EA045808B1 - ANTISENSE NUCLEIC ACID THAT INDUCES EXON 50 SKIPPLING - Google Patents

Description

Field of technology

The invention relates to an antisense oligomer that induces skipping of exon 50 in the human dystrophin gene, and to a pharmaceutical composition containing the antisense oligomer.

Prior Art

Duchenne muscular dystrophy (DMD) is the most common and severe form of inherited progressive muscular atrophy, affecting approximately 3,500 male births. Although motor function in patients with DMD rarely differs from healthy controls during infancy and childhood, muscle weakness is observed in children approximately 4 to 5 years of age. Muscle weakness in patients with DMD then progresses to loss of the ability to walk by approximately 12 years of age and death from cardiac or respiratory failure at 20 years of age. Currently, there is no sufficient therapy for DMD, and there is a strong need to develop an effective therapeutic agent.

DMD is known to be caused by a mutation in the dystrophin gene. The dystrophin gene is located on the X chromosome and is a huge gene consisting of 2.2 million base pairs of DNA. The DNA is transcribed into precursor mRNAs and introns are removed by splicing to synthesize an mRNA of 11,058 bases corresponding to the translated region in which 79 exons are joined together. This mRNA is translated into 3685 amino acids to produce the protein dystrophin. The dystrophin protein is associated with maintaining membrane stability in muscle cells and is needed to make muscle cells less fragile. The dystrophin gene in DMD patients contains a mutation and thus rarely expresses the dystrophin protein that is functional in muscle cells. Thus, the muscle cell structure cannot be maintained in DMD patients, resulting in a large influx of calcium ions into the muscle cells. Thus, an inflammatory-like response occurs, promoting fibrosis, which makes it difficult for muscle cells to regenerate.

Becker muscular dystrophy (BMD) is also caused by a mutation in the dystrophin gene. Symptoms include muscle weakness accompanied by muscle wasting, but they are generally mild and progress slowly compared to DMD. In many cases, its onset occurs in adulthood. The differences in clinical symptoms between DMD and BMD are thought to be whether the amino acid reading frame is disrupted by the mutation in the translation of dystrophin mRNA into dystrophin protein (Non-Patent Literature 1). More specifically, in DMD there is a mutational amino acid frameshift and thus functional dystrophin protein is rarely expressed, whereas in DMD a dystrophin protein is produced that functions, albeit imperfectly, because the amino acid reading frame is preserved while some exons are deleted mutation.

Exon skipping is expected to serve as a treatment for DMD. This method involves modifying splicing to restore the amino acid reading frame of dystrophin mRNA and inducing expression of dystrophin protein with partially restored function (Non-Patent Literature 2). The portion of the amino acid sequence that is the target of exon skipping will be lost. For this reason, the dystrophin protein expressed with this treatment becomes shorter than normal, but since the amino acid reading frame is preserved, the function of stabilizing muscle cells is partially preserved. Thus, exon skipping is expected to result in DMD with symptoms similar to those of BMD, which is milder. Exon skipping has been tested in animals using mice or dogs and is currently being evaluated in clinical trials in humans with DMD.

Exon skipping can be induced by the binding of antisense nucleic acids targeting either the 5' or 3' splice site, both sites, or sites within the exon. An exon will only be included in the mRNA when both its splice sites are recognized by the spliceosomal complex. Thus, exon skipping can be induced by targeting antisense nucleic acids to splice sites. In addition, binding of the SR protein to the exon splicing enhancer (ESE) is thought to be necessary for the exon to be recognized by the splicing machinery. Thus, exon skipping can also be induced by targeting the ESE.

Because dystrophin gene mutation may vary among DMD patients, antisense nucleic acids need to be designed based on the site or type of the corresponding genetic mutation. In the past, exon skipping antisense nucleic acids for all 79 exons were produced by Steve Wilton, et al., University of Western Australia (Non-Patent Literature 3), and exon skipping antisense nucleic acids for exon 39 were produced by Annemieke Aartsma-Rus, et al. al., Netherlands (non-patent literature 4).

It is believed that approximately 4% of all patients with DMD can be treated by skipping exon 50 (hereinafter referred to as exon 50) (Non-Patent Literature 5). In recent years, several research organizations, including the applicant, have reported studies in which exon 50 of the dystrophin gene was targeted for exon skipping (patent literature 1 to 6 and non-patent literature 6).

- 1 045808

Citation list

Patent literature.

Patent literature 1. International publication WO 2013/100190.

Patent literature 2. International publication WO 2004/048570.

Patent literature 3. International publication WO 2006/000057.

Patent literature 4. International publication WO 2010/050802.

Patent literature 5. International publication WO 2010/048586.

Patent literature 6. International publication WO 2011/057350.

Non-patent literature.

Non-patent literature 1. Monaco A.P. et al., Genomics 2:90-95 (1988).

Non-patent literature 2. Matsuo M., Brain and Development 18:167-172 (1996).

Non-patent literature 3. Wilton S.D. et al., Molecular Therapy 15:1288-96 (2007).

Non-patent literature 4. Annemieke Aartsma-Rus et al., Neuromuscular Disorders 12:S71-S77 (2002).

Non-patent literature 5. Bladen C.L. et al., Human Mutation 36:395–402 (2015).

Non-patent literature 6. Bo Wu et al., PLosOne 6(5):el9906 (2011).

The essence of the invention

Technical problem.

Under the above circumstances, new antisense oligomers that induce skipping of exon 50 in the dystrophin gene with high efficiency were desired. In addition, antisense oligomers are desirable that have excellent physical properties (eg, solubility) as drugs while retaining exon 50 skipping inducing activity in the dystrophin gene with high efficiency.

The solution of the problem.

As a result of detailed study of the technical content of the above documents and the structure of the dystrophin gene, the present inventors have discovered that skipping of exon 50 in the human dystrophin gene is induced with high efficiency by the introduction of an antisense oligomer having the base sequence represented by any of SEQ ID NO: 3-5. The present inventors also discovered that the antisense oligomer has excellent solubility, inducing skipping of exon 50 in the human dystrophin gene with high efficiency. Based on this discovery, the present inventors have completed the present invention.

Thus, the present invention is as follows.

An antisense oligomer that is selected from the group consisting of (a)-(d) below:

a) an antisense oligomer containing the base sequence of any of SEQ ID NO: 3 to 5;

(b) an antisense oligomer comprising a base sequence that has a deletion, substitution, insertion and/or addition of 1 to 5 bases in the base sequence of any of SEQ ID NO: 3-5, and has the activity of inducing exon 50 skipping in the human dystrophin gene ;

(c) an antisense oligomer comprising a base sequence that has at least 80% sequence identity with the base sequence of any of SEQ ID NO: 3-5 and has the activity of inducing exon 50 skipping in the human dystrophin gene; and (d) an antisense oligomer that hybridizes under stringent conditions to an oligonucleotide consisting of a base sequence complementary to the base sequence of any of SEQ ID NOs: 3-5 and has the activity of inducing exon 50 skipping in the human dystrophin gene, or a pharmaceutically acceptable salt thereof or hydrate.

An antisense oligomer that is selected from the group consisting of (e)-(h) below:

(e) an antisense oligomer that consists of the base sequence of any of SEQ ID NO: 3-5;

(f) an antisense oligomer that consists of a base sequence having a deletion and/or substitution of 1 to 5 bases in the base sequence of any of SEQ ID NO: 3-5, and has the activity of inducing exon 50 skipping in the human dystrophin gene;

(g) an antisense oligomer that consists of a base sequence having at least 80% sequence identity with the base sequence of any of SEQ ID NO: 3-5, and has the activity of inducing exon 50 skipping in the human dystrophin gene; and (h) an antisense oligomer that hybridizes under very stringent conditions to an oligonucleotide consisting of a base sequence complementary to the base sequence of any of SEQ ID NOs: 3-5 and has the activity of inducing exon 50 skipping in the human dystrophin gene, or a pharmaceutically acceptable amount thereof salt or hydrate.

An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof as defined in [1] or [2] above, wherein the antisense oligomer is an antisense oligomer that has a nucleotide sequence having at least 90% sequence identity with a base sequence of any of SEQ ID NO : 3-5 and has activity to induce

- 2 045808 skipping of exon 50 in the human dystrophin gene.

An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof, according to any one of the above [1]-[3], wherein the antisense oligomer is an oligonucleotide.

An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to [4] above, wherein the sugar molecule and/or the phosphate bond group of at least one nucleotide included in the oligonucleotide is modified.

An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to [4]-[5] above, wherein the sugar molecule of at least one nucleotide included in the oligonucleotide is a ribose in which the 2'-OH group is replaced by any one, selected from the group consisting of OR, R, R'OR, SH, SR, NH ₂ , NHR, NR ₂ , N ₃ , CN, F, Cl, Br and I (where R is alkyl or aryl and R' is an alkylene).

An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to any one of [4]-[6] above, wherein the phosphate bond group of at least one nucleotide included in the oligonucleotide is any one selected from the group consisting of thiophosphate bond, phosphorodithioate bond, alkylphosphonate bond, phosphoramidate bond and boranophosphate bond.

An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof, according to any one of [1]-[3] above, wherein the antisense oligomer is a morpholine oligomer.

The antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to [8] above, wherein the antisense oligomer is a phosphorodiamidate morpholine oligomer.

An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to [8] or [9] above, wherein the 5' end is any one of chemical formulas (1)-(3) below:

Formula 1

An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof, according to any of [1]-[10] above, wherein the length of the antisense oligomer is 19 or 20 bases.

A pharmaceutical composition for the treatment of muscular dystrophy containing an antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof according to any one of [1]-[11] above.

The pharmaceutical composition according to [12] above, further comprising a pharmaceutically acceptable carrier.

A pharmaceutical composition according to [12] or [13] above for administration to a patient with muscular dystrophy, where the patient is a patient with a mutation that is susceptible to exon 50 skipping in the dystrophin gene.

The pharmaceutical composition according to [14] above, wherein the patient has a dystrophin gene that has at least a frameshift mutation caused by an exon deletion near exon 50, and in which the amino acid reading frame is corrected by skipping of exon 50.

Pharmaceutical composition according to [14] or [15] above, where the patient has a frameshift mutation caused by deletions of exons 51, 51-53, 51-55 or 51-57 in the dystrophin gene.

A pharmaceutical composition according to any one of [14]-[16] above, where the patient is a human.

Use of an antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof according to any of [1]-[11] above in the production of a medicament for the treatment of muscular dystrophy.

A method for treating muscular dystrophy, which comprises administering to a patient with muscular dystrophy an effective amount of an antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof according to any of [1]-[11] above, or a pharmaceutical composition according to any of [12][16] above.

A method for treatment according to [19] above, where the patient is a human.

An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to any one of [1]-[11] above, or a pharmaceutical composition according to any one of [12]-[16] above for use in the treatment of muscular dystrophy.

An antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof, or a pharmaceutical composition according to [21] above, wherein the patient with muscular dystrophy is a human being treated.

Effects of the invention

The invention may provide an antisense oligomer that induces skipping of exon 50 in the human dystrophin gene with high efficiency. The present invention can provide an

- 3 045808 tissene oligomer that has excellent solubility while maintaining activity to induce exon 50 skipping in the human dystrophin gene with high efficiency.

Brief description of drawings

In fig. 1 shows the efficiency of exon 50 skipping in the human dystrophin gene by antisense oligomers FMO No. 1 and 2 in human rhabdomyosarcoma cells (RD cells);

in fig. Figure 2 shows the efficiency of exon 50 skipping in the human dystrophin gene by antisense oligomers FMO No. 1, 3 and 4 in RD cells;

in fig. Figure 3 shows the efficiency of exon 50 skipping in the human dystrophin gene by antisense oligomers FMO no. 1, 5, 6 and 7 in RD cells.

Description of Embodiments

Hereinafter, the present invention is described in detail. The embodiments described below are intended to be used by way of example only to describe the invention, but are not intended to limit the present invention to only the following embodiments. The present invention can be implemented in various ways without departing from the spirit of the invention.

1. Antisense oligomer.

The present invention provides an antisense oligomer (hereinafter referred to as the antisense oligomer of the present invention) that is highly effective in causing skipping of exon 50 in the human dystrophin gene.

Exon 50 in the human dystrophin gene.

In the present invention, the term gene includes a genomic gene and also includes cDNA, precursor mRNA and mRNA. Preferably, the gene is an mRNA precursor, i.e. pre-mRNA.

In the human genome, the human dystrophin gene is located at the Xp21.2 locus. The human dystrophin gene is 2.2 million base pairs in size and is the largest known human gene. However, the coding region of the human dystrophin gene is only 14 kb, distributed in 79 exons throughout the human dystrophin gene (Roberts R. G., et al., Genomics, 16: 536538 (1993); and Koenig, M., et al. al., Cell 53, 219-228, 1988). The pre-mRNA, which is a transcript of the human dystrophin gene, is spliced to form a mature 14-kb mRNA. The base sequence of the wild-type human dystrophin gene is known (GeneBank accession number NM_004006).

The base sequence including exon 50 and the sequence near the 5' end of intron 50 in the wild-type human dystrophin gene is shown in SEQ ID NO: 1.

Antisense oligomer.

The antisense oligomer of the present invention is designed to cause skipping of exon 50 in the human dystrophin gene, thereby modifying the DMD type protein encoded by the dystrophin gene into a DMD type dystrophin protein. Thus, exon 50 in the dystrophin gene, which is the target of exon skipping by an antisense oligomer, includes both wild type and mutant types.

The antisense oligomer of the present invention is a specific antisense oligomer that is selected from the group consisting of (a) to (d) below:

(a) an antisense oligomer containing the base sequence of any of SEQ ID NO: 3-5;

(b) an antisense oligomer comprising a base sequence that has a deletion, substitution, insertion, and/or addition of 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 base in the base sequence of any of SEQ ID NO: 3-5, and has activity to induce skipping of exon 50 in the human dystrophin gene;

(c) an antisense oligomer containing a base sequence that is at least 80%, at least 84%, at least 85%, at least 89%, at least 90%, at least 94%, or at least at least 95% sequence identity with the base sequence of any of SEQ ID NO: 3-5 and has the activity to induce skipping of exon 50 in the human dystrophin gene; and (d) an antisense oligomer that hybridizes under stringent conditions to an oligonucleotide consisting of a base sequence complementary to the base sequence of any of SEQ ID NO: 3-5 and has the activity of inducing exon 50 skipping in the human dystrophin gene.

In another embodiment, the antisense oligomer of the present invention is a specific antisense oligomer that is selected from the group consisting of (e)-(h) below.

(e) an antisense oligomer that consists of the base sequence of any of SEQ ID NO: 3-5;

(f) an antisense oligomer that consists of a base sequence having a deletion and/or substitution of 1 to 5, 1 to 4, 1 to 3, 1 to 2, or one base(s) in the base sequence of any of SEQ ID NO: 3-5, and has the ability to induce exon skipping

- 4 045808 in the human dystrophin gene;

(g) an antisense oligomer that consists of a sequence of bases having at least 80%, at least 84%, at least 85%, at least 89%, at least 90%, at least 94%, or has at least 95% sequence identity with the base sequence identity of any of SEQ ID NO: 3-5 and has the ability to induce exon 50 skipping in the human dystrophin gene; and (h) an antisense oligomer that hybridizes under very stringent conditions to an oligonucleotide consisting of a base sequence complementary to the base sequence of any of SEQ ID NO: 3-5, and has the activity of inducing exon 50 skipping in the human dystrophin gene

Antisense oligomers (b)-(d) and antisense oligomers (f)-(h) are mutants of antisense oligomer (a) and antisense oligomer (e), respectively, and are specifically designed to match mutations (eg, polymorphisms) of a gene dystrophin in patients.

As used herein, the term antisense oligomer that hybridizes under stringent conditions refers, for example, to an antisense oligomer obtained by colony hybridization, plaque hybridization, Southern hybridization, or the like, using all or part of the oligonucleotide as a probe consisting of a base sequence complementary to a base sequence, for example any of SEQ ID NO: 3-5. The hybridization method that can be used includes those described, for example, in Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor, Laboratory Press 2001, Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997, etc.

As used herein, the term stringent conditions can be any of low stringency conditions, moderate stringency conditions, or high stringency conditions. The term low stringency conditions means, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide at 32°C. The term moderate stringency conditions means, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide at 42°C, or 5x SSC, 1% SDS, 50 mM Tris-HCl (pH 7.5), 50% formamide at 42°C. The term high stringency conditions means, for example, 1) 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide at 50°C, (2) 0.2x SSC, 0.1% SDS at 60°C, ( 3) 0.2x SSC, 0.1% SDS at 62°C, (4) 0.2x SSC, 0.1% SDS at 65°C, or (5) 0.1x SSC, 0.1% SDS at 65°C, but not limited to those indicated. Under these conditions, it is expected that antisense oligomers with higher sequence identity will be efficiently produced at higher temperatures. The stringency of hybridization is influenced by many factors, including temperature, probe concentration, probe length, ionic strength, time, salt concentration, and others, and those skilled in the art can appropriately select these factors to achieve similar stringency. As used herein, the term sequence identity refers to the identity over the entire base range of a sequence to be compared between a pair of two specific nucleic acids, and is denoted by the ratio (%) of matching bases in an optimal base sequence alignment, which is produced using a mathematical algorithm known in the art the present invention. For example, an antisense oligomer consisting of a sequence of bases having at least 80% sequence identity to an antisense oligomer consisting of a 20-base sequence means an antisense oligomer having 16 or more bases identical to a 20-base antisense oligomer.

Under these conditions, antisense with higher sequence identity is expected to be produced efficiently at higher temperatures.

When commercially available kits are used for hybridization, for example, the Alkphos direct labeling and detection system (GE Healthcare) can be used. In this case, according to the protocol included with the kit, after incubation with the labeled probe overnight, the membrane is washed with a primary wash buffer containing 0.1% (w/v) SDS at 55°C to reveal the hybridized antisense oligomer. Alternatively, the probe is labeled with digoxigenin (DIG) using available reagents (e.g., PCR Labeling Mix (Roche Diagnostics), etc.) to obtain a probe based on all or part of the complementary sequence to the base sequence of any of SEQ ID NO: 3- 5, hybridization can be detected using the DIG Nucleic Acid Detection Kit (Roche Diagnostics).

In addition to the antisense oligomer described above, other antisense oligomers that can hybridize include antisense oligomers having 90% or higher, 91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96%. or higher, 97% or higher, 98% or higher, 99% or higher, 99.1% or higher, 99.2% or higher, 99.3% or higher, 99.4% or higher, 99.5% or greater, 99.6% or greater, 99.7% or greater, 99.8% or greater, and 99.9% or greater sequence identity to the base sequence of any of SEQ ID NO: 3-5, as calculated by the search program homology tests such as FASTA and BLAST using default parameters.

- 5 045808

Sequence identity can be determined using FASTA (Science 227 (4693): 14351441, (1985)) or the BLAST (Basic Local Alignment Search Tool) algorithm by Carlin and Altschul (Proc. Natl. Acad. Sci. USA 872264-2268, 1990); Proc. Natl. Acad. Sci. USA 90:5873, 1993). The blastn, blastx, tblastn and tblastx programs were developed, based on the BLAST algorithm (Altschul S.F., et al: J. Mol. Biol. 215: 403, 1990). If the base sequence is analyzed using blastn, the parameters are, for example, score=100 and word length=12. If using the BLAST and Gapped BLAST programs, use the default parameters for each program.

The term induce (activate) skipping of exon 50 in the human dystrophin gene is intended to mean that by binding the antisense oligomer of the present invention to the region corresponding to exon 50 and/or an adjacent intron of a transcript (e.g., pre-mRNA) in the dystrophin gene In humans, exon 50 is deleted and, for example, the base sequence corresponding to the 5' end of exon 52 is associated with the base sequence corresponding to the 3' end of exon 49 in DMD patients with exon 51 deletion, when the transcript is spliced, resulting in the formation of a mature mRNA free of codon frameshift.

Thus, patients with DMD who have an exon 50 skipping-susceptible mutation in the dystrophin gene can be treated by skipping exon 50. Examples of such DMD patients include patients with DMD with a dystrophin gene that has at least a frameshift mutation caused by a deletion of an exon near exon 50, and in which the amino acid reading frame is corrected by skipping exon 50, and more specifically include DMD patients having a frameshift mutation caused by deletion of exons 51, 51-53, 51-55, 51- 57, etc. in the dystrophin gene.

As used herein, the term binding as described above is intended to mean that when an antisense oligomer of the present invention is mixed with a human dystrophin gene transcript, they both hybridize to each other under physiological conditions to form a double-stranded nucleic acid. The term physiological conditions refers to conditions that mimic the in vivo environment with respect to pH, formulation, and temperature. Conditions: 25 to 40°C, preferably 37°C, pH 5 to 8, preferably pH 7.4 and sodium chloride concentration 150 mM.

Whether skipping of exon 50 in the human dystrophin gene has occurred or not can be confirmed by introducing the antisense oligomer of the present invention into a dystrophin-expressing cell (for example, human rhabdomyosarcoma cells), amplifying the mRNA of the region surrounding exon 50 in the human dystrophin gene from the total RNA of the cell, expressing dystrophin using RT-PCR and performing nested PCR or sequence analysis to amplify the PCR product. The skip efficiency ES (%) can be determined as follows. Human dystrophin gene mRNA is collected from the cells of interest, and the mRNA is measured for the level of polynucleotide in the band indicating that exon 50 is skipped (polynucleotide A level) and the level of polynucleotide in the band indicating that exon 50 is not skipped (polynucleotide B level). Using these A and B measurement values, the efficiency is calculated using the following equation (1). To calculate the pass efficiency, you can refer to the international publication WO 2012/029986

ES=100xA/(A+B) (1)

Preferably, the antisense oligomer of the present invention causes exon 50 skipping with an efficiency of 10% or greater, 20% or greater, 30% or greater, 40% or greater, 50% or greater, 60% or greater, 70% or greater, 80% and above and 90% and above.

The antisense oligomer of the present invention refers to, for example, an oligonucleotide, morpholine oligomer or peptide nucleic acid (PNA) oligomer with a length of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 bases. The length of the antisense oligomer is preferably 16 to 25, 16 to 23, 19 or 20 bases, and morpholine oligomers are preferred.

The oligonucleotide described above (hereinafter referred to as the oligonucleotide of the present invention) is an antisense oligomer of the present invention consisting of nucleotides as constituent units. Such nucleotides may be any of ribonucleotides, deoxyribonucleotides and modified nucleotides.

Modified nucleotide refers to a nucleotide having wholly or partially modified nucleotide bases, sugar molecules and/or phosphate bond groups that constitute a ribonucleotide or deoxyribonucleotide.

In the present invention, the nucleic acid base includes, for example, adenine, guanine, hypoxanthine, cytosine, thymine, uracil and modified bases thereof. Examples of such modified bases include, but are not limited to, pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosines (e.g., 5-methylcytosine), 5-alkyluracils (e.g., 5-ethyluracil), 5-halogenuracils (5-bromouracil), 6-azapyrimidine, 6-pyrimidines (6-methyluracil), 2-thiouracil, 4-thiouracil, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1 -methylhypoxanthine, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-me

- 6 045808 thylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-hydroxyacetic acid, 2-thiocytosine, purine, 2,6-diaminopurine, 2- aminopurine, isoguanine, indole, imidazole, xanthine, etc.

Modification of sugar molecules may include, for example, modifications at the 2' position of ribose and modifications at other sugar positions. Modification at the 2'-position of ribose includes a modification that replaces the 2'-OH of ribose with OR, R, R'OR, SH, SR, NH ₂ , NHR, NR ₂ , N ₃ , CN, F, Cl, Br or I, where R represents alkyl or aryl and R' represents alkylene.

Modification of other sugar positions includes, for example, replacing the O at the 4' position of ribose or deoxyribose with an S, joining between the 2' and 4' positions of the sugar, such as an LNA (closed nucleic acid) or ENA (nucleic acids with 2' O,4'-C-ethylene bridge), but is not limited to them.

Modification of a phosphate bond group includes, for example, modification of replacing a phosphodiester bond with a thiophosphate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoramidate bond, or a boranophosphate bond. (Enya et al: Bioorganic & Medicinal Chemistry, 2008, 18, 9154-9160) (see, for example, Japanese domestic republication of PCT applications No. 2006/129594 and 2006/038608).

In the present invention, alkyl preferably includes straight or branched alkyl having 1 to 6 carbon atoms. Specific examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, t-butyl, n-pentyl, isopentyl, peopentyl, t-pentyl, n-hexyl and isohexyl. Alkyl may optionally be substituted. Examples of such substituents are halogen, alkoxy, cyano and nitro. Alkyl may be substituted with 1-3 substituents.

In the present invention, cycloalkyl preferably includes cycloalkyl having from 5 to 12 carbon atoms. Specific examples include cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclodecyl and cyclododecyl.

In the present invention, halogen includes fluorine, chlorine, bromine and iodine.

Alkoxy includes straight or branched alkoxy having from 1 to 6 carbon atoms, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, t-butoxy, n-pentyloxy, isopentyloxy, n-hexyloxy, isohexyloxy etc. Among others, alkoxy having 1 to 3 carbon atoms is preferred.

In the present invention, aryl preferably includes aryl having 6 to 10 carbon atoms. Specific examples include phenyl, α-naphthyl and β-naphthyl. Among others, phenyl is preferred. Aryl may optionally be substituted. Examples of such substituents are alkyl, halogen, alkoxy, cyano and nitro. Aryl may be substituted with 1-3 substituents.

In the present invention, alkylene preferably includes straight or branched alkylene having 1 to 6 carbon atoms. Specific examples include methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, 2-ethyl trimethylene and 1-methyltetramethylene.

In the present invention, acyl includes straight or branched alkanoyl or aroyl. Examples of alkanoyl include formyl, acetyl, 2-methylacetyl, 2,2-dimethylacetyl, propinoyl, butyrryl, isobutyryl, pentanoyl, 2,2-dimethylpropionyl, hexanoyl, etc. Examples of aroyl include benzoyl, toluoyl and naphthoyl. Aroyl may optionally be substituted at substitutable positions and may be substituted by alkyl(s).

The oligonucleotide of the present invention is preferably an antisense oligomer of the present invention containing a compound unit represented by the general formula below, wherein the -OH group at the 2' position in the ribose is replaced by methoxy and the phosphate linkage group is a thiophosphate linkage

Formula 2

Base

O' bCH3 where the base is a nucleic acid base.

The oligonucleotide of the present invention can be easily synthesized using various automatic synthesizers (eg, AKTA oligopilot plus 10/100 (GE Healthcare)). Alternatively, synthesis can also be outsourced to a third party (eg, Promega Inc., Takara Co., or Japan Bio Service Co.), etc.

The morpholine oligomer of the present invention is an antisense oligomer of the present invention containing a constituent unit represented by the general formula below:

- 7 045808

where the base has the same meaning as defined above and W is a group shown by one of the following groups:

Formula 4 where X is -CH2R ¹ , -O-CH2R ¹ , -S-CH2R ¹ , -NR ² R ³ or F;

R ¹ represents H or alkyl;

R ² and R ³ may be the same or different and each is H, alkyl, cycloalkyl or aryl;

Y1 is O, S, CH ₂ or NR ¹ ;

Y ₂ represents O, S or NR1;

Z represents O or S.

Examples of morpholine monomer compounds that are used in the synthesis of the morpholine oligomer of the present invention include, but are not limited to, the following: morpholine monomer compound (A), morpholine monomer compound (C), morpholine monomer compound (T) and morpholine monomer compound (G ).

Morphol compound A

Morpholine

I, C

Morphol compound T

O. <' ' *.....

*

Full connection G

Table 1

AND ·

-''''λ

The morpholine oligomer is preferably an oligomer containing a constituent unit represented by the general formula below (phosphorodiamidate morpholine oligomer (hereinafter referred to as PMO)):

Formula 5

where base, R ² and R ³ have the same meaning as defined above.

The morpholine oligomer of the present invention includes an oligomer in which all or part of the nucleobases, morpholine ring molecules, phosphate bond groups, 3' end and/or 5' end that constitute the morpholine oligomer are modified.

Modification of a phosphate bond group includes, for example, substitution modification with a phosphorodiamidate bond, thiophosphate bond, phosphorodithioate bond, alkylphosphonate bond, phosphoramidate bond and boranophosphate bond (Enya et al: Bioorganic & Medicinal Chemistry, 2008, 18, 9154-9160) (see, for example , Japanese domestic republication of PCT applications No. 2006/129594 and 2006/038608).

- 8 045808

The morpholine oligomer can be prepared in accordance with, for example, WO 1991/009033 or WO 2009/064471. In particular, FMO can be obtained by the method described in WO 2009/064471, or obtained by the method shown below.

Method for obtaining FMO.

An embodiment of the FMO includes, for example, a compound represented by the general formula (I) below (hereinafter referred to as FMO (I)):

Formula 6

base (t) ft where base, R ² and R ³ have the same meaning as defined above; and, n is a predetermined integer from 1 to 99, preferably a predetermined integer from 15 to 34, 15 to 24, or 15 to 22, more preferably 18 or 19.

FMO (I) can be obtained in accordance with a known method, for example, can be obtained by performing the methods in the following steps.

The compounds and reagents used in the steps below are not particularly limited as long as they are conventional for the preparation of FMO.

In addition, all of the following steps can be performed using a liquid phase method or a solid phase method (manually or using commercial automated solid phase synthesizers). When producing FMO using the solid-phase method, it is advisable to use automated synthesizers due to the ease of operation and accuracy of synthesis.

(1) Stage A.

The compound represented by the general formula (II) below (hereinafter referred to as compound (II)) is reacted with an acid to produce the compound represented by the general formula (III) below (hereinafter referred to as compound (III)) :

where n, R ² and R ³ have the same meaning as defined above;

each B independently represents a nucleic base, which may not necessarily be protected;

T represents trityl, monomethoxytrityl or dimethoxytrityl; And,

L represents hydrogen, acyl or a group represented by the general formula (IV) below (hereinafter referred to as group (IV)):

Formula 8

Solid carrier------ Linker ____

The nucleobase for BP includes the same nucleobase as in the base, provided that the amino group or hydroxy group in the nucleic base shown in ^BP may be protected.

Such a protecting group for an amino group is not particularly limited as long as it is used as a protecting group for nucleic acids. Specific examples include benzoyl, 4methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and dimethylaminomethylene. Specific examples of the protecting group for the hydroxy group include 2-cyanoethyl, 4-nitrophenethyl, phenylsulfonylethyl, methylsulfonylethyl, trimethylsilylethyl, phenyl, which may be substituted with 1 to 5 electron-withdrawing groups at optional substitutable positions, diphenylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, methylphenylcarbamoyl, 1 -pyrolidinylcarbamoyl, morpholinocarbamoyl, 4-(tert-butylcarboxy)benzyl, 4-[(dimethylamino)carboxy]benzyl and 4-(phenylcarboxy)benzyl (see e.g. WO

- 9 045808

2009/064471).

The solid support is not particularly limited as long as it is a support suitable for the solid phase reaction of nucleic acids. It is desirable that the solid support has the following properties: for example, (i) it is sparingly soluble in reagents that can be used for the synthesis of morpholine derivatives of nucleic acids (for example, dichloromethane, acetonitrile, tetrazole, N-methylimidazole, pyridine, acetic anhydride, lutidine, trifluoroacetic acid); (ii) is chemically resistant to reagents that can be used for the synthesis of morpholine derivatives of nucleic acids; (iii) it can be chemically modified; (iv) it can be loaded with the desired morpholine nucleic acid derivatives; (v) it has sufficient strength to withstand high processing pressure; and (vi) has a defined range of diameters and particle distribution. In particular, swelling polystyrene (for example, aminomethyl polystyrene resin with 1% cross-linked divinylbenzene (200-400 mesh) (2.4-3.0 mmol/g) (Tokyo Chemical Industry), aminomethyl polystyrene resin with HCl [divinylbenzene 1%, 100-200 mesh] (Peptid Institute, Inc.)), non-swelling polystyrene (eg, Primer Support (GE Healthcare)), polystyrene with attached PEG chains (eg, NH ₂ -PEG resin (Watanabe Chemical Co.), TentaGel resin) , controlled pore glass (CPG) (manufactured, for example, by CPG), controlled pore size oxalyl glass (see, for example, Alul et al., Nucleic Acids Research, Vol. 19, 1527 (1991)), aminopolyethylene glycol derivative TentaGel substrates (eg, Wright et al., see Tetrahedron Letters, Vol. 34, 3373 (1993)), and Poros brand polystyrene/divinylbenzene copolymer.

The linker that can be used is a known linker generally used for connecting nucleic acid derivatives or morpholino nucleic acids. Examples include 3-aminopropyl, succinyl, 2,2'-diethanolsulfonyl, and long chain alkylamino (LCAA).

At this stage, it is possible to react compound (II) with an acid.

The acid that can be used in this step includes, for example, trifluoroacetic acid, dichloroacetic acid and trichloroacetic acid. The amount of acid used is in the range, for example, from 0.1 mol equivalent to 1000 mol equivalent per 1 mol of compound (II), preferably in the range from 1 mol equivalent to 100 mol equivalent per 1 mol of compound (II).

The organic amine can be used in combination with the acid described above. The organic amine is not particularly limited and includes, for example, triethylamine. The amount of organic amine used is typically in the range of, for example, 0.01 mole equivalent to 10 mole equivalent, and preferably in the range of 0.1 mole equivalent to 2 mole equivalent per mole of acid.

When a salt or mixture of an acid and an organic amine is used in this step, the salt or mixture includes, for example, a salt or mixture of trifluoroacetic acid and triethylamine, and more specifically, a mixture of 1 equivalent of triethylamine and 2 equivalents of trifluoroacetic acid.

The acid that can be used at this stage can also be diluted with a suitable solvent in a concentration of 0.1 to 30%. The solvent is not particularly limited as long as it is inert in the reaction, and includes, for example, dichloromethane, acetonitrile, alcohol(s) (ethanol, isopropanol, trifluoroethanol, etc.), water, or a mixture thereof.

The reaction temperature in the above reaction is preferably in the range of, for example, 10 to 50°C, more preferably in the range of 20 to 40°C, and most preferably in the range of 25 to 35°C.

The reaction time may vary depending on the type of acid used and the reaction temperature, and is in the range of 0.1 minutes to 24 hours, and preferably in the range of 1 minute to 5 hours.

Once this step is complete, a base can be added if necessary to neutralize any acid remaining in the system. The base is not particularly limited and includes, for example, diisopropylethylamine. The base can also be used in diluted form with a suitable solvent at a concentration of 0.1% (v/v) to 30% (v/v).

The solvent used in this step is not particularly limited as long as it is inert to the reaction, and includes dichloromethane, acetonitrile, alcohol(s) (ethanol, isopropanol, trifluoroethanol, etc.), water and a mixture thereof. The reaction temperature is preferably in the range of, for example, 10 to 50°C, more preferably in the range of 20 to 40°C, and most preferably in the range of 25 to 35°C.

The reaction time may vary depending on the type of base used and the reaction temperature, and is generally from 0.1 minute to 24 hours, and preferably in the range from 1 minute to 5 hours.

In compound (II), the compound of the general formula (IIa) below (hereinafter referred to as compound (IIa)), where n is 1 and L represents group (IV), can be prepared by the following method:

- 10 045808

Formula 9

( 1 1 ) where B ^P , T , linker and solid support have the same meaning as defined above.

Stage 1.

The compound represented by the general formula (V) below is reacted with an acylating agent to obtain the compound represented by the general formula (VI) below (hereinafter referred to as compound (VI)):

Formula 10

OH ^-CLinker|—

LjX ,В ^р ........ -θ ^ρ

I; ι:

ΝΝ'

IJ

T (V) (V I >

where ^BP , T and linker have the same meaning as defined above; And,

R ⁴ represents hydroxy, halogen, carboxyl or amino.

This step can be carried out by known methods for introducing linkers using compound (V) as a starting material.

In particular, the compound represented by the general formula (VIa) below can be obtained by performing a method known as esterification using compound (V) and succinic anhydride.

Formula 11

where B ^P and T have the same meaning as defined above. Stage 2.

Compound (VI) is reacted with a solid support using a condensing agent or the like. to obtain compound (IIa)

Formula 12 i ⁴ 1™™*; o CSSSEI -^^.1 o

GG _ o , < V K ^T ( Ϊ F . 5 ^T where ^BP , R ⁴ , T , linker and solid support have the same meaning as defined above.

This step can be carried out using compound (VI) and a solid support in accordance with a method known as a condensation reaction.

In compound (II), a compound represented by the general formula (IIa2) below, where n is 2 to 99 (preferably a predetermined integer of 16 to 35, 16 to 25, or 16 to 23, preferably 19 or 20) and L represents the group represented by the general formula (IV), can be prepared by using compound (IIa) as the starting material and repeating Step A and Step B of the FMO production method given in the specification as many times as necessary.

Formula 13

- 11 045808 where BP, R ² , R ³ , T, linker and solid support have the same meaning as defined above; and n' is 1 to 98 (in a particular embodiment, n' is, for example, 1 to 34, 1 to 24, 1 to 23, 1 to 22, 1 to 21, 1 to 20 , from 1 to 19, from 1 to 18, from 1 to 17, from 1 to 16, from 1 to 15.

(2) Stage B.

Compound (III) is reacted with a morpholine monomer compound in the presence of a base to obtain a compound represented by the general formula (VII) below (hereinafter referred to as compound (VII)):

Formula 14

where each of BP, L, n, R ² , R ³ and T has the same meaning as defined above.

At this stage, it is possible to react compound (III) with a morpholine monomer compound in the presence of a base.

The morpholine monomer compound includes, for example, those represented by the general formula (VIII) below:

Formula 15

^R2 ?

^N-P-O

R ^3ό

V

I t

(VI 1 I) where BP, R ² , R ³ and T have the same meaning as defined above.

A base that can be used in this step includes, for example, diisopropylethylamine, triethylamine and N-ethylmorpholine. The amount of base used is suitably in the range of 1 mol equivalent to 1000 mol equivalent per 1 mol of compound (III), preferably 10 mol equivalent to 100 mol equivalent per 1 mol of compound (III).

The morpholine monomer compound and base that can be used in this step can also be used diluted with an appropriate solvent at a concentration of 0.1 to 30%. The solvent is not particularly limited as long as it is inert in the reaction, and includes, for example, N,N-dimethylimidazolidone, N-methylpiperidone, DMF, dichloromethane, acetonitrile, tetrahydrofuran, or a mixture thereof.

The reaction temperature is preferably in the range, for example, from 0 to 100°C and more preferably in the range from 10 to 50°C.

The reaction time may vary depending on the type of base used and the reaction temperature, and is suitably in the range of 1 minute to 48 hours, generally and preferably in the range of 30 minutes to 24 hours.

In addition, after completion of this stage, an acylating agent can be added if necessary. The acylating agent includes, for example, acetic anhydride, acetyl chloride and phenoxyacetic anhydride. The acylating agent can also be used, for example, diluted with a suitable solvent in a concentration of from 0.1 to 30%. The solvent is not particularly limited as long as it is inert in the reaction, and includes, for example, dichloromethane, acetonitrile, tetrahydrofuran, alcohol(s) (ethanol, isopropanol, trifluoroethanol, etc.), water, or a mixture thereof.

If necessary, a base such as pyridine, lutidine, collidine, triethylamine, diisopropylethylamine, N-ethylmorpholine, etc. can also be used. in combination with an acylating agent. The amount of acylating agent used is preferably in the range of 0.1 mole equivalent to 10,000 mole equivalent, and more preferably in the range of 1 mole equivalent to 1000 mole equivalent. The amount of base used is suitably in the range, for example, from 0.1 mole equivalent to 100 mole equivalent, and also in the range from 1 mole equivalent to 10 mole equivalent per 1 mole of acylating agent.

The reaction temperature in this reaction is preferably in the range from 10 to 50°C, more

- 12 045808 preferably in the range from 10 to 50°C, even more preferably in the range from 20 to 40°C, and most preferably in the range from 25 to 35°C. The reaction time may vary depending on the type of acylating agent used and the reaction temperature, and is suitably in the range of 0.1 minutes to 24 hours, generally and preferably in the range of 1 minute to 5 hours.

(3) Stage C.

In compound (VII) obtained in step B, the protecting group is removed using a deprotecting agent to obtain the compound represented by the general formula (IX) Formula 16 (V ί Ϊ ) where base, BP, L, n, R ² , R ³

n

and T have the same meaning as defined above. At this stage, compound (VII) can be reacted with a deprotection agent.

The deprotection agent includes, for example, concentrated ammonia water and methylamine. The deprotection agent used in this step can also be used in dilute form, for example with water, methanol, ethanol, isopropyl alcohol, acetonitrile, tetrahydrofuran, DMF, N,N-dimethylimidazolidone, N-methylpiperidone or a mixture of these solvents . Among them, ethanol is preferred. The amount of deprotection agent used is suitably, for example, in the range of 1 mol equivalent to 100,000 mol equivalent, and preferably in the range of 10 mol equivalent to 1000 mol equivalent, per 1 mol of compound (VII).

The reaction temperature is suitably, for example, in the range of 15 to 75°C, preferably in the range of 40 to 70°C, and more preferably in the range of 50 to 60°C. The deprotection reaction time may vary depending on the type of compound (VII), reaction temperature, etc., and is suitably in the range of 10 minutes to 30 hours, preferably 30 minutes to 24 hours, and more preferably in the range of 5 hours to 20 hours

(4) Stage D.

FMO (I) is obtained by reacting compound (IX) obtained in step C with the acid Formula 17

Basic but n

Foundation!

R<T

N Р -о θ _п Ц^Оч^Осмивамн where the base, n, R ² , R ³ and T have the same meaning as defined above.

At this stage, the addition of acid to compound (IX) can be carried out.

The acid that can be used in this step includes, for example, trichloroacetic acid, dichloroacetic acid, acetic acid, phosphoric acid, hydrochloric acid, etc. The amount of acid used is suitably used to obtain a solution with a pH in the range of 0.1 to 4.0, for example, and more preferably, in the pH range of 1.0 to 3.0. The solvent is not particularly limited as long as it is inert in the reaction, and includes, for example, acetonitrile, water, or a mixture of these solvents.

The reaction temperature is preferably in the range of 10 to 50°C, more preferably in the range of 20 to 40°C, and more preferably in the range of 25 to 35°C. The deprotection reaction time may vary depending on the type of compound (IX), reaction temperature, etc., and will accordingly range from 0.1 min to 5 h, preferably from 1 min to 1 h, and more preferably range from 1 to 30 min.

FMO (I) can be obtained by subjecting the mixture obtained in this step to conventional separation and purification methods, such as extraction, concentration, neutralization, filtration, centrifugal separation, recrystallization, reverse phase column chromatography using C8 to C18, chromatography with cation exchange columns, anion exchange column chromatography, gel filtration column chromatography, high performance liquid chromatography, dialysis, ultrafiltration, etc., alone or in combination.

In this way, the desired FMO (I) can be isolated and purified (see, for example, WO 1991/09033).

- 13 045808

When purifying FMO (I) using reverse phase chromatography, for example, a solution of a mixture of 20 mM triethylamine/acetate buffer and acetonitrile can be used as an elution solvent.

When purifying FMO (I) using ion exchange chromatography, for example, a solution of a mixture of 1 M physiological solution and 10 mM aqueous sodium hydroxide solution can be used as an elution solvent.

The peptide nucleic acid is an antisense oligomer of the present invention characterized by a group represented by the following general formula as a unit:

Formula 18

Base

Ν'

O where base has the same meaning as defined above. Peptide nucleic acid can be obtained by referring, for example, to the following literature sources:

1) P.E. Nielsen, M. Egholm, R.H. Berg, O. Buchardt, Science, 254, 1497 (1991).

2) M. Egholm, O. Buchardt, P.E. Nielsen, R.H. Berg, Jacs., 114, 1895 (1992).

3) K.L. Dueholm, M. Egholm, C. Behrens, L. Christensen, H.F. Hansen, T. Vulpius, K.H. Petersen, R.H. Berg, P.E. Nielsen, O. Buchardt, J. Org. Chem., 59, 5767 (1994).

4) L. Christensen, R. Fitzpatrick, B. Gildea, K.H. Petersen, H.F. Hansen, T. Koch, M. Egholm, O. Buchardt, P.E. Nielsen, J. Coull, R.H. Berg, J. Pept. Sci., 1, 175 (1995).

5) T. Koch, H.F. Hansen, P. Andersen, T. Larsen, H.G. Batz, K. Otteson, H. Orum, J. Pept. Res., 49, 80 (1997).

In the antisense oligomer of the present invention, the 5' end may be one of the group shown by chemical formula (1)-(3) below, and is preferably (3)-OH

Formula 19

Hereinafter, the groups shown (1), (2) and (3) above are referred to as Group (1), Group (2) and Group (3), respectively.

The antisense oligomer of the present invention may include a compound with a stereochemically optically pure phosphorus atom, since the phosphorus atom in the phosphate bond group serves as a center of asymmetry. One skilled in the art can obtain pure optically active forms from mixtures of isomers (WO 2017/024264). The antisense oligomer of the present invention can be synthesized in a pure optically active form. One skilled in the art can obtain pure optically active forms by controlling the synthesis reactions (Japanese Patent Publication No. 2018-537952).

2. Peptide-conjugated antisense oligomer.

The antisense oligomer of the present invention can form a complex with a functional peptide aimed at increasing efficiency (for example, a membrane permeable peptide aimed at increasing the efficiency of delivery to target cells) (WO 2008/036127, WO 2009/005793, WO 2012/150960, WO 2016 /187425, WO 2018/118662, WO 2018/118599, WO 2018/118627, J. D. Ramsey, N. N. Flynn, Pharmacology & Therapeutics 154, 78-86 (2015), M. K. Tsoumpra et al., EBioMedicine, https:/ /doi.org/10.1016/j.ebiom.2019.06.036). The conjugation site is not particularly limited. Desirably, the 5' end or 3' end of the antisense oligomer is conjugated to the amino terminus or carboxy terminus of the functional peptide.

In another embodiment, the antisense oligomer of the present invention and the functional peptide can form a complex (conjugate) through a linker. The linker is not particularly limited. Preferably, the 5' end or 3' end of the antisense oligomer is connected to one end of the linker, while the amino end or carboxy end of the functional peptide is connected to the other end of the linker. An additional amino acid may be present between the functional peptide and the linker.

- 14 045808

3. Pharmaceutical composition.

The antisense oligomer of the present invention, even if its length is short compared with the antisense oligomers of the prior art, can cause skipping of exon 50 with high efficiency. The antisense oligomer of the present invention has excellent solubility while maintaining exon 50 skipping inducing activity with high efficiency. Thus, it is expected that muscular dystrophy conditions can be improved with high efficiency by administering the antisense oligomer of the present invention to patients with DMD who have a mutation susceptible to exon 50 skipping of the dystrophin gene (eg, frameshift mutation and missense/nonsense mutation -mutation in exon 50). Thus, it is expected that muscular dystrophy conditions can be improved with high efficiency by administering the antisense oligomer of the present invention, for example, to at least patients with DMD who have a predetermined mutant dystrophin gene having an exon deletion near exon 50. Predetermined mutant a dystrophin gene is a dystrophin gene that has at least a frameshift mutation caused by a deletion of an exon near exon 50, and in which the amino acid reading frame is corrected by deletion (skipping) of exon 50. Examples of patients having such a predetermined mutant dystrophin gene , include patients with DMD with a frameshift mutation caused by deletion of exons 51, 51-53, 51-55, 51-57, etc.

More specifically, it is expected that muscular dystrophy conditions can be improved with high efficiency by administering a pharmaceutical composition containing the antisense oligomer of the present invention to patients with DMD who have a mutation that becomes an in-frame exon 50 skipping mutation, e.g. with exon 51 deletion, patients with exon 51-53 deletion, patients with exon 51-55 deletion, patients with exon 51-57 deletion, etc. For example, when the pharmaceutical composition contains the antisense oligomer of the present invention, the same therapeutic effect can be achieved even at a lower dose than prior art oligomers. In this way, side effects can be alleviated and economic benefits can be achieved.

The antisense oligomer of the present invention is also suitable for the preparation of pharmaceutical compositions because the antisense oligomer has excellent solubility while retaining exon 50 skipping inducing activity with high efficiency.

In another embodiment, the present invention relates to a pharmaceutical composition for the treatment of muscular dystrophy containing as an active ingredient an antisense oligomer of the present invention, a pharmaceutically acceptable salt or hydrate thereof (hereinafter referred to as the composition of the present invention).

Also, the present invention relates to a method for treating muscular dystrophy, which involves administering to a patient with DMD an antisense oligomer of the present invention.

In this treatment method, the antisense oligomer of the present invention can be administered in a pharmaceutical composition for the treatment of muscular dystrophy.

Furthermore, the present invention relates to the use of the antisense oligomer of the present invention in the production of a pharmaceutical composition for the treatment of muscular dystrophy and the antisense oligomer of the present invention for use in the treatment of muscular dystrophy.

Examples of the pharmaceutically acceptable salt of the antisense oligomer of the present invention contained in the composition of the present invention include alkali metal salts such as sodium salt, potassium salt and lithium salt; alkaline earth metal salts such as calcium salt and magnesium salt; metal salts such as aluminum salt, iron salt, zinc salt, copper salt, nickel salt, cobalt salt, etc.; ammonium salts; organic amine salts such as t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N' -dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzylphenethylamine salt, piperazine salt, tetramethylammonium salt, tris(hydroxymethyl)aminomethane salt; hydrohalide salt such as hydrofluoride salt, hydrochloride salt, hydrobromide salt and iodohydrate salt; inorganic acid salts such as nitrate salt, perchlorate salt, sulfate salt, phosphate salt, etc.; lower alkanesulfonate salts such as methanesulfonate salt, trifluoromethanesulfonate salt and ethanesulfonate salt; arylsulfonate salt such as benzenesulfonate salt and p-toluenesulfonate salt; organic acid salts such as acetate salt, malic acid salt, fumaric acid salt, succinic acid salt, citric acid salt, tartaric acid salt, oxalate salt, maleic acid salt, etc.; and, an amino acid salt such as glycine salt, lysine salt, arginine salt, ornithine salt, glutamic acid salt and aspartic acid salt. These salts can be obtained in a known manner. Alternatively, the antisense oligomer of the present invention included in the composition of the present invention may be in the form of a hydrate thereof.

The method of administration of the composition of the present formulation is not particularly limited, provided that it

- 15 045808 pharmaceutical acceptable mode of administration, and it can be selected depending on the method of treatment. Due to ease of delivery to muscle tissue, intravenous administration, intra-arterial administration, intramuscular administration, subcutaneous administration, oral administration, tissue administration, transdermal administration, etc. are preferred. Moreover, dosage forms that are available for the composition of the present invention are not particularly limited and include, for example, various injections, oral agents, droppers, inhalations, ointments, lotions, etc.

When administering the antisense oligomer of the present invention to patients with muscular dystrophy, the composition of the present invention may contain a carrier to accelerate delivery of the oligomer to muscle tissue. Such a carrier is not particularly limited as long as it is pharmaceutically acceptable, and examples include cationic carriers such as cationic liposomes, cationic polymers, etc., or carriers using a viral shell. Examples of cationic liposomes include, for example, liposomes consisting of 2-O-(2-diethylaminoethyl)carabamoyl-1,3-O-dioleoylglycerol and phospholipids as the main components (hereinafter referred to as liposome A), Oligofectamine (registered trademark) (Invitrogen Corp.), Lipofectin (registered trademark) (Invitrogen Corp.), Lipofectamine (registered trademark) (Invitrogen Corp.), Lipofectamine 2000 (registered trademark) (Invitrogen Corp.), DMRIE-C ( registered trademark) (Invitrogen Corp.), GeneSilencer (registered trademark) (Gene Therapy Systems), TransMessenger (registered trademark) (QIAGEN, Inc.), TransIT TKO (registered trademark) (Minis), and Nucleofector II (Lonza ). Among others, liposome A is preferred. Examples of cationic polymers include JetSI (registered trademark) (Qbiogene, Inc.) and Jet-PEI (registered trademark) (polyethylenimine, Qbiogene, Inc.). Examples of carriers using a viral shell include GenomeOne (registered trademark) (HVJ-E liposome, Ishihara Sangyo). Alternatively, the medical devices described in Japanese Patent No. 2924179 and the cationic carriers described in Japanese domestic republication of PCT Application Nos. 2006/129594 and 2008/096690 can also be used.

For further details, reference may be made to US Patent No. 4,235,871, US Patent No. 4,737,323, WO 96/14057, New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990) pp 33-104, etc.

The concentration of the antisense oligomer of the present invention contained in the composition of the present invention may vary depending on the type of carrier, etc., and in one embodiment is suitably in the range from 0.1 nM to 100 μM, preferably in the range from 100 nM to 10 µM. The weight ratio of the antisense oligomer of the present invention contained in the composition of the present invention and the carrier (carrier/antisense oligomer of the present invention) may vary depending on the properties of the oligomer, the type of carrier, etc., and is suitably in the range of 0. 1 to 100, preferably in the range from 0.1 to 10.

The composition of the present invention may be in the form of an aqueous solution. In this case, the composition of the present invention may contain the antisense oligomer of the present invention at a concentration of 2.5 to 500 mg/ml, 5 to 450 mg/ml, 10 to 400 mg/ml, 15 to 350 mg/ml , from 20 to 300 mg/ml, from 20 to 250 mg/ml, from 20 to 200 mg/ml, from 20 to 150 mg/ml, from 20 to 100 mg/ml, from 20 to 50 mg/ml, from 20 to 40 mg/ml, 20 to 30 mg/ml, 23 to 27 mg/ml, 24 to 26 mg/ml, or 25 mg/ml. Alternatively, the composition of the present invention may contain the antisense oligomer of the present invention at a concentration of from 10 to 100 mg/ml, from 15 to 95 mg/ml, from 20 to 80 mg/ml, from 25 to 75 mg/ml, from 30 to 70 mg/ml, from 35 to 65 mg/ml, from 40 to 60 mg/ml, from 45 to 55 mg/ml, from 47 to 53 mg/ml, from 48 to 52 mg/ml, from 49 to 51 mg /ml or 50 mg/ml.

The composition of the present invention may be in dry form. In this case, to prepare the composition of the present invention as an aqueous solution, the composition of the present invention in dry form containing, for example, 125 mg or 250 mg of the antisense oligomer of the present invention in dry form, can be mixed with 0.5-100 ml water (corresponding to the antisense oligomer of the present invention at a concentration of 1.25 to 250 mg/ml or 2.5 to 500 mg/ml), preferably 1 to 50 ml of water (corresponding to the antisense oligomer of the present invention at a concentration of 2.5 to 125 mg/ml or 5 to 250 mg/ml), more preferably 5 to 10 ml of water (corresponding to the antisense oligomer of the present invention at a concentration of 12.5 to 25 mg/ml or 25 to 50 mg/ml) and use.

In addition to the antisense oligomers of the present invention and their carriers described above, pharmaceutically acceptable additives may also optionally be included in the composition of the present invention. Examples of such additives are emulsifying additives (for example, fatty acids having from 6 to 22 carbohydrate atoms and their pharmaceutically acceptable salts, albumin and dextran), stabilizers (for example, cholesterol, phosphatidic acid, sucrose, mannitol, sorbitol and xylitol), agents, isotonicity regulators (e.g. sodium chloride, glucose, maltose, lactose, sucrose, trehalose, mannitol, sorbitol and xylitol) and pH adjusters (e.g. hydrochloric

- 16 045808 acid, sulfuric acid, phosphoric acid, acetic acid, sodium hydroxide, potassium hydroxide and triethanolamine) One or more of these additives may be used. The content of the additive in the composition of the present invention is 90 mass% or less, preferably 70 mass% or less, and more preferably 50 mass% or less.

The composition of the present invention can be prepared by adding the antisense oligomer of the present invention to a carrier dispersion and mixing the mixture appropriately. Additives can be added at an appropriate stage either before or after the addition of the antisense oligomer of the present invention. When the composition of the present invention is in the form of an aqueous solution, the aqueous solvent that can be used when adding the antisense oligomer of the present invention is not particularly limited as long as it is pharmaceutically acceptable, and examples of the aqueous solvent include injection water or injection concentrated water, electrolyte liquid, such such as saline solution, etc., and sugar liquid such as glucose liquid, maltose liquid, etc. One skilled in the art can appropriately select the pH and temperature conditions for such a case.

The composition of the present invention can be obtained, for example, in liquid form and in the form of a lyophilized preparation thereof. In one embodiment of the composition of the present invention in dry form, the lyophilized composition of the present invention can be obtained by lyophilizing the composition of the present invention in liquid form in a conventional manner. Lyophilization can be carried out, for example, by suitably sterilizing the composition of the present invention in liquid form, dispensing an aliquot into a container, pre-freezing for 2 hours at a temperature of about -40 to -20° C., performing a primary drying at about 0 to 10 °C under reduced pressure, followed by secondary drying at approximately 15 to 25°C under reduced pressure. Typically, a lyophilized preparation of the composition of the present invention can then be prepared by replacing the gas in the vial with nitrogen gas and capping.

The lyophilized preparation of the composition of the present invention can be used generally after reconstitution by adding an optional solvent (reconstitution liquid) and redissolving the preparation. Such recovery fluid includes injection water, saline and other infusion fluids. The volume of the reconstituting liquid may vary depending on the intended use, etc., is not particularly limited, and is generally 0.5 to 2 times the volume before lyophilization or not more than 500 ml.

It is desirable to control the administered dose of the composition of the present invention, taking into account the following factors: the type and dosage form of the antisense oligomer of the present invention contained in the composition, the conditions of the patients, including age, body weight, etc., the route of administration, and the characteristics and extent diseases. The daily dose, calculated as the amount of antisense oligomer of the present invention, is usually from 0.1 mg to 10 g/person and preferably from 1 mg to 1 g/person. This numerical range may sometimes vary depending on the type of target disease, route of administration, and target molecule. Thus, in some cases a dose below the range may be sufficient and, conversely, sometimes a dose above the range may be required. The composition can be administered one to several times a day or at intervals of one day to several days.

In another embodiment, the composition of the present invention provides a pharmaceutical composition comprising a vector capable of expressing an oligonucleotide of the present invention and a carrier as described above. Such an expression vector may be a vector capable of expressing multiple oligonucleotides of the present invention. The composition can be formulated with pharmaceutically acceptable additives into a composition of the present invention containing an antisense oligomer of the present invention. The concentration of the expression vector contained in the composition may vary depending on the type of carrier, etc., and in one embodiment is suitably in the range of 0.1 nM to 100 μM, preferably in the range of 100 nM to 10 μM . The weight ratio of the expression vector and the carrier contained in the composition (carrier/expression vector) may vary depending on the properties of the expression vector, the type of carrier, etc., and is suitably in the range of 0.1 to 100, preferably in the range of 0 ,1 to 10. The content of the carrier contained in the composition is the same as in the case of the composition of the present invention containing the antisense oligomer of the present invention, and the method for its preparation is also the same as in the case of the composition of the present invention.

Hereinafter, the present invention will be described in more detail with reference to examples and research examples below, but it is not limited to them.

Examples

Example 1. Preparation of antisense oligomer.

According to the method described in WO 2013/100190, the antisense oligomers shown in table were synthesized. 1 (FMO No. 1-7 (SEQ ID NO: 2-8)), which target partial sequence

- 17,045,808 bases of exon 50 and/or the adjacent 3'-intron (intron 50) in the human dystrophin gene. The total size of each antisense oligomer ranged from 19 to 21 units. The theoretical molecular weight of each antisense oligomer and its value found by ESI-TOFMS are also shown.

In table 1, for example, H50_109-129 is a variant where the 5' terminal base of exon 50 in the human dystrophin gene is considered the 1st base and its downstream bases in the 3' direction are numbered in order, the antisense oligomer targeting the sequence 109 to 129 base. Since full-length exon 50 is 109 bases, the base sequence at 130b of the target base sequence is the base sequence in intron 50 in this example.

Table 1

Synthesized antisense oligomers (FMO no. 1 -7)

No. FMO Target base sequence Full length Subsequence FMO grounds Molecular mass SEQ ID NO Theoretical meaning Discovered meaning 1 Н50_У9-129 21 ATGGGATCCAGTATACTTAC A 6946.42 6946.25 2 2 H50_110-129 20 ATGGGATCCAGTATACTTAC 6607.30 6607.72 3 3 H50_110-128 19 TGGGATCCAGTATACTTAC 6268.18 6268.26 4 4 H50J11-129 19 ATGGGATCCAGTATACTT A 6292.19 6291.8 5 5 Н50_10Т-125 19 GATCCAGTATACTTACAG G 6277.19 6276.75 6 6 Н50_У8-126 19 SOATCCAGTATACTTACAG 6277.19 6277.13 7 7 H50_112-130 19 AATOGGATCCAGTATACTT 6292.19 6292.97 8

Example 2. Study of exon skipping activity of antisense oligomer.

In vitro test for exon 50 skipping in the human dystrophin gene.

(1) Research method.

Using the Asch's Cell Line Nucleofector L and Nucleofector II kit (Lonza), up to 3.5 x ^{l0 5} RD cells (human rhabdomyosarcoma cell line, CCL-136, purchased from ATCC) were transfected with 0.1 to 1 μM of each antisense oligomer from Table. 1. For transfection, the T-030 pulse program was used.

After transfection, RD cells were cultured for three nights in 2 ml of Eagle's minimal essential medium (EMEM) (Sigma, hereinafter) containing 10% fetal bovine serum (FBS) (Invitrogen) at 37°C and 5% _CO2 .

Transfected RD cells were washed once with PBS (Nissui, hereinafter) and 350 μl of RAI Buffer (Takara Bio Inc.) containing 1% 2-mercaptoethanol (Nacalai Tesque, Inc.) was added to the cells. After the cells were allowed to stand at room temperature for several minutes to lyse the cells, the lysate was collected on a NucleoSpin (registered trademark) filter (Takara Bio Inc.). The homogenate was obtained by centrifugation at llOOOxg for 1 min. Total RNA was extracted from cells according to the protocol supplied with NucleoSpin RNA (registered trademark) (Takara Bio Inc.). The concentration of isolated total RNA was determined using NanoDrop ONE (Thermo Fisher Scientific Inc.).

One-step RT-PCR was performed on 400 ng of isolated total RNA using the QIAGEN One Step RT-PCR kit (Qiagen) and a thermal cycler. The reaction solution was prepared according to the protocol included with the kit. A TaKaRa PCR Thermal Cycler Dice Touch (Takara Bio Inc.) was used. The following RT-PCR program was used.

50°C, 30 min: reverse transcription reaction;

95°C, 15 min: polymerase activation, reverse transcriptase inactivation, cDNA thermal denaturation;

94°C, 30 s; 60°C, 30 s; 72°C, 1 min]x35 cycles: PNR amplification;

72°C, 10 min: final extension;

The base sequences of forward primer and reverse primer used for RTPCR are given below.

Forward primer: 5'-AACAACCGGATGTGGAAGAG-3' (SEQ ID NO: 9)

Reverse primer: 5'-TTGGAGATGGCAGTTTCCTT-3' (SEQ ID NO: 10).

- 18045808 µl of the PCR reaction product above was analyzed using a Bioanalyzer (Agilent Technologies, Inc.) and MultiNA (Shimadzu Corp).

The level of polynucleotide in the band indicating that exon 50 was skipped (polynucleotide A level) and the polynucleotide level in the band indicating that exon 50 was not skipped (polynucleotide B level) were measured as signal intensities of the bands. Based on these measured values of A and B, the skip efficiency was estimated using equation (1) mentioned above.

) Research results.

In fig. 1-3 show the results regarding the exon 50 skipping efficiency obtained for each antisense oligomer. In table 2-4 below shows the effective concentration (EC ₅₀ ) at which each antisense oligomer exhibits 50% ES skip efficiency, which was calculated from these results. This study showed that FMOs #1-4 among antisense oligomers had high ES skipping efficiency and low EC ₅₀ value and thus effectively caused exon 50 skipping.

Among antisense oligomers with a full-length length of 19 units, as in FMOs No. 3 and 4, FMOs No. 5-7 had low pass efficiency and a high EC ₅₀ value. There is also a high degree of overlap between the base sequences targeted by FMOs #3 and 4 and FMOs #5–7. Thus, the effectiveness of FMOs No. 3 and 4 for skipping exon 50 is noticeable.

These results showed that the antisense oligomer of the present invention, even if its length is short compared with the prior art, can induce exon 50 skipping with high efficiency.

Example 3. Solubility study of antisense oligomer. Study of the solubility of antisense oligomer in physiological solution.

Among the antisense oligomers with high ES skipping efficiency in Example 2, each antisense oligomer FMO No. 2, 3 and 4, which had a total length of 19 to 20 nucleotides and was synthesized by a suitable method, was tested for its solubility in saline in order to further confirm its usefulness for medical use.

(1) Research method.

μL of saline was added to a sample bottle containing 4.5 mg of each antisense oligomer above and mixed using ultrasonic waves and vortex to prepare 100 mg/mL of saline. A sequence that did not cause precipitation at room temperature within 24 hours was judged to have high solubility.

(2) Research results.

All antisense oligomers tested showed solubility equal to or greater than 100 mg/ml in saline. These antisense oligomers are antisense oligomers that are highly useful as drugs due to their high exon 50 skipping efficiency as well as high solubility in physiological solutions.

These results demonstrate that the antisense oligomer of the present invention has

-

Claims (17)

superior physical properties as a drug while maintaining the ability to induce exon 50 skipping in the dystrophin gene with high potency. Industrial applicability. Experimental results from test examples demonstrated that the antisense oligomers of the present invention induced exon skipping with markedly high efficiency in RD cells. Thus, the antisense oligomers of the present invention are extremely useful for the treatment of DMD. Free form sequence listing SEQ ID NO: 1-10: synthetic nucleic acids. CLAIM 1. An antisense oligomer for the treatment of muscular dystrophy, which consists of the base sequence of SEQ ID NO: 4 or 5, or a pharmaceutically acceptable salt or hydrate thereof. 2. An antisense oligomer for the treatment of muscular dystrophy, which consists of the base sequence of SEQ ID NO: 4, or a pharmaceutically acceptable salt or hydrate thereof. 3. The antisense oligomer according to claim 1, which consists of the base sequence of SEQ ID NO: 5, or a pharmaceutically acceptable salt or hydrate thereof. 4. An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to any one of claims 1 to 3, wherein the antisense oligomer is an oligonucleotide. 5. An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to claim 4, wherein the sugar molecule and/or phosphate bond group of at least one nucleotide included in the oligonucleotide is modified. 6. Antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to claim 4 or 5, in which the sugar molecule of at least one nucleotide included in the oligonucleotide is ribose, in which the 2'-OH group is replaced by any one, selected from the group consisting of OR, R, R'OR, SH, SR, NH ₂ , NHR, NR ₂ , N ₃ , CN, F, Cl, Br and I (where R is alkyl or aryl and R' is an alkylene). 7. An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to any one of claims 4 to 6, wherein the phosphate bond group of at least one nucleotide included in the oligonucleotide is any one selected from the group consisting of thiophosphate bond, phosphorodithioate bond, alkylphosphonate bond, phosphoramidate bond and boranophosphate bond. 8. An antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to any one of claims 1 to 3, wherein the antisense oligomer is a morpholine oligomer. 9. The antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to claim 8, wherein the antisense oligomer is a phosphorodiamidate morpholine oligomer. 10. The antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to claim 8 or 9, wherein the 5' end is one of the chemical formulas (1)-(3) below: Formula 1 11. Pharmaceutical composition for the treatment of muscular dystrophy, containing an antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to any one of claims 1 to 10. 12. The pharmaceutical composition according to claim 11, further comprising a pharmaceutically acceptable carrier, a pharmaceutically acceptable additive or an aqueous solvent. 13. The pharmaceutical composition according to claim 11 or 12 for administration to a patient with muscular dystrophy, where the patient is a patient having a mutation that is susceptible to exon 50 skipping in the dystorophin gene. 14. The pharmaceutical composition according to claim 13, wherein the patient has a dystrophin gene characterized by at least a frameshift mutation caused by an exon deletion near exon 50 and in which the amino acid reading frame is corrected by exon 50 skipping. 15. The pharmaceutical composition according to claim 13 or 14, where the patient has a frameshift mutation caused by deletions of exons 51, 51-53, 51-55 or 51-57 in the dystrophin gene. 16. Pharmaceutical composition according to any one of claims 13 to 15, where the patient is a human. 17. Use of an antisense oligomer, or a pharmaceutically acceptable salt or hydrogen -