EA046088B1 - RNA-TAGING LIGANDS AND THEIR APPLICATION - Google Patents

Description

Field of technology

The present invention relates to compounds that bind to a target RNA molecule, such as the TPP riboswitch, and the use of these compounds. The compounds contain two structurally distinct moieties that allow binding to a target RNA at two different binding sites, thereby producing a binding ligand with higher affinity compared to compounds that bind to only one RNA binding site.

Incorporating a sequence listing by reference

The material in the accompanying sequence listing is hereby incorporated by reference into the present invention in its entirety. The accompanying file, named Sequence Listing 39397600002_ST25, was created on August 5, 2020 and is 4 KB in size.

Governmental support

The present invention was made with government support under Grant Nos. GM098662 and AI068462 awarded by the National Institutes of Health (NIH). The government has certain rights to an invention.

State of the art

The vast majority of small molecule ligands are primarily designed to manipulate biological systems by targeting proteins. Proteins have highly complex three-dimensional structures that are critical for their proper function and include clefts and pockets in which small molecule ligands can bind ^1,2 . The transcriptome, the collection of all RNA molecules produced in the body, also includes promising targets for studying and manipulating biological systems. For example, RNA transcriptomes not only play important roles in mammalian systems, but are also present in both bacteria and viruses and thus represent targets for small molecules to modulate gene expression.

It is noteworthy that RNA can adopt three-dimensional structures of complexity comparable to those of proteins ³ , a key property required for the development of highly selective ligands ⁴ , and RNAs play a dominant role in controlling the behavior of biological systems ⁵ . Originally viewed as simply a carrier of genetic information that exists solely to convey the message of protein coding and control of the process of protein biosynthesis, the modern view of RNA has evolved to embrace an expanded role, where a wide range of RNA molecules are now known to have broad and far-reaching roles. role in modulating gene expression and other biological processes through various mechanisms. Even a large number of newly discovered non-coding RNAs have been found to be associated with diseases such as cancer and non-carcinogenic diseases. Thus, the realization that RNAs contribute to disease states beyond encoding pathogenic proteins provides many previously unknown therapeutic targets.

However, although it has been shown that small molecule ligands can bind to mRNA and can potentially increase or decrease translation efficiency, thereby regulating protein expression in cells ^6,7 , there are challenges associated with identifying small molecule RNA ligands that do not collide when targeting proteins ^4,11,12 . This also includes the development of small molecules targeting noncoding RNAs, which also represent a rich set of targets ^{8 - 10} . Unfortunately, despite the development of various techniques for analyzing RNA structure and the discovery of new functions, the ability to effectively and quickly identify or develop inhibitors that bind to RNA and disrupt its function has lagged far behind. Thus, there is a great need in the art to develop new methods and technologies to quickly and efficiently identify small molecule ligands targeting RNA molecules.

The essence of the invention

As mentioned above, the transcriptome represents a promising but underexploited set of small molecule ligand targets. Small molecule ligands (and ultimately drugs) targeting messenger RNAs and non-coding RNAs have the potential to modulate cellular health and disease. In the present invention, fragment-based screening strategies using selective 2'-hydroxyacylation assayed by primer extension (SHAPE) and SHAPE mutational profiling (MaP) for RNA structure were used to detect low molecular weight fragments that bind to target RNA structure . In particular, fragments and cooperatively binding fragment pairs have been identified that bind the TPP riboswitch with millimolar to micromolar affinities. Structure-activity relationship (SAR) studies were conducted to provide information for the efficient design of a tethered ligand moiety that binds to the TPP riboswitch with high nanomolar affinity. The principles herein are not intended to limit the TPP riboswitch, but may also be broadly applicable to other target RNA structures using cooperativity and multisite

- 1 046088 binding for the development of high quality ligands for various RNA targets.

Thus, one aspect of the subject matter of the invention described herein is a compound with the structure of formula (II):

where X _2a and X _2b represent CR1;

X1 and _X3 represent N;

L selected from

where q and r are independently selected from the integers 0, 1, 2, 3, 4 and 5; z is independently selected from the integers 1, 2, 3, 4 and 5; And

A is selected from where X ₄ and X7 are CR ₃ , and X ₅ and X6 are independently selected from CR ₃ and N;

where R ₁ and R ₃ represent -H;

m represents 1;

W represents -O or -NR4, where R4 represents -H; or a pharmaceutically acceptable salt thereof.

Another aspect of the subject matter of the invention described herein includes the use of a compound described herein as an agent that binds to a region of a coding RNA molecule, wherein the coding RNA molecule is an mRNA and the region of the mRNA is a TPP riboswitch.

Additional aspects of the subject matter of the invention described herein will be presented below.

Brief description of graphic materials

In fig. Figure 1 shows workflow diagrams for screening constructs and RNA fragments. RNA motifs 1 and 2, helix barcode; the spirals of the cassette structure are shown. RNA is probed using SHAPE in the presence or absence of a small molecule fragment, and chemical modifications corresponding to ligand-dependent structural information are read using multiplex MaP sequencing.

In fig. Figure 2 shows representative comparisons of mutation rates for hit fragments and non-hit fragments. Normalized mutation frequencies for samples exposed to fragments are labeled +ligand, +2, or +4 and compared to non-ligand traces labeled as no-ligand. Statistically significant changes in mutation rates are indicated by triangles (see Fig. 8 for SHAPE validation data). (top) Comparison of mutation rates for a representative fragment that does not bind to the test construct. (middle) Hit fragment in the TPP riboswitch region of RNA. (bottom) A nonspecific hit that causes changes in reactivity throughout the test construct. Motif landmarks 1 and 2 are shown below the SHAPE profiles.

In fig. 3A and 3B show a comparison of the structures of the TPP riboswitch bound by fragment 17 (FIG. 3A) and (FIG. 3B) the native TPP ligand (2HOJ ²⁸ ). RNA structures are shown in the same orientation in each image. Hydrogen bonds between ligands and RNA are shown by dotted lines.

In fig. 4A and 4B show the thermodynamic cycle and stepwise ligand binding affinity for fragments 2 and 31. FIG. 4A shows a summary of fragment binding by compound 2 (dark gray,

- 2 046088

K1) and connection 31 (light gray, K2). KD values are determined by ITC. In fig. 4B shows ITC data showing single-component and co-binding by moieties 2 and 31. The coupling of the two moieties shows an additive effect in binding energies, resulting in a submicromolar ligand, compound 37 (KL). ITC traces are shown as background traces (ligand titrated in buffer) in light grey, experimental traces are shown in dark grey. Curve fits are shown with 95% confidence intervals in gray.

In fig. Figure 5 shows the covalent binding of fragments 17 and 31 depending on the type and length of the linker, the chemotype of the end group and the orientation of the end group. Modifications that increase RNA binding affinity are present in compounds 36 and 37 (light gray); a negative modification is present in compounds 35, 39 and 40 (light gray), and a neutral modification is present in compound 38 (light gray). Dissociation constants are determined by ITC.

In fig. 6 shows a comparison of fragment-linker-fragment ligands produced by fragment-based methods ordered by their binding coefficient (E). Values are shown on the logarithmic axis. Cooperative binding corresponds to lower values of E (upper part of the vertical axis). Fragment 37 has an E value of 2.5 and an LE value of 0.34 Dissociation constants for individual fragments (left, middle) and bound ligand (right) are indicated below the composite fragments; E value (top) and ligand efficiency (bottom) are shown. The covalent bond introduced between the fragments is highlighted in light gray. The structures of component fragments are described in detail in Table. 7.

In fig. 7A and 7B show the design of the screening structure. In fig. 7A shows the RNA sequence (SEQ ID NO: 6) with the following components: GGUCGCGAGUAAUCGCGACC (SEQ P) NO: 7) is a structural cassette; GOJGCAAGAGAUUGUAGC (SEQ ID NO: 8) is an RNA barcode (NT barcode is underlined); GUGGGCACUUCGGUGUCCAC (SEQ ID NO: 9) is a structural cassette;

ACGCGAAGGAAACCGCGUGUCAACUGUGCAACAGCUGACAAAGAGAUUCCU (SEQ ID NO: 10) _{πηρττρτ3β} ^v n represents a DENV pseudoknot (mutations in bold); AAAACU is a linker;

CAGUACUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUC

UGGAUAUGCCAGCGUAGGGAAGUGCUG (SEQ ID NO: 11) is a TPP riboswitch (mutations in bold); And

GAUCCGGUUCGCCGGAUCAAUCGGGCUUCGGUCCGGUUC (SEQ ID NO: 12) is a structural cassette. In fig. 7B shows the secondary structure of an RNA sequence barcode in the context of its self-folding hairpin.

In fig. Figure 8 shows the SHAPE profiles for hits, non-hits, and non-specific hit fragments. Mutation rate curves corresponding to control curves with fragment and without ligand are highlighted in solid gray and outlined in black, respectively. Nucleotides that are statistically significantly different in samples with and without fragments are indicated by triangles. Mutation rate curves for the same fragments are shown schematically in FIG. 2.

Detailed description

The subject matter of the invention described herein will now be described more fully hereinafter. However, many modifications and other embodiments of the subject matter described herein will come to mind to one skilled in the art to which the subject matter of the invention described herein relates, taking into account the principles presented in the preceding descriptions. Accordingly, it is to be understood that the subject matter described herein is not intended to be limited to the specific embodiments described, and that modifications and other embodiments are intended to be included within the scope of the appended claims. In other words, the subject matter of the invention described herein covers all alternatives, modifications and equivalents. To the extent that one or more of the included literature, patents and similar materials differ from or conflict with this invention, including, but not limited to, defined terms, use of terms, techniques described, etc., the present invention shall control. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety.

Definitions.

As used herein, the term alkyl group refers to a saturated hydrocarbon radical containing 1 to 8, 1 to 6, 1 to 4, or 5 to 8 carbon atoms. In some embodiments, the saturated radical contains more than 8 carbon atoms. An alkyl group is structurally similar to a non-cyclic alkane compound modified by removing one hydrogen from the non-cyclic alkane and therefore replacing a non-hydrogen group or radical.

- 3 046088

Alkyl group radicals may be branched or unbranched. Radicals of lower alkyl groups have from 1 to 4 carbon atoms. Radicals of higher alkyl groups have from 5 to 8 carbon atoms. Examples of alkyl, lower alkyl and higher alkyl radicals include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, amyl, tamil, n-pentyl, n-hexyl, isooctyl and similar radicals.

As used herein, the designations (CO) and C(O) are used to denote a carbonyl group. Examples of suitable carbonyl groups include, but are not limited to, ketone and aldehyde groups.

The term cycloalkyl refers to a hydrocarbon with 3-8 members, or 3-7 members, or 3-6 members, or 3-5 members, or 3-4 members, and may be monocyclic or bicyclic. The ring may be saturated or may have some degree of unsaturation. Cycloalkyl groups may optionally be substituted with one or more substituents. In one embodiment, 0, 1, 2, 3, or 4 atoms of each ring of the cycloalkyl group may be replaced by a substituent. Representative examples of the cycloalkyl group include cyclopropyl, cyclopentyl, cyclohexyl, cyclobutyl, cycloheptyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl and the like.

The term aryl refers to a hydrocarbon monocyclic, bicyclic or tricyclic aromatic ring system. Aryl groups may optionally be substituted with one or more substituents. In one embodiment, 0, 1, 2, 3, 4, 5, or 6 atoms of each ring of the aryl group may be replaced by a substituent. Examples of aryl groups include phenyl, naphthyl, anthracenyl, fluorenyl, indenyl, azulenyl and the like.

The term heteroaryl refers to aromatic 5-10 membered ring systems where the heteroatoms are selected from O, N or S and the remaining ring atoms are carbon (with corresponding hydrogen atoms unless otherwise noted). Heteroaryl groups may optionally be substituted with one or more substituents. In one embodiment, 0, 1, 2, 3, or 4 atoms of each ring of the heteroaryl group may be replaced by a substituent. Examples of heteroaryl groups include pyridyl, furanyl, thienyl, pyrrolyl, oxazolyl, oxadiazolyl, imidazolyl, thiazolyl, isoxazolyl, quinolinyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, isoquinolinyl, indazolyl and the like.

As used herein, the term substituted refers to a group (such as heteroaryl, aryl, alkyl and/or alkenyl) where the group is bonded to one or more additional organic or inorganic radical substituents. In some embodiments, the substituted group contains 1, 2, 3, 4, or 5 additional substituent groups or radicals. Suitable organic and inorganic radical substituents include, without limitation, hydroxyl, cycloalkyl, aryl, substituted aryl, heteroaryl, heterocyclic ring, substituted heterocyclic ring, amino, monosubstituted amino, disubstituted amino, acyloxy, nitro, cyano, carboxy, carboalkoxy, alkylcarboxamide, substituted alkylcarboxamide, dialkylcarboxamide, substituted dialkylcarboxamide, alkylsulfonyl, alkylsulfinyl, thioalkyl, alkoxy, substituted alkoxy or haloalkoxy radicals, where the terms are defined herein. Unless otherwise specified herein, organic substituents may contain from 1 to 4 or from 5 to 8 carbon atoms. When a substituted group is bonded to more than one substituent radical, then the substituent radicals may be the same or different.

As used herein, the term unsubstituted refers to a group (such as heteroaryl, aryl, alkenyl and/or alkyl) that is not bonded to one or more additional organic or inorganic radical substituents as described above, which means that such group is substituted only hydrogen.

It should be understood that the structures presented herein and any listing of substitution or substituted include the implicit condition that such structures and substitution correspond to the allowed valency of the substituted atom and substituent, and that the substitution results in a stable compound, for example, that does not spontaneously undergo a transformation such as rearrangement, cyclization, elimination, etc.

As used herein, the term RNA refers to ribonucleic acid, which is a polymer molecule required to perform various biological roles in the encoding, decoding, regulation and expression of genes. RNA and DNA are nucleic acids and, together with lipids, proteins and carbohydrates, constitute the four basic macromolecules required for all known forms of life. Like DNA, RNA is assembled as a chain of nucleotides, but unlike DNA, RNA occurs in nature as a single strand folded onto itself rather than as a paired double strand. Cellular organisms use messenger RNA (mRNA) to convey genetic information (using the nitrogenous bases guanine, uracil, adenine, and cytosine, designated G, U, A, and C) that directs the synthesis of specific proteins. Many viruses encode their genetic information using genomic RNA. Some RNA molecules play an active role inside cells, catalyzing biological reactions, controlling ex

- 4 046088 gene compression or by sensing and transmitting responses to cellular signals. One such active process is protein synthesis, a universal function in which RNA molecules direct the synthesis of proteins on ribosomes. This process uses transfer RNA (tRNA) molecules to deliver amino acids to the ribosome, where ribosomal RNA (rRNA) then binds the amino acids together to form encoded proteins.

As used herein, the term non-coding RNA (ncRNA) refers to an RNA molecule that is not translated into protein. The DNA sequence from which functional non-coding RNA is transcribed is often called the RNA gene. Abundant and functionally important types of noncoding RNAs include transfer RNAs (tRNAs) and ribosomal RNAs (rRNAs), as well as small RNAs such as microRNAs, siRNAs, piRNAs, snoRNAs, snRNAs, cRNAs, mtcRNAs, and long ncRNAs such as Xist and HOTAIR.

As used herein, the term coding RNA refers to RNA that codes for a protein, i.e. messenger RNA (mRNA). Such RNAs contain a transcriptome.

As used herein, the term riboswitch refers to a regulatory segment of a messenger RNA molecule that binds a small molecule, resulting in a change in the production of the protein encoded by the mRNA. Thus, the mRNA containing the riboswitch is directly involved in the regulation of its own activity in response to the concentration of its effector molecule.

As used herein, the term TPP riboswitch, also known as THI element and Thi-box riboswitch, refers to the highly conserved secondary structure of RNA. It serves as a riboswitch that directly binds to thiamine pyrophosphate (TPP) to regulate gene expression through different mechanisms in archaea, bacteria and eukaryotes. TPP is the active form of thiamine (vitamin B1), an essential coenzyme synthesized by linking pyrimidine and thiazole groups in bacteria.

As used herein, the term pseudoknot refers to a secondary nucleic acid structure containing at least two stem-loop structures in which half of one stem is inserted between two halves of another stem. Pseudoknot was first discovered in turnip yellow mosaic virus in 1982. Pseudoknots fold into three-dimensional knot-shaped conformations but are not true topological knots.

An aptamer refers to a nucleic acid molecule that is capable of binding to a specific molecule of interest with high affinity and specificity (Tuerk and Gold, 1990; Ellington and Szostak, 1990), and can either be engineered by humans or obtained naturally. The binding of a ligand to an aptamer, which is typically RNA, changes the conformation of the aptamer and the nucleic acid within which the aptamer is located. In some cases, the conformational change inhibits translation of the mRNA in which the aptamer is located, for example, or otherwise interferes with the normal activity of the nucleic acid. Aptamers may also be composed of DNA or may contain unnatural nucleotides and nucleotide analogues. Most often, an aptamer is obtained by in vitro selection for binding to a target molecule. However, in vivo selection of the aptamer is also possible. The aptamer is also the ligand-binding domain of the riboswitch. The aptamer length is typically from about 10 to about 300 nucleotides. Most often, the aptamer length is from about 30 to about 100 nucleotides. See, for example, US6949379, incorporated herein by reference. Examples of aptamers that can be used for the present invention include, but are not limited to, the PSMA aptamer (McNamara et al., 2006), the CTLA4 aptamer (Santulli-Marotto et al., 2003), and the 4-1BB aptamer (McNamara et al., 2007 ).

As used herein, PCR stands for polymerase chain reaction and refers to a technique widely used in molecular biology to rapidly make millions to billions of copies of a particular DNA sample, allowing scientists to take a very small sample of DNA and amplify it to a quantity large enough to study in detail. .

The phrase pharmaceutically acceptable indicates that the substance or composition is chemically and/or toxicologically compatible with the other ingredients contained in the composition and/or with the subject it is treating.

The phrase pharmaceutically acceptable salt as used herein refers to pharmaceutically acceptable organic or inorganic salts of a compound of the invention. Examples of salts include, but are not limited to, sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, hydrophosphate, isonicotinate, lactate, salicylate, hydrocitrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate , maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate mesylate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, pamoate (i.e. 1,1'-methylene-bis-(2hydroxy-3- naphthoate) salt, alkali metal salts (for example, sodium and potassium), alkaline earth metal salts (for example, magnesium) and ammonium salts. The pharmaceutically acceptable salt may include the inclusion of another molecule, such as an acetate ion, succinate ion, or other counterion. Against

- 5 046088 ion can be any organic or inorganic moiety that stabilizes the charge of the parent compound. In addition, a pharmaceutically acceptable salt may have more than one charged atom in its structure. In cases where multiple charged atoms are part of a pharmaceutically acceptable salt, the salt may have multiple counterions.

Therefore, a pharmaceutically acceptable salt may have one or more charged atoms and/or one or more counterions.

As used herein, the term carriers includes pharmaceutically acceptable carriers, excipients or stabilizers that are non-toxic to the cell or mammal exposed to them at the dosages and concentrations used. Often the physiologically acceptable carrier is a pH buffered aqueous solution. Non-limiting examples of physiologically acceptable carriers include buffers such as phosphate, citrate and other organic acids; antioxidants, including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates, including glucose, mannose or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or non-ionic surfactants such as TWEEN™, polyethylene glycol (PEG) and PLURONICS™. In some embodiments, the pharmaceutically acceptable carrier is a non-natural pharmaceutically acceptable carrier.

The terms treat and treatment refer to both therapeutic treatment and prophylactic or prophylactic measures whose purpose is to prevent or slow (reduce) an undesirable physiological change or disorder, such as the development or spread of cancer. For purposes of the present invention, beneficial or desirable clinical outcomes include, but are not limited to, relief of symptoms, reduction in disease extent, stabilization (i.e., non-worsening) of disease state, delay or slowing of disease progression, improvement or temporary relief of disease state, and remission (partial or complete), detectable or undetectable. Treatment may also mean longer survival than would be expected if no treatment was given. Those in need of treatment include those who already have the condition or disorder, as well as those who are prone to the condition or disorder, or those in whom the condition or disorder needs to be prevented.

The term administration or administration includes routes for administering the compound(s) to a subject to perform their intended function. Examples of routes of administration that may be used include injection (including, without limitation, subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal), topical, oral, inhalation, rectal, and transdermal.

The term effective amount includes an amount effective in doses and for periods of time necessary to achieve the desired result. The effective amount of the compound may vary depending on factors such as the disease state, age and weight of the subject, and the ability of the compound to produce the desired response in the subject. Dosage regimens may be adjusted to ensure optimal therapeutic response.

The phrases systemic administration, systemically administered, peripheral administration, and peripherally administered, as used herein, mean the administration of a compound(s), drug, or other material such that it enters the patient's body and thereby undergoes metabolism and other similar processes. .

The phrase therapeutically effective amount means an amount of a compound of the present invention that (i) treats or prevents a particular disease, condition or disorder, (ii) reduces, alleviates or eliminates one or more symptoms of a particular disease, condition or disorder, or (iii) prevents or delays the onset of one or more symptoms of a specific disease, condition or disorder described herein. In the case of cancer, a therapeutically effective amount of a drug can reduce the number of cancer cells; reduce tumor size; inhibit (ie, to some extent slow and preferably stop) the infiltration of cancer cells into peripheral organs; inhibit (ie, to some extent slow down and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or alleviate to some extent one or more symptoms associated with cancer. To the extent that a drug can prevent the growth and/or kill existing cancer cells, it may be cytostatic and/or cytotoxic. For cancer therapy, efficacy can be measured, for example, by assessing time to progression (TTP) and/or determining response rate (RR).

The term subject refers to animals such as mammals, including, without limitation, primates (eg, humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, and the like. In some embodiments, the subject is a human.

The present description is directed to a fragment-based ligand discovery strategy, under

- 6 046088 used to identify small molecules that bind to specific regions of RNA with high affinity. Typically, fragment-based ligand discovery identifies one or more small-molecule fragments with low to moderate affinity that bind to the target of interest. These fragments are then either modified or linked to create more potent ligands ^13,14 . Typically, these fragments have a molecular weight of less than 300 Da, and in order to be detected, they make significant high-quality contacts with the target of interest.

Fragment‐based ligand detection has so far only been successfully used to identify initial hit compounds, which are single‐fragment hits that bind to a given RNA ^{15 - 19} . The identification of multiple fragments that bind the same RNA will make it possible to exploit potential additive and cooperative interactions between fragments within the binding pocket ^20,21 . However, it has recently been shown that many RNAs bind their ligands through multiple subsites, which are regions of the binding pocket that contact the ligand in an independent or cooperative manner ²² . Furthermore, it has been shown that high-affinity RNA binding can occur even when subsite binding shows only modest cooperative effects. These features bode well for the performance of fragment-based ligand detection when applied to RNA targets.

Thus, based on the foregoing, the present disclosure is directed to methods for identifying fragments that bind to an RNA of interest, such as, for example, the TPP riboswitch. Second, the described methods are aimed at establishing the binding position of a fragment in RNA at approximate nucleotide resolution. Third, the described methods are aimed at identifying second site fragments that bind near the hit site of the original fragment. The described method combines a fragment-based approach to ligand discovery with SHAPE-MaP RNA structure probing, ^23,24 which has been used both to identify RNA-binding fragments and to identify individual fragment binding sites. The ligand ultimately created by binding the two fragments bears no similarity to the native riboswitch ligand and binds the structurally complex TPP riboswitch RNA with high affinity.

The described methods and identification of ligands will be described in more detail below.

A. Connections.

The first aspect of the subject matter of the invention described herein is a compound having the structure of formula (II):

where X _2a and X _2b represent CR1;

X1 and X3 represent N;

L selected from

where q and r are independently selected from the integers 0, 1, 2, 3, 4 and 5; z is independently selected from the integers 1, 2, 3, 4 and 5; And

A selected from

- 7 046088 where X ₄ and X7 represent CR ₃ , and X5 and X6 are independently selected from CR ₃ and N;

where R ₁ and R ₃ represent -H;

m represents 1;

W represents -O or -NR4, where R4 represents -H; or a pharmaceutically acceptable salt thereof.

As in any of the above embodiments, a compound having the structure of formula (III):

where L and A are the same as for formula (II).

As with any of the above embodiments, a join where q and r are independently selected from the integers 0, 1, 2, and 3.

As with any of the above embodiments, the connection where L represents

As with any of the above implementations, a connection where q and r represent 0 or 1.

As with any of the above implementations, the connection where q is 1.

As with any of the above embodiments, a join where r is 1.

As with any of the above implementations, join where r represents 0.

As with any of the above implementations, a connection where q and r are 1.

As with any of the above embodiments, a join where q is 1 and r is 0.

As in any of the above embodiments, the compound where W represents NH.

As with any of the above embodiments, the connection where X5 represents N.

As with any of the above embodiments, the connection where X6 represents N.

As in any of the above embodiments, a compound wherein X ₅ or X ₆ is N and both X4 and X7 are independently CR3.

As in any of the above embodiments, the connection where A represents

As in any

As in any

As with any of the above embodiments, the connection where L represents

of the above embodiments, a connection where z represents 2. of the above embodiments, a connection where A is

As in any of the above connection implementations, where said connection has the structure:

- 8 046088

Q.

or a pharmaceutically acceptable salt thereof.

As in any of the above connection implementations, where said connection has the structure:

or a pharmaceutically acceptable salt thereof.

B. Screening methods.

The present disclosure aims to develop and validate a flexible, selective 2'hydroxyacylation assay analyzed by the Screening for Fragments Based on Primer Extension (SHAPE) method. Fragment-based ligand detection has proven to be an effective approach for identifying compounds that form significant close contacts with macromolecules, including RNA ^13,14,17 . A prerequisite for the success of this discovery strategy is a customizable, high-quality, biophysical assay to detect ligand binding. Thus, in some embodiments, the SHAPE RNA structure assay, which measures local nucleotide flexibility as the relative reactivity of the 2'-hydroxyl group of ribose with respect to electrophilic reagents, was used to detect ligand binding ^23-25 . SHAPE can be used for any RNA and provides data on virtually all nucleotides in the RNA in a single experiment, providing information on the structure of each nucleotide in addition to simple binding detection, and is described in more detail below. In addition, the present description also addresses the application of SHAPE mutational profiling (MaP) ^23,24 , which combines SHAPE with high-throughput sequencing reads, allowing multiplexing and efficient high-throughput analysis of many thousands of samples.

Thus, in some embodiments, the present disclosure provides a screening method using SHAPE and/or SHAPE-MaP to identify small molecule fragments and/or compounds that bind and/or associate with an RNA molecule of interest. The methods described herein further include the use of SHAPE and/or SHAPE-MaP to identify small molecule fragments (e.g., fragment 2) that bind and/or associate with an RNA molecule that has already been preincubated with another small molecule fragment (e.g., fragment 1). Without being limited by theory, it is believed that fragment 1 binds to a first binding site and fragment 2 binds to a second binding site (eg, subsite) in the same RNA molecule. Thus, it is believed that combining the structural features of fragment 1 and fragment 2 (e.g., connecting the two fragments with linker L) to create compounds as described herein provides the ligands of the linked fragments with increased RNA binding affinity compared to fragment 1 and/or fragment 2 alone.

The SHAPE and SHAPE-MaP screening methods are described in more detail below.

I. Chemistry SHAPE.

SHAPE chemistry is based, at least in part, on the observation that the nucleophilicity of ribose at the 2′ position of RNA is sensitive to the electronic influence of the adjacent 3′ phosphodiester group. Unconstrained nucleotides try more conformations that increase the nucleophilicity of the 2'hydroxyl group than base-paired or otherwise constrained nucleotides. Consequently, hydroxyl-selective electrophiles, such as, but not limited to, N-methylisatoic anhydride (NMIA), more readily form stable 2'-O-adducts with flexible RNA nucleotides. Local nucleotide flexibility can be examined simultaneously at all positions of the RNA molecule in one experiment, since all RNA nucleotides (with the exception of a few cellular RNAs that carry post-transcriptional modifications) have a 2'-hydroxyl group. Absolute SHAPE reactivity can be compared across all positions in RNA because 2′-hydroxyl reactivity is insensitive to base identity. It is also possible that the nucleotide may be reactive because it is located

- 9 046088 in a conformation that increases the nucleophilicity of the particular 2'-hydroxyl. This class of nucleotides is expected to be rare, to involve non-canonical local geometry, and to be correctly scored as an unpaired position.

The disclosed subject matter now provides, in some embodiments, methods for discovering structural data in an RNA molecule by examining structural constraints in an RNA molecule of arbitrary length and structural complexity. In some embodiments, the methods include annealing an RNA molecule containing 2'-O-adducts to a (labeled) primer; annealing an RNA molecule containing no 2'-O-adducts with a (labeled) primer as a negative control; extension of primers to obtain a cDNA library; cDNA analysis; and generating output files containing structural data for the RNA.

An RNA molecule may be present in a biological sample. In some embodiments, the RNA molecule may be modified in the presence of a protein or other small or large biological ligands and/or compounds. The primers may optionally be labeled with radioisotopes, fluorescent tags, heavy atoms, enzymatic tags, a chemiluminescent group, a biotinyl group, a predetermined polypeptide epitope recognized by a secondary reporter, or combinations thereof. The analysis may involve separation, quantification, sizing, or a combination of these. The analysis may involve extracting fluorescence or dye amount data as a function of elution time data, called traces. For example, cDNA can be analyzed in a single column of a capillary electrophoresis instrument or in a microfluidic device.

In some embodiments, the peak area of the curves for an RNA molecule containing 2'-O-adducts and for an RNA molecule not containing 2'-O-adducts can be calculated relative to the nucleotide sequence. The curves can be compared and aligned with RNA sequences. The curves observed and accounting for those cDNAs generated by sequencing are one nucleotide longer than the corresponding positions in the footprints for RNA containing 2'-O-adducts and for an RNA molecule not containing 2'-O-adducts. The areas under each peak can be determined by performing a Gaussian integration of the entire curve.

Thus, in some embodiments, provided herein are methods for forming covalent 2'-O-adducts of ribose with an RNA molecule in complex biological solutions. In some embodiments, the method includes contacting an electrophile with an RNA molecule, where the electrophile selectively modifies free nucleotides in the RNA molecule to form a covalent H-O-ribose adduct.

In some embodiments, an electrophile, such as, but not limited to, N-methylisatoic anhydride (NMIA), is dissolved in an anhydrous polar aprotic solvent such as DMSO. The reagent-solvent solution is added to a complex biological solution containing an RNA molecule. The solution may contain varying concentrations and quantities of proteins, cells, viruses, lipids, mono- and polysaccharides, amino acids, nucleotides, DNA, and various salts and metabolites. The concentration of the electrophile can be adjusted to achieve the desired degree of modification of the RNA molecule. The electrophile can react with all the free hydroxyl groups in solution, forming 2'O-ribose adducts on the RNA molecule. In addition, the electrophile can selectively modify unpaired or otherwise unrestricted nucleotides in the RNA molecule.

An RNA molecule can be exposed to an electrophile at a concentration that results in rare modification of the RNA to form 2'-O-adducts, which can be detected by the ability to inhibit primer extension by reverse transcriptase. All RNA sites can be examined in a single experiment because the chemistry targets the overall reactivity of the 2'-hydroxyl group. In some embodiments, an electrophile exclusion control extension reaction can be performed in parallel to evaluate background, as well as dideoxy sequencing extension to determine nucleotide positions. These combined steps are called selective 2'hydroxyacylation assayed by primer extension, or SHAPE.

In some embodiments, the method further comprises contacting an RNA molecule containing a 1'-O-adduct with a (labeled) primer, contacting RNA not containing the 2'O-adduct with a (labeled) primer as a negative control; primer extension to produce a linear cDNA array, cDNA analysis, and generation of output files containing RNA structural data.

The number of nucleotides examined in a single SHAPE experiment depends not only on the detection and resolution of the separation technology used, but also on the nature of the RNA modification. Given the reaction conditions, there is a length at which almost all RNA molecules have at least one modification. When primer extension reaches these lengths, the number of cDNAs being extended decreases, weakening the experimental signal. Adjusting conditions to reduce modification yield can increase read length. However, reducing the reagent yield may also reduce the measured signal for each cDNA length. Given these considerations, the preferred maximum length of a single SHAPE read is probably, without limitation, about 1

- 10,046,088 kilobases of RNA.

II. SHAPE-MaP.

In SHAPE-MaP, SHAPE adducts are detected using mutational profiling (MaP), which exploits the ability of reverse transcriptase enzymes to incorporate non-complementary nucleotides or create deletions at the sites of SHAPE chemical adducts. In some implementations, SHAPE-MaP can be used for library construction and sequencing. In some implementations, SHAPE-MaP may use multiplexing techniques.

Typically, RNA is treated with the SHAPE reagent, which reacts to conformationally dynamic nucleotides. During reverse transcription, the polymerase reads chemical adducts in the RNA and incorporates a nucleotide that is not complementary to the original sequence into the cDNA. The resulting cDNA is sequenced using any massively parallel approach to generate mutational profiles (MaP). Sequencing reads are aligned to a reference sequence, and nucleotide-resolution mutation rates are calculated, background-corrected, and normalized to yield a standard SHAPE reactivity profile. SHAPE reactivity can then be used to model secondary structures, visualize competing and alternative structures, or quantify any process or function that modulates local RNA nucleotide dynamics. After SHAPE modification of the RNA molecule, reverse transcriptase is used to create a mutational profile. At this stage, the position and relative frequency of SHAPE adducts as mutations in the cDNA are encoded. The cDNA is converted to dsDNA using methods known in the art (eg, PCR reactions), and the dsDNA is further amplified in a second PCR reaction, thereby adding sequencing for multiplexing. After purification, sequencing libraries are uniform in size and each DNA molecule contains the entire sequence of interest.

Thus, in accordance with some embodiments of the subject matter described herein, methods are provided for detecting one or more chemical modifications in a nucleic acid. In some embodiments, the method includes obtaining a nucleic acid that is believed to have a chemical modification; synthesizing a nucleic acid using a polymerase and the resulting nucleic acid as a template, where the synthesis occurs under conditions where the polymerase reads a chemical modification in the resulting nucleic acid to thereby produce an incorrect nucleotide in the resulting nucleic acid at the site of the chemical modification; and detection of incorrect nucleotide.

In accordance with some embodiments of the subject matter described herein, methods are provided for detecting structural data in a nucleic acid. In some embodiments, the method includes obtaining a nucleic acid that is believed to have a chemical modification; synthesizing a nucleic acid using a polymerase and the resulting nucleic acid as a template, where the synthesis occurs under conditions where the polymerase reads a chemical modification in the resulting nucleic acid to thereby produce an incorrect nucleotide in the resulting nucleic acid at the site of the chemical modification; detection of incorrect nucleotide; and generating output files containing structural data for the resulting nucleic acid.

In some embodiments of the subject matter described herein, the resulting nucleic acid is an RNA molecule (eg, a coding RNA and/or a non-coding RNA molecule). In some embodiments, the methods include detecting two or more chemical modifications. In some embodiments, the polymerase reads through multiple chemical modifications to produce multiple incorrect nucleotides, and the methods include detecting each incorrect nucleotide.

In some embodiments, the nucleic acid (eg, an RNA molecule) has been exposed to a reagent that provides a chemical modification, or a chemical modification already exists in the nucleic acid (eg, an RNA molecule). In some embodiments, the pre-existing modification is a 2'-O-methyl group and/or is created by the cell from which the nucleic acid is derived, such as, without limitation, an epigenetic modification and/or a 1-methyladenosine, 3-methylcytosine, 6 -methyladenosine, 3methyluridine and/or 2-methylguanosine. In some embodiments, nucleic acids, such as an RNA molecule, may be modified in the presence of protein or other small and large biological ligands and/or compounds.

In some embodiments, the reagent contains an electrophile. In some embodiments, the electrophile selectively modifies free nucleotides in the RNA molecule to form a covalent 2'-O-ribose adduct. In some embodiments, the reagent is 1 M7, 1 M6, NMIA, DMS, or combinations thereof. In some embodiments, the nucleic acid is present in or derived from a biological sample.

In some embodiments, the polymerase is a reverse transcriptase. In some embodiments, the polymerase is a native polymerase or a mutant

- 11 046088 polymerase. In some embodiments, the synthesized nucleic acid is cDNA.

In some embodiments, detection of an incorrect nucleotide involves nucleic acid sequencing. In some embodiments, the sequence information corresponds to the sequence of the resulting nucleic acid. In some embodiments, detection of an incorrect nucleotide involves the use of massively parallel nucleic acid sequencing. In some embodiments, the method includes amplifying a nucleic acid. In some embodiments, the method includes amplifying a nucleic acid using a site-targeted approach using specific primers, a whole genome using random priming, a whole transcriptome using random priming, or a combination thereof.

In accordance with some embodiments of the subject matter described herein, computer program products are provided comprising computer-executable instructions embodied in a computer-readable medium when performing steps including any method step of any embodiment of the subject matter described herein. In accordance with some embodiments of the subject matter described herein, nucleic acid libraries prepared by any method in accordance with the subject matter described herein are provided.

III. Electrophiles SHAPE.

As described above, SHAPE chemistry takes advantage of the discovery that the nucleophilic reactivity of the 2'-hydroxyl group of ribose is controlled by the local flexibility of the nucleotide. In nucleotides limited by base pairing or tertiary interactions, the 3'phosphodiester anion and other interactions reduce the reactivity of the 2'-hydroxyl. In contrast, flexible positions preferentially adopt conformations that react with an electrophile, including, but not limited to, NMIA, to form a 2'-O-adduct. For example, NMIA typically reacts with all four nucleotides and the reagent undergoes a parallel self-inactivating hydrolysis reaction. Indeed, the subject matter described herein provides that any molecule that can react with a nucleic acid as described herein can be used in accordance with certain embodiments of the subject matter described herein. In some embodiments, the electrophile (also referred to as a SHAPE reagent) may be selected from, without limitation, an isatoic anhydride derivative, a benzoyl cyanide derivative, a benzoyl chloride derivative, a phthalic anhydride derivative, a benzyl isocyanate derivative, and combinations thereof. The isatoic anhydride derivative may include 1methyl-7-nitroisatoic anhydride (1M7). The benzoyl cyanide derivative may be selected from the group including, but not limited to, benzoyl cyanide (BC), 3-carboxybenzoyl cyanide (3-CBC), 4-carboxybenzoyl cyanide (4-CBC), 3-aminomethylbenzoyl cyanide (3-AMBC), 4-aminomethylbenzoyl cyanide, and combinations thereof. The benzoyl chloride derivative may include benzoyl chloride (BCI). The phthalic anhydride derivative may include 4-nitrophthalic anhydride (4NPA). The benzyl isocyanate derivative may include benzyl isocyanate (BIC).

IV. Molecular design of RNA.

Because SHAPE reactivity can be assessed in one or more primer extension reactions, information may be lost both at the 5' end and near the primer binding site of the RNA molecule. Typically, adduct formation on the 10–20 nucleotides adjacent to the primer binding site is difficult to quantify due to the presence of cDNA fragments that reflect pausing or nontemplate extension by the reverse transcriptase (RT) enzyme during the initiation phase of primer extension. Positions 8–10 at the 5' end of the RNA are difficult to visualize due to the presence of excess full-length extension product.

To monitor SHAPE reactivity at the 5′ and 3′ ends of a sequence of interest, the RNA molecule can be inserted into a larger native sequence fragment or sandwiched between tightly folded RNA sequences that contain a unique primer binding site. In some embodiments, a structural cassette can be constructed containing 5' and 3' flanking nucleotide sequences so that all positions within an RNA molecule of interest can be assessed using any nucleotide resolution separation method, such as, but not limited to, gel sequencing , capillary electrophoresis, etc. In some embodiments, both 5' and 3' extensions can fold into stable hairpin structures that do not interfere with the folding of various internal RNAs. The cassette primer binding site can effectively bind to the cDNA primer. The sequence of any 5' and 3' structural cassette elements can be checked to ensure that they are not prone to form stable base-pairing interactions with internal sequence.

In some embodiments, the RNA molecule of interest contains two different target motifs that are linked by a nucleotide linker. The target motif can be any nucleotide sequence of interest. Typical target motifs include, but are not limited to, ribope

- 12 046088 switches, viral regulatory elements, structured regions in mRNA, multihelical compounds, pseudoknots and/or aptamers. In some embodiments, the first target motif is a pseudoknot, such as a pseudoknot from the 5'UTR of a dengue virus genome. In some embodiments, the second target motif is an aptamer domain, such as a TPP riboswitch aptamer domain. For a nucleotide linker, the number of nucleotides may vary. For example, in some embodiments, the number of nucleotides in the linker is from about 1 to about 20 nucleotides, from about 1 to about 15 nucleotides, from about 1 to about 10 nucleotides, or from about 5 to about 10 nucleotides (or is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides).

In some embodiments, the RNA molecule further comprises an RNA barcode region. The RNA barcode region is a unique barcode that allows the identification of a specific RNA molecule in a mixture of RNA molecules (for example, during multiplexing). The location of the RNA barcode region can vary, but it is usually located near one of the cassettes present in the RNA molecule. In some embodiments, the RNA barcode is designed to fold into a self-contained structure that does not interact with any other part of the RNA molecule. The structure of the RNA barcode region can vary. In some embodiments, the structure of the RNA barcode region comprises a base pair helix of about 1 to about 10 base pairs (or about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 base pairs). In some embodiments, the RNA barcode region contains 7 base pairs. In some embodiments, the base pairs are capped by a tetraloop attached to the terminal base pair of the base pair helix. The closure of the base pair helix maintains the overall stability of the hairpin region of the RNA barcode. In some embodiments, the tetraloop comprises a GNRA nucleotide sequence, but is not meant to be limited thereto. In some embodiments, the RNA barcode region is designed such that any individual barcode undergoes at least two mutations that may be misinterpreted as a different barcode.

V. Folding of the RNA molecule.

The subject matter of the invention described herein can be carried out using RNA molecules generated by methods including, but not limited to, in vitro transcription and RNA molecules generated in cells and viruses. In some embodiments, RNA molecules can be purified by denaturing gel electrophoresis and denatured to achieve a biologically relevant conformation. Additionally, any procedure that folds the RNA molecules into the desired conformation at the desired pH (e.g., around pH 8) can be substituted. RNA molecules can be first heated and then rapidly cooled in a low ionic strength buffer to eliminate multimeric forms. A folding solution can then be added to allow the RNA molecules to achieve the appropriate conformation and prepare it for structure-sensitive probing with an electrophile. In some embodiments, the RNA may be folded in a single reaction and then separated into (+) and (-) electrophilic reactions. In some embodiments, the RNA molecule is not natively folded before modification. Modification can occur when the RNA molecule is denatured by heat and/or low salt conditions.

VI. Modification of the RNA molecule.

An electrophile can be added to RNA to produce 2'-O-adducts at flexible nucleotide positions. The reaction can then be incubated until virtually all of the electrophile has either reacted with the RNA or has degraded due to hydrolysis by water. No special quenching step is required. Modification can occur in the presence of complex ligands and biomolecules, as well as in the presence of various salts. RNA can also be modified inside cells and viruses. These salts and complex ligands may include magnesium, sodium, manganese, iron and/or cobalt salts. Complex ligands may include, but are not limited to, proteins, lipids, other RNA molecules, DNA, or small organic molecules. In some embodiments, the complex ligand is a small molecule fragment, as described herein. In some embodiments, the complex ligand is a compound as described herein. The modified RNA can be purified from reaction products and buffer components that may interfere with the primer extension reaction, for example, by ethanol precipitation.

VII. Primer extension and polymerization.

Analysis of RNA adducts by primer extension in accordance with the subject matter of the invention described herein may, in various embodiments, include the use of an optimized primer binding site, a thermostable reverse transcriptase enzyme, low MgCl ₂ concentration, elevated temperature, short extension time, and combinations of any of the above. Intact, undegraded RNA, free of reaction byproducts and other small molecule contaminants, can also be used as a template for reverse transcription. The RNA component of the resulting RNA-cDNA hybrids can be degraded by base treatment. The cDNA fragments can then be separated using, for example, polyacrylamide sequencing gels, capillary electrophoresis, or other separation techniques that will be apparent to one skilled in the art upon reading the present disclosure.

- 13 046088

Deoxyribonucleotide triphosphates dATP, dCTP, dGTP and dTTP and/or deoxyribonucleotide triphosphate (dNTP) can be added to the synthesis mixture alone or together with primers in adequate quantities, and the resulting solution can be heated to about 50-100°C for about 1 to 10 minutes . After the heating period, the solution can be cooled. In some embodiments, a suitable agent may be added to the cooled mixture to effect a primer extension reaction, and the reaction may proceed under conditions known in the art. In some embodiments, the polymerization agent may be added along with other reagents as long as it is heat stable. In some embodiments, the synthesis (or amplification) reaction may occur at room temperature. In some embodiments, the synthesis (or amplification) reaction may occur to a temperature above which the polymerization agent is no longer effective.

The polymerization agent can be any compound or system that functions to effect the synthesis of primer extension products, including, for example, enzymes. Suitable enzymes for this purpose include, but are not limited to, E. coli DNA polymerase I, E. coli DNA polymerase Klenow fragment, mutein polymerases, reverse transcriptase, and other enzymes, including thermostable enzymes (i.e., those that perform primer extension after exposure to temperatures elevated enough to cause denaturation), such as mouse or avian reverse transcriptase enzymes. Suitable enzymes can facilitate the combination of nucleotides appropriately to form primer extension products that are complementary to each nucleic acid strand of the polymorphic locus. In some embodiments, synthesis may be initiated at the 5' end of each primer and continue in the 3' direction until synthesis is completed at the template end by incorporation of dideoxynucleotide triphosphate or at the 2'-O-adduct, producing molecules of varying lengths.

The newly synthesized strand and its complementary nucleic acid strand can form a double-stranded molecule under the hybridization conditions described herein, and the hybrid is used in subsequent steps as described in the methods described in US Pat. No. 10240188 and US Pat. No. 8,318,424, which are incorporated herein. document in its entirety. In some embodiments, the newly synthesized double-stranded molecule may also be denatured using any of the procedures known in the art to produce single-stranded molecules.

VIII. Processing of source data.

The subject matter described herein for a nucleic acid, such as an RNA molecule, a chemical modification assay and/or a nucleic acid structure assay may be implemented using a computer program product containing computer-executable instructions embodied in a computer-readable medium. Examples of computer-readable media suitable for implementing the subject matter described herein include chip memory devices, disk memory devices, programmable logic devices, and application-specific integrated circuits. In addition, a computer program product that implements the subject matter described herein may be located on a single device or computing platform or may be distributed across multiple devices or computing platforms. Thus, the subject matter described herein may include a set of computer instructions that, when executed by a computer, perform a specific function on a nucleic acid, such as analyzing the structure of RNA.

Taking into account points I-VII mentioned above, a modular RNA screening design was developed to implement SHAPE as a high-throughput ligand binding readout assay (Figure 1, top).

The construct was designed to contain two target motifs, such as a pseudoknot from the 5′UTR of the dengue virus genome, which reduces viral fitness when its structure is disrupted ²⁶ , and the aptamer domain of the TPP riboswitch ^{27 - 29} . Incorporating two distinct structural motifs into a single construct allowed each to serve as an internal control of specificity for the other. Fragments that bound to both RNA structures were easily identified as nonspecific binders. These two structures were connected by a six-nucleotide linker designed to be single-stranded to allow the two RNA structures to remain structurally independent. On the sides of the structural core of the structure there are structural cassettes ²⁵ ; these stem-loop regions are used as primer binding sites for steps required in the screening workflow and were designed not to interact with other structures in the construct (Figure 7).

Another component of the screening construct is the RNA barcode; barcoding allows multiplexing, which significantly reduces the downstream workload. Each well of the 96-well plate used to screen the fragment library contains RNA with a unique barcode in the context of an identical construct; the barcode sequence thus identifies the well position and the fragment (or fragments) present after multiplexing (Fig. 1). The RNA barcode region was designed in such a way

- 14 046088 zom to fold into a self-contained structure that does not interact with any other part of the structure. The barcode structure is a seven base pair helix capped by a GNRA tetraloop and an attached G-C base pair to maintain hairpin stability (Figure 7). Each set of 96 barcodes has been designed in such a way that any individual barcode will undergo two or more mutations so that it can be mistaken for another barcode.

This design provides flexibility in the selection of RNA structures for ligand binding screens and supports a simple, direct screening experiment (Figure 1). Each well of a 96-well plate containing an otherwise identical RNA construct with a unique RNA barcode is incubated with one or more small molecule fragments or a no fragment control (solvent) and then treated with SHAPE reagent. The resulting SHAPE adducts chemically encode structural information about each nucleotide. After a SHAPE assay, the information needed to determine fragment identity (RNA barcode) and fragment binding (SHAPE adduct pattern) is permanently encoded in each RNA strand, so RNA from 96 wells of a plate can be pooled into a single sample. The fragment screening experiment is very similar to the standard MaP structure research workflow ²⁴ . For example, some embodiments use a specialized attenuated reverse transcription reaction to produce cDNAs that contain non-template-encoded sequence changes at the positions of any SHAPE adducts on the RNA ³⁰ . These cDNAs are then used to generate a DNA library for high-throughput sequencing. Multiple experimental plates can be barcoded at the DNA library level ²⁴ , allowing the collection of data on thousands of compounds in a single sequencing run (Figure 1). The resulting sequencing data contains millions of individual reads, each corresponding to specific RNA strands. These reads are sorted by barcode so that the data can be analyzed for each small molecule fragment or combination of fragments. The detection and identification of low molecular weight fragments (eg, fragment 1 and/or fragment 2) using the methods described above, such as SHAPE and/or SHAPEMaP, are described in more detail in the next section.

B. Identification and selection of ligand.

As mentioned above, SHAPE and SHAPE-MaP have been used to identify small molecule fragments that bind to or are associated with an RNA molecule of interest. In particular, when testing small molecule fragments using SHAPE-Map, discovering associated fragment signatures from the SHAPE-MaP mutation rate for each nucleotide involves several steps to normalize the data on a large experimental screen and to ensure statistical rigor. Key features of the SHAPE-based hit assay strategy include: (i) comparison of each exposed RNA fragment or experimental sample with five negative, unexposed fragment controls to account for plate-to-plate and well-to-well variability; (ii) hit detection performed independently for each of the two structural motifs in the construct, herein pseudoknot and TPP riboswitch; (iii) masking individual nucleotides with low reactivity in all samples, since these nucleotides are unlikely to exhibit fragment-induced changes; and (iv) calculating the per-nucleotide difference in mutation frequency between the exposed fragment of the experimental sample and the unexposed fragment of the negative control sample. Nucleotides with a difference in mutation rate of 20% or more between one of the motifs and the no-fragment controls were selected for Z-score analysis. However, one skilled in the art will be able to adjust the difference in mutation rate accordingly, recognizing that it may vary. For example, in some embodiments, the difference in mutation rate may be 25, 30, 35, 45, or 50% or more. In some embodiments, the difference in mutation rate may be 15%, 10%, or 5% or more. A fragment was determined to significantly change the SHAPE reactivity pattern if three or more nucleotides in one of the two motifs had Z-scores greater than 2.7 (as determined by comparing the Poisson number for the two motifs ³¹ , see Example 2). However, the Z values may vary and one skilled in the art will be able to adjust them accordingly. For example, in some embodiments, Z values exceed 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3 .8 or 3.9. In some embodiments, Z values exceed 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0 , 2.1, 2.2, 2.3, 2.4, 2.5 or 2.6.

To identify small molecule fragments using SHAPE and/or SHAPE-MaP, which are subsequently joined together to produce compounds as described herein, a number of steps are performed. First, a primary screen is conducted in which a large number of compounds are screened, such as at least 100 compounds, to identify any initial lead or target compounds that exhibit suitable binding activity to the target RNA molecule. In step 2, these target compounds are then further investigated in structure-activity relationship (SAR) studies, where changes in target RNA binding affinity are determined as the structure of the target compounds is modified.

- 15 046088

Once several small molecule fragments have been identified as suitable binding ligands for a target RNA molecule, additional binding studies can be performed to further explore the binding site for each small molecule fragment (ie, step 3). For example, in some embodiments, the target RNA may be preincubated with a first fragment (identified as a target RNA binding ligand according to SAR studies in step 2) before exposing the target RNA to a second fragment (also identified as an RNA binding ligand). in SAR studies in step 2) to determine whether the second fragment can bind to the target RNA when the first fragment is already bound. Once a second fragment with suitable binding activity to the RNA of interest has been identified, it can be linked to the first fragment using a linker to produce the compound described herein (ie, step 4). Each of the stages mentioned above is described in more detail below.

Stage 1. Primary screening.

In the initial screening, 1500 fragments were tested and 41 fragments were detected as hits, for an initial hit rate of 2.7%. Confirmation of hits was performed using triplicate SHAPE analysis (Fig. 2, Fig. 8), and a compound was considered a true hit only if it was detected as a binder in all three replicates. These replicate hit compounds were then analyzed by isothermal titration calorimetry (ITC) to determine binding affinity to RNA corresponding to the target motif only (excluding flanking sequences in the screening construct). Of these initial hits, eight hits were confirmed by reanalysis and ITC (Table 1). Seven of the hits were associated with the TPP riboswitch based on their mutational signatures located primarily or entirely within the TPP riboswitch region of the construct tested. The remaining hit was nonspecific, since this fragment affected nucleotides in all parts of the RNA construct. No compounds were found that specifically bound to the dengue pseudoknot site of the construct tested.

Table 1

Fragments that bind the TPP riboswitch discovered by the SHAPE study

Structure ID x _d (µm)

δ 650+100

insoluble

In insoluble

0.028 ±0.002

Hits were discovered using the SHAPE structure study and confirmed by repeated

- 16 046088 analysis and ITC. The dissociation constant was determined by ITC; error values marked J indicate the standard error obtained from >3 replicates, other error estimates are calculated based on the 95% confidence interval for least squares regression of the binding curve. The native TPP ligand is included for comparison.

The seven fragments that bind the TPP riboswitch were confirmed by ITC to have different chemotypes; most of them have little or no similarity to the native TPP ligand (Table 1). In general, heteroaromatic nitrogen-containing rings predominate; they are likely involved in hydrogen bonding interactions. Three compounds have pyridine rings, and two have pyrazine rings. The azole ring moiety is present in three compounds: two thiadiazoles and an imidazole. The native TPP ligand contains a thiazole ring, but this fragment is not involved in binding interactions with RNA ^28,29,33 . In addition, a number of identified fragments contain primary amines, esters and ethers, as well as fluorine groups that can serve as hydrogen bond acceptors or donors.

Step 2: Structure-activity relationships (SAR) of riboswitch-binding fragments.

Analogs of some of the original hits were then examined to increase binding affinity and identify positions at which fragment hits could be modified by a linker without interfering with binding. In particular, analogues of compounds 2 and 5 were considered, since these two fragments differ in structure and analogues are commercially available. RNA analogue binding was assessed using ITC. Sixteen analogues of 2 were tested. Altering the basic quinoxaline structure of compound 2 by removing one or both nitrogen atoms in the ring resulted in a change in binding activity (Table 2A).

Table 2A

SAR for analogues of fragment 2

Molecule R, X,, χ ₂ , χ ₃ KDmkm) 2 Ν,Ν, C 25 10 γ". M,S. WITH 3500 And γ-ΝΗ; S, N. WITH 2100 12 S, S, S no binding 13 Η N.N. Ν 354 14 Η Ν, Ν. WITH 120

Modifications of the quinoxaline core were studied and dissociation constants were obtained using ITC.

The improvement in binding affinity resulted from the introduction of a methylene-linked hydrogen bond donor or acceptor (Table 2B, compounds 16 and 17). Various substituents at other positions on the core of the quinoxaline ring resulted in decreased binding activity. Compound 2 was a good candidate for further development based on the high degree of flexibility and even improved binding observed upon modification of the substituent at the C-6 position.

- 17 046088

Table 2B Structure-activity relationships for fragment 2 analogues binding to TPP riboswitch RNA.

Modifications of side groups of the quinoxaline core. Dissociation constants were obtained by the ITC method

R ₂

Molecule r ₂ R _{3 Kd} (µm) 15 Υ^ΟΗ Η Η 18 16 M Η Η 12 17 Η Η 50 18 About ν’ Η Η 35 19 Η Η 58 20 Η η 33 21 Η τ νη ₂ Η 75 22 Η τ He Η 286 23 Η τ Η 220 24 Η Η 379 25 Η Η 0 d. 600

A study of 18 analogues of fragment 5 then showed that the basic pyridine functionality of the molecule appears to be important for binding, since changing the position of the ring nitrogen or adding or removing a ring nitrogen reduces or inhibits binding (Table 3).

Table 3

Structure-activity relationships for fragment 5 analogues binding to TPP riboswitch RNA. Pyridine core modifications and dissociation constants were obtained using ITC

Molecule x _v x _a , x ₄ Κ _ά (µm) B N, s, s, s 265 S1 S, S.S, N 490 S2 N, N, C _f C 420 S3 N,C, N,C 1200 S4 S, S, S, S no binding

Modifications to ring substituents generally resulted in significant loss of binding activity (Table 4). The only affinity-increasing analogue contained a chlorine at the C-4 position, S12, resulting in the compound having approximately three times the affinity for ribocross 18 046088

TPP switch than fragment 5.

Table 4

Structure-activity relationships for fragment 5 analogues binding to TPP riboswitch RNA.

Modifications of side groups of the pyridine ring.

Dissociation constants were obtained by the ITC method

Molecule R. R, K _a (mm) S5 A Br' Η Η _4Α- 440 S6 OjhA Η Η γΆ 390 87 Η Η χΑ»'' 1"Yu S8 NJ ^L Η Η 1100 S9 5 1 F Η Η D D no binding S1O Η Η no binding 811 α' ⁵ ' ^α '/ Η O\·Άγ his S12 Η C1 γλθΧ ο 93 S13 Η Η 600 314 A Η Η χ-'~ΌΗ 1300 S15 Η Η A 1W0 516 And Η Υ 'NHs 1300 317 Η Η no binding S1B αΆ Η Η Λ- no binding

Step 3. Identification of fragments that bind to the second site on the TPP riboswitch.

A second round screen was used to identify fragments that bound to the TPP riboswitch site of a screening construct previously linked to compounds 2 or S12. This screen identified fragments that preferentially interact with the TPP riboswitch when 2 or S12 is already bound, either due to cooperative effects or because new binding modes become available due to structural changes that occur upon binding of the primary ligand (Fig. 3). Of the 1500 fragments tested, five were confirmed to simultaneously bind to either 2 or S12 (Table 5).

- 19 046088

Table 5

Fragments that bind to the TPP riboswitch in the presence of a prebound fragment partner detected by SHAPE. The hits were confirmed by repeated SHAPE analysis. Primary binding partners (2, 6) are shown in table. 1

Primary partners

ID

Structure

6.2

N

One hit from the second screen, 29, induced very strong changes in the SHAPE reactivity signal and appeared to cause a significant change in RNA structure, including unwinding of the P1 helix. This fragment caused changes in other regions of the RNA consistent with nonspecific interactions, so this fragment was not further considered as a candidate for fragment binding. Fragment 28 was insoluble at the concentrations required for the ITC assay; therefore, related analogues containing a pyridine ring instead of a quinoline ring were examined by ITC (Table 6). These compounds, associated with weak affinity, however, 31 and 32 showed clear but moderate binding cooperativity with 2.

- 20 046088

Table 6

Structure-activity relationships for fragment 28 analogues binding to TPP riboswitch RNA in the presence and absence of prebound fragment 2. *

K _d SMM)

Molecule R ₁ R ₂ ⁵ Ligand not bound

31 n n 3 >10 32 n _a s^ n 4 >10 33 N not defined >10 34 n not defined >10 28 ABOUT n insoluble insoluble

*not defined (undefined) due to inability to fit ITC binding curve; insoluble, a compound that is insoluble in the concentrations required for ITC.

Table 7

Detailed comparison of representative proteins and fragment-linker-RNA fragment ligands designed by fragment-based methods

Fragment 1 k _l -μm: O _ k. .μ-i G 2 :ώ I M' to ώΐ Fragment 2 K, : µm 1 ’ :,1.1 ” < l 1,: , ?’ MJ.1 Related compound µl; sa nM | _ ¹ . ί , ,. ^s , nz! IE,. Ε Ref 0.62 0 49 0.0021 0.06 [Ν] IN) . 1 , "-") ’ -«« · · Z'S pkm •l ’ •J J.T.K.M 1 4 nz1 0.30 0 35 IN] 1 llfcl ZmM ,!s. 19nz1 ' 0.40 0.60 IN] * _ ,ιΜ - _:! 'L ‘ ί 1ΙΚ.Ι 0 31 'ΙΟ |N] ' 12 :.1.h:ι g l. J7 π Π ΜΚΜ ' ‘’‘λ 0 40 14 IN) l irJI .. 1 'MJ. I .-../9.7 ' = ικ:: m 0.26 1.6 IN)

- 21 046088

Examples of RNA are highlighted with an asterisk. Each entry details two fragment components and their individual Kd values, the bound compound and its corresponding Kd value, and the ligand efficiency (LE) and binding coefficient (E) for the bound compound ^{22,38,53,54,45-52} .

Stage 4. Cooperation and linking of fragments.

Cooperative binding interactions between 2 and 31 were quantified using ITC. Individually, 2 is associated with a Kd of 25 μM and 31 with a much higher Kd of 10 mM. As in the secondary screen, the affinity of fragment 31 was also examined when 2 was pre-bound to TPP riboswitch RNA, forming a 2-RNA complex. Under these conditions, fragment 31 bound to the RNA 2-TPP complex with a Kd of about 3 mM (Fig. 4). This experiment also showed that when binding of 2 is saturated, 31 binds to TPP RNA, implying that the two moieties do not bind at the same location. Because 2 and 31 bound with excellent and acceptable affinity, respectively, to different regions of TPP RNA, the two fragments were linked to create a high-affinity ligand.

Based on SAR analysis of fragment hits 2 (Table 2B) and 28 (Table 4), bound analogues of the most promising SAR fragments were obtained, focusing on the aminomethyl position 17 and two sites in the pyridine ring of fragment 31 (Fig. 5).

First, the affinities of the moieties conjugated to the amide or amine linker were compared. The compound with a flexible amine linker (compound 36) had five times higher binding affinity than the amide linker version (compound 35, Figure 5). These bonds have been introduced with hydroxamic acid, which can chelate the magnesium ion ³⁵ as does the pyrophosphate moiety of the native TPP ligand ²⁷ , ²⁸ . However, the amine-linked hydroxamic acid compound 36 binds with an affinity similar to that of the parent fragment 17, indicating that the hydroxamic acid moiety does not impart additional binding affinity by chelating the ion. The bound compound 37 binds with an affinity of 625 nM, showing that when properly approximated, binding of two moieties with moderate affinity can result in a high nanomolar binder. Replacement of fragment 31 with a tertiary amine (compound 38) reduces the affinity compared to compound 37, suggesting that the interaction of fragment 31 with RNA is mediated by more than just charge-based effects. Finally, changing the linkage between fragments 17 and 31 along the length (compound 39) or the binding site of the pyridine ring (compound 40) reduces the affinity compared to compound 37 (Fig. 5). Ultimately, by combining compounds that bound individually to the TPP riboswitch with affinities of 5.0 μM (compound 19) and >10 mM (compound 31), compound (37) was created that binds RNA with a K _d of 625 nM.

One skilled in the art will appreciate that the steps I-IV described above are not intended to be limiting, but merely serve as an exemplary embodiment. It will be understood that one skilled in the art will be able to apply Steps I-IV described above to identify alternative moieties that can be linked together to form the compounds described in

- 22 046088 standing document, with suitable binding affinity for the TPP riboswitch. In addition, it will be well understood that one skilled in the art will be able to apply Steps I-IV described above to identify fragments that can be linked to each other to produce compounds described herein that bind to other RNA molecules of interest.

D. Conclusion and additional considerations.

Since both coding (mRNA) and non-coding RNAs can potentially be manipulated to alter the course of cellular regulation and disease, an attempt has been made to develop an effective strategy to identify small molecule ligands for structured RNAs. The study described herein demonstrates the promise of using the SHAPE screening read detecting ligand binding to RNA combined with a fragment-based strategy. Herein, this strategy was used to obtain a ligand that binds at Kd 625 nM to the TPP riboswitch, which is not structurally related to the native ligand. The combined approach of SHAPE and fragment-based screening is common to both the RNA structure that can be targeted and the chemotypes of ligands that can be designed. This strategy is particularly well suited to searching for RNA ligands with complex structures, which may be important for identifying RNA motifs that bind in three-dimensional pockets ⁴ . In addition, due to the use of the MaP approach and the use of multiplexing via RNA and DNA barcoding, the effort required to screen a thousand-plus member fragment library is modest, allowing efficient screening of many structurally diverse targets.

Many of the resulting ligands were similar to those previously reported for single‐circuit screening also performed for the TPP riboswitch ^{15 , 17} . The hits in the primary screen appeared to be moderately biased toward higher affinity, such that most ligands detected by SHAPE bound in the 10–300 μM range. The hit detection assay used is likely biased towards detecting the strongest binding moieties and those binders that cause the most significant changes in SHAPE reactivity. Lower affinity fragments were likely missed. This bias towards tightly binding fragments is thought to be generally advantageous. No fragment was identified that bound the dengue pseudoknot and achieved the affinity and specificity required to meet the above screening criteria. Dengue pseudoknot RNA has a complex structure, and the likelihood of a fragment disrupting this structure may be low. Another possibility is that this particular pseudoknot structure may not contain a ligandable pocket.

A fragment pair identification strategy, in which the hit fragment in the primary screen was pre-bound to RNA and screened for additional fragment binding partners, specifically took advantage of the per-nucleotide information obtained from SHAPE, and was successfully used herein for detection pairs of fragments of induced correspondence (Fig. 4). The basic principle of fragment-based ligand design is that cooperativity between two fragments can be achieved through proximal binding and that this additive binding can be exploited by linking cooperative fragments together with a minimally invasive covalent bond ^20,21,36,37 . The development of tethered compound 37 from primary and secondary fragment hits shows that fragment-based ligand detection can be effectively applied to RNA targets. There is a moderate degree of cooperativity between 2 and 31: binding of compound 31 was 3- to 10-fold stronger when 2 was prebound to RNA. When binding these two fragments, a moderate additivity of their binding energies was observed: 37 has an affinity of 625 nM. No superadditive effect was observed when binding fragments 2 and 31, ³⁶ probably because ideal positioning of the fragments was not achieved. Small changes in linker length or geometry resulted in large changes in the affinity of the bound ligand (Figure 5), implying that precise linker orientation is important for optimal orientation of the two moieties. The successful development of compound 37 shows that it is not necessary to achieve perfection in either the degree of cooperativity between moieties or the design of the covalent linker connecting them for efficient development of a submicromolar ligand.

Although numerous attempts have been made to exploit cooperativity between moieties to produce tightly binding ligands targeting proteins, RNA targeting is in its infancy. It was examined how well described the SHAPE-based screening strategy combined with fragment linking compared to previous (protein-focused) efforts. Compounds previously discovered using fragment-based strategies were ranked according to their binding coefficients (E), which is a measure of how well the entire system functions together in ^binding21,38 (Figure 6; expanded in Table 7) . In the absence of positive or negative contributing factors, binding energy

- 23 046088 the two fragments are exactly additive, the linker is inert, and E is 1.0. Cooperative effects or beneficial linker interactions decrease E, and anticooperative effects or negative linker interactions increase E. Critically, E values can vary by orders of magnitude in protein systems.

The binding coefficient for 37 is 2.5, which is slightly higher than the average for bound (protein-targeting) ligands in the academic literature. 37 has ligand efficiency (LE), the binding free energy divided by the number of non-hydrogen atoms, which compares favorably with examples of bound fragment ligands targeting proteins (Figure 6). By these measures, 37 performs almost as well as TPPc, a ligand closely related to the native riboswitch ligand TPP ²² . Thus, fragment-based ligand discovery, particularly implemented through SHAPE-enabled multiplex screening, holds significant promise for enabling the rapid development of unique ligands targeting the vast world of RNA structures.

D. Methods of obtaining.

The present description also applies to any methods for preparing the compounds described herein. One skilled in the art will be aware that such preparation methods may vary. For example, in some embodiments, methods for preparing the described compounds include: contacting a moiety of Formula IV:

x,.___ /' ^T| ^NH 2

Formula (IV) where X1 and X ₃ represent N;

X ₂ represents CR1;

dotted lines represent double bonds;

Y1, Y ₂ and Y ₃ represent CR2;

R ₁ and R ₂ represent -H; and n is 2; with a fragment of formula V-1 or V-2:

Formula V-1 Formula V-2 where X is a halogen selected from F, Br, Cl and I;

X ₄ and X7 are CR ₃ , and X ₅ and X6 are independently selected from CR ₃ and N;

R ₃ represents -H;

m represents 1; And

W represents -O or -NR4, where R ₄ is selected from -CO(C ₁ -C ₆ -αalkyl), substituted or unsubstituted ^-^-alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl) and CO(cycloalkyl), in the presence of a Pd catalyst.

In some embodiments, the Pd catalyst is selected from (DPPF)PdCl ₂ , Pd ₂ (dba) ₃ , PdCl ₂ [P(otolyl) ₃ ] ₂ , Pd(dba) ₂ and Pd(OAc) ₂ . In some embodiments, the contacting step further includes a phosphine ligand. In some embodiments, the phosphine ligand is monodentate. In some embodiments, the phosphine ligand is bidentate. Examples of phosphine ligands include, but are not limited to, DPPF, BINAP, and rac-BINAP. In some embodiments, the reaction step further includes a base. In some embodiments, the base is inorganic. In some embodiments, the base is NaOtBu. In some embodiments, the contacting step is performed neat (ie, without solvent). In some embodiments, the contacting step is carried out in the presence of a solvent. In some embodiments, the solvent is a non-polar solvent. Examples of solvents include, but are not limited to, toluene, benzene, dioxane and tetrahydrofuran. In some embodiments, the contacting step is performed at elevated temperatures. In some embodiments, the stage of bringing to

- 24 046088 contact is carried out at 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105 or 100°C.

In some embodiments, methods for preparing the described compounds include: contacting a moiety of Formula IV:

with a fragment of formula VI-1 or VI-2:

where X1, X ₂ , X3, X ₄ , X ₅ , X ₆ , X ₇ , Y ₁ , Y ₂ , Y3, n, m and W are as defined above, in the presence of a reducing agent.

In some embodiments, the reducing agent can be any reducing agent useful in reductive amination chemistry. Examples of reducing agents include, without limitation, aluminum borohydride and/or hydrides. In some embodiments, the reducing agent is a borohydride. In some embodiments, the reducing agent is sodium borohydride. In some embodiments, the contacting step is performed in its pure form. In some embodiments, the contacting step is carried out in a solvent. Examples of solvents include, but are not limited to, alcoholic solvents (eg, methanol, ethanol, isopropanol), chlorinated solvents (eg, dichloromethane), and/or ethereal solvents (eg, tetrahydrofuran). In some embodiments, the contacting step is performed at below room temperature. In some embodiments, the contacting step is performed at elevated temperatures.

In some embodiments, methods for preparing the described compounds include: contacting a moiety of Formula IV:

with a fragment of formula VII-1 or VII-2:

where X1, X ₂ , X3, X ₄ , X ₅ , X ₆ , X ₇ , Y1, Y ₂ , Y ₃ , n, m and W are as defined above; And

G is -F, -Cl, -Br, -OH, -OCH3 or -OCH2CH3;

in the presence of a base.

In some embodiments, the base is organic (pyridine and/or trimethylamine). In some embodiments, the base is inorganic (eg, potassium/sodium carbonate and/or potassium/sodium bicarbonate). In some embodiments, the method further

- 25 046088 includes, but is not limited to, a coupling agent such as DCC and/or EDCI. In some embodiments, the contacting step is performed in its pure form. In some embodiments, the contacting step is carried out in the presence of a solvent. Examples of solvents include, but are not limited to, THF, DCM, ACN and/or DMSO. In some embodiments, the contacting step is performed at room temperature. In some embodiments, the contacting step is performed at elevated temperatures.

E. Compositions.

The compounds described herein can be formulated into a pharmaceutical composition together with a pharmaceutically acceptable carrier.

The compounds described herein may be formulated in accordance with standard pharmaceutical practice into a pharmaceutical composition. In accordance with this aspect, there is provided a pharmaceutical composition containing a compound described herein in combination with a pharmaceutically acceptable diluent or carrier.

A typical formulation is prepared by mixing a compound described herein and a carrier, diluent or excipient. Suitable carriers, diluents and auxiliaries are well known to those skilled in the art and include materials such as carbohydrates, waxes, water-soluble and/or swellable polymers, hydrophilic or hydrophobic materials, gelatin, oils, solvents, water and the like. The particular carrier, diluent or excipient used will depend on the means and purpose for which the compound is used. Solvents are typically selected based on solvents generally recognized as safe (GRAS) by those skilled in the art for administration to a mammal. Generally, safe solvents are non-toxic aqueous solvents such as water and other non-toxic solvents that dissolve or mix with water. Suitable aqueous solvents include water, ethanol, propylene glycol, polyethylene glycols (eg PEG 400, PEG 300), etc. and mixtures thereof. The compositions may also include one or more buffers, stabilizers, surfactants, wetting agents, lubricants, emulsifiers, suspending agents, preservatives, antioxidants, coating agents, lubricants, processing aids, colors, sweeteners, flavors, fragrances, and other known additives for providing an elegant presentation of a drug (ie, a compound described herein or a pharmaceutical composition thereof) or assisting in the manufacture of a pharmaceutical product (ie, a drug).

The compositions can be prepared using conventional dissolution and mixing procedures. For example, a bulk drug substance (i.e., a compound described herein or a stabilized form of the compound (e.g., complexed with a cyclodextrin derivative or other known complexing agent) is dissolved in a suitable solvent in the presence of one or more of the excipients described above. The compound typically formulated in pharmaceutical dosage forms to provide an easily controlled dose of the drug and ensure patient compliance with the prescribed regimen.The pharmaceutical composition (or formulation) for use may be packaged in a variety of ways depending on the method used to administer the drug. Typically, the product for distribution includes a container containing the pharmaceutical composition in a suitable form.Suitable containers are well known to those skilled in the art and include materials such as bottles (plastic and glass), sachets, ampoules, plastic bags, metal cylinders and the like . The container may also include tamper-proof protection to prevent inadvertent access to the contents of the package. In addition, the container is provided with a label describing the contents of the container. The label may also contain appropriate warnings.

Pharmaceutical compositions can be prepared for various routes and types of administration. For example, a compound described herein having a desired degree of purity may optionally be mixed with pharmaceutically acceptable diluents, carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences (1980), 16th edition, Osol, A. Ed.), in in the form of a lyophilized composition, crushed powder or aqueous solution. Formulation can be accomplished by mixing at ambient temperature at the appropriate pH and the desired degree of purity with physiologically acceptable carriers, i.e. carriers that are non-toxic to recipients at the dosages and concentrations used. The pH of the formulation depends primarily on the specific application and concentration of the compound, but can range from about 3 to about 8. Formulation in an acetate buffer at pH 5 is a suitable embodiment.

Connections may be sterile. In particular, formulations used for in vivo administration must be sterile. Such sterilization is easily accomplished by filtration through sterile filtration membranes.

The compound can generally be stored as a solid composition, a lyophilized composition, or an aqueous solution.

- 26 046088

Pharmaceutical compositions containing a compound described herein can be formulated, dosed and administered in a manner, i.e. quantities, concentrations, schedule, course, vehicles and route of administration, in accordance with good medical practice. Factors to be considered in this context include the particular disease being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the route of administration, the schedule of administration, and other factors known to the medical practitioner. A therapeutically effective amount of a compound administered will be determined by such considerations and represents the minimum amount necessary to prevent, alleviate, or treat a clotting factor-mediated disorder. Such an amount is preferably below an amount that is toxic to the host or renders the host significantly more susceptible to bleeding.

Acceptable diluents, carriers, excipients and stabilizers are non-toxic to recipients at the dosages and concentrations used and include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzylammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkylparabens such as methyl or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates, including glucose, mannose or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (eg Zn-protein complexes); and/or nonionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG). Active pharmaceutical ingredients can also be enclosed in microcapsules prepared, for example, by coacervation or interfacial polymerization techniques, for example, hydroxymethylcellulose or gelatin microcapsules and poly(methyl methacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules) or in macroemulsions. Such techniques are described in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. Ed. (1980).

Sustained release preparations of the compounds can be prepared. Suitable examples of sustained release formulations include semi-permeable matrices of solid hydrophobic polymers containing a compound described herein, these matrices being in the form of molded articles such as films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (e.g. poly(2hydroxyethyl methacrylate) or poly(vinyl alcohol)), polylactides (US Pat. No. 3,773,919), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, nondegradable ethylene vinyl acetate, degradable copolymers lactic and glycolic acids, such as LUPRON DEPOT™ (injectable microspheres consisting of a copolymer of lactic-glycolic acids and leuprolide acetate) and poly-E-(-)-3hydroxybutyric acid.

Formulations include those suitable for the routes of administration described herein. The compositions may be conveniently presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Methods and formulations can generally be found in Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton, Pa.). Such methods include the step of binding the active ingredient to a carrier, which is one or more auxiliary ingredients. Typically, formulations are prepared by uniformly and intimately binding the active ingredient to liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product.

Formulations of a compound described herein suitable for oral administration may be prepared in discrete units such as pills, capsules, wafers or tablets, each containing a predetermined amount of the compound.

Compressed tablets can be prepared by compressing in a suitable machine the active ingredient in bulk form, such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surfactant or dispersant. Molded tablets can be prepared by molding in a suitable machine a mixture of powdered active ingredient moistened with an inert liquid diluent. Tablets may not necessarily be coated or scored and may not necessarily be formulated to provide a slow or controlled release of the active ingredient.

Tablets, lozenges, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, e.g. gelatin capsules, syrups or elixirs

- 27 046088 can be obtained for oral administration. Formulations of the compounds described herein for oral administration may be prepared in accordance with any method known in the art for the manufacture of pharmaceutical compositions, and such compositions may contain one or more agents, including sweeteners, flavorings, colors and preservatives. to provide a tasty preparation. Suitable tablets contain the active ingredient in admixture with a non-toxic pharmaceutically acceptable excipient suitable for the preparation of tablets. These excipients can be, for example, inert diluents such as calcium or sodium carbonate, lactose, calcium or sodium phosphate; granulating and disintegrating agents such as corn starch or alginic acid; binding agents such as starch, gelatin or gum acacia; and lubricants such as magnesium stearate, stearic acid or talc. Tablets may be uncoated or may be coated according to known techniques, including microencapsulation, to retard disintegration and adsorption in the gastrointestinal tract and thus provide sustained action over a longer period of time. For example, a time delay material such as glycerol monostearate or glycerol distearate, alone or with a wax, can be used.

For treating the eyes or other external tissues, such as the mouth and skin, the compositions can be applied as an ointment or cream for external use containing the active ingredient(s) in an amount of, for example, 0.075 to 20% w/w. When preparing an ointment for external use, the active ingredients can be used in either a paraffin or water-miscible ointment base. Alternatively, the active ingredients may be formulated into an oil-in-water cream formulation.

If desired, the aqueous phase of the cream base may include a polyhydric alcohol, that is, an alcohol having two or more hydroxyl groups, such as propylene glycol, butane-1,3-diol, mannitol, sorbitol, glycerin and polyethylene glycol (including PEG 400), and mixtures thereof . Formulations for external use may desirably include a compound that enhances absorption or penetration of the active ingredient through the skin or other affected areas. Examples of such skin penetration enhancers include dimethyl sulfoxide and related analogs.

The oil phase of the emulsions can be formulated from known ingredients in a known manner. Although the phase may contain only an emulsifier, it may also contain a mixture of at least one emulsifier and a fat or oil, or both a fat and an oil. A hydrophilic emulsifier included together with a lipophilic emulsifier can act as a stabilizer. Together, the emulsifier(s) with or without stabilizer(s) constitute the so-called emulsifying wax and the wax, together with the oil and fat, constitute the so-called emulsifying ointment base, which forms the oily dispersed phase of cream formulations. Emulsifiers and emulsion stabilizers suitable for use in the formulation include Tween® 60, Span® 80, cetostearyl alcohol, benzyl alcohol, myristyl alcohol, glyceryl monostearate and sodium lauryl sulfate.

Aqueous suspensions of compounds contain the active materials in admixture with excipients suitable for preparing aqueous suspensions. Such excipients include suspending agents such as sodium carboxymethylcellulose, croscarmellose, povidone, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and acacia and dispersing or wetting agents such as natural phosphatide (eg, lecithin), the condensation product of alkylene oxide with fatty acid (e.g. polyoxyethylene stearate), condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g. heptadecaethyleneoxycetanol), condensation product of ethylene oxide with a partial fatty acid ester and hexitol anhydride (e.g. polyoxyethylene sorbitan monooleate). The aqueous suspension may also contain one or more preservatives, such as ethyl or n-propyl-p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweeteners, such as sucrose or saccharin.

Pharmaceutical compositions of the compounds may be in the form of a sterile injectable preparation, such as a sterile aqueous or oleaginous injectable suspension. This suspension can be formulated in accordance with the prior art using those suitable dispersing or wetting agents and suspending agents as mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent such as 1,3butanediol. The sterile injectable preparation can also be obtained as a lyophilized powder. Acceptable vehicles and solvents that may be used include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils can usually be used as a solvent or suspending medium. Any soft, fixed oil can be used for this purpose, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can also be used in the preparation of injection preparations.

The amount of active ingredient that can be combined with the carrier material to

- 28 046088 obtaining a single dosage form will vary depending on the host being treated and the specific route of administration. For example, a sustained release formulation for oral administration to a human may contain from about 1 to 1000 mg of active agent admixed with a suitable and convenient amount of carrier material, which may range from about 5 to about 95% of the total compositions (weight: weight). The pharmaceutical composition can be prepared to provide easily measurable amounts for administration. For example, an aqueous solution intended for intravenous infusion may contain from about 1 to 500 μg of active ingredient per milliliter of solution so that a suitable volume can be infused at a rate of from about 10 to about 50 ml/hour.

Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injectable solutions that may contain antioxidants, buffers, bacteriostatic agents and solutes that render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions, which may include suspending agents and thickening agents.

Formulations suitable for topical administration to the eye also include eye drops wherein the active ingredient is dissolved or suspended in a suitable vehicle, especially an aqueous vehicle for the active ingredient. The active ingredient is preferably present in such formulations at a concentration of from about 0.5 to 20% w/w, for example from about 0.5 to 10% w/w, for example about 1.5% w/w .

Formulations suitable for topical administration to the mouth include lozenges containing the active ingredient in a flavored base, typically sucrose and acacia or tragacanth; lozenges containing the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia; and mouthwashes containing the active ingredient in a suitable liquid carrier.

Preparations for rectal administration can be presented in the form of suppositories with a suitable base containing, for example, cocoa butter or salicylate.

Formulations suitable for intrapulmonary or nasal administration have particle sizes, for example, in the range of 0.1 to 500 microns (including particle sizes in the range of 0.1 to 500 microns in micron increments, for example, 0.5, 1, 30 micron, 35 micron, etc.), which is administered by rapid inhalation through the nasal passage or by inhalation through the mouth to reach the alveolar sacs. Suitable formulations include aqueous or oily solutions of the active ingredient. Formulations suitable for administration as an aerosol or dry powder can be prepared according to conventional methods and can be delivered with other therapeutic agents, such as compounds previously used for the treatment or prevention of disorders, as described below.

Formulations suitable for vaginal administration may be presented in the form of pessaries, tampons, creams, gels, pastes, foams or sprays containing, in addition to the active ingredient, such carriers as are known in the art to be suitable.

The formulations may be packaged in single-dose or multi-dose containers, such as sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) state, requiring only the addition of a sterile liquid vehicle, such as water, for injection immediately prior to use. Injection solutions and suspensions for extemporaneous use are prepared from the sterile powders, granules and tablets described above. Preferred unit dosage forms are those that contain a daily dose or a unit daily subdose as defined herein above, or a corresponding fraction of the active ingredient thereof.

The invention also relates to veterinary compositions containing at least one active ingredient as defined above together with a veterinary carrier. Veterinary carriers are the materials used to administer the composition and may be solid, liquid or gaseous materials that are otherwise inert or veterinary acceptable and compatible with the active ingredient. These veterinary compositions can be administered parenterally, orally, or any other desired route.

In specific embodiments, a pharmaceutical composition containing the compounds described herein further comprises a chemotherapeutic agent. In some of these embodiments, the chemotherapeutic agent is an immunotherapeutic agent.

G. Methods of treatment.

The compounds and compositions described herein may also be used in methods of treating various diseases and/or disorders that have been found to be associated with dysfunction of RNA expression and/or function, or with the expression and/or function of a protein that is derived from mRNA, either with the beneficial role of switching RNA conformation by a small molecule, or altering the native function of a riboswitch as a way of inhibiting the growth of an infectious organism. Thus, the methods according to the present description are aimed at treating

- 29 046088 disease or disorder that is associated with dysfunction of RNA expression and/or function, or for the development of a new switchable therapeutic agent. See, for example, Patent Application Publication US 2018/010146, which is incorporated herein by reference in its entirety. Thus, in some embodiments, methods of treating a disease or disorder as described herein (e.g., associated with dysfunction of RNA expression and/or function) comprise administering to a subject in need thereof a dose of a therapeutically effective amount of a compound and/or composition described in this document.

RNA expression dysfunction is characterized by overexpression or underexpression of one or more RNA molecules. In some embodiments, one or more RNA molecules are associated with promoting a disease and/or disorder being treated. In some embodiments, the RNA molecule(s) are characterized as part of the machinery of a healthy cell and thus can prevent and/or alleviate the disease and/or disorder being treated. In some embodiments, the disease or disorder being treated is associated with dysfunction of RNA function associated with transcription, processing, and/or translation. In some embodiments, the disease or disorder being treated is associated with inaccurate expression of proteins resulting from dysfunctional function of the RNA molecule. In some embodiments, the disease or disorder being treated is associated with dysfunction of RNA function associated with gene expression. In some embodiments, the disease or disorder is a disease or disorder in which it is desirable to reduce protein expression by binding the molecule to mRNA. In some embodiments, the disease is successfully treated with a therapy that can be turned on and off using a small molecule. For example, in some embodiments, the disease or disorder is a genetic disease in which it is desirable to be able to turn on or off the expression of a therapeutic gene.

Diseases and disorders to be treated include, but are not limited to, degenerative disorders, cancer, diabetes, autoimmune disorders, cardiovascular disorders, bleeding disorders, eye diseases, infectious diseases and diseases caused by mutations in one or more genes.

Examples of degenerative diseases include, but are not limited to, Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease), cancer, Charcot-Marie-Tooth disease (CMT), chronic traumatic encephalopathy, cystic fibrosis, cytochrome oxidase deficiency (commonly is the cause of degenerative Leigh syndrome), Ehlers-Danlos syndrome, fibrodysplasia ossificans progressiva, Friedreich's ataxia, frontotemporal dementia (FTD), some cardiovascular diseases (for example, atherosclerotic, such as coronary heart disease, aortic stenosis, etc. ), Huntington's disease, childhood neuroaxonal dystrophy, keratoconus (KK), keratoglobus, leukodystrophy, macular degeneration (MAD), Marfan syndrome (MFS), some mitochondrial myopathies, mitochondrial DNA depletion syndrome, multiple sclerosis (MS), multiple system atrophy, muscular dystrophies (MD), neuronal ceroid lipofuscinosis, Niemann-Pick disease, osteoarthritis, osteoporosis, Parkinson's disease, pulmonary arterial hypertension, all prion diseases (Creutzfeldt-Jakob disease, fatal familial insomnia, etc.), progressive supranuclear palsy, pigmentary retinitis (RP), rheumatoid arthritis, Sandhoff disease, spinal muscular atrophy (SMA, motor neuron disease), subacute sclerosing panencephalitis, Tay-Sachs disease and vascular dementia (may not be neurodegenerative in itself, but often occurs along with other forms of degenerative dementia).

Typical cancers include, but are not limited to, all forms of carcinoma, melanoma, blastoma, sarcoma, lymphoma and leukemia, including, but not limited to, bladder cancer, bladder carcinoma, brain tumors, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, endometrial cancer, hepatocellular carcinoma, laryngeal cancer, lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, kidney cancer and thyroid cancer, acute lymphocytic leukemia, acute myeloid leukemia, ependymoma, Ewing's sarcoma, glioblastoma, medulloblastoma, neuroblastoma, osteosarcoma, rhabdomyosarcoma, rhabdoid cancer and nephroblastoma (Wilms tumor).

Exemplary autoimmune disorders include, but are not limited to, adult Still's disease, agammaglobulinemia, alopecia areata, amyloidosis, ankylosing spondylitis, anti-GBM/anti-TBM nephritis, antiphospholipid syndrome, autoimmune angioedema, autoimmune dysautonomia, autoimmune encephalomyelitis, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune retinopathy, autoimmune urticaria, axonal and neuronal neuropathy (AMAN), Balo's disease, Behçet's disease, benign mucosal pemphigoid, bullous pemphigoid, Castleman's disease (CD), celiac disease, Chagas disease, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic recurrent multifocal osteomyelitis (CRMO), Churg-Strauss syndrome (CSS) or eosinophilic gra

- 30 046088 nullomatosis (EGPA), cicatricial pemphigoid, Cogan's syndrome, cold agglutination disease, congenital heart block, Coxsackie myocarditis, CREST syndrome, Crohn's disease, dermatitis herpetiformis, dermatomyositis, Devic's disease (opticomyelitis), discoid lupus, Dressler's syndrome, endometriosis , eosinophilic esophagitis (EoE), eosinophilic fasciitis, erythema nodosum, essential mixed cryoglobulinemia, Evans syndrome, fibromyalgia, fibrosing alveolitis, giant cell arteritis (temporal arteritis), giant cell myocarditis, glomerulonephritis, Goodpasture's syndrome, granulomatosis with polyangiitis, Graves' disease, Guillain's syndrome - Barre, Hashimoto's thyroiditis, hemolytic anemia, Henoch-Schönlein purpura (HSP), herpes gravidarum or pemphigoid gravidarum (PG), hidradenitis Suppurativa (HS) (Acne Inversa), hypogammalglobulinemia, IgA nephropathy, IgG4-related sclerosing disease, immune thrombocytopenia purpura (ITP), inclusion body myositis (IBM), interstitial cystitis (IC), juvenile arthritis, juvenile diabetes (type 1 diabetes), juvenile myositis (JM), Kawasaki disease, Lambert-Eaton syndrome, leukocytoclastic vasculitis, lichen planus , lichen sclerosus, woody conjunctivitis, linear IgA disease (LAD), lupus, chronic Lyme disease, Meniere's disease, microscopic polyangiitis (MPA), mixed connective tissue disease (MCTD), Moray ulcer, Mucha-Habermann disease, multifocal motor neuropathy (MMN ) or MMNCB, multiple sclerosis, myasthenia gravis, myositis, narcolepsy, neonatal lupus, neuromyelitis optica, neutropenia, ocular cicatricial pemphigoid, optic neuritis, palindromic rheumatism (PR), PANDAS, paraneoplastic cerebellar degeneration (PCD), paroxysmal nocturnal hemoglobinuria (PNH), Parry-Romberg syndrome, parsplanitis (peripheral uveitis), Parsonage-Turner syndrome, pemphigus, peripheral neuropathy, perivenous encephalomyelitis, pernicious anemia (RA), POEMS syndrome, polyarteritis nodosa, polyglandular syndromes type I, II, III, polymyalgia rheumatica, polymyositis, post-infarction syndrome, post-pericardiotomy syndrome, primary biliary cirrhosis, primary sclerosing cholangitis, progesterone dermatitis, psoriasis, psoriatic arthritis, pure red cell aplasia (PRCA), pyoderma gangrenosum, Raynaud's phenomenon, reactive arthritis, reflex sympathetic dystrophy, relapsing polychondritis, restless legs syndrome (RLS ), retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis, sarcoidosis, Schmidt's syndrome, scleroderma, Sjogren's syndrome, sperm and testicular autoimmunity, stiff person syndrome (SPS), subacute bacterial endocarditis (SBE), Susak syndrome, sympathetic ophthalmia (SO), arteritis Takayasu, temporal arteritis/giant cell arteritis, thrombocytopenic purpura (TTP), Tolosa-Hunt syndrome (THS), transverse myelitis, type 1 diabetes, ulcerative colitis (UC), undifferentiated connective tissue disease (UCTD), uveitis, vasculitis, vitiligo and disease Vogta-Koyanagi-Harada.

Examples of cardiovascular disorders include, but are not limited to, coronary artery disease (CAD), angina pectoris, myocardial infarction, stroke, heart attack, heart failure, hypertensive heart disease, neurotic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, valve disease heart disease, carditis, aortic aneurysm, peripheral artery disease, thromboembolism and venous thrombosis.

Examples of coagulation disorders include, but are not limited to, hemophilia, von Willebrand disease, disseminated intravascular coagulation, liver disease, excess production of circulating anticoagulants, vitamin K deficiency, platelet dysfunction, and other coagulation disorders.

Examples of eye diseases include, but are not limited to, macular degeneration, bulging eye, cataract, CMV retinitis, diabetic macular edema, glaucoma, keratoconus, ocular hypertension, ocular migraine, retinoblastoma, subconjunctival hemorrhage, pterygium, keratitis, dry eye and corneal erosion.

Examples of infectious diseases include, but are not limited to, acute flaccid myelitis (AFM), anaplasmosis, anthrax, babesiosis, botulism, brucellosis, campylobacteriosis, carbapenem-resistant infection (CRE/CRPA), chancroid, chikungunya virus infection (chikungunya), chlamydia, ciguatera ( harmful algal blooms (HABs), Clostridium Difficile infection, Clostridium Perfringens (epsilon toxin), fungal infection coccidioidomycosis (valley fever), COVID-19 (coronavirus disease 2019), Creutzfeldt-Jakob disease, transmissible spongiform encephalopathy (CJD), cryptosporidiosis (Crypto), cyclosporiasis, tropical fever, 1,2,3,4 (dengue fever), diphtheria, Escherichia coli infection, Shiga toxin produced (STEC), Eastern equine encephalitis (EEE), Ebola hemorrhagic fever (Ebola), ehrlichiosis, encephalitis, arboviral or parainfectious, enterovirus infection, non-poliomyelitis (non-polio enterovirus), enterovirus infection, D68 (EV-D68), giardiasis (giardia), glanders, gonococcal infection (gonorrhea), inguinal granuloma, Haemophilus Influenza disease, type B ( Hib or H-flu), hantavirus pulmonary syndrome (HPS), hemolytic uremic syndrome (HUS), hepatitis A (Hepatitis A), hepatitis B (Hep B), hepatitis C (Hepatitis C), hepatitis D (hepatitis D), hepatitis E (hepatitis E), herpes, herpes zoster, herpes zoster VZV (herpes zoster), histoplasmosis infection (histoplasmosis), human immunodeficiency virus/AIDS (HIV/AIDS), human papillomavirus (HPV), Influenza (flu), lead poisoning , le

- 31 046088 gyonellosis (Legionnaires' disease), leprosy (Hansen's disease), leptospirosis, listeriosis (listeria), Lyme disease, lymphogranuloma venereum infection (LGV), malaria, measles, melioidosis, meningitis, viral (meningitis, viral), epidemic meningitis, bacterial (meningitis, bacterial), Middle East respiratory syndrome coronavirus (MERS-CoV), mumps, norovirus, paralytic shellfish poisoning (paralytic shellfish poisoning, ciguatera), pediculosis (lice, head lice, body lice), pelvic inflammatory disease (PID), whooping cough (convulsive cough), plague; bubonic, septicemic, pneumonic (plague), pneumococcal disease (pneumonia), poliomyelitis (infantile paralysis), powassan, ornithosis (parrot fever), ptyriasis (crabs; pubic lice infestation), pustular rash (smallpox, monkeypox, cowpox), Q-Fever, rabies, ricin poisoning, rickettsiosis (Rocky Mountain spotted fever), rubella, including congenital (German measles), salmonella gastroenteritis (Salmonella), scabies infection (scabies), scombroid, septic shock (sepsis), severe acute respiratory syndrome (SARS), shigella gastroenteritis (Shigella), smallpox, methicillin-resistant staphylococcal infection (MRSA), staphylococcal food poisoning, enterotoxin-B poisoning (staph food poisoning), staph infection, vancomycin intermediate (VISA), vancomycin-resistant staphylococcal infection (VRSA), group A streptococcal infection (invasive) (Strep A (invasive)), group B streptococcal infection (Strep-B), streptococcal toxic shock syndrome, STSS, toxic shock syndrome (STSS, TSS), syphilis (primary, secondary, early latent, late latent, congenital), tetanus infection, tetanus (Lock Jaw), trichomoniasis (trichomoniasis infection), trichonosis infection (trichinosis), tuberculosis (TB), tuberculosis (latent) (LTBI), tularemia (rabbit fever) , typhoid fever (group D), typhus, vaginosis, bacterial (yeast infections), vaping-related lung injury (e-cigarette-related lung injury), varicella (chickenpox), Vibrio cholerae (cholera), vibriosis (vibrio) , viral hemorrhagic fever (Ebola, Lassa, Marburg), West Nile virus, yellow fever, Yersenia and Zika virus infection.

Examples

Example 1: Construct design and RNA production.

The screening construct was designed to ensure inclusion of a broad range of one or more internal RNA target motifs. The construct contained two motifs: the TPP riboswitch domain ²⁷ and a pseudoknot from the dengue virus 5′UTR ²⁶ . The full sequence design of the construct, including the structural cassettes, the RNA barcode helix, and two test RNA structures (separated by a six‐nucleotide linker), was assessed using the RNA structure ³⁹ . To reduce the likelihood that the two test structures would interact, a small number of sequence changes were made to prevent misfolded structures predicted by the RNA structure while maintaining the native fold (Fig. 7). The structure of the final construct was confirmed by SHAPE-MaP.

RNA barcodes were designed to fold into self-contained hairpins (Figure 7). All possible permutations of RNA barcodes were calculated and collapsed in the context of the complete sequence of the construct, and any barcodes that could interact with another part of the RNA construct were removed from the set. The barcode constructs were probed with SHAPE-MaP using a ligand-free protocol and folded using the SHAPE reactivity-constrained RNA structure to confirm that the barcode helices were folded into the desired free-standing hairpins.

Obtaining RNA.

DNA templates (Integrated DNA Technologies) for in vitro transcription encoded the target sequence construct (containing the dengue pseudoknot sequence, single-stranded linker and TPP riboswitch sequence) and flanking structural cassettes ²⁵ :

5'-GTGGG CASTT CGGTG TCC AC ACGCG

AAGGA AACCG CGTGT CAAST GTGCA ACAGC TGACA AAGAG ATTSS TAAAAAA

CTCAG TASTS GGGGT GCCCT TCTGC GTGAA GGCTG AGAAA TASS GTATC ACCTG

ATCTG GATAA TGCCA GCGTA GGGAA GTGCT GGATC CGGTT CGCCG GATCA ATCGG

GCTTC GGTCC GGTTC-3' (SEQ ID NO:1).

Primer binding sites are underlined.

Direct PCR primers containing unique RNA barcodes and T7 promoter sequence were used to individually add RNA barcodes to each of the 96 constructs in individual PCR reactions. An example of a forward primer sequence, where the barcode nucleotides are in bold and the primer binding site is underlined:

5'- GAAAT TACGA STS AC TAT AG GTCGC GAGTA ATCGC GACCG

GCGCT AGAGA TAGTG CCGTG GGCAC TTCGG TGTC -3’ (SEQ ID NO:2).

DNA was amplified by PCR using 200 μM dNTP mix (New England Biolabs), 500 nM forward primer, 500 nM reverse primer, 1 ng DNA template, 20% (v/v) reaction.

- 32 046088 Q5 buffer and 0.02 U/μl of Q5 high-precision hot-start polymerase (New England Biolabs) for creating templates for in vitro transcription. DNA was purified (PureLink Pro 96 PCR Purification Kit; Invitrogen) and quantified (Quant-iT dsDNA High Sensitivity Assay Kit; Invitrogen) on a Tecan Infinite M1000 Pro microplate reader.

In vitro transcription was performed in a 96-well plate format, with each well containing 100 μl of total reaction volume. Each well contained 5 mM NTPs (New England Biolabs), 0.02 U/μl inorganic pyrophosphatase (yeast, New England Biolabs), 0.05 mg/ml T7 polymerase in 25 mM MgCl ₂ , 40 mM Tris, pH 8.0 , 2.5 mM spermidine, 0.01% Triton, 10 mM DTT and 200-800 nM unique barcoded DNA template (generated using PCR). Reactions were incubated at 37°C for 4 h; then treated with TurboDNase (RNase-free, Invitrogen) at a final concentration of 0.04 U/μl; incubated at 37°C for 30 min; followed by the addition of a second DNase to a total final concentration of 0.08 U/μL and an additional 30-minute incubation at 37°C. Enzymatic reactions were stopped by adding EDTA to a final concentration of 50 mM and placed on ice. RNA was purified (Agencourt RNAclean XP magnetic beads; Beckman Coulter) in 96-well format and resuspended in 10 mM Tris, pH 8.0, 1 mM EDTA. RNA concentrations were quantified (Quant-iT Broad Spectrum RNA Assay Kit; Invitrogen) on a Tecan Infinite M1000 Pro microplate reader, and the RNA in each well was separately diluted to 1 pmol/μl. RNA was stored at -80°C.

Example 2. Chemical modification and screening of low molecular weight fragments.

Fragments were obtained as a fragment screening library from Maybridge, which was part of their Ro3 diversity fragment library and contained 1500 compounds dissolved in DMSO at 50 mM. Most of these compounds adhere to the rule of three for fragment compounds; with a molecular weight <300 Da, containing <3 hydrogen bond donors and <3 hydrogen bond acceptors, and ClogP <3.0. All compounds used for ITC, with the exception of those listed in Example 5, were purchased from Millipore-Sigma and used without further purification. Screening experiments were performed in 25 μl 96-well plate format on a Tecan Freedom Evo-150 fluidic manipulator equipped with an 8-channel air displacement pipette manipulator, disposable filter tips, a robotic arm and an EchoTherm RIC20 dry heating/cooling bath with remote control (Torrey Pines Scientific). Fluid manipulator programs used for screening are available upon request.

To screen the first ligand fragment, 5 pmol of RNA per well was diluted to 19.6 μl in RNase-free water on a cooling block at 4°C. The plate was heated at 95°C for 2 min and then immediately quenched to 4°C for 5 min. 19.6 μl of 2× buffer (final concentration 50 mM HEPES, pH 8.0, 200 mM potassium acetate, and 10 mM MgCl ₂ ) was added to each well, and the plates were incubated at 37°C for 30 min. To screen the second ligand fragment, 24.3 μl of folded RNA per well was added to 2.7 μl of primary binding fragment in DMSO to a final fragment concentration of 10x K _d , and samples were incubated at 37°C for 10 min. To combine target RNA with fragment, 24.3 μl of RNA or RNA plus primary binding fragment solution was added to wells containing 2.7 μl of 10x screening fragments (in DMSO to give a final fragment concentration of 1 mM). The solutions were thoroughly mixed by pipetting and incubated for 10 minutes at 37°C. For SHAPE probing, 22.5 μL of RNA fragment solution from each well of the screening plate was added to 2.5 μL of 10x SHAPE reagent in DMSO on a heating block at 37°C and rapidly mixed with a pipette to achieve homogeneous distribution of SHAPE reagent with RNA. After the appropriate reaction time, the samples were placed on ice. To screen the first fragment, 1-methyl-7-nitroisatoic anhydride (1M7) was used as a SHAPE reagent at a final concentration of 10 mM with a reaction time of 5 min. To screen the second fragment, 5-nitroisatoic anhydride (5NTA) ⁴⁰ was used as the SHAPE reagent at a final concentration of 25 mM with a reaction time of 15 min. Excess fragments, solvent, and digested SHAPE reagent were removed using AutoScreen-A 96-well plates (GE Healthcare Life Sciences), and 5 μl of modified RNA from each well of the 96-well plate was pooled into one sample per plate for library preparation for sequencing.

Each screen consisted of 19 fragment test plates, two plates containing a distribution of positive (fragment 2, final concentration 1 mM) and negative (solvent, DMSO) controls, and one SHAPE negative control plate treated with solvent (DMSO) instead of SHAPE reagent. For hit validation experiments, the well locations of each hit fragment were measured to control for well locations and RNA barcoding effects. Tablet maps were also available for both the main and secondary screens.

After screening of test fragments is completed, statistical tests are performed to identify differences in the modification coefficient of a given nucleotide. In particular, the screening analysis requires a statistical comparison of the modification coefficient of a given nucleotide in the presence of the fragment compared with its absence. For each nucleotide, the number of modifications in a given

- 33 046088 reaction is a Poisson process with known variance; thus, the statistical significance of the observed difference in modification coefficients between the two samples can be established by performing a comparison of two Poisson tests ³¹ . That is, if modifications m ₁ of the test nucleotide were counted among n ₁ reads in sample 1 and modifications m 2 were counted among n 2 reads in sample 2, the null hypothesis tested predicts that among all modifications counted (m ₁ + m2) the proportion of modification in the sample 1 will be p ₁ = n ₁ /(n ₁ + n2). Z-test of this hypothesis:

. pc - /d (w, + πι ₂ ) + 0.5 2>> - ...............—................. .---------------------------------------=g~

U/M 1 - /'1 )(t! + m _z ) pc - /h(pc + t,) - 0.5

V/'iC 1 - Ρι)(™ι + '%>)

7. = min( |Z _/7 |, j%|)

If the Z value exceeds a given significance threshold, the test nucleotide is considered to be statistically significantly influenced by the presence of the test fragment.

For each fragment, a Z test must then be performed on the large number of nucleotides that make up the RNA sequence, increasing the likelihood of false positives. Although the number of false positives in the SHAPE nucleotide reactivity assay can be minimized by increasing the Z significance threshold, this approach will reduce the sensitivity of the screen (i.e., reduce the ability to detect weaker binding ligands). To reduce the number of Z tests performed, such tests were applied only to nucleotides in the region of interest rather than to all nucleotides in the RNA screen construct. For the dengue RNA motif, the region of interest was located at positions 59–110; for the TPP motif, the region of interest was positions 100–199. The number of Z tests was further reduced by excluding nucleotides with low modification coefficients in both samples. The threshold for considering a nucleotide as having a low modification coefficient was set at 25% of the average plate modification coefficient, which was calculated for all nucleotides in all 96 wells of a given plate. Z-tests were performed only on those nucleotides that, in at least one of the two samples compared, had a modification coefficient exceeding this 25% threshold.

Ideally, the only difference between the conditions in the two samples being compared would be the presence of the fragment in one sample, but its absence in the other. Comparing negative control samples to each other can be used to assess the prevalence of uncontrolled factors that may lead to sample-to-sample variability in the nucleotide modification ratio. For example, if the Z significance threshold is set at 2.7, in the absence of any such factors, a Z test applied to pairs of negative control samples (no fragments) should theoretically identify differentially reactive nucleotides with probability P = 0.0035. However, when the Z test was applied to pairs of negative control samples randomly selected from the 587 negative control samples tested in the primary screening, the actual probability was 90 times higher with P = 0.32. Thus, statistically significant variability in the SHAPE reactivity of individual nucleotides was observed in the absence of fragments.

Although most replicates had essentially the same profiles, there were a significant number of replicates with different profiles; some coefficients of determination were as low as 0.85. Applying the Z test to different negative control samples resulted in a large number of cases where nucleotides were misclassified as differentially reactive. To avoid this outcome, each sample was compared to the five most highly correlated negative control samples. Z tests applied to such selective pairs of negative controls with a Z significance threshold of 2.7 resulted in the identification of differentially reactive nucleotides with a probability of P = 0.067.

This probability is about 20 times higher than the theoretical P = 0.0035, indicating variability in sample processing. Some of this variability scales equally across the reactivity of all nucleotides of all RNAs in the sample. This variability can be eliminated by reducing the overall reactivity of the more reactive sample to match the overall reactivity of the less reactive sample. This scaling was performed by (i) calculating for each nucleotide in the RNA sequence the ratio of its modification coefficient in the more reactive sample to its modification coefficient in the less reactive sample and (ii) dividing the modification coefficient of all nucleotides in the more reactive sample by the median of the ratios obtained in step (i). This scaling of the negative control well pairs with maximum correlation reduced the probability of detecting nucleotide hits to P = 0.030, which is 9 times higher than the theoretical probability. Thus, false positive fragment identifications would occur, as indeed occurs in all high throughput screening assays, and actual fragment hits with unligand variations were isolated by retesting SHAPE and directly measuring whether binding

- 34 046088 ganda using ITC.

Since an effective ligand is expected to influence the modification ratio of several nucleotides in the target RNA, a fragment was considered a hit only if the number of nucleotides with reactivity different from that in the negative control exceeded a certain threshold, which was set to 2. In Secondly, when looking for relatively strong effects of fragments on RNA, small relative differences in nucleotide reactivity, even if statistically significant, were excluded from the total number of differentially reactive nucleotides. In practice, the minimum acceptable difference was set at 20% of the average:

|l - g ₂ | / (l + l) / 2 = 0.2, where r ₁ and r ₂ are the coefficients of nucleotide modification in two samples. Third, this sample was tested against the five negative control samples with which it had the highest correlation. All five tests were necessary to detect changes in the test sample compared to the negative control sample.

Finally, the sensitivity and specificity of the screen were controlled by the choice of the significance threshold Z. Samples containing fragments and all negative control samples were assessed at multiple significance threshold Z parameters. For each such parameter, the false positive rate (FPF) was calculated as the proportion of negative control samples in which a change was detected and the ligand fraction (LF) was estimated by subtracting the FPF from the fraction of altered samples containing the fragment. The balance between LF and FPF was quantified by their LF/FPF ratio. The best balance (LF/FPF " 1.3) for TPP riboswitch RNA was achieved with a significance threshold Z ranging from 2.5 to 2.7, at which 0.022 > FPF > 0.014. For dengue pseudonodule, the best balance (LF/FPF " 4) was achieved at a significance threshold Z ranging from 2.5 to 2.65, at which 0.007 > FPF > 0.005.

Example 3: Library preparation and sequencing.

Reverse transcription was performed on pooled modified RNA in a volume of 100 μl. To 71 μl of pooled RNA, 6 μl of reverse transcription primer was added to achieve a final primer concentration of 150 nM, and the sample was incubated at 65°C for 5 min and then placed on ice. To this solution was added 6 μl of 10x first-strand synthesis buffer (500 mM Tris, pH 8.0, 750 mM KCl), 4 μl of 0.4 M DTT, 8 μl of dNTP mixture (10 mM each) and 15 μl of 500 mM MnCl ₂ and the solution was incubated at 42°C for 2 min before adding 8 μl of Superscript II reverse transcriptase (Invitrogen). The reaction was incubated at 42°C for 3 h, followed by heat inactivation at 70°C for 10 min before placing on ice. The resulting cDNA product was purified (Agencourt RNAClean magnetic beads; Beckman Coulter), eluted with RNase-free water, and stored at 20°C. The reverse transcription primer sequence was 5'-CGGGC TTCGG TCCGG TTC-3' (SEQ ID NO: 3)

DNA libraries were prepared for sequencing using a two-step PLR reaction to amplify the DNA and add the required TruSeq adapters ²⁴ . DNA was amplified by PNR using 200 μM dNTP mix (New England Biolabs), 500 nM forward primer, 500 nM reverse primer, 1 ng cDNA or dsDNA template, 20% (v/v) Q5 reaction buffer (New England Biolabs) and 0.02 U/μl of high-fidelity hot start polymerase Q5 (New England Biolabs). Excess unincorporated dNTPs and primers were removed by affinity purification (Agencourt AmpureXP magnetic beads; Beckman Coulter; sample to bead ratio 0.7:1). DNA libraries were quantified (Qubit dsDNA High Sensitivity Assay Kit; Invitrogen) on a Qubit Fluorometer (Invitrogen), quality checked (Bioanalyzer 2100 On-Chip Electrophoresis Instrument; Agilent), and sequenced on an Illumina NextSeq 550 high-throughput sequencer.

The amplicon-specific forward primer for generating the SHAPE-MaP library was 3'-CCTA CACGA CGCTC TTCCG ATCTN NNNNG GCCTT CGGGC CAAGG A-3' (SEQ ID NO:4)

The amplicon-specific reverse primer for generating the SHAPE-MaP library was 5'-GACTG GAGTT CAGAC GTGTG TTTTT

CCGAT CTNNN NNTTG AACCG GACCG AAGCC CGATT T-3' (SEQ ID NO:5)

Sequences overlapping the RNA screening construct are underlined.

Example 4. Isothermal titration calorimetry.

ITC experiments were performed using an automated Microcal PEAQITC instrument (Malvern Analytical) under RNase‐free conditions ⁴¹ . In vitro transcribed RNA was replaced with folding buffer containing 100 mM CHES, pH 8.0, 200 mM potassium acetate, and 3 mM MgCl2 using centrifugal concentration (Amicon ultracentrifugal filters, 10K MWCO, Millipore-Sigma). Ligands were dissolved in the same buffer (to minimize the heat of mixing when adding ligand to RNA) at a concentration 10–20 times the required experimental RNA concentration. RNA concentration was quantified (Nanodrop UVVIS spectrometer; ThermoFisher Scientific), diluted 1-10 times the expected K _d in the buffer, and diluted

- 35 046088 RNA was requantified to confirm the final experimental RNA concentration. RNA diluted in folding buffer was heated at 65°C for 5 min, placed on ice for 5 min, and allowed to fold at 37°C for 15 min. If necessary, the primary binding ligand (eg, 2) was prebound to the RNA by adding 0.1 volume of 10 times the desired final concentration of bound ligand, followed by incubation at room temperature for 10 min.

Each ITC experiment included two runs: one in which the ligand was titrated into RNA (experimental curve) and another in which the same ligand was titrated in buffer (control curve). ITC experiments were performed using the following parameters: cell temperature 25°C, reference power 8 μCal/s, agitation speed 750 rpm, high feedback mode, initial injection of 0.2 μL, followed by 19 injections of 2 μL. Each injection required 4 seconds to complete and the interval between injections was 180 seconds.

ITC data were analyzed using MicroCal PEAQ-ITC analysis software (Malvern Analytical). First, the baseline for each injection peak was manually adjusted to correct any incorrectly selected injection endpoints. Second, the control curve was subtracted from the experimental curve by pointwise subtraction. Third, a least squares regression line was fitted to the data using the Levenberg-Marquardt algorithm. For weakly binding ligands (>500 μM), N was manually set to 1.0 to allow curves with low c values to be fitted.

Example 5 Chemical synthesis of test compounds 35, 36, 37, 38, 39 and 40.

Compound 35: 3-C-linked hydroxamic acid 35 was prepared from carboxylic acid S19 via a mixed anhydride intermediate by reaction with aqueous hydroxylamine. Acid S19 was prepared by treating quinoxaline-6-amine with cyclized dihydrofuran-2,5-dione anhydride.

N NN, *. Η p NN radlikh. 1 h O MeOH. kgZh O ^F S20 36

Compound 36. The 2-C-linked analogue 36 was prepared from the corresponding ester S20 by reaction with hydroxylamine formed in situ. Ester S20 was prepared by Michael addition of quinoxaline-6-amine with ethyl acrylate.

Compound 37 The Buchwald-Hartwig reaction was used to synthesize intermediates S21 and S22. Deprotection (Boc) was achieved with HCl in ether followed by further treatment with Na ₂ CO ₃ to give 37.

LZD ⁺ 3. MaVNd, ct, 1 h. ^N

84% 38

Compound 38. Formation of an imine and subsequent reduction of quinoxaline-6-carbaldehyde and diamine with sodium borohydride to give compound 38.

- 36 046088

Compound 39 Imine formation and subsequent sodium borohydride reduction of quinoxalin-6-ylmethanamine hydrochloride and aldehyde S23 from the SnAt reaction yielded intermediate S24, which after deprotection (Boc) with HCl yielded 39.

Compound 40 The less restrictive analogue 40 was prepared using two Buchwald-Hartwig reactions with 3,5-dibromopyridine followed by deprotection (Boc) with HCl.

Example 6. X-ray crystallography.

To evaluate whether structural variants 2 would be good candidates for binding to the TPP riboswitch, Compound 17 was examined by X-ray crystallography. TPP riboswitch RNA was prepared by in vitro transcription as described ²⁷ . TPP (0.2 mM) and 17 (2 mM) riboswitch RNAs were heated in a buffer containing 50 mM potassium acetate (pH 6.8) and 5 mM MgCl2 at 60°C for 3 min, quenched in crushed ice, and incubated at 4°C for 30 min until crystallization. For crystallization, 1.0 μl of RNA-17 complex was mixed with 1.0 μl of reservoir solution containing 0.1 M sodium acetate (pH 4.8), 0.35 M ammonium acetate and 28% (v/v) PEG4000 . Crystallization was carried out at 291 K using the hanging drop method via vapor diffusion for 2 weeks. The crystals were cryoprotected in a mother liquor supplemented with 15% glycerol before being quickly frozen in liquid nitrogen. Data were collected at beamline 17-ID-2 (FMX) at NSLS-II (Brookhaven National Laboratory) at a wavelength of 0.9202 A. Data were processed using HKL200043. The structure was solved by molecular replacement using Phenix44 and the 2GDI riboswitch RNA structure ²⁷ . The structure was clarified by Phenix. Organic ligand, water molecules, and ions were added at late stages of refinement based on the electron density maps of Fo-Fc and 2Fo-Fc.

The results showed that compound 17 binds the TPP riboswitch in a manner similar to the thiamine moiety of the TPP ligand, located between G42 and A43 at the J3/2 junction (Fig. 3) ^27,28 . 17 forms three hydrogen bonds with RNA: one each on the ribose and the Watson-Crick surface G40 and one each on the ribose G19. Compared to RNA, in complex with the native TPP ligand, a significant change in the local structure of RNA occurs. In the 17-linked structure, G72 is flipped into the binding site where the pyrophosphate moiety of the TPP ligand is located. This binding mode is consistent with previous work that visualized an inverted G72 orientation for fragments bound in

- 37 046088 thiamine subsite of the riboswitch binding pocket ^17.34 . Based on SAR analysis, the orientation of the C-6 substituent appears to be relatively unhindered by interactions with RNA, meaning that this vector may be a good candidate for fragment generation.

Links

1. Hajduk, R. I, Huth, J. R. & Tse, S. Predicting protein druggability. Drug Discov. Today 10, 1675-1682 (2005).

2. Vukovic, S. & Huggins, D. J. Quantitative metrics for drug-target ligandability. Drug Discov. Today 23, 1258-1266 (2018).

3. Batey, R. T., Rambo, R. P. & Doudna, J. A. Tertiary Motifs in RNA Structure and Folding.

Angew. Chem. Int. Ed. 38, 2326-2343 (1999).

4. Warner, K. D., Hajdin, S. E. & Weeks, K. M. Principles for targeting RNA with drug-like small molecules. Nat. Rev. DrugDiscov. 17, 547-558 (2018).

5. Sharp, P. A. The Centrality of RNA. Cell 136, 577-580 (2009).

6. Kozak, M. Regulation of translation via mRNA structure in prokaryotes and eukaryotes. Gene 361, 13-37 (2005).

7. Corbino, K. A., Sherlock, M. E., McCown, P. J., Breaker, R. R. & Stav, S. Riboswitch diversity and distribution. RNA 23, 995-1011 (2017).

8. Cech, T. R. & Steitz, J. A. The noncoding RNA revolution - Trashing old rules to forge new ones. Cell 157, 77-94 (2014).

9. Parsons, C., Slack, F. J., Zhang, W. C., Adams, B. D. & Walker, L. Targeting noncoding RNAs in disease. J. Clin. Invest. 127, 761-771 (2017).

10. Matsui, M. & Corey, D. R. Non-coding RNAs as drug targets. Nat. Rev. Drug Discov. 16, 167-179 (2017).

11. Guan, L. & Disney, M. D. Recent advances in developing small molecules targeting RNA. ACS Chem. Biol. 7, 73-86 (2012).

12. Connelly, S. M., Moon, M. H. & Schneekloth, J. S. The Emerging Role of RNA as a Therapeutic Target for Small Molecules. Cell Chem. Biol. 23, 1077-1090 (2016).

13. Murray, C. W. & Rees, D. C. The rise of fragment-based drug discovery. Nat. Chem. 1, 187–92 (2009).

14. Doak, V. C., Norton, R. S. & Scanlon, M. J. The ways and means of fragment-based drug design. Pharmacol. Ther. 167, 28-37 (2016).

15. Cressina, E., Chen, L., Abell, C., Leeper, F. J. & Smith, A. G. Fragment screening against the thiamine pyrophosphate riboswitch thiM. Chem. Sci. 2, 157-165 (2011).

16. Moumne, R., Catala, M., Larue, V., Micouin, L. & Tisne, C. Fragment-based design of small RNA binders: Promising developments and contributions of NMR. Biochimie 94, 1607-1619 (2012).

17. Warner, K. D. et al. Validating fragment-based drug discovery for biological RNAs: Lead fragments bind and remodel the TPP riboswitch specifically. Chem. Biol. 21, 591-595 (2014).

- 38 046088

18. Zeiger, M. et al. Fragment based search for small molecule inhibitors of HIV-1 Tat-TAR. Bioorganic Med. Chem. Lett. 24, 5576-5580 (2014).

19. Bottini, A. et al. Targeting Influenza A Virus RNA Promoter. Chem. Biol. Drug Des. 86, 663-673 (2015).

20. Hunter, C. A. & Anderson, H. L. What is cooperativity? Angew. Chemie - Int. Ed. 48, 74887499 (2009).

21. Ichihara, 0., Barker, J., Law, R. J. & Whittaker, M. Compound design by fragment-linking. Mol. Inform. 30, 298-306 (2011).

22. Zeller, M. J., Li, K., Aube, J. & Weeks, K. M. Multisite ligand recognition and cooperation in the TPP riboswitch RNA. Prep. (2019).

23. Siegfried, N. A., Busan, S., Rice, G. M., Nelson, J. A. E. & Weeks, K. M. RNA motif discovery by SHAPE and mutational profiling (SHAPE-MaP). Nat. Methods 11, 959-65 (2014).

24. Smola, M. J., Rice, G. M., Busan, S., Siegfried, N. A. & Weeks, K. M. Selective 2'-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis. Nat. Protoc. 10, 1643-1669 (2015).

25. Merino, E. J., Wilkinson, K. A., Coughlan, J. L. & Weeks, K. M. RNA structure analysis at single nucleotide resolution by selective 2’-hydroxyl acylation and primer extension (SHAPE). J. Am. Chem. Soc. 127, 4223-4231 (2005).

26. Liu, Z.-Y. et al. Novel cis-acting element within the capsid-coding region enhances flavivirus viral-RNA replication by regulating genome cyclization. J. Virol. 87, 6804-18 (2013).

27. Serganov, A., Polonskaia, A., Phan, A. T., Breaker, R. R. & Patel, D. J. Structural basis for gene regulation by a thiamine pyrophosphate-sensing riboswitch. Nature 441, 1167-1171 (2006).

28. Edwards, T. E. & Ferre-D’Amare, A. R. Crystal structures of the thi-box riboswitch bound to thiamine pyrophosphate analogs reveal adaptive RNA-small molecule recognition. Structure 14, 1459-68 (2006).

29. Thore, S., Frick, C. & Ban, N. Structural basis of thiamine pyrophosphate analogues binding to the eukaryotic riboswitch. J. Am. Chem. Soc. 130, 8116-8117 (2008).

30. Busan, S. & Weeks, K. M. Accurate detection of chemical modifications in RNA by mutational profiling (MaP) with ShapeMapper 2. RNA 24, 143-148 (2018).

31. Woolson, R. Statistical Methods for the Analysis of Biomedical Data. (John Wiley & Sons, 1987).

32. Jhoti, H., Williams, G., Rees, D. C. & Murray, C. W. The ‘rule of three’ for fragment-based drug discovery: Where are we now? Nat. Rev. DrugDiscov. 12, 644 (2013).

33. Chen, L. et al. Probing riboswitch-ligand interactions using thiamine pyrophosphate analogues. Org. Biomol. Chem. 10, 5924-5931 (2012).

- 39 046088

34. Warner, K. D. & Ferre-D'Amare, A. R. Crystallographic analysis of TPP riboswitch binding by small-molecule ligands discovered through fragment-based drug discovery approaches. Methods Enzymol. 549, 221-233 (2014).

35. Codd, R. Traversing the coordination chemistry and chemical biology of hydroxamic acids. Coord. Chem. Rev. 252, 1387-1408 (2008).

36. Jencks, W. P. On the attribution and additivity of binding energies. Proc. Natl. Acad. Set. U.S.A. 78, 4046-4050(1981).

37. Olejniczak, E. T. et al. Stromelysin inhibitors designed from weakly bound fragments: Effects of linking and cooperativity. J. Am. Chem. Soc. 119, 5828-5832 (1997).

38. Borsi, V., Calderone, V., Fragai, M., Lucinat, C. & Sarti, N. Entropic contribution to the linking coefficient in fragment based drug design: A case study. J. Med. Chem. 53, 42854289 (2010).

39. Reuter, J. S. & Mathews, D. H. RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 11, 129 (2010).

40. Busan, S., Weidmann, C. A., Sengupta, A. & Weeks, K. M. Guidelines for SHAPE Reagent Choice and Detection Strategy for RNA Structure Probing Studies. Biochemistry 58, 26552664 (2019).

41. Gilbert, S. D. & Batey, R. T. Monitoring RNA-ligand interactions using isothermal titration calorimetry. Methods Mol. Biol. 540, 97-114 (2009).

42. Turnbull, W. B. Divided We Fall? Studying low affinity fragments of ligands by ITC. Microcal Application Notes (2005).

43. Otwinowski, Z. & Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. (1997). doi:10.1016/S0076-6879(97)76066-X.

44. Liebschner, D. et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr. 75, 861-877 (2019).

45. Hajduk, P. J. et al. Discovery of potent nonpeptide inhibitors of stromelysin using SAR by NMR. J. Am. Chem. Soc. 119, 5818-5827 (1997).

46. Howard, N. et al. Application of fragment screening and fragment linking to the discovery of novel thrombin inhibitors. J. Med. Chem. 49, 1346-1355 (2006).

47. Barker, J. J. et al. Discovery of a novel Hsp90 inhibitor by fragment linking. ChemMedChem 5, 1697-1700 (2010).

48. Mobitz, H. et al. Discovery of Potent, Selective, and Structurally Novel DotlL Inhibitors by a Fragment Linking Approach. ACS Med. Chem. Lett. 8, 338-343 (2017).

49. Hung, A. W. et al. Application of fragment growing and fragment linking to the discovery of inhibitors of mycobacterium tuberculosis pantothenate synthetase. Angew. Chemie - Int. Ed. 48, 8452-8456 (2009).

50. Jordan, J. B. et al. Fragment-Linking Approach Usingl9F NMR Spectroscopy to Obtain Highly Potent and Selective Inhibitors of β-Secretase. J. Med. Chem. 59, 3732-3749 (2016).

51. Maly, D. J., Choong, I. C. & Ellman, J. A. Combinatorial target-guided ligand assembly: Identification of potent subtype-selective c-Src inhibitors. Proc. Natl. Acad. Sci. 97, 24192424 (2000).

52. Shuker, S. B., Hajduk, P. J., Meadows, R. P. & Fesik, S. W. Discovering High-Affinity Ligands for Proteins: SAR by NMR. Science (80-.). 274, 1531-1534 (1996).

53. Mondal, M. et al. Fragment Linking and Optimization of Inhibitors of the Aspartic Protease Endothiapepsin: Fragment-Based Drug Design Facilitated by Dynamic Combinatorial Chemistry. Angew. Chemie - Int. Ed. 55, 9422-9426 (2016).

54. Swayze, E. E. et al. SAR by MS: A ligand based technique for drug lead discovery against structured RNA targets. J. Med. Chem. 45, 3816-3819 (2002).

-

Claims (7)

CLAIM 1. Compound with structure of formula (II): where X _2a and X _2b represent CR1; X1 and X3 represent N; L selected from where q and r are independently selected from the integers 0, 1, 2, 3, 4 and 5; z is independently selected from the integers 1, 2, 3, 4 and 5; And A selected from where X ₄ and X ₇ represent CR ₃ , and X ₅ and X ₆ are independently selected from CR3 and N; where R1 and _R3 represent -H; m represents 1; W represents -O or -NR ₄ where R4 represents -H; or a pharmaceutically acceptable salt thereof. 2. The compound according to claim 1, characterized in that L is where q and r are independently selected from the integers 0, 1, 2 and 3. 3. The connection according to claim 2, characterized in that q and r are 0 or 1. 4. The compound according to claim 3, characterized in that W represents -NH. 5. The connection according to claim 4, characterized in that X5 or X6 represents N. 6. The compound according to claim 5, characterized in that A is 7. A compound according to claim 1, characterized in that said compound has the structure: -