementation fragment of the 0-galacto- sidase gene. It has been reported previously by others (Been and Cech, Cell 42:207, 1986; Price and Cech, Science 228:719, 1985; Waring et al., Cell 4.0:371, 1985), that 0-galactosidase activity in E. coli relies on the ability of the IVS RNA to excise itself and ligate the lacZ^• cod¬ ing region in frame so as to produce a translatable mRNA product. In vitro mutagenesis was carried out on the pTZ19R derivative containing the rDNA insert to generate a clone in which the corresponding lacZ' RNA would self- splice ana maintain the correct reading frame. In addi¬ tion, a potentially useful Sail site was created in the 3'-exon and an in-frame AUG in the 3'-exon was destroyed to ensure that it not be used as a translation start site. The final DNA sequence and correct reading frame of the 3'-exon from the 3'-splice site (A) to the Hindlll site (underlined) in the vector sequence is shown below. pTETBLU A T AAG GTA GCC AGC CGT CGA CAT CTA ATT AGT GAC GCA AGC _TT pTETBLU DNA was then used as the parent for a series of splicing mutants in which changes were made by in vitro mutagenesis in the 5' exon sequence to improve the base- pairing ability in the alternative P(-l) stem-loop struc¬ ture. Care was taken to maintain the correct reading frame in the spliced RNA product and to avoid the creation of translational start or stop codons. The resulting sequence changes made in the 5' exon RNA and the RNA alternative structures predicted to form are shown in Fig. 3.

All site-specific mutations were generated using the in vitro Mutagenesis Kit from United States Biochemical Corporation. DNA oligos were made on an Applied Biosys- tems 394 DNA/RNA Synthesizer using phosphoramidite chem¬ istry and purified using OLIGOCLEAN™ columns (United States Biochemical Corporation) prior to use as mutagenic oligo. Plasmids were maintained in strain MV1190 (E. coli A (srl-recA) 306::TN10 A ac-pro. thi-supE (F' pro A+B+ lacl° lacZ A Mi5 traD36.. Each plasmid was verified by DNA sequencing (Tabor and Richardson, Proc. Natl. Acad. Sci. USA 84:4767, 1987). Plasmids for use as in vitro transcription templates were purified by Qiagen (Qiagen Inc., Chatsworth, CA) maxi-column preparation as described by the manufacturer except that the final DNA preparation (400 μl) was extracted two times with an equal volume of phenol, once with chloroform, and ethanol precipitated in the presence of 0.25 M Tris-HCl, pH 7.5. The plasmids were linearized by cleavage with either EcoRI or BamHI to generate tem¬ plates on which runoff T7 transcription will yield full- length RNA of 548 or 527 nt, respectively. (The T7 pro¬ moter sequence is located immediately upstream of the polycloning site and within the coding sequence of 3-galactosidase.)

Example 4: Signal RNAs Short signal RNAs (11-26 nt) were chemically synthe¬ sized on an Applied Biosystems 380B DNA synthesizer using phosphoramidite chemistry. Prior to use, the signal RNAs were desalted using a C₁₈ SEP-PAC* cartridge (Millipore Corporation) , gel-purified and quantified by absorbance at 260 nm. Signal RNAs were stored at -20"C in 1 mM EDTA, 10 mM Tris-HCl (pH 7.5). The sequences of the signal RNAs specific for precursor RNA from PTET1419 and pTET21-24 (see FIG. 3) are given below: pTET1419 4S 3' GCCGCUCUCAG 5' 4S3 3' GCCGCUCUCAGUGAU 5' pTET21-24 8S4 3' CGCCCAUUUAAAUCUCUCAGUGAUA 5'

12S 3^« CGGAAACGCCCAUUUAAAUCUCUCAG 5' These signal RNAs are complementary to the upstream exon sequence which forms the 5* side of the P(-l) stem in the given construct. The underlined nucleotides corres¬ pond to the portion of the signal sequence that will base pair with 5' exon sequence involved in the P(-l) stem, the remaining nucleotides base pair either with nucleotides at the base of the stem or in the loop. For example, signal RNA 4S3 will base pair with 4 nt 5• to the base of the stem in pTET1419 RNA, all the nucleotides included in the 5' side of the P(-l) stem and 3 nucleotides in the loop.

In pTET14 RNA (see FIG. 3), a U to C change at -14 relative to the 5'-splice site allows the formation of an extra C-G base-pair to lengthen the P(-l) stem. This par¬ ticular sequence change was reported by Woodson and Cech (Woodson and Cech, Biochemistry 30:2042. 1991) to decrease self-splicing activity of a short precursor RNA. pTET1419 RNA has an additional nucleotide change (G to A at -19) which allows P(-l) to form a more stable stem by creating an A-U base pair in place of a less stable G-U base pair. Finally, pTET21-24 RNA has a very stable P(-l) stem gener¬ ated by 4 additional nucleotide changes (at positions -21 to -24 relative to the splice site) . Calculated free energies at 37"C for these structures, based on the most current values in the literature (Freier et al., Proc. Natl. Acad. Sci. USA £3.:9373, 1986; Jaeger et al., Proc. Natl. Acad. Sci. USA 86:7706, 1989), are also given in Fig. 3. In all of these constructs, nucleotide changes were made in the upstream 5' exon only, without altering the IVS or the 13 nt at the 3' end of the 5' exon.

On templates linearized with EcoRI or BamHI. full- length transcription from the T7 promoter yielded tran¬ scripts of 548 and 527 nt, respectively. These differed only in the length of their 3'-exon (92 vs. 71 nt) , but had equivalent length 5' exons (43 nt) and IVS RNA (413 nt) . Correct ligation of the 3'-exon to the 5' exon with excision of the IVS yielded an RNA of 135 nt for the EcoRI runoff transcript and 114 nt for the corresponding BamHI transcript. The appearance of ligated exons is an indi¬ cation of the level of self-splicing supported by a par¬ ticular IVS-containing construct.

Example 5: Decreasing Self-Splicing bv Increasing Stability of P.-l.. In vitro transcription was performed as follows. Transcription reactions using T7 RNA polymerase were carried out in transcription buffer (40 mM Tris-HCl, pH 7.5, 5 mM MgCl₂, 10 mM dithiothreitol, 4 mM spermidine) containing 500 μM each NTP and -10 μCi [α³²P]CTP. Indivi¬ dual reactions (10 μl total volume) contained 0.1 μg line- arized plasmid template and 20-30 U T7 RNA polymerase. After 30 minutes at 30^βC, 2 μl of each sample was removed and mixed with 2 μl buffered forma ide containing xylene cyanol FF and bromphenol blue (formamide/dye mix) . The remainder of the sample was warmed to 37*C, and 2 μl of 1M NaCl, 20 mM MgCl₂, 1 mM GTP was added to adjust the reac¬ tion conditions to better support splicing. After 15 or 60 minutes as noted, 2.5 μl samples were removed and mixed with 2.5 μl of the formamide/dye mix. Samples were ana¬ lyzed on denaturing gels containing 4% (19:1) aσrylamide: bisacrylamide and 7M urea in 0.4 X TBE (TBE is 89 mM Tris, 89 mM boric acid, 0.025 mM EDTA). Electrophoresis was carried out at 30-60 watts using 0.4 X TBE as running buffer. Gels were exposed to Kodak XOMAT XAR-5 film.

For gel purification of ³²P-labelled, precursor RNAs, transcription reactions were scaled up 2.5- to 10-fold and incubated 1-2 hours at 37^βC. In some cases, the concen¬ tration of each NTP was increased to 2.5-3 mM in an attempt to reduce self-splicing during the transcription reaction and thereby maximize the recovery of full-length transcripts. An equal volume of formamide/dyes was added to the completed reaction and the entire reaction was loaded onto a denaturing gel as described above. After visualization by autoradiography, the region of the gel containing the full-length transcript was excised and placed in 0.5-1 ml 0.5 M ammonium acetate, 1 mM EDTA. After 12-16 hours at 4°C, the eluent was removed and the RNA precipitated by the addition of 2.5 volumes of etha- nol. The final RNA pellet was resuspended in 1 mM EDTA, 10 mM Tris-HCl (pH 7.5) and stored at -20°C. Transcription using the parent plasmid and the modi¬ fied constructs as templates was carried out in the pres¬ ence of [α.³²P]CTP to generate ³²P-labelled transcripts that could be analyzed for their ability to self-splice (Fig. 4, 0 min). Full-length transcripts (FL) , a slight amount of IVS RNA (IVS) , and additional "intermediate" RNA products (*) , were present for all templates. A small amount of an RNA product of the appropriate length to be ligated exons (LE) from the EcoRI run-off transcript (135 nt) as well as from the BamHI run-off transcript (114 nt) was also visible, and indicated that a limited amount of splicing could occur under these transcription conditions. This faint band decreased in intensity with the order pTETBLU>pTET14>pTET1419 and was not visible in pTET21-24.

From analysis of the resultant RNA products, it is clear that transcription of the parent plasmid, pTETBLU, generated transcripts capable of efficient self-splicing. This is evidenced by an increased amount of ligated exons 15 and 60 minutes after adjusting the conditions to better support splicing.

By comparison of the amount of ligated exon produced, it is apparent that transcripts from pTET14 and pTET1419 were still capable of self-splicing, although less effi¬ ciently than transcripts from the parent pTETBLU. Both pTET14 and pTET1419 produced fewer ligated exons than pTETBLU when shifted to splicing conditions, and of these two mutants, pTET1419 was the least efficient. Under the same conditions, however, transcripts from pTET21-24 did not appear to self-splice. No ligated exons were visible for pTET21-24 precursors after conditions were altered to support splicing. The relative observed ability of these three mutant constructs to self-splice, then, follows the order expected based on the increasing stability of the P(-l) stem, i.e. , there is a negative correlation between the strength of the P(-l) stem and the RNA's ability to self-splice. Moreover, the presence of the highly stabil¬ ized P(-l) stem in pTET21-24 reduced in vitro splicing to undetectable levels.

Under splicing conditions, a number of RNA products in addition to the ligated exons were visualized. As expected, splicing of the pTETBLU transcript generated a significant amount of the excised IVS RNA in its various forms (circular and linear IVS and the shortened forms lacking the 5' 15 or 19 nt) . Some of these products were visible for the mutant transcripts as well, even for pTET21-24 where no ligated exons were visible. The pres¬ ence of these IVS products may reflect the ability of these mutant RNAs, which are to various degrees misfolded at the 5'-splice site due to a stronger than normal P(-l) stem, to still support hydrolysis at their 3'-splice site (See Woodson and Cech, Biochemistry 3__0:2042, 1991). Although no released 3'-exon was visible, one RNA product that was greatly enhanced in the mutant RNA lanes (indi¬ cated with an asterisk in Fig. 4) , was of the appropriate size to represent the 5' exon-IVS RNA. This 5' exon-IVS RNA would still be expected to undergo circularization reactions, producing the linear IVS products (L-15 and L-19) seen on the gel. The short RNA indicated with an arrowhead is unidentified. This RNA increased in inten- sity after the switch to splicing conditions. It also seemed to increase in abundance as the ability of the precursor RNA to self-splice decreased, and thus was most prominent in the pTET21-24 RNA lanes.

It is clear from the lack of ligated exons in the pTET21-24 lanes that this mutant was unable to undergo correct ligation of the two exon products. The apparent side reactions of the mutant IVS-containing RNAs (e.g. , the formation of the RNA product labeled with the aster¬ isk) when unable to undergo a correct splicing reaction may be able to be used advantageously. For example, this "self-destruction" may be beneficial for IVS-containing mRNAs that encode toxins where rapid turnover of the message would further diminish the possibility that a toxin be produced in the absence of the proper signal. Example 6: Reactivity of Splicing Reaction by Signal RNA Gel-purified, full-length RNA precursors were sub¬ jected to splicing conditions in the absence or presence of signal RNAs to test the ability of short RNAs comple- mentary to the upstream 5' exon sequence to disrupt the P(-l) structure and thereby allow the active P(l) struc¬ ture to form.

Splicing reactions using gel-purified precursor RNAs were carried out by incubating 0.1-0.25 pmole of ³²P- labelled transcription 10 μl splicing buffer (200 mM NaCl, 200 μM GTP, 30 mM Tris-HCl, pH 7.5) in the presence of 0 to 1000-fold molar excess of signal RNAs. After warming to 37°C, MgCl₂ was added to 5 mM to initiate the splicing reaction. Incubation periods ranged from 10 to 120 min¬ utes at 37^βC, at which times samples were removed and mixed with an equal volume of formamide/dye. Samples were analyzed on denaturing gels as described above.

If self-splicing were reactivated, more ligated exon products would be expected to be produced in the presence of these signal RNAs than in their absence. Results of experiments demonstrating reactivation of the splicing reaction are given for pTET1419 RNA in Fig. 5 and for PTET21-24 RNA in Fig. 6.

As seen previously in Fig. 5, incubation of pTET1419 RNA under splicing conditions in the absence of any signal RNA generated a small amount of ligated exon product. With gel-purified transcript, this was again the case (Fig. 5). It may be that the P(-l) stem in pTET1419 RNA is not stable enough to completely inhibit the formation of P(l) , so a small amount of splicing still occurred. The amount of ligated exons produced increased, however when either of two specific signal RNAs was present in incubation. Even with an extremely low signal-to- transcript ratio (0.1:1), a slight elevation in the amount of ligated exons was seen. As the signal-to-transcript ratio was increased (up to 1000:1), the production of ligated exons also increased. These experiments showed that the ability of pTET1419 RNA to correctly self-splice and produce ligated exons responds directly to the pres¬ ence of a specific signal RNA, and that a significant level of self-splicing is recovered. A similar response to signal RNAs was seen with gel- purified pTET21-24 RNA (Fig. 6) . As noted before, with pTET21-24 RNA, no ligated exons were visible when the transcript was incubated alone (see also Fig. 4) . This indicates that the P(-l) stem in pTET21-24 RNA is suffi- ciently stable to completely inhibit the formation of P(l) . Upon addition of either of two signal RNAs (8S4 or 12S) specific .for this transcript, however, ligated exons are produced. That the ³²P-labelled RNA products are ligated exons can be seen by comparing their length to that of ligated exons produced from pTETBLU RNA. Splicing of transcripts produced from EcoRI-digested templates pro¬ duced ligated exons of 135 nt in length. Transcripts from templates linearized with BamHI produced ligated exons that were correspondingly shorter (114 nt) . Thus, even though the splicing reaction was turned completely "off" in the pTET21-24 RNA itself, it was still possible to reactive the splicing reaction with a specific signal RNA.

For the EcoRI runoff transcripts shown on the left of

Fig. 6, there was a second major product (indicated with a dot) that also seemed to respond to the presence of the signal RNAs. This RNA is shorter than the correctly ligated exons, and at this time its origin in unknown. Splicing at an alternative site or a specific breakdown of the RNA are possibilities.

Example 7: Colony Color Assay

When grown on LB or B agar plates containing 5-bromo- 4-chloro-3-indoyl-0-D-galactoside (X-gal) , a chromogenic substrate of 3-galactosidase, pTETBLU-containing colonies are dark blue as expected for a colony producing 0-galac- tosidase. Since the coding region of the α-complementa- tion fragment of _/3-galactosidase on pTETBLU is interrupted by the Tetrahvmena IVS, this RNA must be correctly self- splicing in order to produce an active α-fragment. If self-splicing is not occurring, stop codons present in all three reading frames in the IVS would not allow transla- tion into the downstream portion of the gene. For compar¬ ison, a control plasmid (pTETULB) in which the intron- containinc, Hindlll fragment from pTETBLU is inserted into pTZ19R in the reverse orientation was constructed. For this control, where no splicing can occur due to the wrong orientation, the resulting colonies are white.

Theoretically, then, cells containing mutants which are deficient in splicing should produce lighter blue colonies, while colonies of non-splicing mutants would be white. Under standard growth conditions, cells containing pTET1419 and pTET21-24 mutants grew as colonies that were considerably lighter in color than cells containing the parent plasmid pTETBLU, but not white. This appears to indicate that even the strongest non-splicing mutant, PTET21-24 (as judged by its inability to form ligated exons in vitro, is still capable of forming the minimal amount of spliced message necessary to support translation of a level of an α-fragment of 3-galactosidase that could confer blue color to the colonies. Other scientists have noted /8-galactosidase activity (blue colony color) with IVS-containing constructs in which self-splicing should have left the 0-galactosidase message in an untranslatable frame (Been and Cech, Cell 47:207, 1986; Price and Cech, Science 228:719. 1985) . It may be that alternative splice sites exist. For a more quantitative determination, _/3-galactosi- dase assays were carried out on plasmid-containing cells growing in culture. (Miller, Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1972). For this assay, o-nitrophenyl-_/3-D- galactoside (ONPG) was used as the chromogenic substrate because its product after cleavage with 3-galactosidase can be measured spectrophotometrically. A control plasmid (pTETULB) was constructed in which the intron-containing Hindlll fragment from pTETBLU was inserted into pTZ19R in the reverse orientation and was used to determine back¬ ground levels of spontaneous breakdown of ONPG. In these experiments, cells containing either the parent plasmid or the splicing mutants were grown under inducing conditions (i.e.. in the presence of IPTG, a lactose analog) . Pro¬ duction of active 3-galactosidase in cells containing the pTET1419 and pTET21-24 splicing mutants was reduced to a few percent of the parental values, thus indicating that the changes in the RNA were reflected, not only by a decrease in the amount of is vitro self-splicing, but by a concomitant decrease in the amount of active protein produced in the E. coli cell. Use

The responsive RNA molecules of the invention are useful for producing cells that respond to the presence of a given virus. In particular, in the case of large-scale in vitro cell culture for commercial production of bio- logical compounds, viral contamination is a serious prob¬ lem which can lead to destruction of the entire culture. In many instances there is no way to prevent viral infec¬ tion of such cells. The molecules of the invention will allow creation of cell lines that are resistant to any given virus in that any cells whiHP LaserJet Series IIHPLASEII.PRSffect the physiological state or viability of a particular cell type. In the case of responsive RNA molecules that are regulated by the formation of a base- paired domain within a protein-coding region the method requires construction of a responsive RNA which encodes a protein which will affect the physiology or viability of a cell; and identification of an signal RNA which is specific to the cell type, i.e.. an RNA molecule which carries a nucleotide sequence that is only present or accessible in the RNA population of the cell type which is to be affected. For responsive RNA molecules regulated by self-splicing introns the method requires construction of a responsive RNA which encodes a protein which will affect the physiology or viability of a cell. The active protein must be translated from the spliced message and not the unspliced message. It also requires identification of a signal RNA which is specific to the cell type, i.e.. an RNA molecule which carries a nucleotide sequence that is only present or accessible in the RNA population of the cell type which is to be affected.

For example, a responsive RNA can be designed to specifically kill: virus-infected cells containing viral RNA and not uninfected cells; cells containing mutant RNA and not cells containing wild type RNA; cells in a parti¬ cular tissue or organ and not other kinds of cell in the organism; and neoplastic or cancer causing cells contain- ing abnormal RNA within a population of cells and not cells containing normal cellular RNA.

The efficacy of such a responsive RNA in altering the physiological state of a cell will depend upon the respon¬ sive RNA being delivered to the location in the cell where the signal nucleic acid resides; the responsive RNA having all of the nucleoside sequences required for all the pro¬ cesses leading to production of the encoded protein including splicing, poly-A addition, capping, transport across the nuclear membrane, and translation initiation; and the responsive RNA must carry sequence elements which confer stability to RNA in the nucleus as well as the cytoplasm.

A responsive RNA molecule can be delivered into a cell in the form of RNA or in the form of a gene made of DNA or RNA. Delivery of RNA into a cell can be accom¬ plished by needle injection, or by the use of liposomes including those made of cationic lipids. Delivery of the responsive RNA in the form of a gene can be accomplished by the use of a nonvirulent virus. This would require the insertion of the responsive RNA-encoding gene along with the transcriptional or replicative signal elements into the genome of the virus. Retroviruses, polyoma viruses, and vaccinia virus have been engineered which are capable of delivering and expressing genes, and other viruses could be developed and used for this purpose.

Another general method of using a responsive RNA to control the physiology of a particular cell type involves a responsive RNA gene integrated into the genome of a cell. The activation of splicing of the responsive RNA could be caused by exogenously added polynucleotides.

Other embodiments are within the following claims.

Claims

Claims

1. A responsive RNA molecule having a ribosome recognition sequence, a regulatory domain, a substrate region, and encoding, in one or more protein-coding regions, a polypeptide; said regulatory domain comprising an inhibitor region and complementary to said substrate region; said inhibitor and substrate regions being capable of forming a base-paired domain in the absence of a signal nucleic acid; said base-paired domain reducing the level of translation compared to that level observed in the absence of said base-paired domain; said signal nucleic acid having an anti-inhibitory region complementary to said inhibitor region which, when base-paired with said inhibitor region, increases the level of translation of said responsive RNA compared to the level of translation of said responsive RNA observed in the absence of said signal nucleic acid.

2. The responsive RNA of claim 1 wherein said protein-coding region is an exon.

3. The responsive RNA of claim 1 wherein said substrate region comprises part of one said protein- coding region.

4. The responsive RNA of claim 2 wherein said substrate region comprises part of an intron.

5. The responsive RNA of claim 2 wherein said substrate region comprises part of an intron adjacent to the 5'-end of one said exon.

6. The responsive RNA of claim 1 wherein said substrate region includes part of said ribosome recog- nition sequence.

7. The responsive RNA of claim 6 wherein said ribo¬ some recognition sequence is a ribosome binding site.

8. The responsive RNA of claim 1 wherein said responsive RNA is purified.

9. The responsive RNA of claim 1 wherein said poly¬ peptide modifies cell viability, cell proliferation, tran¬ scription of DNA, translation of RNA, or replication of DNA.

10. The responsive RNA of claim 9 wherein said polypeptide has cytotoxic activity or ribonuclease activity.

11. The responsive RNA of claim 10 wherein said polypeptide is selected from the group consisting of the active subunit of diphtheria toxin, the active subunit of cholera toxin, ricin, and the hok, gef, RelF or flm gene products of E. coli.

12. The responsive RNA of claim 14 wherein said intron prevents the complete translation of said one or more exons.

13. The responsive RNA of claim 4 wherein said intron reduces the level of translation of said one or more exons compared to the level of translation of said exon in the absence of said intron.

14. The responsive RNA of claim 4 wherein said intron is located between said ribosome recognition sequence and a protein-coding region.

15. The responsive RNA of claim 4 wherein said first intron is located between two said exons.

16. The responsive RNA of claim 4 wherein said intron is bordered at its 5'-end by a 5'-splice junction and at its 3'-end by a 3 '-splice junction.

17. The responsive RNA of claim 15 wherein said sub- strate region comprises a 5'-splice junction bordering said intron.

18. The responsive RNA of claim 16 wherein said intron catalyzes two RNA cleavage reactions, one within said 5'-splice junction and one within said 3 '-splice junction.

19. The responsive RNA of claim 18 wherein said sub¬ strate region comprises the 5'-splice junction of said intron.

20. The responsive RNA of claim 19 wherein said inhibitor region reduces the level of occurrence of said cleavage reaction within said 5'-splice junction.

21. The responsive RNA of claim 1 wherein said signal nucleic acid is single-stranded.

22. The responsive RNA of claim 10 wherein said signal nucleic acid is a viral RNA.

23. A DNA molecule encoding the responsive RNA of claim 1.

24. The responsive RNA of claim 19 wherein said responsive RNA comprises a 5'-splice junction RNA of Tetrahymena thermophila having at least one base modified compared to a native 5'-splice junction.

25. A method for specifically interfering with the growth of a cell harboring a signal nucleic acid by intro- ducing into the cell the responsive RNA wherein said responsive RNA comprises a ribosome recognition sequence, a regulatory domain, a substrate region, and encoding, in one or more exons, a polypeptide; said regulatory domain comprising an inhibitor region complementary to said sub¬ strate region; said inhibitor and substrate regions being capable of forming a base-paired domain in the absence of a signal nucleic acid; said base-paired domain reducing the level of translation of said responsive RNA molecule compared to the level of translation in the absence of said base-paired domain; said signal nucleic acid having an anti-inhibitor region complementary to said inhibitor region which, when base-paired with said inhibitor region, increases the level of translation of said responsive RNA compared to the level of translation of said responsive RNA observed in the absence of said signal nucleic acid.