EA046215B1 - NEW EHV INSERT SITE ORF70 - Google Patents

Description

List of sequences

The invention contains a sequence listing in accordance with 37 C.F.R. 1.821 - 1.825. The sequence listing accompanying the present invention is hereby incorporated by reference in its entirety.

Prerequisites for creating the invention

A. Field of technology to which the invention relates

The present invention relates to the field of (vector) vaccines, and in particular to the novel EHV insertion site ORF70. The present invention further covers related expression cassettes and vectors that are useful for expressing genes of interest, in particular antigen coding sequences. Viral vectors according to the present invention are suitable for producing an immunogenic composition or vaccine.

B. Background and Description of the Prior Art

The equine pathogen equine alphaherpesvirus type 1 (mare abortion virus, EHV-1) belongs to the genus Varicellovirus in the subfamily Alphaherpesvirinae in the family Herpesviridae in the order Herpesvirales. It is a large, enveloped virus with a double-stranded DNA genome of approximately 150 kilobase pairs. Other important members of the subgenus Varicellovirus are human alphaherpesvirus type 3 (varicella zoster virus), Aujeszky's disease virus 1 (pseudorabies virus), bovine alphaherpesvirus type 1 (infectious bronchitis virus), and equine alphaherpesvirus type 4 (Equine rhinopneumonia virus, EHV-4 ) (http://www.ictvonline.org/virustaxonomy.asp Virus Taxonomy: 2015 Release EC 47, London, UK, July 2015; Email ratification 2016 (MSL #30) EHV-1 and EHV-4 are endemic and affect horses worldwide. While EHV-4 causes predominantly mild upper respiratory tract infection, EHV-1 can cause systemic infection with illnesses ranging from respiratory symptoms to abortion and fatal myeloencephalopathy depending on the strain and immunological status of the host. Currently available two licensed modified live vaccines (MLV) against EHV-1 in the US and Europe, respectively, Rhinomune™ (Boehringer Ingelheim) and Prevaccinol™ (MSD), both containing a classically attenuated EHV-1 RacH strain that has been cultured 256 times in porcine epithelial cells for attenuation (Ma et al. 2013). The mechanism of attenuation was studied at the molecular level. Osterrieder et al. (1996) showed that RacH lacks two genomic copies of orf67 and that restoration of one copy is sufficient to restore virulence. Additionally, RacH carries a 1283 deletion that removes more than 90% of the orf1 coding sequence, which encodes an immunosuppressive viral protein. Other mutations may also have an effect on attenuation, but have not been studied in detail to date. All this makes RacH an extremely safe vaccine strain, since restoration of virulence by grafting in vaccinated animals is extremely unlikely, if not impossible.

Two variants of the E. coli bacterial artificial chromosome (BAC) are known to anchor the complete genome of the RacH vaccine strain of equine alphaherpesvirus type 1 (EHV-1): pRacH and pRacH-SE as a platform for the development of a vector vaccine. BAC pRacH-SE was created based on pRacH, BAC was initially cloned in the laboratory of Klaus Osterrieder, FU Berlin. pRacH has a deletion of orf71, encoding glycoprotein II (gpII; Wellington et al., 1996). BAC vector sequences and a GFP expression cassette were introduced into this location. To recover unmodified EHV-1 RacH from pRacH, it must be cotransfected using a plasmid containing the complete orf71 plus flanking regions, so that during viral replication, parts of the BAC vector sequence and GFP expression cassette are replaced with orf71 by homologous recombination, thereby being restored the original RacH genome. pRacH has been modified in the present invention such that the BAC vector sequences/GFP expression cassette becomes self-truncating (SE) when transfected in cell cultures (Tischer et al., 2007). This improved BAC was designated pRacH-SE. pRacH and pRacH-SE can both serve as platforms for the development of vector vaccines, with the only difference being that pRacH-SE facilitates the recovery of the orf71-repaired virus in a significant manner.

EHV-1 RacH vector vaccines have been shown to induce immunity in several mammalian species, including pigs, cattle and dogs (Rosas et al. 2007, Rosas et al. 2008, Trapp et al. 2005, Said et al. . 2013). Genes encoding antigenic proteins of pathogens can be expressed using recombinant EHV-1 RacH. The EHV-1-RacH genome is manipulated in its BAC form in E. coli and adapted for expression of additional proteins, usually by insertion of transgene expression cassettes (Tischer et al., 2010). When transfecting pRacH-SE DNA into cultured permissive cells, EHV-1 replication is initiated by cellular transcription factors. Viral DNA polymerase activity results in the deletion of all BAC vector-associated sequences and restoration of the EHV-1 RacH genome to its original state. A pathogenic virus is created that is indistinguishable from RacH.

- 1 046215

If pRacH-SE is manipulated in E. coli, for example by insertion of transgene expression cassettes, then the virus recovered from transfection in permissive cells will carry the modification and will express the additional gene. Recombinant EHV-1 RacH can be used as a vector vaccine.

Wild-type EHV-1 strains have three open reading frames (orfs), called orf1, orf 2, and orf3, at one end of a long, unique segment of their genome (sequence coordinates 12983614; Fig. 1). Orf1 and orf3 are sequentially assembled on the same DNA strand, while orf 2 is encoded by the complementary strand. The RacH vaccine strain has a 1283 bp deletion in this region involving orf 1 and 2, indicating that these genes are nonessential for viral replication. For this reason, the site serves as the transgene insertion site. This insertion site is called ORF1/3.

However, the size and number of transgenes that can be inserted into the ORF1/3 insertion site are usually limited. Thus, to enhance the capabilities of the EHV-1 vector, there is an unmet need for new and alternative routes for insertion and expression of transgenes from the EHV-1 vector, particularly the recombinant EHV-1 RacH vector.

Summary of the invention

To enhance the capabilities of the EHV-1 vector, the present invention provides new and alternative routes for the insertion and expression of transgenes from the EHV-1 vector backbone.

The present invention provides a new, alternative ORF70 transgene insertion site that can be used to insert a transgene sequence and express a transgene protein from an EHV-1 vector, particularly a recombinant EHV-1 RacH.

The new ORF70 insertion site in the EHV-1 vector is characterized by a partial deletion, truncation, substitution, modification, or the like of ORF70. It is believed that deletion of complete ORF70 will be detrimental to viral replication and therefore vaccine production and efficacy because complete deletion of ORF70 will affect the ORF71 promoter encoding gpII. A new ORF70 insertion site and/or insertion (expression cassette) in ORF70 is functionally defined such that ORF71 remains functional or intact.

In a specific aspect, the ORF70 insertion site spans a deletion of approximately 801 bp within ORF70 for RacH (SEQ ID NO.: 20) or 70, 80, 85, 90, 95, 99% of its homologous sequence. The deleted portion of the RacH genomic sequence is shown at SEQ ID NO.: 20 (no nucleotide numbers available because the complete RacH genomic sequence is not known). In another specific aspect, the ORF70 insertion site spans the theoretical 801 deletion within ORF70 for the wild-type EHV-1 strain ab4 (Genbank accession number AY665713.1). The deleted portion is located on the wild-type ab4 genomic sequence (Genbank accession number AY665713.1) between nucleotides 127681 and 128482 (SEQ ID NO.: 19).

In the present invention, flanking regions refer to the recombination of an expression cassette comprising a sequence or gene of interest, preferably an antigen coding sequence, in the EHV-1 genome. These flanking regions are naturally present in EHV-1. The Up70 flanking region (417 bp, SEQ ID NO.: 13) and the Up71 flanking region (431 bp, SEQ ID NO.: 14) are selected for classical homologous recombination for all transfer vectors/plasmids used for the ORF70 site. In the wild-type EHV-1 strain ab4 (Genbank accession number AY665713.1), the corresponding sequences are located at nucleotides 127264 - 127680 (flanking region up orf70, SEQ ID NO.: 15) and 128483 - 128913 (flanking region up orf71, SEQ ID NO. .: 16). For RED recombination, the flanking regions are truncated due to cleavage with the restriction enzyme XbaI. These truncated flanking regions are identical to 3'283 of 417 of the classical flanking region (Up70 flanking region, SEQ ID NO.: 13) and 5'144 of 431 of the classical flanking region (Up71 flanking region, SEQ ID NO.: 13). 14), which are described above. These truncated flanking regions are named Up70 flanking region (283 bp), included as SEQ ID NO.: 17 and Up71 flanking region (144 bp), included as SEQ ID NO.: 18. These different flanking regions define the same ORF70 insertion site . Flanking regions are always used in pairs, one left flanking region such as SEQ ID NO.: 13, 15, 17 and one right flanking region such as SEQ ID NO.: 14, 16, 18.

Plasmid/vector maps in FIG. 3 for transfer plasmid pU-mC70-BGH (SEQ ID NO.: 21), in FIG. 4 for transfer vector pU70-p455-71K71 (SEQ ID NO.: 22), and FIG. 5 for transfer plasmid pU70-p455-H3-71K71 (SEQ ID NO.: 23) are examples of vectors containing an expression cassette including a new ORF70 insertion site. Plasmid/vector maps in FIG. 10 for transfer vector pU-1-3-p430-BGHKBGH (SEQ ID NO.: 24), and FIG. 11 for transfer plasmid pU13-p430-Hlav-BGHKBGH (SEQ ID NO.: 25) are examples of vectors containing an expression cassette including an ORF1/3 insertion site.

The present invention further encompasses an EHV-1 vector expressing two different transgenes from a single vector backbone without linking the two transgenes using RNA virus-derived functions (2a peptides, IRES sites) under the control of a single promoter.

The present invention further covers the equine alphaherpesvirus 1 (EHV-1) vector,

- 2 046215 preferably RacH or RacH-SE comprising a first sequence or gene of interest inserted into a new ORF70 insertion site and a second sequence or gene of interest inserted ( y) at a well-known insertion site such as ORF1/3. Additionally, the present invention further covers vectors based on other herpesviruses, in particular alphaherpesviruses in particular, Varicelloviruses, including alphaherpesvirus 3 (EHV-3), equine alphaherpesvirus 4 (EHV-4), alphaherpesvirus 8 (EHV-8), alphaherpesvirus 9 (EHV-9), bovine alphaherpesvirus type 1 (BHV-1), bovine alphaherpesvirus type 5 (BHV-5), canine alphaherpesvirus type 1, and feline alphaherpesvirus type 1.

The present invention further covers mammalian host cells comprising such vectors and methods for creating vector vaccines using such host cells, as well as immunogenic compositions and vaccines comprising the alphaherpesvirus type 1 (EHV-1) vector of the present invention.

Therefore, the solution to the above-described technical problem is accomplished by the description and embodiments described in the claims, and the invention in its various aspects is implemented in accordance with the claims.

These properties provide the opportunity to create recombinant vector vaccines based on EHV-1 RacH, expressing at least one antigen from the first described ORF70 insertion site or at least two different antigens in parallel with similar effectiveness from the first described ORF70 insertion site and another insertion site, such as ORF1/3. If the vaccine target consists of two different pathogens, then using a new ORF70 insertion site in parallel with a well-known insertion site such as ORF1/3 can significantly reduce the cost of goods and represents a clear advantage over a vector expressing only one antigenic component.

Detailed Description of the Invention

The present invention solves problems present in the prior art and provides a significant improvement over the prior art.

In general terms, the present invention provides an expression cassette comprising (i) at least one exogenous nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, wherein said nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence operably linked to a promoter sequence, and (II) at least one left ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 13 and at 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence, SEQ ID NO.: 15 and at 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence thereto, and SEQ ID NO.: 17 and 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% thereof homologous and/or identical sequence, and (III) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 14 and at 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence thereto, SEQ ID NO.: 16 and at 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence thereof, and SEQ ID NO.: 18 and 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical identical sequence.

The present invention further provides an equine herpesvirus (EHV), specifically an alphaherpesvirus such as EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9, more specifically an equine alphaherpesvirus 1 (EHV-1) vector, most specifically a RacH strain including an expression cassette according to the present invention.

The present invention provides an equine alphaherpesvirus 1 (EHV-1) vector, preferably a RacH strain, comprising an expression cassette according to the present invention.

In addition, the present invention covers equine herpesvirus (EHV), specifically alphaherpesvirus such as EHV-1, EHV-3, EHV-4, EHV- and EHV-9, more specifically the equine alphaherpesvirus 1 (EHV-1) vector, most specifically a RacH strain comprising (I) at least one exogenous nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, wherein said nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence is operably linked with a promoter sequence, and (II) at least one left ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 13 and at 70, 80, 85, 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99% homologous and/or identical sequence thereto, SEQ ID NO.: 15 and 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% of it homologous and/or identical sequence, and SEQ ID NO.: 17 and 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence, And

- 3 046215 (III) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 14 and at 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97 , 98, 99% homologous and/or identical sequence thereto, SEQ ID NO.: 16 and 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and /or identical sequence, and SEQ ID NO.: 18 and 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence thereof.

The present invention further covers equine herpesvirus (EHV), specifically alphaherpesvirus such as EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9, more specifically equine alphaherpesvirus 1 (EHV-1) vector, most specifically strain RacH comprising a nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted into ORF70.

The present invention further covers equine herpesvirus (EHV), specifically alphaherpesvirus such as EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9, more specifically equine alphaherpesvirus 1 (EHV-1) vector, most specifically strain RacH comprising a first nucleotide sequence of interest or gene, preferably an antigen coding sequence, inserted into ORF70 and a second nucleotide sequence of interest or gene, preferably another antigen coding sequence, inserted into a second insertion site, preferably ORF1/3 . In a specific aspect of the EHV-1 vector of the present invention, at least two genes of interest are operably linked to regulatory sequences, preferably promoter sequences.

In a specific aspect of the vector of the present invention, the insertion in ORF70 is characterized by a partial deletion, truncation, substitution, modification, or the like in ORF70 while ORF71 remains functional.

In another specific aspect of the vector of the present invention, the insertion in ORF70 is characterized by a deletion of approximately 801 bp within ORF70 for RacH (SEQ ID NO.: 20) or at 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% of its homologous and/or identical sequence.

In another specific aspect of the vector of the present invention, the insertion in ORF70 is characterized by a deletion of approximately 801 bp within ORF70 for RacH (SEQ ID NO.: 20) or a deletion thereof by 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence to any other strain.

In a further specific aspect of the vector of the present invention, the insertion in ORF70 is characterized by a deletion of approximately the 801-bp portion within ORF70 for the wild-type EHV-1 strain ab4 (Genbank accession number AY665713.1), such that the deleted portion in the wild-type ab4 genomic sequence is located between nucleotides 127681 and 128482 (SEQ ID NO.: 19) or 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence thereof.

In a further specific aspect of the vector of the present invention, the insertion in ORF70 is characterized by a deletion of approximately the 801-bp portion within ORF70 for the wild-type EHV-1 strain ab4 (Genbank accession number AY665713.1), such that the deleted portion in the wild-type ab4 genomic sequence is located between nucleotides 127681 and 128482 (SEQ ID NO.: 19) or deletion thereof by 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence in any other strain.

In a further specific aspect of the vector of the present invention, the EHV vector, specifically the EHV-1 vector, includes at least one of the flanking regions selected from the group consisting of: SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO. : 15, SEQ ID NO.: 16, SEQ ID NO.: 17, and SEQ ID NO.: 18 and at 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence to any of these sequences.

In another specific aspect of the vector of the present invention, the EHV vector, specifically the EHV-1 vector, includes (I) at least one left ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 13, SEQ ID NO.: 15, and SEQ ID NO.: 17, and (II) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 14, SEQ ID NO.: 16, and SEQ ID NO.: 18.

In a further specific aspect of the vector or expression cassette of the present invention, said nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence is not naturally occurring and/or is recombinant.

In another specific aspect of the vector or expression cassette of the present invention, said nucleotide sequence of interest is recombinant and/or heterologous and/or exogenous.

In a further specific aspect of the vector or expression cassette according to the present invention, said antigen coding sequence relates to an animal infected

- 4 046215 pathogen used in food production, such as pigs and/or cattle.

In a specific aspect of the vector or expression cassette according to the present invention, said antigen coding sequence relates to a pathogen that infects pigs. In a further specific aspect, said pathogen is swine influenza A virus (IAV). In a further specific aspect, said antigen is a hemagglutinin (HA) antigen, in particular, said hemagglutinin antigen is derived from influenza A virus. For example, the influenza virus is influenza A virus (A/swine/Italy/116114/2010(HlN2)), influenza A virus (A/swine/Italy/7680/2001(H3N2)), influenza A virus (A/swine/Gent/132/2005(H1N1)), and/or influenza A virus (A/swine/Italy/4675 /2003(H1N2)). In a further specific aspect, said antigen includes or consists of a sequence encoded by SEQ ID NO. selected from the group consisting of: SEQ ID NO.: 26, 27, 28 and 29. In another specific aspect, said antigen includes or consists of a sequence encoded by an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence as set forth in SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29.

In another specific aspect of the vector or expression cassette according to the present invention, said antigen coding sequence relates to a pathogen that infects cattle. In a further specific aspect, said pathogen is the Schmallenberg virus (SBV). In a further specific aspect, said antigen is a Gc protein from SBV (SBV-Gc). In a more specific aspect, said antigen is a truncated form of SBV-Gc, such as, for example, a portion of the 234 amino acid coding region of SBV-Gc. In a specific aspect, such a portion of the 234 amino acid coding region from SBV-GC is derived from the amino terminus of the SBV Gc glycoprotein. In a further specific aspect, such a portion of the 234 amino acid coding region from SBV-GC is modified to allow efficient transport to and insertion into the plasma membranes of infected cells (e.g., by inserting a signal peptide into the sequence from SBV-Gc and/or by inserting a transmembrane anchor peptide into sequence from SBV-Gc), and/or said 234 amino acid portion is codon frequency optimized for expression in EHV-1, and/or a GS linker (e.g., SEQ ID NO.: 30) is inserted between the Gc portion and the signal peptide / transmembrane anchor. In a further specific aspect, said antigen is encoded by a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92 %, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to the nucleotide sequence as set forth in SEQ ID NO: 31. In another specific aspect, said antigen includes or consists of the sequence encoded by SEQ ID NO.: 31.

In a specific aspect of the vector of the present invention, the gene of interest is operably linked to a regulatory sequence, preferably a promoter sequence.

In a further specific aspect of the vector or expression cassette according to the present invention, said vector or expression cassette further comprises at least one additional regulatory sequence, such as a stop codon or a polyadenylation sequence.

In another specific aspect of the vector or expression cassette according to the present invention, said vector or expression cassette further comprises additional regulatory sequences, such as a stop codon and/or a polyadenylation sequence.

In a further specific aspect of the vector or expression cassette of the present invention, said vector or expression cassette further comprises at least one additional nucleotide sequence of interest, preferably another gene of interest, more preferably an antigen coding sequence. In one aspect, at least one additional nucleotide sequence of interest, preferably another gene of interest, more preferably an antigen coding sequence, is inserted into the same ORF70 insertion site, for example, by IRES/2a peptide(s). In another aspect, said vector or expression cassette comprises at least one additional nucleotide sequence of interest, preferably another gene of interest, more preferably an antigen coding sequence, inserted into another insertion site, preferably ORF1/3.

In a specific aspect of the vector or expression cassette of the present invention

- 5 046215 at least two genes of interest are operably linked to regulatory sequences, preferably promoter sequences.

In a further aspect of the vector or expression cassette of the present invention, the promoter sequence(s) operably linked to one or two or more sequences or genes of interest are selected from the group consisting of: SV40 big T, HCMV and MCMV immediate early gene 1, human elongation factor alpha promoter, baculovirus polyhedrin promoter, functional fragment from 4pgG600 (SEQ ID No. 1), preferably said functional fragment is p430 (SEQ ID NO.: 3), functional fragment from a complementary nucleotide sequence 4pgG600 (SEQ ID No. 1), a functional fragment from 4pMCP600 (SEQ ID No. 2), preferably said functional fragment is p455 (SEQ ID NO.: 4), a functional fragment from the complementary nucleotide sequence of 4pMCP600 (SEQ ID No. 2 ).

In a further specific aspect of the vector or expression cassette according to the present invention, the promoter sequences operably linked to the at least two genes of interest are different.

In another specific aspect of the vector or expression cassette of the present invention, the promoter sequence operably linked to the at least one gene of interest is p455 (SEQ ID No. 4) or a functional fragment or derivative thereof or complementary nucleotide sequences thereof, and wherein the promoter sequence operably linked to another gene of interest is p430 (SEQ ID No. 3) or a functional fragment or derivative thereof or complementary nucleotide sequences thereof.

The present invention further covers a plasmid including flanking regions for homologous recombination or RED-mediated recombination (both described in detail below) at a specific target site in a viral vector genome, preferably at the orf1/3 site from an EHV vector, specifically EHV-1, more specifically RacH a vector such as transfer plasmid pU-mC70-BGH (SEQ ID NO: 21) and/or transfer vector pU70-p455-71K71 (SEQ ID NO.: 22), and/or transfer plasmid pU70-p455-H3-71K71 ( SEQ ID NO.: 23), and/or transfer vector pU-1-3-p430BGHKBGH (SEQ ID NO.: 24), and/or transfer plasmid pU1-3-p430-H1av-BGHKBGH (SEQ ID NO.: 25 ).

The present invention further encompasses a plasmid including flanking regions for homologous recombination or RED-mediated recombination (both described in detail below) at a specific target site in a viral vector genome, preferably at the orf70 site from an EHV vector, specifically an EHV-1 vector, more specifically a RacH vector.

The present invention further covers a plasmid including flanking regions for homologous recombination or RED-mediated recombination (both described in detail below) at a specific target site in a viral vector genome, preferably at the orf1/3 site from an EHV vector, specifically EHV-1, more specifically RacH vector and a regulatory nucleic acid, preferably a promoter, preferably p430, such as the transfer vector pU-1-3-p430BGHKBGH (SEQ ID NO.: 24), and/or the transfer plasmid pU1-3-p430-H1av-BGHKBGH (SEQ ID NO. .: 25).

The present invention further covers a plasmid including flanking regions for homologous recombination or RED-mediated recombination (both described in detail below) at a specific target site in a viral vector genome, preferably at the orf70 site from an EHV vector, specifically an EHV-1 vector, more specifically a RacH vector, and a regulatory nucleic acid, preferably a promoter, preferably p455, such as the transfer vector pU70-p455-71K71 (SeQ ID NO.: 22), and/or the transfer plasmid pU70-p455-H3-71K71 (SeQ ID NO.: 23).

The present invention further covers a plasmid including flanking regions for homologous recombination or RED-mediated recombination (both described in detail below) at a specific target site in a viral vector genome, preferably at the orf1/3 site from an EHV vector, specifically EHV-1, more specifically RacH vector and a regulatory nucleic acid, preferably a promoter, preferably p430, such as transfer vector pU-1-3-p430BGHKBGH (SEQ ID NO.: 24), and/or transfer plasmid pU1-3-p430-H1av-BGHKBGH (SEQ ID NO. .: 25).

The present invention further covers a plasmid including flanking regions for homologous recombination or RED-mediated recombination (both described in detail below) at a specific target site in a viral vector genome, preferably at the orf1/3 site from an EHV vector, specifically EHV-1, more specifically RacH a vector and a regulatory nucleotide sequence, preferably a promoter, preferably p430, and a second regulatory nucleic acid, preferably a polyadenylation sequence, preferably a BGH polyadenylation sequence, such as the transfer vector pU-1-3-p430-BGHKBGH (SEQ ID NO.: 24), and /or transfer plasmid pU1-3-p430-H1av-BGHKBGH (SEQ ID NO.: 25).

- 6 046215

The present invention further covers a plasmid including flanking regions for homologous recombination or RED-mediated recombination (both described in detail below) at a specific target site in a viral vector genome, preferably at the orf70 site from an EHV vector, specifically an EHV-1 vector, more specifically a RacH vector, and a regulatory nucleotide sequence, preferably a promoter, preferably p455, and a second regulatory nucleic acid, preferably a polyadenylation sequence, preferably a 71pA polyadenylation sequence, such as transfer vector pU70-p455-71K71 (SEQ ID NO.: 22), and/or transfer plasmid pU70- p455-H3-71K71 (SEQ ID NO.: 23).

The present invention further covers a method for producing a vector in accordance with the present invention, comprising:

a) inserting a first nucleotide sequence of interest, preferably a gene of interest, such as an antigen coding sequence, into ORF70,

b) optionally operably linking said first gene of interest to a regulatory nucleotide sequence/promoter sequence, preferably p455 or p430,

c) optionally operably linking said first gene of interest to an (additional) regulatory nucleic acid, for example a polyadenylation sequence, preferably 71pA or BGHpA.

In a specific aspect, the method further includes

a) inserting a nucleotide sequence of interest, preferably a second gene of interest, into a second insertion site, preferably ORF1/3,

b) optionally operably linking said second gene of interest to a regulatory nucleotide sequence/promoter sequence, preferably p455 or p430,

c) optionally operably linking said first gene of interest to a regulatory nucleic acid, for example a polyadenylation sequence, preferably 71pA or BGHpA.

The present invention further covers a kit consisting of a vector in accordance with the present invention, optional transfection reagent(s), and an instruction leaflet.

The present invention also includes a mammalian host cell characterized in that it contains a vector in accordance with the present invention.

The present invention further covers a method for obtaining a host cell, which is characterized by the following steps:

a) infecting a mammalian host cell in accordance with the present invention with a vector in accordance with the present invention,

b) culturing infected cells under suitable conditions,

c) optionally collecting said host cell.

The present invention further covers the use of ORF70 in an equine herpesvirus (EHV) vector, specifically in equine alphaherpesviruses such as EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9, more specifically in an equine alphaherpesvirus 1 (EHV) vector -1), most specifically in RacH, as an insertion site in said equine herpesvirus (EHV) vector, wherein said insertion site promotes/facilitates the expression of a nucleotide sequence of interest, preferably a gene of interest, such as an antigen coding sequence, wherein said The ORF70 insertion site involves a partial deletion, truncation, substitution, modification, or the like in ORF70 while ORF71 remains functional.

The invention further covers the use of a vector in accordance with the present invention or a mammalian host cell in accordance with the present invention for the preparation of an immunogenic composition or vaccine.

The invention further covers an immunogenic composition containing

a) a vector in accordance with the present invention, and/or

b) a polypeptide expressed by a vector in accordance with the present invention, such as a virus, modified live virus, virus-like particle (VLP) or the like, and

c) optionally a pharmaceutically or veterinarily acceptable carrier or excipient, preferably said carrier is suitable for oral, intradermal, intramuscular or intranasal administration, preferably said immunogenic composition includes a virus. In a specific aspect, said virus is a pathogenic virus.

The invention further covers a vaccine or pharmaceutical composition containing a) a vector in accordance with the present invention, and/or

b) a polypeptide expressed by a vector in accordance with the present invention, such as a modified live virus, virus-like particle (VLP) or the like, and

c) a pharmaceutically or veterinarily acceptable carrier or excipient, preferably

- 7 046215 the specified carrier is suitable for oral, intradermal, intramuscular or intranasal administration, optionally the specified vaccine additionally contains an adjuvant.

The present invention demonstrates successful vaccination using a vector or expression cassette according to the present invention in various species, especially in pigs and cattle. For example, an experimental EHV-1 RacH vaccine construct expressing a modified Schmallenberg virus (SBV) antigen at the newly described ORF70 insertion site has been shown to be effective in cattle (see Example 9). All vaccinated animals exhibited reduced levels of viral replication following challenge with virulent Schmallenberg virus, as assessed by quantitative reverse transcription-PCR (qRT-PCR). Two of the four vaccinated animals were completely protected, and no viral replication was detected throughout the sampling period. In two other animals in this group, SBV gene replication was detected by qRT-PCR, but at lower levels compared to the infected control group. (Fig. 27A). In addition, no SBV-specific antibodies were detected in unvaccinated control animals by serum neutralization test before challenge. Beginning one or two weeks after infection, neutralizing antibodies can be detected in all unvaccinated animals (Fig. 27B). In contrast to the unvaccinated control group, SBV-specific neutralizing antibodies were detected on the day of challenge in two of four cattle immunized with rEHV-SBV-Gc. In the remaining two animals from this group, no SBV-specific neutralizing antibodies were detected before challenge, but two weeks after challenge, neutralizing antibodies were present (Fig. 27B). SBV-specific neutralizing antibodies in all four animals were lower compared to challenged controls, indicating significantly reduced viral replication following challenge.

Thus, in a specific aspect, said immunogenic composition or vaccine or pharmaceutical composition comprises a vector or expression cassette according to the present invention, wherein said antigen coding sequence relates to a pathogen infecting cattle. In a further specific aspect, said pathogen is the Schmallenberg virus (SBV). In a further specific aspect, said antigen is a Gc protein from SBV (SBV-Gc). In a more specific aspect, said antigen is a truncated form of SBV-Gc, such as, for example, a portion of the 234 amino acid coding region of SBV-Gc. In a specific aspect, such a portion of the 234 amino acid coding region from SBV-GC is derived from the amino terminus of the SBV Gc glycoprotein. In a further specific aspect, such a portion of the 234 amino acid coding region from SBV-GC is modified to allow efficient transport to and insertion into the plasma membranes of infected cells (e.g., by inserting a signal peptide into the sequence from SBV-Gc and/or by inserting a transmembrane anchor peptide into sequence from SBV-Gc), and/or said 234 amino acid portion is codon frequency optimized for expression in EHV-1, and/or a GS linker (e.g., SEQ ID NO.: 30) is inserted between the Gc portion and the signal peptide / transmembrane anchor. In a further specific aspect, said antigen is encoded by a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92 %, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to the nucleotide sequence as set forth in SEQ ID NO: 31. In another specific aspect, said antigen includes or consists of the sequence encoded by SEQ ID NO.: 31.

Moreover, in another specific aspect, said immunogenic composition or vaccine or pharmaceutical composition includes a vector or expression cassette according to the present invention, wherein said antigen coding sequence relates to a pathogen infecting pigs. In a further specific aspect, said pathogen is swine influenza A virus (IAV). In a further specific aspect, said antigen is a hemagglutinin (HA) antigen, in particular, said hemagglutinin antigen is derived from influenza A virus. For example, the influenza virus is influenza A virus (A/swine/Italy/116114/2010(H1N2)), influenza A virus (A/swine/Italy/7680/2001(H3N2)), influenza A virus (A/swine/Gent/132/2005(H1N1)), and/or influenza A virus (A/swine/Italy/4675 /2003(H1N2)). In a further specific aspect, said antigen includes or consists of a sequence encoded by SEQ ID NO. selected from the group consisting of: SEQ ID NO.: 26, 27, 28 and 29. In another specific aspect, said antigen includes or consists of a sequence encoded by an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence as set forth in SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29.

- 8 046215

The invention further covers a method of preparing an immunogenic composition or vaccine for reducing the frequency or severity of one or more clinical symptoms associated with or caused by an infection, comprising the following steps:

a) infecting a mammalian host cell in accordance with the present invention using a vector in accordance with the present invention,

b) culturing infected cells under suitable conditions,

c) collection of infected cell cultures,

d) optionally purifying infected cell cultures from step c),

e) optionally mixing said harvested infected cell culture with a pharmaceutically acceptable carrier.

Medical use.

The invention further covers an immunogenic composition or vaccine in accordance with the present invention for use in a method of reducing or preventing clinical symptoms or disease caused by infection by a pathogen in an animal or for use in a method of treating or preventing infection by a pathogen in an animal, preferably said animal is an animal used for food production, such as pigs or cattle, especially pigs.

The invention further covers a method of immunizing an animal, such as a food production animal, including swine, against a clinical disease caused by a pathogen in said animal, wherein said method includes the step of administering to the animal an immunogenic composition or vaccine in accordance with the present invention, wherein said The immunogenic composition or vaccine cannot cause clinical symptoms of infection, but is capable of inducing an immune response that immunizes said animal against pathogenic forms of said pathogen.

In a specific aspect of the medical use of the present invention described above, or the method of immunizing an animal as described above, said antigen coding sequence relates to a pathogen infecting pigs. In a further specific aspect, said pathogen is swine influenza A virus (IAV). In a further specific aspect, said antigen is a hemagglutinin (HA) antigen, in particular, said hemagglutinin antigen is derived from influenza A virus. For example, the influenza virus is influenza A virus (A/swine/Italy/116114/2010(H1N2)), influenza A virus (A/swine/Italy/7680/2001(H3N2)), influenza A virus (A/swine/Gent/132/2005(H1N1)), and/or influenza A virus (A/swine/Italy/4675 /2003(H1N2)). In a further specific aspect, said antigen includes or consists of a sequence encoded by SEQ ID NO. selected from the group consisting of: SEQ ID NO.: 26, 27, 28 and 29. In another specific aspect, said antigen includes or consists of a sequence encoded by an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence as set forth in SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29.

In another specific aspect of the medical use of the present invention described above, or the method of immunizing an animal as described above, said antigen coding sequence relates to a pathogen infecting cattle. In a further specific aspect, said pathogen is the Schmallenberg virus (SBV). In a further specific aspect, said antigen is a Gc protein from SBV (SBV-Gc). In a more specific aspect, said antigen is a truncated form of SBV-Gc, such as, for example, a portion of the 234 amino acid coding region of SBV-Gc. In a specific aspect, such a portion of the 234 amino acid coding region from SBV-GC is derived from the amino terminus of the SBV Gc glycoprotein. In a further specific aspect, such a portion of the 234 amino acid coding region from SBV-GC is modified to allow efficient transport to and insertion into the plasma membranes of infected cells (e.g., by inserting a signal peptide into the sequence from SBV-Gc and/or by inserting a transmembrane anchor peptide into sequence from SBV-Gc), and/or said 234 amino acid portion is codon frequency optimized for expression in EHV-1, and/or a GS linker (e.g., SEQ ID NO.: 30) is inserted between the Gc portion and the signal peptide / transmembrane anchor. In a further specific aspect, said antigen is encoded by a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92 %, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to a nucleotide sequence as set forth in SEQ ID NO: 31. In another specific aspect, said antigen includes or consists of a sequence coded

- 9 046215 regulated SEQ ID NO.: 31.

The invention also includes a kit for immunizing an animal, preferably a food production animal such as a pig or cattle, against a disease associated with and/or reducing the frequency or severity of one or more clinical symptoms associated with or caused by a pathogen in the animal containing:

a) a dispenser capable of administering the vaccine to the specified animal; And

b) an immunogenic composition or vaccine in accordance with the present invention, and

c) optionally an instruction leaflet.

Definitions.

Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one skilled in the art to which this invention relates at the time of filing. The meaning and scope of the terms must be clear; however, in the event of any underlying ambiguity, the definitions provided in this invention supersede any dictionary or external definition. In addition, unless the context otherwise requires, special terms shall include plurals, and plural terms shall include the singular. In this case, the use of the conjunction or means and/or, unless otherwise indicated. Moreover, the use of the term including, as well as other forms such as includes and included, is not limiting. All patents and publications mentioned herein are incorporated herein by reference.

In carrying out the present invention, unless otherwise indicated, conventional techniques of virology, molecular biology, microbiology, recombinant DNA, protein chemistry and immunology, which are known to specialists in the art, will be used. Such techniques are described in detail in the literature. See, for example, Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, volumes I, II and III, 2nd ed. (1989); DNA Cloning, volumes I and II (D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins ed. 1984); Animal Cell Culture (R. K. ed., 1986); Immobilized Cells and Enzymes (IRL ed., 1986); Perbal, V., A Practical Guide to Molecular Cloning (1984); series, Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Protein purification methods - a practical approach (E.L.V. Harris and S. Angal eds., IRL Press at Oxford University Press); and Handbook of Experimental Immunology, volumes I-IV (D. M. Weir and S. S. Blackwell eds., 1986, Blackwell Scientific Publications).

Before describing the present invention in more detail, it should be understood that the present invention is not limited to specific DNA, polypeptide or sequences or process parameters, which, of course, may vary. It should also be understood that the terminology used in this invention is intended only for the purpose of describing specific embodiments of the invention and is not intended to be limiting. It should be noted that, as used in this specification and the accompanying claims, the singular forms any or this include references to the plural unless the content clearly indicates otherwise. Thus, for example, a reference to any antigen includes a mixture of two or more antigens, a reference to any excipient includes mixtures of two or more excipients, and the like.

Molecular biological definitions.

The term vector, as it is known in the art, refers to a polynucleotide construct, typically a plasmid or bacterial artificial chromosome, used to transfer genetic material into a host cell. Vectors may be, for example, bacteria, viruses, phages, bacterial artificial chromosomes, cosmids or plasmids. A vector as used in the present invention may consist of or contain either DNA or RNA. In some embodiments, the vector consists of DNA. In some embodiments, the vector is a pathogenic virus. Such a viral vector contains a viral genome that is processed such that it carries a foreign gene that does not participate in replication of the viral vector, in cell culture, or in the host animal. In accordance with specific aspects of the present invention, the vector can be used in various aspects, such as transfer of genetic material only, for transfection of host cells or organisms, for use as a vaccine, such as DNA vaccines, or for gene expression. Gene expression is a term that describes protein biosynthesis in a cell, which is controlled by a specific polynucleotide sequence called a gene. In a specific aspect, the vector may be an expression vector, which is a vector capable of directing the expression of a protein encoded by one or more genes carried by the vector when placed in a suitable environment.

Vectors and methods for producing and/or using vectors (or recombinants) for expression may be or are similar to methods described, in particular, in: US patent Nos. 4,603,112, 4,769,330, 5,174,993, 5,505,941, 5,338,683, 5,494,807, 4,722,848, 5, 942.235, 5,364,773, 5,762,938, 5,770,212, 5,942,235, 382,425, PCT publications WO 94/16716, WO 96/39491, WO 95/30018; Paoletti, Applications of pox virus vectors to vaccination: An update, PNAS USA 93: 11349-11353, October 1996

- 10 046215

G.; Moss, Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety, PNAS USA 93: 11341-11348, October 1996; Smith et al., US Patent No. 4,745,051 (recombinant baculovirus); Richardson, S. D. (ed.), Methods in Molecular Biology 39, Baculovirus Expression Protocols (1995 Humana Press Inc.); Smith et al., Production of Human Beta Interferon in Insect Cells Infected with a Baculovirus Expression Vector, Molecular and Cellular Biology, December, 1983, vol. 3, no. 12, cc. 2156-2165; Pennock et al., Strong and Regulated Expression of Escherichia coli B-Galactosidase in Infect Cells with a Baculovirus Vector, Molecular and Cellular Biology March 1984, Vol. 4, No. 3, p. 406; EPA0 370 573; Published US Patent Application No. 920,197, filed October 16, 1986; published patent application EP No. 265785; US Patent No. 4,769,331 (recombinant herpesvirus); Roizman, The function of herpes simplex virus genes: A primer for genetic engineering of novel vectors, PNAS USA 93:11307-11312, October 1996; Andreansky et al., The application of genetically engineered herpes simplex viruses to the treatment of experimental brain tumors, PNAS USA 93: 11313-11318, October 1996; Robertson et al., Epstein-Barr virus vectors for gene delivery to B lymphocytes, PNAS USA 93: 11334-11340, October 1996; Frolov et al., Alphavirus-based Expression Vectors: Strategies and applications, PNAS USA 93: 11371-11377, October 1996; Kitson et al., J. Virol. 65, 3068-3075, 1991; US Patent Nos. 5,591,439, 5,552,143; WO 98/00166; accepted applications for US patent ser. Nos. 08/675,556, and 08/675,566 both filed July 3, 1996 (recombinant adenovirus); Grunhaus et al., 1992, Adenovirus as cloning vectors, Seminars in Virology (vol. 3) pp. 237-52, 1993; Ballay et al. EMBO Journal, vol. 4, pp. 3861-65, Graham, Tibtech 8, 85-87, April 1990; Prevec et al., J. Gen. Virol. 70, 42434; PCT WO 91/11525; Feigner et al (1994), J. Biol. Chem. 269, 2550-2561, Science, 259: 1745-49, 1993; and McClements et al., Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease, PNAS USA 93: 11414-11420, October 1996; and US Patent Nos. 5,591,639, 5,589,466, and 5,580,859, and WO 90/11092, WO93/19183, WO94/21797, WO95/11307, WO95/20660; Tang et al., Nature, and Furth et al., Analytical Biochemistry, relating to DNA Expression Vectors. See also WO 98/33510; Ju et al., Diabetologia, 41: 736-739, 1998 (lentiviral expression system); Sanford et al., US Patent No. 4,945,050; Fischbachet et al. (Intracel); WO 90/01543; Robinson et al., Seminars in Immunology vol. 9, cc. 271-283 (1997), (DNA vector systems); Szoka et al., US Patent No. 4,394,448 (method of inserting DNA into living cells); McCormick et al., US Patent No. 5,677,178 (use of cytopathic viruses); and US Patent No. 5,928,913 (gene delivery vectors); as well as other documents cited in the present invention.

The term viral vector describes a genetically modified virus that can be manipulated using recombinant DNA techniques such that its entry into a host cell results in a specific biological activity, such as expression of a transgene, that is carried by the vector. In a specific aspect, the transgene is an antigen. The viral vector may be able to replicate or unable to replicate in the target cell, tissue or organism.

The creation of a viral vector can be accomplished using any suitable genetic engineering techniques known in the art, including, but not limited to, standard restriction endonuclease digestion, ligation, transformation, plasmid purification, DNA sequencing, cell culture transfection techniques, e.g. as described in Sambrook et al. (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, N.Y. (1989)) or K. Maramorosch and H. Koprowski (Methods in Virology volume VIII, Academic Press Inc. London, UK (2014) )).

The viral vector may include sequences from the genome of any known organism. The sequences may be inserted in their native form or may be modified in any way to obtain the desired activity. For example, the sequences may contain insertions, deletions or substitutions.

The viral vector may include coding regions for two or more proteins of interest. For example, the viral vector may include a coding region for a first protein of interest and a coding region for a second protein of interest. The first protein of interest and the second protein of interest may be the same or different. In some embodiments, the viral vector may include coding region(s) for a third or fourth protein of interest. The third or fourth protein of interest may be the same or different. The total length of two or more proteins of interest encoded by the viral vector may vary. For example, the total length of two or more proteins may be at least about 200 amino acids. At least about 250 amino acids, at least about 300 amino acids, at least about 350 amino acids, at least about 400 amino acids, at least about 450 amino acids, at least about 500 amino acids, at least about 550 amino acids, according to at least about 600 amino acids, at least about 650 amino acids, at least about 700 amino acids, at least about 750 amino acids, at least about 800 amino acids, or more.

- 11 046215

Preferred viral vectors include herpesvirus vectors such as those derived from EHV-1 or EHV-4 or other Varicelloviruses such as PrV (pseudorabies virus) or BHV-1 (bovine herpesvirus type 1).

In accordance with specific aspects of the present invention, the term viral vector or alternatively viral construct refers to a recombinant viral construct derived from a virus that is selected from the Herpesviridae families, such as EHV-1, EHV-4. Preferred viral vectors include herpesvirus vectors, such as those derived from EHV-1 or EHV-4.

The terms viral vector and viral construct may be used interchangeably.

The term construct, as used in the present invention, refers to a recombinant nucleic acid, such as a plasmid, BAC or recombinant virus, that has been artificially created.

The term plasmid refers to cytoplasmic DNA that replicates independently of the bacterial chromosome in the bacterial host cell. In a specific aspect of the present invention, the term plasmid and/or transfer plasmid refers to an element of recombinant DNA technology used to construct, for example, an expression cassette for insertion into a viral vector. In another specific aspect, the term plasmid can be used to indicate a plasmid suitable for DNA vaccination.

As used herein, the terms nucleic acid and polynucleotide are used interchangeably and refer to any nucleic acid.

The term nucleic acid, nucleotide sequence, nucleotide sequence, polynucleotide, polynucleotide sequence, RNA sequence or DNA sequence, as used in the present invention, refers to an oligonucleotide, nucleotide or polynucleotide and fragments and parts thereof and DNA or RNA of genomic or synthetic origin that can be single-stranded or double-stranded and represent a sense or antisense strand. The sequence may be a non-coding sequence, a coding sequence, or a mixture of both. The nucleotide sequences of the present invention can be obtained using standard techniques well known to one skilled in the art.

The terms nucleic acid and polynucleotide also specifically cover nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

The terms regulatory nucleic acid, regulatory element and expression control element are used interchangeably and refer to nucleic acid molecules that can influence the expression of an operably linked coding sequence in a particular host organism. These terms are used in a broader sense to cover all elements that promote or regulate transcription, including promoters, promoter sequences, core elements required for basic RNA polymerase interactions and transcription factors, upstream elements, enhancers, and response elements. Typical regulatory elements in prokaryotes include promoters, operator sequences, and ribosome binding sites. Regulatory elements that are used in eukaryotic cells may include, but are not limited to, transcriptional and translational control sequences such as promoters, enhancers, splicing signals, polyadenylation signals, terminators, protein decay signals, internal ribosome entry site (IRES), picornavirus 2A sequences, and others, which provide for and/or regulate the expression of the coding sequence and/or the production of the encoded polypeptide in the host cell.

The internal ribosome entry site or IRES describes a sequence that functionally promotes translation initiation independent of the 5' IRES gene and allows for the translation of two cistrons (reading frame opening) from a single transcript in an animal cell. The IRES provides an independent ribosome entry site for translation of the open reading frame, located immediately downstream of it. Unlike bacterial mRNA, which can be polycistronic, that is, encode several different polypeptides that can be translated sequentially from the mRNA, most animal cell mRNAs are monocistronic and encode the synthesis of only one polypeptide. With a polycistronic transcript in a eukaryotic cell, translation will initiate from the 5' extreme translation initiation site, terminating at the first stop codon, and the transcript will be released from the ribosome, resulting in translation of only the first encoded polypeptide into mRNA. In a eukaryotic cell, a polycistronic transcript having an IRES operably linked to a second or subsequent open reading frame in the transcript allows sequential translation of the downstream open reading frame to produce two or more polypeptides encoded by the same transcript. IRES can be of varying lengths and from different sources, e.g. encephalomyocarditis virus (EMCV), picornaviruses (e.g. foot-and-mouth disease virus,

- 12 046215

FMDV or poliovirus (PV) or hepatitis C virus (HCV). Various IRES sequences and their use in vector constructs have been described and are well known in the art. The downstream coding sequence is operably linked to the 3' end of the IRES at any distance that does not adversely affect the expression of the downstream gene. The optimal or tolerable distance between an IRES and the start of a downstream gene can be easily determined by varying the distance and measuring expression as a function of the distance.

The term 2a or 2a peptide refers to short oligopeptide sequences, described as 2a and '2a-like', that serve as linkers capable of mediating cotranslational cleavage between proteins through a process defined as ribosomal escape. Such 2a and '2a-like' sequences (from Picornaviridae and other viruses or cellular sequences) can be used to chain multiple gene sequences into a single gene, allowing for co-expression in the same cell (see Luke and Ryan, 2013) .

As used herein, the term promoter or promoter sequence refers to a nucleotide sequence that permits binding of RNA polymerase and directs transcription of a gene. Typically, the promoter is located at the 5' non-coding region of the gene, proximal to the transcription initiation site of the gene. Sequence elements within promoters that function to initiate transcription are often characterized by consensus nucleotide sequences. Examples of promoters include, but are not limited to, promoters from bacteria, yeast, plants, viruses and animals such as mammals (including horses, pigs, cattle and humans), birds or insects. A promoter can be inducible, repressible and/or constitutive. Inducible promoters initiate increased levels of transcription from DNA under their control in response to a specific change in culture conditions, such as a change in temperature (Ptashne, 2014). Examples of promoters well known to one skilled in the art include, for example, SV40 big T, HCMV and MCMV immediate early gene 1, human elongation factor alpha promoter, baculovirus polyhedrin promoter.

As used in the present invention in the context of the present invention, the term promoter refers in particular to a functional fragment, for example, a truncation of 4pgG600 (SEQ ID No. 1) or its complementary nucleotide sequence, preferably the sequence identity is (at least) 72% relative to entire length (or higher). Moreover, as used herein, in the context of the present invention, the term promoter refers in particular to a functional fragment, for example, a truncation of 4pMCP600 (SEQ ID No. 2) or its complementary nucleotide sequence, preferably the sequence identity is (at least ) 78% relative to the entire length (or higher). Most preferably, the promoter is p430 (SEQ ID NO.: 3) or p455 (SEQ ID NO.: 4). As used hereinafter in the present invention, in the context of the present invention, the term promoter refers especially to a functional derivative of p430 (SEQ ID NO.: 3) or p455 (SEQ ID NO.: 4) or 4pgG600 (SEQ ID No. 1) or 4pMCP600 (SEQ ID No. 2) having, for example, a small substitution, mutation or inversion such that the sequence identity is 70%, 80%, 85%, 90%, 95%, 99% identity or homology.

The terms p430, gG 430 and 430 are used synonymously and interchangeably in the description, figures, sequence listing, etc. The terms p455, MCP 455 and 455 are used synonymously and interchangeably in the description, figures, sequence listing, etc.

The term enhancer refers to a polynucleotide sequence that, in cis localization, influences the activity of a promoter and, therefore, stimulates transcription of a gene or coding sequence operably linked to that promoter. Unlike promoters, the influence of enhancers is independent of position and orientation and, therefore, they can be located upstream or downstream of a transcription unit, within an intron, or even within a coding region. The enhancer can be located either in close proximity to the transcription unit or at a considerable distance from the promoter. It also seems possible to have physical and functional overlap with the promoter. One skilled in the art will have information regarding various enhancers from various sources (and deposited in data banks such as GenBank, e.g., SV40 enhancers, CMV enhancers, polyoma enhancers, adenovirus enhancers) that are available as independent elements or elements cloned within polynucleotide sequences (for example, deposited in ATCC or from commercial and individual sources). Various promoter sequences also contain enhancer sequences, such as the commonly used CMV promoter. The human CMV enhancer is one of the most potent enhancers identified to date. One example of an inducible enhancer is the metallothionein enhancer, which can be stimulated by glucocorticoids or heavy metals.

- 13 046215

The term complementary nucleotide sequences describes one strand of two paired strands of polynucleotides such as DNA or RNA. The nucleotide sequence of the complementary strand is a mirror image of the nucleotide sequence of its paired strand in such a way that for each adenosine it contains thymine (or uracil for RNA), for each guanine it contains cytosine, and vice versa. The complementary nucleotide sequence, for example, 5'-GCATAC3' is 3'-CGTATG-5' or for RNA 3'-CGUAUG-5'.

The terms gene, gene of interest, as used in the present invention, have the same meaning and refer to a polynucleotide sequence of any length that encodes a product of interest. The gene may further comprise regulatory sequences located before (5' non-coding or untranslated sequences) and after (3' non-coding or untranslated sequences) the coding sequence. The selected sequence may be full length or truncated, fused, or tagged, and may be a cDNA, genomic DNA, or DNA fragment. In general terms, it is understood that genomic DNA encoding a polypeptide or RNA may include non-coding regions (i.e., introns) that are spliced from mature messenger RNA (mRNA) and therefore are not present in cDNA encoding the same polypeptide or RNA. It may be a native sequence, that is, a naturally occurring form(s), or may be mutated, or include sequences originating from different sources, or otherwise modified if desired. These modifications include frequency optimization codon optimizations to optimize the frequency of codon usage in the selected host cell or tagging. In addition, they may include deletions or additions of cis-acting sites such as (cryptic) splice donors, acceptor sites and branch points, polyadenylation signals, TATA boxes, chi sites, ribosome entry sites, repeat sequences, secondary structures (e.g. loops -on-stem), binding sites for transcription factors or other regulatory factors, restriction enzyme sites, etc., to provide just a few, non-limiting examples. The selected sequence may encode a secreted, cytoplasmic, nuclear, membrane-bound or cell surface polypeptide.

The term nucleotide sequence of interest, as used in the present invention, is a more general term than gene of interest, since it does not necessarily contain a gene, but may contain elements or parts of a gene or other genetic information, for example, ori (origin of replication). The nucleotide sequence of interest may be any DNA or RNA sequence, whether or not it includes a coding sequence.

An open reading frame or ORF refers to a stretch of nucleotide sequence, either DNA or RNA, that includes a translation start signal or start codon, such as ATG or AUG, and a stop codon and can potentially be translated into a polypeptide sequence.

The term transcription describes the biosynthesis of mRNA in a cell.

The term expression, as used in the present invention, refers to the transcription and/or translation of a nucleotide sequence in a host cell. In accordance with specific aspects of the present invention, the term expression refers to the transcription and/or translation of a heterologous and/or exogenous nucleotide sequence in a host cell. The level of expression of a desired product in a host cell can be determined based on either the amount of the corresponding RNA or mRNA that is present in the cell or the amount of the desired polypeptide encoded by the selected sequence. For example, the mRNA transcribed from a selected sequence can be quantified by Northern blot hybridization, RNA ribonuclease protection, in situ hybridization with cellular RNA, or by RTqPCR (reverse transcription followed by quantitative PCR). Proteins expressed from a selected sequence can be quantified using various methods, for example, by ELISA, Western blotting, radioimmunoassays, by immunoprecipitation, by testing the biological activity of the protein, or by protein immunostaining followed by FACS analysis.

The term expression cassette or transcription unit or expression unit is defined as a region in a vector, construct or polynucleotide sequence that contains one or more transcribed genes, where the nucleotide sequences encoded by the transcribed gene(s), as well as the polynucleotide sequences including regulatory elements , contained in the expression cassette, are functionally linked to each other. They are transcribed from a promoter and transcription is terminated at at least one polyadenylation signal. In one specific aspect, they are transcribed from a single promoter. As a result of this, different genes are at least transcriptionally related. More than one protein or product can be transcribed and expressed from each transcription unit (multicistronic transcription unit). Each transcription unit

- 14 046215 unit will contain the regulatory elements necessary for transcription and translation of any of the selected sequences that are contained in this unit. And each transcription unit may contain the same or different regulatory elements. For example, each transcription unit may have the same terminator, IRES element, or introns may be used to functionally link genes within the transcription unit. A vector or polynucleotide sequence may contain more than one transcription unit.

The term increased expression, increased titer or productivity, or improved expression or productivity means increased expression, synthesis or secretion of a heterologous and/or exogenous sequence introduced into a host cell, e.g., a gene encoding a therapeutic protein, by comparison with a suitable control, e.g. , encoded by the cDNA relative to the protein encoded by the intron-containing gene. An increased titer or productivity is present if the cell of the invention is cultured according to the method of the invention described in the present invention, and if the cell has at least a 1.2-fold, 1.5-fold, two-fold, three-fold, four-fold or five-fold increase in the specific productivity or titer . There is also an increased titer or productivity if the cell of the invention is cultured according to the method of the invention described in the present invention, and if the cell has at least 1.2-fold or at least 1.5-fold or at least two-fold or at least at least a threefold increase in specific productivity or titer. There is also, in particular, an increased titer or productivity if the cell according to the invention is cultured according to the method according to the invention described in the present invention, and if the cell has at least 1.2-fold - five-fold, preferably 1.5-fold - five-fold, more preferably a twofold to fivefold, especially preferably a threefold to fivefold increase in specific productivity or titer. Increased expression may also indicate that more cells actually express the gene/sequence of interest. For example, increased expression may indicate that the novel promoters of the present invention are active for a longer period of time during the viral replication cycle compared to other promoters.

Increased expression, titer or productivity can be obtained by using a heterologous vector in accordance with the invention. This can be combined with other approaches such as FACS-assisted selection of recombinant host cells that contain, as an additional selectable marker, one or more fluorescent proteins (eg GFP) or a cell surface marker. It is also possible to use other methods for obtaining increased expression, and a combination of various methods, based on, for example, the use of cis-active elements for manipulation of chromatin structure (for example, LCR, UCOE, EASE, insulators, S/MAR, STAR elements), the use of (artificial) transcription factors, treatment of cells with natural or synthetic agents to activate the expression of endogenous or heterologous and/or exogenous genes, improving the stability (half-life) of mRNA or protein, improving the initiation of translation of mRNA, increasing gene dosage through the use of episomal plasmids (based on the use of viral sequences in as origins of replication, for example SV40, polyoma, adenovirus, EBV or BPV), the use of amplification sequences or in vitro amplification systems based on DNA concatemers.

The study to measure increased expression is LC-MS/MS based protein determinations such as multiple reaction monitoring (MRM); antibody-based detection methods such as Western blotting, dot blotting, or immunodiffusion, and flow cytometry; and measuring biological activity through hemagglutination assays.

Promoter activity is measured indirectly by quantifying the mRNA transcribed under the control of the corresponding promoter. The mRNA is quantified by RTqPCR against an endogenous standard.

The term viral titer is an indicator of infectious units per volume of viral preparation. The virus titer is the ultimate precision biological procedure and is defined as the dilution at which a given portion of tests carried out in parallel produces an effect (Reed and Muench, 1938). Specifically, the semi-infectious dose of tissue culture per milliliter (TSI50/ml) provides a dilution of the viral preparation at which 50% of the number of cell cultures inoculated in parallel with such dilution are infected.

Transcription regulatory elements normally contain a promoter located upstream of the expressed gene sequence, transcription initiation and termination sites, and a polyadenylation signal.

The term transcription start site refers to the nucleic acid in the construct corresponding to the first nucleic acid incorporated into the primary transcript, that is, the precursor mRNA. The transcription start site may overlap with promoter sequences.

Stop codon or terminator or polyadenylation signal or polyA or

- 15 046215 a transcription termination site or transcription termination element is a signal sequence that causes cleavage at a specific site at the 3' end of a eukaryotic mRNA and post-transcriptional incorporation of a sequence of approximately 100-200 adenine nucleotides (polyA tail) at the cleaved 3' end, and, therefore, causes termination of transcription carried out by RNA polymerase. The polyadenylation signal includes the sequence AATAAAA approximately 10-30 nucleotides upstream of the restriction site and a sequence located downstream of transcription. Various polyadenylation elements are known, such as tk polyA, SV40 late and early polyA, BGH polyA (described, for example, in US Pat. No. 5,122,458) or hamster growth hormone polyA (WO 2010010107).

Translation regulatory elements contain a translation initiation site (AUG), a stop codon, and a polyA signal for each individual polypeptide to be expressed. Some constructs may include an internal ribosome entry site (IRES). To optimize expression, it may be desirable to remove, add or modify 5' and/or 3' untranslated regions of the expressed nucleotide sequence to eliminate any potential additional inappropriate alternative translation initiation codons, or other sequences that may interfere with or reduce expression, either at transcription or translation. Consensus ribosome binding sites (Kozak sequence) can be inserted immediately upstream of the start codon to enhance translation and hence expression. Increased A/U content around this ribosome binding site further influences more efficient ribosome binding.

By definition, each polynucleotide sequence or each gene inserted into a host cell and the corresponding protein or RNA so encoded is designated as exogenous, exogenous sequence, exogenous gene, exogenous coding sequence, with respect to the host cell, which is of origin from different (viral) species. Thus, the EHV-4 based promoters of the present invention are exogenous to the EHV-1 viral vector. As used herein, with respect to a sequence or gene of interest, such as an antigen, the term exogenous means that said sequence or gene of interest, specifically the antigen, is expressed outside surroundings of its natural species. Thus, H3 antigen from porcine IAV is one example (see Example 3) of an exogenous antigen to the EHV-1 vector. Therefore, any non-equine sequence of interest or gene, such as a non-equine antigen, is an exogenous sequence of interest or gene or antigen in accordance with a specific aspect of the present invention.

By definition, each polynucleotide sequence or gene inserted into a host cell and the corresponding protein or RNA so encoded is referred to as a heterologous, heterologous sequence, heterologous gene, heterologous coding sequence, transgene, or heterologous protein with respect to the host cell. This applies even if the introduced sequence or introduced gene is identical to the endogenous sequence or endogenous gene of the host cell. For example, an EHV-4 promoter sequence introduced into an EHV-4 viral vector at a different site or in a modified form than in a wild-type EHV-4 virus is by definition a heterologous sequence. As used herein, with respect to a sequence or gene of interest, such as an antigen, the term heterologous means that said sequence or gene of interest, specifically the antigen, is expressed outside its natural environment. subspecies Thus, any non-EHV-1 specific sequence or gene of interest, such as an antigen, e.g., antigen from any alphaherpesvirus other than EHV-1, e.g., EHV-3, EHV- 8 is therefore a heterologous sequence(s) of interest or gene or antigen in accordance with a specific aspect of the present invention.

The term non-naturally occurring means any sequence or gene of interest, such as an antigen, that does not occur naturally in that environment, such as a hybrid sequence or sequence or gene of interest, such as an antigen from different species, or a sequence or gene of interest, such as an antigen, that is not a natural product due to an artificial mutation, insertion, deletion or the like.

The term recombinant is used interchangeably with the terms non-naturally occurring, heterologous and exogenous in the description of the present invention. Thus, a recombinant protein is a protein expressed from either a heterologous or exogenous polynucleotide sequence. The term recombinant, as used in relation to a virus, means a virus produced by artificial manipulation of the viral genome. Virus,

- 16 046215 comprising a heterologous or exogenous sequence, such as an exogenous antigen coding sequence, is a recombinant virus. The term recombinant virus and the term unnatural virus are used interchangeably.

Thus, the term heterologous vector means a vector that includes a heterologous or exogenous polynucleotide sequence. The term recombinant vector means a vector that includes a heterologous or recombinant polynucleotide sequence.

As used in the present invention, the term operably linked is used to describe the relationship between regulatory elements and a gene or coding region thereof. Typically, gene expression is placed under the control of one or more regulatory elements, such as, but not limited to, constitutive or inducible promoters, tissue-specific regulatory elements and enhancers. When a gene or coding region is stated to be operably linked to or operably linked to or operably associated with regulatory elements, it means that either the coding region is controlled by or is influenced by the regulatory element. For example, a promoter is operably linked to a coding sequence if the promoter influences the transcription or expression of the coding sequence.

Additionally, as used herein, the terms operably linked, operably linked, or operably linked mean that two or more nucleotide sequences or sequence elements are arranged in such a manner as to allow them to function properly. For example, a promoter/enhancer or terminator is operably linked to a coding gene sequence if it is capable of controlling or modulating transcription of the associated gene sequence in cis. In general, but not necessarily required, DNA sequences that are operably linked are contiguous and, if necessary to join two polypeptide coding regions or in the case of signal peptide secretion, contiguous and in frame. However, although an operably linked promoter is typically located upstream of transcription or an operably linked terminator is typically located downstream of a coding sequence, it is not always adjacent to them. Enhancers do not need to be contiguous because they increase transcription of the coding sequence. To do this, they can be located against the direction of transcription or along the direction of transcription of the coding sequence, and even at some distance. A polyadenylation site is operably linked to a coding sequence if it is located at the 3' end of the coding sequence such that transcription occurs through the coding sequence onto the polyadenylation signal. Linking is accomplished using recombinant methods well known in the art, for example, by ligation at suitable restriction sites or blunt ends, or by using PCR techniques with overlapping primers. Synthetic oligonucleotide linkers or adapters can be used in accordance with conventional practice if suitable restriction sites are not present.

Thus, the term functional fragment or functional derivative of a promoter sequence means that the fragment or derivative still has promoter activity. Functional assays to assess promoter activity are well known to those skilled in the art (Bustin 2000, Nolan et al. 2006). An exemplary embodiment of such a functional study includes, for example, a promoter kinetics experiment. Cells infected with vector viruses carrying expression cassettes, where a promoter or its fragment directs transcription of a reporter transgene, are incubated for various periods of time. Total RNA obtained from samples was collected at various times after infection. After the contaminating DNA is destroyed by DNase I digestion, the RNA is reverse transcribed. One replicate sample was processed with the addition of reverse transcriptase (RT), and a second replicate was processed without the addition of RT to demonstrate successful removal of contaminating DNA from the RNA preparation. The resulting cDNA is purified and used as a template in conventional PCR. Only samples processed with the addition of RT will produce a PCR product. These cDNAs are then used for quantitative PCR with primers for the reporter transgene and in parallel with primers for the viral vector core gene (internal standard gene), the transcription of which provides the internal standard for infection and replication efficiency. Reporter qPCR values are normalized between different constructs and times postinfection using the internal standard gene qPCR values. This provides the opportunity to interpret the activities of various promoters and their fragments.

Sequence homology, as used in the present invention, refers to a method for determining the relatedness of two sequences. To determine sequence homology, two or more sequences are optimally aligned, and gaps are introduced if necessary.

- 17 046215 mo. However, unlike sequence identity, conservative amino acid substitutions are counted as matches when determining sequence homology.

In other words, to obtain a comparable polypeptide or polynucleotide having 95% sequence homology with the comparison sequence, 85%, preferably 90, 91, 92, 93, 94%, even more preferably 95, 96, 97, 98, 99, 99.9 % of amino acid residues or nucleotides in the reference sequence must match or contain a conservative substitution for another amino acid or nucleotide. Alternatively, the amount of amino acids or nucleotides is up to 15%, preferably up to 10, 9, 8, 7, 6%, even more preferably up to 5, 4, 3, 2, 1, 0.1% of the total amino acid residues or nucleotides, excluding conservative substitutions, comparison sequences can be inserted into the comparison sequence. Preferably, the homologous sequence is at least 50, even more preferably 100, even more preferably 250, even more preferably 500 nucleotides in length.

Sequence identity, as it is known in the art, refers to the relationship of two or more polypeptide sequences or two or more polynucleotide sequences, namely the reference sequence and the given sequence that is compared with the reference sequence. Sequence identity is determined by comparing a given sequence to a reference sequence after optimal sequence alignment to obtain the highest degree of sequence similarity, as determined by matches between stripes of such sequences. In such an alignment, sequence identity is established based on positional comparisons, for example, sequences are identical at a particular position if, at that position, the nucleotides or amino acid residues are identical. The total number of such identical positions is then divided by the total number of nucleotides or residues in the reference sequence, yielding % sequence identity. Sequence identities can be easily calculated using known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, A. N., ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988), the teachings of which are incorporated herein by reference. Preferred methods for determining sequence identity are created to obtain the greatest match between the test sequences. Methods for determining sequence identity are codified in publicly available computer programs that determine sequence identity between given sequences. Examples of these include, but are not limited to, the GCG software package (Devereux, J., et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F., et al. , J. Molec. Biol., 215:403-410 (1990) The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCVI NLM NIH Bethesda, MD 20894, Altschul, S. F. and al., J. Molec. Biol., 215:403-410 (1990), the details of which are incorporated herein by reference.) These programs optimally align sequences using default gap opening penalties to obtain the highest level of sequence identity between given and comparative sequences. By way of illustration, by polynucleotide having a nucleotide sequence having at least, for example, 85%, preferably 90, 91, 92, 93, 94%, even more preferably 95, 96, 97, 98, 99 99.9% sequence identity to the reference nucleotide sequence, it is understood that the nucleotide sequence of a given polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to 15, preferably up to 10, even more preferably up to 5 point mutations for every 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide having a nucleotide sequence having at least 85%, preferably 90, 91, 92, 93, 94%, even more preferably 95, 96, 97, 98, 99, 99.9% identity with respect to of the comparison nucleotide sequence, up to 15%, preferably 10, 9, 8, 7, 6%, even more preferably 5, 4, 3, 2, 1, 0.1% of the nucleotides in the comparison sequence may be deleted or replaced by another nucleotide , or the number of nucleotides up to 15%, preferably 10, 9, 8, 7, 6%, even more preferably 5, 4, 3, 2, 1, 0.1% of the total nucleotides in the reference sequence can be inserted into the reference sequence. These reference sequence mutations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between these terminal positions, scattered either individually between nucleotides in the reference sequence or in one or more contiguous groups in the reference sequence. Likewise, a polypeptide having a given amino acid sequence having at least, for example, 85%, preferably 90, 91, 92, 93, 94%, even more preferably 95, 96, 97,

- 18 046215

98, 99 sequence identity to a reference amino acid sequence, it is meant that a given amino acid sequence of a polypeptide is identical to a reference sequence, except that a given polypeptide sequence may include up to 15, preferably up to 10, 9, 8, 7, 6, even more preferably, up to 5, 4, 3, 2, 1 amino acid changes for every 100 amino acids of the comparison amino acid sequence. In other words, to obtain a given polypeptide sequence having at least 85%, preferably 90, 91, 92, 93, 94%, even more preferably 95, 96, 97, 98, 99 sequence identity with the reference amino acid sequence, up to 15 %, preferably up to 10, 9, 8, 7, even more preferably up to 5, 4, 3, 2, 1 amino acid residues in the reference sequence may be deleted or replaced with another amino acid, or the number of amino acids up to 15%, preferably up to 10, 9, 8, 7, even more preferably up to 5, 4, 3, 2, 1 total amino acid residues in the comparison sequence can be inserted into the comparison sequence. These reference sequence changes may occur at the amino- or carboxy-terminal positions of the reference amino acid sequence or anywhere between these terminal positions, scattered either individually between residues in the reference sequence or in one or more contiguous groups in the reference sequence. Preferably, positions of residues that are not identical are distinguished by conservative amino acid substitutions. However, conservative substitutions are not included as a match when determining sequence identity.

The terms sequence identity or percent identity are used interchangeably throughout the present specification. For purposes of the present invention, the present invention specifies that to determine the percent identity of two amino acid sequences or two nucleotide sequences, the sequences are aligned for optimal comparison (e.g., gaps may be introduced into the first amino acid or nucleic acid sequence for optimal alignment with the second amino acid or nucleic acid sequence). The amino acid or nucleotide residues at the corresponding amino acid or nucleotide positions are then compared. If a position in the first sequence is occupied by the same amino acid or nucleotide residue as the corresponding position in the second sequence, then these molecules are identical at that position. The percentage identity between two sequences is a function of the number of identical positions shared by the sequences (ie, % identity = number of identical positions/total number of positions (ie, overlapping positions) x 100). Preferably, the two sequences are the same length.

Sequence comparisons can be made for the full lengths of the two sequences being compared or for a fragment of two sequences. Typically, the comparison is made for the full length of the two sequences being compared. However, it is possible to determine sequence identity for a region of, for example, twenty, fifty, one hundred or more contiguous amino acid residues.

One skilled in the art will know that several different computer programs are available for determining homology between two sequences. For example, comparing sequences and determining the percent identity between two sequences can be done using a mathematical algorithm. In a preferred embodiment, the percentage identity between two amino acid or nucleotide sequences is determined using the algorithm of Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)), which was included in the GAP program in the Accelrys software package GCG (available at http://www.accelrys.com/products/gcg/), using either a Blosum 62 matrix or a PAM250 matrix, and a gap opening penalty of 16, 14, 12, 10, 8, 6 or 4 and a penalty length 1, 2, 3, 4, 5 or 6. It will be appreciated by one skilled in the art that all of these different parameters will result in slightly different results, but the overall percentage identity of the two sequences will not change significantly when different algorithms are used.

The protein sequences or nucleotide sequences of the present invention may further be used as a search sequence to search public databases, for example, to identify other members of families or related sequences. Such searches can be performed using the programs BLASTN and BLASTP (version 2.0) from Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST searches for proteins can be performed using the BLASTP program, score=50, word length=3, to obtain amino acid sequences homologous to protein molecules according to the invention. To obtain gap alignments for comparisons, Gapped BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25(17): 3389-3402. When using the BLAST and Gapped BLAST programs, you can use the default parameters of the corresponding programs (for example, BLASTP and

- 19 046215

BLASTN). See the National Center for Biotechnology Information home page at http://www.ncbi.nlm.nih.gov/.

Definitions of EHV-1 and EHV-4/recombinant vector technology.

The term equidae or equine or odd-toed ungulate refers to or refers to the equidae family (Equidae), which includes horses, donkeys and zebras, preferably equines. Additionally, the term equidae or equine or equid also covers hybrids of members of the family Equidae (eg, mules, hinnies, etc.).

Herpes virus or herpes virus vector belongs to the species in the family Herpesviridae in the order Herpesvirales.

The term equine herpes virus vector or equine herpes virus or EHV refers to a member of the Herpesviridae family that infects horses. To date, eight different species of equine herpesviruses have been identified, five of them belonging to the subfamily Alphaherpesvirinae (EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9) and three to Gammaherpesvirinae. (http://www.ictvonline.org/virustaxonomy.asp Virus Taxonomy: 2015 Release EC 47, London, UK, July 2015; Email ratification 2016 (MSL #30).

The term EHV-1 refers to equine alphaherpesvirus type 1, a member of the subgenus Varicellovirus in the genus Alphaherpesvirinae in the family Herpesviridae. A non-limiting reference sequence for EHV-1 could be, for example, wild-type EHV-1 strain ab4 (Genbank accession number AY665713.1) or RacH (Hubert 1996).

The term EHV-4 refers to equine alphaherpesvirus type 4, a member of the subgenus Varicellovirus in the genus Alphaherpesvirinae in the family Herpesviridae.

The term inserted into ORF70 means that the DNA fragment has been inserted into the genomic DNA at a location encoding the equine alphaherpesvirus type 1 open reading frame 70. In a specific aspect of the present invention, the insertion refers to the resulting deletion of 801 5' base pairs of ORF70, leaving the remaining 423 base pairs at the 3' end intact but abolishing expression of the ORF70 gene product glycoprotein G. G glycoprotein of several alphaherpesviruses, including EHV- 1 is secreted from infected cells and acts as an immunomodulatory protein by binding proinflammatory cytokines. Abolition of its expression in the viral vector will increase the immunogenicity of the viral infection compared with wild-type EHV-1 expressing intact glycoprotein G.

The term inserted into ORF1/3 means that the DNA fragment has been inserted into the viral genome at a position where, by random deletion during passivation during the attenuation procedure of the EHV-1 vaccine strain, the RacH fragment 1283, comprising 90% of ORF1 and all of ORF2, was lost. This insertion site was chosen because it is believed that there is a very low likelihood that expression of the transgene from this location will interfere with viral replication.

Vaccine definitions.

An immunogenic or immunological composition refers to a composition of a substance that contains at least one antigen or immunogenic portion thereof that induces a cell- or antibody-mediated immune response to the composition in the host.

The term antigen as used in the present invention is well known in the art and includes substances that are immunogenic, that is, immunogens, as well as substances that induce immunological unresponsiveness or anergy, that is, a lack of response through the body's defenses to foreign substances. As used in the present invention, the term antigen refers to full-length proteins, as well as peptide fragments thereof containing or including an epitope.

The term food animal means animals that are used for human consumption such as pigs, cattle, poultry, fish and others, preferably food animal means pigs and cattle, most preferably pigs .

An immunogenic composition as used in the present invention may refer to a polypeptide or protein, such as, for example, a viral surface protein, which induces an immune response as described in the present invention. The term immunogenic fragment or immunogenic part refers to a fragment or truncated and/or substituted form of a protein or polypeptide that includes one or more epitopes and, therefore, causes the immune response described in the present invention. In general, such truncated and/or substituted forms or fragments will contain at least six consecutive amino acids from the full-length protein. Such fragments can be identified using any of a number of techniques that are used for epitope mapping that are well known in the art. See, for example, Epitope Mapping Protocols in Methods in Molecular Biology, volume 66 (Glenn E. Morris, ed., 1996) Humana Press, Totowa, New Jersey. For example, linear epitopes can be determined by simultaneously synthesizing large numbers of peptides on solid supports, identifying peptides corresponding to parts of the protein molecule, and reacting the peptides with antibodies while the peptides are still

- 20 046215 remain attached to the substrates. Such techniques are known and described in the art, see, for example, US Pat. No. 4,708,871; Geysen et al (1984) Proc. Natl. Acad. Sci. USA 81:39984002; and Geysen et al. (1986) Molec. Immunol. 23:709-715. Similarly, conformational epitopes are easily identified by determining the spatial conformation of amino acids, for example, by X-ray crystallography and two-dimensional nuclear magnetic resonance. See Epitope Mapping Protocols, as described above. Synthetic antigens are also included in the definition, for example, polyepitopes, flanking epitopes and other recombinant or synthetically produced antigens. See, for example, Bergmann et al. (1993) Eur. J. Immunol. 23:2777-2781; Bergmann et al (1996), J. Immunol. 157:3242-3249; Suhrbier, A. (1997), Immunol, and Cell Biol. 75:402-408; and Gardner et al., (1998) 12th World AIDS Conference, Geneva, Switzerland, 28 July 1998. (The disclosure and contents of which are incorporated herein by reference.)

The term vaccine, as used herein, refers to a pharmaceutical composition comprising at least one immunologically active component that induces an immune response in an animal and optionally, but not necessarily, one or more additional components that enhance the immunological activity of the active component. The vaccine may additionally contain other components that are typical of pharmaceutical compositions. In contrast, the immunologically active vaccine component may contain complete viral particles either in their original form or as attenuated particles in a so-called modified live vaccine (MLV) or particles inactivated by suitable methods in a so-called killed vaccine (KV). In another form, the immunologically active vaccine component may contain suitable elements of organisms (subunit vaccines), where these elements are created either by destruction of the whole particle or by growing cultures containing such particles, and optionally subsequent purification steps resulting in the desired structure(s). structures), or by synthetic processes, including suitable manipulation by use of a suitable system based on, for example, bacteria, viruses, mammals or other species, plus optional subsequent isolation and purification procedures, or by inducing synthetic processes in an animal in need of a vaccine, by direct incorporation of genetic material using suitable pharmaceutical compositions (polynucleotide vaccination). The vaccine may contain one or more than one of the elements described above. As used in specific aspects of the present invention, a vaccine refers to a live vaccine or live virus, also called a recombinant vaccine. In another specific aspect, according to the present invention, the vaccine refers to an inactivated or killed virus, including virus-like particles (VLPs). Thus, the vaccine may be a subunit vaccine or a killed (KV) or inactivated vaccine.

The term Multiplicity of Infection (M.O.I.) describes how many infectious units, such as TCID50, of a viral preparation are used per cell to infect cell cultures. For example, M.O.I. 0.01 means that one infectious unit is inoculated for every 100 cells in the culture vessel.

The term DNA vaccination or polynucleotide vaccination refers to the direct inoculation of genetic material using suitable pharmaceutical compositions.

Various physical and chemical inactivation methods are known in the art. The term inactivated refers to a previously virulent or non-virulent virus or bacterium that has been irradiated (ultraviolet (UV), x-rays, electron beam or gamma rays), heated, or chemically treated to inactivate or kill such virus or bacterium while still maintaining its immunogenicity . Suitable inactivating agents include betapropiolactone, binary or beta- or acetyl-ethylenimine, glutaraldehyde, ozone and formalin (formaldehyde).

For inactivation with formalin or formaldehyde, formaldehyde is typically mixed with water and methyl alcohol to create formalin. The addition of methyl alcohol prevents degradation or cross-reaction during the activation process. In one embodiment, approximately 0.1-1% of a 37% formaldehyde solution is used to inactivate the virus or bacteria. It is very important to adjust the amount of formaldehyde to ensure that the material is inactivated, but not so much that side effects from the high dose occur.

More preferably, the term inactivated with respect to a virus means that the virus is unable to replicate under in vivo or in vitro conditions and, correspondingly, the term inactivated with respect to a bacterium means that the bacterium is unable to reproduce under in vivo or in vitro conditions. For example, the term inactivated may refer to a virus that has been propagated in vitro and has then been inactivated using chemical or physical means in such a way that it is no longer capable of replication. In another example, the term inactivated may refer to a bacterium that has been propagated and then inactivated using chemical or physical means, resulting in a suspension of bacteria, fragments or components of the bacterium, such as a bacterin, which can be used as a component of a vaccine .

- 21 046215

As used in the present invention, the terms inactivated, killed or KV are used interchangeably.

The term live vaccine refers to a vaccine comprising either a living organism or a replication competent virus or viral vector.

A pharmaceutical composition essentially consists of one or more ingredients capable of modifying physiological, eg immunological, functions of the organism into which it is administered or organisms living in it or on the organism. The term includes, but is not limited to, antibiotics or antiparasitics, as well as other constituents that are typically used to achieve certain other objectives such as, but not limited to, processability, sterility, stability, ability to administer the composition via enteral or parenteral routes, such as oral, intranasal, intravenous, intramuscular, subcutaneous, intradermal, or other suitable route, tolerability after administration, or controlled release properties. One non-limiting example of such a pharmaceutical composition, presented for demonstration purposes only, can be prepared as follows: the cell culture supernatant of an infected cell culture is mixed with a stabilizer (for example, spermidine and/or bovine serum albumin (BSA) and then the mixture is lyophilized or dehydrated with other Methods: Before vaccination, the mixture is then reconstituted in aqueous (eg, saline, phosphate-buffered saline (PBS)) or non-aqueous solutions (eg, oil emulsion, aluminum-based adjuvant).

As used herein, the term pharmaceutically or veterinarily acceptable carrier includes any and all solvents, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption retarding agents, and the like. In some preferred embodiments, and especially those that include lyophilized immunogenic compositions, stabilizing agents for use in the present invention include freeze-drying or freeze-drying stabilizers.

In some embodiments, the immunogenic composition of the present invention contains an adjuvant. Adjuvants as used in this invention may include aluminum hydroxide and aluminum phosphate, saponins, e.g. Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL) , water-in-oil emulsion, oil-in-water, water-in-oil-in-water. The emulsion may be based in particular on light petrolatum (according to the European Pharmacopoeia); isoprenoid oil such as squalane or squalene; oil obtained from the oligomerization of alkenes, in particular isobutene or decene; esters of acids or alcohols containing a linear alkyl group, in particular vegetable oil, ethyl oleate, propylene glycol di-(caprylate/caprate), glyceryl tri-(caprylate/caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular esters of isostearic acid. The oil is used in combination with emulsifiers to form an emulsion. Emulsifiers are preferably non-ionic surfactants, in particular esters of sorbitan, mannitol (eg anhydromannite oleate), glycol, polyglycerol, propylene glycol and oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, and a polyoxypropylene block copolymer -polyoxyethylene, in particular Pluronic products, in particular L121. See Hunter et al., The Theory and Practical Application of Adjuvants (Ed. Stewart-Tull, D.E.S.), John Wiley and Sons, NY, pp. 51-94 (1995) and Todd et al., Vaccine 15:564-570 ( 1997). Typical adjuvants are SPT emulsion, described on page 147 of Vaccine Design, The Subunit and Adjuvant Approach, ed. M. Powell and M. Newman, Plenum Press, 1995, and emulsion MF59, described on page 183 of the same source.

Another example of an adjuvant is a compound selected from polymers of acrylic or methacrylic acid and copolymers of maleic anhydride and alkenyl derivatives. Preferred adjuvant compounds are polymers of acrylic or methacrylic acid which are cross-linked, in particular, with polyalkenyl esters of sugars or polyhydric alcohols. These compounds are known by the term carbomer (Pharmacopeia Vol. 8, No. 2, June 1996). Those skilled in the art may also refer to US Pat. No. 2,909,462, which describes such acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably no more than 8, with at least hydrogen atoms three hydroxyl groups are replaced by unsaturated aliphatic radicals containing at least 2 carbon atoms. Preferred radicals are those containing from 2 to 4 carbon atoms, for example vinyls, allyls and other ethylenically unsaturated groups. Unsaturated radicals themselves may contain other substituents such as methyl. Products sold under the name CARBOPOL®; (BF Goodrich, Ohio, USA) are particularly acceptable. They are cross-linked with allylsucrose or pentaerythritol. Among them, Carbopol 974P, 934P and 971P may be mentioned.

- 22 046215

The most preferred is the use of CABOPOL® 97IP. Among the copolymers of maleic anhydride and an alkenyl derivative, mention should be made of EMA copolymers (Monsanto), which are copolymers of maleic anhydride and ethylene. Dissolution of these polymers in water results in an acidic solution, which will be neutralized, preferably to a physiological pH, in order to introduce the adjuvant solution into which the immunogenic or immunological vaccine will be included.

Other suitable excipients include, but are not limited to, RIBI adjuvant system (Ribi Inc.), block copolymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-based adjuvant. amine, heat labile enterotoxin from E. coli (recombinant or otherwise), cholera toxin, IMS 1314 or muramyl dipeptide, either natural or recombinant cytokinins or analogs thereof, or stimulators of endogenous cytokine release, among others.

It is expected that the adjuvant may be added in an amount of from about 100 μg to about 10 mg per dose, preferably in an amount from about 100 μg to about 10 mg per dose, more preferably in an amount from about 750 μg to about 2.5 mg per dose , and most prefer an amount of approximately 1 mg per dose. Additionally, the adjuvant may be present at a concentration of about 0.01 to 50%, preferably at a concentration of about 2 to 30%, more preferably at a concentration of about 5 to 25%, even more preferably at a concentration of about 7 to 22%, and most preferably at a concentration of 10 to 20% by volume of the final product.

Diluents may include water, saline, dextrose, ethanol, glycerin, and the like. Isotonic agents may include, but are not limited to, sodium chloride, dextrose, mannitol, sorbitol and lactose. Stabilizers include albumin and alkaline salts of ethylenediaminetetraacetic acid, among others.

Isolated means altered by the hand of man from its natural state, that is, if it occurs in nature, then it has been altered or removed from its original environment or both. For example, a polynucleotide or polypeptide that is naturally present in a living organism is not isolated, but the same polynucleotide or polypeptide, when separated from coexisting materials in its natural state, is isolated as that term is used herein.

Attenuation refers to a decrease in the virulence of a pathogen. In the present invention, attenuation is synonymous with avirulence. In the present invention, an attenuated virus is a virus in which the virulence has been reduced such that it does not cause clinical signs of infection but is capable of inducing an immune response in the target animal, but may also mean that clinical signs are reduced in frequency or severity in animals infected with an attenuated virus, especially an EHV-1 RacH viral vector, as stated, compared with a control group of animals infected with a non-attenuated virus or pathogen and not receiving the attenuated virus. In this context, the term reduced/reduced means a reduction of at least 10%, preferably 25%, even more preferably 50%, even more preferably 60%, even more preferably 70%, even more preferably 80%, even more preferably 90% and most preferably 100% compared to the control group as defined above. Thus, an attenuated, avirulent pathogen, such as, for example, the inventive attenuated viral vector, especially the inventive EHV-1 (preferably RacH) viral vector, is suitable for creating a modified live vaccine (MLV) or a modified live immunogenic composition.

In this invention, effective dose means, but is not limited to, the amount of antigen that produces or is capable of producing an immune response that results in a reduction in clinical symptoms in an animal to which the antigen is administered.

As used herein, the term effective amount means, in the context of a composition, an amount of an immunogenic composition capable of inducing an immune response that reduces the incidence or severity of infection, or the incidence of disease in an animal. Specifically, the effective amount refers to colony-forming units (CFU) per dose. Moreover, in the context of therapy, the term effective amount refers to an amount of therapy that is sufficient to reduce or ameliorate the severity or duration of a disease or disorder, or one or more symptoms thereof, prevent the development of the disease or disorder, cause regression of the disease or disorder, prevent the relapse, development, onset or progression of one or more symptoms associated with a disease or disorder, or enhance or improve the prevention or treatment of another therapy or therapeutic agent.

Immune response or immunological response means, but is not limited to, the development of a cellular and/or antibody-mediated immune response to (immunogenic) compositions or vaccines of interest. Generally, an immune or immunological response includes, but is not limited to, one or more of the following effects: production or

- 23 046215 activation of antibodies, B cells, T helper cells, suppressor T cells and/or cytotoxic T cells, directly directed to the antigen or antigens included in the compositions or vaccines of interest. Preferably, the host will demonstrate either a therapeutic or a protective immunological (immunological memory) response such that resistance to a new infection will be enhanced and/or the clinical severity of the disease will be reduced. Such protection will be manifested by either a reduction in the number of symptoms, severity of symptoms, or the absence of one or more symptoms associated with infection with the pathogen, a delay in the onset of viremia, a decrease in viral persistence, a decrease in overall viral load, and/or a decrease in viral excretion.

Protection from disease, protective immunity, functional immunity, reduction of clinical symptoms, induction/production of neutralizing antibodies and/or serological transformations, and similar phrases, mean a partial or complete response against a disease or condition that is induced by administration of one or more therapeutic compositions in accordance with the invention, or a combination thereof, resulting in more reduced harmful effects than would be expected in a non-immunized subject who has been exposed to a disease or infection. That is, the severity of the harmful effects of the infection is reduced in the vaccinated subject. Infection may be reduced, delayed, or perhaps completely prevented in a vaccinated subject. Moreover, when complete prevention of infection is meant, this is specifically indicated. If complete prevention is not specified, the term includes partial prevention.

In this invention, reducing the incidence of disease and/or clinical signs or reducing clinical symptoms means, but is not limited to, reducing the number of infected subjects in a group, reducing or eliminating the number of subjects who exhibit clinical signs of infection, or reducing the severity of any clinical symptoms , which are present in one or more subjects, compared to wild-type infection. For example, any reduction in pathogen load, pathogen shedding, reduction in pathogen transmission, or reduction in any clinical sign of symptomatic malaria infection should be mentioned. Preferably, these clinical signs are reduced in one or more subjects receiving a therapeutic composition in accordance with the present invention by at least 10% compared to subjects not receiving the composition and who are infected. More preferably, clinical signs are reduced in subjects receiving a composition according to the present invention by at least 20%, preferably by at least 30%, more preferably by at least 40%, and even more preferably at least 50%.

The term increased protection as used herein means, but is not limited to, a statistically significant reduction in one or more clinical symptoms that are associated with infection with an infectious agent in a group of vaccinated subjects versus an unvaccinated control group of subjects. The term statistically significant reduction in clinical symptoms means, but is not limited to, the incidence of at least one clinical symptom in a group of vaccinated subjects that is at least 10%, preferably 20%, more preferably 30%, even more preferably 50%, and even more preferably 70% lower than in the unvaccinated control group after challenge with the infectious agent.

Long-term protection refers to an improvement in effectiveness that lasts for at least 3 weeks, but more preferably at least 3 months, even more preferably at least 6 months. In cattle, it is most preferable for long-term protection to be maintained until the average age at which the animals are sold for meat.

The term reduction in virus-induced viremia means, but is not limited to, a reduction in virus entering the animal's circulatory system where the level of viremia, that is, the number of copies of viral DNA or RNA per milliliter of blood serum or the number of plaque-forming colonies per deciliter of blood serum, is reduced. in the blood serum of animals receiving the composition according to the present invention by at least 50% compared to animals that did not receive the composition and may become infected. More preferably, the level of viremia is reduced in animals receiving the composition of the present invention by at least 90%, preferably by at least 99.9%, more preferably by at least 99.99%, and even more preferably by at least 99.999%.

As used in the present invention, the term viremia is specifically understood as a condition in which viral particles reproduce and/or circulate in the circulatory system of an animal, in particular a mammal, bird or insect.

Safety refers to the absence of adverse effects in vaccinated animals following vaccination, including, but not limited to, the potential for the virus-based vaccine to become virulent, clinically significant adverse effects such as persistent, systemic disease, or unacceptable inflammation at the site of vaccine administration.

- 24 046215

The terms vaccination or vaccinating or variants thereof, as used in this invention, mean, but are not limited to, a process that involves the administration of an immunogenic composition in accordance with the invention, which, when administered to an animal, causes or can cause - directly or indirectly - an immune response in the specified animal.

Mortality in the context of the present invention refers to death caused by infection and includes the situation where the infection is so severe that the animal is euthanized to prevent suffering and ensure a humane end to its life.

Drugs.

The subject to which the composition is administered is preferably an animal, including, but not limited to, cows, horses, sheep, pigs, poultry (eg chickens), goats, cats, dogs, hamsters, mice and rats; most preferably, the mammal is a pig.

The compositions in accordance with the invention contain an effective immunizing amount of one or more immunogenic compositions and a physiologically acceptable carrier. The vaccines contain an effective immunizing amount of one or more immunogenic compositions and a physiologically acceptable carrier. The composition must be suitable for the route of administration.

The immunogenic composition, if desired, may also contain minor amounts of wetting or emulsifying agents or pH buffering agents. The immunogenic composition may be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release composition, or powder. Oral preparations may include standard carriers such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like.

Methods of treatment.

Preferred routes of administration include, but are not limited to, intranasal, oral, intradermal and intramuscular. Administration in drinking water is desirable, most preferably in a single dose. One skilled in the art will appreciate that the compositions of the invention may also be administered in one, two or more doses, as well as by other routes of administration. For example, such other routes include subcutaneous, intradermal, intraperitoneal, intradermal, and depending on the desired duration and effectiveness of treatment, the compositions in accordance with the invention may be administered one or more times, as well as periodically, for example, on a daily basis for several days , weeks or months and at varying dosages, such as from approximately 10 ³ to 10 ⁸ TCID50 (see virus titer above). In a specific aspect of the present invention, the dosage is from about 10 ³ to 10 ⁸ TCID50, especially for a live virus/live vaccine.

The compositions, if desired, may be presented in a package or dosage device, which may contain one or more unit dosage forms containing the active ingredient. The package may, for example, comprise metal or plastic packaging, such as a blister pack. The package or dispenser device may be accompanied by instructions for administration, preferably for administration to a mammal, in particular a pig. Such container(s) may be accompanied by notices in a form prescribed by the government agency regulating the manufacture, use, or sale of pharmaceutical or biological products, where the notices reflect agency approval for manufacture, use, or sale for administration to humans.

Sequence overview.

The following sequences are set out in detail and are thus disclosed in the present invention.

- 25 046215

Promoters:

SEQ ID NO: 1 EHV-4 600 DNA sequence 4pgG600 SEQ ID NO: 2 EHV-4 600 DNA sequence 4pMCP600 SEQ ID NO: 3 EHV-4 430 DNA sequence pG430 SEQ ID NO: 4 EHV-4 449 DNA sequence p455 SEQ ID NO: 5 primer No. ISO, specific for orf72 SEQ ID NO: 6 primer no. 1131, specific for orf72 SEQ ID NO: 7 primer no. 1079, specific for mCherry SEQ ID NO: 8 Insertion site: primer no. 1080, specific for mCherry SEQ ID NO: 9 Artificial nucleic acid sequence of PCR primer 1017 for the orf70 insertion site SEQ ID NO: 10 Artificial nucleic acid sequence acid PCR primer 1018 for the insertion site orf70

- 26 046215

SEQ ID NO: AND Artificial nucleic acid sequence acid PCR primer 1007 for the insertion site orfl/3 SEQ ID NO: 12 Artificial nucleic acid sequence acid PCR primer 1008 for the insertion site orfl/3 SEQ ID NO: 13 left (Up70) flanking region (417th) SEQ ID NO: 14 right (Up71) flanking region (431st) SEQ ID NO: 15 flanking region left (up orf70) in EHV-1 wild-type strain ab4 (Genbank accession number AY665713.1), located at nucleotides 127264 127680 SEQ ID NO: 16 flanking region right (up orf71) in EHV-1 wild-type strain ab4 (Genbank accession number AY665713.1), located at nucleotides 128484 128913 SEQ ID NO: 17 truncated flanking region in the RED system: left (Up70) flanking region (283 bp) = identical to 3’ 283 bp “classical” flanking section 417 SEQ ID NO: 18 truncated flanking region in the RED system: right (Up71) flanking region (144th) = identical to 5’ 144th “classical” flanking section 431 SEQ ID NO: 19 Deleted part in wild type ab4 (Genbank accession number AY665713.1) genomic sequence, nt 127681 - 128482 SEQ ID NO: 20 Deleted portion of the RacH genomic sequences (no nt numbers available,

since the complete genome sequence is unknown)

Plasmid/vector sequences:

SEQ ID NO: 21 Nucleotide sequence plasmids pU-mC70-BGH transfer SEQ ID NO.: 22 Nucleotide sequence of vector pU70-p455-71K71 transfer SEQ ID NO.: 23 Nucleotide sequence plasmids pU70-p455-H3-71K71 transfer SEQ ID NO.: 24 Nucleotide sequence vector pU-l-3-p430-BGHKBGH transfer SEQ ID NO.: 25 Nucleotide sequence plasmids pU 1 -3 -p43 0-H1 av-BGHKBGH transfer

- 27 046215

Hemagglutinin sequences:

SEQ ID NO:26 hemagglutinin [influenza A virus (A/swine/Italy/116114/2O1O(H1N2))] GenBank: ADR01746.1 Hlpdm SEQ ID NO:27 hemagglutinin [influenza A virus (A/swine/Italy/7680/2001 (H3N2))] GenBank: ABS50302.2 H3: SEQ ID NO:28 hemagglutinin [influenza A virus (A/swine/Gent/132/2005(HlNl))] GenBank: AFR76623.1 Hlav: SEQ ID NO:29 hemagglutinin [influenza A virus (A/swine/Italy/4675/2003(HlN2))] GenBank: ADK98476.1* Hlhu

*It should be noted that amino acid 531 (X, stop codon, changed to I by the inventors):

SBV construction sequences:

SEQ ID NO:30 SEQ ID NO: 31 GS linker sequence Synthesized DNA sequence including restriction sites for subcloning SEQ ID NO:32 DNA fragment used for RED recombination to create pRacH-SE-70-455-SBVGc SEQ ID NO:33 SEQ ID NO:34 SEQ ID NO:35 SEQ ID NO:36 SEQ ID NO:37 up70 F primer up71 R primer seq455-Fl primer SBV Gc Fl primer SBV Gc RI primer

Brief description of the figures

The following figures form part of the present description and are included to further demonstrate certain aspects of the present invention. The invention may be better understood with reference to one or more of these figures in combination with a detailed description of the specific embodiments presented in the present invention.

Fig. 1. Schematic illustration of comparison of the orf1/3 regions of EHV-1 wild-type (wt) strain ab4 and the attenuated EHV-1 vaccine strain RacH.

Fig. 2. Schematic representation of the ORF70 insertion site UL = long unique segment US = short unique segment IR = internal inverted repeat TR = terminal inverted repeat gG = glycoprotein G gpII = glycoprotein II orf = open reading frame at = base pairs.

Fig. 3. Plasmid map and nucleotide sequence of transfer plasmid pU-mC70BGH.

Fig. 4. Plasmid map and nucleotide sequence of the transfer vector pU70-p45571K71.

Fig. 5. Plasmid map and nucleotide sequence of the transfer plasmid for insertion of the p455-H3-71 expression cassette into orf70 from EHV-1 RacH.

H3 = open reading frame encoding hemagglutinin H3 influenza A virus.

71pA = new polyA sequence as described in the invention, EM P2016-022.

I-SceI = restriction site for restriction endonuclease I-SceI.

aph promoter = prokaryotic promoter of the kanamycin resistance gene.

Kana = kanamycin resistance gene.

3' end of ORF70 = recombination region downstream of the insertion site.

ORI = plasmid origin of replication.

AP _r = ampicillin resistance gene plasmid.

upstream orf70 = recombination site upstream of the insertion site.

p455 = new p455 promoter.

by = base pairs.

- 28 046215

Fig. 6. Schematic illustration of the rEHV-1 genome RacH-SE-70-p455-H3 with an extended ORF70 insertion site.

orf69: open reading frame number 69 upstream of the insertion site in orf70; p455: new promoter described in the present invention, see for example example 1; H3: influenza virus hemagglutinin transgene; 71pA: new polyadenylation sequence; Aorf70: a residue from orf70 containing the promoter for orf71, which encodes the structural viral glycoprotein II (gpII).

Fig. 7. Indirect immunofluorescence analysis: Indirect immunofluorescence analysis of VERO cells infected with rEHV-1 RacH-SE-70-p455-H3 after 24 h p.i. cells were fixed with ethanol and air dried. Using a commercially available monoclonal antibody to H3 as the primary antibody and FITC-conjugated rabbit anti-mouse IgG as the secondary antibody, H3 was present in cells infected with recombinant EHV-1 RacHSE-70-p455-H3 by fluorescence microscopy.

Fig. 8. Western blotting: Western blotting of cells infected with different passages of rEHV-1 RacH-SE-70-p455-H3 or control rEHV-1 RacH-SE or mock infected. The blot on the left was incubated with the monoclonal antibody Ai2G7, which targets gpII from EHV-1. The replica blot on the right was incubated with commercially available rabbit hyperimmune serum to influenza A hemagglutinin H3 (PA5-34930).

Fig. 9. Virus titers: graphs show viral loads of lung samples from vaccinated or unvaccinated pigs after infection

Inact = commercially available inactivated EHV vaccine = rEHV-1 RacH-SE-70-p455-H3

Fig. 10. Plasmid map and nucleotide sequence of the transfer vector pU-1-3-p430BGHKBGH.

Fig. 11. Plasmid map and nucleotide sequence of the transfer plasmid for insertion of the p430-H1av-BGH expression cassette into orf1/3 from EHV-1 RacH.

H1av = open reading frame encoding hemagglutinin H1 influenza A virus.

BGHpA = bovine growth hormone polyA sequence.

aph promoter = prokaryotic kanamycin-resistant gene promoter.

Kana = kanamycin resistance gene.

Flank B = recombination region downstream of the insertion site.

Flank A = recombination region upstream of the p430 insertion site = new p430 promoter.

by = base pairs.

Fig. 12. Schematic illustration of the rEHV-1 RacH-SE-1/3-p430-H1av genome with an extended orf1/3 insertion site.

Aorf1: remaining open reading frame 1 upstream of the insertion site; p430: new promoter described in the present invention, see for example example 1; H1av: influenza virus hemagglutinin transgene; BGHpA: bovine growth hormone polyadenylation sequence; orf3: open reading frame 3 downstream of the insertion site.

Fig. 13. Western blotting and immunofluorescence of cells infected with rEHV-1 RacH-SE-1/3-p430-H1av showed transgene expression.

H1av = rEHV-1 RacH-SE1/3-p430-H1av

SE = rEHV-RacH-SE (control) mock = uninfected cells (control).

Fig. 14. Schematic illustration of the rEHV-1 RacH-SE-1/3-p430-H1av-70-p455-H3 genome (rEHV-1RacH-SE_B) with two extended insertion sites.

Δοιί 1: the remaining part of open reading frame 1 upstream of the insertion site; p430: new promoter; H1av: influenza virus hemagglutinin transgene; BGHpA: bovine growth hormone polyadenylation sequence; orf3: open reading frame 3 downstream of the insertion site.

orf69: open reading frame 69 upstream of the insertion site in orf70; p455: new promoter; H3: influenza virus hemagglutinin transgene; 71pA: new polyadenylation sequence; ΔοιΉΟ: residue from orf70 containing the promoter for orf71, which encodes the structural viral glycoprotein II (gpII).

Fig. 15. Western blotting: Western blotting of cells infected using rEHV-1 RacH-SE-1/3-p430-Hlav-70-p455-H3 (B), rEHV-1 RacH-SE empty vector (SE), or mock-infected (control). Replica blots were incubated with either commercially available rabbit hyperimmune serum to H3 (H3), commercial rabbit hyperimmune serum (PA 34929) to H1 (H1), or monoclonal antibody Ai2G7 to EHV-1 gpII (gpII).

Fig. 16. Average group body temperatures before and 1, 2 and 3 days after infection. Error bars, standard deviations. From left to right for the study day: negative control group (neg. control), infected control group (control, infection), animals vaccinated once with RacH-SE-70-p455-H3 (1x EHV-1), vaccinated twice using RacH-SE

- 29 046215

70-p455-H3 (2x EHV-1), or twice with swine IAV vaccine (2x killed).

Fig. 17. Average pulmonary parameters for groups one and three days after infection. Error bars, standard deviations. Negative control group (neg. control), infected control group (control, infect.), animals vaccinated once with RacH-SE-70-p455H3 (1x EHV-1), vaccinated twice with RacH-SE- 70-p455-H3 (2x EHV-1), or twice using swine IAV vaccine (2x killed).

Fig. 18. Reciprocal serum neutralization titers (SN) of animal sera against swine IAV H3 strain R452-14, collected on the day of infection. 20, detection limit. Negative control group (neg. control), infected control group (control. infection), animals vaccinated once with RacH-SE-70-p455-H3 (1x EHV-1), vaccinated twice with RacH- SE-70-p455-H3 (2x EHV-1), or twice using swine IAV vaccine (2x killed).

Fig. 19. Results from IL-1 β from BALF collected one or two days after porcine IAV infection. Each spot represents a value defined per animal. Negative control group (Neg. control), infected control group (Infection control), animals vaccinated once with RacH-SE-70-p455-H3 (1x EHV-1), vaccinated twice with RacH- SE-70-p455-H3 (2x EHV-1), or twice with swine IAV vaccine (2x killed).

Fig. 20. Results from IFNY-ELISpots PBMC rechallenged 7 days after the 2nd vaccination. (A), unvaccinated control group; (B), vaccinated twice with inactivated porcine IAV vaccine; (C), vaccinated once with rEHV-1 RacHSE-70-p455-H3; (D) vaccinated twice with rEHV-1 RacH-SE-70-p455-H3. For animals vaccinated only once with rEHV-1 RacH-SE-70-p455-H3, repeated stimulation corresponds to 7 days after the 1st vaccination. Each spot represents the value determined per animal for a given time point and after repeated stimulation with a specific stimulus. For restimulation, recombinantly expressed porcine IAV HA corresponding to the H3 vaccine antigen in rEHV-1 RacH-SE-70-p455-H3 (HAV), recombinantly expressed porcine IAV HA corresponding to the H3 of the infected strain R452-14 (HACH), medium for HAV and NACH dilutions (RPMI), EHV-1 empty vector RacH-SE (EHV-1 empty), vaccine RacH-SE-70-p455H3 (EHV-1-H3), swine IAV H3N2 infected strain R452-14 (H3N2) , cell supernatant from uninfected cells was used to grow R452-14 (MDCK), or recombinantly expressed porcine IAV nucleoprotein (NP) was used.

Fig. 21. Schematic map of the transfer plasmid pU1/3-p430-H1hu-BGHKBGH.

Fig. 22. Schematic map of the transfer plasmid pU70-p455-H1pdm-71K71.

Fig. 23. Linear double-stranded DNA genome rEHV-1 RacH-SE-1/3-p430-H1hu-70-p455-H1pdm (rEHV-1 RacH-SED) with extended orf1/3 and orf70 insertion sites

Fig. 24. Western blots of cells infected with rEHV-1 RacH-SE_B, RacHSED, RacH-SE, or uninfected (control). Replica blots were incubated with either a polyclonal rabbit hyperimmune serum targeting H3 (PA5-34930), a polyclonal rabbit hyperimmune serum targeting H1 (PA5-34929), or a monoclonal antibody (Ai2G7) to EHV-1 glycoprotein II (gpII). All antibodies produced the expected pattern of confirmed expression of the desired H3 and H1 antigens and comparable replication efficiencies of the different viruses, as evidenced by the very similar staining of EHV-1 gpII in all infected cell samples.

Fig. 25. Results of tests for neutralization of influenza virus in mouse sera.

* Error bars indicate standard deviation.

Fig. 26. Map of transfer plasmid pU70-455-SBVGc_71K71.

Fig. 27. A. qRT-PCR results of unvaccinated control cattle (top panel) and animals vaccinated twice with rEHV-SBV-Gc (bottom panel) to detect the SBV viral genome. Individual animals were identified by different types of lines and symbols for each group of unvaccinated and vaccinated animals, respectively. Animal 1 is represented as a black line with black filled circles (corresponding to the black bar in Fig. 27B). Animal 2 is represented as a dotted gray line with gray filled triangles (corresponding to the light gray bar in Fig. 27B). Animal 3 is represented by a dashed black line with empty squares (corresponding to the white bar in Fig. 27B). Animal 4 is represented as a dotted gray line with gray filled diamonds (corresponding to the dark gray bar in Fig. 27B). B) Results of serum neutralization reactions in unvaccinated control cattle (top panel) and animals vaccinated twice with rEHV-SBV-Gc (bottom panel). Individual animals were identified by different bar/fill colors (black to light gray or dark gray to white) for each group of unvaccinated and vaccinated animals, respectively. Animal 1 is represented as a black bar (corresponding to the black line with black filled circles in Fig. 27A). Animal 2 is represented as a light gray pillar

- 30 046215 ka (corresponds to the dotted gray line with gray shaded triangles in Fig. 27A). Animal 3 is represented as a white bar (corresponding to the dashed black line with open squares in Fig. 27A). Animal 4 is represented as a dark gray bar (corresponding to the dotted gray line with gray filled diamonds in Fig. 27A).

Fig. 28. EHV neutralization test. All results obtained from samples of an identical animal in the corresponding group are presented in the same shade of gray: one animal is presented as a black filled bar, another animal is presented as a light gray filled bar, a third animal is presented as a white bar, and the fourth animal is represented as a dark gray column.

Fig. 29. Porcine IAV titer in the lungs, determined as TIS50/g lung tissue for animals killed one day after infection, neg. contr., negative control group; control, infected, infected control group; 2x IM, group vaccinated twice intramuscularly; IN+IM, group vaccinated intranasally for the first time and intramuscularly for the second time; 2X IN, group vaccinated twice intranasally. The points in the graphs indicate the average values obtained for individual animals. The middle horizontal lines indicate group means, respectively. The upper and lower horizontal lines indicate standard deviations, respectively, p values for pairwise statistical comparisons of groups are presented below and calculated by Student's t test using the Mann-Whitney test and GraphPad Prism® for Windows 7.02 software, GraphPad Software, Inc., La Jolla , CA 92037, USA using standard software installations, respectively.

Fig. 30. Titer of porcine IAV in the lungs, determined as TIS50/g lung tissue for animals killed three days after infection. neg. contr., negative control group; counter. infected, infected control group; 2x IM, group vaccinated twice intramuscularly; IN+IM, group vaccinated intranasally for the first time and intramuscularly for the second time; 2X IN, group vaccinated twice intranasally. The points in the graphs indicate the average values obtained for individual animals. The middle horizontal lines indicate group means, respectively. The upper and lower horizontal lines indicate standard deviations, respectively. p values for pairwise statistical comparisons of groups are presented below and calculated using the Student's t test using the Mann-Whitney test and GraphPad Prism® for Windows 7.02 software, GraphPad Software, Inc., La Jolla, CA 92037, USA, using standard software settings , respectively.

Fig. 31. Titer of porcine IAV in the lungs, determined as TIS50/g lung tissue for animals killed five days after infection. neg. contr., negative control group; counter. infected, infected control group; 2x IM, group vaccinated twice intramuscularly; IN+IM, group vaccinated intranasally for the first time and intramuscularly for the second time; 2X IN, group vaccinated twice intranasally. The points in the graphs indicate the average values obtained for individual animals. The middle horizontal lines indicate group means, respectively. The upper and lower horizontal lines indicate standard deviations, respectively. p values for pairwise statistical comparisons of groups are presented below and calculated using the Student's t test using the Mann-Whitney test and GraphPad Prism® for Windows 7.02 software, GraphPad Software, Inc., La Jolla, CA 92037, USA, using standard software settings , respectively.

Fig. 32. Results of a porcine immunoglobulin G (IgG)-specific enzyme-linked immunosorbent assay (ELISA) targeting the recombinantly expressed porcine IAV hemagglutinin antigen H3, which is homologous to the H3 expressed by the rEHV-1 vaccine strain RacH-SE_B. For this test, each well was coated with 100 ng of recombinantly expressed H3. Samples were measured in pairs, sample means were calculated from pairwise measurements, and group values were calculated from sample means, respectively, control. infected, infected control group (served as negative control); 2x IM, group vaccinated twice intramuscularly; IN+IM, group vaccinated intranasally for the first time and intramuscularly for the second time; 2X IN, group vaccinated twice intranasally. Error whiskers indicate standard deviations. Study days (SD) were indicated in the legend on the right side of the graph.

Fig. 33. Results of a porcine immunoglobulin G (IgG)-specific enzyme-linked immunosorbent assay (ELISA) targeting the recombinantly expressed porcine IAV hemagglutinin antigen H3, which is homologous to the H3 expressed by the rEHV1 RacH-SE_B vaccine strain. For this test, each well was coated with 100 ng of recombinantly expressed H3. Samples were measured in pairs, sample means were calculated from pairwise measurements, and group values were calculated from sample means, respectively. counter. infected, infected control group (served as negative control); 2x IM, group vaccinated twice intramuscularly; IN+IM, group vaccinated for the first time intra

- 31 046215 nasally and a second time intramuscularly; 2X IN, group vaccinated twice intranasally. Error whiskers indicate standard deviations. Study days (SD) were indicated in the legend on the right side of the graph.

Fig. 34. Results of gamma interferon specific immunospot spot method (IFNy ELISpot). Peripheral blood mononuclear cells (PBMCs) were purified from blood collected from study animals on study day 28 (SD28). PBMC were then restimulated with either the H3N2 swine IAV challenge strain R452-14 at a multiplicity of infection of 1 (H3N2 MOI 1) or with a recombinantly expressed swine IAV H3 antigen, which is homologous to the H3 expressed by the rEHV-1 vaccine strain RacH-SE_B at concentration 1 µg/ml (rH3 1 µg/ml). Using re-stimulated PBMCs, the interferon-gamma specific immunospot spot (IFNy ELISpot) method was performed and the results obtained were normalized to 10 6 cells and calculated as means per group, respectively, control. infected, infected control group (served as negative control); 2x IM, group vaccinated twice intramuscularly; IN+IM, group vaccinated intranasally for the first time and intramuscularly for the second time; 2X IN, group vaccinated twice intranasally. Error whiskers indicate standard deviations.

Fig. 35. Results of gamma interferon specific enzyme immunospot spot method (IFNy ELISpot). Peripheral blood mononuclear cells (PBMCs) were purified from blood collected from study animals on study day 28 (SD28). PBMCs were then restimulated with either the H3N2 swine IAV challenge strain R452-14 at a multiplicity of infection of 1 (H3N2 MOI 1) or with a recombinantly expressed swine IAV H3 antigen that is homologous to the H3 expressed by the rEHV-1 vaccine strain RacH-SE_B at concentration 1 µg/ml (rH3 1 µg/ml). Using re-stimulated PBMCs, the interferon-gamma specific immunospot spot (IFNy ELISpot) method was performed and the results obtained were normalized to 10 6 cells and calculated as means per group, respectively, control. infected, infected control group (served as negative control); 2x IM, group vaccinated twice intramuscularly; IN+IM, group vaccinated intranasally for the first time and intramuscularly for the second time; 2X IN, group vaccinated twice intranasally. Error whiskers indicate standard deviations.

Examples

The following examples are included to demonstrate preferred embodiments of the invention. Those skilled in the art will appreciate that the methods disclosed in the examples represent methods disclosed by the inventors for the normal practice of the present invention, and thus may be considered preferred methods for its practice. However, it will be apparent to those skilled in the art in light of the present disclosure that many changes can be made to the specific embodiments disclosed and still achieve a similar or similar result without departing from the spirit and scope of the present invention.

Example 1.

Establishing a new ORF70 insertion site.

To increase the capabilities of the EHV-1 vector, the inventors discovered a way to express two different transgenes from a single vector backbone without linking the two transgenes using RNA virus-derived functions under the control of a single promoter. The inventors hypothesized that the herpes virus genome would be tolerant of the use of two independent transgene insertion sites in parallel. To determine whether EHV-1 ORF70 was a suitable transgene insertion site, 801 bp at the 5' end of orf70 (bp 1236) was replaced with an expression cassette encoding autofluorescent mCherry protein (Shaner et al. 2004) using classical homologous recombination (Fig. .2). A map of plasmid pU-mC70-BGH is shown in Fig. 3 (SEQUENCE ID NO.21). The DNA fragment used for homologous recombination was excised from pU-mC70-BGH using XbaI. The gel-purified fragment was co-transfected with viral genomic DNA from EHV-1 RacH into RK13 cells. Efficient release of the recombinant vector virus and efficient replication in cultured cells were demonstrated using live fluorescence and virus titrations (not shown). Deletion of two-thirds of orf70 had the additional benefit that expression of glycoprotein G, encoded by orf70, was abolished. Glycoprotein G from EHV-1 has been shown to be a nonstructural, secreted chemokine-binding protein that antagonizes the host immune response (Drummer et al., 1998; Bryant et al., 2003). Since the vector vaccine is intended to stimulate an immune response to the vaccine, removal of this particular immunosuppressive function of the viral vector should further improve the platform of functioning of the EHV-1 RacH-SE viral vector.

Example 2.

Application of a new ORF70 insertion site with the p455 promoter in the recombinant EHV-1 vector

- 32 046215 vaccines and construction of a recombinant p455 promoter virus.

For the first experimental animal, influenza subtype H3 hemagglutinin from swine influenza A virus (A/swine/Italy/7680/2001(H3N2), GenBank accession number: ABS50302.2) was used. Its coding sequence was synthesized and subcloned into the transfer vector pU70-p45571K71 (Fig. 4, SEQ ID NO. 22), creating the transfer plasmid pU70-p455-H3-71K71, placing H3 under the control of the new p455 promoter and the new 71pA polyadenylation signal and inserting into frame cassette with recombination sites for insertion into orf70 (Fig. 5, SEQ ID NO. 23).

By en-passant mutagenesis using the RED recombination system (Tischer et al. 2006), the p455-H3-71 expression cassette was inserted into orf70 from pRacH-SE to generate pRacH-SE70-p455-H3 (Fig. 6).

PK/WRL cells were transfected with pRacH-SE70-p455-H3, and the recombinant virus rEHV1 RacH-SE70-p455-H3 was released and plaque purified twice. The correct insertion of the expression cassette was confirmed by sequencing the product of the insertion site using high-fidelity PCR with corrective exonuclease activity. Transgene expression in infected cells was analyzed by indirect immunofluorescence assay (ELISA, Fig. 7).

Reconstitution of orf71, encoding EHV-1 gpII, was confirmed by ELISA (not shown) and Western blotting (Fig. 8) using monoclonal antibody Ai2G7 (owned by BI). The appearance of H3 trimers on the plasma membrane of infected cells was analyzed by hemadsorption reaction using chicken erythrocytes (not shown). Peak titers, measured as _TIR50 /ml in PK/WRL cells, were in the same range as those of the parental rEHV-1 RacH-SE virus, indicating that transgene expression does not have a negative effect on viral replication (not shown). This was confirmed by passivation of rEHV-1 RacH-SE70-p455H3 in PK/WRL cells up to passage 20 (P20) after release. In passages P5, P10, P15, and P20, the virus was characterized by titration, sequencing and Western blotting (Fig. 8), in P10 and P20 additionally by ELISA, and the HA expression and genetic stability of the insert, which encodes HA together with the promoter and polyA sequences.

The two blots shown in Fig. 8 are replicates that were incubated with either the monoclonal antibody Ai2G7 (left), which specifically detects EHV-1 glycoprotein II (gpII) or, or with a commercially available polyclonal rabbit antibody (PA5-34930), which is raised against the influenza H3 subtype hemagglutinin ( right), gpII was detected in all cell cultures infected with recombinant EHV-1, as expected. Full-length H3 was detected in all cells infected with different passages of rEHV-1 RacH-SE-70-p455-H3, as expected. The specificity of the antiserum to H3 is shown in the same Western blot, see lane gG430mC. In this case, only the gpII monoclonal antibody produces a reaction as expected, while the anti-H3 antibody does not bind in the corresponding replica lane.

By dual immunofluorescence assay (dIFA) of viral plaques in cells infected with P20, using anti-H3 monoclonal antibody and horse anti-EHV serum, it was confirmed that virtually all EHV-1-induced plaques also express H3 (not shown). All tests confirmed the stability of recombinant EHV-1 RacH-SE-70-p455-H3.

Example 3.

Proof of concept animal study (POC I) using a new ORF7O insertion site and assessing serological response:

tested animals: inclusion criteria and experimental design:

Five groups of ten piglets born to sows that had never been infected with influenza A virus were included in the POC-I study, as summarized in Table 1. 2.

- 33 046215

table 2

Group Vaccine treatment Number of animals Route of administration Dose 1 IxNaCl; lx EHV1 vector vaccine 10 i/m 2 ml NaCl; 2 ml EHV1, 1.00 x 10 ⁷ tssh ₅₀ 2 2x EHVI vector vaccine 10 i/m 2x 2 ml EHV1, 1.00 X 10 ⁷ tssh ₅₀ 3 2x NaCl 10 i/m 2x 2 ml NaCl 4 2x inactivated vaccine 10 i/m 2x 2 ml IDT 5 2x NaCl 10 i/m 2x 2 ml NaCl Group Infection Number of animals Route of administration Dose 1 H3N2 INFLUENZA VIRUS FROM PIGS 10 Intratracheal 8 ml; 1.00 x 10 ⁷ TSH ₅₀ /ml 2 H3N2 INFLUENZA VIRUS FROM PIGS 10 Intratracheal 8 ml; 1.00 x 10 ⁷ TSH ₅₀ /ml 3 H3N2 INFLUENZA VIRUS FROM PIGS 10 Intratracheal 8 ml; 1.00 x 10 ⁷ TSH ₅₀ /ml 4 H3N2 INFLUENZA VIRUS FROM PIGS 10 Intratracheal 8 ml; 1.00 x 10 ⁷ TSH ₅₀ /ml 5 culture medium (Negative control) 10 Intratracheal 8 ml

An infectious dose of 1x10 ⁷ TCID50 rEHV-1 RacH-70-p455-H3 (EHV-1) was administered either once at five weeks of age or twice at two and five weeks of age. For comparison, a commercially available inactivated vaccine was administered twice at two and five weeks of age. All piglets did not have maternal antibodies, so as not to eliminate the effect of the inactivated vaccine (inact). Two groups were not vaccinated but received injections of saline sodium chloride (NaCl) and served as challenge controls or strict negative controls, respectively. 21 days after the second vaccination, all groups except the strict negative control group were challenged with 1 x ^{10 7} TCID ₅₀ heterologous influenza A virus strain (IVA) (H3N2 SWINE INFLUENZA VIRUS R452-14, challenge isolate owned by BI ). While all pigs in the unvaccinated challenged control group (control, challenge) had high titers of influenza virus in their lungs one and three days after challenge, all pigs in the strict negative control group (negative control) and the group, who were vaccinated twice (EHV 2x) with rEHV-1 RacH-SE-70-p455-H3 were IVA negative on both days. In the group vaccinated twice with the inactivated control vaccine (inact. 2x), one out of five animals had a low IVA titer on the third day after infection. In the group vaccinated once (EHV 1x), 21 days before challenge with rEHV-1 RacH-SE-70-455-H3, two of five animals had low IVA titers in their lungs one day after challenge and one of five animals three days after infection (Fig. 9).

Two vaccinations using 1x10 ⁷ TCID50 of rEHV-1 RacH-SE-70-p455-H3 completely protected pigs from challenge using heterologous IVA, subtype H3N2.

It was demonstrated that the EHV-1 vector RacH-SE is suitable for vaccination of pigs and that the novel p455 promoter is functional to regulate the immunogenic expression of hemagglutinin IVA in vaccinated pigs.

Example 4.

Application of a new p430 promoter in a recombinant EHV-1 vaccine vector and construction of a recombinant p430 promoter virus:

the newly identified p430 promoter was used to drive the expression of another H1N1 hemagglutinin from the influenza virus ((A/swine/Gent/132/2005(HlNl), GenBank accession no.: AFR76623.1). Because the hemagglutinin gene in this virus isolate was of IAV origin birds, it was designated H1av.H1av was synthesized and subcloned into a transfer vector for the orf1/3 insertion site (FIG. 10, SEQ ID NO. 24) to produce pU1/3-p430-H1av-BGH_K_BGH (FIG. 11, SEQ

- 34 046215

ID NO. 25). H1av expression was placed under the control of the p430 promoter and the bovine growth hormone (BGH) polyA signal.

By en-passant mutagenesis using the RED recombination system (Tischer et al. 2006), the p430-H1av-BGH expression cassette was inserted into orf1/3 from pRacH-SE to generate pRacH-SE1/3p430-H1av (Fig. 12).

PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av, and the recombinant rEHV-1 virus RacH-SE1/3-p430-H1av was released and plaque purified twice. The correct insertion of the expression cassette was confirmed by sequencing the product of the insertion site using high-fidelity PCR with corrective exonuclease activity. Transgene expression in infected cells was analyzed by indirect immunofluorescence assay (IFA) and Western blotting using commercially available monoclonal and polyclonal antibodies (Fig. 13).

Reconstitution of orf71, encoding EHV-1 gpII, was confirmed by ELISA and Western blotting using the monoclonal antibody Ai2G7 (owned by BI) (not shown). Proper processing and transport of H1av and localization to the plasma membrane of infected cells was analyzed by a hemadsorption reaction using chicken erythrocytes (not shown). Peak titers, measured as TIR50/ml in PK/WRL cells, were in the same range as those of the parental RacH-SE virus, indicating that transgene expression does not negatively affect viral replication (not shown) .

The specific detection of a broad band migrating at 75 kDa by antibody PA34929 is consistent with the expected appearance of a recombinant HA glycoprotein as predicted from its sequence. Visible staining of cell membranes with monoclonal antibody C102 corresponds to subcellular localization, as expected (Fig. 13).

To test whether the expressed recombinant hemagglutinins would be processed and transported as expected, VERO cells were infected with rEHV-1 RacH-SE-1/3p430-H1av, rEHV-1 RacH-SE-70-p455-H3, rEHV- 1 RacH-SE (parent) at a multiplicity of infection of 0.01, or remained uninfected. After 24 hours p.i. live infected and uninfected cells were incubated with a suspension of chicken red blood cells in PBS, washed with PBS, and stained with fluorescent Hoechst 33342 to stain nuclei. Because avian red blood cells contain cell nuclei, they can be stained with Hoechst33342 and appear as miniature blue spots under fluorescence microscopy. Compared to cells that were infected using rEHV-1 RacH-SE, which do not express hemagglutinin, red blood cell adsorption chickens was significantly increased for cells infected with either rEHV-1 RacH-SE1/3-p430-H1av or rEHV-1 RacH-SE-70-p455-H3 (not shown). Based on this, it can be concluded that hemagglutinins were translated, processed and transported to the plasma membrane of cells infected with the vector virus in the same way as if they were produced by authentic infection with influenza virus.

The distinct hemadsorption phenotype of infected cells confirms the results of Western blot and immunofluorescence assays, which show efficient expression of transgenic proteins and suggest the formation of functional HA trimers on the cell surface of cells infected with the EHV-1 vector.

Example 5.

Application of the new ORF70 insertion site and ORF1/3 insertion site in vaccines based on the recombinant EHV-1 vector in parallel.

To demonstrate that the two new promoters can be used in parallel, recombinant EHV-1 RacH was generated expressing two different hemagglutinins from two different influenza A virus subtypes.

The specificity and lack of cross-reactivity of polyclonal commercially available antibodies to H3 (PA5-34930) and H1 (PA5-34929) were confirmed using Western blots of infected cells infected with singly inserted viruses rEHV-1 RacH-SE-70-p455-H3 and rEHV- 1 RacH-SE-1/3-p430-H1av (not shown).

An open reading frame encoding the hemagglutinin of the influenza A virus (A/swine/Gent/132/2005(H1N1)) was synthesized and cloned into the transfer vector pU1-3-p430-BGHKBGH (Fig. 10), which ensured the production of pU1-3- p430-H1av-BGHKBGH (Fig. 11). Using the recombinant BAC pRacH-SE-70-p455-H3 as a starting point, the p430-H1av-BGH expression cassette, which was assembled into pU1/3-p430-H1av-BGHKBGH (Fig. 11, SEQ ID NO. 25), was inserted into orf1/3 insertion site by two-step RED recombination to produce pRacH-SE-1/3-p430-H1av-70-p455-H3. PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av-70-p455-H3, and the recombinant rEHV-1 virus RacH-SE1/3-p430-H1av-70-p455-H3 was released and purified twice plaques (Fig. 12).

The short name for this recombinant virus is rEHV-1 RacH-SE_B. The correctness of the insertion of the expression cassette was confirmed by sequencing the high-precision PCR products with corrective exonuclease activity of the insertion sites along with the flanking sequences

- 35 046215 relations. Transgene expression in infected cells was analyzed by indirect immunofluorescence assay (IFA, not shown) and Western blotting using commercially available monoclonal and polyclonal antibodies (Fig. 13). Reconstitution of orf71, encoding EHV-1 gpII, was confirmed by ELISA (not shown) and Western blotting using monoclonal antibody Ai2G7 (owned by BI) (Fig. 13).

As shown in FIG. 13, both H3 and H1av transgenes were expressed in parallel in cell cultures infected with the double recombinant rEHV-1 insert RacH-SE-1/3-p430-H1av-70p455-H3 (B). Transgene expression was stable and did not impair viral titers tested to passage 11 in PK/WRL cells (not shown).

Two novel promoters, p430 and p455, were shown to be functional in the context of rEHV1-RacH replication in cell cultures. Activity levels during the viral replication cycle appeared to be very similar, as inferred from in vitro promoter kinetics studies. These properties provide the opportunity to create recombinant vector vaccines based on EHV1 RacH or other vector platforms expressing two different antigens in parallel with similar efficacy. If the target vaccine consists of two different pathogens, then the use of two new promoters at two insertion sites in combination with two polyadenylation sequences can significantly reduce the cost of goods and represents a clear advantage over a vector expressing only one antigenic component.

Example 6.

Development, IN VITRO characterization and IN VIVO testing of a monovalent vaccine against swine influenza A virus based on the EHV-1 vector (H3 vaccine).

Hemagglutinin of swine influenza virus IAV serotype H3 (SEQ ID NO 27) (A/swine/Italy/7680/2001(H3N2), GenBank accession number: ABS50302.2) was selected as the antigen for the vaccination study in pigs. This new porcine IAV vaccine provides the hallmark of DIVA, for example, the detection of antibodies to porcine IAV NP or NA proteins in animals that have been infected with field strains of porcine IAV, but not in animals vaccinated only with the vaccine described in the present invention, since it expresses only one HA protein from porcine IAV. Its coding sequence was synthesized and subcloned to obtain the transfer vector pU70-p455-H3-71K71, placing H3 under the control of the new p455 promoter and the new 71pA polyadenylation signal and inserting a cassette with recombination sites in frame for insertion into orf70 (Fig. 2).

By en-passant mutagenesis using the RED recombination system, the p455-H3-71 expression cassette was inserted into orf70 from pRacH-SE to generate pRacH-SE70-p455-H3 (Fig. 6).

PK/WRL cells were transfected with pRacH-SE70-p455-H3, and the recombinant virus rEHV1 RacH-SE70-p455-H3 was released and plaque purified twice.

The correct insertion of the expression cassette was confirmed by sequencing the product of the insertion site using high-fidelity PCR with corrective exonuclease activity. Transgene expression in infected cells was analyzed by indirect immunofluorescence assay (IFA, Fig. 7) and Western blotting (Fig. 8) using commercially available monoclonal and polyclonal antibodies.

Reconstitution of orf71, encoding EHV-1 gpII, was confirmed by ELISA (not shown) and Western blotting (Fig. 8) using monoclonal antibody Ai2G7 (owned by BI). The appearance of H3 trimers on the plasma membrane of infected cells was analyzed by hemadsorption reaction using chicken erythrocytes (not shown). Peak titers, measured as _TIR50 /ml in PK/WRL cells, were in the same range as those of the parental RacH-SE virus, indicating that transgene expression does not have a negative effect on viral replication (not shown ). This was confirmed by passivation of rEHV-1 RacH-SE70-p455-H3 in PK/WRL cells up to passage 20 (P20) after release. In passages P5, P10, P15, and P20, the virus was characterized by titration, sequencing and Western blotting (Fig. 8), in P10 and P20 additionally by ELISA, and the HA expression and genetic stability of the insert, which encodes HA together with the promoter and polyA sequences.

The two blots shown in Fig. 9 are replicates that were incubated with either the monoclonal antibody Ai2G7 (left), which specifically detects EHV-1 glycoprotein II (gpII) or, or with a commercially available polyclonal rabbit antibody (PA5-34930), which is raised against the influenza H3 subtype hemagglutinin ( right), gpII was detected in all cell cultures infected with recombinant EHV-1, as expected. Full-length H3 was detected in all cells infected with different passages of rEHV-1 RacH-SE-70-p455-H3, as expected. The specificity of the H3 antiserum was also demonstrated by Western blots of cells infected with other recombinant EHV-1 RacH-SEs expressing influenza hemagglutinins from the H1 subtypes of viruses, see below, FIG. 15.

By dual immunofluorescence analysis (dIFA) of viral plaques in cells infected with P20, using anti-H3 monoclonal antibody and horse anti-EHV serum, it was confirmed that virtually all EHV-1-induced plaques also express

- 36 046215

H3 (not shown). All tests confirmed the stability of recombinant EHV-1 RacH-SE-70-p455-H3.

To investigate its properties as a vector vaccine in young piglets, rEHV-1 RacH-SE70-p455-H3 was tested in a vaccination-challenge study. In more detail, piglets without maternal immunity to porcine IAV (without maternal antibodies) were vaccinated twice using cell culture supernatant containing RacH-SE-70-p455-H3 at a dose of 1x 10 ⁷ TCID50 intramuscularly at two and five weeks of age (two-time vaccination , 2x EHV-1), or only at five weeks of age (single vaccination, 1x EHV-1). The unvaccinated group served as a negative control, and the group of animals vaccinated at two and five weeks of age with a commercially available inactivated swine IAV vaccine according to the manufacturer's instructions (but at the vaccination time points) served as a positive control (killed). At 8 weeks of age, all animals, but not the negative control, were challenged intratracheally with 1 x ¹⁰⁷ TCID50 H3N2 porcine challenge strain IAV (European field virus isolate R452-14, whose H3 is heterologous to the H3 vaccine antigen used in RacH-14). SE-70-p455-H3). Unvaccinated and unchallenged animals served as negative controls, while unvaccinated but infected animals served as challenge controls. During and after vaccination, as well as before and after infection, body temperature was measured and blood samples were collected at various points in time. One day after infection, half the animals per group were killed and the lungs were assessed for the presence of lesions typical of porcine IAV infection, three lung samples of the left and right lung were collected from each animal, respectively, to determine infectious titers of porcine IAV in lung homogenates, and bronchoalveolar lavage fluid (BALF) samples were collected. A similar procedure was carried out with the remaining half of the animals per group three days after infection.

In a study of the increase in body temperature following IAV challenge in pigs, unvaccinated animals showed an increase in body temperature of approximately 1°C 1 day after challenge. This increase in body temperature 1 day after challenge was prevented for the group of animals vaccinated twice with the RacH-SE-70-p455-H3 vaccine (Fig. 16).

Evaluation of lung parameters in animals slaughtered 1 or 3 days after swine IAV infection found that the negative control did not exhibit lung lesions typical of swine IAV infection, the challenge control showed an average lung lesion rate in the range of 6-7%, and that relative to group averages, lung injury rates were significantly reduced from one to 4% for the group of animals vaccinated twice with the RacH-SE-70-p455H3 vaccine (Fig. 17).

Mean porcine IAV titers in the lungs of animals slaughtered 1 or 3 days after porcine IAV challenge showed that the negative control did not detect porcine IAV in the lung samples, while the challenge control showed viral titers per g of lung tissue ranging from greater than 5 (day 3) to greater than 7 log (day 1). In stark contrast, group means were greatly reduced to approximately two logs or less for the group vaccinated once with the RacH-SE-70-p455-H3 vaccine, and reduced to undetectable levels for the group vaccinated twice with RacH -SE-70-p455-H3 vaccine (Fig. 9).

When testing the induction of neutralizing antibodies by IAV pigs following vaccination, sera from animals vaccinated once with the RacH-SE-70-p455-H3 vaccine exhibited reciprocal neutralization titers in the range of approximately 160 three weeks after the first vaccination, and sera from animals vaccinated twice. times using the RacH-SE-70-p455-H3 vaccine exhibited neutralizing titers of approximately 2560 three weeks after the second vaccination, while sera from the unvaccinated groups had no detectable levels of neutralizing antibodies to porcine IAV (FIG. 18).

When quantifying the pro-inflammatory cytokine IL-1β in BALF from animals 1 or 3 days after IAV infection in pigs, IL-1e levels greater than 100 pg/ml up to 900 pg/ml were detected in three of four animals tested on day 1 , while these levels were reduced to 100-300 pg/ml IL-1e for BALF from animals vaccinated once with the RacH-SE-70p455-H3 vaccine, and even further reduced to levels of 0 to less than 100 pg /ml IL-1e for all animals vaccinated twice with the RacH-SE-70-p455-H3 vaccine (Fig. 19). This indicates that vaccination with the RacH-SE-70-p455-H3 vaccine effectively prevented the induction of the proinflammatory cytokine IL-1e following IAV infection in pigs.

When testing repeated stimulation of peripheral blood mononuclear cells (PBMCs) collected on study day 28 and using different stimuli, stimulated PBMCs from unvaccinated animals showed less than 75/1x 10 ⁶ units in the IFNY-ELISpot regardless of the stimuli used (Fig. 20A ). PBMCs obtained from animals that received the inactivated vaccine twice (killed) showed approximately 150/1 x 10 ⁶ units when they were restimulated with recombinant porcine IAV nucleoprotein NP and approximately 3000/1 x 10 ⁶ units when

- 37 046215

IFNY-ELISpot when they were restimulated with H3N2 infected porcine IAV strain R452-14, but did not detect re-stimulation of PBMCs (levels of 75/1 x 10 ⁶ units or less) when using recombinant HA swine IAV or EHV-1 viruses (Fig. 20B ). In contrast, animals vaccinated once or twice with the RacH-SE-70-p455-H3 vaccine also exhibited approximately 200 (1x EHV-1) to 300 (2x EHV-1)/1x10 ⁶ units of IFNY- ELISpot when they were restimulated with H3N2 infected porcine IAV strain R452-14, but did not demonstrate restimulation of PBMCs (levels of 75/1x 10 ⁶ units or lower) when using recombinant porcine IAV NP (Fig. 20C and D). When EHV-1 viruses were used for restimulation, animals vaccinated once or twice with the RacH-SE-70-p455-H3 vaccine showed approximately 300/1 x 10 ⁶ units in the IFNY-ELISpot when they were restimulated using the empty EHV-1 vaccine RacH-SE, and this value was further increased to more than 400/1x10 ⁶ units using the RacH-SE-70-p455-H3 vaccine expressing porcine H3 IAV, respectively (Fig. 20C and D ). Thus, if recombinant porcine IAV HA was used for booster stimulation, only animals vaccinated once or twice with RacH-SE-70-p455H3 vaccine exhibited approximately 100-150 (1xEHV-1) to 150-200 (2x EHV- 1)/1x10 ⁶ units in IFNY-ELISpot (Fig. 20C and D).

Example 7.

Creation. IN VITRO characterization and IN VIVO testing of a tetravalent EHV-1 influenza A virus vector vaccine in pigs.

As described below, in the present invention, the four above-described porcine IAV hemagglutinin (HA) antigens, derived from the avian H1N2, H3N2, H1N1, and H1N1 pandemic sub-/serotypes of porcine IAV, were expressed by two recombinant viruses based on the EHV-1 vector. This new tetravalent porcine IAV vaccine provides DIVA signature, for example, by detecting antibodies against porcine IAV NP or NA proteins in animals that have been infected with field strains of porcine IAV, but not in animals vaccinated with the vaccine described in the present invention, since only it expresses porcine IAV HA proteins.

A new tetravalent porcine IAV vaccine was characterized in vitro and tested in vivo to determine its effectiveness against porcine IAV.

The newly identified p430 promoter was used to drive the expression of porcine H1N1 IAV ((A/swine/Gent/132/2005(H1N1), GenBank accession number: AFR76623.1). Since the hemagglutinin gene in this virus isolate was of avian IAV origin, it was designated H1av. H1av was synthesized and subcloned into a transfer vector for the orf1/3 insertion site to produce pU1/3p430-H1av-BGH_K_BGH. H1av expression was placed under the control of the p430 promoter and the bovine growth hormone (BGH) polyA signal and inserted in frame with the recombinant sites for insertion into orf1/3 (FIG. 11, SEQ ID NO. 25).

By en-passant mutagenesis using the RED recombination system, the p430-H1av-BGH expression cassette was inserted into orf1/3 pRacH-SE to generate pRacH-SE1/3-p430-H1av FIG. 12). PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av, and the recombinant rEHV-1 virus RacHSE1/3-p430-H1av was released and plaque purified twice. The correct insertion of the expression cassette was confirmed by sequencing the product of the insertion site using high-fidelity PCR with corrective exonuclease activity. Transgene expression in infected cells was analyzed by indirect immunofluorescence assay (IFA) and Western blotting using commercially available monoclonal and polyclonal antibodies (Fig. 13). Reconstitution of orf71, encoding EHV-1 gpII, was confirmed by ELISA and Western blotting using monoclonal antibody Ai2G7 (owned by BI) (not shown). Proper processing and transport of H1av and localization to the plasma membrane of infected cells were analyzed by hemadsorption reaction using chicken erythrocytes (not shown). Peak titers, measured as TIR50/ml in PK/WRL cells, were in the same range as those of the parental RacH-SE virus, indicating that transgene expression does not negatively affect viral replication (not shown) .

The specific detection of a broad band migrating at 75 kDa by antibody PA34929 is consistent with the expected appearance of a recombinant HA glycoprotein as predicted from its sequence. Visible staining of cell membranes with monoclonal antibody C102 corresponds to subcellular localization, as expected.

To test whether the expressed recombinant hemagglutinins would be processed and transported as expected, VERO cells were infected with rEHV-1 RacH-SE-1/3p430-H1av, rEHV-1 RacH-SE-70-p455-H3, rEHV- 1 RacH-SE (parent) at a multiplicity of infection of 0.01, or remained uninfected. After 24 hours p.i. live infected and uninfected cells were incubated with a suspension of chicken red blood cells in PBS, washed with PBS, and stained with fluorescent Hoechst 33342 to stain nuclei. Since avian red blood cells contain cell nuclei, they can be stained with Hoechst33342 and appear as miniature

- 38 046215 blue spots by fluorescence microscopy, compared to cells that were infected with rEHV-1 RacH-SE that do not express hemagglutinin, chicken erythrocyte adsorption was significantly increased for cells infected with either rEHV-1 RacH-SE1 /3-p430-H1av or rEHV-1 RacH-SE-70-p455-H3 (not shown). Based on this, it can be concluded that the hemagglutinins were translated, processed and transported to the plasma membrane of cells infected with the vector virus in the same way as if they were produced by an authentic replication of the influenza virus.

The hemadsorption phenotype of infected cells confirms the results of Western blots and immunofluorescence assays (for H1av, Fig. 13), which show efficient expression of transgenic proteins and suggest the formation of functional HA trimers on the cell surface of cells infected with the EHV-1 vector.

The specificity and lack of cross-reactivity of polyclonal commercially available antibodies to H3 (PA5-34930) and H1 (PA5-34929) were confirmed using Western blots of infected cells infected with singly inserted viruses rEHV-1 RacH-SE-70-p455-H3 and rEHV- 1 RacH-SE-1/3-p430-H1av (not shown).

Next, recombinant EHV-1 RacH-SE was generated expressing two different hemagglutinins from two different sub-/serotypes of the A virus.

Using the recombinant BAC pRacH-SE-70-p455-H3 as a starting point, the expression cassette p430-H1av-BGH, which was assembled in the transfer vector pU1/3-p430-H1av-BGH_K_BGH (Fig. 12), was inserted into the orf1/3 site insertion by two-step RED recombination to produce pRacH-SE1/3-p430-H1av-70-p455-H3. PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av-70p455-H3, and the recombinant rEHV-1 virus RacH-SE1/3-p430-H1av-70-p455-H3 was released and plaque purified two times. The short name for this recombinant virus is rEHV-1 RacH-SEB (Fig. 14). The correctness of the insertion of the expression cassette was confirmed by sequencing the high-precision PCR products with corrective exonuclease activity of the insertion sites along with the flanking sequences.

Transgene expression in infected cells was analyzed by indirect immunofluorescence assay (IFA, not shown) and Western blotting using commercially available monoclonal and polyclonal antibodies (Fig. 15). Reconstitution of orf71, encoding EHV-1 gpII, was confirmed by ELISA (not shown) and Western blotting using the monoclonal antibody Ai2G7 (owned by BI) (Fig. 15).

Both H3 and H1av transgenes were expressed in parallel in cell cultures infected with the double recombinant rEHV-1 RacH-SE_B insert. Transgene expression was stable and did not impair viral titers tested to passage 11 in PK/WRL cells.

An improved EHV-1 vector with two insertion sites and two new promoters was shown to express two influenza virus hemagglutinins in parallel. Subcellular localization, as determined by ELISA, and mobility in SDS-PAGE, as determined by Western blotting, were consistent with authentic hemagglutinins that are expressed in influenza A virus-infected cells known from the literature.

Thereafter, a second double insertion rEHV-1 RacH expressing the hemagglutinins H1hu, SEQ ID NO: 29, (A/swine/Italy/4675/2003(H1N2); GenBank accession no. ADK98476.1) and H1pdm, SEQ ID NO: 26, (A/swine/Italy/116114/2010(H1N2); GenBank accession no. ADR01746.1).

The H1hu coding sequence was synthesized and subcloned into a transfer vector for the orf1/3 insertion site to generate pU1/3-p430-H1hu-BGHKBGH. H1hu expression was placed under the control of the p430 promoter and the bovine growth hormone (BGH) polyA signal and framed with recombinant insertion sites in orf1/3 (FIG. 21).

The H1pdm coding sequence was synthesized and subcloned to produce the transfer vector pU70-p455-H1pdm-71K71, placing H1pdm under the control of a new p455 promoter and a new 71pA polyadenylation signal and inserting a recombination site cassette in frame for insertion into orf70 (Fig. 22).

Thereafter, the p430-H1av-BGH and p455-H1pdm-71 expression cassettes were inserted into pRacH-SE by en-passant mutagenesis using the RED recombination system, first generating pRacH-SE-1/3p430-H1hu. Using this modified BAC as a target, p455-H1pdm-71 was inserted by en-passant mutagenesis using the RED recombination system, yielding pRacH-SE-1/3-p430H1hu-70-p455-H1pdm. pRacH-SE-1/3-p430-H1hu-70-p455-H1pdm was transfected into PK/WRL cells and rEHV-1 RacH-SE-1/3-p430-H1hu-70-p455-H1pdm was released and purified three times with plaques. The short designation for the new recombinant vector virus is rEHV-1 RacH-SE_D (Fig. 23).

Expression of transgenes in infected cells was analyzed by indirect immunofluorescence assay (IFA, not shown) and Western blotting using commercially available monoclonal and polyclonal antibodies (Fig. 24). Reconstitution of orf71, encoding EHV-1 gpII, was confirmed by ELISA (not shown) and Western blotting using a monoclonal antibody

- 39 046215

Ai2G7 (owned by BI), (Fig. 24).

The genetic and phenotypic stability of recombinant rEHV-1 was demonstrated by passivation in cell culture, determining virus titers every 5 passages. The sequences of the insertion sites were confirmed every ten passages, as well as the expression of the transgene using Western blotting (not shown). Expression accuracy was assessed by double plaque ELISA under the methylcellulose top ball, counting plaques stained with anti-EHV antibodies and transgene-specific antibodies (not shown).

To investigate its properties as a vector vaccine in young piglets, a tetravalent porcine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D was tested in a vaccination-challenge study. In more detail, piglets with maternal immunity to swine IAV (positive for maternal antibodies) were vaccinated twice with rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D at a dose of 1x 10 ⁷ TCID50 per vaccine strain intramuscularly at one and four weeks of age. (double vaccination, 2x EHV-1) or only at four weeks of age (single vaccination, 1x EHV-1). The unvaccinated group served as a negative control. At 11 weeks of age, all animals except the negative control were challenged intratracheally with 1 x ¹⁰⁶ TCID50 H3N2 porcine challenge strain IAV (European field virus isolate R452-14, the H3 of which is heterologous to the H3 vaccine antigen used in rEHV-1 RacH-SE_B). Unvaccinated and unchallenged animals served as negative controls, while unvaccinated but infected animals served as challenge controls. During and after vaccination, as well as before and after infection, body temperature was measured and blood samples were collected at various points in time. One day after infection, half the animals in the group were killed and the lungs were assessed for the presence of lesions typical of porcine IAV infection, three lung samples of the left and right lung were collected from each animal, respectively, to determine infectious titers of porcine IAV in lung homogenates, and bronchoalveolar lavage fluid (BALF) samples. A similar procedure was carried out with the remaining half of the animals per group three days after infection. Sample material and collected data were analyzed to determine, inter alia, changes in body temperature after infection, clinical symptoms after infection with porcine IAV, lung assessment, titers of porcine IAV in the lungs, histological changes in lung tissue, serum neutralization titers of porcine IAV, cytokine levels in BALF , PBMC re-stimulation as measured by IFNY-ELISpot, and B cell activation.

Example 8.

Induction of a neutralizing antibody response against two antigens in mice vaccinated with a bivalent vector vaccine based on rEHV-1 RacH rEHV-1 RacH SE_B (rEHV-1 RacH-SE-1/3-p430-H1av-7-p455-H3 cm. Fig. 14) was used to immunize Balb/c mice to demonstrate that the expressed transgenes are immunogenic in species other than pigs and that neutralizing antibodies were induced against one of the two antigens by intranasal application.

In more detail, three groups of five Balb/c mice per group, 3–5 weeks of age, were inoculated intranasally on study days 0 and 21 with either 40 μl rEHV-1 RacH SE_B (rEHV-1 RacH-SE-1/3-430H1av -7-455-H3, group 1), or 40 μl of empty vector (rEHV-1 RacH-SE, group 2, vector control), or 40 μl of tissue culture medium (group 3 negative control), respectively. For groups 1 and 2, the dosage of recombinant EHV-1 was 1x10 ⁵ TCID50/40 μl, respectively. Blood samples were collected from mice on study days 0 (before 1st inoculation), 7, 14, 21 (before 2nd inoculation), 28, and 35. Serum was prepared from blood samples and stored frozen at -80°C.

Immunofluorescence assay for detection of antibodies to vector virus.

AI-ST cells were infected at a multiplicity of infection (MOI) of 0.001 with rEHV-1 RacH-SE1212, and virus was released from the empty BAC vector pRacH-SE1.2. After 24 hours p.i. clear plaques were observed and cells were processed for indirect immunofluorescence assay (IFA). Sera from all three groups of final blood collection (obtained 14 days after the second vaccination), diluted 1:50 in PBS, were tested. Serum from an EHV-1 vaccinated horse was used as a positive control at a dilution of 1:500. Secondary antibodies were commercially available FITC-conjugated rabbit anti-mouse IgG for mouse sera and Cy5-conjugated goat anti-horse IgG for horse sera and were used at a dilution of 1:200. Antibody binding was assessed by fluorescence microscopy. All vaccinated mice developed antibodies reactive in ELISA with cells infected with rEHV-1 RacH-SE. Uninfected cells did not bind to any of the sera tested. Sera from negative control mice showed no specific binding to either infected or uninfected cells. The data is summarized in the table below.

- 40 046215

Table 3

Results of fluorescence microscopy ELISA for anti-EHV-l antibodies

Treatment Mouse number Ident. experiment number Breeding Uninfected cells Infected cells Group 3 (Negative Control) 1 1 1:50 neg. neg. 2 2 1:50 neg. neg. 3 3 1:50 neg. neg. 4 4 1:50 neg. neg. 5 5 1:50 neg. neg. Group 2 (Empty 1 6 1:50 neg. positive vector) 2 7 1:50 neg. positive 3 8 1:50 neg. positive 4 9 1:50 neg. positive 5 10 1:50 neg. positive Group 1 (rEHV-1 RacH SE B) 1 eleven 1:50 neg. positive 2 12 1:50 neg. positive 3 13 1:50 neg. positive 4 14 1:50 neg. positive 5 15 1:50 neg. positive Control antibody Specific to Horse serum EHV-1 22 1:500 neg. positive Secondary antibodies Specific to FITC-goat anti- mice 23 1:200 neg. neg. Su5 goat anti- horses 24 1:200 neg. neg.

From this it can be concluded that inoculation of rEHV-1 into the nostrils of mice leads to infection and replication of the virus, such that the immune systems of the mice were stimulated to produce antibodies to EHV-1.

Virus Neutralization Tests (VNT).

To demonstrate the induction of protective immunity against expressed transgenes originating from either influenza A virus (IAV) (A/swine/Italy/7680/2001(H3N2)) or (A/swine/Gent/132/2005(H1N1)) , mouse sera were tested for neutralization activity against the respective viruses (Allwinn et al. 2010; Trombetta et al. 2014). The IAV used for neutralization tests were isolates obtained from pigs in Germany since 2014, specifically A/swine/Germany/AR452/2014 (H3N2) and A/swine/Germany/AR1181/2014 (H1N1). Because they are heterologous to the strains from which the study vaccines are derived, any neutralization of these viruses by mouse sera would indicate broad and effective induction of protective immunity by rEHV-1 vaccination.

As a negative control serum, pig serum was used that was demonstrated to be negative for influenza virus antibodies.

Influenza A virus neutralization tests.

MDCK cells for virus neutralization and back titration in 96-well plates were incubated for two days at 37°C/5% CO ₂ before use. IAV-matched stocks of H3N2 and H1avN1 were thawed on ice and diluted in MEM containing gentamicin and 2x trypsin (MEM/Genta/2x trypsin).

The test sera were obtained from the last blood draw of group 1 (rEHV-1 RacH SE B), group 2 (empty vector), positive control (serum from a pig vaccinated with an inactivated multivalent IAV vaccine, and negative control).

Sera were heat inactivated and, in two and three independent experiments, respectively, serially diluted 1:2, starting from 1:16 up to 1:4096. IAV was diluted to approximately 100 TCID50/reaction mixture for the neutralization reaction. Reaction mixtures for the neutralization reaction were incubated for 2 hours at 37°C, 5% CO ₂ . Back titration of the virus used was carried out in quadruple repetition. The growth medium was removed and the MDCK cells were washed with medium containing

- 41 046215 gentamicin and trypsin before adding reaction mixtures for neutralization reactions or dilutions of back titration viruses. VNTs and titration plates were incubated at 37°C/5% CO2 for 1 hour after the addition of neutralization reaction mixtures or virus dilutions to MDCK cells, respectively. After this, the inoculum was removed and fresh medium containing gentamicin and trypsin was applied to the cells. After five days p.i. monitored and documented CPE. The actual virus titer used in the assay was calculated as TIR50/ml according to Reed and Munch, and the dilutions at which the test sera prevented the induction of the typical virus group CPE were recorded, see tables below.

Table 4

H1avN1 influenza virus VNT results

HlavNl VNT#1 VNT#2 VNT#3 Average value of neutralization ability 146 TCID50/well ability 32 TCID50/well ability 181 TCID50/well ability SD (standard deviation) MOUSE Reciprocal neutralizing dilution Reciprocal neutralizing dilution Reciprocal neutralizing dilution rEHV-1 RacH SE B -1 32 4672 128 4096 32 5792 4853 862 rEHV-1 RacH SE B -2 16 2336 64 2048 neg. 2192 204 rEHV-1 RacH SE B -3 32 4672 128 4096 16 2896 3888 906 rEHV-1 RacH SE B -4 128 18688 512 16384 64 11584 15552 3624 rEHV-1 RacH SE B -5 32 4672 256 8192 16 2896 5253 2695 Blank vector-1 But. n.d. neg. n.d. neg. n.d. n.d. n.d. Blank vector-2 But. n.d. neg. N.d. neg. N.d. N.d. n.d. Blank vector-3 But. n.d. neg. N.d. neg. N.d. N.d. n.d. Blank vector-4 neg. n.d. neg. N.d. neg. N.d. N.d. n.d. Blank vector-5 But. n.d. neg. N.d. neg. N.d. N.d. n.d. Pig serum counter. 32 n.d. n.d. N.d. n.d. N.d. N.d. n.d.

Table 5

H3N2 influenza virus VNT results

H3N2 VNT#1 VNT#2 VNT#3 Average value of neutralization ability 16 TCID50/well ability 24 TCID50/well ability 15 TCID50/well ability SD (standard deviation) MOUSE Reciprocal neutralizing dilution Reciprocal neutralizing dilution Reciprocal neutralizing dilution rEHV-1 RacH SE IN 1 4096 65536 1024 24576 2048 30720 40277 22089 rEHV-1 RacH SE AT 2 1024 16384 512 12288 128 1920 10197 7455

- 42 046215

rEHV-1 RacH SE AT 3 1024 16384 512 12288 256 3840 10837 6397 rEHV-1 RacH SE AT 4 256 4096 256 6144 64 960 3733 2611 rEHV-1 RacH SE AT 5 256 4096 128 3072 64 960 2709 1599 Blank vector-1 neg. n.d. neg. n.d. neg. n.d. n.d. n.d. Blank vector-2 neg. n.d. neg. N.d. neg. N.d. n.d. N.d. Blank vector-3 neg. N.d. neg. N.d. neg. N.d. n.d. N.d.

To compare the results of independent tests, the neutralizing ability was calculated by multiplying the reciprocal dilution of the serum by the corresponding titer that was neutralized by it. The averages of the three tests were then divided by 100 to show neutralization of 100 TCID50 (Tables 3, 4, and 5). The data is summarized and presented graphically in Fig. 25.

All mice vaccinated with rEHV-1 RacH SE B developed neutralizing antibodies against the corresponding IAV heterologous strains of the H3N2 and H1avN1 subtypes. Thus, double intranasal application of rEHV-1 RacH-SE, which express IAV hemagglutinins from the orf70 insertion site under the control of the p455 promoter (H3) and in parallel from the orf1/3 insertion site under the control of the p430 promoter (H1av), successfully stimulated a protective immune response in BALB/c mice.

It can be concluded that the rEHV-1 RacH-SE vector can be used to express two different transgenes in parallel to stimulate an immune response after intranasal vaccination.

Example 9.

Creation. IN VITRO characterization and IN VIVO testing of the EHV-1 vector-based Schmallenberg virus (SBV) vaccine in cattle.

One promising bunyavirus is the Schmallenberg virus (SBV), the first European virus of the Simbu serogroup (genus Orthobunyavirus), which can cause abortion, stillbirth and severe intrauterine malformations if pregnant animals become infected during the critical phase of gestation and is therefore currently is increasingly used as a model virus for the study of orthobunyaviruses (Bilk et al., 2012). Since Simbu viruses are transmitted by insect vectors and treatment options are not available, the main component of disease control is vaccination. Inactivated whole virus vaccines and live attenuated SBV vaccines are available against SBV and other Simbu viruses such as Akabane virus (AKAV) or Aino virus (Anonymous, 2013, 2015; Kraatz et al., 2015; Wernike et al., 2013b). however, none of these vaccines provide the ability to differentiate between infected field animals and vaccinated animals (DIVA principle). Only recently, DIVA subunit vaccines based on the 234 amino acids (aa) from the amino terminus of the SBV Gc glycoprotein have been tested in a lethal small animal model of infection and in cattle (Wernike et al., 2017). When delivered as expression plasmids or expressed in a mammalian cell culture system, the Gc domain provides protection in up to 66% of animals, while all animals immunized with the SBV Gc domain linked to the corresponding domain of the related AKAV are fully protected (Wernike et al., 2017). To study the use of rEHV-1 RacH-SE as a vector vaccine in cattle, the 234 amino-terminal aa of SBV-Gc were inserted into the orf70 (US4) insertion site and expressed under the control of the new p455 promoter and 71pA poly A signal and tested in the study vaccination-infection in cattle.

Generation of recombinant EHV-1 expressing an antigen derived from glycoprotein c (Gc) of Schmallenberg virus (SBV).

A portion of the 234 amino acid coding region from Schmallenberg virus (SBV) glycoprotein c (Gc) was optimized for codon frequency for expression in EHV-1 and further modified to ensure efficient transport and insertion into the plasma membranes of infected cells. To do this, a sequence encoding a signal peptide derived from the H1N2 hemagglutinin (HA) subtype of influenza A virus (IAV) (A/swine/Italy/116114/2010 (H1N2), GenBank accession number ADR01746.1) as well as a transmembrane anchor (TM) and the cytoplasmic C-terminus from such HA were attached to the 5' and 3' ends, respectively. Additionally, a GS linker HMGGSGGGGSGGGGSGGGT (SEQ ID NO: 30) was inserted between the Gc portion and the HA-TM domain. DNA was synthesized (SEQ ID NO: 31) and subcloned into the NotI/KpnI sites of pU70-455-71K71, a transfer vector for insertion of transgene expression cassettes into orf70 (US4) from EHV-1 using RED-mediated BAC recombination pRacH-SE. The resulting plasmid pU70-455-SBVGc_71K71 (Fig. 26) was cut with XbaI to release DNA fragment 3056 bp (SEQ ID NO: 32), which

- 43 046215 was transformed into E. coli K12 GS1783 carrying pRacH-SE.

SEQ ID NO: 31: Synthesized DNA sequence including restriction sites for subcloning

GCGGCCGCATGAAGGCGATCCTGGTTGTGCTGCTGTACACCTTTGCCAC CGCCAACGCCGATACGCTGATCAACTGCAAGAACATCCAGAGCACCCAGCT GACAATCGAGCACCTGAGCAAGTGCATGGCCTTCTACCAGAACAAGACCAG CAGCCCCGTCGTGATCAACGAGATCATCTCCGACGCCAGCGTGGACGAACA GGAACTGATTAAGTCTCTGAACCTGAACTGCAACGTGATC GACCGGTTCATC AGCGAGTCCAGCGTGATCGAGACACAGGTGTACTACGAGTATATCAAGAGC CAGCTGTGTCCACTGCAAGTGCACGATATCTTCACCATCAACAGCGCCAGCA ACATCCAGTGGAAGGCCCTGGCCCGCAGCTTTACCCTGGGCGTGTGCAACAC CAACCCCCACAAGCACATCTGCCGGTGCCTGGAATCCATGCAGATGTGTACC AGCACCAAGACCGACCACGCCA GAGAGATGAGCATCTACTACGACGGCCAC CCCGACAGATTCGAGCACGACATGAAGATTATCCTGAATATCATGCGGTACA TCGTGCCCGGCCTGGGCAGAGTGCTGCTGGACCAGATCAAGCAGACCAAGG ACTACCAGGCCCTGAGACACATCCAGGGCAAGCTGAGCCCCAAGTCCCAGA GCAACCTGCAGCTGAAGGGCTTCCTGGAATTCGTGGACTTCATCCTGGCGC CAACGTGACCATTG AGAAAACCCCCCAGACCCTGACCACCCTGAGCCTGATT CATATGGGAGGTTCCGGAGGTGGAGGTTCCGGAGGTGGAGGTTCCGGAGGT GGCACCATACTGGCCATTTACAGCACAGTTGCGAGCAGCCTGGTCCTGATCG TGAGCCTGGGTGCTATATCATTCTGGATGTGCAGCAACGGCTCTCTCCAGTG CCGCATCTGTATCTGAGGTACC

SEQ ID NO: 32: DNA fragment used for RED recombination to create pRacH-SE-70455-SBVGc.

Restriction enzyme cleavage positions are indicated by an asterisk (*).

- 44 046215

T*CTAGACTCGAGCGCAAGCCCTACACGCGCTACCCCTGCTTTCAACGC GTCAACCTGCACATTGACGGGGAGTTTCTGGTTCACAAGATGCTAGCGTTCA ATGCCGCGATGCGCCCATCGGCCGAGGAGCTGCTGTCATACCCAATGTTTGC TCAACTTTAGGATGACTAACCTGTTTCTGGGAGGAGACAGCGTGGGCGACGG TGTATAAAAGTTGGTCTGCTTTCAAGCCCTGCCACT GCGCTACAGTGCCACCA ACTGTAAAGCGGTAGTAAGCTGCAGTGGTCGACTGGTGGTAGCATATACTAC CTTATTTATACGCTCCGAGCTGTTTTTCAGCATGCTAGCACCCAACGCCGAGC GAGAGTATATAACTCCCATCATTGCCCACAAGCTTATGCCACTTATTAGCGT CCGCTCTGCCGTTTGCTTAGTCATAATATCTACCGCCGTTTACGCAGCAGACG CTATCTGCGACACAATTGGA TTTGCGATACCGCGCATGTGGATGTGTATTTT AATGAGATCAACCTCCATGAAGCGTAACTAGGGGGCCTCCCACTGAGGCACT ACCGGCTTAGCAGCTGACTAACACAGTATAAAACGTGAGAAGAAATCAGTC TCATGCGCCATTAGCGCTAGGCTAGTTAGCGTGGAGGACCGGAGCGCTACCG CCAGCAGTTTCATCCGCCTGGTTACGGGTTTGTTAACACCTACCGGTGTTTTA CCGCTACCATA GGATCCGATCCATGGGCGGCCGCATGAAGGCGATCCTGGTT GTGCTGCTGTACACCTTGCCACCGCCAACGCCGATACGCTGATCAACTGCA AGAACATCCAGAGCACCCAGCTGACAATCGAGCACCTGAGCAAGTGCATGG CCTTCTACCAGAACAAGACCAGCAGCCCCGTCGTGATCAACGAGATCATCTC CGACGCCAGCGTGGACGAACAGGAACTGATTAAGTCTCTGAACCTGA ACTG CAACGTGATCGACCGGTTCATCAGCGAGTCCAGCGTGATCGAGACACAGGT GTACTACGAGTATATCAAGAGCCAGCTGTGTCCACTGCAAGTGCACGATATC TTCACCATCAACAGCGCCAGCAACATCCAGTGGAAGGCCCTGGCCCGCAGCT TTACCCTGGGCGTGTGCAACACCAACCCCCACAAGCACATCTGCCCGGTGCCT GGAATCATGCAGATGTGTACCAGCACC AAGACCGACCACGCCAGAGAGAT GAGCATCTACTACGACGGCCACCCCGACAGATTCGAGCACGACATGAAGAT TATCCTGAATATCATGCGGTACATCGTGCCCGGCCTGGGCAGAGTGCTGCTG GACCAGATCAAGCAGACCAAGGACTACCAGGCCCTGAGACACATCCAGGGC AAGCTGAGCCCCAAGTCCCAGAGCAACCTGCAGCTGAAGGGCTTCCTGGAA TTCGTGGACTTCATCCTG GGCGCCAACGTGACCATTGAGAAAACCCCCCAGA CCCTGACCACCCTGAGCCTGATTCATATGGGAGGTTCCGGAGGTGGAGGTTC

- 45 046215

CGGAGGTGGAGGTTCCGGAGGTGGCACCATACTGGCCATTTACAGCACAGTT GCGAGCAGCCTGGTCCTGATCGTGAGCCTGGGTGCTATATCATTCTGGATGT GCAGCAACGGCTCTCTCCAGTGCCGCATCTGTATCTGAGGTACCAATAAACG CGGTATGTCTACCTTCAAGCCTATGATGAACGGATGTTTGGTGTTTGCGGCT ATTATAACGCTCTTGAGTTTTATGCTA TCTCTGGGAACATGCGAAAATTACA GGCGTGTGGTTCGGGATCCTAGGGATAACAGGGTAATCGATTTATTCAACAA AGCCACGTTGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATA TATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGG TGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAAT TCCAACATGGATGCTGAT TTATATGGGTATAAAATGGGCTCGCGATAATGTCG GGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAG AGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGA GATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAG CATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCG GAAAAC AGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATT GTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAA TTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAA TGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTG GCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCAT TCTCACCG GATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGA GGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCG ATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCAT TACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAA ATTGCAGTTTCATTTGATGCTCGATGAGTT TTTCTAAAATAAAACGCGGTATGT CTACCTTCAAGCCTATGATGAACGGATGTTTGGTGTTTGCGGCTATTATAAC GCTCTTGAGTTTTATGCTATCTCTGGGAACATGCGAAAATTACAGGCGTGTG GTTCGGGATCCGACCCTGTTGGTGGGTGCGGTTGGACTCAGAATCTTGGCGC AGGCATGGAAGTTTGTCGGTGACGAAACATACGACACCATCCGCGCAGAAG CAAAGAATTTAGAGA CCCACGTACCCTCAAGTGCTGCAGAGTCGT*CTAGA

Recombinant DNA pRacH-SE-70-455-SBVGc was prepared and correct insertion of the expression cassette and sequence identity were confirmed by high-fidelity PCR using Herculase™ and Sanger sequencing of the PCR products. For the primers used, see table. 6, SEQ ID NO: 33 - SEQ ID NO: 37.

Table 6

Primers used for PCR and sequencing

No. Name subsequence application SEQ ID NO:33 up70_F 5 ' -CGTGCGCGGAT AC ATCG-3 ' PCR and sequencing SEQ ID NO:34 up71_R 5 ' -CGCTTCGC AGGTGGGC-3 ' PCR and sequencing SEQ ID NO:35 seq455-Fl 5 ' -GACTGGTGGT AGC AT AT AC -3 ' sequencing SEQ ID NO:36 SBV GcFl 5 ' -GATC AACGAGATC ATCTCC-3 ' sequencing SEQ ID NO:37 SBV Gc RI 5 ' -CTGGAGAGAGCCGTTGC-3 ' sequencing

Release and characterization of recombinant EHV-1 RacH-SE-70-455-SBVGc

BAC DNA was prepared from four different clones of pRacH-SE-70-455-SBVGc. AI-ST cells (a porcine testicular cell line proprietary to Boehringer-Ingelheim) were seeded in 6-well plates (Corning Incorporated - Life Sciences, One Becton Circle, Durham, NC 27712, USA; REF 353046)

- 46 046215 at a density of 10 ⁵ cells/well in MEM (Sigma-Aldrich Chemie GmbH, Munich, Germany, SAFC628921000M3056) containing 10% FBS (Sigma-Aldrich Chemie GmbH, Munich, Germany, SAFC, Cat 12003C1000 ml). When cells reached 60-70% confluence, usually the next day, they were transfected with 2 mg BAC DNA using the Mirus™ mRNA transfection kit (Mirus Bio LLC, 545 Science Drive, Madison, WI 53711 USA) according to the manufacturer's instructions . Briefly, 200 mL of Optimem™ medium (Thermo Fisher Scientific) was added to 5 mL polystyrene tubes. DNA was added and mixed. 3 ml of Boost reagent was then added and mixed by spinning, followed by the addition of a similar volume of transfection reagent and mixed by spinning again. The mixtures were incubated for 3 min at room temperature and then added dropwise directly to the cell cultures. Cells were incubated at 37°C/5%CO ₂ for five days. Cells were washed in medium and collected for storage at -80°C.

Serial 1:10 dilutions of released viruses were prepared in MEM and plated on confluent AI-ST cell monolayers in 6-well plates. After adsorption for 1 hour at 37°C/5%CO ₂ , the inocula were removed and the cells were covered with semi-solid medium containing 0.5% Methocel (European Pharmacopoeia methylcellulose, Fluka 64632-500G) and 5% FBS (MEM-Methocel). After incubation at 37°C/5% CO ₂ for two to three days (passage 1), individual spots located as far from adjacent spots as possible were aspirated in a volume of 10 ml and inoculated into new AI-ST cell cultures in 6-well plates. Infected cells were incubated for two to three days until massive CPE was observed (passage 2). Cells were washed in medium and collected for storage at -80°C. This stain cleaning procedure was repeated twice. AI-ST cells infected three times with blot-purified viruses were processed for indirect immunofluorescence (IFA) or Western blot analysis, respectively.

Viral DNA prepared from infected cells was used as a template for high-fidelity PCR using Herculase™. The resulting PCR products were analyzed by Sanger sequencing and the identity of the insertion site was confirmed with the theoretical sequence and the sequence of the corresponding BAC PCR product.

Indirect immunofluorescence assay.

AI-ST cells in 24-well plates (Corning Incorporated - Life Sciences, One Becton Circle, Durham, NC 27712, USA; REF 353047) were infected using three times plaque purified virus serially diluted in MEM. The cells were aspirated from the growth medium and the cells were covered with 250 μl of diluted virus (dilutions from 10 ^-2 to 10 ^-7 ). The cells were incubated for 1 hour at 37°C/5%CO2 to adsorb the virus, after which the inoculum was removed and the cells were coated with 1000 μl of MEMMethocel/well and incubated at 37°C/5%CO2 for two days. When plaque formation was observed microscopically, the cells were processed for ELISA. The medium was aspirated and the cells were washed once with 1 ml PBS (Gibco Life Technologies, Paisley PA49RF, UK, DPBS (1x) REF 14190-136)/well. PBS was removed and cells were fixed by adding 1 ml/well - 20°C cold ethanol (Carl Roth GmbH, Schoemperlenstr. 3-5, D-76185 Karlsruhe, Art. Nr. 5054.1) and incubated for 30 min at RT. The ethanol was aspirated and the cells were air dried. After rehydrating the cells with 1 ml/well PBS for 10 min at RT, primary antibodies diluted in PBS (150 ml/well) were added and incubated for 1 h at RT. Primary antibodies were removed and cells were washed three times for 2 min with 1 ml PBS/well before adding secondary antibody dilutions (150 ml/well). After incubation for 1 h at RT, protected from light, secondary antibody dilutions were removed and cells were washed three times for 2 min with 1 ml PBS/well and finally coated with 500 ml PBS/well for analysis by fluorescence microscopy. The antibodies used are listed in table. 7.

Table 7

Antibody breeding Equine anti-EHV-1 hyperimmune serum (Property of Boehringer Ingelheim Veterinary Research Center) 1:400 Anti SBV-Gc monoclonal antibody (Wernike et al., 2015a) 1:50 FITC-conjugated goat anti-mouse IgG Jackson Immuno Research cat. No. 115-095-003 1:200 Cy ^1M 5-conjugated goat anti-horse IgG Jackson Immuno Research cat. No. 108-175-003 1:200

Western blotting.

1. Infection: Three wells of each confluent AI-ST cell monolayer in 6-well plates were infected at an MOI of approximately 1 with two different rEHV-1 plaque isolates RacH-SE-455-SBVGc (#121.131 P6 and #121.232 P6) and rEHV-1 plaque isolate RacHSE1212 P9 (released from the parental empty BAC pRacH-SE1.2) by directly adding 50 ml and 10 ml, respectively, of thawed virus stocks to the growth medium. Three wells remained uninfected. Infected and uninfected cells were incubated for two days and

- 47 046215 was then processed for Western blotting.

2. Preparation of lysates: RIPA buffer supplemented with protease inhibitor cocktail (RIPA+PI) was prepared as follows: 0.7 ml 10x RIPA lysis buffer Millipore cat. No. 20-188 was added to 6.3 ml H ₂ O, Fisher Scientific cat. No. BP2470-1, and 1 tablet of Complete™ Mini Protease inhibitor cocktail (Roche cat. No. 11 836 153 001) were dissolved in 7 ml of 1xRIPA buffer. Uninfected controls were scraped into the medium, and suspensions from triplicate wells were pooled in 15-ml centrifuge tubes and placed on ice. Infected cells were washed from the medium and suspensions from the wells were combined in triplicate in 15 ml centrifuge tubes and placed on ice. Cells were pelleted by centrifugation at 1000xg 4°C for 5 min. The supernatants were carefully aspirated and the cell pellet after centrifugation was resuspended in RIPA +PI (Uninfected cells in 300 ml, infected cells in 150 ml). The suspensions were incubated on ice for 30 min and shaken every 10 min. The suspensions were transferred to 1.5 ml microcentrifuge tubes and the undissolved material was pelleted by centrifugation at 15,000 rpm, 4°C for 10 min in a microcentrifuge. Clear supernatants were transferred to new 1.5 ml microcentrifuge tubes and stored at -80°C until use.

3. SDS-PAGE and transfer to nylon membranes: materials: BioRad Criterion TGX Stain Free Precast Gels, 4-20%, 26 well cat. No._567-8095; Bio Rad Precision Plus Dual Color Marker, cat. No. 161-0374; Bio Rad Precision Plus All Blue Marker, cat. No. 161-0373; Bio Rad Trans Blot Turbo transfer kit, Midi format cat. No. 170-4159; Bio Rad 4x Laemmli Sample Buffer (Cat no. 161-0747) (Bio Rad Laboratories GmbH, Heidemannstrasse 164, D-80939 Munchen); TGS running buffer (Sambrook et al.), blocking solution 1: 5% FBS in PBST (Sambrook et al.); PBST.

Samples were prepared without adding a reducing agent. Samples were thawed on ice and mixed with 1 volume of 4x Lammli buffer, boiled for 6 min at 96°C, and kept at RT until loading on the gel. The gel was run for 30 min at 230 mA and then collected for electroblotting using a BioRad Trans Blot Turbo system. The transfer was set to 2.5 A 25 V for 10 min. The membrane was washed in sterile distilled H ₂ O and incubated with 25 ml of a blocking solution of 5% FBS in PBST for 30 min at 4°C.

Incubation and detection of antibodies.

Materials: Immun-Star WesternC Chemiluminescent Kit (Bio Rad Laboratories GmbH, Heidemannstrasse 164, D-80939 Munchen) cat. No. 170-5070 primary antibodies:

A: monoclonal antibody specific for SBV-Gc protein (Wernike et al., 2015a) 1:20 B: mouse monoclonal antibody Ai2G7 to EHV-1 gpII (proprietary of Boehringer Ingelheim) Secondary antibody: Peroxidase-conjugated goat anti-mouse, (Jackson Immune Research #115-035-146) 1:5000.

All incubations were carried out in sufficient volume with constant stirring. Antibodies were diluted in 5%FBS/TBST. Primary antibodies were incubated overnight at 4°C. The antibody solution was removed and the blots were washed three times with TBST for 5-10 min. The diluted secondary antibody was incubated with the blots for 1 h at RT, removed, and the blots were washed three times with TBST for 5–10 min. The blots were placed on a clear plastic protective sheet. Peroxide and Lumino/Enhancer solutions were mixed 1 ml + 1 ml (total 2 ml for each blot), pipetted onto the blots and incubated for 3-5 min. The membranes were then placed into a ChemiDocXRS imaging system (Bio Rad Laboratories GmbH, Heidemannstrasse 164, D-80939 Munchen) and the signals were recorded using Image Lab software.

Virus titration.

AI-ST cells were seeded in 96-well plates (Corning Incorporated -Life Sciences, One Becton Circle, Durham, NC 27712, USA; REF 353072) at 2x104 cells/well in MEM supplemented with 10% FBS one day before infection. Virus stocks were quickly thawed and placed on ice. Ten serial dilutions of 1:10 in MEM were prepared in a volume of 1.2 ml per dilution. Dilutions of viruses in an amount of 100 ml/well were added to the cells, 8 wells in one vertical row per dilution. Vertical rows 11 and 12 of each plate served as control medium by adding 100 ml/well of MEM. Titrations were performed in triplicate and cells were incubated for 5 days at 37°C/5%CO ₂ . Cell cultures were analyzed microscopically and wells in which EHV-1 RacH typical CPE was observed were recorded. Titers were calculated as TIS50/ml according to the method of Reed and Muench (1938).

Characteristics of recombinant EHV-1 used for vaccination.

Expression of the modified SBV Gc234 in infected cells is shown by Western blotting and dual immunofluorescence analysis (DIFA) for the rEHV-1 plaque isolate RacHSE-70-455-SBVGc 121.232. DIFA with polyclonal horse anti-EHV antiserum and monoclonal anti-SBV antibody confirmed transgene expression in virtually 100% of rEHV-1-infected cells. When DIFA was performed on cells infected using rEHV-1 RacH-SE70-455-SBVGc_121.232, the EHV-1 antigen-positive cells that were stained using

- 48 046215 horse anti-EHV antiserum (magenta) also bound the SBV Gc monoclonal antibody. Western blots run under non-reducing conditions confirmed the expression of modified SBVGc234 in cells infected with recombinant EHV-1 RacH-SE-70-455SBVGc. Western blots were performed on lysates of infected or uninfected cells probed with anti-SBV Gc monoclonal antibody or anti-EHV1 gpII monoclonal antibody. While EHV-1 gpII was expressed in all infected cells, SBV Gc was expressed only in cells infected with rEHV-1RacH-SE-70-455-SBVGc, but not in those cells that were infected with the rEHV-1 RacH- empty vector SE1212. No viral protein was detected in lysates of mock-infected cells. Incubation of parallel blots with a monoclonal antibody to gpII from EHV-1 confirmed recovery of orf71 (US5) by a self-excision procedure during release of the recombinant virus after transfection. P7 virus stocks increased threefold for plaque-purified rEHV-1 isolate RacH-SE-70-455-SBVGc_121.232, replicated to a very high titer of 1.85x109 TSS50/ml in AI-ST cells, indicating that expression the transgene does not disrupt EHV replication in this cell line. The average of six titrations of rEHV-1RacH-SE-70-455-SBVGc_121.232 as TSGO50/ml resulted in 1.85x109 TSGO50/ml with a standard deviation of 1.28x109 TSGO50/ml.

Animals and experimental design.

German domestic breeds of cattle were vaccinated twice with an interval of three weeks using 108 TCID ₅₀ rEHV-SBV-Gc; 4 cattle were kept as unvaccinated controls. Three weeks after the second immunization, all animals were inoculated subcutaneously with 2 x 0.5 ml of the field strain SBV, which was passivated only in cattle (Wernike et al., 2012). Throughout the study, body temperature was measured rectally daily and animals were examined by veterinarians to determine clinical signs. Serum was collected weekly and analyzed using a commercially available N-based ELISA (ID Screen® Schmallenberg virus Competition, ID vet, France) and a microneutralization test against SBV isolate BH80/11 as previously described (Wernike et al., 2013a). . Evaluation was carried out by determining the cytopathic effect after 3 days; All samples were tested in quadruplicate and antibody titers were calculated as ND ₅₀ according to Behrens and Kaerber. Sera collected on the days of immunization, challenge and at the end of the study, respectively, were further analyzed using microneutralization tests against EHV strain RacH (rEHV-SBV-Gc group and unvaccinated control animals).

During the first 10 days after challenge, additional blood samples were collected daily. From these samples, viral RNA was extracted using a King Fisher 96 Flex (Thermo Scientific, Braunschweig, Germany) in combination with a MagAttract Virus Mini M48 Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions and tested by reverse transcription-PCR in real-time based on the S-segment (Bilk et al., 2012).

The experimental protocol was reviewed to comply with the requirements of the state ethics committee and approval was obtained from the competent authority (State Office for Agriculture, Food Safety and Fisheries of Mecklenburg-Vorpommern, Rostock, Germany, ref. LALLF M-VTSD/7221.3-1.1004/12).

Clinical observation and detection of viral RNA.

None of the animals exhibited any relevant clinical signs specific to SBV throughout the study and body temperature remained within the normal range for all animals when measured rectally.

Beginning on the first day or two subsequent challenges, viral RNA was detected in serum samples from each unvaccinated control animal for four consecutive days. All vaccinated animals in the rEHV-SBV-Gc group exhibited reduced viral RNA concentrations by quantitative reverse transcription-PCR (FIG. 27A) throughout the sampling period. Two animals in the rEHV-SBV-Gc group tested completely negative by quantitative reverse transcription-PCR (FIG. 27A) throughout the sampling period. In two animals immunized with rEHV-SBV-Gc, the SBV genome was detected at reduced levels for three or five days, respectively.

Antibody production.

In unvaccinated control animals, no SBV-specific antibodies were detected by serum neutralization test before challenge. Beginning one or two weeks after infection, high titers of neutralizing antibodies were detected in all unvaccinated animals (Fig. 27B).

In contrast to the unvaccinated control group, SBV-specific neutralizing antibodies were detected on the day of challenge in two of four cattle immunized with rEHV-SBV-Gc. In the remaining two animals from this group, no SBV-specific neutralizing antibodies were detected before challenge, but

- 49 046215 two weeks after infection, neutralizing antibodies were present (Fig. 27B). SBV-specific neutralizing antibody titers in all four vaccinated animals were lower than those in the challenge, indicating less efficient viral replication of the challenged viruses, and this was confirmed by quantitative reverse transcription-PCR data.

EHV neutralization test.

Two-fold dilutions of serum were prepared in MEM, starting from 1:5. Fifty ml of MEM containing 100 TCID50 SBV and 50 ml of diluted serum were incubated in 96-well cell culture plates for 2 hours. After this, 100 ml of freshly prepared BHK cell suspension (in MEM containing 10% fetal bovine serum) and cultured The plates were incubated for 3-4 days at 37°C/5%CO ₂ . Cytopathic effects were assessed using light microscopy. All sera were tested in duplicate and the antibody titer was calculated as ND50 according to Kaerber (1931), as modified by Behrens (personal communication). The results presented in Fig. 28 indicate that vaccination of cattle with rEHV-1 RacH-SE70-455-SBVGc results in vector virus replication efficient enough to induce a specific immune response. In one of four EHV-1 animals, an extremely low titer of neutralizing antibodies (1:4) was detected three weeks after primary vaccination. After two vaccinations, three weeks after the second application, all four cattle produced neutralizing antibodies at a titer of 1:128. Based on this result, it can be concluded that EHV-1 RacH should also be functional as a vaccine vector in cattle.

Example 10.

Efficacy of a tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D against infection of piglets with H3N2 swine IAV.

To study its properties as a vector vaccine in young piglets, a tetravalent porcine IAV vaccine consisting of rEHV-1 RacH-SE B (rEHV-1 RacH-SE-1/3-p430-H1av-70-p455-H3 see FIG. 14) and rEHV-1 RacH-SE_D (rEHV-1 RacH-SE-1/3-p430-H1hu-70-p455-H1pdm see Fig. 23) were tested in a second vaccination-challenge experiment.

In this second study, piglets from unvaccinated sows were tested serologically negative for porcine IAV-specific antibodies using the H3-specific ELISA (Figure 32) and a viral neutralization test (data not shown) at during the first vaccination, were vaccinated twice using a tetravalent vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D. Animals were vaccinated first in the first week of their life (study day 0, SD0) and a second time at four weeks of age (study day 21, SD21), respectively, either intramuscularly and then intramuscularly (2X IM), or intranasally first and then intramuscularly (2X IM). then intramuscularly (IN+IM), or twice intranasally (2X IN), at a dose of 1 x 10 ⁷ TCID50 at a dose of 2 ml per vaccine strain, animal and vaccination, respectively. An unvaccinated group served as a negative control and another unvaccinated group served as a challenge control at the eleventh week of life (study days 69 or 70, SD42/43), all animals, but not the negative control, were challenged with an intratracheal dose ^{of 2x107} TCID50 H3N2 swine IAV strain for infection (European field virus isolate R452-14, the H3 of which is heterologous to the H3 vaccine antigen used in rEHV-1 RacH-SE_B). Unvaccinated and unchallenged animals served as negative controls (neg. ctr.), while unvaccinated but infected animals served as challenge controls (c.c.). During vaccination and after vaccination and before infection, blood samples were collected at different time points.

One day after infection, half of the animals per group were killed and three lung samples were collected from the left and right lungs of each animal, respectively. Porcine IAV infectious titers per gram of lung homogenate were then determined for each animal as the average of the left and right lungs per animal, each derived from the homogenates being a pool of three samples for the left or right lung and which were normalized to the total weight of the three samples. left or right lung, respectively. A similar procedure was carried out with the remaining half of the animals per group three days after infection. For all vaccinated groups, mean infectious porcine IAV titers obtained from individual animals in the group were statistically significantly reduced for samples collected one day postchallenge (CH+1) compared to the challenged control group, while all animals from the negative control group did not detect infectious titers of porcine IAV viruses in their lung homogenates (Fig. 29). In addition, for all vaccine groups, mean infectious porcine IAV titers obtained from individual animals in the group were statistically significantly reduced for samples collected on day 3 postchallenge (CH+3) compared with the challenged control group, while while all animals from the negative control group did not detect

- 50 046215 infectious titers of pig IAV viruses in their lung homogenates (Fig. 30). In summary, vaccination with a tetravalent porcine IAV vaccine, consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D, statistically significantly reduced the lung burden of porcine IAV one and three days after challenge with the heterologous H3N2 strain of porcine IAV in piglets, respectively. Accordingly, the vaccine described in the present invention is effective against porcine IAV in pigs.

In addition, sera collected from study animals on study day 0 (SD0, before the first vaccination), on study day 21 (SD21, before the second vaccination), and on study days 42 or 43 (SD42/43, before application of the challenge material ) were analyzed using a porcine immunoglobulin G (IgG)-specific enzyme-linked immunosorbent assay (ELISA) targeting the recombinantly expressed porcine IAV H3 antigen, which is homologous to the H3 expressed by the rEHV-1 vaccine strain RacH-SE_B. While the mean OD values of sera from the negative control group gave only very low values for all measurement time points, sera from the vaccinated groups showed a significant increase in OD values after two intramuscular applications (2X IM; SD21 and SD42/43), after the first intranasal , and then intramuscular injection (IN+IM; SD42/43), and after two intranasal injections (2X IN; SD42/43); fig. 32. In summary, vaccination with a tetravalent porcine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D induced a serological immune response in piglets against porcine IAV hemagglutinin H3 expressed by the rEHV-1 RacHSE_B vaccine strain, respectively.

Additionally, peripheral blood mononuclear cells (PBMCs) were purified from blood collected from study animals on study day 28 (SD28). PBMC were then restimulated with either the H3N2 swine IAV challenge strain R452-14 at a multiplicity of infection of 1 (H3N2 MOI 1) or with a recombinantly expressed swine IAV H3 antigen, which is homologous to the H3 expressed by the rEHV-1 vaccine strain RacH-SE_B at concentration 1 µg/ml (rH3 1 µg/ml). Using re-stimulated PBMCs, interferon-gamma specific immunospot spotting (ZFNy ELISpot) was performed and the results obtained were normalized to 10 cells and calculated as group averages, respectively (FIG. 34). Although restimulated PBMCs from the challenged control group (served as a negative control for this assay; the animals were not vaccinated) showed mean spot values per group below 45 after any restimulation, restimulated PBMCs from vaccinated animals showed mean spot values per group above 85 after two intramuscular applications, more than 100 spots after the first intranasal and then intramuscular administration (IN+IM), and more than 150 spots after two intranasal administrations (2X IN), after any repeated stimulation, respectively (Fig. 34) . Thus, vaccination with a tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D induced a cellular immune response in piglets against both porcine IAV hemagglutinin H3 expressed by the rEHV-1 RacH-SE_B vaccine strain and against H3N2 swine IAV R452-14 used for heterologous viral challenge, respectively.

In summary, vaccination of piglets with a tetravalent porcine IAV vaccine, consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D, induced a detectable serological and cellular immune response in piglets and demonstrated vaccine efficacy by statistically significantly reducing porcine IAV load in lung homogenates through one and three days after infection with heterologous IAV in pigs.

Example 11.

Efficacy of the tetravalent porcine IAV vaccine, consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D against H3N2 IAV infection of pigs in piglets with maternal antibodies.

To investigate its properties as a vector vaccine in young piglets, a tetravalent porcine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D was tested in a third vaccination-challenge study.

This third study used piglets that were born and fed colostrum and milk from sows that had been vaccinated twice during pregnancy with a commercially available inactivated porcine IAV vaccine. Piglets were determined to be serologically positive for porcine IAV-specific antibodies by using an H3-specific ELISA (FIG. 33) and by using a commercially available porcine IAV-specific antibody ELISA (IDEXX Influenza A (Virus Antibody Test)®; IDEXX, Westbrook , Maine 04092, USA) according to the manufacturer's testing instructions (data not shown), the first vaccination was vaccinated twice with a tetravalent vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D. Animals were vaccinated first in their first week of life (study day 0, SD0) and a second time at four weeks of age (study day 21, SD21), respectively, either intramuscularly and then again intramuscularly (2X IM), or the first time intranasally , and then intramuscularly (IN+IM), or twice intranasally (2X IN), at a dose of 1x10 ⁷ TCID50 per

- 51 046215 dose of 2 ml per vaccine strain, animal and vaccination, respectively. An unvaccinated group served as a negative control, and another unvaccinated group served as a challenge control. At the eleventh week of life (study days 69 or 70, SD69/70), all animals, but not the negative control, were challenged intratracheally with a dose of 2x107 TCID50 H3N2 swine challenge strain IAV (European field virus isolate R452-14, of which H3 is heterologous H3 vaccine antigen used in rEHV-1 RacH-SE_B). Unvaccinated and unchallenged animals served as negative controls (neg. ctr.), while unvaccinated but infected animals served as challenge controls (c.c.). At the time of vaccination and after vaccination and before infection, blood samples were collected at various time points.

Five days after infection, animals were killed and three lung samples were collected from the left and right lungs of each animal, respectively. Porcine IAV infectious titers per gram of lung homogenate were then determined for each animal as the average of the left and right lungs per animal, each derived from the homogenates being a pool of three samples for the left or right lung and which were normalized to the total weight of the three samples. left or right lung, respectively. For all vaccinated groups, mean infectious porcine IAV titers obtained from individual animals in the group were statistically significantly reduced for samples collected on day five post-challenge (CH+5) compared to the challenged control group, while all animals from the negative control group did not detect infectious titers of porcine IAV viruses in their lung homogenates (Fig. 31). In summary, vaccination with a tetravalent porcine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D statistically significantly reduced the lung burden of porcine IAV five days after challenge with the heterologous H3N2 strain of porcine IAV in piglets, respectively. Accordingly, the vaccine described in the present invention is effective against porcine IAV in pigs.

In addition, sera collected from study animals on study day 0 (SD0, before the first vaccination), study day 21 (SD21, before the second vaccination), and study day 35 (SD35, two weeks after the second vaccination) were analyzed using a porcine immunoglobulin G (IgG)-specific enzyme-linked immunosorbent assay (ELISA) targeting the recombinantly expressed porcine IAV H3 antigen, which is homologous to the H3 expressed by the rEHV-1 vaccine strain RacH-SE_B. While the mean OD values of sera from the negative control group gave only very low values for SD21 and SD35, sera from the vaccinated groups showed a significant increase in OD values after two intramuscular applications (2X IM; SD35), after the first intranasal and then intramuscular administration (IN+IM; SD35), and after two intranasal injections (2X IN; SD35); fig. 33. In summary, vaccination with a tetravalent porcine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacHSE_D induced a serological immune response in piglets against porcine IAV hemagglutinin H3 expressed by the rEHV-1 RacH-SE_B vaccine strain, respectively.

Additionally, peripheral blood mononuclear cells (PBMCs) were purified from blood collected from study animals on study day 28 (SD28). PBMC were then restimulated with either the H3N2 swine IAV challenge strain R452-14 at a multiplicity of infection of 1 (H3N2 MOI 1) or with a recombinantly expressed swine IAV H3 antigen, which is homologous to the H3 expressed by the rEHV-1 vaccine strain RacH-SE_B at concentration 1 µg/ml (rH3 1 µg/ml). Using re-stimulated PBMCs, interferon-gamma specific immunospot spotting (ZFNy ELISpot) was performed and the results obtained were normalized to 10 cells and calculated as group averages, respectively (FIG. 35). Although restimulated PBMCs from the challenged control group (served as a negative control for this assay; the animals were not vaccinated) showed mean spot values per group below 15 after any restimulation, restimulated PBMCs from vaccinated animals showed mean spot values per group greater than 30 after two intramuscular applications, more than 55 spots after the first intranasal and then intramuscular administration (IN+IM), and more than 65 spots after two intranasal administrations (2X IN), after any repeated stimulation, respectively (Fig. 35) . Thus, vaccination with a tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D induced a cellular immune response in piglets against both porcine IAV hemagglutinin H3 expressed by the rEHV-1 RacH-SE_B vaccine strain and against H3N2 swine IAV R452-14 used for heterologous viral challenge, respectively.

In summary, vaccination of piglets with a tetravalent porcine IAV vaccine, consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D, induced a detectable serological and cellular immune response in piglets and demonstrated vaccine efficacy by statistically significantly reducing porcine IAV load in lung homogenates through five days after infection with heterologous

- 52 046215

IAV pigs.

All compositions and methods disclosed and claimed in this invention can be prepared and carried out without undue experimentation in light of the present description. Although the compositions and methods in accordance with this invention have been described in the context of preferred embodiments, it will be apparent to those skilled in the art that changes may be made to the compositions and methods, as well as to the steps or sequence of steps of the method described herein without deviation. from the concept and scope of the present invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results are achieved. All such similar substitutions and modifications apparent to those skilled in the art are intended to be within the scope and concept of the invention as defined in the appended claims.

Links

The following references, to the extent that they provide illustrative or other details additional to those set forth herein, are expressly incorporated herein by reference.

1. Allwinn R, Geiler J, Berger A, Cinatl J, Doerr HW. 2010. Determination of serum antibodies against swine-origin influenza A virus H1N1/09 by immunofluorescence, haemagglutination inhibition, and by neutralization tests: how is the prevalence rate of protecting antibodies in humans? Med Microbiol Immunol. 199(2):117-21. doi:10.1007/s00430-010-0143-4. Epub 2010 Feb 17.

2. Anonymous (2013). VMD authorizes SBV vaccine for use in the UK. The Veterinary record 172, 543

3. Anonymous (2015). Schmallenberg virus vaccine. The Veterinary record 177, 321

4. Bilk S, Schulze C, Fischer M, Beer M, Hlinak A, Hoffmann B (2012). Organ distribution of Schmallenberg virus RNA in malformed newborns. Veterinary microbiology 159, 236-238

5. Boshart M, Weber F, Jahn G, Dorsch-Hasler K, Fleckenstein B, Schaffner W. 1985. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41(2):521–30.

6. Bryant, N. A., Davis-Poynter, N., Vanderplasschen, A., and Alcami, A. 2003. Glycoprotein G isoforms from some alphaherpesviruses function as broad-spectrum chemokine binding proteins. The EMBO Journal Vol. 22(4):833-846.

7. Bustin, S. 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. Journal of Molecular Endocrinology 25(2): 169-193.

8. Charoensawan, V., Wilson, D., Teichmann, S.A. 2010. Genomic repertoires of DNAbinding transcription factors across the tree of life. Nucleic Acids Res. 38(21):7364-77

9. Colle, C.F. 3rd, O'Callaghan, D.J. 1995. Transcriptional analyzes of the unique short segment of EHV-1 strain Kentucky A. Virus Genes;9(3):257-68.

10. Dorsch-Hasler, K., Keil, G.M., Weber, F., Jasin, M. Schaffner, W., and Koszinowski, U.H. 1985. A long and complex enhancer activates transcription of the coding gene for the highly abundant immediate early mRNA in murine cytomegalovirus. PNAS Vol. 82: 83258329.

11. Drummer, H.E., Studdert, M.J., Crabb, B.S. 1998. Equine herpesvirus-4 glycoprotein G is secreted as a disulphide-linked homodimer and is present as two homodimeric species in the virion. J.Gen. Virol. 79: 1205-1213

12. von Einem J, Smith PM, Van de Walle GR, O'Callaghan DJ, Osterrieder N (2007). In vitro and in vivo characterization of equine herpesvirus type 1 (EHV-1) mutants devoid of the viral chemokine-binding glycoprotein G (gG). Virology 362, (1) 151-162

13. Goodwin, E.C. & Rottman, F.M. 1992. The 3’flanking sequence of the bovine growth hormone gene contains novel elements required for efficient and accurate polyadenylation. J.Biol.Chem. 267: 16330-16334.

- 53 046215

14. Hubert, P. H., Birkenmaier, S., Rziha, H.-J. and Osterrieder, N. 1996, Alterations in the Equine Herpesvirus Type-1 (EHV-1) Strain RacH During Attenuation. Journal of Veterinary Medicine, Series B, 43: 1-14. doi:10.1111/j.l439-0450.1996.tb00282.x

15. Karber, G (1931) Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Archiv f experiment Pathol u Pharmakoi.; 162:480-483

16. Kraatz F, Wernike K, Hechinger S, Konig P, Granzow H, Reimann I, Beer, M (2015). Deletion mutants of Schmallenberg virus are avirulent and protect from virus challenge. J Virol 89, 1825-1837

17. Luke, GA and Ryan, MD. 2013. The protein coexpression problem in biotechnology and biomedicine: virus 2A and 2A-like sequences provide a solution.Future Virology, Vol. 8, No. 10, Pages 983-996.

18. Ma, G., Eschbaumer, M., Said, A., Hoffmann, B., Beer, M., Osterrieder, N. 2012. An equine herpesvirus type 1 (EHV-1) expressing VP2 and VP5 of serotype 8 bluetongue virus (BTV-8) induces protection in a murine infection model. PLoS One. 2012;7(4):e34425. doi: 10.1371/joumal.pone.0034425. Epub 2012 Apr 12.

19. Ma, G., Azab, W., Osterrieder, N. 2013. Equine herpesviruses type 1 (EHV-1) and 4 (EHV-4)—masters of co-evolution and a constant threat to equids and beyond. Vet Microbiol. 167(1-2):123-34.

20. Nolan, T. Rebecca E Hands, R.E., and Bustin S.A. 2006. Quantification of mRNA using real-time RT-PCR Nature Protocols 1: 1559-1582

21. Osterrieder, N., Neubauer, A., Brandrmiller, C., Kaaden, O.R., and O’Callaghan, D.J. 1996. The equine herpesvirus 1 IR6 protein influences virus growth at elevated temperature and is a major determinant of virulence. Virology 226:243–251.

22. Ptashne, M. 2014. The Chemistry of Regulation of Genes and Other Things The Journal of Biological Chemistry Vol. 289, (9) 5417-5435. Reed, L.J., and Muench, H. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. (27) 3; 493-497.

23. Reed LJ and Muench H (1938). A simple method estimating fifty percent endpoints. The American Journal of Hygiene 27(3) 493-497

24. Rosas, C.T., Konig, P., Beer, M., Dubovi, E.J., Tischer, B.K., Osterrieder, N., 2007a. Evaluation of the vaccine potential of an equine herpesvirus type 1 vector expressing bovine viral diarrhea virus structural proteins. J.Gen. Virol. 88(3), 748-757.

25. Rosas, C.T., B.K. Tischer, G. A. Perkins, B. Wagner, L.B. Goodman, N. Osterrieder. 2007b. Live-attenuated recombinant equine herpesvirus type 1 (EHV-1) induces a neutralizing antibody response against West Nile virus (WNV) Virus Research, 125, pp. 69-78.

26. Rosas, C.T., Van de Walle, G.R., Metzger, S.M., Loelzer, K., Dubovi, E.J., Kim, S.G., Parrish, C.R., Osterrieder, N., 2008. Evaluation of a vectored equine herpesvirus type 1 (EHV -1) vaccine expressing H3 haemagglutinin in the protection of dogs against canine influenza. Vaccine 26 (19), 2335-3234.

27. Said, A., Elke Lange, E., Beer, M. Damiani, A., Osterrieder, N. 2013. Recombinant equine herpesvirus 1 (EHV-1) vaccine protects pigs against challenge with influenza A(HlNl)pmdO9 Virus Research 173: 371-376

28. Sambrook J and Russell DW (2001). Molecular Cloning, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; ISBN 978-087969-577-4

-

Claims (28)

29. Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans, B.N., Palmer, A.E., Tsien, R.Y. 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. Dec;22(12): 1567-72. Epub 2004 Nov 21. 30. Tischer, B.K., von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step redmediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechnol. Tech. 40, 191-197. 31. Tischer, B. K., Kaufer, B. B., Sommer, M., Wussow, F., Arvin, A., and Osterrieder, N. A Self-Excisable Infectious Bacterial Artificial Chromosome Clone of Varicella-Zoster Virus Allows Analysis of the Essential Tegument Protein Encoded by ORF9. J. Virol.81 (23), 2007, 13200-13208. 32. Tischer, B. K., Smith, G. A., and Osterrieder, N. in: Jeff Braman (ed.), In Vitro Mutagenesis Protocols: Third Edition, Methods in Molecular Biology, vol. 634,DOI 10.1007/978-l-60761-652-8_30, © Springer Science+Business Media, LLC 2010, Chapter 30: En Passant Mutagenesis: A Two Step Markerless Red Recombination System. 33. Thompson, S.R. 2012. Tricks an IRES uses to enslave ribosomes. Trends Microbiol. Nov;20(l 1):558-66. 34. Trapp, S., von Einem, J., Hofmann, H., Kostler, J., Wild, J., Wagner, R., Beer, M., Osterrieder, N., 2005. Potential of equine herpesvirus 1 as a vector for immunization. J. Virol. 79, 5445-5454. 35. Trombetta CM, Perini D, Mather S, Temperton N, Montomoli E. 2014. Overview of Serological Techniques for Influenza Vaccine Evaluation: Past, Present and Future. Vaccines (Basel) 13;2(4):707-34. doi: 10.3390/vaccines2040707. 36. Wellington, J.E., Allen, G.P., Gooley, A.A., Love, D.N., Packer, N.H., Yan, J.X., Whalley, J.M. 1996. The highly O-glycosylated glycoprotein gp2 of equine herpesvirus 1 is encoded by gene 71. J Virol. 70(11):8195-8. 37. Wernike K, Aebischer A, Roman-Sosa G, Beer M, (2017). The N-terminal domain of Schmallenberg virus envelope protein Gc is highly immunogenic and can provide protection from infection. Scientific reports.2017 Feb 13;7:42500. 38. Wernike K, Eschbaumer M, Breithaupt A, Hoffmann B, Beer M (2012). Schmallenberg virus challenge models in cattle: infectious serum or culture-grown virus? Veterinary research 43, 84 39. Wernike K, Eschbaumer M, Schirrmeier H, Blohm U, Breithaupt A, Hoffmann B, Beer M, (2013a). Oral exposure, reinfection and cellular immunity to Schmallenberg virus in cattle. Veterinary microbiology 165, 155-159 40. Wernike K, Nikolin VM, Hechinger S, Hoffmann B, Beer M (2013b). Inactivated Schmallenberg virus prototype vaccines. Vaccine 31, 3558-3563 CLAIM 1. An expression cassette containing (I) at least one left ORF70 flanking region selected from the group consisting of: SEQ ID NO: 13 and at least 95% homologous and/or identical sequence, SEQ ID NO: 15 and at least 95% homologous and/or identical sequence thereto, and SEQ ID NO: 17 at least 95% homologous and/or identical sequence thereto, and (II) at least one exogenous nucleotide sequence of interest that is operably linked to promoter sequence, and (III) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO: 14 and at least 95% homologous and/or identical sequence thereto, SEQ ID NO: 16 and at least 95% homologous and/or identical sequence thereto and SEQ ID NO: 18 and at least 95% homologous and/or identical sequence thereof. 2. An expression cassette according to claim 1, wherein the exogenous nucleotide sequence is an antigen coding sequence. 3. Equine alphaherpesvirus 1 (EHV-1) RacH strain vector for immunization, comprising an expression cassette according to claim 1 or 2. 4. An equine alphaherpesvirus 1 (EHV-1) RacH strain vector comprising (I) at least one left ORF70 flanking region selected from the group consisting of: SEQ ID NO: 13 and at least 95% homologous and/or identical her follower - 55 046215 ity, SEQ ID NO: 15 and at least 95% homologous and/or identical to the sequence and SEQ ID NO: 17 and at least 95% homologous and/or identical to the sequence, and (II) according to at least one exogenous nucleotide sequence of interest that is operably linked to the promoter sequence, and (III) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO: 14 and at least 95% homologous and/ or a sequence identical thereto, SEQ ID NO: 16 and at least 95% homologous and/or identical sequence thereto, and SEQ ID NO: 18 and at least 95% homologous and/or identical sequence thereto. 5. The equine alphaherpesvirus 1 (EHV-1) strain RacH vector of claim 4, wherein the sequence is a gene or antigen-coding sequence of interest. 6. An equine alphaherpesvirus 1 (EHV-1) RacH strain vector comprising a first nucleotide sequence of interest inserted into an ORF70 and a second nucleotide sequence of interest or gene, wherein (I) at least one left ORF70 the flanking region is selected from the group consisting of: SEQ ID NO: 13 and at least 95% homologous and/or identical sequence, SEQ ID NO: 15 and at least 95% homologous and/or identical sequence, and SEQ ID NO: 17 and at least 95% homologous and/or sequence identical thereto, and (II) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO: 14 and at least 95% identical homologous and/or identical sequence thereto, SEQ ID NO: 16 and at least 95% homologous and/or identical sequence thereto, and SEQ ID NO: 18 and at least 95% homologous and/or identical sequence thereto. 7. The equine alphaherpesvirus 1 (EHV-1) RacH strain vector of claim 6, wherein the sequence of interest is a first antigen-coding sequence and a second, preferably another antigen-coding sequence. 8. The EHV-1 vector of claims 3 to 7, wherein the insertion in ORF70 is characterized by a partial deletion, truncation, substitution, modification, or the like in ORF70 while ORF71 remains functional. 9. The EHV-1 vector of claims 3 to 8, wherein the insertion in ORF70 is characterized by a deletion of approximately 801 bp. within ORF70 for RacH (SEQ ID NO: 20) or at 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous and/or identical sequence. 10. EHV-1 vector according to claims 3-9, which includes at least one flanking region selected from the group consisting of: SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18 and 95% homologous and/or sequence identical thereto to any of these sequences. 11. The EHV-1 vector of claims 3 to 10, which includes (I) at least one left ORF70 flanking region selected from the group consisting of: SEQ ID NO: 13, SEQ ID NO: 15 and SEQ ID NO: 17 , and (II) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO: 14, SEQ ID NO: 16 and SEQ ID NO: 18. 12. The EHV-1 vector of claims 3 to 11 or the expression cassette of claim 1, wherein said nucleotide sequence of interest is not naturally occurring and/or is recombinant. 13. EHV-1 vector according to claims 3 to 12 or an expression cassette according to claim 1 or 2, wherein said nucleotide sequence of interest is recombinant and/or heterologous and/or exogenous. 14. The EHV-1 vector of claims 8 to 13 or the expression cassette of claim 2, wherein the antigen-coding region relates to a pathogen that infects pigs or cattle used for food production. 15. EHV-1 vector according to claims 3-14 or an expression cassette according to claim 1 or 2, including additional regulatory sequences, such as a stop codon or a polyadenylation sequence. 16. The EHV-1 vector of claims 3 to 15, comprising at least one additional nucleotide sequence of interest, preferably another gene of interest, more preferably an antigen coding sequence. 17. The EHV-1 vector of claim 16 further includes an antigen coding sequence inserted into another insertion site, such as ORF1/3. 18. The EHV-1 vector of claims 6 to 17 or the expression cassette of claim 1, wherein the promoter sequence(s) are operably linked to one or two or more sequences selected from the group consisting of: SV40 large T, HCMV and MCMV immediate early gene 1, human elongation factor alpha promoter, baculovirus polyhedrin promoter, functional fragment from 4pgG600 (SEQ ID NO: 1), preferably said functional fragment is p430 (SEQ ID NO: 3), functional fragment from the complementary nucleotide sequence of 4pgG600 (SEQ ID NO: 1), functional fragment from 4pMCP600 (SEQ ID NO: 2), preferably - 56 046215 Specifically, the specified functional fragment is p455 (SEQ ID NO: 4), a functional fragment from the complementary nucleotide sequence of 4pMCP600 (SEQ ID NO: 2). 19. The EHV-1 vector of claim 18, wherein the various promoter sequences are operably linked to at least two sequences that are genes of interest. 20. The EHV-1 vector of claim 19, wherein the promoter sequence operably linked to the at least one gene of interest is p455 (SEQ ID NO: 4) or a functional fragment thereof or complementary nucleotide sequences thereof, and wherein the promoter sequence, operably linked to another gene of interest is p430 (SEQ ID NO: 3) or a functional fragment thereof or complementary nucleotide sequences thereof. 21. A mammalian host cell, characterized in that it contains a vector according to claims 3 to 20. 22. Use of the vector according to claims 3-20 for the preparation of an immunogenic composition or vaccine. 23. Use of a mammalian host cell according to claim 21 for the preparation of an immunogenic composition or vaccine. 24. An immunogenic composition for reducing or preventing clinical symptoms or disease caused by infection with a pathogen, containing a) vector according to paragraphs 3-20 and b) a pharmaceutically acceptable carrier or excipient. 25. A vaccine for reducing or preventing clinical symptoms or disease caused by infection with a pathogen, containing a) vector according to paragraphs 3-20 and b) a pharmaceutically acceptable carrier or excipient. 26. A method of preparing an immunogenic composition or vaccine for reducing or preventing clinical symptoms or disease caused by infection with a pathogen, comprising the following steps: a) infecting a mammalian host cell according to claim 21 using a vector according to claims 3 to 20, b) culturing infected cells under suitable conditions, c) collection of infected cell cultures, d) purification of the supernatant of infected cell cultures from stage c), e) mixing said collected supernatant of the infected cell culture with a pharmaceutically acceptable carrier. 27. A method of immunizing a pig or cattle against a clinical disease caused by a pathogen in said animal, wherein said method includes the step of administering to the animal an immunogenic composition according to claim 24 or a vaccine according to claim 25, wherein said immunogenic composition or vaccine cannot cause clinical symptoms of infection, but is capable of inducing an immune response that immunizes said animal against pathogenic forms of said pathogen. 28. A kit for immunizing a pig or cattle against a disease caused by a pathogen in the specified animal, and/or for reducing the frequency or severity of one or more clinical symptoms associated with or caused by the pathogen in the animal, containing: a) a dispenser for administering the vaccine to the specified animal, and b) an immunogenic composition according to claim 24 or a vaccine according to claim 25, and c) instruction leaflet. -