EP0558491A1 - Virus resistance in plants - Google Patents

Abstract

An RNA-dependent replicase (RdRp) comprises P1a and P2a polypeptides from a cucumber mosaic virus and tobacco P50 polypeptide. It may also contain other constituents of minor polypeptides. Each polypeptide can be substituted by another coming from an analogous source of equivalent function. Also described is a recombinant plant genome having resistance to viruses and comprising a gene expressing a product which inhibits the expression or catalytic activity of viral RNA replicase. This product can in particular be (1) an antibody directed against a protein component of the replicase or (2) RNA in an antisense orientation with respect to the RNA coding a protein component of the replicase.

Description

VIRUS RESISTANCE IN PLANTS

This invention relates to the prevention of disease in plants, more specifically, to the production of plants with recombinant genomes (transgenic plants) which are resistant to infection by viruses.

Many important human and animal viruses, most plant viruses and some bacteriophages have genomes of positive-strand (messenger-sense) RNA (Matthews, 1982) . Examples include poliovirus, foot and mouth disease virus, tobacco mosaic virus, cucumber mosaic virus and bacteriophages MS2 and Q_fl.

Replication of virus RNA is catalysed by an RNA-dependent RNA polymerase (RdRp) and takes place in two stages: (1) synthesis of a complementary

(negative-strand) RNA using the virus genomic RNA as a template; and, (2) synthesis of progeny virus genomic RNA using the negative-strand RNA as a template. The best characterised RdRp is that of bacteriophage Q_ which has been purified to homogeneity and shown to consist of one virus-encoded polypeptide and three host polypeptides ( 3lumenthal & Carmichael, 1979). This enzyme has a specific template requirement for Q_ RNA and catalyses both stages of the replication process. A number of template-dependent RdRp preparations have been obtained from cells infected by eukaryotic viruses, ie, poliovirus (Van Dyke and Flanegan, 1980, Baron and Baltimore, 1982, Hey e_t at^*.. , 1987; Lubinski et al., 1987), black beetle virus (Saunders & Kaesberα, 1985), turnip vellow mosaic virus (Mouches e_t al_. , 1985), brome mosaic virus (Miller and Hall, 1983; Quadt et. at., 1988) , cowpea chlorotic mottle virus .Miller and Hall, 1984) and alfalfa mosaic virus (Houwing and Jaspers, 1986). However none of these enzyme preparations was able to catalyse complete replication of its RNA template.

The genome of CMV is divided among three RNAs designated RNA 1 (3.4 kb) , RNA 2 (3.0 kb) and RNA 3 (2.1 kb) (Gould and Symons, 1982; Rezaian et. al. , 1984, 1985). These RNAs serve as messenger RNAs for non-structural proteins Pla, P2a and P3a respectively. RNA 3 also encodes the virus coat protein which is translated from a subgenomic RNA designated RNA 4 (1.0 kb) . RNA 1, 2 and 3 are required to infect plants systemically and the function of protein P3a is believed to be the potentiation of movement of virus particles from cell-to-cell . RNA 1 and RNA 2 together, but not separately, have been shown to induce the synthesis of a membrane-bound RNA polymerase in tobacco protoplasts (Nitta et a_l. , 1988), suggesting a role for proteins Pla and P2a in RNA replication. However attempts to produce a soluble, template-free CMV polymerase or to demonstrate the presence of proteins Pla and P2a in RNA containing membrane-bound polymerase preparations have hitherto been unsuccessful (Gordon e_t a_ . , 1982; Jaspers et a_l . , 1985) .

An object of the present invention is to provide a viral replicase capable of catalysing complete replication of its RNA template and the use of that replicase to impart virus resistance to plants .

According to the present invention there is

HEET provided an RNA-dependant replicase (RdRp) comprising polypeptides which includes: proteins Pla and P2a of cucumber mosaic virus or homologous or analogous proteins from another virus; and polypeptide P50 of tobacco, or a homologue or analogue thereof from another plant species.

The invention also provides a recombinant plant genome having^' virus resistance comprising a gene expressing a product which inhibits expression of or inhibits the catalytic activity of viral RdRp.

The said product may be an antibody directed against the protein Pla or P2a of cucumber mosaic virus, or a homologue or analogue of either protein from another virus, against polypeptide P50 of tobacco, or a homologue or analogue thereof from another plant species or against any other component of the replicase.

Alternatively the said product may be RNA in antisense orientation to the RNA encoding the protein Pla or P2a of cucumber mosaic virus, or a homologue or analogue of either protein from another virus, to polypeptide P50 of tobacco, or a homologue or analogue thereof from another plant species or to any other component of the replicase.

The said product may also be RNA coding for a truncated or otherwise modified form of a protein (for example, Pla, P2a or P50) which is an essential component of the replicase. Production by the plant of such modified proteins can disrupt the function of the replicase.

The said product may also be a ribozyme adapted to cut RNA coding for an essential component of the replicase.

The invention further provides monoclonal or polycional antibodies which inhibit the replication of cucumber mosaic virus _irι vitro. Such antibodies may also inhibit the replication of other plant viruses.

The said antibodies may be prepared by a method comprising injecting a mammal with a substance selected from the group consisting of: (i) a purified RNA replicase extracted from a plant infected with cucumber mosaic virus; (ii) the protein Pla or a peptide fragment thereof;

(iii) the protein P2a or a peptide fragment thereof; and,

(iv) the protein P50 or a peptide fragment thereof; (v) any other protein component of a purified RNA replicase (particularly one of the minor protein constituents of the replicase that binds specifically to the negative strand of the viral RNA), or a peptide fragment thereof; and thereafter recovering polyclonal antibodies from serum extracted from the injected mammal or producing hybridomas which produce monoclonal antibodies or cloning DNA sequences from the animal or from the hydridomas into a vector and expressing the antibody in an expression system.

The said proteins Pla, P2a, and P50 may be produced by isolation from the purified replicase or by cloning the respective gene in an expression vector and expression thereof in a bacterial expression system. Peptideε corresponding to regions of target proteins may be produced by degradation of the proteins or by direct synthesis.

The invention also provides a DNA sequence which encodes an antibody which inhibits replication of the cucumber mosaic virus replicase; and, additionally, tranεgenic plants, resistant to

SUBSTITUTESHEET virus infection, which contain such a sequence stably incorporated within their genomes.

Several mechanisms are known to inhibit expression or activity of proteins. Actual transcription of the RNA encoding the target protein may be suppressed by expression of RNA in antisense orientation to that RNA. The catalytic activity of the target protein may be inhibited by expression of an antibody to the protein, or by expression of modified or truncated forms of the protein or of RNA coding for such forms.

In the present invention, therefore, viral replication in a host plant may be inhibited by expression of antisense RNA directed against the RNA encoding protein Pla or protein P2a of the virus or against protein P50 of the plant. Alternatively, antibodies directed against the RdRp may be expressed in plant cells. Alternatively modified or truncated forms of these proteins, or of RNA coding for such forms, may be expressed in plant cells.

In order to achieve such effects it is necessary to be able to isolate the replicase and, therefore, in the following description we describe the purification and properties of an RdRp isolated from plants infected by cucumber mosaic virus ( CMV) .

We have isolated a CMV RdRp which is soluble, completely dependent on addition of CMV RNA as a template and contains proteins Pla and P2a, as well as a host polypeptide. Furthermore the enzyme catalyses the synthesis of both stages of the replication process: ie, th-^* synthesis of positive-strand RNA, as wel„ as negative-strand RNA.

There have been no previous reports of the

T complete replication of a eukaryotic virus RNA by a purified template-dependent RNA polymerase.

The invention will now be described by way of illustration, in the following Example, and with reference to the accompanying drawings, of which: Figure i is the results of non-denaturing gel electrophoresis of products of RdRp reactions: Lanes 1 to 5, products of RdRp fraction 4 reactions; lanes 6 to 8 , products of RdRp fraction 6 reactions. Reactions were programmed with: lane 1, CMV RNA; lane 2, no added RNA; lanes 3 and 6, RNA 3; lanes 4 and 7, RNA 2; lanes 5 and 8, RNA 1. Double arrowheads indicate dsRNA bands. Single arrowheads indicate ssRNA bands. Bands were detected by autoradiography.

Figure 2 relates to the analysis of ssRNA synthesised in an RdRp reaction:

Figure 2A: The band corresponding to to ssRNA 1 (Figure 1) was gel extracted, heated to 100°C for 30 seconds, annealed to oligonucleotides, and treated with ribonuclease H. The products were then electrophoresed through 1.2% agarose- formaldehyde gels and detected by autoradiography. Lane 1, ssRNAl reaction product; lane 2, ssRNA reaction products plus ribonuclease H; lane 3, ssRNA 1 reaction product + Pi + P2 + ribonuclease H; lane 4, ssRNA 1 reaction product + P3 + P4 + ribonuclease H; lane 5, ssRNA 1 reaction product + Pi + P2 + P3 + P4 + ribonuclease H. The sizes, shown by the side of the gel photograph, are in kilobases. The genomic RNA is indicated by a double arrowhead and ribonuclease H products by a single arrowhead.

Figure 2B is a diagram showing the expected products from ribonuclease H digestion of positive- strand RNA I annealed to PI and P2 or neqative-

EET strand RNA 1 annealed to P3 and P4. The sequences of the oligonucleotides are :

Pi, 5'-AT„.GGTCATACCATTG-3' Cnucleotides 988-1003) P2, 5'-GACAGCATGAAGTTTC-3' (nucleotides 2488-2503) P3, 5'-GTCTTATGTTCACGAT-3' (nucleotides

928-948) P4, 5 ' -AAGTGAGGAAGTCTGT-3 ' (nucleotides 2717-2733) .

Figure 3 shows the results of gel electrophoretic analysis of proteins of RdRp fractions. Proteins were electrophoresed in

SDS-polyacrylamide gels and detected by silver staining (lanes 1 to 7), by Western blotting and probing with antisense to the protein Pla (lanes 8 to 11) or antiserum to protein P2a (lanes 12 to 15), or by blotting followed by antibody-linked polymerase assay (ALPA) with antiserum to protein Pla (lanes 16 to 19) or with antiserum to protein P2a (lanes 20 to 23). Lanes 1, 8, 12, 16 and 20, protein P2a expressed in E.col lanes 2, 9, 13, 17, and 21, protein Pla expressed in E.coli; lanes 3, 10, 14, 18 and 22, fraction 4 from healthy plant; lanes 4, 11, 15, 19 and 23, RdRp fraction 4 from CMV-infected plant; lane 5, RdRp fraction 5 om CMV-infected plant; lane 6, RDRP fraction 6 from CMV-infected plant; lane 7, inactive fraction 6 from CMV-infected plant. The M^r of marker proteins are shown on the side of the gel: myosin (205 Kd) , 3-galactosidase (116 Kd) , phosphorylase B 7Kd), bovine serum albumin (66Kd), ovalbumin (45Kd). The two faint bands in the M^r range of 55κd to 60 Kd detected in all silver-stained lanes (lanes 1 to 7) were also detected when only the buffer used to prepare the samples was applied to the gel (not shown); bands in this range are a commonly encountered artefact in silver-stained gels and have been attributed to

EET traces of keratin-type proteins in the reagents used to prepare the samples for protein gel analysis (Ochs, 1983)..

Figure 4: antibody-linked polymerase assays ALPA) of fraction 6.

Lane 1. ALPA using pre-immune sera. Lane 2. ALPA using mAB/HP. Lane 3. ALPA using^' mABlal. Lane 4. ALPA using mAB/2a3. Figure 5: effect of polyclonal antisera on replicase assays.

Various amounts of pre-immune δ-globulin, polyclonal antibodies or monoclonal antibodies were added to a 20μl replicase assay. Pla P/C and P2a P/C antibodies are polyclonal antibodies raised against CMV proteins Pla and P2a respectively. mAB/lal and mAB/2a3 are monoclonal antibodies against protein Pla of RNA 1 and protein P2a of RNA 2 respectively. Replicase P/C are polyclonal antibodies raised in rabbits injected with Fraction 6.

Figure 6: effect of polyclonal antibodies raised against peptides on replicase activity.

Various amounts of pre-immune δ-globulin or lyclonal antibodies were added to a 20 μl replicase assay.

Peptide 1. HVAGVAGCGKTTAIC (la sequence). Peptide 2. KTVHESQGISEDHC (la sequence). Peptide 3. QRRTGDAFTYFGNTC (2a sequence). Peptide 4. HRLLFSGDDSLAFSC (2a sequence).

Figure 7: effect of mAB/HP on replicase assays .

Various amounts of pre-immune δ-globulin or polyclonal antibodies were added to a 20 ul replicase assay.

Figure 8: interaction of 3'-terminal sequences

SUBSTITUTESHEET with Fraction 3.

Tt.s 32P-labelled 150 nucleotides from positive-sense (lanes 1 & 3) or negative-sense (lanes 2 & 4) CMV RNA 1 were incubated with Fraction 3 prepared from healthy plants 'lanes 1 & 2) or CMV infected plants (lanes 3 & 4) .

Figure 9: competition binding of 3' terminal 150 nucleotides of negative-sense RNA 1.

The 32P-labelled 3' terminal 150 nucleotides from negative-sense RNA 1 was incubated with Fraction 3 from healthy plants together with unlabelled 3' terminal 150 nucleotides of negative-sense RNA 1 (lanes 1, 2 & 3) or unlabelled 3' terminal nucleotides of positive sense RNA (lanes 4, 5 & 6) at molar ratios of 100:1 (lanes 1 & 4), 10:1 (lanes 2 & 5) or 1:1 (lanes 3 & 6).

Figure 10: effect of polyclonal antibodies on protein-RNA binding.

The 3' terminal 150 nucleotide from positive-sense (lanes 1 & 3) or negative-sense RNA (lanes 2, 4, 5 & 6) were incubated with Fraction 3 from infected plants (lanes 1 to 5). Lane 6 shows the effect of incubation with Fraction 3 from healthy plants. After 10 minutes incubation pre-immune δ-globulin (lane 5) or antibodies against Pla (lanes 1 & 3) or P2a (lanes 2 & 4) were added.

Figure 11: effect of mAB/HP on protein-RNA binding.

The 3' terminal 150 nucleotides of negative- sense RNA was incubated with Fraction 3 from healthy (lane 3) or infected plants (lanes 1 & 2). After 10 minutes incubation mAB/HP was added to the protein-RNA from infected plant complex (lane 1) . Figure 12: determination of the size of RNA binding proteins. Fraction 3 from healthy plants was incubated with 32P-labelled RNA corresponding to the 3 ^r terminal 150 nucleotides of positive-sense 'lanes

3) or negative-sense (lanes 2, 3 & 5) RNA. After UV cross-linking and RNase digestion (lanes 2, 3 &

4) or UV cross-linking. RNase digestion and proteinase K treatment (lane 5), the proteins were electrophoresed through a 10% SDS-PAGE gel. Lanes 2 to 5 show the autoradiograph of the dried down gel. On the same gel Fraction 6 from infected plants was co-electrophoresed (lane 1). The proteins in this lane were transferred to nitro-cellulose and probed in a Western blot with mAB/HP. A number of monoclonal antibodies that inhibit CMV replicase have been prepared by the process of the invention. Details of their efficacy and mapping are shown in Table I below.

SUBSTITUTESHEET TABLE 1 MONOCLONAL ORIGINAL COMMENTS

ANTIGEN ANTIBODY

mAB/lal Replicase Very effective replicase inhibitor (~60%). Maps in helicase region around nucleotide 2880 of RNA 1.

mAB/la2 Replicase Very poor replicase inhibitor ( -5% )

mAB/2al Replicase Poor inhibitor (-15%)

mAB/2a2 Replicase Poor inhibitor (-10%)

mAB/2a3 Replicase Effective replicase inhibitor (~25%). Maps in GDD region around nucleotide 1850 of RNA 2.

mAB/A Purified Pla Poor inhibitor (-10%)

mAB/B Purified Pla Effective replicase inhibitor (-50%). Maps in N terminal region around nucleotide 550 of RNA 1.

mAB/C Purified P2a Effective replicase inhibitor (-40%). Maps in GDD region around nucleotide 1900 of RNA 2.

ET EXAMPLE

Isolation and purification cf CMV RdRp

A membrane-bound polymerase (Fraction 1) was obtained by differential centrifugation of extracts of CMV-infected tobacco leaves. Treatment with a non-ionic detergent produced a soluble polymerase (Fraction 2) from which endogenous RNA was removed by nuclease digestion to give Fraction 3. More high purified preparations were obtained by chromatography on an anion-exchange column (Fraction 4), followed by separation on the basis of molecular size (Fraction 5) and finally fractionation on a high resolution anion-exchange column (Fraction 6). The specific activity of Fraction 6 was 760,000 times that of Fraction 1 (Table 2) .

Total Specific protein activity ( c.p.m./mg)

2580 2.1 x 10^"

168 1.1 x 10^f

184 1.2 x 10^! 14 2.3 x 10^f 2.4 0.08 x 10

RNA polymerase activity was assayed as described

32 below. The P-UMP incorporated (c.p.m. ) was multiplied by the ratio of the volume of each fraction obtained from 200α of CMV-infected tobacco

SUBSTITUTESHEET leaves to the volume of each fraction used for the assay.

RNA polymerase activities of Fractions 4,5 and 6 were completely dependent on addition of CMV RNA. No activity was observed in the absence of added RNA or on addition of equivalent amounts of RNA from viruses in different taxonomic groups (Matthews, 1982^") namely tobacco mosaic virus, tomato bushy stunt virus or red clover necrotic mosaic virus. Hence the polymerase had a specific template requirement. Complete Replication of CMV bv the purified RdRo

The products of reaction programmed by CMV positive-strand RNAs were analysed by gel electrophoresis (Figure 1). Fraction 4 gave rise to full-length double-stranded ( ds ) RNA corresponding to RNAs 1 and 4 (lanes 1 to 5). Fraction 5 gave additionally small amounts of RNA components which were shown to be single-stranded (ss) by their susceptibility to ribonuclease A under conditions in which the dsRNA components were resistant (not shown). With Fraction 6 the ssRNA components became the predominant product, the ratio of nucleotide incorporation into ssRNA and dsRNA being about 5:1 (lanes 6 to 8). The ssRNA components comigrated with CMV RNAs 1 to 4 (not shown) demonstrating that they are full-length products. It is noteworthy that when RNA 3 was used as a template, both RNa 3 and the subgenomic RNA 4 were synthesised.

To show that the ssRNA products were evenly labelled along their length and to determine if they were positive or negative strands, the ssRNA 1 product was extracted from a gel and hybridised with two oligonucleotides Pi and P2 with sequences complementary to internal sequences in RNA 1 (Figure 2b). Digestion with ribonuclease H hydrolysed the RNA specifically at the sites of hybridisation with Pi and P2 to produce fragments of the calculated size (1.0 kb, 1.5 kb and 0.8 kb) 'Figure P2a, lane 3) with nucleotide incorporation in proportion to their length. Hence the ssRNA 1 reaction product consisted mainly of positive- strand RNA uniformly labelled along its length. The small amount of RNA undigested by ribonuclease H (Figure P2a, lane 3) was shown to be the RNA 1 negative-strand. In similar experiments using oligodeoxynucleotides P3 and P4 with sequences complementary to internal sequences of the RNA 1 negative-strand (Figure 2b) and ribonuclease H digestion, most of the RNA (ie, the positive-strand) remained undigested, but products of the size (0.9 kb, 1.8 kb and 0.6 kb) calculated for specific cleavage of RNA 1 negative-strand at the sites of hybridisation with P3 and P4 were formed (Figure P2a, lane 4). After hybridisation with all four oligodeoxynucleotides, the ssRNA 1 product was completely cleaved by ribonuclease H, giving the expected mixture of the cleavage products of the positive and negative-strands (Figure P2a, lane 5). The ratio of positive-strand to negative-strand was about 7:1. Similar results were obtained with the ssRNA 2 and ssRNA 3 reaction products (not shown). The results show conclusively that the most highly purified RdRp preparation (Fraction 6) catalysed the complete replication of CMV genomic RNA.

Vi us-encoded and host polypeptides in purified RdRp Fractions

To determine if the polymerase preparations contained proteins Pla and P2a, antibodies were raised against each of these proteins produced in

SUBSTITUTESHEET E. coli from an expression vector. In Western plots (Figure 3, lanes 8 to 15) the Pla antibodies reacted specifically with the Pla protein expressed in E. coli (lane 9) and with a protein of the same electrophoretic mobility in RdRp Fraction 4 (lane 11). Similarly the P2a antibodies reacted specifically with the P2a antibodies reacted specifically with the P2a protein expressed in E. coli (lane 12) and with a protein of the same mobility in RdRp Fraction 4 (lane 15). The apparent Mr of the proteins that reacted with the protein Pla or P2a antibodies were 98 K and 110K respectively, values similar to those obtained for the in vit o translation products of RNA 1 and RNA 2 respectively (Gordon et al . , 1982). Similar results were obtained with RdRp Fraction 6. hence the purified RNA polymerase contained proteins Pla and P2a.

Evidence that proteins Pla and P2a were both subunits of the RdRp, and had not just fortuitously co-purified with it, was obtained from antibody-linked polymerase assays (Van der Meer et al., 1984; Candresse et al . , 1986) (Figure 3, lanes 16 to 23) . Proteins Pla and P2a produced in E. coli , and RdRp Fraction 4, were subjected to electrophoresiε, blotted onto membranes and incubated with Pla and P2a antibodies. The membranes, containing antibodies bound to proteins Pla or P2a, were then incubated with a solution of purified RdRp to allow the RdRp to bind to the second antigen binding site on the IgG antibody molecules. After further incubation with an RNA polymerase reaction mixture, the labelled products were detected by autoradiography. Bands in the positions of proteins Pla or P2a were detected using Pla antibodies (lanes 17 and 19) or P2a antibodies (lanes 20 and 23) respectively, but not with pre-immune serum (not shown). Therefore proteins Pla and P2a are both components of the RdRp. This conclusion was supported by the observation that Pla or P2a antibodies, but not pre-immune serum, partially (about 40%) inhibited the activity of RdRp preparations.

Comparisons of the proteins of RdRp Fractions 4, 5 and 6 by gel electrophoresis (Figure 3, lanes 4,5 and 6) showed that Fractions 4 and 5 contained a number of host proteins in addition to proteins Pla and P2a. Fraction 6 contained one major host protein of apparent M 50 K, although a number of other minor proteins were also present. Sometimes Fraction 5 lost the ability to synthesise ssRNA but was still able to synthesise dsRNA with no apparent change in its protein composition. On a number of other occasions the final stages of RdRp purification led to loss of the 50 K host protein (Figure 3, lane 7); such loss was invariably accompanied by complete loss of RdRp activity.

The results show that the most highly purified RdRp preparation (Fraction 6) catalysed the complete replication of CMV RNA. Complete replication of viral RNA is likely to require not only polymerase activity to synthesise RNA, but also helicase activity to separate the template and product strands. Proteins Pla and P2a of CMV, which has been identified in the RdRp, contain sequence motifs characteristic of nucleic acid helicases and polymerases respectively (Gorbalenya and Koonin, 1989; Habili & Symons , 1989) . The presence of free negative-strand RNA in the ssRNA reaction product (Figure P2a, lane 4) confirms the ability of the RdRp preparation to separate the template and product strands. Soluble, template-dependent RdRp preparations have previously been obtained for very few viruses of eukaryotes, the best studied being those of poliovirus 'Van Dyke & Flanegan, 1980; Baron & Baltimore, 1982; Hey et al . , 1986; Lubinski et al . , 1987; Plotch et al . , 1989) and brome mosaic virus (Miller & Hall, 1983; Quadt et al., 1988). The inability of RdRp preparations to catalyse complete replication of RNA could be due to absence of a helicase subunit or inhibition of helicase activity in partially purified preparations. In the case of poliovirus, sequence motifs characteristic of helicases and polymerases lie in proteins 2C and 3D respectively (Gorbalenya et al., 1989). Soluble, template-dependent preparations of poliovirus RdRp, either isolated from infected cells or produced in E. coli from cDNA clones, contain 3D, but not 2C, a protein known to be required for RNA replication in vivo (Li & Baltimore, 1988). Hence the absence of a helicase subunit could be a factor in the inability of poliovirus RdRp preparations to catalyse complete RNA replication.

In the case of CMV, which has a similar genome organisation to CMV, BMV-encoded proteins Pla and P2a were detected in the RdRp preparations (Quadt et al., 1988). Hence the helicase subunit was present and inhibition of helicase activity could explain the ability of these enzyme preparations to produce only dsRNA. Inhibition of helicase activity probably also explains the ability of partially purified CMV RdRp (Fraction 4) to synthesise only dsRNA (Figure 1, lanes 1 to 5), since further purification resulted in ability to synthesise free positive-strands and negative-strands.

The CMV RdRp produced an excess of positive-strands over negative-strands. The ratio of positive-to negative-strands in the ssRNA product was 7:1. We have not measured this ratio in the dsRNA product, but even if nucleotide incorporation into dsRNA were completely in the negative-strand, the overall ratio of positive-to negative-strands synthesised would be about 2.5 to 1. Since an excess of positive-strand templates was always present, the polymerase must utilise the negative-strand template preferentially and clearly each negative-strand template was copied more than once .

The reaction products using RNA 3 as a template included the subgenomic RNA 4, as well as full-length RNA 3 (Figure 1). This is consistent with data on BMV that RNA 4 is transcribed from a subgenomic promoter on the negative-strand of RNA 3 upstream of the RNA 4 start site (Miller et al., 1985 Marsh et al., 1988). The purified CMV RdRp contained a host polypeptide, apparent M 50 K, in addition to the two virus-encoded polypeptides . This protein is apparently bound to the RdRp, because it could not be detected in material corresponding to Fraction 6 from healthy plants. Furthermore on those occasions when host polypeptide was lost in the final stage of RdRp purification, polymerase activity was concomitantly lost, suggesting that the host polypeptide is essential for activity. Viruses with small genomes often utilise host components for their replication. For example, the RdRp of bacteriophage Q_fi consists of one virus-encoded and three host-encoded subunits and an additional host protein is needed for negative-strand synthesis on a positive-strand template (reviewed by Blumenthal & Carmichael, 1979). A host protein has been shown to enable initiation of poliovirus negative-strand synthesis in vitro (Dasgupta, 1983, Hey et al . , 1987). A highly purified preparation of an RdRp from plants infected by turnip yellow mosaic virus was shown to contain one virus-encoded polypeptide and one host polypeptide, although it was not established whether the host polypeptide was needed for activity and the reaction products were not characterised (Candresse et al., 1986).

A host RdRp is induced when tobacco is infected by CMV or other viruses ( Fraenkel-Conrat, 1986). This enzyme consists of a single polypeptide, about 130 K, has no template specificity and synthesises only short chains. It is clearly distinct from the RdRp described here which contains two virus-encoded polypeptides and a host polypeptide, M about 50 K, is specific for CMV RNA and catalyses the complete replication of CMV RNA.

The availability of a system for complete replication of a eukaryotic virus RNA i_n vitro opens up the way for investigations of the mechanism of RNA replication and the roles of the virus- and host-encoded subunits, which have not been possible hitherto. Such studies could lead to novel antiviral agents designed to inhibit different stages of the replication process. Furthermore the insights gained in the purification of the CMV replicase could lead to development of in vitro systems for the replication of other animal and plant RNA viruses. EXPERIMENTAL PROCEDURES Purification and assay of DMV RdRp

Leaves of young Nicotiana tabacum cv. Samsun plants were inoculated with CMV (Q-strain) and - 2.0 - three days later the infected leaves (200 g) were homogenised in TMDPG buffer (50 mM tris-HCl pH 8.2, 15 mM MgCl-,, 10 mM dithiothreitol (DDt), 0.1 mM phenylmethylsulphonyl fluoride, 18% glycerol) (4 ml buffεr/g leaves) at 4°C. The homogeneity was centrifuged at 3 000 q for 10 minutes at 4°C. The supernatant was then centrifuged at 35 000 g for 30 minutes at 4°C. The pellet was re-suspended in TMDPG buffer (0.5 ml/g leaves) to give Fraction 1. Alternatively Fraction 1 could be obtained by isolation of tonoplast vesicles by the method of Bremberger et al (1988). After addition of NP40 (final concentration, 0.75%), the mixture was stirred at 4°C for 1 hour and then centrifuged at 35 000 g for 30 minutes. The supernatant was recentrifuged at 100 000 g for 1 hour. The final supernatant (Fraction 2) was treated with micrococcal nuclease (Miller & Hall, 1983) to yield Fraction 3. Fraction 3 was applied to a DEAE-Biogel column (1 x 10cm) at a flow rate of 1 ml/min. Unbound proteins were washed through with 30 ml of TMDPGN buffer (TMDPG containing 0.75% NP40) and the RdRp activity was eluted with TMDPGN buffer containing 0.5 M KC1. Fractions of 1 ml were collected and assayed for RdRp activity. The pooled active fractions were termed Fraction 4. Q-Sepharose could be used in place of DEAE-Biogel. Fraction 4 was passed through a Pharmacia FPLC Superose 6 column (30 x 1 cm) at a rate of 0.25 ml/min with TMDPGN buffer containing 0.5 M KCl and fractions of 1 ml were collected. Fractions containing RdRp activity were pooled (Fraction 5), dialyzed against TMDPGN buffer and then applied to a Pharmacia FPLC Mono Q column (5 x 0.5 cm) at a flow rate of 1 ml/min. A linear gradient of 0 to 0.5 M KCl in TMPDGN buffer was then applied. Fractions of 1 ml were collected and those with RdRp activity were pooled (Fraction 6).

Fraction 3 could be stored at -70°C for at least one month and thawed and re-frozen several times without significant loss of RdRp activity.

Fraction 4 could also be stored at -70°C, but after thawing could not be re-frozen without considerable loss of activity. The activities of Fractions 5 and 6 were completely lost after freezing and thawing. These fractions were stored unfrozen at 0°C and generally used within an hour of preparation.

RdRp activity was assayed by mixing 25 μl of each fraction with 25 μl of 100 mM tris-HCl pH 8.2, containing 4% v/v glycerol, 20 mM MgCl-,, 2 mM ATP,

32"

2 mM CTP, 2 mM GTP and 20 mM DTT. [ p]UTP (10 mCi/ml; l l ) and template RNA (10 ug) were then added and the reaction mixture was incubated at 30°C for 5 minutes. After addition of 50 mM UTP (1 μl), incubation was continued for a further 25 minutes. Incorporation of the label into RNA was determined by spotting 5 μl aliquots onto DE52 discs (Whatman) (Sambrook et al . , 1989). Protein concentrations were determined using a BioRad kit according to the manufacturer's instructions with bovine serum albumin as standard. RdRp reaction products were extracted with phenol: chloroform and precipitated by addition of 2.5 volumes of ethanol in the presence of 2 M ammonium acetate. Virus RNA

CMV RNA was extracted from purified CMV particles (lot et al . , 1974). RNA 1, RNA 2 and RNA

3 were synthesised by transcription i_n vitro using T7 RNA polymerase and vectors containing full-length clones of CMV RNA 1, RNA 2 and RNA 3

( pCMVl , pCMV2 and pCMV3 respectively). The capped transcripts initiated precisely at the 5' termini of CMV RNAs, but contained up to 4 additional residues at the 3' termini. They have been shown to be infectious when inoculated together onto tobacco plants. Details of the construction of pCMVl , pCMV2 and pCMV3 , _in it o transcription and infectivity cf transcripts have been described (Hayes and Buck, 1991).^' Analysis of Mucleic Acids RNA was electrophoresed through non-denaturing or denaturing (formaldehyde) agarose gels as described by (Sambrook et al . , 1989). Digestion with ribonuclease A to distinguish between ssRNA and dsRNA was by the method of Buck et al . , 1987. Annealing of oligonucleotides to ssRNA and digestion with ribonuclease H was as described by Hayes et al. , 1988. Analysis of Proteins

Proteins were electrophoresed in SDS-polyacrylamide gels (Laemlli, 1970) and detected by silver-staining (Ochs, 1983), by Western blotting (Sherwood, 1987) or by blotting followed by antibody-linked polymerase assay (Van der Meer et al., 1984; Candresse et al . , 1986). Production of Proteins Pla and P2a

Ndel sites were introduced into pCMVl and pCMV2 (Figure 1) by _in_ vitro mutagenesis (Kunkel et al., 1987) using oligonucleotides

TAAAATTCATATGGCAACGTCCTC and CTTCTGTCATATGATAAGTCC respectively. The complete Pla and P2a coding regions were then cut out with Ndel and BaroHl and cloned into expression vector pET3a in E Coli BL21 cells (Rosenberg et al., 1987) . Expression and purification of proteins Pla and P2a were essentially as described ( Plotch et al , 1989). Electrophoretically homogeneous proteins were used

SUBSTITUTESHEET to raise antisera in rabbits.

THE HOST-ENCODED PROTEIN (P50)

Since the evidence pointed to the potential importance of the host encoded subunit, further investigation of this component was undertaken. Although SDS-polyacrylamide gel electrophoresis and silver staining demonstrate the presence of a host-encoded subunit, it is possible that this protein merely co-purifies with the replicase or binds to it during the extraction procedure. However, the following work confirms that it is indeed a replicase subunit. Antibody linked polymerase assays (ALPA) have been used to establish the presence of the viral proteins in the replicase (as described hereinabove ) . In order to test for the presence of a host-encoded component, an antiserum against that protein is required.

ANTIBODIES TO THE MAJOR HOST-ENCODED PROTEIN 'P50

Approximately 10/vg of Fraction 6 replicase was injected into Balb/c mouse. After two similar injections two and four weeks later the spleen cells were fused with myeloma cells to produce hybridomaε. A number of hybridomas were screened for the production of antibodies against the host-encoded polypeptide. Only one (mAB/HP) was detected using Western blot analysis (see Figure 12, lane 1) . This antibody was then used in an ALPA against Fraction 6 replicase. As can be seen in Figure 4, lane 2, a band is present in Fraction 6 which corresponds to the host-polypeptide .

Two monoconal antibodies against Pla and three monoclonal antibodies a ainst P2a were detected using the replicase as an antigen as described above. The monoclonal antibodies against Pla were termed mAB/lal and mAB/la2 , and those against P2a as mAB/2al, πιAB/2a2 and mAB/2a3. Polyclonal antibodies against the viral proteins Pla and P2a, and the monoclonal antibodies mAB/la and mAB/2a3 have been εhown to inhibit the activity of the replicase (Figure 5). Polyclonal antibodies raised against the replicase are more effective than any antibodies against the single viral proteins. To test whether more effective antibodies could be raised, polyclonal antibodies were raised against peptides corresponding to conserved regions of the Pla or P2a proteins. As can be seen from Figure 6, polyclonal antibodies to peptides 2 and 3 have inhibitory effects similar to those raised against whole proteins. However, antibodies against peptide 4 are notable for their ability to inhibit the replicase. The antibodies, raised against the GDD region of P2a, are capable of near total inhibitions of the polymerase at extremely low levels. Monoclonal antibodies against this peptide are being raised.

The monoclonal antibody mHP has a smaller concentration dependent inhibitory effect on the replicase as shown by Figure 7.

CLONING AND SEQUENCING THE GENE FOR THE MAJOR HOST

PROTEIN 'P50)

Genes encoding a polypeptide can be cloned if some of the amino acid sequence data is known.

Oligonucleotides can then be designed to screen a cDNA library or to amplify the gene via the polymerase chain reaction. Approximately 5 g of purified HP was subjected to M-terminal sequencing via Ξdman degradation. Fortunately the M-terminus was not blocked, and fourteen amino acids could

SUBSTITUTESHEET clearly be resolved:

A-P-I-P-G-V-M-P-I-G-M-Y-V-S

Comparison of this sequence with sequences in the PIR databank show that the fourteen amino acids of the M-terminus of the HP are completely homologous to β-amylase from sweet potato.

Messenger RNA from CMV-infected M. tabacum has been isolated. Oligo-dT was used to prime first strand cDNA syntheεis using standard techniques. The mRNA was then hydrolysed uεing εodium hydroxide, and the single-stranded cDNA was purified using a column of Sephacryl S-400. The cDNA was then amplified in a Vent DNA polymerase chain reaction using a 5'-prιmer designed from the above amino acid sequence:

ATAAGAATGCGGCCGCGCXCCXATXCCXGGXGTXATG (Notl site underlined) and the 3'-primer: ATAAGAATGGCCXXXXXGGCCTTTTTTTTTTTTTTTT (Sfil site underlined)

The reaction products were purified using a Stratagene PrimerErase column, digested overnight with Notl and Sfil and ligated into Motl-Sfil digested pGem-llZf( + ) . A number of colonies were obtained with inserts of the correct length.

Nucleotide sequence analysis of one clone indicated that it contained a single open reading frame with the capacity to code for a protein of Mr about 50K. Comparison with sequences in the PIR data bank indicated that this protein had 58% amino acid sequence identity with beta-amylase from barley 'Kreis et al 1987) and lower, but εignificant, homology with beta-amylaεeε from sweet potato (Toda, 1989) and soyabean (Mikami et al 1986) . It is likely therefore that the major host protein (HP or P50) of the CMV replicase is beta-amylase . Beta-amylase from tobacco has not been deεcribed previously.

The continued presence of the HP during replicase purification and its detection by ALPA 'Figure 4) indicated that the protein probably has some enzymatic or structural role in CMV RNA replications. It may serve to anchor the replicase in the tonoplast, the probable site of replication.

EVIDENCE FOR OTHER HOST PROTEINS IN THE

REPLICASE

Other host-encoded proteinε may also be present, but at a much lower concentration. To play a role in replication host-encoded proteinε might be expected to be preεent when the polymeraεe interacts with the 3'-ends of either the positive (genomic) sense RNA and/or with the 3 '-end of the negative-sense RNA. Short RNA molecules corresponding to the terminal 150 nucleotides of the positive and negative-sense RNA were prepared. These were labelled and allowed to interact with Fraction 3 prepared from either healthy or CMV-infected plants. As expected, both fragments interacted with proteins present in Fraction 3 from infected plants (Figure 8, laneε 3 and 4). However, an unexpected protein-RNA complex was obtained when Fraction 3 from healthy plants was incubated with the 3' RNA fragment of negative- strand senεe. This complex represents a specific interaction: addition of unlabelled fragment competes out the interaction between the labelled fragment and the proteins, a feature not observed with an equivalent sized fragment of the opposite sense 'Figure 9). The disappearance of this complex with Fraction 3 from infected plants indicates that the protein(s) responsible for the

HEET complex may form part of the replicase. It may be required specifically for the synthesis of positive (genomic) sense RNA.

The presence of Pla and P2a in the complex

Ξ formed when using Fraction 3 from infected plants can be seen by the action cf mAB/la and mAB/2a. Both of these antisera retard the complex 'Figure 10). A similar retardation is observed with mAB/HP 'Figure 11) indicating that this protein is also

10 present. An obvious question is whether the complex formed between the Fraction 3 from healthy plants and the RNA fragment (Figure 8) is due to the 50kD HP. Evidence that it is not comes from the experiments shown in Figure 12. In lane 1,

15 fraction 3 from infected plants was probed with mAB/HP. A clear band with the correct molecular weight is observed. In lane 2, the RNA fragment from the 3 '-end of the negative-sense RNA was incubated with Fraction 3 from healthy plants

20 (equivalent to Figure 8, lane 2). The complex waε then UV-irradiated, treated with RNase and electrophoresed on the same SDS-polyacrylamide gel. The complex is significantly smaller, indicating that the protein responsible for the complex in

25 Figure 8, lane 2, has a lower molecular weight than the HP.

References :

30 Hayes, R.J. and Buck, K.W. (1990) .

Infectious cucumber mosaic virus RNA transcribed in vitro from clones obtained from cDNA amplified using the polymerase chain reaction. Journal of General Viroloσv 71, 2503-2508.

ESHEET Bremberger, C, Haschke, H.P. and Luttge, V. (1988). Separation and purification of the tonoplaεt ATPase and pyrophosphatase from plants with constitutive and inducible Crassulacean acid metabolism. Flanta 175 , 465-470.

Kreis, M. , Williamson, M. , Buston, 3. , Pywell, J., Hejgaard, J. and Svendsen, I. (1987). Primary structure and differential expreεsion of β-amylase in normal and mutant barleys. European Journal cf Biochemistry 169 , 517-525.

Toda, H. (1989) . Sequence analysis of sweet potato β-amylase. Denpun Kagaku 36 87-101.

Mikani, E., Nomura, K and Morita, Y. (1986) . Journal of Biochemistry (Tokyo) 100 , 513-516.

Sharon, M.H. and Baltimore, D. (1982). I_n vitro copying of viral positive strand RNA by poliovirus replicase. Characterisation of the reaction and its products. J. Biol. Chem 257 , 12359-12366.

Blumethal, T. and Carmichael, G.G. (1979) .

RNA replication: function and structure of Qβ-replicase . Ann. Rev. Biochem. 48 , 525-548.

Buck, K.W. , Chain, E.B and Himmelweit, F. (1971). Compariεon of interferon induction in mice by purified Penicillium chryεoσenum virus and derived double-stranded RNA. J. Gen. Virol. 1 , 131-139.

SUBSTITUTESHEET Candreεεe, T., Mouches, C. and Bove , J.M. (1986) . Characterisation of the virus-encoded subunit of turnip yellow mosaic virus RNA replicase. Virology 152 , 322-330.

Dasgupta, A. (1983) . Purification of host factor required for in vitro transcription of poliovirus RNA. Virology 128 , 245-251.

Fraenkel-Conrat, H. (1986). RNA-directed RNA polymerases of plants. CRC Crit. Rev. Plant Sci . 4, 213-226.

Gorbalenya, E.E. and Koonin, E.V. (1989). Viral proteins containing the purine NTP-binding sequence pattern. Nucleic Acids Res. 17 , 8413-8440.

Gordon, K.H.J., Gill, D.S. and Symons, R.H. (1982). Highly purified cucumber mosaic virus-induced RNA-dependent RNA polymerase does not contain any of the full length translation products of the genomic RNAs. Virology 123 , 284-285.

Gould, A.R. and Symons, R.H. (1982).

Cucumber mosaic virus RNA 3. Determination of the nucleotide sequence provides the amino acid sequences of protein P3a and viral coat protein. Eur. J. Biochem. 126, 217-225.

Habili, N. and Symons, R.H. (1989) . Evolutionary relationship between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerases and nucleic acid helicases. Nucleic Acids Res. 17, 9543-9555. Hayes, R.J. , Brunt, A. . and Buck, K.W. '1988) . Gene mapping and expression of tomato bushy stunt virus. J. Gen. Virol. 69 , 304"-3057.

Hey, T.D. , Richards, O.C. and Ehrenfeid, Ξ. (1987). Host factor-induced template modification during synthesis of poliovirus RNA in vitro. J. Virol. 61, 802-811.

Houwing, C.J. and Jaspars, E.M.J. (1986).

Coat protein blockε the in vitro tranεcription of virion RNAs of alfalfa mosaic virus, FEBS Lett. 209, 284-288.

Jaspars, E.M.J. , Gill, D.S. and Symons, R.H. (1985). Viral RNA synthesis by a particulate fraction from cucumber seedlings infected with cucumber mosaic virus. Virology 144 , 410-425.

Kunkel, T.A., Roberts, J.D. and Zakour, R.A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154 , 367-382.

Laemlli, U.K., (1970). Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227 , 680-685.

Li, J. and Baltimore, D. (1988). Isolation of poliovirus 2C mutants defective in viral RNA synthesis. J. Virol. 62, 4016-4021.

HEET Lot, H. , Harchoux, G., arrou, J. , Kaper, J.M., West, C.K., Van Vloten-Doting, L. and Hull, R. '1974) . Evidence for three functional RNA species in several strains of cucumber mosaic virus. J. Gen. Virol. 2_2, 31-93.

Lubinski , J.M., Ransone, L.J. and Dasgupta, A. (1987) . Primer-dependent synthesis of covalent^'ly linked dimeric RNA molecules by poliovirus replicase. J. Virol. 6_ , 2997-3003.

Marsh, L.E., Dreher, T.W. and Hall, T.C. (1988). Mutational analysis of the core and modulator sequences of the BMV RNA 3 subgenomic promoter. Nucleic Acids Res. 16 , 981-995.

Mathews, R.E.F. (1982). Classification and nomenclature of viruses. Intervirology 17 , 1-199.

Miller, W.A. and Hall, T.C. (1983). Use of micrococcal nuclease in the purification of highly template-dependent RNA-dependent RNA polymerase from brome mosaic virus-infected barely. Virology 125, 236-241.

Miller, W.A. and Hall, T.C. (1984). RNA-dependent RNA polymerase isolated from cowpea chlorotic mottle virus-infected cowpeas in specific for bromoviral RNA. Virology 132 , 5 3-60.

Miller, W.A., Dreher, T. and Hall, T.C. (1985) . Synthesis of brome mosaic virus subgenomic RNA in itro by internal initiation on (-> sense σenomic RNA. Nature 313, 68-70. Mouches, C, Bove , C, Barreau, C. and Bove , J.M. '1975). TYMV RNA-replicase : formation of a complex between the purified enzyme and TYMV-RNA. Ann. Microbiol. - Inst. Pasteur) 127A, 75-90.

Mitta, M. , Takanami , Y. , Kuwata, S. and Kubo, S. (1988) . Inoculation with RNAs 1 and 2 of cucumber mosaic virus induces viral RNA replicase activity in tobacco mesophyll protoplasts. J. Gen, Virol. 6_9, 2695-2700.

Oochε , D.C. (1983) . Protein contaminants of sodium dodecyl sulphate-polyacrylamide gels. Analvt. Biochem. 135, 470-474.

Plotch, S.J., Palant, 0. and Gluzman, Y. (1989). Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli. J. Virol. 63, 216-225.

Quadt, R., Verbeck, H.J.M. and Jaspars, E.M.J. (1988). Involvement of a non-structural protein in the RNA synthesiε of brome mosaic virus. Virology 165, 256-261.

Rezaian, M.A. , Williams, R.H.V., Gordon, K.H.J., Gould, A.R. and Symons, R.H. (1984). Nucleotide seσuence of cucumber mosaic virus RNA 2 reveals a translation product significantly homologous to corresponding proteins of other viruses. Eur. J. Biochem. 143 , 277-284.

Rezaian, M.A., Williams, R.H.V. and Symons, R.H. '1985). Nucleotide seσuence of cucumber mosaic virus RNA 1. Presence of a sequence complementary to part of the viral satellite RNA and homologies with other viral RNAε . Eur . J . Biochem. 150, 331-339.

Rosenberg, A.H. , Lade, B.N. , Chui , D., Lin,

S. , Dunn, J.J. and Studier, F.W. (1987) . Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56 , 125-135.

Sambrook, J., Fritεch, E.F. and Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. Second edition. New York: Cold Spring Harbor Laboratory Press.

Sherwood, J.L. (1987). Comparison of a filter paper immunobinding assay, Western blotting and an enzyme-linked immunosorbent assay for the detection of wheat streak mosaic virus. J. Phytopathol. 118 , 68-75.

Saunders, K. and Kaesberg, P. (1985). Template-dependent RNA polymerase from black beetle virus-infected Drosophila melanogaster cells. Virology 144, 373-381.

Van Dyke, T.A. and Flanegan, J.B. (1980). Identification of poliovirus polypeptide P63 as a soluble RNA-dependent RNA polymerase. J. Virol. 3J5, 732-740.

Van der Meer, J. , Dorssers, L. and Zabel, P. (1983). Antibody-linked polymerase assay on protein blots: a novel method for identifying polymerases following SDS-polyacrylamide gel electrophoresis. EMBO J. 2, 233-237.

Claims

CLAI S

1. An R A-dependant replicase (RdRp) comprising polypeptides which includes: proteins Pla and P2a of cucumber mosaic virus or homologous or analogous proteins from another virus; and polypeptide P50 of tobacco or a homologue or analogue thereof from another plant species.

2. A replicase as claimed in claim 1 which additionally comprises one or more other plant proteins.

3. A recombinant plant genome having virus resistance and comprising a gene expressing a product which inhibits expresεion of or inhibitε the catalytic activity of viral RdRp.

4. A genome aε claimed in claim 3 in which the product expressed is an antibody effective against the protein Pla or P2a of cucumber mosaic virus, or a homologous or analogous protein from another virus, against polypeptide P50 of tobacco, or a homologue or analogue thereof from another plant εpecieε or against another protein component of the replicase, or a homologue or analogue thereof from another plant species.

5. A genome as claimed in claim 3 in which the product exprεxxed is RNA in antisense orientation to RNA encoding a protein component cf the replicase. -

6. A genome as claimed in claim 3 in which the said product is a truncated or otherwise modified form of a protein defined in claim 4.

7. A monoclonal or polyclonal antibody which inhibits the replication of cucumber mosaic virus or other plant viruses i τ\ vitro.^'

8. A method for the preparation of the monoclonal or polyclonal antibody claimed in claim 6, comprising injecting a mammal with a substance selected from the group consisting of:

(i) a purified RNA replicase extracted from a plant infected with cucumber mosaic virus;

(ii) the protein Pla or a peptide fragment thereof ; (iii) the protein P2a or a peptide fragment thereof;

(iv) the protein P50 isolated from a plant or a peptide fragment thereof;

(v) any other protein component of a purified RNA replicase, or a peptide fragment thereof; and thereafter recovering polyclonal antibodies from serum extracted from the injected mammal; or producing hybridomas which produce monoclonal antibodies; or cloning DNA sequences from the animal or from the hydridomas into a vector and expressing the antibody in an expression system.

9. A method as claimed in claim 8 in which the proteins Pla, P2a, P50 or other replicase components are produced by isolation from the purified replicase or by cloning the respective gene in an expression vector and expression thereof in a bacterial expresεion system. - ;_ o -

10. A DMA sequence which encodes an antibody which inhibits replication of a plant virus replicase.

11. A transgemc plant, resistant to virus infection, which contains a stably inherited genome as claimed in any of claimε 3-5 or which haε stably incorporated within^' itε genome a DNA seσuence as claimed in claim 10.

SUBSTITUTESHEET