EP0507934B1 - Polypeptides involved in the expression of resistance to glycopeptidic antibiotics - Google Patents

Description

The invention relates to polypeptides associated with the expression of resistance to antibiotics of the family of glycopeptides, especially in Gram-positive bacteria, in particular of the Gram-positive cocci family. The invention also relates to a nucleotide sequence encoding these polypeptides. It also relates to the use of these polypeptides and their nucleotide sequence as means for in vitro detection of resistance to glycopeptides. Among the Gram-positive cocci, the invention is particularly directed to enterococci, streptococci and staphylococci which are of particular interest for the implementation of the invention.

Glycopeptides, including vancomycin and teicoplanin, are antibiotics that inhibit bacterial wall synthesis. These antibiotics are widely used for the treatment of severe infections caused by Gram-positive cocci (enterococci, streptococci and staphylococci), especially in cases of allergy and penicillin resistance. Despite a long clinical use of vancomycin, this antibiotic remained active on almost all strains until 1986, when the first resistant strains were isolated. Since then, resistance to glycopeptides has been detected by many microbiologists in Europe and the United States, particularly in isolated strains of immunocompromised patients, making it necessary to systematic evaluation of the sensitivity of germs in a hospital environment.

The activity of the glycopeptides is dependent on the formation of a complex between the antibiotic and the peptidoglycan precursors, rather than the direct interaction with cell wall metabolism enzymes. In particular it has been found that glycopeptides bind to the D-alanyl-D-alanine (D-ala-D-ala) end-residues of the peptidoglycan precursors.

The recent emergence of glycopeptide resistance, particularly in enterococci, has led to certain results in the knowledge of the factors conferring this resistance.

For example, Enteroccus faecium BM4147 was found in a particular enterococci strain that the determinant of glycopeptide resistance was located on a 34 kb plasmid, plasmid pIP816. This determinant was cloned in E. coli (Brisson Noël et al, 1990, Antimicrob Agents Chemother 34, 924-927).

Leclercq R. et al (The New England Journal of Medicine, 319, No. 3, 157-161) describes the study of the resistance of two isolates of E. faecium to high levels of vancomycin and teicoplanin. . Plasmid pIP816 and the 10 kb HindIII restriction fragments are used in hybridization reactions with the plasmid DNA of E. faecium isolates BM4152 and BM4152-1 .

According to the results obtained so far, the resistance to glycopeptides was associated with the production of a protein of molecular weight of about 40 kDa, the synthesis of this protein being induced by sub-inhibitory concentrations of certain glycopeptides such as vancomycin.

By conducting a more in-depth study of the resistance of certain Gram-positive cocci strains towards glycopeptides, in particular vancomycin or teicoplanin, the inventors have found that this resistance is linked to the expression of several proteins or polypeptides. coded by sequences usually carried by plasmids in resistant strains. The new results obtained by the inventors also make it possible to distinguish the genes coding for two resistance phenotypes, on the one hand the strains highly resistant to glycopeptides, and on the other hand, strains resistant to a low level.

By strain resistant to a high level is meant a bacterial strain, in particular a gram-positive cocci strain for which the minimum inhibitory concentrations (MIC) of vancomycin and teicoplanin are respectively greater than 32 and 8 μg / ml. The MICs of vancomycin against low-level resistant strains are between 16 and 32 μg / ml. These strains are apparently sensitive to teicoplanin.

The inventors have isolated and purified, among the components necessary for the expression of glycopeptide resistance, a particular protein called VANA or VanA having a certain homology with D-alanine-D-alanine ligases. VanA is nevertheless functionally distinct from ligases.

In principle, a gene sequence will be designated "van ..." and an amino acid sequence "Van".

The invention relates to polypeptides or proteins involved in the expression of resistance to antibiotics of the glycopeptide family and in particular to vancomycin and / or teicoplanin, as well as the nucleotide sequences coding for such complexes.

The invention also relates to nucleotide probes that can be used for the detection of glycopeptide resistance, in particular by means of the reaction polymerase chain reaction (PCR), or by assays involving antibodies.

The invention relates to a purified protein required for the expression or regulation of resistance to antibiotics of the family of glycopeptides, characterized in that it has an amino acid sequence chosen from the amino acid sequences identified. in the sequence listing by SEQ ID No. 1 (VanH), SEQ ID No. 3 (VanX), SEQ ID No. 20 (VanC), SEQ ID No. 4 (VanR) or SEQ ID No. 5 (VanS), or a hybridizing sequence with one of the nucleotide sequences identified in the sequence listing by SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10 or SEQ ID NO 21 or with one of the following sequences V1 or V2 under stringent conditions or little stringent:

A first particular composition according to the invention involved in the expression of glycopeptide resistance is characterized in that it comprises at least 3 proteins or any part of one or more of these proteins necessary to confer on Gram bacteria. -positive, resistance to antibiotics of the family of glycopeptides, including vancomycin and / or teicoplanin, or to promote this resistance, particularly in strains of the Gram-positive cocci family.

Another protein, VanC, related to D-Ala-D-Ala ligases but of different specificity was characterized in Enterococcus gallinarum BM4173; the vanC gene has domains having sufficient homology with the vanA gene, so that probes corresponding to specific vanA regions allow its detection.

E. gallinarum is a constitutively resistant isolate at low levels of vancomycin (Dutka-Malen et al., Antimicrob Agents Chemother 34 (1990b) 1875-1879).

By the term "polypeptides" is meant any sequence of amino acids that may contain proteins, or of a size smaller than that of a protein. -

• pour une hybridation dans de conditions de forte stringence :
  • * température de la réaction 65°C pendant une nuit dans une solution contenant 0,1% de SDS, 0,7% de lait en poudre écrémé, 6xSSC (1xSSC=0, 15M NaCl et 0,015M de citrate de sodium à pH=7,0)
  • * lavages à 65°C dans 2xSSC-0,1% SDS ;
• pour une hybridation dans des conditions peu stringentes, la température d'hybridation est 60°C pendant une nuit et la température des lavages 45°C.

The stringency conditions referred to above are determined according to the usual procedures for the hybridization of sequences nucleotide. By way of example, with regard to sequences hybridizing with the sequence of the vanA gene (SEQ ID No. 8), the following conditions can be applied:

• for hybridization under conditions of high stringency:
  • * reaction temperature 65 ° C overnight in a solution containing 0.1% SDS, 0.7% skimmed milk powder, 6xSSC (1xSSC = 0.15M NaCl and 0.015M sodium citrate at pH = 7.0)
  • * washes at 65 ° C in 2xSSC-0.1% SDS;
• for hybridization under low stringency conditions, the hybridization temperature is 60 ° C overnight and the wash temperature 45 ° C.

The expression of resistance to glycopeptides can result in the persistence of an infection due to germs usually sensitive to glycopeptides.

A polypeptide or a protein is necessary for the expression of glycopeptide resistance, since its absence renders the strain which contains this polypeptide or this protein, more sensitive to glycopeptides and that this polypeptide or protein is not present in sensitive strains.

Different levels of glycopeptide resistance exist among Gram-positive cocci strains in particular.

The invention also relates to a composition formed by the combination of the proteins identified in the list of sequences by SEQ ID No. 1 (VanH), SEQ ID No. 2 (VanA), SEQ ID No. 3 (VanX).

The inventors have thus found that the expression of glycopeptide resistance in Gram-positive bacteria requires the expression of at least three proteins or polypeptides derived from these proteins.

According to a first particular embodiment of the invention, the polypeptides of the composition are further characterized in that the amino acid sequences necessary for the expression of resistance to antibiotics of the glycopeptide family are under the control of regulatory elements, in particular proteins corresponding to the sequences designated SEQ ID NO 4 or SEQ ID NO 5 in the sequence listing, and which respectively correspond to a control sequence R, and to a sensor S sequence.

VanS and VanR are a two-component regulatory system, with VanR being a transcriptional activator and VanS stimulating VanR-dependent transcription. VanS is able to modulate the level of phosphorylation of VanR in response to vancomycin present in the external medium and thus intervenes in the control of the transcription of vancomycin resistance genes.

These regulatory sequences are in particular capable of increasing the level of resistance, insofar as they promote the expression of the resistance proteins included in the polypeptides of the invention.

According to another advantageous embodiment of the invention, the polypeptides of the above composition are encoded by the sequence SEQ ID No. 6 identified in the sequence listing, which represents the coding sequence of the proteins described above.

Another sequence according to the invention is designated by SEQ ID No. 11 which contains the sequence SEQ ID NO 6 as well as a sequence upstream of SEQ ID No. 6 coding for a transposase (encoded by the strand (-) of the sequence, and a downstream sequence of SEQ ID No. 6 corresponding to vanY and vanZ genes and at each end, repeated inverted sequences of 38 bp SEQ ID No. 11 is a transposon whose genes intervene at different levels in the establishment of resistance to glycopeptides.

The sequence identified by the abbreviation SEQ ID No. 1 contains the VanH protein encoded by the vanH gene, this protein comprises 322 amino acids and begins with a methionine. This protein is an enzyme involved in the synthesis of peptidoglycan and has a molecular weight of 35.754 kDa. VanH has some similarities with dehydrogenases that catalyze the NAD ⁺ dependent oxidation of 2-hydroxy carboxylic acids to form the corresponding 2-keto-carboxylic acids. In fact, the VanH protein could use NADP ⁺ rather than NAD ⁺ . The VanH protein also contains several residues of reactive sites that probably participate directly in substrate binding and catalysis. VanH would be involved in the synthesis of a VanA ligase substrate. This VanA substrate would be a D-α-hydroxycarboxylic acid, which would be condensed by VanA with D-alanine in place of a D-amino acid, which would affect the binding of the peptidoglycan precursor, with vancomycin, by loss of a hydrogen bond because one of the hydrogen bonds formed between vancomycin and N-acetyl-D-Ala-D-Ala is carried out with the NH group of the D-alanine-terminal residue. Recall that "Ala" is the abbreviation of "alanine".

The inventors have been able to highlight certain interactions between the VanA and VanH proteins and in particular have been able to describe this: the nature of the VanA protein (D-alanine ligase: D-alanine of specificity altered for its substrate) which has allowed resistance to glycopeptides involves the biosynthesis of a new compound different from D-Ala-D-Ala by VanA, which peptide can be incorporated into peptidoglycans but is not recognized by vancomycin. In particular, the observation of the similarities between the product of the vanH gene and the specific α-keto acid reductases D made it possible to determine that this compound could not be an amino acid D but a hydroxy acid D, which when bound with D-alanine by VanH could generate a new peptidoglycan precursor depsipeptide.

The invention also relates to any combination of these different proteins in a resistance complex, as well as hybrid proteins comprising one or more of the above proteins, or some of these proteins, in association with a determined amino acid sequence. It relates in particular to a composition of polypeptides forming an antibiotic resistance complex, characterized in that it is formed by the combination of the proteins according to claim 1 designated by SEQ ID No. 1 (VanH), SEQ ID No. 20 (VanC ), SEQ ID NO. 3 (VanX).

Also within the scope of the invention are the nucleotide sequences encoding one of the amino acid sequences described above.

1. a. l'un des enchaînements nucléotidiques identifiés dans la liste de séquences suivantes : SEQ ID NO 9 (vanH), SEQ ID NO 10 (vanX);
2. b. une séquence codante d'un gène, hybridant dans des conditions stringentes avec une séquence complémentaire de l'un des enchaînements identifiés en a., dès lors qu'elle permet la détection de souches résistantes à des antibiotiques de la famille des glycopeptides ;
3. c. l'un des enchaînements nucléotidiques identifiés dans la liste de séquences suivantes : SEQ ID NO 21 (vanC), SEQ ID NO 23 (vanR), ou SEQ ID NO 24 (vanS) ; ou,
4. d. un fragment des séquences identifiées en a. ou c., permettant la détection de souches résistantes à des antibiotiques de la famille des glycopeptides ;

ou en ce qu'il s'agit d'une partie de l'un des enchaînements de SEQ ID NO 6, SEQ ID NO 7 ou SEQ ID NO 22, susceptible

1. a. soit de constituer une amorce, pour la détection d'une résistance à des antibiotiques de la famille des glycopeptides, notamment à la vancomycine et/ou à la teicoplanine, en particulier dans des souches de la famille des cocci à Gram-positif,
2. b. soit de coder pour une séquence nécessaire à l'expression ou à la régulation de la résistance à des antibiotiques de la famille des glycopeptides, notamment à la vancomycine et/ou la teicoplanine, en particulier dans des souches de la famille des cocci à Gram-positif.

A nucleotide sequence according to the invention is characterized in that it consists of:

1. at. one of the nucleotide sequences identified in the following sequence list: SEQ ID NO 9 (vanH), SEQ ID NO 10 (vanX);
2. b. a coding sequence of a gene, hybridizing under stringent conditions with a sequence complementary to one of the sequences identified in a., as it allows the detection of antibiotic-resistant strains of the glycopeptide family;
3. vs. one of the nucleotide sequences identified in the following sequence list: SEQ ID NO 21 (vanC), SEQ ID NO 23 (vanR), or SEQ ID NO 24 (vanS); or,
4. d. a fragment of the sequences identified in a. or c., allowing the detection of strains resistant to antibiotics of the family of glycopeptides;

or in that it is a part of one of the sequences of SEQ ID NO 6, SEQ ID NO 7 or SEQ ID NO 22, susceptible

1. at. either to constitute a primer for the detection of resistance to antibiotics of the glycopeptide family, in particular to vancomycin and / or teicoplanin, in particular in strains of the Gram-positive cocci family,
2. b. to encode a sequence necessary for the expression or regulation of resistance to antibiotics of the glycopeptide family, in particular to vancomycin and / or teicoplanin, in particular in strains of the Gram-cocci family; positive.

The sequence SEQ ID NO 7 codes for the 3 resistance proteins VanH, VanA and VanX.

The sequence SEQ ID No. 22 and the sequence SEQ ID No. 11 comprise a transposon represented in FIG. 7a; this transposon contains the genes necessary for the expression of glycopeptide resistance, as well as the genes associated with this resistance involved for example in the regulation of the expression of the genes necessary to obtain the resistance phenotype or involved in the quantity of polypeptide resistance obtained.

ou

A particular sequence as defined above is one of the following sequences:

or

V1 and V2 allow the constitution of probes where appropriate in combination with other nucleotides, depending on the degree of specificity sought to detect vanA and vanC and can also be used as primers in polymerase chain reactions.

Other nucleotide sequences described in the present description are the sequences SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 21, SEQ ID NO 12 (transposase), SEQ ID NO 13 (resolvase), SEQ ID NO 14 (vanY), SEQ ID NO 15 (vanZ), SEQ ID NO 23 (vanR), SEQ ID NO 24 (vanS) or a variant of one of these sequences as soon as it encodes a protein having immunological and / or functional properties similar to those of the proteins encoded by the sequences SEQ ID NO 8 SEQ (vanA), ID NO 9 (vanH), SEQ ID NO 10 (vanX), or SEQ ID NO 21 (vanC), SEQ ID NO12 (transposase), SEQ ID NO 13 (resolvase), SEQ ID NO 14 (vanY), SEQ ID NO 15 (vanZ), SEQ ID NO 23 (vanR), SEQ ID NO 24 (vanS) or that it allows the detection of strains resistant to antibiotics of the family of glycopeptides.

Variants include all fragments of sequences having the following properties.

These sequences encode the VanH, VanA and VanX resistance proteins.

The nucleotide sequence designated SEQ ID NO 8 corresponds to a DNA fragment of 1029 bp located between the ATG codon at position 377 and the TGA codon at position 1406 on plasmid pAT214 (Fig. 6).

The localization of the regulation and resistance proteins is illustrated in FIG.

The inventors have identified upstream and downstream vanR, vanS, vanH, vanA and vanX genes required or associated with the expression of resistance to glycopeptides at a given level, as long as genes coding for a transposase and a resolvase (upstream of the aforementioned group) and vanY and vanZ genes, downstream of this group. The transposase and resolvase genes would be involved in transposition functions and the vanY gene encoding a D, D-carboxy peptidase would be involved in the metabolism of peptidoglycan, and could contribute to glycopeptide resistance in E. faecium BM4147 even though vanR, vanS, vanH, vanA and vanX carried by a high copy number plasmid alone confer a high level of resistance.

Note that the coding sequence of the transposase is located on the (-) strand of the sequence ID NO 22 which codes for vanR, vanS, vanH, vanA, vanX, vanY, vanZ and the resolvase.

The invention relates not only to the DNA sequences identified in the sequence listing but also to the complementary DNA sequences and the corresponding RNA sequences. The invention furthermore relates to the equivalent sequences of the preceding ones, either in terms of the expression of proteins, polypeptides or fragments thereof described above, or in terms of their ability to detect, for example by chain polymerization techniques, Gram-positive bacterial strains, which are resistant to antibiotics of the glycopeptide family such as vancomycin or teicoplanin.

Also included in the invention are recombinant sequences characterized in that they comprise one of the nucleotide sequences above.

The invention also relates to a recombinant vector characterized in that it comprises one of the nucleotide sequences above, in a non-essential site for its replication, under the control of regulatory elements likely to intervene in the expression, of resistance to antibiotics of the family of glycopeptides, in particular vancomycin or teicoplanin, in a specific host.

Particularly advantageous recombinant vectors for carrying out the invention are the following vectors: pAT214 containing the 1761 bp Eco RV- Sac II fragment containing a nucleotide sequence coding for the VanA protein; in these vectors, the sequences of the invention are advantageously placed under the control of promoters such as the lac promoter.

The invention also relates to a recombinant cell host comprising a nucleotide sequence as described above or a vector described above, under conditions allowing the expression of resistance to antibiotics of the family of glycopeptides, in particular the resistance to vancomycin or / and teicoplanin, this host being for example selected from bacteria, including gram-positive cocci. In particular, the invention relates to a method for preparing a recombinant cellular host as described above.

For some applications it is also possible to use yeasts, fungi, insect or mammalian cells.

The invention also relates to a nucleotide probe characterized in that it is capable of hybridizing with a sequence described above, this probe being optionally labeled. These probes may or may not be specific for glycopeptide resistance proteins.

Markers that can be used for the purposes of the invention are known radioactive markers as well as than other markers such as enzymatic markers or chemoluminescent markers.

Probes so labeled can be used in hybridization assays to detect glycopeptide resistance in Gram-positive bacteria. In this case, it will be possible to implement conditions of low stringency.

Nucleotide probes according to the invention can be characterized in that they are specific in Gram-positive bacteria for sequences coding for a glycopeptide resistance protein, in particular vancomycin and / or teicoplanin, these probes being able to besides being universal among these sequences.

By these specific probes is meant any oligonucleotide hybridizing with a nucleotide sequence coding for one of the proteins according to the invention, as described in the preceding pages, and exhibiting no cross-hybridization or amplification reaction (PCR ) with sequences present in all the susceptible strains.

The universal character of the oligonucleotides usable in PCR is determined by their ability to specifically promote the amplification of a nucleotide sequence involved in resistance in any strain of Gram-positive bacterium, resistant to antibiotics of the glycopeptide family.

The size of the nucleotide probes according to the invention may vary according to the desired use. For the oligonucleotides usable in PCR, fragments of the usual length will be used in this technique. To make probes, you can take any part of the sequences of the invention, for example probes fragments of 200 nucleotides.

According to a particular embodiment of the invention, a nucleotide probe is chosen for its specificity with respect to a nucleotide sequence coding for a protein required for expression in Gram-positive bacteria of a high level of resistance. to antibiotics of the glycopeptide family, in particular to vancomycin and teicoplanin.

Other probes that are advantageous for carrying out the invention are characterized by their universal character, according to the above definition, but not specific to the resistance genes. They can also be used as PCR primers, and are for example:

V1 and V2 hybridize with vanA and vanC and are likely to lead to the detection in other microorganisms of proteins associated with glycopeptide resistance.

Other particular probes of the invention have the specific character of a nucleotide sequence coding for a protein necessary for the expression in Gram-positive bacteria of a low level of resistance to antibiotics of the family of glycopeptides, particularly to vancomycin in Gram-positive bacteria.

In a particularly preferred manner, a probe of the invention is characterized in that it hybridises with a chromosomal or non-chromosomal nucleotide sequence of a Gram-positive strain resistant to glycopeptides, in particular vancomycin and / or teicoplanin, in particular in that it hybridises with a chromosomal or non-chromosomal nucleotide sequence of a Gram-positive cocci strain, for example an enterococci strain and preferably E. faecium 4147 or E. gallinarum.

To differentiate strains with a high level of resistance, strains with a low level of resistance, a hybridization test can be carried out using conditions of high stringency.

The oligonucleotides of the invention can be obtained from the sequences of the invention, by cleavage with restriction enzymes, or by chemical synthesis according to conventional methods.

The invention also relates to polyclonal or monoclonal antibodies, characterized in that they recognize the polypeptide or polypeptides described above or an amino acid sequence described above.

These antibodies can be obtained by conventional methods of producing antibodies. In particular, for the preparation of the monoclonal antibodies, the Kolher method will be used. Milstein according to which monoclonal antibodies are prepared by cell fusion between myeloma cells and mouse spleen cells previously immunized with a polypeptide or a composition according to the invention, according to the conventional method.

The antibodies of the invention are advantageously usable for the detection of the presence of proteins characteristic of a resistance to glycopeptides, in particular to vancomycin and teicoplanin.

Also within the scope of the invention, tests for the detection in Gram-positive bacteria, a resistance to glycopeptides, including tests using ELISA techniques.

• des anticorps répondant à la définition ci-dessus, le cas échéant marqués,
• un réactif pour la détection d'une réaction immunologique du type anticorps-antigène,
• le cas échéant des réactifs pour effectuer la lyse de cellules de l'échantillon testé.

A kit for the in vitro diagnosis of the presence of Gram-positive strains, resistant to glycopeptides, in particular to vancomycin and / or teicoplanin, these strains belonging in particular to Gram-positive cocci, for example enterococci, for example E. faecium or E. gallinarum , characterized in that it comprises:

• antibodies as defined above, where appropriate labeled,
• a reagent for the detection of an immunological reaction of the antibody-antigen type,
• optionally, reagents for lysing cells of the test sample.

The means developed by the inventors also have the advantage of being very advantageous for being suitable for carrying out a rapid and reliable test or kit for the detection of Gram-positive strains resistant to glycopeptides by the polymerase chain reaction (PCR). Such a test makes it possible to improve the sensitivity of existing tests which remain unreliable and may in certain cases allow the detection of all the representatives of the family of genes coding for glycopeptide-resistant proteins in Gram-positive bacteria. .

The realization of a test by the method of amplification of the genes of these proteins is done by the PCR technique or by the IPCR technique (IPCR: abbreviation of reverse chain polymerization reaction).

The IPCR technique allows the amplification of the NH ₂ and terminal COOH regions of the genes that one wishes to detect.

Certain particular primers make it possible to amplify the genes of the resistant strains at low level.

By way of example, the following sequences can be used as primers for the preparation of probes for the detection of amplification by the PCR or IPCR method.

X represents one of the bases A, T, C or G or in each case corresponds to inosine.

The invention naturally targets the complementary probes of the oligonucleotides previously described as well as possibly the corresponding RNA probes.

• une sonde nucléotidique répondant aux définitions ci-dessus et le cas échéant,
• des oligonucléosides triphosphates en quantité suffisante pour permettre l'amplification de la séquence recherchée,
• un tampon d'hybridation,
• un agent de polymérisation d'ADN.

A kit for the in vitro diagnosis of the presence of Gram-positive bacteria strains, resistant to glycopeptides, in particular resistant to vancomycin and / or teicoplanin, these strains belonging in particular to gram-positive cocci, especially in what are enterococcal strains, for example E. faecium or E. gallinarum , is characterized in that it comprises:

• a nucleotide probe corresponding to the above definitions and, if appropriate,
• oligonucleoside triphosphates in sufficient quantity to allow the amplification of the desired sequence,
• a hybridization buffer,
• a DNA polymerization agent.

1. a) la mise en contact d'un échantillon biologique susceptible de contenir les souches résistantes, avec une amorce constituée par une séquence nucléotidique ci-dessus décrite, ou toute partie d'une séquence précédemment décrite, capable d'hybrider, avec une séquence nucléotidique recherchée nécessaire à l'expression de la résistance aux glycopeptides, cette séquence étant utilisée comme matrice, en présence des 4 différents nucléosides triphosphates, et d'un agent de polymérisation, dans des conditions d'hybridation telles que pour chaque séquence nucléotidique ayant hybride avec une amorce, un produit d'élongation de chaque amorce complémentaire de la matrice est synthétisé,
2. b) la séparation de la matrice et du produit d'élongation obtenu, ce dernier pouvant alors également se comporter comme une matrice,
3. c) la répétition de l'étape a) de façon à obtenir une quantité détectable des séquences nucléotidiques recherchées,
4. d) la détection du produit d'amplification des séquences nucléotidiques.

The invention also relates to a method for the in vitro detection of the presence of Gram-positive strains resistant to glycopeptides, in particular to vancomycin and / or teicoplanin, these strains belonging in particular to the family of Gram cocci. positive, especially in that it concerns enterococcal strains, for example E. faecium or E.gallinarum, characterized in that it comprises:

1. a) bringing into contact a biological sample that may contain the resistant strains, with a primer consisting of a nucleotide sequence described above, or any part of a sequence previously described, capable of hybridizing, with a desired nucleotide sequence necessary for the expression of glycopeptide resistance, this sequence being used as a template in the presence of the 4 different nucleoside triphosphates, and a polymerization agent, under hybridization conditions such that for each nucleotide sequence having hybridized with a primer, an extension product of each complementary primer of the matrix is synthesized,
2. b) the separation of the matrix and the elongation product obtained, which can also behave like a matrix,
3. c) repeating step a) so as to obtain a detectable quantity of the desired nucleotide sequences,
4. d) the detection of the amplification product of the nucleotide sequences.

The detection of the elongation products of the desired sequence can be carried out by a probe identical to the primers used to perform the PCR or IPCR technique, or by a probe different from these primers, this probe being optionally labeled.

Details concerning the implementation of PCR techniques can be obtained from patent applications EP 0229701 and EP 0200362.

Other advantages and features of the invention appear in the examples which follow and in the figures.

FIGURES

• Figure 1 : SDS polyacrylamide gel electrophoresis (SDS-PAGE) of the proteins of the lines 1 and 4 membrane fractions, molecular weight standards; line 2, E. faecium BM4147 cultured in the absence of vancomycin; line 3, BM4147 cultured with 10 μg / ml of vancomycin. The arrowhead indicates the position of the VANA protein.
• Figure 2 :
  • A: Restriction maps of plasmid pAT213 and pAT214 inserts. The vector and the DNA insert are distinguished by light and dark segments respectively. The open arrow represents the vanA gene.
  • B: Strategy for nucleotide sequencing for the 1761 bp insert in plasmid pAT214. The arrows indicate the direction and extent of the sequencing reactions by the dideoxy method. The synthetic primer of oligonucleotides
    (5 'ATGCTCCTGTCTCCTTTC 3' OH) is complementary to the sequence between positions 361 and 378. Only the relevant restriction sites are given.
• Figure 3 : position of the sequences R, S, ORF1, ORF2, ORF3.
• Figure 4 : Representation of SEQ ID NO 6
• Figure 5 : representation of SEQ ID NO 6 and the corresponding protein.
• Figure 6: sequence of the vanA gene and the corresponding protein.
• Figure 7 :
  1. (a): Localization of the vanR, vanS, vanH, vanA, vanX, vanY, vanZ genes of the transposase gene and the resolvase gene, as well as inverted terminal 38 bp end sequences at the end of the transposon.
  2. (b): Mapping Plasmids (A) Polylinker of pAT29 and derivatives constructed in this study. The arrow labeled F2 indicates the position and orientation of the P2 promoter of aphA-3 (Caillaud et al., 1987, Mol Gen. Genet 207 : 509-513). (B) Insert of pAT80. The white rectangles indicate the pAT29 DNA but are not represented on the scale. The rectangles ending in an arrow indicate the coding sequences. The arrows in solid, vertical and horizontal lines respectively indicate the position and the orientation of the apha-1 gene in the pAT80 derivatives. Restriction sites: Ac, Acc I; B, Bam HI; Bg, Bql II; Bs, Bss HII; E, Eco RI; H, Hin dIII; Hc, Hin cII; K, Kpn I; P, Pst I; S, Sma I; SI, Bag I, SII, Bag II; Sa, Sal I; Sp, Sph I; Xb, Xba I. (C) Inserts in pAT86, pAT87, pAT88 and pAT89. The inserts are represented by solid lines and the corresponding vectors are indicated in parentheses.
• Figure 8 : nucleotide sequence of the transposon shown in Figure 7 and amino acid sequence of the corresponding proteins. The nucleotide sequence is presented for the strand (+) and for the strand (-) (corresponding to the complementary sequence of the strand (+) of the positions 1 to 3189) on which is located the coding sequence of the transposase.
• Figure 9 : Nucleotide sequence of the 1347 bp Sac I- Pst I fragment of plasmid pAT216 containing the vanC gene. The numbering starts at the first G base of the Sac I restriction site. The potential RES sequence upstream of the ATG translation initiation codon at position 215 is underlined. The STOP (TGA) codon is indicated by *. The vanC coding region and the deduced amino acid sequence are indicated in bold type. Overlapping sequential clones were generated by subcloning restriction fragments of pAT216 in bacteriophage M13mp10 (Amersham, England). The universal primer (New England Biolabs Beverly MA) was used to sequence the insertion of recombinant phages. Sequencing was performed by the enzymatic method of di-desoxy nucleotide (Sanger et al., 1977 PNAS 74: 5463-5467) using T7 DNA polymerase (Sequenase US B CORP, Cleveland, OH) and [α- ³⁵ S] dATP (Amersham, England). The reaction products were loaded onto 6% denaturing polyacrylamide gels.
• Figure 10 : Alignment of the amino acid sequences of VanC, VanA, DdlA and DdlB. Identical amino acids (I) and conservative substitutions (C) in the 4 sequences are indicated in the alignment. To classify conservative substitutions, the amino acids were grouped as follows: RK, LFPMVI, STQNC, AGW, H, ED and Y. The regions of strong homology corresponding to domains 1, 2, 3 and 4 are underlined. The sequences corresponding to peptides 1 and 2 are indicated by the arrows.
• Figure 11 : Description of Oligonucleotides V1 and V2
  1. (A): Amino acid sequence of VanA peptides 1 and 2 and D-Ala-D-Ala ligases. The number of amino acids between the N-terminus and the peptide 1, between the peptides 1 and 2 and the peptide 2 and the C-terminus is indicated. The identical amino acids between at least 2 of the 3 sequences are shown in bold type.
  2. (B): Target peptides and deduced nucleotide sequence. X represents any base of the DNA. Peptide 2 in DdlB differs from the target peptide at 2 positions (*).
  3. (C): Nucleotide sequence of V1 and V2. Alternate nucleotides and deoxyinosine (I) which may correspond to any DNA base, have been used at the positions for which the nucleotide sequences encoding the target peptides vary. The arrows give the direction of DNA synthesis. Oligonucleotides were synthesized by the methoxy-phospharamidite method with Biosystem DNA 380B (Applied Biosystem, Foster City, Ca). DNA was isolated from bacterial lysates by extraction with hexadecyl trimethyl ammonium bromide (Inst Biotechnologies, Inc., New Haven, CO) (Bouguenec et al., 1990, J. Bacteriol., 172 : 727-734 and used as a template for PCR amplification with an IBH101 Intelligent Heating Block (Hybarid, GB), as described by Mabilat et al (1990, Plasmid 23 : 27-34). The amplification products were revealed by 0.8% gel electrophoresis after staining with ethidium bromide.
• Figure 12 : inactivation by insertion of vanC. The vanC gene is represented by an open arrow and the internal fragment of 690 bp Eco RI- Hin CII is hatched. In thin lines, the DNA of pAT114 is shown; in bold lines the chromosomal DNA of PM4174; the arrows indicate antibiotic resistance genes: aphA-3 is the gene coding for 3'-aminoglycoside phosphotransferase; erm is the gene encoding ER ^R methyl transferase.
  1. (A): Plasmid pAT217 was constructed by ligation of the Eco RI- Hin CII fragment of pAT216 with the suicide vector pAT114 (Trieu-Cuot et al., 1991, Gene 106 : 21-27) digested with Eco RI and Sma I.
  2. (B): vanC region of chromosomal DNA of BM4174.
  3. (C): vanC region after integration of pAT217.
• Figure 13 : Southern blot analysis of the integration of pAT217 in the vanC gene of BM4174.
  (left panel): Total DNA of BM4175 (lane 2) and BM4174 (lane 3) digested with Eco RI and resolved by electrophoresis on 1% agarose gel. The lambda bacteriophage DNA digested with Pst I was used as a molecular weight standard (lane 1). The DNA was transferred under vacuum to a Nytran membrane (Schleicher and Schul, Germany) using a TE80 Trans-Vac apparatus (Heller Scientific Instruments, San Francisco, CA) and bound to the membrane via a light. UV. Hybridization was carried out with the C probe (Middle) or the aphA-3 probe specific for pAT114 (Lambert et al., 1985, Annals of the Institut Pasteur / Microbiol 136 (b): 135-150).
  (right part): the probes were marked with ³² P by shear translation. Molecular weights (kb) are indicated.
• Figure 14 : alignment of deduced amino acid sequences of VanS from E. faecium BM4147 and PhoR and EnvZ of E. coli. The numbers on the left refer to the position of the first amino acid in the alignment. The numbers on the right refer to the position of the last amino acid in the line corresponding. The identical amino acids are boxed. Dashed lines indicate introduced holes to maximize similarity. The lines indicate the positions of conserved amino acid motifs in other HPKs. Histidine residues in bold in motif 1 are potential sites of autophosphorylation.
• Figure 15 : Alignment of the amino acid sequences deduced from E. coli E. faecium BM4147, OmpR and PhoB from E. coli as well as from CheY from Salmonella typhimurium . The numbers on the right indicate the position of the last amino acid in the corresponding line. The identical amino acids are boxed. The dotted lines indicate the holes introduced to optimize the similarities. Residues in bold correspond to amino acids strongly conserved in effector domains, other RRs. The aspartic residue 57 of CheY is phosphorylated by the associated HPK CheA.

I - IDENTIFICATION OF vanA Materials and methods for the identification and characterization of the vanA gene Bacterial strains and plasmids

The origin of the plasmids used is given in the table below. Strain or plasmid Source or Reference Escherichia Coli JM83 Messing (1979) AR1062 Rambach and Hogness (1977) JM103 Hannshan (1983) ST640 Lugtenberg and van Schijndel van-Dam (1973) Enterococcus faecium BM4147 Leclercq et al (1988) Plasmid pUC18 Norrander et al (1983) pAT213 Brisson-Noël et al (1990) pAT214 Described in this text

Preparation of the enterococcal membranes

Enterococcus faecium BM4147 was cultured until an optical density (OD ₆₀₀ ) of 0.7 in 500 ml brain-heart broth (BHI broth medium) was obtained. Induction was performed with 10 μg / ml of vancomycin (Eli Lilly Indianapolis Ind). The subsequent steps were carried out at 4 ° C. The cells were recovered by centrifugation for 10 minutes at 6000 g, washed in TE buffer (0.01 M TRIS-HCl, 0.002 M EDTA, pH 7.0) and lysed with glass beads (100 diameter) in a Braun device for 2 minutes. Cell debris was separated by centrifugation for 10 minutes at 6000 g. The membranes were collected by centrifugation for 1 hour at 65000 g and resuspended in 0.5 ml of TE buffer.

Preparation of minicells

Plasmids were introduced by transformation into E. coli strain AR1062 prepared as a bacterial sac. The bacterial sacs were recovered on sucrose gradients and the proteins were labeled with 50 μCi of [ ³⁵ S] L-methionine (Amersham, UK) according to the method of Rambach and Hogness (1977, PNAS USA, 74; 5041-5045).

Preparation of membrane fractions and cytoplasmic fractions of E. coli

E.coli JM83 and derived strains were cultured in BHI medium until an optical density (OD ₆₀₀ ) of 0.7 was obtained, washed and suspended in TE buffer. The cell suspension was sonicated (phonolysed) for 20 seconds with 50 W doses in a Branson B7 ultrasonic apparatus and the intact cells were removed by centrifugation for 10 minutes at 6000 g. The supernatant was fractionated into membrane and cytoplasmic fractions by centrifugation for 1 hour at 100000g.

SDS polyacrylamide gel electrophoresis (SDS-PAGE)

Proteins from the bacterial fractions were separated by SDS-PAGE in polyacrylamide linear gradient gels (7.5% -15%) (Laemmli 1970, Nature 227: 680-685). The electrophoresis was carried out for 1 hour at 200 V then 3 hours at 350 V. The gels were stained with Coomassie blue. Proteins from the extracts were separated in 10% polyacrylamide gels and visualized by autoradiography.

Purification of the protein band and determination of the N-terminal sequence

Proteins from the membrane fractions of an E. faecium BM4147 induced culture were separated by SDS-PAGE. The gel was electrotransferred for 1 hour at 200 mA on a polyvinylidene difluoride membrane (Immobilon Transfer, Millipore) using a transfer apparatus (Electrophoresis Unit LKB 2117 Multiphor II) according to the manufacturer's recommendations. The transferred proteins were stained with Ponceau red. The membrane portion carrying the protein of interest was cut off, centered on a teflon filter and placed in the block cartridge of a sequencer (Applied Biosystems Model 470A Sequencer). The protein was sequenced by automated degradation of Edman (1967, Eur J. Biochem 1; 80-81).

Plasmid construction

Plasmid pAT213 (Brisson-Noël et al, 1990, Antimicrob Agents Chemother, 34; 924-927) consists of a 4.0 kb Eco RI DNA fragment of plasmid pIP816 enterococci cloned at the Eco RI site of a gram-positive-gram-negative shuttle vector pAT187 (Trieu-Cuot et al., 1987, FEMS Microbiol Lett 48; 289-294). To construct pAT214, the 1761 bp Eco RV- Sac II DNA fragment of pAT213 was purified, treated with the Klenow fragment of E.coli DNA polymerase I, and ligated to the pUC18 DNA previously digested with Sma I and dephosphorylated (Figure 2). Cloning (Maniatis et al, 1982 Cold Spring Harbor Laboratory Press) was performed with restriction endonucleases (Boehringer Mannheim and Pharmacia) with T4 DNA ligase (Pharmacia) and alkaline phosphatase (Pharmacia) according to the manufacturer's recommendations.

Subcloning in M13 and nucleotide sequence

Restriction DNA fragments were subcloned into the polylinker of the replication forms of mp18 and mpl9 derivatives of bacteriophage M13 (Norrander et al., 1983, Gene 26; 101-106), obtained from Pharmacia PL Biochemicals. E. coli JM103 was transfected with recombinant phages and single stranded DNA was prepared. Nucleotide sequencing was performed by the enzymatic method of the di-deoxy nucleotides (Sanger et al., 1977, PNAS USA 74; 5463-5467) using T7 polymerase DNA (Sequenase, United States Biochemical Corporation, Cleveland Ohio), and '[α ³⁵ S] dATP (Amersham, Great Britain). The products of the reactions were revealed in polyacrylamide gels containing a 6% denaturing buffer.

Computer analysis and data on the sequence

The complete DNA sequence was assembled using the DBCOMP and DBUTIL computer programs (Staden, 1980, Nucleic Acids Res 8; 3673-3694). The PSEQIP protein library of the Institut Pasteur was screened using an alogorythmus developed by Claverie (1984, Nucleic Acids Res 12; 397-407). Alignments between pairs of amino acid sequences were constructed using the algorithm of Wilbur et al (1983, P.N.A.S USA 80; 726-730). The statistical significance of homology was evaluated with Lipman and Pearson's algorithm (1985, Science 227; 1435-1440).

For each comparison, 20 amino acid sequences were used to calculate the averages and standard deviations of the random results.

Genetic complementation tests

Plasmids were introduced by transformation into E. coli ST640, a temperature-sensitive mutant with an unmodified D-ala-D-ala ligase (Lugtenberg et al., 1973, J. Bacteriol 110; 26-34). Transformants were selected at 30 ° C on plates containing 100 μg / ml ampicillin and the presence of plasmid DNA of the desired size and restriction maps were verified. Single colonies grown at 30 ° C. in BHI broth medium containing ampicillin were placed on both a BHI agar medium containing 100 μg / ml ampicillin and in 50 μM isopropyl-1-thio-β -D-glacto-pyranoside (IPTG) and the plates were incubated at a permissive temperature of 30 ° C or non-permissive at 42 ° C. The complementation test was considered positive if the colonies were present after 18 hours of incubation at 42 ° C.

RESULTS Identification of the VanA protein and N-terminal sequence

The membrane fractions of E. faecium BM4147 cultured on the one hand under induction conditions, and on the other hand in the absence of induction, were analyzed by SDS-PAGE. The only detectable difference associated with exposure to sub-inhibitory concentrations of vancomycin was the marked intensification of a band that corresponded to an estimated molecular weight protein of about 40 kDa. In the induced cells and in the uninduced cells, the protein band represents the same protein since this band is absent from the membranes of a BM4147 derivative which has lost the plasmid pIP816. The inducible protein, designated VanA, was purified after SDS-PAGE and automated Edman degradation was performed on a 50 pmol sample. Nine amino acids of the N-terminal sequence of VanA have been identified: Met Asn Arg Ile Lys Val Ala Ile Leu.

Subcloning of the vanA gene

The 4.0 kb insert of plasmid pAT213 is the determinant of glycopeptide resistance of E. faecium BM4147. Various restriction fragments of this insert were subcloned into pUC18 and the Recombinant plasmids specific for vanA in E. coli were identified by SDS-PAGE analysis of the proteins of the cytoplasmic and membrane fractions or bacterial bag extracts. This approach has been used because E.coli is intrinsically resistant to the glycopeptide. The Eco RV- Sac II insert of plasmid pAT214 (FIG. 2) encodes a single 40 kDa polypeptide which migrates together with VanA, derived from the membrane preparations of E. faecium BM4147.

Nucleotide sequence of the insert in pAT214 and identification of the vanA coding sequence

The nucleotide sequence of the Eco RV- Sac II insert of 1761 bp in pAT214 was determined on both strands of the DNA according to the strategy described in FIG. 2. The localization of the termination codons (TGA, TAA, TAG) in three reading frames on each strand of DNA showed the presence of a single open reading frame (ORF) of sufficient size to encode the VanA protein. This ORF reading frame is located between the TAA codon at position 281 and the TAG codon at position 1406. The deduced amino acid sequence of ORF was compared with that of the N-terminus of VanA. The nine amino acids identified by the protein sequencing are encoded by the nucleotide sequence starting with the ATG codon (methionine) at position 377 (FIG. 3). This translation initiation codon is preceded by a sequence (TGAAAGGAGA), characteristic of a ribosome binding site (RBS) of Gram-positive bacteria that is complementary to the 8 bases of the subunit rRNA. 16S Bacillus subtilis in its part (3'OH UCUUUCCUCC 5 ') (Moran et al, 1982, Mol Gen. Genet 186, 339-346). In this context ORF, there is no other ATG or GTG initiation codon between positions 281 and 377. The 1029 bp sequence that extends from the ATG codon at position 377 to the TGA codon at position 1406 encodes a protein containing 343 amino acid residues. The calculated molecular weight of this protein is 37400 Da which is consistent with the 40 kDa estimate obtained by SDS-PAGE analysis.

Homology of VanA amino acid sequences and D-ala-D-ala ligase enzymes

Screening of the protein database, PSEQIP, showed the existence of sequence homology between VanA and E. coli D-ala-D-ala ligases (ECOALA, Robinson et al, 1986, J. Bacteriol 167; 809-817) and Salomella typhimurium (DALIG, Daub et al., 1988, Biochemistry 27; 3701-3708). The percentage of similarity calculated in pairs of proteins was between 28% and 36% for the identical amino acids and between 48% and 55%, taking into account the homologous amino acids. VanA and DALIG are more closely related. The statistical significance of these similarities was evaluated by aligning VANA and sequences containing the same amino acid composition as DALIG or ECOALA (Lipman and Pearson, 1985, Science 227; 1435-1440).

Genetic complementation test for D-ala-D-ala ligase activity

Strain E. coli ST640 is a thermosensitive mutant exhibiting a deficient D-ala-D-ala ligase activity (Lugtenberg et al., 1973, J. Bacteriol 113: 96-104). Plasmids pUC18 and pAT214 were introduced by transformation into E. coli ST640. Strains ST640 and ST640 (pUC18) grew normally only at permissive temperature (30 ° C) while E. coli ST640 (pAT214) grew at both permissive and non-permissive temperatures (42 ° C) .

This test shows that VANA is functionally related to D-Ala-D-Ala ligases in E. coli and is likely capable of catalyzing the same ligation reaction as DALIG.

II - VanS-VanR two-component control system for controlling the synthesis of peptidoglycan precursor depsipeptides MATERIALS AND METHODS Strains, plasmids and culture conditions

The restriction fragments of pIP816 (Tra-, Mob ⁺ , Vm ^r ) were cloned into pAT29 vector derivatives which constitutes a shuttle vector between gram-positive and gram-negative bacteria (oriR pAMβ1, oriR pUC, oriT RK2, spc, lacZα) (Trieu-Cuot et al, 1990, Nucleic Acids Res 18 : 4296). This vector was constructed by the inventors and used to transform E. coli strain JM103 (Δ (lac-proAB), supE, thi, strA, sbcB15, endA, hspR4, F traD36, proAB, LacI ^q , lacZΔM15) (Messing et al., 1983, Methods Enzymol., 101 : 20-78). Plasmid DNA was prepared by a small-scale alkaline lysis protocol (Sambrook et al., 1982, Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor NY) and introduced by electrotransformation (Cruz-Rodz AL et al., 1990, Mol Gen. Genet 224 : 152-154) into E. faecalis JH2-2 (Fus ^R , Rif ^R (Jacob AE et al, 1974, J. Bacteriol 117 : 360-372), using a Gene Pulser apparatus (Bio-Rad Laboratories, Richmond, Calif.). Restriction patterns of plasmids purified from E. faecalis and E. coli were compared to detect possible DNA rearrangements.

The integrative plasmid pAT113 (Mob ⁺ , Em ^R , Km ^R , oriR PACYC184, attTn1545, LacZα) (Trieu-Cuot et al, Gene 106: 21-27) carries the joined ends of the transposon Tn1545. This vector does not replicate in gram-positive bacteria but integrates with the chromosome of the host by illegitimate recombination mediated by the integrase of Tn1545 or Tn916 (Trieu-Cuot et al). Integrative plasmids were introduced by electrotransformation into E. faecalis BM4148 (strain JH2-2 :: Tn916). This strain is modified by the Tn916 transposon described by Franque AE et al (1981, J. Bacteriol., 145: 494-502).

The cultures were made in Brain Heart Infusion Broth (BHI) or on agar at 37 ° C. The method of Steers et al (Antibiot, Chemother, Basel, 9 : 307-311) was used to determine the minimum inhibitory concentrations (MICs) of antibiotics on a Mueller-Hinton agar agar medium.

Recombinant DNA techniques

Cleavage of the DNA with restriction endonucleases (Boehringer Manheim and Pharmacia), the purification of the restriction DNA fragments from the agarose gels, conversion of the cohesive ends to blunt ends with the Klenow fragment of E.coli DNA polymerase I (Boehringer Manheim), dephosphorylation of the ends of the DNA with calf intestine phosphatase (Boehringer Manheim), ligation of DNA fragments with T4 DNA ligase (Amersham) were performed according to standard methods of Sambrook et al (1982, Molecular Cloning, a Laboratory Manual. Spring Harbor Laboratory, Cold Spring Harbor NY).

Plasmid construction

1. (i) vecteur pAT78 pour la reconnaissance de promoteur : l'ADN amplifié du gène cat de chloramphénicol acétyltransférase du plasmide pC194 de Staphylococcus aureus (Horinouchi et al, 1982, J. Bacteriol. 150:815-825) a été inséré entre les sites de restriction PstI et SphI du vecteur navette pAT29. L'amplification par la réaction de polymérisation en chaîne a été effectuée au moyen des amorces A1 et A2 qui ont été synthétisées par la méthode au méthoxy phosphoramidite (Mabilat et al, 1990, Plasmid 23:27-34). La séquence de l'amorce A1 (5'GCTGCAGATAAAAATTTAGGAGG) est composée d'un site de reconnaissance PstI (souligné) et de 18 bases (positions 6 à 23) de pC194 qui incluent le site de liaison au ribosome (RBS ; AGGAGG positions 18 à 23) du gène cat. La séquence de l'amorce A2(5'CGCATGCTATTATAAAA GCCAGTC) contient le site de clivage SphI (souligné) et est complémentaire (positions 8 à 24) à 17 bases de l'extrémité 3' du gène cat. Le triplet ATT aux positions 9 à 11 correspond au codon stop TAA de cat. Les fragments d'ADN amplifiés avec les amorces A1 et A2 consistent donc en une phase ouverte de lecture (orf) et en un site de liaison au ribosome pour CAT (positions 1234 à 1912 selon la numérotation de Horinouchi et al (1982, J. Bacteriol. 150:815-825) flanqués par les sites PstI et SphI. La position 1234 est localisée à l'intérieur de la boucle de la structure secondaire de l'ARNm qui bloque la traduction en l'absence de chloramphénicol. Ainsi la séquence amplifiée ne contient pas le promoteur cat ni la séquence complémentaire du RBS qui est essentielle pour la régulation de traduction Ambulos, N.P et al, 1984, Gene 28:171-176).
2. (ii) vecteur d'expression pAT79 : le fragment de 243 bp ClaI-BssHII portant le promoteur P2 du gène aphA-3 du plasmide d'entérocoque pJHl (Caillaud et al, 1987, Mol. Gen. Genet. 207: 509-513) a été inséré entre les sites de restriction EcoRI et SacI de pAT78.
3. (iii) plasmide pAT80 et ses dérivés : le fragment de 5,5 kb BglII-XbaI de pIP816 a été inséré entre les sites BamHI et XbaI de pAT78. Le plasmide résultant dénommé par pAT80 a été partiellement digéré avec HincII et ligaturé avec le fragment EcoRV contenant un gène apparenté au gène apha-I du transposon Tn903 (Oka A. et al, 1981, J. Mol. Biol. 147: 217-226). Ce fragment contient le gène aphA-I qui code pour la 3'aminoglycoside phosphotransférase de type I conférant la résistance à la kanamycine. L'insertion de aphA-I a été réalisée à trois sites différents dans pAT80, générant les plasmides pAT81, pAT83 et pAT85. Les cassettes BamHI et EcoRI contenant aphA-I ont été insérées aux sites BamHI (pour former le plasmide pAT84) et EcoRI (pour former le plasmide pAT82) de pAT80.
4. (iv) plasmide pAT86, pAT87, pAT88 et pAT89 : le plasmide pAT86 a été construit par clonage du fragment de 2,803 bp, EcoRI-SacII de pAT80 codant pour VanH et VanA, au niveau d'un site SmaI de pAT79. pAT87 a été obtenu en insérant le fragment de 3,4 kb EcoRI-XbaI de pAT80 en amont du gène cat du vecteur de détection de promoteur pAT78. Le plasmide pAT88 résultait de la ligature de pAT78 digéré avec EcoRI et BamHI avec le fragment EcoRI-BamHI de 1,731 bp de pAT80. Le fragment BglII-AccI (positions 1 à 2356) de pAT80 a été inséré dans le polylinker du vecteur intégratif pAT113, générant pAT89.

The origin of the vectors and inserts used for the recombinant plasmids constructed here is as follows:

1. (i) pAT78 vector for promoter recognition: the amplified DNA of the chloramphenicol acetyltransferase cat gene of Staphylococcus aureus plasmid pC194 (Horinouchi et al., 1982, J. Bacteriol., 150 : 815-825) was inserted between the sites Pst I and Sph I restriction of pAT29 shuttle vector. Amplification by the polymerase chain reaction was carried out using primers A1 and A2 which were synthesized by the methoxy phosphoramidite method (Mabilat et al., 1990, Plasmid 23 : 27-34). The A1 primer sequence (5'G CTGCAG ATAAAAATTTAGGAGG) is composed of a PstI recognition site (underlined) and 18 bases (positions 6 to 23) of pC194 which include the ribosome binding site (RBS; AGGAGG). positions 18 to 23) of the cat gene. The sequence of the primer A2 (5'C GCATGC TATTATAAAA GCCAGTC) contains the Sph I cleavage site (underlined) and is complementary (positions 8 to 24) to 17 bases of the 3 'end of the cat gene. The ATT triplet at positions 9 to 11 corresponds to the stop codon TAA of cat. The DNA fragments amplified with primers A1 and A2 thus consist of an open reading phase (orf) and a ribosome binding site for CAT (positions 1234 to 1912 according to the Horinouchi et al numbering (1982, J. Bacteriol 150 : 815-825) flanked by the Pst I and Sph I sites . Position 1234 is located within the loop of the secondary mRNA structure that blocks translation in the absence of chloramphenicol. the amplified sequence does not contain the cat promoter or the complementary sequence of RBS which is essential for translation regulation Ambulos, NP et al., 1984, Gene 28 : 171-176).
2. (ii) pAT79 expression vector: the 243 bp Cla I- Bss HII fragment carrying the P2 promoter of the aphA-3 gene of the enterococci plasmid pJH1 (Caillaud et al., 1987, Mol Gen Genet 207: 509 -513) was inserted between Eco RI and Sac I restriction sites of pAT78.
3. (iii) plasmid pAT80 and its derivatives: the 5.5 kb Bgl II- Xba I fragment of pIP816 was inserted between the Bam HI and Xba I sites of pAT78. The resulting plasmid designated pAT80 was partially digested with Hinc II and ligated with the Eco RV fragment containing a gene related to the transposon apha -I gene Tn903 (Oka A. et al, 1981, J. Mol Biol 147 : 217). -226). This fragment contains the gene aphA-I which encodes for type 3 aminoglycoside phosphotransferase conferring resistance to kanamycin. The insertion of aphA-I was performed at three different sites in pAT80, generating plasmids pAT81, pAT83 and pAT85. The Bam HI and Eco RI cassettes containing aphA-I were inserted at Bam HI (to form plasmid pAT84) and Eco RI (to form plasmid pAT82) sites of pAT80.
4. (iv) plasmid pAT86, pAT87, pAT88 and pAT89: plasmid pAT86 was constructed by cloning the 2.803 bp fragment, Eco RI- Sac II of pAT80 coding for VanH and VanA, at a Sma I site of pAT79. pAT87 was obtained by inserting the Eco RI- Xba I 3.4 kb fragment of pAT80 upstream of the cat gene of the pAT78 promoter detection vector. The pAT88 plasmid pAT78 resulted from the ligation digested with Eco RI and Bam HI fragment with the Eco RI- Bam HI 1,731 bp Pat80. The Bgl II- Acc I fragment (positions 1 to 2356) of pAT80 was inserted into the polylinker of the integrative vector pAT113, generating pAT89.

Subcloning in M13 and sequencing

The restriction DNA fragments were subcloned into a polylinker of bacteriophage M13 replicative derivatives, these derivatives being termed mp18 and mp19 (Norrander et al., 1983, Gene 26 : 101-106). E. coli JM103 was transfected with recombinant phages and single stranded DNA was prepared. Nucleotide sequencing was performed according to the conditions described by Sanger et al (Proc Natl Acad Sci USA, 1977, 74: 5463-5467) using modified T7 DNA polymerase. (Sequenase, United States, Cliveland OH Biochemical Corporation) and [α-35S] dATP (Amersham). The products of the reactions were resolved on gradient gels in 6% polyacrylamide buffer.

Enzymatic test

The JH2-2 derivatives of E. faecalis were cultured at OD ₆₀₀ optical density of 0.7 in BHI broth medium supplemented with spectinomycin (300 μg / ml). Cells were treated with lysozyme, lysed by sonication, and cell debris was centrifuged for 45 minutes at 100000g according to the description of Courvalin et al (1978, Antimicrob Agents Chemother 13 : 716-725). The formation of 5-thio-2-nitrobenzoate was measured at 37 ° C in the presence and absence of chloramphenicol and the specific CAT activity was expressed in micromoles per minute and per milligram of protein (Shaw et al, 1975 Methods Enzymol 43 : 737-755).

RESULTS

The vanH and vanA genes of pIP816 were cloned into plasmid pAT79 under the control of the P2 heterologous promoter (Caillaud et al., 1987, Mol Gen. Genet 207 : 509-513) and the plasmid pAT86 formed did not confer on the strain E. faecalis JH2-2 resistance to vancomycin. These genes are therefore not sufficient for the synthesis of peptidoglycan in the absence of the antibiotic. Various restriction fragments of pIP816 were cloned into the pAT78 vector. The 5.5 kb Bgl II- Xba I fragment of pAT80 is the most small fragment obtained conferring resistance to vancomycin.

Nucleotide sequence of vanR and vanS genes

The sequence of the pAT80 insert was determined on both strands of the DNA from the Bgl II site to the VanH ATG translation initiation codon. Two open reading phases (orf) were found within the 2475 bp sequence: the first open reading phase extends from nucleotide 386 to nucleotide 1123; at position 431 there is a sequence characteristic of RBS sequences of gram-positive bacteria, 6 base pairs upstream of the ATG translation initiation codon (T GAAAGG GT G ); the other translation initiation codons in this orf are not preceded by this type of sequence. The 693 bp sequence from the ATG codon at level 431 to the TAA codon at position 1124 is capable of encoding a protein of 231 amino acids with a molecular weight of 26.612 Da and which is designated VanR.

For the second open reading phase (nucleotide 1089 to nucleotide 2255) the deduced amino acid sequence from the first in-phase initiation codon (TTG at position 1104) would encode a 384 amino acid protein with a molecular weight of 43,847 Da and designated by VanS. The TTG codons at position 1116 and ATG at position 1164 are phase translation initiation codons preceded by sequences with low complementarity to the 3'OH termination of the 16S subunit of B. subtilis RNA ( G G GGG G TT GG -N8-TTG and AGAA C G A AA-N6-ATG respectively).

Between the last vanS codon and the vanH ATG translation initiation codon is a 217 bp sequence that contains a 17 bp inverted inverted sequence. This sequence does not work as a strong transcription terminator.

Comparison of the sequences obtained with databases showed that the conserved amino acid motifs identified by Stock et al (1989, Microbiol Rev. 53 : 450-490) in the kinase domain of 16 HPK (Histidine Protein Kinase) were detected in the C-terminal part of VanS. VanS has two groups of hydrophobic amino acids in the N-terminal region. The Histidine residue 164 of VanS is aligned with the His216 residue of PhoR (Makino et al., 1986, J. Mol Biol 192 : 549-556) and His 243 of EnvZ (Comeau et al., 1985, 164 : 578-584 ) which are sites of presumed autophosphorylation in these proteins.

Similarly amino acids 1 to 122 of VanR have similarities to the effector domains of RR response regulators. Aspartic acid 53 from VanR could be a site of phosphorylation since this residue is aligned with Asp 57 of Che Y which is phosphorylated by HPK associated with CheA and corresponds to an invariant position in other RR-like proteins (Stock et al. supra). VanR could belong to the subclass OmpR-PhoB of RR which activates the transcription initiation mediated by the RNA polymerase comprising the σ70S factor of E. coli (Stock et al supra).

Inactivation by insertion of van genes

Kanamycin resistance cassettes inserted into the van gene cluster in plasmid pAT80 showed that: insertion into vanR suppresses resistance to vancomycin and chloramphenicol; VanR is a transcription enhancer required for the expression of vancomycin resistance genes. Inactivation of vanS results in a reduction of twice the minimum inhibitory concentration (MIC) of chloramphenicol and a three-fold reduction in specific CAT activity, but the minimal inhibitory concentration of vancomycin remains unchanged. Thus VanS is necessary to obtain a high level of transcription of the vancomycin resistance genes, although it is not required for the expression of the vancomycin resistance phenotype.

PAT80 derivatives carrying insertions in vanH (pAT83), vanA (pAT84) or in the 1.0 kb region downstream of vanA (pAT85), provided resistance to chloramphenicol but not to vancomycin. This dissociated phenotype corresponds to the inactivation of genes coding for enzymes that synthesise depsipeptide precursors necessary for the assembly of bacterial walls in the presence of vancomycin.

Downstream of the vanA gene, the presence of an inactivated orf in pAT85, which contains an initiation codon, was detected at a sequence of 365 bp after the vanA TGA codon and before the Sac II site. ATG in phase, preceded by an RBS-like sequence. This sequence codes for a necessary protein the glycopeptide resistance, designated VanX, which comprises at most about 330 amino acids.

Trans-activation of the transcription of van genes

The integrative plasmid pAT89 encoding VanR and VanS was introduced into the chromosome of E. faecalis BM4138. Plasmid pAT87 carrying vanH, vanA and vanX genes cloned upstream of cat gene lacking pAT78 promoter, conferred vancomycin resistance on this strain but not E. faecalis JH2-2. The level of expression of the pAT87 cat gene in strains BM4138 :: pAT89 and JH2-2 indicated that VanR activates transcription of the reporter gene located at the 3 'end of the van gene cluster. Similar levels of CAT synthesis were observed for pAT88 which carries a transcriptional fusion between the 5 'vanA moieties and the cat gene . These results show that in E. faecalis BM4138 :: pAT89 (pAT87) VanR and VanS encoded by the chromosome activate in trans the vanA, vanH and vanX transcription of pAT87 making it possible to obtain a resistance to vancomycin.

It was further noted that gene expression was essentially constitutive when vanR and vanS were carried by a pAT80 multicopy plasmid and weakly inducible by vancomycin when the genes for the regulatory proteins were present on the chromosome of the host.

III- Characterization of the VanC gene sequence of Enterococcus gallinarum BM4174 Definition and use of universal primers for the amplification of genes encoding D-Ala-D-Ala ligases and related proteins involved in vancomycin resistance

The VanA protein required to express a high level of glycopeptide resistance in E. faecium BM4147 shares approximately 28-36% amino acid similarity with E. coli D-Ala-D-Ala ligases but has specificity of substrates different from that of these ligases. Peptides designated by 1 and 2 which are retained in the sequences ligases DdlA and DdlB (Zawadzke, 1991 Biochemistry 30: 1673-1682) in E. coli and the VanA protein were selected to synthesize the universal primers to amplify internal fragments of genes encoding D-Ala-D-Ala ligases or related enzymes. The GEDG (S / T) (I / L) QG and NT (I / L) PGFT target peptides were translated back as shown in Figure IV.1, to obtain degenerate oligonucleotides V1 and V2. Since peptides 1 and 2 of VanA, Dd1A and Dd1B are separated by amino acid sequences of similar length, the predicted size for the amplification product was about 640 bp.

PCR amplification with E. coli JM83 DNA and E. faecium BM4147 resulted in amplification of the expected size products, which were then purified and cloned into bacteriophage M13mp10 (Norrander et al, 1983, Gene 26 : 101-106). Sequencing of the insert obtained with E. coli JM83 a indicated that the PCR product was an internal fragment of ddlA. A probe generated from a recombinant phage obtained with the BM4147 amplification fragment was used for Southern analysis of a BM4147 and BM4147-1 DNA which is a vancomycin-sensitive BM4147 derivative and which is devoid of plasmid pIP816 (Leclercq et al., 1988, N. Engl J. Med 319 : 157-161). The probe hybridized with the 4 kb EcoRI DNA fragment of BM4147 but not with the E. faecium BM4147-1 DNA. As the vanA gene is carried by the Eco RI fragment of 4 kb pIP816, these results indicate that the primers also allow the amplification of a portion of vanA. Thus oligonucleotides V1 and V2 can amplify gene fragments encoding different proteins related to D-Ala-D-Ala ligases in different species.

Amplification, cloning and sequencing of the vanC gene

PCR amplification was performed on the total DNA of E. gallinarum BM4174 and the resulting amplification product of approximately 640 bp was cloned into bacteriophage M13mp10. Single-stranded DNA isolated from recombinant phage was used to construct a C probe (Hu et al, 1982, Gene 17 : 2171-2177). In Southern analysis the probe hybridized with a 1.7 kb Pst I fragment of BM4174 but not with the BM4147 and BM4147-1 DNA.

BM4174 DNA was digested with Pst I and 1.5 and 2 kb fragments were purified by agarose gel electrophoresis and cloned into pUC18 (Norrander et al, 1983, supra). The recombinant plasmids were introduced into E. coli JM83 by transformation and screened by colony hybridization (Sambrook et al., 1989, Molecular cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) using probe C. Homology was detected with plasmid-containing transformant called pAT216, which contained a 1.7 kb Pst I insert. The sequence of the 1347 bp Sac I- Pst I portion of the pAT216 insert was demonstrated on both strands of DNA. Localization of the termination codons in the three reading frames of each DNA strand revealed the presence of an ORF phase located between the TGA codons at positions 47 and 1244. The ATG transcription initiation codon at position 215 is preceded by a GAAAGGA A G A sequence characteristic of RBS sequences complementary to B. subtilis 16S subunit RNA (Moran et al., 1982, Mol Gen. Genet 186 : 339-346). The 1029 bp sequence extending from the ATG codon at position 215 to the TGA codon at position 1244 could encode a 343 amino acid protein with a calculated molecular weight of 37504Da designated VanC. Sequence similarity was detected between VanC, VanA and E. coli D-Ala-D-Ala ligases . In particular, four domains of strong homology previously found between VanA and the enterobacterial D-Ala-D-Ala ligases are also present in VanC. The percentage of identical amino acids calculated for these proteins taken in pairs was between 29 and 38%. Alignment of the four sequences revealed the presence of 57 invariant amino acids that include the conserved residues of peptides 1 and 2 used to define oligonucleotide probes V1 and V2.

Inactivation by insertion of the vanC gene

To evaluate the contribution of vanC to vancomycin resistance in E. gallinarum BM4174, the vanC gene was inactivated by insertion. A fragment of 690 bp EcoRI-HincII, internal vanC was cloned into pAT114 which does not replicate in gram-positive bacteria. The resulting plasmid pAT217 was introduced into BM4174 by electrotransformation (Cruz-Rodz et al., 1990, Mol Gen. Genet 224 : 152-154) and the clones presumed to result from homologous recombination leading to the integration of pAT217 into vanC were selected on erythromycin. Clone BM4175 was compared to BM4174 by Southern hybridization using pAT114-specific C and aphA-3 probe. Both probes hybridized with the 8.6 kb Eco RI fragment of BM4175. Probe C hybridized with a 2.5 kb fragment of BM4174 whereas no signal was observed with the aphA-3 probe. The results indicate that the 6.1 kb plasmid pAT217 was integrated into the vanC gene . Determination of the minimum inhibitory concentration of vancomycin for BM4174 (16 mg / l) and BM4175 (2 mg / l) indicated that inactivation by insertion into vanC abolished vancomycin resistance.

VanC is therefore required for vancomycin resistance. This protein may therefore be thought to synthesize a dipeptide or depsipeptide that is incorporated into the peptidoglycan precursors and is not recognized by vancomycin.

The sequences which are the subject of the invention are given in the following pages after the list of sequences containing the description of these sequences. In the sequence listing, the proteins are identified with respect to the position of the nucleotide bases corresponding to the amino acids of the protein ends.

List of sequences (contained in sequences I (Ia, Ib), II presented below or in the sequence of FIG. 5). Sequences of amino acids

SEQ ID NO: 1 (VanH) : sequence of the first resistance protein, corresponding to the amino acid sequence of open reading phase # 3, starting at base 3501 and ending at base 4529, containing the sequence coding of the vanH gene between bases 3564 and 4529, with respect to the sequence of FIG. 5 or corresponding to the sequence between the positions of nucleotides 6018 and 6983 of sequence Ia.

SEQ ID NO 2 (VanA): Sequence of the VanA protein, corresponding to the amino acid sequence of open reading phase # 1, starting at base 4429 and terminating at base 5553, relative to the sequence of FIG. 5 or corresponding to the sequence between the positions of nucleotides 6977 and 7807 of sequence Ia.

SEQ ID NO. 3 (VanX) : Sequence of the third resistance protein, corresponding to the amino acid sequence of open reading phase No. 3, starting at base 5526 and ending at base 6167, relative to the sequence of Figure 5 or corresponding to the sequence between the positions of nucleotides 7816 and 8621 of the sequence Ia.

SEQ ID NO 4 (VanR) : Sequence of the Regulatory Protein R, Corresponding to the Amino Acid Sequence of Reading Phase No. 1, Starting at the Base 1477 and ending at the base 2214, relative to the sequence of Figure 5 or corresponding to the sequence between the positions of nucleotides 3976 and 4668 of the sequence Ia.

SEQ ID NO 5 (VanS): Sequence of the S sensor protein, corresponding to the amino acid sequence of open reading phase 2, starting at base 2180 and ending at base 3346, relative to the sequence of Figure 5 or corresponding to the sequence between the positions of nucleotides 4648 and 5800 of sequence Ia.

SEQ ID NO 16 : Transposase sequence corresponding to amino acids between nucleotides 150 and 3112 of sequence Ib.

SEQ ID NO : 17 : sequence of the resolvase comprising the amino acids located between nucleotide positions 3187 and 3759 of sequence Ia.

SEQ ID NO 18 : VanY sequence comprising the amino acids located between the positions of nucleotides 9046 to 9960 in sequence Ia.

SEQ ID NO 19 : VanZ sequence comprising the amino acids located between the positions of nucleotides 10116 and 10598 in sequence Ia.

SEQ ID No. 20 : VanC sequence of amino acids represented on list II.

- Nucleotide sequences

SEQ ID NO : 6 nucleotide sequence containing the sequence coding for the proteins, as well as the flanking sequences, represented in FIG.

SEQ ID NO : 7 : sequence containing the coding sequence for the 3 resistance proteins, as well as the flanking sequences starting at base 3501 and terminating at base 6167, shown in FIG.

SEQ ID NO 8 : sequence of the van A gene, starting at base 4429 and ending at base 5553, of the sequence shown in FIG. 5, or corresponding to the nucleotide sequence located between nucleotides 6977 and 7807 of sequence Ia .

SEQ ID NO : 9 coding sequence for the first resistance protein called VanH, starting at the base 3501 and ending at the base 4529, in particular the vanH sequence whose coding sequence is located between the bases 3564 and 4529, of the sequence shown in FIG. 5, or corresponding to the nucleotide sequence located between nucleotides 6018 and 6983 of sequence Ia.

SEQ ID NO : 10 : coding sequence for the third VanX resistance protein, starting at base 5526 and ending at base 6167, of the sequence shown in FIG. 5, or corresponding to the nucleotide sequence located between nucleotides 7816 and 8621 of the sequence Ia.

SEQ ID No. 11 : transposon sequence coding for transposase, resolvase, VanR, VanS, VanH, VanA, VanX, VanY and VanZ and containing the invsersed sequence repeated 38 bp at its N- and C-termini, and corresponding to the sequence Ia.

SEQ ID NO : 12 : coding sequence for the transposase, starting at the base 150 and ending at the base 3112 of the sequence Ib.

SEQ ID NO : 13 : coding sequence for resolvase, starting at base 3187 and ending at base 3759 of sequence Ia.

SEQ ID NO 14 : VanY coding sequence starting at base 9046 and ending at base 9960 of sequence Ia.

SEQ ID NO 15 : sequence coding for VanZ beginning at base 10116 and terminating at base 10598 of sequence Ia.

SEQ ID NO : 21 : coding sequence for VanC, represented on list II in correspondence with the VanC protein.

SEQ ID NO 22 : complete sequence Ia of the E. faecium transposon beginning at base 1 and ending at base 10851.

SEQ ID NO : 23 : coding sequence for the VanR protein, starting at base 3976 and terminating at base 4668 of sequence Ia.

SEQ ID NO : 24 : coding sequence for VanS protein, starting at base 4648 and terminating at base 5800 of sequence Ia.

I. Transposon nucleotide sequence and translation. Ia. strand "+"

Ib strand (-) (corresponds to the sequence of the complementary strand of the strand (+) of position 1 to 3189

LIST OF SEQUENCES: II

Claims (18)

1. A purified protein necessary for expressing or regulating resistance to antibiotics from the glycopeptide family, characterized in that it has an amino acid sequence selected from amino acid sequences identified in the sequence listing as SEQ ID NO: 1 (VanH), SEQ ID NO: 3 (VanX), SEQ ID NO: 20 (VanC), SEQ ID NO: 4 (VanR) or SEQ ID NO: 5 (VanS).
2. A polypeptide composition forming an antibiotics resistance complex, characterized in that it is formed by an association of the proteins of claim 1 designated by SEQ ID NO: 1 (VanH) and SEQ ID NO: 3 (VanX) and the protein designated by SEQ ID NO: 2 (VanA).
3. A polypeptide composition forming an antibiotics resistance complex, characterized in that it is formed by an association of the proteins of claim 1 designated by SEQ ID NO: 1 (VanH), SEQ ID NO: 20 (VanC) and SEQ ID NO: 3 (VanX).
4. A nucleotide sequence, characterized in that it consists of:

   a) one of the nucleotide concatenations identified in the following sequence listing: SEQ ID NO: 9 (VanH), SEQ ID NO: 10 (VanX);

   b) a sequence coding for a gene, hybridizing under stringent conditions with a complementary sequence of one of the concatenations identified in a), provided that they can detect strains resistant to antibiotics from the glycopeptide family;

   c) one of the nucleotide concatenations identified in the following sequence listing: SEQ ID NO: 21 (VanC); SEQ ID NO: 23 (VanR) or SEQ ID NO: 24 (VanS); or

   d) a fragment of the sequences identified in a) or c), allowing the detection of strains resistant to antibiotics from the glycopeptide family.
5. A nucleotide sequence according to claim 4, characterized in that it has one of the following concatenations:

   

   
6. A nucleotide sequence according to claim 4, characterized in that it is a complementary DNA sequence or an RNA sequence.
7. A recombinant nucleotide sequence, characterized in that it is a nucleotide sequence according to any one of claims 4 to 6, under the control of regulation elements that may be involved in expressing resistance to antibiotics from the glycopeptide family, especially vancomycin or teicoplanin, in a predetermined host.
8. A method for preparing a recombinant host cell, characterized in that it comprises transformation of a host cell by a nucleotide sequence according to any one of claims 4 to 7, under conditions allowing the expression of resistance to antibiotics from the glycopeptide family.
9. A nucleotide probe, characterized in that it is a DNA or RNA sequence according to any one of claims 4 to 7, said probe being labeled if appropriate.
10. A nucleotide probe according to claim 9, characterized in that it hybridizes specifically in Gram-positive bacteria with sequences coding for a glycopeptide resistance protein, especially vancomycin and/or teicoplanin, and in that it is universal among said sequences.
11. A nucleotide probe according to claim 9 or claim 10, characterized in that it hybridizes with a non-chromosomal nucleotide sequence of a glycopeptide resistant strain, especially vancomycin and/or teicoplanin, in particular in that it hybridizes with a non-chromosomal nucleotide sequence of a strain of Gram-positive cocci, for example an enterococcus strain, and preferably E. faecium 4147.
12. A nucleotide probe according to one of claims 9 to 11, characterized in that it is one of the following nucleotides:

    

    or

    
13. Monoclonal antibodies, characterized in that they specifically recognize a protein according to claim 1.
14. A kit for in vitro diagnosis, carried out on a biological sample, of the presence of glycopeptide-resistant strains, especially vancomycin and/or teicoplanin, said strains in particular belonging to Gram-positive cocci, especially when they are enterococcal strains, for example E. faecium, characterized in that it comprises:

    • antibodies according to claim 13, which may be labeled if appropriate;

    • a reagent for detecting an immunological antibody-antigen type reaction;

    • if appropriate, reagents to carry out cell lysis in the test sample.
15. A kit for in vitro diagnosis of the presence of glycopeptide-resistant strains, in particular strains resistant to vancomycin and/or teicoplanin, said strains in particular belonging to Gram-positive cocci, especially when they are enterococcal strains, for example E. faecium, characterized in that it comprises:

    • a nucleotide probe according to any one of claims 10 to 12 and, if appropriate;

    • dATP, dCTP, dTTP, dGTP triphosphate oligonucleosides;

    • a DNA polymerization agent.
16. A method for in vitro detection of the presence of glycopeptide-resistant strains, in particular resistant to vancomycin and/or teicoplanin, said strains in particular belonging to the Gram-positive cocci family, especially when they are enterococcal strains, for example E. faecium or E. gallinarum, characterized in that it comprises:

    a) bringing a biological sample which may contain resistant strains into contact with a primer constituted by a nucleotide probe according to any one of claims 9 to 12, capable of hybridizing with a desired nucleotide sequence necessary for the expression of resistance, said sequence being used as a matrix, in the presence of 4 different triphosphate oligonucleosides and a polymerization agent, under hybridization conditions such that for each nucleotide sequence which has hybridized with a primer, an elongation product of each complementary primer of the matrix is synthesized;

    b) separating the matrix and the elongation product obtained, said latter also possibly acting as a matrix;

    c) repeating step a) to obtain a detectable quantity of the desired nucleotide sequences;

    d) detecting the amplification product of said nucleotide sequences.
17. Use of a nucleotide sequence which codes for a protein according to claim 1 or a portion of said protein or for a nucleotide sequence according to claim 4, for in vitro detection of the presence of glycopeptide-resistant strains, especially resistant to vancomycin and/or teicoplanin.
18. Use of a nucleotide sequence constituted by part of one of the concatenations SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 22, as a primer for polymerization chain reactions for the detection of a resistance to antibiotics from the glycopeptide family, especially to vancomycin and/or teicoplanin, in particular in strains from Gram-positive cocci families.

Images