EA046318B1 - PREPARATION OF A SEMICARBAZIDE-SENSITIVE AMINOOXIDASE INHIBITOR AND ITS APPLICATION - Google Patents

Description

Field of technology to which the invention relates

The present invention relates to the field of pharmaceutical technology, more specifically to the class of semicarbazide-sensitive amine oxidase inhibitors.

State of the art

Semicarbazide-sensitive amine oxidase (SSAO) is a type of amine oxidase containing dopamine-quinone groups, which is a member of the semicarbazide-sensitive amine oxidase family and it is also called vascular adhesion protein-1, VAP-1 (vascular adhesion protein 1). It is mainly encoded by the AOC3 gene in animals. Mammalian smooth muscle cells, adipocytes, and endothelial cells contain large amounts of SSAO, and it is also expressed in various organs such as blood vessels, cartilage, and kidneys. SSAO in mammals mainly consists of two isoforms: a membrane-bound isoform and a soluble isoform. Enzyme activity varies greatly among different species and among different tissues of the same species. SSAO can catalyze and metabolize endogenous or dietary amines into aldehydes and produce hydrogen peroxide and ammonia. Natural metabolic substrates in the body are mainly aliphatic amines and aromatic amines, with methylamine (MA) and aminoacetone recognized as two major physiological substrates of SSAOs that are catalyzed to formaldehyde and pyruvicaldehyde, respectively. In endothelial cells, SSAO exists in the form of vascular adhesion protein-1, which mediates leukocyte adhesion to endothelial cells and their exudation.

A large number of studies have confirmed that SSAO and its metabolites are closely associated with atherosclerosis, diabetes and their complications, obesity, stroke, chronic kidney disease, retinopathy, chronic obstructive pulmonary disease (COPD), autoimmune diseases, multiple sclerosis, rheumatoid arthritis, etc. ., pain caused by arthritis, Alzheimer's disease and other inflammatory diseases. SSAO/VAP-1 has been reported to play an important role in cancer biology. Small molecule inhibitors of SSAO/VAP-1 suppress neoangiogenesis and reduce the number of myeloid leukocytes in melanoma and lymphoma. In recent years, research has also shown that SSAO plays a role in the occurrence and development of liver diseases such as fatty liver disease. Fatty liver disease can develop into non-alcoholic fatty liver after combining with inflammation and progression, and a certain proportion of patients will develop liver fibrosis, cirrhosis and even liver cancer over time.

Considering that SSAO function plays an important role in the pathological process of various inflammation-related diseases, the search for highly effective inhibitors is of great significance and importance for the control of diseases caused by SSAO abnormality.

Disclosure of the invention

The purpose of the present invention is to create a class of new SSAO inhibitors, as well as their preparation and use.

In a first aspect of the present invention there is provided a compound of formula I, stereoisomers or racemates thereof, or pharmaceutically acceptable salts thereof

R ₇ - ^L 3 where

A may be selected from the group consisting of a substituted or unsubstituted C6-C10 aromatic ring and a substituted or unsubstituted 5-12 membered heteroaromatic ring, or A is a chemical bond (or lack thereof);

B may be selected from the group consisting of a substituted or unsubstituted C _3-10 cycloalkyl, a substituted or unsubstituted C6-C10 aromatic ring (including a monocyclic ring and a fused ring), a substituted or unsubstituted 5-12 membered heteroaromatic ring (including a monocyclic ring and fused ring), and a substituted or unsubstituted 3-12 membered heterocyclic ring (including a monocyclic ring, a fused ring, a bridged ring and a spiro ring); wherein the heteroaromatic ring or heterocyclic ring may also contain 1-3 heteroatoms selected from nitrogen, oxygen or sulfur;

L1 may be selected from the group consisting of -O-, -NH-, -(C=O)-, -NH(C=O)-, -(C=O)NH-, -NHS(=O) ₂ -, -S(=O) ₂ NH- and (CR9R ₁₀ )n; in each of the above groups, when written from left to right, it means that the left side of the group is attached to ring A, and the right side is attached to -CR3R4-;

L2 may be a chemical bond (or lack thereof) or groups selected from the group consisting of -O-, -NH-, -S-, -(C=O)-, -SO2-, -NH-(C= O)-NH-, -NH-S(=O)2-NH-, -(S=O)-, -NH(S=O)-NH-, -NH-(C=O)-, -( C=O)-NH-, -(CH=CH)n-, -(C=C) _n -, -NH-S(=O) ₂ -, -S(=O) ₂ -NH-, C ₃ -C ₈

- 1 046318 cycloalkyl, 5-8-membered heterocyclyl and (CR ₉ R ₁₀ )n;

L3 may be selected from the group consisting of a substituted or unsubstituted C _3-12 carbocyclic ring (including a monocyclic ring, a fused ring, a bridged ring, and a spiro ring), a substituted or unsubstituted 5-12 membered heterocyclic ring (including a monocyclic ring, a fused ring, bridge ring and spiro ring) and a substituted or unsubstituted 5-6 membered heteroaromatic ring; the heterocyclic ring may contain 1-3 heteroatoms selected from nitrogen, oxygen or sulfur;

R1, R2 can each independently be selected from the group consisting of H, F and Cl;

R ₃ , R 4 each independently may be selected from the group consisting of H, F, -OH, -CN, substituted or unsubstituted ^-^-alkyl, substituted or unsubstituted ^-^-cycloalkyl, substituted or unsubstituted -OC ₁ -C ₈ -alkyl, substituted or unsubstituted -OC ₃ -C ₈ -cycloalkyl, substituted or unsubstituted ^-Cw-aryl, substituted or unsubstituted -OC ₁ -C ₄ -alkyl-C ₆ -C ₁₀ -aryl and substituted or unsubstituted -SC ₁ -C ₈ -alkyl; or R3 and R4 together with the carbon atoms to which they are bonded constitute a 3-8 membered carbocyclic ring or a 3-8 membered heterocyclic ring; and when L1 may be -O-, -NH-, -(C=O)NH- or -S(=O) ₂ NH-, neither R3 nor R4 may be a group selected from the group consisting of - OH, substituted or unsubstituted -OC ₁ ^-alkyl, substituted or unsubstituted -OC ₃ -C ₈ -cycloalkyl, substituted or unsubstituted -OC ₁ -C ₄ -alkyl-C ₆ -C ₁₀ -aryl and substituted or unsubstituted -B- ^^-alkyl;

R ₅ , R 6 each independently may represent hydrogen or R ₅ and R ₆ together with the nitrogen atom to which they are bonded are capable of forming a substituted or unsubstituted 5-6 membered nitrogen-containing heterocyclic ring; or each independently may be -NR _a R _b , wherein R _a and R _b may each independently be H, -C1-C ₈ alkyl, substituted or unsubstituted C3-C8 cycloalkyl, -C ₁ -C ₄ -alkyl-C ₆ -C ₁₀ -aryl, or R _a and R _b together with the nitrogen atom to which they are connected, can form a 5-6-membered nitrogen-containing heterocyclic ring;

R7 may be selected from the following group: substituted or unsubstituted groups selected from the group consisting of ^-^-cycloalkyl, 5-6 membered heterocyclic ring containing 1 nitrogen atom, 4-6 membered heterocyclic ring containing 1 oxygen atom , C1-C6fluoroalkoxy, ( _C1 - _C6 -alkoxyl) _C1 - _C6 -alkoxyl, ^-Oz-alkylcarbonyl, _C2 - _C6- acylamino, (C1-C6alkyl)NH- and ( _C1 - _C6 -alkyl) (C ₁ -C ₆ -alkyl)N-; substituted means that the groups are substituted with a group selected from the group consisting of QC.'6-alkoxyl. C ₁ -C ₆ -alkylcarbonyl, 5-12 membered heteroaromatic ring (monocyclic, conjugated ring or fused ring) and C ₆ -C ₁₂ aromatic ring (monocyclic, conjugated ring, fused ring);

or R7 may be selected from the group consisting of H, substituted or unsubstituted C1-C6 alkoxy, and L3 may be selected from the group consisting of a substituted or unsubstituted 5-12 membered bridge ring and a 5-12 membered oxygen-containing spiroheterocyclic ring;

R8 and R8' can each independently be selected from the group consisting of H, F, Cl, Br, -NO2, -OH, -CN, substituted or unsubstituted Cl- _C8 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted -O-Cl-C ₈ -alkyl, substituted or unsubstituted -O-C3^-cycloalkyl, substituted or unsubstituted -C ₆ -Cl ₀ -aryl, substituted or unsubstituted -O-C1C ₄ -alkyl-C ₆ -Clo- aryl, substituted or unsubstituted -S-Cl-C ₈ -alkyl, -NR _a Rb, -NHR _c , -SO ₂ -(C1-C ₈ alkyl) and -CONR _a R _b ; where Ra and R _b can each independently be H, -C ₁ -C ₈ -alkyl, -C 1 -C 4 -alkyl-C ₆ -C ₁₀ -aryl, or R _a and R _b together with the nitrogen atom to which they are bonded, can form a 5-6 membered nitrogen-containing heterocyclic ring; Rc may be selected from the group consisting of -C(=O)-(C ₁ -C ₈ -alkyl) and -C(=O)-(C ₆ -C ₁₀ -aryl);

R ₉ , R ₁₀ each independently can be selected from the group consisting of H, C ₁ -C ₈ -alkyl, -O-C1-C8-alkyl, -O-C3-C8-cycloalkyl, -C6-C10-aryl, -O -C1-C4-alkyl-C6-C10-aryl, -S-C1-C8-alkyl, -CF3, -S-CF3, -OCF ₃ , -OCH2CF3, F, -OH and -CN; or R ₉ and R ₁₀ together with the carbon atom to which they are bonded may form a group selected from the group consisting of C ₃ -C ₈ -cycloalkyl and 5-12 membered heterocyclyl;

X may be selected from the group consisting of -(C=O)-, -(C=O)-NH- and -CR11R12;

R ₁₁ , R ₁₂ each independently may be selected from the group consisting of H, F, -OH, -CN, substituted or unsubstituted C ₁ -C ₈ -alkyl, substituted or unsubstituted C ₃ -C ₈ -cycloalkyl, substituted or unsubstituted -OC ₁ -C ₈ -alkyl, substituted or unsubstituted -OC ₃ -C ₈ -cycloalkyl, substituted or unsubstituted -C ₆ -C ₁₀ -aryl, substituted or unsubstituted -OC ₁ -C ₄ -alkyl-C ₆ -C ₁₀ aryl and substituted or unsubstituted -SC ₁ -C ₈ -alkyl; or R11 and _R12 together with the carbon atoms to which they are bonded constitute a 3-8 membered carbocyclic ring or a 3-8 membered heterocyclic ring;

provided that the above groups form a chemically stable structure;

unless otherwise specified, the above substituted means one or more hydrogen atoms in the group, substituted by a substituent selected from the group consisting of oxo (=O), hydroxyl, substituted or unsubstituted C5-C ₆ -cycloalkyl, substituted or unsubstituted 5-6- membered heterocyclic ring containing 1 nitrogen atom, 4-6 membered heterocyclic ring containing

- 2 046318 total 1 oxygen atom, C1-C ₆ -alkyl, C1-C ₆ -alkoxy, C1-C ₆ -fluoroalkoxy, C ₁ -C ₆ -alkoxy-C ₁ -C ₆ alkoxy, C1-C ₆ -alkylcarbonyl , C2-C ₆ -acylamino, C1-C ₆ -alkyl NH-, (C1-C ₆ -alkyl) (C1-C ₆ -alkyl) N-; substitution means that the above group is replaced by a group selected from the group consisting of C1- _C6 alkoxy and _C1 - _C6 alkylcarbonyl.

The 5-12 membered oxygen-containing spiro-ring heterocycle may be a spiro-ring selected from the group consisting of an oxygen-containing spiro[3,3]ring, an oxygen-containing spiro[3,4]ring, an oxygen-containing spiro[3,5]ring, an oxygen-containing spiro[3 ,6] ring and an oxygen-containing spiro[4,5] ring.

L3 may be a structure selected from the group consisting of a piperazine ring,

and, while L ₃ may be substituted or unsubstituted.

A compound of formula I may have the structure shown in the following formula:

Ri^R ₂

Р , |Г ^5 /\ ^{Х R} 6 L ₂ ' R3 R4 (|>—R8

R ₉ )m

N

I

R7 where m is 0, 1, 2, 3 or 4.

R ₇ may be selected from the group consisting of substituted or unsubstituted C ₅ -C ₆ cycloalkyl, 5-6 membered heterocyclic ring containing 1 nitrogen atom, 4-6 membered heterocyclic ring containing 1 oxygen atom, 5-12- a heteroaromatic ring member (monocyclic, conjugated ring or fused ring); or R ₇ may be selected from the group consisting of H, substituted or unsubstituted C1-C ₆ -alkoxy, and L3 may be selected from the group consisting of a substituted or unsubstituted 5-12 membered bridged ring and a 5-12 membered oxygen-containing spiroheterocyclic ring .

R ₇ may be selected from the group consisting of ^{v 4} > or ⁷ ; where each of p and q can be independently selected from the group consisting of O, 1, 2, 3 and 4, and the sum of p and q>1. The connection is selected from the following group:

The connection can be selected from the following group:

- 3 046318

A second aspect of the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound according to the first aspect of the present invention, or stereoisomers or racemates thereof, or pharmaceutically acceptable salts thereof, and a pharmaceutically acceptable excipient.

The pharmaceutical composition can be used to prevent and/or treat diseases associated with SSAO or regulated by the SSAO/VAP-1 protein; the diseases may be selected from the group consisting of inflammatory diseases and/or inflammation-related diseases, diabetes and/or diabetes-related diseases, mental disorders, ischemic diseases, vascular diseases, ocular diseases, fibrosis, neuroinflammatory diseases, cancer, with the pain of disease or tissue graft rejection.

Inflammatory and/or inflammation-related diseases may be selected from the group consisting of arthritis (including juvenile rheumatoid arthritis) and pain due to arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel disease (eg, irritable bowel syndrome), psoriasis , asthma, pneumonia, chronic obstructive pulmonary disease (COPD), bronchiectasis, skin inflammation, eye disease, contact dermatitis, hepatitis, autoimmune liver disease, autoimmune hepatitis, primary biliary cirrhosis, sclerosing cholangitis, autoimmune cholangitis, alcoholic cholangitis, atherosclerosis, chronic heart disease failure, congestive heart failure, coronary artery disease, stroke and its complications, myocardial infarction and its complications, destruction of inflammatory cells after stroke, synovitis, systemic inflammatory sepsis, etc.

The pain may be selected from the group consisting of muscle pain, bone and arthritis pain, neuropathic pain, tumor pain, low back pain, inflammatory pain, etc.

Eye diseases may be uveitis or macular degeneration.

The fibrosis may be selected from the group consisting of cystic fibrosis, idiopathic pulmonary fibrosis, liver fibrosis, including non-alcoholic fatty liver disease such as non-alcoholic steatohepatitis (NASH), and alcohol-induced fibrosis causing liver cirrhosis, renal fibrosis, scleroderma, radiation-induced fibrosis and complications caused by fibrosis.

Neuroinflammatory diseases may be selected from the group consisting of stroke, Parkinson's disease, Alzheimer's disease, vascular dementia, multiple sclerosis, chronic multiple sclerosis, etc.

The cancer may be selected from the group consisting of lung cancer, breast cancer, colorectal cancer, anal cancer, pancreatic cancer, prostate cancer, ovarian cancer, liver and bile duct cancer, esophageal cancer, non-Hodgkin's lymphoma, bladder cancer , uterine cancer, glioma, glioblastoma, medulloblastoma and other brain tumors, kidney cancer, head and neck cancer, stomach cancer, multiple myeloma, testicular cancer, germ cell tumor, neuroendocrine tumor, cervical cancer, benign tumors of the gastrointestinal tract, breast and other organs, signet ring cell carcinoma, mesenchymal cell tumors, including sarcoma, fibrosarcoma, hemangioma, angiomatosis, hemangiopericytoma, pseudoangiomatous stromal hyperplasia, myofibroblastoma, fibromatosis, inflammatory myofibroblastoma, lipoma, angiolipoma, granulosa cell tumor of the ovary, fibroneuron omas, neuromas, angiosarcomas, liposarcoma, rhabdomyosarcoma, osteosarcoma, leiomyoma or leiomyosarcoma.

Diabetes and/or diabetes-related diseases may be type I diabetes, type II diabetes, syndrome X, diabetic retinopathy, diabetic nephropathy, diabetic neuropathy or diabetic macular edema.

Mental disorders may be major depression, bipolar depression, or attention disorder with hyperactivity disorder.

Ischemic diseases may be stroke and/or its complications, myocardial infarction and/or its complications, or tissue damage by inflammatory cells after a stroke.

Vascular disease may be atherosclerosis, chronic heart failure, or congestive heart failure.

The arthritis may be osteoarthritis, rheumatoid arthritis, rheumatoid arthritis, or juvenile rheumatoid arthritis.

Systemic inflammatory syndrome may be systemic inflammatory sepsis.

Inflammatory bowel disease can be an irritable bowel disease.

Liver diseases may be autoimmune liver disease, autoimmune hepatitis, primary biliary cirrhosis, sclerosing cholangitis, autoimmune cholangitis, alcoholic liver disease, or non-alcoholic fatty liver disease.

Respiratory diseases may be asthma, acute lung injury, acute respiratory distress syndrome, pneumonia, chronic obstructive pulmonary disease, bronchitis or bronchiectasis.

Eye diseases may include uveitis, iritis, retinitis, autoimmune ocular inflammation

- 5 046318 macular inflammation, inflammation or degeneration caused by angiogenesis and/or lymphogenesis.

Skin conditions may include contact dermatitis, skin inflammation, psoriasis or eczema.

Neuroinflammatory diseases may include Parkinson's disease, Alzheimer's disease, vascular dementia, multiple sclerosis, or chronic multiple sclerosis.

Non-alcoholic fatty liver diseases are simple non-alcoholic liver disease, non-alcoholic steatohepatitis, cryptogenic cirrhosis associated with non-alcoholic fatty liver disease, or primary liver cancer.

The third aspect of the present invention provides the use of a compound according to the first aspect of the present invention or its stereoisomers or racemates or pharmaceutically acceptable salts thereof, or a pharmaceutical composition according to the second aspect of the present invention, wherein it is used for the preparation of medicaments for the prevention and/or treatment of diseases , associated with SSAO or regulated by SSAO/VAP-1 protein or activity.

Diseases associated with SSAO or regulated by SSAO/VAP-1 protein or activity may be selected from the group consisting of inflammatory diseases and/or inflammation-related diseases, diabetes and/or diabetes-related diseases, psychiatric disorders, ischemic diseases , vascular diseases, ocular diseases, fibrosis, neuroinflammatory diseases, cancer, fibrosis or tissue graft rejection.

In one embodiment of the method and application of the present application, the diseases may be diabetes-related diseases selected from diabetic nephropathy, glomerulosclerosis, diabetic retinopathy, non-alcoholic fatty liver disease and choroidal neovascularization.

In another embodiment of the method and application of the present application, the diseases may be neuroinflammatory diseases. In other embodiments of the methods and applications of the present application, the diseases may be selected from liver fibrosis, liver cirrhosis, renal fibrosis, idiopathic pulmonary fibrosis, and radiation-induced fibrosis. In other embodiments of the method and application of the present application, the disease may be cancer.

It should be understood that, within the scope of the present invention, the above-mentioned specifications herein and the specifications specifically described below (such as examples) may be combined with each other, thereby constituting new or technical solutions that do not need to be specified here again.

Brief description of drawings

In fig. 1 shows the results of a pharmacodynamic study of SSAO compounds in a biological study according to example 6 in a disease model associated with ocular inflammation;

In fig. 2 shows the effect of a compound of the present invention on the expression of inflammatory signaling pathway genes in the retina in a rat model of LPS-induced inflammatory disease.

Carrying out the invention

The inventor first discovered a class of small molecule SSAO inhibitors after extensive and in-depth research. The present invention has been completed on this basis.

Terms

Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention belongs.

As used herein, the terms containing or consisting of may be open form, semi-closed form and closed form. In other words, these terms also include essentially consisting of or consisting of.

As used herein, the term alkyl refers to a fully saturated straight or branched hydrocarbon chain group consisting of only carbon and hydrogen atoms and linked to the rest of the molecule by a single bond; having, for example, 1 to 12 (preferably 1 to 8, more preferably 1 to 6) carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl , n-pentyl, 2-methylbutyl, 2,2-dimethylpropyl, n-hexyl, heptyl, 2methylhexyl, 3-methylhexyl, octyl, nonyl and decyl, etc., but are not limited to them. For the purposes of this application, the term G-G^km refers to alkyl groups containing from 1 to 6 carbon atoms.

The term alkoxy as used herein refers to alkyloxy. The alkyl group is as defined above.

As used herein, the term cycloalkyl refers to cyclic alkyl groups consisting of only carbon atoms and hydrogen atoms. For example, including, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc., the cycloalkyl group may optionally have a fused ring, spiro ring, or bridged ring structure. C ₃ -C ₅ cycloalkyl refers to cyclic alkyl groups having from 3 to 5 carbon atoms; C ₅ -C ₆

- 6 046318 cycloalkyl refers to cyclic alkyl groups having from 5 to 6 carbon atoms.

The term 5-12 membered heterocyclyl or 5-12 membered heterocyclic ring as a group or part of other groups as used herein refers to stable 5-12 membered non-aromatic cyclic groups consisting of carbon atoms and 1-3 heteroatoms selected from nitrogen, oxygen, sulfur. Unless otherwise indicated in the specification, a heterocyclyl may be a monocyclic, bicyclic, tricyclic, or more ring system, which may include a fused ring system, a bridged ring system, or a spiro ring system; the nitrogen, carbon or sulfur atoms in the heterocyclic group may optionally be oxidized; the nitrogen atoms may optionally be quaternized; heterocyclyl may be partially or fully saturated. The heterocyclyl may be linked to the rest of the molecule by a single bond via a carbon atom or a heteroatom. In fused rings containing heterocyclyl, one or more rings may be aryl or heteroaryl as defined below, provided that the bridge to the remainder of the molecule is non-aromatic ring atoms. Examples of heterocyclic groups include, but are not limited to: tetrahydropyrrolyl, morpholinyl, piperazinyl, piperidinyl, thiomorpholinyl, 2,7diazaspiro[3.5]nonan-7-yl, 2-oxa-6-azaspiro[3.3]heptan-6-yl, 2, 5-diazabicyclo[2.2.1]heptan-2-yl, azetidinyl, pyranyl, tetrahydropyranyl, thiopyranyl, tetrahydrofuranyl, oxazinyl, dioxanyl, tetrahydroisoquinolinyl, decahydroisoquinolinyl, imidazolinyl, imidazolidinyl, quinazinyl, thiazolidinyl, isothiazolidinyl, iso xazolidinyl, indoline, octahydroindolyl, octahydroisoindolyl, pyrrolidinyl, pyrazolidinyl, phthalimido, etc.

As used herein, the term 5-6 membered heterocyclic ring containing 1 nitrogen atom refers to 5- or 6-membered heterocyclic rings containing only one nitrogen atom in the ring.

As used herein, the term 4-6 membered heterocyclic ring containing 1 oxygen atom refers to 4-membered, 5-membered or 6-membered heterocyclic rings containing only one oxygen atom in the ring.

As used herein, the term 5-6 membered aromatic ring refers to 5 or 6 membered aromatic rings.

As used herein, the term 5-6 membered heteroaromatic ring refers to 5 or 6 membered aromatic rings having 1 to 3 heteroatoms selected from nitrogen, sulfur and oxygen.

As used herein, the term halogen refers to fluorine, chlorine, bromine or iodine.

Compounds of the present invention

The compounds of the present application may be a compound according to Formula I, or stereoisomers or racemates thereof, or pharmaceutically acceptable salts thereof.

The compounds of this application may contain one or more chiral carbon atoms and, therefore, may form enantiomers, diastereomers and other stereoisomeric forms. Each chiral carbon atom can be defined as (R)- or (S)- based on stereochemistry. This application purports to disclose all possible isomers, as well as their racemates and their optically pure forms. To prepare the compounds described herein, racemates, diastereomers or enantiomers can be selected as starting materials or intermediates. Optically active isomers can be prepared using chiral synthons or chiral reagents, or can be separated using conventional methods such as crystallization and chiral chromatography, etc.

Common methods for the preparation/separation of individual isomers include chiral synthesis from suitable optically pure precursors or resolution of racemates (or racemate salts or derivatives) using, for example, chiral high performance liquid chromatography, see, for example, Gerald Gubitz and Martin G. Schmid (Eds. ), Chiral Separations, Methods and Protocols, Methods in Molecular Biology, vol. 243, 2004; A.M. Stalcup, Chiral Separations, Annu. Rev. Anal. Chem. 3:341-63, 2010; Fumiss et al. (eds.), VOGEL'S ENCYCLOPEDIA OF PRACTICAL ORGANIC CHEMISTRY 5.sup.TH ED., Longman Scientific and Technical Ltd., Essex, 1991, 809-816: Heller, Acc. Chem. Res. 1990, 23, 128.

The term pharmaceutically acceptable salts includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

Pharmaceutically acceptable acid addition salts refer to salts formed with an inorganic acid or an organic acid that can maintain the biological effectiveness of the free base without other side effects. Inorganic acid salts include, but are not limited to, hydrochloride, hydrobromide, sulfate, nitrate, phosphate, etc.; salts of organic acids include, but are not limited to, formate, acetate, 2,2-dichloroacetate, trifluoroacetate, propionate, capronate, caprylate, caprate, undecylenate, glycolate, gluconate, lactate, sebacate, adipate, glutarate, malonate, oxalate, maleate, succinate, fumarate, tartrate, citrate, palmitate, stearate, oleate, cinnamate, laurate, malate, glutamate, pyroglutamate, aspartate, benzoate, methanesulfonate, benzenesulfonate, ptoluenesulfonate, alginate, ascorbate, salicylate, 4-aminosalicylate, naphthalene disulfonate, etc. These salts can be obtained by methods known in the art.

- 7 046318

Pharmaceutically acceptable base addition salts refer to salts formed with an inorganic base or an organic base that can maintain the biological effectiveness of the free acid without other side effects. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum and the like. Inorganic salts in this application may be ammonium, sodium, potassium, calcium and magnesium salts. Salts derived from organic bases include, but are not limited to, the following salts: primary amines, secondary amines and tertiary amines, substituted amines including natural substituted amines, cyclic amines and basic ion exchange resins such as ammonia, isopropylamine, trimethylamine, diethylamine , triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethylethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, choline, betaine, ethylenediamine, glucosamine, methylglucosamine, theobromine, purine, piperazine , piperidine , N-ethylpiperidine, polyamine resin, etc. In this application, organic bases may be isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine. These salts can be prepared by methods known in the art.

Methods of obtaining

The following reaction scheme illustrates by way of example a method for preparing a compound of Formula I, or a stereoisomer or racemate thereof, or pharmaceutically acceptable salts thereof, wherein each group is as described above. It should be understood that combinations of substituents and/or variables in the formula are permitted only when such combinations result in stable compounds in the following reaction schemes. It should also be understood that another formula may be prepared by those skilled in the art of organic chemistry by methods disclosed herein (by using appropriately substituted starting materials and changing synthesis parameters, if necessary, using methods well known to those skilled in the art) or known ways.

Those skilled in the art will also appreciate that certain functional groups of the intermediates may need to be protected with appropriate protecting groups in the methods described below. Such functional groups include hydroxyl, amino, mercapto and carboxylic acid. Suitable protecting groups for the hydroxy group include trialkylsilyl or diarylalkylsilyl (eg tert-butyldimethylsilyl, tert-butyldiphenylsilyl or trimethylsilyl), tetrahydropyranyl, benzyl, etc. Suitable protecting groups for amino, amidino and guanidino include tert-butoxycarbonyl, benzyloxycarbonyl, etc. Suitable sulfhydryl protecting groups include -C(O)-R (where R is alkyl, aryl or aralkyl), p-methoxybenzyl, trityl, etc. Suitable carboxy protecting groups include alkyl, aryl or arylalkyl esters.

Protecting groups can be introduced and removed according to standard techniques known to those skilled in the art and as described herein. The use of protecting groups is described in detail in Greene, T. W. and P. G. M. Wuts, Protective Groups in Organic Synthesis, (1999), 4th Ed., Wiley. The protecting groups can also be polymer resins.

Application

The compounds of the present application may have excellent SSAO inhibitory activity and can be used in a pharmaceutical composition with the compounds of the present application as an active ingredient for the prevention and/or treatment of diseases associated with SSAO or regulated by the SSAO/VAP-1 protein, such as atherosclerosis, diabetes and its complications, obesity, stroke, chronic kidney disease, chronic obstructive pulmonary disease (COPD), autoimmune disease, multiple sclerosis, rheumatoid arthritis, arthritis pain, Alzheimer's disease, eye diseases, liver diseases (such as hepatic steatosis, hepatitis, liver fibrosis, liver cirrhosis, liver cancer).

As used herein, the term pharmaceutical composition refers to preparations of compounds and media conventional in the art for delivering biologically active compounds to mammals (such as humans). The medium includes a pharmaceutically acceptable carrier. The purpose of a pharmaceutical composition is to promote administration to the body, which promotes absorption of the active ingredient and thus exhibit biological activity.

As used herein, the term pharmaceutically acceptable refers to a substance (e.g., carriers or diluents) that does not affect the biological activity or properties of the compound and is relatively non-toxic, that is, the substance can be administered to patients without causing adverse biological reactions or interactions with any components included in the formulation. composition in an undesirable manner.

As used herein, the term pharmaceutically acceptable excipients includes, but is not limited to, any adjuvants, carriers, excipients, glidants, sweeteners, diluents, preservatives, coloring agents/pigments, flavoring agents, surfactants, wetting agents, dispersants, suspending agents agents, stabilizers,

- 8 046318 isotonic agents, solvents or emulsifiers acceptable for use by humans or livestock, approved by appropriate government authorities.

As used in the application, the terms preventive, preventive and preventive include reducing the likelihood of developing or worsening eye conditions in patients.

In the application, the term treatment and other similar synonyms include the following meanings:

(i) preventing the occurrence of a disease or condition in mammals, especially when such mammals are susceptible to the disease or condition but have not been diagnosed as having the disease or condition;

(ii) suppression of a disease or condition, that is, inhibition of development;

(iii) alleviation of a disease or condition, that is, a retreat from the state of the disease or condition; or (iv) relief of symptoms caused by the disease or condition.

As used herein, the term effective amount, therapeutically effective amount, or pharmaceutically effective amount refers to an amount of at least one agent or compound that is sufficient to relieve one or more symptoms of the disease or condition being treated to some extent after administration. The result may be a reduction and/or alleviation of signs, symptoms or causes, or any other desired changes in the biological system. For example, an effective amount for treatment is the amount of a composition containing a compound described herein necessary to clinically provide significant relief of a disease. Methods such as dose escalation tests can be used to determine the effective amount appropriate for each individual case.

In the application the terms introduction, enter, entered, etc. refer to methods of delivering compounds or compositions to the desired site for biological action. These methods include, but are not limited to, the oral route, the transduodenal route, parenteral injection (including intravenous, subcutaneous, intraperitoneal, intramuscular, intra-arterial injection or infusion), topical administration and rectal administration. Those skilled in the art are familiar with the administration techniques that can be used for the compounds and methods described herein, for example, those described in Goodman and Gilman, The Pharmacological Basis of Therapeutics, current ed.; Pergamon; and Remington's, Pharmaceutical Sciences (current edition), Mack Publishing Co., Easton, Pa. The compounds and compositions discussed herein can be administered orally.

In the application, the terms combination of drugs, drugs of combined use, combination drug, administration of other therapeutic agents, administration of other therapeutic agents, etc. refer to medical treatment obtained by mixing or combining more than one active ingredient, which includes fixed and non-fixed combinations of active ingredients. The term fixed combination refers to the simultaneous administration of at least one compound described herein and at least one synergistic agent to patients in the form of a single entity or a single dosage form. The term "unfixed combination" refers to the simultaneous administration, combined administration, or sequential administration at variable intervals of at least one compound described herein and at least one synergistic agent to a patient in the form of separate units. This also applies to cocktail therapy, such as the administration of three or more active ingredients.

The relative inhibitory potency of compounds can be measured by the amount required to inhibit SSAO/VAP-1 amine oxidase activity in various ways, for example, in vitro studies using recombinant human protein or recombinant non-human enzymes, cellular studies using cells expressing normal rodent enzymes, studies on cells transfected with human protein, in vivo studies on rodents and other mammals, etc.

Also disclosed are methods of inhibiting SSAO/VAP-1 in patients suffering from inflammatory diseases and receiving treatment for inflammatory diseases using the compounds described by formulas I and II. Human inflammatory diseases include arthritis and pain caused by arthritis, Crohn's disease, irritable bowel syndrome, psoriasis, asthma, chronic obstructive pulmonary disease, bronchiectasis, joint sclerosis, inflammation caused by diabetes, and destruction of inflammatory cells after stroke.

Therefore, the present application discloses a method for inhibiting amine oxidase in humans in need thereof. The method includes administering an effective amount of a compound of formula I or formula II to a patient to obtain positive therapeutic responses.

In addition, the present application discloses a method for treating diseases associated with amine oxidase. The method includes administering a therapeutically effective amount of a compound of Formula I or Formula II to individuals in need thereof.

Also disclosed herein is a method for treating diseases regulated by SSAO/VAP-1. The method includes administering a therapeutically effective amount of a compound of formula I or form

- 9 046318 ly II to people in need.

The above method is applicable where the disease is inflammation. In this context, inflammation includes a variety of indications, including arthritis (including juvenile rheumatoid arthritis), Crohn's disease, ulcerative colitis, inflammatory bowel disease (eg, irritable bowel syndrome), psoriasis, asthma, pneumonia, chronic obstructive pulmonary disease (COPD), bronchiectasis, skin inflammation, eye diseases, contact dermatitis, hepatitis, autoimmune liver disease, autoimmune hepatitis, primary biliary cirrhosis, sclerosing cholangitis, autoimmune cholangitis, alcoholic liver disease, atherosclerosis, chronic heart failure, congestive heart failure, ischemic disease, stroke and its complications, myocardial infarction and its complications, destruction of inflammatory cells after a stroke, synovitis, systemic inflammatory sepsis, etc.

The above method can also be applied when the diseases are type I diabetes, type II diabetes and their complications.

The above method can also be applied when the diseases are macular degeneration and/or other eye diseases.

The above method can also be applied to fibrosis. As used herein, the term fibrosis includes diseases such as cystic fibrosis, idiopathic pulmonary fibrosis, liver fibrosis, including non-alcoholic fatty liver disease such as non-alcoholic steatohepatitis (NASH) and alcohol-induced fibrosis causing liver cirrhosis, renal fibrosis, scleroderma, radiation-induced fibrosis and other diseases , in which excessive fibrosis contributes to disease pathology.

The above method can also be applied to the treatment of neuroinflammatory diseases. As used herein, the term neuroinflammatory diseases includes various indications including stroke, Parkinson's disease, Alzheimer's disease, vascular dementia, multiple sclerosis, chronic multiple sclerosis, etc.

The above method can also be applied to pain-related diseases selected from, but not limited to, the following group: muscle pain, bone and arthrosis pain, neuropathic pain, tumor pain, lumbar and back pain, inflammatory pain and etc.

The above method can also be applied in the treatment of cancer. The cancer may be selected from lung cancer, breast cancer, colorectal cancer, anal cancer, pancreatic cancer, prostate cancer, ovarian cancer, liver and bile duct cancer, esophageal cancer, non-Hodgkin's lymphoma, bladder cancer, uterine cancer, glioma, glioblastoma, medulloblastoma and other brain tumors, kidney cancer, head and neck cancer, stomach cancer, multiple myeloma, testicular cancer, germ cell tumor, neuroendocrine tumor, cervical cancer, benign tumors of the gastrointestinal tract, breast and other organs , signet ring cell carcinoma, mesenchymal cell tumor, including sarcoma, fibrosarcoma, hemangioma, angiomatosis, hemangiopericytoma, pseudoangiomatous stromal hyperplasia, myofibroblastoma, fibromatosis, inflammatory myofibroblastoma, lipoma, angiolipoma, granulosa cell tumor, fibroneuronoma, neuroma, angiosarcoma, liposarcoma, rhabdomyosarcoma, osteosarcoma, leiomyoma or leiomyosarcoma.

The disclosed inventions will be further illustrated below with reference to specific examples. It should be understood that these examples are intended to illustrate the invention only and not to limit the scope of the invention. The experimental methods without special conditions described in the following examples are usually performed under conventional conditions or in accordance with the manufacturer's instructions. Unless otherwise stated, percentages and parts are calculated by weight.

Experimental materials and reagents used in the following examples may be obtained from commercial sources unless otherwise noted.

The method for synthesizing the intermediate product is as follows:

Example A: tert-butyl (E)-(2-(bromomethyl)-3-fluoroallyl)carbamate

OH 1.(Boc) ₂ O,TEA,MeOH OH (CO) ₂ CI ₂ , DMSO2

Η,Ν. D. ΌΗ-------------- BocHN. A. OTBS ---pgm 7ya-s---~ BocHN.JL.OTBS ² ' 2.TBDMSCI, DCM.-78G

Imidazole,0-25“С

[fN Θ ^Ar c _c p γ* NaHMDS , V TBAF A SVgd, PPbz%

THF,-78'C BocHN^A^OTBS _{THFrti 1h} BocHN^kk/OH THF.rt BocHN^Jk^Br

A3 A4 A5A

Example A1:

OH BocHN^/k^OTBS

To a solution of 3-aminopropane-1,2-diol (400 g, 4395.6 mmol) and triethylamine (665.9 g, 6593.4 mmol) in

- 10 046318 methanol (4 L) was added with stirring di-tert-butyl dicarbonate (1040.1 g, 4835.2 mmol) at 010°C. The reaction solution was stirred at 25°C for 2 hours and concentrated under reduced pressure until the complete absence of methanol. The residue was dissolved in dichloromethane (5 L), then imidazole (448.6 g, 6593.4 mmol) was added. At 0-10°C, a solution of TBDMSCl (791.2 g, 5274.7 mmol) in dichloromethane (1 L) was slowly added dropwise to the above solution. The mixture was stirred at room temperature for 2 hours after addition and then 1% citric acid solution (2 L) was added. The organic phase was separated, washed twice with brine, dried over anhydrous sodium sulfate and evaporated in vacuo to give a colorless oil. The oil was dissolved in n-heptane (5 L), washed with 5% brine until imidazole and triethylamine disappeared, dried over anhydrous sodium sulfate and evaporated in vacuo to give the crude product as a colorless oil (1206.6 g, 91%).

Example A2:

About BocHN^/K^-OTBS

To a solution of oxalyl chloride (203.4 g, 1603.2 mmol) in anhydrous dichloromethane (3000 ml), anhydrous DMSO (158.4 g, 2030.8 mmol) was slowly added under a nitrogen atmosphere at -78°C (note: large amount of CO and CO2 has been released and the temperature should not exceed -60°C). After addition, the reaction solution was stirred at -78°C for 30 min, then a solution of compound 1-4 (326.0 g, 1068.8 mmol) in dry dichloromethane (500 ml) was slowly added dropwise to the reaction solution at -78° C. In addition, the reaction solution was stirred at -78°C for another 1 hour. Next, triethylamine (545.1 g, 5344.0 mmol) was slowly added (humidity to be controlled) at -78°C. After addition, the reaction solution was warmed to room temperature, stirred for 1 hour and monitored by TLC. After the disappearance of the starting materials, water (1000 ml) was added to the reaction solution, the organic layer was separated, and the aqueous layer was extracted with dichloromethane (200 mlx2). The organic layers were combined, dried over anhydrous sodium sulfate and evaporated in vacuo to give the crude product. The crude product was dissolved in 3 L of n-heptane, washed with 3% brine until no triethylamine was present and purified by distillation to give the title compound A2 (colorless oil, 225.0 g, 70.1%).

Example A4:

F BocHN^jK^OTBS

A solution of compound A3 (438.0 g, 1148.6 mmol) in anhydrous tetrahydrofuran (1000 ml) was added slowly dropwise to a solution of sodium bis(trimethylsilyl)amide (2M, 1673.0 ml, 3346.0 mmol) in tetrahydrofuran at - 68°C. Thereafter, the reaction solution was stirred at -68°C for 1 hour and a solution of compound 1-5 (290.0 g, 956.0 mmol) in tetrahydrofuran (400 ml) was slowly added to the reaction mixture and stirred for another 8 hours. The reaction solution was heated to 0°C, stirred for 2 hours and monitored by LCMS. After the disappearance of the starting compounds, water (1000 ml) was added to the reaction solution and the mixture was extracted with ethyl acetate (500 mlx3). The organic layers were combined, washed with brine (200 mlx2), dried over anhydrous sodium sulfate and evaporated in vacuo to give the crude product. 1 kg of silica gel was added to the crude product and eluted with petroleum ether. The eluted liquid was evaporated in vacuo to leave a residue. The residue was distilled under reduced pressure (distillates collected at 100-110°C) to give A4 (light yellow oil, 173.0 g, 46.2%, E/Z = 10:1). MS (ESI): m/z=264.15 [M56+H]+.

Example A5: tert-butyl (E)-(3-fluoro-2-(hydroxymethyl)αlyl)carbamate

To a solution of Example A4 (173.0 g, 538.9 mmol, E:Z = 10:1) in tetrahydrofuran (400 ml) was added TBAF tetrahydrate (170.0 g, 538.9 mmol) at 0°C. The reaction solution was warmed to room temperature, stirred for 1 hour and monitored by LCMS. After the disappearance of the starting compounds, water (1000 ml) was added to the reaction mixture and the mixture was extracted with ethyl acetate (400 mlx2). The organic layers were combined, washed with 0.1 N aqueous hydrochloric acid (200 mlx2) and brine (100 mlx2), dried over anhydrous sodium sulfate and evaporated in vacuo to obtain the crude product. The crude product was purified by reduced pressure distillation (collecting distillates at 100-120°C) to give the title compound A5 (light yellow oil, 104.0 g, 94.2%, E:Z = 10:1). ¹ H NMR (400 MHz, CDCl ₃ ) δ 6.59 (d, J=83.7 Hz, 1H), 5.01 (br s, 1H), 3.95 (s, 2H), 3.91 ( dd, J=6.5, 1.6 Hz, 2H), 3.81 (br s, 1H), 1.43 (s, 9H).

- 11 046318

Example A: tert-butyl (E)-(2-(bromomethyl)-3-fluoroallyl)carbamate

A solution of CBr ₄ (251.9 g, 761.0 mmol) in anhydrous 1,2-dichloromethane (100 ml) was slowly added dropwise to a solution of Example A5 (104.0 g, 507.3 mmol) and triphenylphosphine (199.4 g, 761.0 mmol) in anhydrous 1,2-dichloromethane (580 ml) at 0°C. After addition dropwise, the reaction solution was warmed to room temperature and stirred for 30 min. The reaction was monitored using LCMS. After the disappearance of the starting compounds in the reaction solution, the reaction solution was evaporated in vacuo to obtain the crude product. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1) to give the title compound A (white solid 104.0 g, E:Z = 10:1). It was recrystallized twice from petroleum ether (500 ml) to give a white solid (85.5 g, 63.2%, E:Z = 50:1). ¹ H NMR (400 MHz, CDCl ₃ ) δ 6.77 (d, J=81.2 Hz, 1H), 4.76 (br s, 1H), 4.00 (d, J=4.6 Hz, 2H), 3.95 (dd, J=3.4, 0.6 Hz, 2H), 1.45 (s, 9H).

Example 1. (E)-2-(((2-(3,5-Dimethyl-4-(oxobutan-3-yl)piperazin-1-yl)pyrimidin-5-yl)oxo)methyl)3-fluoroprop- 2-en-1-amine .X .,/5¾. ,ΟΒη f NH N _N ^,OBn

N^° ^Bn TFA/DCM, rt, 16 h J O-J

Pd2(dba)3, X-phos ^N ZnCI ₂ , NaBH ₃ CN t-BuONa, toluene, 105 °C ° ^C | ^ΗΝχ γ^ MeOH, 70 °C, 48 h

138274-14-3 1-1 1-2

Example 1-1. tert-Butyl 4-(5-(benzyloxy)pyrimidin-2-yl)-2,6-dimethylpiperazine-1-carboxylate

To solution of compound CAS: 138274-14-3 (220 mg, 1.0 mmol), tert-butyl-3,5-dimethylpiperazine-1carboxylate (291 mg, 1.5 mmol), sodium tert-butoxide (174 mg, 2 .0 mmol) in toluene (3 ml), tris(benzylideneacetone)dipalladium (0) (45 mg, 0.05 mmol) and 2-dicyclohexylphosphorus-2,4,6diisopropylbiphenyl (47 mg, 0.1 mmol) were added. The mixture was stirred at 105°C under nitrogen atmosphere for 1 hour in a sealed tube. The reaction solution was cooled and concentrated. The residue was separated and purified by silica gel column chromatography (dichloromethane:methanol = 20:1) to give the title compound 1-1 (141 mg, 39%) as a yellow oil. MS (ESI): m/z = 399.2 [M+H] ⁺ .

Example 1-2. 5-(Benzyloxy)-2-(3,5-dimethylpiperazin-1-yl)pyrimidine

Trifluoroacetic acid (0.5 ml) was added to a solution of compound 1-1 (141 mg, 0.35 mmol) in dichloromethane (2 ml). The mixture was stirred at room temperature for 16 hours, concentrated, and adjusted to pH=9 with saturated sodium bicarbonate solution. The solution was extracted with ethyl acetate (20 mlx2), dried and concentrated to give the title compound 1-2 (105 mg, 99%) as a yellow oil. MS (ESI): m/z = 299.1 [M+H]+.

- 12 046318

Example 1-3. 5-(Benzyloxy)-2-(3,5-dimethyl-4-(oxobutan-3-yl)piperazin-1 -yl)pyrimidine

To a solution of compound 1-2 (104 mg, 0.35 mmol), 3-oxetanone (126 mg, 1.75 mmol) in methanol (5 ml) was added zinc chloride in tetrahydrofuran (1 M, 0.52 ml, 0. 52 mmol), sodium cyanoborohydride (66 mg, 1.05 mmol). The mixture was heated and stirred for 48 hours, then cooled and concentrated. The residue was separated and purified by silica gel column chromatography (petroleum ether:ethyl acetate = 13:87) to give the title compound 1-3 (44 mg, 35%) as a yellow solid. MS (ESI): m/z = 355.2 [M+H]+.

Example 1-4. 2-(3.5-dimethyl-4-(oxobutan-3-yl)piperazin-1-yl)pyrimidin-5-phenol

Example 1-3 (44 mg, 0.12 mmol) in methanol (5 ml) was placed in a one-neck flask, palladium carbon (20 mg) was added and the hydrogen balloon was replaced three times. The reaction solution was stirred at room temperature for 1 hour. The palladium carbon was filtered off and the filtrate was concentrated to give the title compound 1-4 (22 mg, 67%) as a yellow oil. MS (ESI): m/z = 265.1 [M+H]+.

Example 1-5. tert-Butyl (E)-(2-(((2-(3,5-dimethyl-4-(oxobutan-3-yl)piperαzin-1-yl)pyrimidin-5yl)oxo)methyl)-3-fluoroallyl) carbamate

To a solution of example 1-4 (22 mg, 0.08 mmol) and tert-butyl (E)-(2-(bromomethyl)-3-fluoroallyl)carbamate (26 mg, 0.1 mmol) in \,\-dimethylformamide (2 ml) potassium carbonate (17 mg, 0.12 mmol) was added. The mixture was heated to 50°C and stirred for 1 hour, and then the reaction solution was immediately purified using C-18 reverse phase column chromatography (acetonitrile/formic acid aqueous solution) to obtain the title compound 1-5 (15 mg, 40%) in the form of a colorless oil. MS (ESI): m/z = 452.2 [M+H]+.

Example 1. (E)-2-(((2-(3,5-dimethyl-4-(oxobutan-3-yl)piperazin-1-yl)pyrimidin-5-yl)oxo)methyl)3-fluoroprop- 2-ene-1-amine

Trifluoroacetic acid (0.5 ml) was added to example 1-5 (15 mg, 0.033 mmol) in dichloromethane (2 ml). The resulting mixture was stirred at room temperature for 30 minutes, concentrated and adjusted to pH 7-8 with ammonia water, and then the reaction solution was immediately purified using C-18 reverse phase column chromatography (acetonitrile/ammonium bicarbonate aqueous solution) to give title compound 3 (5.5 mg, 47%) as a white solid. MS (ESI): m/z = 352.6 [M+H]+.

¹ H NMR(400 MHz, CD3OD): δ 8.15 (s, 2H), 8.20 (d, J=83.6 Hz, 1H), 4.73 (t, J=6.4 Hz, 2H ), 4.54-4.53 (m, 2H), 4.12-4.14 (m, 1H), 3.76-3.72 (m, 2H), 3.57-3.52 (m , 2H), 3.48 (d, J=2.4 Hz, 2H), 2.81-2.73 (m, 2H), 1.04 (d, J=6.4 Hz, 6H).

The following compounds were prepared using a method similar to Example 1 by replacing the corresponding starting materials.

- 13 046318

Number Connection structure LCMS, NMR 2 nh ₂ MC (ESI): m/z = 308.9 [M+H]+ Ή NMR (400 MHz, CDC1 ₃ ) δ 8.06 (d, J = 6.1 Hz, 2H), 6.63 (d, J = 82.8 Hz, 1H), 4.57 (s, 1H), 4.41 (dd, J = 3.6, 0.8 Hz, 2H), 3.55 - 3.47 (m, ZN ), 3.44 (dd, J = 10.3, 4.0 Hz, 1H), 3.30 (s, ZN), 2.96 (d, J = 10.3 Hz, 1H), 2.73 (s, 1H), 2.01 (ddd, J = 13.3, 6.8, 2.5 Hz, 1H), 1.79 (d, J = 10.1 Hz, 1H), 1.66 ( s, 1H), 1.55 (s, 1H). 3 nh ₂ r^l\TH 0 MS (ESI): m/z=308.9 [M+H]+. Ή NMR (400 MHz, CD3OD) δ 8.12 (s, 2H), 6.99 (s, 0.5H), 6.78 (s, 0.5H), 4.51 (dd, J = 3, 6, 0.9 Hz, 2H), 4.47 (s, 4H), 3.68 - 3.62 (m, 4H), 3.48 (d, J= 2.1 Hz, 2H), 1, 88 1.82 (m, 4H).

Example 4. (E)-3-Fluoro-2-(((2-(4-(oxobutan-3-yl)piperazin-1-yl)pyrimidin-5-yl)oxo)methyl)prop2-en-1- amine

Example 4-1. tert-Butyl (E)-(2-(((2-chloropyrimidin-5-yl)oxo)methyl)-3-fluoroallyl)carbamate

Compound A ₍ 9800 mg _, 36.7 mmol). The mixture was reacted at 50°C for 3 hours. After completion of the reaction, the reaction solution was cooled to room temperature and added slowly dropwise to water (800 ml). The solid slowly precipitated. The mixture was stirred at room temperature for 2 hours until the solid became homogeneous. The solid was filtered, washed with water and dried. 200 ml of solvent (petroleum ether:ethyl acetate = 10:1) was added and stirred for 6 hours. The solid was filtered and dried to give the title compound 4-1 (9600 mg, 82.5%) as an off-white solid. MS (ESI): m/z = 262.0 [M-55] ⁺ .

Example 4-2. tert-Butyl (E)-(3-fluoro-2-(((2-(4-(oxobutan-3-yl)piperazin-1-yl)pyrimidin-5yl)oxo)methyl)allyl)carbamate

To a solution of Example 4-1 (9600 mg, 30.2 mmol) in N-methylpyrrolidone (80 ml) was added 1(oxobutacyclo-3-yl)piperazine (10750 mg, 75.7 mmol) and N-diisopropylethylamine (7813 mg, 60.5 mmol). The resulting mixture was heated overnight at 120°C in a sealed tube. After completion of the reaction, water (500 ml) was added. The mixture was extracted three times with ethyl acetate (100 ml). The combined organic phases were washed three times with water (80 ml) and once with brine (80 ml), dried over anhydrous sodium sulfate and concentrated. 80 ml of solvent (petroleum ether: ethyl acetate = 10:1) was added and stirred for 6 hours. The solid was filtered and dried

- 14 046318 was sewn to obtain the title compound 4-2 (10200 mg, 79.6%) as an off-white solid. MS (ESI): m/z = 424.2 [M+H]+.

Example 4. (E)-3-Fluoro-2-(((2-(4-(oxobutan-3-yl)piperazin-1-yl)pyrimidin-5-yl)oxo)methyl)prop2-en-1- amine

At 0°C, trifluoroacetic acid (30 mL) was added to a solution of Example 4-2 (8460 mg, 20 mmol) in dichloromethane (60 mL). The solution was stirred at 0°C for 3 hours. After completion of the reaction, the solution was concentrated and then water (10 ml) was added. Ammonia was added dropwise to adjust the pH to 9. After purification by reverse phase column chromatography (mobile phase: aqueous acetonitrile/ammonium bicarbonate), the title compound (6000 mg, 92.8%) was obtained as a white solid. MS (ESI): m/z = 324.0 [M+H] ⁺ .

^1H NMR (400 MHz, CD ₃ OD) δ 8.15 (s, 2H), 6.94 (s, 0.5H), 6.73 (s, 0.5H), 4.69 (t, J =6.7 Hz, 2H), 4.62 (t, J=6.2 Hz, 2H), 4.52 (dd, J=3.6, 0.8 Hz, 2H), 3.73 (t , J=3.9 Hz, 4H), 3.53 - 3.45 (m, 1H), 3.43 (d, J=2.4 Hz, 2H), 2.38 (t, J=3, 9 Hz, 4H).

The following compounds were prepared using a method similar to those in Examples 1 and 4, by substituting the corresponding starting compounds._______________

Number Connection structure LCMS, NMR ,νη ₂ MC (ESI): m/z = 352.1[M+H]+. Ή NMR (400 MHz, CD ₃ OD) δ 8.21 (s, 2H), 8.20 (d, J= 82.8 Hz, 1H), 4.71 (t, J 5 O-J ^nh ₂ = 6.8 Hz, 2H), 4.61 (d, J = 6.0 Hz, 2H), 4.58-4.57 (m, 2H), 3.73 (d, J = 6.8 Hz , 2H), 3.51 (d, J= 2.0 Hz, 2H), 3.47-3.41 (m, 1H), 2.44 (d, J= 6.8 Hz, 2H), 2 .17 (s, 2H), 1.51 (s, 6H). MS (ESI): m/z = 350.6 [M+H]+. Ή NMR (400 MHz, CD ₃ OD) δ 8.15 (s, 2H), 6.87 (d, J= 83.2 Hz, 1H), 4.75 (t, J 6 lT° ^N OJ nh ₂ = 2.0 Hz, 2H), 4.58 (t, J = 2.0 Hz, 2H), 4.56-4.53 (m, 2H), 4.15-4.11 (m, 2H) , 3.79-3.73 (m, 1H), 3.46-3.45 (m, 2H), 3.26-3.21 (m, 2H), 3.12-3.09 (m, 2H), 1.93-1.87 (m, 2H), 1.66-1.58 (m, 2H). MS (ESI): m/z = 348.6 [M+H]+. Ή NMR (400 MHz, CD ₃ OD) δ 8.20 (d, J = 3.2 Hz, 1H), 7.70 (d, J = 2.8 Hz, 1H), 7 /-,O. N -у __CN OJ _Λ /-Ч _r NH ₂ 8.20 (d, J = 82.8 Hz, 1H), 4.72 (t, J = 6.8 Hz, 2H), 4.64 (d, J = 6.0 Hz, 2H), 4, 59-4.52 (m, 2H), 3.60-3.57 (m, 1H), 3.53-3.50 (m, 6H), 2.52 (d, J= 4.2 Hz, 4H). MS (ESI): m/z = 323.9 [M+H]+. Ή NMR (400 MHz, CD3OD) δ 8.50 8.39 (m, 1H), 8.15 (s, 2H), 7.01 (d, 8 °h O C ( 1=81.2 Hz, 1H), 4.73 (d, J = 2.4 Hz, 2H), 4.65 (s, 2H), 4.58 (s, 2H), 3.74 - 3, 66 (m, 4H), 3.59 (d, J = 2.4 Hz, 2H), 3.49 - 3.40 (m, 1H), 2.37 - 2.30 (m, 4H).

- 15 046318

9 nh ₂ Г f ^N < NN 0-J MC (ESI): m/z = 486.2 [M+H]+. Ή NMR (400 MHz, CD ₃ OD) δ 8.24 (s, 2H), 8.18 (s, 2H), 7.13 (d, J = 80.5 Hz, 1H), 4.83 - 4 .76 (m, 4H), 4.56 - 4.52 (m, 2H), 4.37 (td, J = 7.0, 3.6 Hz, 1H), 3.87 3.81 (m, 4H), 3.75 (s, 2H), 3.13 - 3.08 (m, 4H). 10 nh ₂ Ο-J MC (ESI): m/z = 352.6 [M+H]+. Ή NMR (400 MHz, CD ₃ OD) δ 8.17 (s, 2H), 7.15 (d, 7= 81.2 Hz, 1H), 4.82-4.78 (m, 2H), 4 .65-4.62 (m, 2H), 4.58-4.56 (m, 2H), 4.46-4.38 (m, 1H), 3.86-3.83 (m, 2H) , 3.79 (d, J = 2.0 Hz, 2H), 3.61 (s, 2H), 2.86-2.84 (m, 2H), 1.35-1.08 (m, 6H ). eleven nh ₂ OJ MC (ESI): m/z = 280.9 [M+H]+ Ή NMR (400 MHz, CDCh) δ 8.10 (s, 2H), 6.68 (d, J = 81.9 Hz, 1H ), 4.83 (s, 4H), 4.45 (s, 2H), 4.21 (d, J = 6.7 Hz, 4H), 3.57 (s, 2H). 12 ,nh ₂ ι€νύ ''Ό·Ά MC (ESI): m/z=322.9 [M+H]+. Ή NMR (400 MHz, CD3OD) δ 8.43 (s, 2H), 7.26 (d, J= 80.6 Hz, 1H), 4.77 4.67 (m, 4H), 3.84 ( s, 2H), 3.52 (s, 1H), 3.33 (s, ZN), 2.36 - 2.26 (m, 2H), 2.15 2.00 (m, 6H).

Biological Assay Example 1: In vitro SSAO/VAP-1 Inhibitory Activity Assay of Compounds

This assay was used to evaluate the in vitro inhibitory activity of the compounds against SSAO/VAP-1 of various species. Recombinant human SSAO protein, mouse SSAO protein, or rat SSAO protein (provided by Eli Lilly) were used. Enzyme Activity Assay Kit MAO-Glo Assay Kit (V1402) was purchased from Promega. Enzyme reaction buffer was prepared (50 mM HEPES, 120 mM NaCl, 5 mM KCl, 2 mM CaCl ₂ , 1.4 mM MgCl ₂ , 0.001% Tween-20, pH 7.4). The test compound was dissolved in DMSO and diluted in a 3-fold concentration gradient. The final concentration of the test compound in a 10 μL reaction system ranged from 1 μM to 0.05 nM for SSAO detection. The DMSO content in the detected reaction was 1%. After the DMSO solution of the test compound was diluted with enzyme reaction buffer at a volume ratio of 1:25, 2.5 μL of which was added to each well of the detection plate, in duplicate for each concentration. To each well, 5 μl of SSAO protein diluted in enzyme reaction buffer was added, the final concentration of which ranged from 10 nM to 80 nM in a 10 μl reaction system. The mixture was incubated at room temperature for 10 min. To each well, 2.5 μl of reaction substrate was added, diluted in enzyme reaction buffer, the final concentration of which was 10 μM in a 10 μl reaction system. After the mixture had reacted at room temperature for 120 min, 10 μL of detection reagent was added to each well. The reaction solution was incubated for 20 min at room temperature and the plate was read using Synergy Neo 2 for detection. The value was converted to the degree of inhibition using the following formula:

Inhibition degree = (Signal _Pos . - Signal _And trace)/(Signal _Pos . Signal _Pos .) ^x 100%

_Positive signal was a positive control without the test compound. _Negative signal. was a negative control without the test compound and the SSAO enzyme, and Signal _{was studied} . represented the detection value of each compound at different concentrations. The IC ₅₀ value was calculated using a 4-parameter curve fit. For connections with degree

- 16 046318 inhibition of less than 50% within the test range of the compound, the IC ₅₀ value was greater than the highest concentration tested.

After testing, the compounds in the examples of the present invention can effectively inhibit the enzyme activity of SSAO/VAP-1 of various species, and the results are shown in Table. 1.

Biological Assay Example 2: Analysis of Inhibitory Activity of Compounds on MAO-A and MAO-B

Recombinant human MAO-A and MAO-B protein were purchased from Sigma (M7316, M7441). Other reagents are the same as in Biological Assay Example 1. The final concentration of the test compound in 10 μl of the reaction system was 100 μM to 5 nM when MAO-A and MAO-B were detected. The final concentrations of MAO-A and MAO-B protein in 10 μl of the reaction system were 70 nM and 300 nM, respectively, while other reaction conditions were the same as in Biological Study Example 1. Data analysis and method for calculating IC ₅₀ were as follows same as Biological Study Example 1. For compounds with less than 50% inhibition within the compound's test range, the IC ₅₀ value was greater than the highest concentration tested. The results are presented in table. 1.

Bioassay Example 3: Compound AOC1 Inhibitory Activity Assay

Recombinant human AOC1/DAO protein was purchased from R&D systems (Cat: 8298-AO). Amplex UltraRed was purchased from Thermo Scientific (Cat: A36006). HRP (Cat: P8250) and putrescine (Cat: V900377) were purchased from Sigma. Enzyme reaction buffer was prepared (50 mM HEPES, 120 mM NaCl, 5 mM KCl, 2 mM CaCl ₂ , 1.4 mM MgCl ₂ , 0.001% Tween-20, pH 7.4). The test compound was dissolved in DMSO and diluted in a 3-fold concentration gradient. The final concentration of the test compound in 10 μl of the reaction system ranged from 100 μM to 5 nM when detecting AOC1. The DMSO content in the detected reaction was 1%. After the DMSO solution of the test compound was diluted in the enzyme reaction buffer at a volume ratio of 1:25, 10 μL of the mixture was added to each well of the detection plate. A 4x substrate mixture (containing 400 μM putrescine, 4 U/mL HRP, 4 μM Amplex UltraRed) was prepared in enzyme reaction buffer, 10 μL of which was added to each well. 20 μl of AOC1 protein diluted in enzyme reaction buffer was added to each well to a final concentration of 0.4 nM in a 40 μl reaction system. Synergy Neo 2 was used to read the plate for detection. The device was set at 30°C, excitation wavelength 530 nm, emission wavelength 590 nm. Detection was performed once per minute for 30 min continuously. Enzyme activity was calculated based on the increase in signal of each well from the 10th to the 30th minute. The value was converted to the degree of inhibition using the following formula:

Inhibition degree = (Positive signal ^- Research signal)/(Positive signal ^-

Signal _O tric.) ^x 100%

_Positive signal was a positive control without the test compound. _Tris signal. was a negative control without the test compound and AOC1, and the signal _{was studied} . represented the detection value of different compounds at each concentration. The IC ₅₀ value was calculated using a 4-parameter curve fit. For compounds with an inhibition rate of less than 50% within the compound's test range, the IC ₅₀ value was greater than the highest concentration tested.

The results are shown in table. 1.

Biological Assay Example 4: Assay for AOC2 Inhibitory Activity of Compounds.

Recombinant human AOC2 protein (provided by Eli Lilly). Other reagents are the same as in Bioassay Example 1. The final concentration of the test compound in 10 μL of the reaction system was 100 μM to 5 nM for AOC2 detection, while other reaction conditions were the same as in Bioassay Example 1. Assay data and the method for calculating the IC ₅₀ were the same as in Biological Study Example 1. For compounds with an inhibition rate of less than 50% within the compound's test range, the IC ₅₀ value was greater than the highest concentration tested.

The results are presented in table. 1.

- 17 046318

Table 1. Inhibitory activity IC50 (nM) of compounds in vitro against SSAO of various ________________ species and other amine oxidases ______________

Example SSAO person AOC1 AOC2 MAO-A MAO-V SSAO rats SSAO mice 1 A E F I To N.A. N.A. 2 A D G n To L L 3 A D G n To N.A. N.A. 4 A E G I To L L 5 IN E F I To N.A. N.A. 6 IN E F I To N.A. N.A. 7 WITH E G I J N.A. N.A. 8 A E G n J N.A. N.A. 9 A D F I To N.A. N.A. 10 IN E G I To N.A. N.A. eleven WITH N.A. N.A. n To N.A. N.A. 12 A E G n To L L

Enzyme Letter Inhibitory activity IC50 (nM) A <10 S S A ABOUT — IN 10-50 person — WITH >50 D 100-10000 AOC1 — E >10000 F 100-1000 AOC2 — G >1000 N 2000-100000 MAO-A — I >100000 J 5000-20000 MAO-V — TO >20000 S S A ABOUT L <100 rats S S A ABOUT L <100 mice

The above results show that the compounds of the present invention exhibit excellent inhibitory activity against AOC3 and quite good selectivity towards amine oxidase subtypes.

Biological Study Example 5: Analysis of Inhibitory Activity of Compounds on SSAO/VAP-1 in Mouse/Rat Model

The MAO-Glo assay kit (Promega, V1402) was used to determine SSAO activity in animal tissues. After the test compounds were administered to the animal, SSAO enzyme activity was calculated by measuring the activity of monoamine oxidases in an animal tissue homogenate that was insensitive to the MAO inhibitors clologine and pargyline. The compounds were administered orally to rats at various doses and control animals were orally administered the same volume of vehicle. Plasma, brain, retina, small intestine, lungs, liver and kidneys of animals were collected, respectively, 24 h after administration (animals were perfused with PBS before collection of small intestine, lungs, liver and kidneys) and stored at -80°C in the refrigerator until analysis . Each tissue was homogenized in tissue homogenate lysis buffer (20 mM HEPES, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, and 1 Roche Complete protease inhibitor tablet). The homogenate was centrifuged at 12,000 rpm at 4°C for 30 min to remove tissue fragments. 5 µl of supernatant and

- 18046318 µl of a mixture of clologine (10 µM) and pargyline (10 µM) was incubated for 10 minutes at room temperature. Then, 2 μL of substrate from the MAO-Glo assay kit was added to the mixture, and the reaction was carried out at room temperature for 60 min. Detection reagents were added to quench the reaction according to the instructions. Fluorescein data were read using Biotek Neo2. Monoamine oxidase activity in tissues that are not sensitive to MAO inhibitors was used to represent SSAO activity. The percentage of SSAO activity in animals treated with compounds was compared with that in control animals to calculate the degree of inhibition of the compound.

Test results indicate that the compounds can effectively inhibit SSAO activity in various animal tissues after administration. The results are presented in table. 2 and 3.

Table 2. Remaining percentage of SSAO activity (% SSAO activity) after 24 hours __________after a single administration of the compound__________

Example Dose (mg/kg) Plasma Head brain Retina 2 0.6 24.3±5.2 49.1±21.2 28.7±8.5 3 1 15.2±2.6 55.6±10.5 8.9±3.2 10 0.6 5.8±2.1 27.3±1.8 8±0.8 12 1 25.6±3 63.1±12.1 24.6±3.5

Data in the table are presented as mean ± SEM, N = 3.

Table 3. Remaining percentage of SSAO activity (% SSAO activity) of compound _____example 4 24 hours after a single administration_____

Dose (mg/kg) Plasma Headly th brain Retina Liver Lungs Kidneys Small intestine 15 1.1±0.4 4±1.7 3±2.2 -2.4±5.4 2.2±0.2 2.4±1.3 1.1±0.9 3 1.8±0.2 22.1±7.7 5.2±2.4 5.3±3.2 4.6±2.5 0.7±1.8 11.1=1=4.4 0.6 12.9±2.2 26.5±11, 8 8±1.2 3±7.6 14.1±3.8 26.2±10, 1 38.9±3.2 0.12 33.7±1.9 75.4±7.4 25.1±5.3 40.1±8.2 39.8±11, 3 46.3±3.5 96.9±21, 7 0.025 58.6±4.2 143.1±68.3 49.1±7.1 14.4±8.1 64±20.3 58.7±12, 1 / 0.005 61.7±8.2 98.3±25, 4 65±14 107.7±33.5 94.9±17, 2 99.2±4.1 / Control l. 99.89±8, 8 100±18.7 100±23 99.89±14.4 100±36 99.89±5, 7 100±3.2

Data in the table are presented as mean ± SEM, N = 3.

Biological Study Example 6: Pharmacodynamic Study of SSAO Compound in a Rat Ocular Inflammation Disease Model (7-8 weeks, 220-250 g) were divided into 3 groups: control group (6), model group (8) and treated group connection (8). For the model group and the compound-treated group, ocular inflammation was induced by a single injection of 8 μg/100 μl of lipopolysaccharide (Sigma-Aldrich-L2880) into the footpad. Rats were divided into groups according to their body weight 1 hour before induction. The compound of Example 4 (6 mg/kg, 10 ml/kg) or vehicle (10 ml/kg) was administered orally, respectively. 24 hours after induction, anterior aqueous humor was collected and the eyeballs were removed for retinal dissection. Ocular inflammation was quantified by measuring protein concentration and cell number in the intraocular fluid. qPCR was used to test for changes in gene expression associated with retinal inflammation.

Methods for determining cell number and protein concentration in intraocular fluid μl of intraocular fluid was diluted in 40 μl of PBS and mixed, then 25 μl of the mixture was mixed with 75 μl of PBS and centrifuged at 300 rpm for 5 min at 4°C. 55 μl of the supernatant was gently aspirated and the protein concentration was determined according to the method described in the BCA Protein Assay Kit (Pierce-23227); after resuspension of the remaining sample, 40 μl of the cell suspension was added to 100 μl of 1% FBS/PBS for analysis and live cell counting using NovoCyte 3130 flow cytometry after excluding cellular debris.

Compared with the control group, the concentration of total protein in the intraocular fluid in the mo

-

Claims (9)

separate group increased significantly (mean ± SEM: 9730.04 ± 1232.30 μg/ml vs. 3147.42 ± 404.79 μg/ml), and the number of cells increased significantly (mean ± SEM: 48.28 ± 21.46* 104 cells/ml versus 2.69 ± 0.45*104 cells/ml), suggesting that the ocular inflammatory disease model was successfully induced. Compared with the model group, the protein concentration was decreased (mean ± SEM: 7275.44 ± 622.66 vs. 9730.04 ± 1232.30 μg/ml) and the cell number was significantly decreased in the compound-treated group (mean ± SEM: 5.07 ± 0.80 * 104 cells/ml vs. 48.28 ± 21.46 * 104 cells/ml), suggesting that the compound of Example 4 can significantly alleviate the symptoms of a disease associated with ocular inflammation. As shown in FIG. 1, the compound of Example 4 can significantly alleviate the symptoms associated with ocular inflammation in a rat model of LPS-induced inflammatory disease; fig. 1A. Changes in protein concentration in intraocular fluid (µg/ml); Figure 1B. Changes in the number of cells in the intraocular fluid (*104/ml). Determination of the expression level of genes associated with inflammation in the retina: 1) Primers were synthesized with the following information: _____________________________ Primer name Rat-Alox5ap-F Rat-Alox5ap-R Rat-Socs3-F Rat-Socs3-R Rat-UBC-F Sequence ( 5*to3*) CCTTCGCTGGGCTGATGTAT ATAGGATGATCCGCTTGCCG CCCCGCTTTGACTGTGTACT AAAGGAAGGTTCCGTCGGTG ACACCAAGAAGGTCAAACAGG Rat-UB C-R AGACACCTCCCCATCAAACC Rat-TLR7-F AGCTCTGTTCTCCTCCACCA Rat-TLR7-R ACCATCGAAACCCAAGGACTC 1 . Compound according to formula I or stereoisomers or racemates thereof, or pharmaceutically acceptable salts thereof Where A is missing; B is a substituted or unsubstituted 6-membered heteroaromatic ring, with - 20 046318 containing 1-2 nitrogen heteroatoms; L1 represents -O-; L2 is missing; R1, R2 are each independently selected from the group consisting of H and F; R ₃ , R ₄ each represents H; R5, R6 each represent H; R ₇ is a 4-6 membered heterocyclic ring containing 1 oxygen atom; L ₃ represents a substituted or unsubstituted 6-10 membered heterocyclic ring containing 2 nitrogen heteroatoms; R ₈ is selected from the group consisting of H and -CN; X represents -CR11R12; R11, R12 each represent H; provided that the above groups form a chemically stable structure; unless otherwise indicated, the above substituted means that one or more hydrogen atoms in the group are replaced by a ^-^-alkyl substituent. 2. A compound according to claim 1, or stereoisomers or racemates thereof, or pharmaceutically acceptable salts thereof, the compound of formula I has the structure represented by the following formula: where m is 0, 1, 2, 3 or 4; R9 represents C ₁ -C ₆ -αalkyl. 2) Retinal RNA was extracted according to the instructions for using an RNA extraction kit (RNeasy Mini Kit, Qiagen-74104), and then the RNA was reverse transcribed into cDNA (High Capacity cDNA Reverse Transcription Kits, ABI-4374966). The resulting cDNA was diluted 10-fold to serve as a qPCR reaction template. According to the instructions of the Power SYBR Green kit (ABI-A25918), the qPCR reaction was performed on a CFX384 Real-Time qPCR equipment. Quantitative analysis of expression changes for each gene expression was performed using CFX Maestro software using the ΔΔΟ method with UBC as the internal housekeeping gene. Compared with the control group, the gene expression levels of ALOX5AP, SOCS3 and TLR7 increased significantly in the model group. Compared with the model group, the gene expression levels of ALOX5AP, SOCS3 and TLR7 were significantly decreased in the compound-treated group, as shown in FIG. 2. After analysis, all gene expressions of ALOX5AP, SOCS3 and TLR7 were regulated by NFkB signaling pathway, which was a very important molecular signaling pathway in inflammatory diseases. Fig. 2: The compound of Example 4 can significantly reduce the expression level of inflammation-related genes in the retina in an LPS-induced inflammatory disease rat model. A. ALOX5AP; B.SOCS3; C. TLR7. All literature referenced in this application is incorporated herein by reference as if each were individually incorporated by reference. In addition, it should be understood that after reading the above methods, those skilled in the art may make various changes and modifications to the present invention. These equivalents are also within the scope of the appended claims. CLAIM 3. A compound according to claim 1, or stereoisomers or racemates thereof, or pharmaceutically acceptable salts thereof, wherein R ₇ is a value of 0, 1 or 2, and the sum of p and q > 2. where each of p and q is independently selected from the following group: 4. Connection according to paragraphs 1-3, in - 21 046318 5. A compound according to Formula I or its stereoisomers or racemates, or its pharmaceutically acceptable salts Where A is missing; B is a substituted or unsubstituted 6-membered heteroaromatic ring containing 1-2 nitrogen heteroatoms; L ₁ represents -O-; L ₂ is missing; R1, _R2 are each independently selected from the group consisting of H and F; _R3 , R4 each represents H; _R5 , R6 each represent H; R ₇ is selected from the group consisting of H and ^-^-alkoxy; L ₃ is selected from the group consisting of a substituted or unsubstituted 6-10 membered bridged heterocyclic ring containing 1-2 nitrogen heteroatoms, and a 6-10 membered spiroheterocyclic ring containing 2 nitrogen and oxygen heteroatoms; R8 is selected from the group consisting of H and -CN; X represents -CR11R12; R11, _R12 each represent H; provided that the above groups form a chemically stable structure; unless otherwise specified, the above substituted means that one or more hydrogen atoms in a group are replaced by a ^-^-alkyl substituent. 6. A compound according to claim 5, or stereoisomers or racemates thereof, or pharmaceutically acceptable salts thereof, wherein L ₃ is a structure selected from the group consisting of while L ₃ may be substituted or unsubstituted. 7. The compound according to any one of claims 5, 6, in which the compound is selected from the following group: - 22 046318 8. A compound according to formula I or its stereoisomers or racemates, or its pharmaceutically acceptable salts Where A represents a substituted or unsubstituted 6-membered heteroaromatic ring containing 1-2 nitrogen heteroatoms; B is substituted or unsubstituted pyrimidinyl, or substituted or unsubstituted pyridinyl; L1 represents -O-; L ₂ represents a substituted or unsubstituted 6-10 membered heterocyclic ring containing 2 nitrogen heteroatoms; L ₃ represents a substituted or unsubstituted piperazine ring; R1, R2 are each independently selected from the group consisting of H and F; R ₃ , R 4 each represents H; R5, R6 each represent H; R ₇ is a 4-6 membered heterocyclic ring containing 1 oxygen atom; R8 represents H; R8' is H or -CN; X represents -CR11R12; R11, R12 each represent H; provided that the above groups form a chemically stable structure; unless otherwise specified, the above substituted means that one or more hydrogen atoms in a group are replaced by a ^-^-alkyl substituent. 9. The connection according to claim 8, where the connection is ____________ Connection number Connection structure 9 nh ₂ N f('.Y'yy' oJ -