EA045753B1 - VIB H52 VACCINE WITH HETEROLOGUS SPIKE PROTEIN - Google Patents

Description

List of sequences

This invention contains a sequence listing in accordance with 37 C.F.R. 1.821-1.825.

The sequence listing accompanying the present invention is hereby incorporated by reference in its entirety.

Prerequisites for creating the invention

Avian coronavirus infectious bronchitis virus (IBV) is the prototype of a gammacoronavirus of the Coronaviridae family, order Nidovirales. Infectious bronchitis virus primarily infects the epithelium of the upper respiratory tract of chickens, causing respiratory disease usually complicated by secondary bacterial pathogens (Cook et al., 2012, Avian Pathol., 41:239-250). Some strains of IBD additionally affect the renal tubules, oviducts, and parts of the gastrointestinal tract, leading to pathological lesions and clinical symptoms in these organ systems. The virus is present worldwide in both commercial and domestic chickens. Due to its high genomic variability, IBD is distinguished by a large number of geno-, sero- and protectotypes. Currently, PIV is considered one of the most economically relevant viral pathogens in poultry farming.

Infectious bronchitis virus is an enveloped virus having a 27.6-kb positive-sense single-stranded RNA genome. (Cavanagh, 2007, Vet. Res., 38:281-297). The first two-thirds of the viral genome contains a large coding region (also referred to as gene 1), divided into two open reading frames 1a and 1b, which encode 15 nonstructural proteins involved in RNA replication, editing, and transcription. The last third of the viral genome encodes structural proteins: spike protein (S, encoded by gene 2), envelope protein (E, encoded by gene 3c), membrane protein (M, encoded by gene 4) and nucleocapsid protein (N, encoded by gene 6). Proteins S, E and M are part of the viral envelope, and protein N, together with viral RNA, forms the core of the ribonucleoprotein. The coronavirus spike protein determines the tropism of the host species (Kuo et al., 2000, J. Virol., 74:1393-1406). It is a dimeric or trimeric transmembrane protein that is proteolytically cleaved into two subunits, S1 and S2. The highly glycosylated S1 domain forms the head of the spike protein and contains a receptor-binding domain that interacts with 2,3-linked sialic acids on the host cell surface (Promkuntod et al. 2014. Virology. 448:26-32). The S2 domain contains the remainder of the ectodomain (pedicle), the transmembrane domain, and the endodomain, located in the cytoplasm.

Today, the most widely used live attenuated vaccine strains against FIV were developed in the 1960s. in the Netherlands by serial passaging of the Massachusetts type IBV strain (Bijlenga et al., 2004, Avian Pathol., 33:550-557). However, since the 1970s, new serotypes of HIV infection have emerged for which traditional vaccines against the Massachusetts type did not provide sufficient protection (Cook et al., 2012, Avian Pathol., 41:239–250). Therefore, there is a need for new and highly effective vaccines against other serotypes of HIV infection.

VIB Beaudette (Geilhausen et al., 1973, Arch Gesamte Virusforsch., 40(3) (1973), pp. 285-290) and H120 (G. Bijlenga et al., 2004, Avian Pathol., 33(6), pp. 550-557) are attenuated VIBs. However, attenuation may result in loss of immunogenicity.

In addition, recombinant VIBs were obtained. In Zhou et al. 2016 (Arch Virol., 161:3179-3187) described VIB H120 (Massachusetts genotype) with Beaudette styloid protein (Massachusetts genotype). Hodgson et al., 2004 (J. Virol., 78:13804-13811) described Beaudette VIB (Massachusetts genotype) with styloid protein M41 (Massachusetts genotype). In addition, Armesto et al., 2011 (PLoS One, 6(8):e24352) disclosed the Beaudette VIB (genotype Massachusetts) with a heterologous styloid protein from 4/91 (genotype 4/91).

However, the recombinant VIBs described in Zhou et al., 2016; and Hodgson et al., 2004, cannot be considered as IPV with heterologous spike protein because both IPV and the inserted spike protein belong to the same genotype/serotype (Massachusetts). In addition, all the vaccines mentioned are based on a Beaudette-based scaffold or have a Beaudette-based spike protein.

In addition, neither Beaudette-based vaccines nor such recombinant vaccines (with heterologous spike proteins) are commercially available, although Beaudette has been described many decades ago and recombinant approaches using Beaudette have been known for more than one decade, respectively. Recombinant Beaudette-based IPVs are not suitable as vaccines. Wei et al., 2014 (Apl. Microbiol. Biotechnol., 98) described the Beaudette VIB, which has an S1 subunit from H120.

Ellis et al., 2018 (J. Virol., 92(23)), Hodgson et al. (J. Virol. 78(24)); and Armesto et al., 2011 (PLoS One, 6(8):e24352) all reveal Beaudette VIB with styl protein M41 or 4/91. However, Ellis et al. 2018 (J. Virol. 92(23)) describe that recombinant Beaudette with chimeric spike proteins with heterologous S1 subunits from M41 or QX in combination with the S2 subunit of the Beaudette spike protein does not provide sufficient protection against homologous S1 challenges (Single vaccination of chickens without pathogen-specific rVIB expressing the S1 virulent strains M41 or QX, BeauR-M41 (S1) and BeauR-QX (S1), provided incomplete protection against homologous challenge based on ciliary activity and clinical signs; abstract). In addition, Ellis et al., 2018 (J. Virol., 92(23)) describe that the full-length S gene (S1 and S2 from M41) provided only partial protection against challenge with HIV of the homologous serotype (p. 12), suggesting that the Beaudette strain of FIV is not suitable as a backbone for recombinant FIV vaccines. Hodgson et al. (J. Virol., 78(24)) further disclose that the Baudette strain is also considered weakly immunogenic, and therefore has never been used as a vaccine strain (p. 13802, left column, second paragraph). Therefore, there is a need to develop new and highly effective vaccines against FIV and recombinant vaccines against FIV, respectively. In addition, there is a need for highly effective vaccine vectors against FIV.

Detailed Description of the Invention

Before describing aspects of the present invention, it should be noted that as used in the present description and in the accompanying claims, the singular number includes references to the plural unless the context clearly requires otherwise. Thus, for example, a reference to an antigen includes a plurality of antigens, a reference to a virus is a reference to one or more viruses and their equivalents known to those skilled in the art, etc. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as commonly understood by one skilled in the art to which this invention relates. Although any methods and materials similar or equivalent to those described in the present invention may be used in the practice or testing of the present invention, the preferred methods, devices and materials are described herein. All publications mentioned in the present invention are incorporated herein by reference for the purpose of describing and disclosing cell lines, vectors and methodologies, as indicated in the publications, that can be used in connection with the invention. Nothing in the present invention should be construed as an admission that the invention is not entitled to backdate such disclosure by virtue of a prior invention.

The essence of the invention

The present invention solves the problems inherent in the prior art and provides significant advances in the art.

In general, the present invention provides IBV H52 (infectious bronchitis virus) encoding a heterologous IBV S (spike) protein or a fragment thereof.

The term VIB H52 is well known to one skilled in the art. The term IBV refers to the infectious bronchitis virus. The term H52 identifies a specific strain of HIV infection. Strain H52 is well known to one skilled in the art and belongs to the Massachusetts genotype. FIV strains are usually differentiated by the coding sequence of the S1 subunit of the spike protein (Valastro et al., 2016, Infect. Genet. Evol., 39:349-364), and can also be differentiated by their complete nucleotide sequence or sequences of specific proteins, such as spike protein, nucleocapsid protein, envelope (E) protein, or membrane (M) glycoprotein. Since the spike protein determines the host tropism and antigenicity of HIV, the genotypes of HIV are classified according to the coding sequence of subunit 1 of the spike protein. Alternatively, IBD strains can be differentiated by their serotype.

Serotype classification involves treating the virus with neutralizing antibodies.

In addition, H52 can be distinguished from H120 by its higher pathogenicity when used on young chickens.

A person skilled in the art will know where to obtain VIB N52. VIB H52 strains can be purchased commercially, such as Nobilis IB H52 (MSD Animal Health), AviPro IB H52 (Lohmann Animal Health GmbH & Co. KG), Bronchovac (Ceva), etc. In addition, McDonald et al., 1980 (Avain Pathology, 9:245-259) described that VIB H52 can be obtained at the Central Veterinary Laboratory of Rotterdam, Kusters (J. gen Virol., 68:343-352) described that H52 IBV can be obtained from the Poultry Health Institute Dorn in the Netherlands (now called GD Animal Health), and Chen et al., 2007 (Avian Pathology, 36(4):269-274) describe that H52 IBV can be obtained from the China Institute of Veterinary Drug Control. In addition, H52 HPV has been used as a vaccine strain for decades (Bijlenga et al., 2004, Avian Pathology, 33(6):550-557) and can therefore be isolated by those skilled in the art. Methods for isolating VIB H52 strains and characterizing IVB H52 strains are well known to those skilled in the art. For example, strains of HIV H52 can be characterized as described in Zwaagstra et al., 1992 (J. Clin. Microbiol., 30 (1):79-84), Handberg et al., 1999 (Avian Pathology, 28:327 -335) or Callison et al. 2006 (Journal of Virological Methods, 138:60-65). Zwaagstra et al., 1992 and Handberg et al., 1999, for example, describe specific Massachusetts primers (for S and N proteins, respectively) for RTPCR and sequencing reference sequences for comparison. In addition, H52 IBVs have been sequenced and genomic sequences such as EU817497 are available. Thus, the genome of a virus can be generated by synthesizing its sequence and generated using reverse genetic systems.

The term spike refers to a specific VIB protein that is well known to one skilled in the art. Spike protein is a major inducer of antibodies and protective immune responses. In addition, the spike (S) protein facilitates the entry of HIV into cells by binding to cellular receptors of the host cell, as well as mediating the fusion of the virus-cell membrane with the host cell. In addition, it determines the tissue and cellular tropism of the virus strain.

The term heterologous S (spike) means that the spike protein or fragment thereof that was introduced into the H52 VIB belongs to a different genotype or serotype than the H52 VIB. Thus, heterologous spiny has a genotype or serotype different from H52. Because H52 is a Massachusetts genotype and serotype, the heterologous spike protein is a non-Massachusetts genotype or serotype.

The terms protein, amino acid and polypeptide are used interchangeably. The term protein refers to a sequence of amino acids consisting of naturally occurring amino acids as well as their derivatives. Naturally occurring amino acids are well known in the art and are described in standard biochemistry textbooks. In an amino acid sequence, amino acids are linked by peptide bonds. Additionally, the two ends of the amino acid sequence are called the carboxyl terminus (C-terminus) and the amino terminus (N-terminus). The term protein covers essentially purified proteins or protein preparations containing in addition other proteins. In addition, the term also refers to protein fragments. Moreover, it contains chemically modified proteins. Such modifications may be artificial or naturally occurring modifications such as phosphorylation, glycosylation, myristylation, and the like.

In addition, the present invention also provides an immunogenic composition containing IAV H52 (infectious bronchitis virus) encoding a heterologous S (spike) protein or a fragment thereof.

In addition, the present invention also provides an immunogenic composition containing IBV (infectious bronchitis virus) as described in the present invention. Thus, an immunogenic composition has been proposed containing VIB H52 (infectious bronchitis virus), encoding the heterologous S (spike) protein of VIB or a fragment thereof.

The term immunogenic composition refers to a composition that contains at least one antigen that causes an immunological response in the host to which the immunogenic composition is administered. Such an immunological response may be a cellular and/or antibody-mediated immune response to the immunogenic composition of the invention. Preferably, the immunogenic composition induces an immune response and more preferably provides protective immunity against one or more clinical signs of HIV infection. The owner is also described as the subject. Preferably, any of the hosts or subjects described or mentioned in the present invention is a bird or poultry.

Typically, the immunological response includes, but is not limited to, one or more of the following effects: production or activation of antibodies, helper T cells, suppressor T cells and/or cytotoxic T cells, and/or gamma delta T cells specifically targeted on the antigen or antigens included in the immunogenic composition proposed in the invention. Preferably, the host exhibits either a protective immunological response or a therapeutic response.

A protective immunological response or protective immunity will be demonstrated by either a reduction or absence of clinical signs that would normally be seen in an infected host, a faster time to recovery and/or a decreased duration of infectivity, or a reduced titer of pathogens in the tissues or body fluids or secretions of an infected host.

In the event that the host exhibits a protective immunological response such that resistance to a new infection will increase and/or reduce the clinical severity of the disease, then the immunogenic composition is described as a vaccine.

VIB H52 - determination by protein coding sequences.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the H52 VIB has a nucleotide sequence as shown for EU817497 (SEQ ID NO: 78) or a sequence having at least 95, 96, 97, 98, 99, 99.2 , 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

The term nucleic acid or nucleic acid sequence or nucleotide sequence refers to polynucleotides, including DNA molecules, RNA molecules, cDNA molecules or derivatives.

The term covers both single-stranded and double-stranded polynucleotides. Nucleic acid in accordance with the present invention includes isolated polynucleotides (ie, isolated from their natural environment) and genetically modified forms. Also included are chemically modified polynucleotides, including naturally occurring modified polynucleotides, such as glycosylated or methylated polynucleotides, or artificially modified ones, such as biotinylated polynucleotides. In addition, the terms nucleic acid and polynucleotide are used interchangeably and refer to any nucleic acid.

- 3 045753

The terms nucleic acid and polynucleotide also specifically include nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

The term RNA refers to any ribonucleic acid. The term covers both single-stranded and double-stranded RNA. RNA in accordance with the present invention includes isolated RNA (ie, isolated from its natural environment) and genetically modified forms. In addition, this also includes chemically modified RNAs, including naturally occurring modified RNAs such as methylated RNA, or artificially modified RNAs such as biotinylated RNA. The term RNA also specifically includes RNA composed of bases other than the four biologically occurring nucleotides/bases (adenine, guanine, cytosine and uracil).

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the VIB strain H52 has a spike (S) protein having the amino acid sequence as shown for AF352315 (SEQ ID NO: 79) or a sequence having at least 95, 96, 97 , 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

It should be understood that the spike protein or nucleic acid sequence can be used to determine whether the HIB strain is of H52 origin. However, since the H52 VIB is used as a backbone and the H52 spike protein sequence or nucleic acid sequence is replaced by a heterologous spike protein or a fragment thereof, the final IVB with the heterologous spike protein no longer contains or only contains remaining portions of the H52 spike protein.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the VIB strain H52 has a spike (S) protein having an amino acid sequence as shown in SEQ ID NO: 1 or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the H52 VIB has a nucleocapsid (N) protein having the amino acid sequence as shown for AY044185 (SEQ ID NO: 80) or a sequence having at least 95, 96, 97. 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% sequence identity with at least one of the above sequences .

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the H52 VIB has a nucleocapsid (N) protein having an amino acid sequence as shown for AF352310 (SEQ ID NO: 81) or a sequence having at least 95, 96, 97. 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the H52 VIB has a nucleocapsid (N) protein having an amino acid sequence as shown in SEQ ID NO: 2 or a sequence having at least 95, 96, 97, 98, 99 , 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the H52 VIB has an envelope (E) protein having the amino acid sequence as shown for AF317210 (SEQ ID NO: 82) or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the H52 VIB has an envelope (E) protein having an amino acid sequence as shown in SEQ ID NO: 3 or a sequence having at least 95, 96, 97, 98, 99 , 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the H52 VIB has a membrane glycoprotein (M) protein having the amino acid sequence as shown for AF286185 (SEQ ID NO: 83) or a sequence having at least 95, 96, 97 , 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the H52 VIB has a membrane glycoprotein (M) protein having an amino acid sequence as shown in SEQ ID NO: 4 or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

The term identity or sequence identity is known in the art and refers to the relationship between two or more polypeptide sequences or two or more polynucleotide sequences, namely a reference sequence and a given sequence to be compared with the reference sequence. Sequence identity is determined by comparing a given sequence to a reference sequence after the sequences have been optimally aligned to obtain the highest degree of sequence similarity, as determined by the correspondence between strings of such sequences. Following such alignment, sequence identity is confirmed on a position-by-position basis, for example, sequences are identical at a particular position if the nucleotides or amino acid residues at that position are identical. The total number of such position identities is then divided by the total number of nucleotides or residues in the reference sequence to obtain % sequence identity. Sequence identities can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, A.N., ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D.W. , ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A.M., Griffin, H.G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988), the contents of which are incorporated herein by reference. Preferred methods for determining sequence identity are designed to provide the best possible match between the sequences being examined. Methods for determining sequence identity are encoded in publicly available computer programs that determine sequence identities between given sequences. Examples of such programs include, but are not limited to, the GCG software package (Devereux, J. et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN and FASTA (Altschul, S.F. et al. , J. Molec. Biol., 215:403-410 (1990) The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCVI NLM NIH Bethesda, MD 20894, Altschul, S. F. et al. ., J. Molec. Biol., 215:403-410 (1990), the contents of which are incorporated herein by reference.) These programs optimally align sequences using a default gap weight to obtain the highest level of sequence identity between a given and a reference By way of example, by a polynucleotide with a nucleotide sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity with a reference nucleotide sequence, the nucleotide sequence of the given polynucleotide is assumed to be identical to the reference sequence, except except that the sequence of a given polynucleotide may contain up to 15, preferably up to 10, even more preferably up to 5 point mutations for every 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide having a nucleotide sequence having at least 85%, preferably 90%, even more preferably 95% identity to a reference nucleotide sequence, up to 15%, preferably 10%, even more preferably 5% of the nucleotides in the reference sequence may be removed or replaced by other nucleotides, or up to 15%, preferably 10%, even more preferably 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These reference sequence mutations may be present at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between these terminal positions, distributed either individually among the nucleotides in the reference sequence or in one or more contiguous groups in the reference sequence. Similarly, by a polypeptide with a given amino acid sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity with a reference amino acid sequence, the amino acid sequence of the polypeptide is assumed to be identical to the reference sequence, except that that a given polypeptide sequence may contain up to 15, preferably up to 10, even more preferably up to 5 amino acid changes for every 100 amino acids of the reference amino acid sequence. In other words, to obtain a given polypeptide sequence that has at least 85%, preferably 90%, even more preferably 95% sequence identity with a reference amino acid sequence, up to 15%, preferably up to 10%, even more preferably up to 5 % of the amino acid residues in the reference sequence may be deleted or replaced by another amino acid, or up to 15%, preferably up to 10%, even more preferably up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These reference sequence changes may occur at the amino- or carboxy-terminal positions of the reference amino acid sequence or anywhere between these terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups in the reference sequence. Preferably, positions of residues that are not identical are distinguished by conservative amino acid substitutions. However, conservative substitutions are not included as hits when determining sequence identity.

The terms identity, sequence identity or percentage identity are used interchangeably in the present invention. To practice the present invention, it is here determined that to determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison (for example, spaces may be introduced into the sequence of the first

- 5 045753 amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid or nucleotide residues at the corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide residue as the corresponding position in the second sequence, the molecules are identical at that position. The percentage identity between two sequences is a function of the number of identical positions shared by the sequences (ie % identity = number of identical positions/total number of positions (ie overlapping positions) x 100). Preferably the two sequences are of the same length.

Sequence comparisons can be made over the entire length of the two sequences being compared, or over portions of the two sequences. Typically, the comparison will be made over the entire length of the two sequences being compared. However, identity with it can be achieved over a region of, for example, twenty, fifty, one hundred or more contiguous amino acid residues.

One skilled in the art will know that several different computer programs are available for determining the identity between two sequences. For example, comparing sequences and determining the percent identity between two sequences can be performed using a mathematical algorithm. In a preferred embodiment, the percentage identity between two amino acid or nucleic acid sequences is determined using the Needleman-Wunsch algorithm (J. Mol. Biol., (48):444-453 (1970)), which was included in the GAP program in the software package Accelrys GCG (available at http://www.accelrys.com/products/gcg/), using either a Blosum 62 matrix or a PAM250 matrix, and a gap opening penalty of 16, 14, 12, 10, 8, 6 or 4 and the penalty for continuing the space is 1, 2, 3, 4, 5, or 6. One skilled in the art will appreciate that each of these different parameters will produce slightly different results, but the overall percent identity of the two sequences does not change significantly when different algorithms are used.

In addition, protein sequences or nucleic acid sequences in accordance with the present invention can be used as a query sequence to search available databases, for example, to identify other family members or related sequences. Such searches can be performed using the programs BLASTN and BLASTP (version 2.0) from Altschul, et al. (1990), J. Mol. Biol., 215:403-10. BLAST protein searches can be performed using the BLASTP program, score=50, word length=3, to obtain amino acid sequences homologous to protein molecules in accordance with the invention. To obtain alignments with gaps for comparison purposes, Gapped BLAST can be used as described by Altschul et al. (1997), Nucleic Acids Res., 25(17):3389-3402. When using the BLAST and Gapped BLAST programs, you can use the default settings of the corresponding programs (for example, BLASTP and BLASTN). See the National Center for Biotechnology Information home page at http://www.ncbi.nlm.nih.gov/.

In the context of the present invention, in particular, it should be understood that the term identical to the sequence of SEQ ID NO: X is equivalent to the term identical to the sequence of SEQ ID NO: X throughout the length of SEQ ID NO: X or the term identical to the sequence of SEQ ID NO: X throughout the entire length of SEQ ID NO: X respectively. In this context, X is any integer from 1 to 85, such that SEQ ID NO: X is any of the SEQ ID NOs mentioned in the present invention.

Heterologous S protein.

VIB strains.

FIV strains can be classified by serotype and genotype. Serotype classification involves treating the virus with neutralizing antibodies, while genotype classification usually involves examining the sequence of the S1 (spike) protein. However, various strains of IBD are well known to those skilled in the art. Infectious bronchitis virus was first discovered in the United States in the 1930s. The first identified serotype of IBV was Massachusetts, but several serotypes have been identified in the United States, including Arkansas and Delaware, in addition to the initially identified Massachusetts type.

The VIB Beaudette strain is of the Massachusetts type and was obtained after at least 150 passages in chick embryos. The VIB strain Beaudette was originally isolated by Beaudette and Hudson (J. Am. Vet. Med. A., 90, 51-60, 1937) and passaged in chick embryos. Other strains of Massachusetts type VIB, in addition to Beaudette, are H120, H52 and M41. Strain H120 was passaged 120 times.

IBV QX is described as a virulent field isolate of IBV that was originally isolated in China. However, the virus has spread to Europe and has been detected in parts of Western Europe, predominantly in the Netherlands, but also in Germany, France, Belgium, Denmark and the UK. In addition, genotype or serotype QX has been described in several countries in Asia and Africa.

IBV 4/91, commonly referred to as 793B, was first registered in the UK

- 6 045753 in the early nineties and is now distributed in many parts of the world. CR88 is an attenuated strain belonging to this genotype and is commercially available as a vaccine.

Strains designated Italian-02 or Italy-02 were isolated in the late 1990s. V

Italy. A sequence analysis of one of these isolates was published in 2002 (NCBI-BLAST number AJ457137).

However, studies have shown that this Italian-02 strain is widespread in Europe and that, in addition to the VIB 4/91 strain variant, it has become one of the most predominant genotypes in the UK, Spain, France and the Netherlands.

Since 1996, a new genotype of infectious bronchitis virus (IBV), designated Q1, has been circulating in China and was first reported in Italy in 2011. Q1 is associated with increased mortality, kidney damage, and proventriculitis.

In addition, strains D274, B1648/D8880, D1466, V1397 and Arkansas have been identified in Europe.

A person skilled in the art will know where to obtain any strains of HIV infection. FIB strains are commercially available, can be obtained from scientific institutions, or genomes can be synthesized synthetically as complementary DNA, since FIB strains have been sequenced and the sequences have been published and are thus available. Moreover, IBD strains can be isolated locally. Methods for isolating HIB strains and characterizing HIB strains are well known to those skilled in the art. Valter Leonardo de Quadros, 2011 (Thesis, Das Infektiose Bronchitis Virus (IBV): Molekularbiologische Untersuchungen zur Diagnostik und zum Vorkommen sowie zur Pathogenitat des Genotyps IBV QX in spezifisch pathogenfreien (SPF) Broilern, Freie Universitat Berlin), Worthington et al., 2009 (Avian Pathology, 37(3), 247-257), Liu et al., 2009 (Virus Genes, 38:56-65), Dolz et al., 2006 (Avian Pathology, 35(2):77-85) , Farsang et al., 2002 (Avian Pathology, 31:229-236) and Feng et al., 2014 (Virus Genes, 49:292-303) describe how to isolate and differentiate different strains of FIV.

In another specific aspect of the HIV or immunogenic composition in accordance with the present invention, the heterologous spike protein is of a genotype or serotype other than Massachusetts.

In another specific aspect of the HIB or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof belongs to the HIB with a genotype or serotype selected from the list consisting of: Arkansas (such as Arkansas 99), Brazil (such as BR-1, BR-2, 23/2013, IBV/Brazil/351/1984), California (such as California 1734/04, California 99), Connecticut, Delaware (such as Delaware 98), Dutch (such as D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (such as Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holt, Iowa (such as Iowa 97 and Iowa 69), Italy ( such as Italy 02), JMK, LDT3, Maine (such as Maine 209), Pennsylvania (such as Pennsylvania 1220/98, Pennsylvania Wolg/98), PL84084, Qu (such as Qu-mv), QX (such as GB341/ 96), Q1, SE 17, Option 2 (such as IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016) and 4/91 (793B, CR88) .

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof is derived from a VIB selected from the list of genotypes or serotypes including 4/91, QX, Q1, Italy 02, Arkansas, Connecticut, Georgia, LDT3, PL84084, Option 2 or Brazil.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof is derived from a VIB selected from the list of genotypes or serotypes including 4/91, QX, Q1, Arkansas, Variant 2 and Brazil.

In another specific aspect of the HIB or immunogenic composition in accordance with the present invention, strain 4/91 is selected from the list including Spain/98/328, Spain/92/35, IR-3654-VM, FR-CR88061-88, FR- 85131-85, UK-1233-95, UK/3/91, Spain/00/336, UK/7/91, 4/91pathogenic, 4/91-attenuated, IB4-91 and CR88.

In another specific aspect of the IBV or immunogenic composition in accordance with the present invention, the QX strain is selected from the list including FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV/Ck/ SP/170/09, IBV/Ck/SP/79/08, IBV/Ck/SP/248/09, HBN, IBVQX, LX4, BJQ, CK/CH/LGD/03 and GB341/96.

In another specific aspect of the HIV infection or immunogenic composition in accordance with the present invention, the Q1 strain is selected from the list including CK/CH/LDL/98I, CK/CH/LSD/08-10, J2, Q1, AR08ER22, AR08BA21 and Chili- 295-10.

In another specific aspect of the HIV infection or immunogenic composition in accordance with the present invention, the Arkansas strain is selected from the list including Ark99, ArkGA, ArkDPI, AL/5364/00, ARKDPI11, AL/0803/01, AL/7149/00, ArkDPI101, AL/1221/01, AL/1793/01 and AL/4614/98.

In another specific aspect of the HIV infection or immunogenic composition in accordance with the present invention, the Option 2 strain is selected from the list including: IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/ 2016, Eg/CLEVB-2/IBV/012, D1344/2/4/10_EG, TR8 and IB VAR2-06.

- 7 045753

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the Brazil strain is selected from the list including: BR1, BR-2, 23/2013 and

IBV/Brazil/351/1984.

In another specific aspect of the HIV or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof is derived from genotype or serotype 4/91.

In another specific aspect of the HIV or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof has a genotype or serotype of 4/91 having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 , 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 5 or 6.

In another specific aspect of the IVB or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof has a genotype or serotype QX having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 ,2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 7 or 8.

In another specific aspect of the HIV or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof has a Q1 genotype or serotype having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 ,2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 9 or 10.

In another specific aspect of the HIV or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof has an Arkansas genotype or serotype having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 ,2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 11 or 12.

In another specific aspect of the HIV or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof has a Variant 2 genotype or serotype having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99. 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 13 or 14.

In another specific aspect of the HIV or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof has a Brazil genotype or serotype of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 ,2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 15 or 16.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the heterologous S protein or fragment thereof is selected from the list consisting of SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the heterologous S protein is a full-length spike protein.

The present experimental data show that fragments of the spike protein sequence, such as the ectodomain of the spike protein, can be used. However, full-length spike protein sequences can also be used.

In another specific aspect of the VIB or immunogenic composition of the present invention, the heterologous S (spike) protein fragment is at least 500, 750, 1000, or 1077 amino acids in length.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the fragment of the heterologous S (spike) protein has a length of at least 500, 750, 1000 or 1077 amino acids from the N-terminus.

The term N-terminus is well known to one skilled in the art. The N-terminus is also called the amino terminus, NH2-terminus, N-terminal region or amino terminus. When a protein is translated from messenger RNA, it is created from the N-terminus to the C-terminus. Thus, the N-terminus is the beginning of an amino acid chain (protein or polypeptide) containing the specified amino group (-NH2).

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the heterologous S (spike) protein fragment is at least 1000 amino acids in length.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the heterologous S (spike) protein fragment is an ectodomain of the spike protein.

The term ectodomain is well known to one skilled in the art. The spike protein consists of various functional parts, a signal sequence, an ectodomain, a transmembrane domain, and an endodomain (from N-terminus to C-terminus). Thus, after cleavage of the signal sequence, the N-terminus of the spike protein begins with the ectodomain. The ectodomain of spiny HIB is approximately 1077 amino acids long and varies in length by several amino acids depending on the HIB strain.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, a heterologous S (spike) protein or fragment thereof replaces a homologous S protein or fragment thereof.

- 8 045753

In another specific aspect of the VIB or immunogenic composition of the present invention, the heterologous S (spike) protein or fragment thereof replaces a naturally occurring S protein or fragment thereof.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, a heterologous S (spike) protein or fragment thereof replaces the S protein or fragment thereof in the H52 VIB.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the VIB is attenuated.

The term attenuated refers to a pathogen that has reduced virulence compared to the wild type isolate. In the present invention, an attenuated FIV is a virus that has been reduced in virulence such that it does not cause clinical signs of FIV infection, but is capable of eliciting an immune response in the target animal, and may also mean that clinical signs are reduced in frequency or severity in animals infected with the attenuated IBV compared with a control group of animals infected with non-attenuated IBV and not receiving the attenuated virus. In this context, the term reduce/lower means a reduction of at least 10%, preferably 25%, even more preferably 50%, even more preferably 60%, even more preferably 70%, even more preferably 80%, even more preferably 90 %, even more preferably 95% and most preferably 100% compared to a control group infected with non-attenuated IPV as defined above. Thus, the attenuated strain of VIB is a strain that is suitable for inclusion in an immunogenic composition containing modified live VIB.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the VIB is inactivated.

For the purposes of the present invention, any standard inactivation method can be used. Thus, inactivation can be carried out using chemical and/or physical treatments that are known to one skilled in the art. Preferred inactivation methods include the addition of cyclized binary ethyleneimine (BEI), including the addition of a solution of 2-bromoethyleneamine hydrobromide (BEA) that has been cyclized to binary ethyleneimine (BEI). Other preferred chemical inactivators include, but are not limited to, Triton X-100, sodium deoxycholate, cetyltrimethylammonium bromide, β-propiolactone, thimerosal, phenol, and formaldehyde (formalin). However, inactivation may also include a neutralization step. Preferred neutralizing agents include, but are not limited to, sodium thiosulfate, sodium bisulfite, and the like.

Preferably, the formaldehyde inactivation conditions include a formalin concentration between about 0.02-2.0% (v/v), more preferably from about 0.1-1.0% (v/v), even more preferably from about 0.15-0.8% (v/v), even more preferably from about 0.16-0.6% (v/v) and most preferably about 0.2-0.4% (v/v) ./about.). Incubation time depends on the stability of the VIB. In general, the inactivation process is carried out until growth of VIB is detected in a suitable culture system.

Preferably, the inactivated VIB according to the present invention is formaldehyde inactivated, preferably using the concentrations described above.

The inactivated VIB according to the invention can be incorporated into liposomes using known technology such as that described in Nature, 1974, 252, 252-254 or Journal of Immunology, 1978, 120, 1109-13. In another embodiment, the inactivated VIB of the invention may be conjugated to suitable biological compounds, such as polysaccharides, peptides, proteins, etc., or a combination thereof.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the VIB is genetically engineered.

The term genetically engineered refers to a VIV that has been mutated using reverse genetics approaches. Preferably, the VIB according to the present invention is obtained through genetic engineering. The reverse genetics method involves producing synthetic recombinant viral RNAs. However, reverse genetics techniques are well known to those skilled in the art.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the VIB is a recombinant VIB.

As used herein, the term recombinant refers to an RNA genome (or RNA sequence, cDNA sequence or protein) having any modifications that do not occur naturally in the corresponding RNA genome (or RNA sequence, cDNA sequence or protein). For example, an RNA genome (or RNA sequence, cDNA sequence, or protein) is considered recombinant if it contains an insertion, deletion, inversion, movement, or point mutation introduced artificially, such as by human intervention. Therefore, the genomic RNA sequence (or RNA sequence, cDNA sequence or

- 9 045753 protein) is not related to all or part of the sequences (or RNA sequence, cDNA sequence or protein) with which it is associated in nature.

The term recombinant, when used in relation to a virus, means a virus produced by artificial manipulation of the viral genome. The term recombinant virus covers genetically modified viruses.

In another specific aspect of the VIB or immunogenic composition in accordance with the present invention, the VIB is chimeric.

The term chimeric refers to an IPV containing one or more nucleotide sequences from another coronavirus, preferably from a different strain of INV. For example, VIB H52, encoding a heterologous S (spike) protein or a fragment thereof, is a chimeric VIB.

In another specific aspect of the immunogenic composition in accordance with the present invention, the immunogenic composition is a vaccine. The term vaccine has already been described elsewhere in the present invention. However, in the event that the host exhibits a protective immunological response such that resistance to a new infection will increase and/or reduce the clinical severity of the disease, the immunogenic composition is described as a vaccine.

In another specific aspect of the immunogenic composition in accordance with the present invention, the immunogenic composition contains a pharmaceutically acceptable carrier.

The term pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption retardants, adjuvants, immunostimulants, and combinations thereof.

Diluents include water, saline, dextrose, ethanol, glycerin, etc. Isotonic agents may include, but are not limited to, sodium chloride, dextrose, mannitol, sorbitol, and lactose. Stabilizers include, but are not limited to, albumin and alkaline salts of ethylenediaminetetraacetic acid.

In another specific aspect of the immunogenic composition of the present invention, the pharmaceutically acceptable carrier is phosphate buffered saline.

Preferably, the immunogenic composition further contains a sucrose and gelatin stabilizer.

Preferably, the pharmaceutically acceptable carrier is chitosan.

Chitosan is a naturally occurring deacetylated polysaccharide from the chitin of crustaceans (eg shrimp, crabs), insects and other invertebrates. Recently, Rauw et al., 2009 (Vet. Immunol. Immunop., 134:249-258) demonstrated that chitosan enhances the cellular immune response of a live Newcastle disease vaccine and enhances its protective effect. Additionally, Wang et al., 2012 (Arch Virol (2012), 157:1451-1461) showed results revealing the potential of chitosan as an adjuvant for use in live attenuated influenza vaccine.

Preferably, the immunogenic composition may further include one or more other immunomodulatory agents, such as, for example, interleukins, interferons or other cytokines. The amounts and concentrations of adjuvants and additives useful in the context of the present invention can be readily determined by one skilled in the art.

In some aspects, the immunogenic composition of the present invention contains an adjuvant. As used herein, the term adjuvants may include aluminum hydroxide and aluminum phosphate, saponins, e.g. Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), emulsion water-in-oil type, oil-in-water emulsion, water-in-oil-in-water emulsion. The emulsion can be based, in particular, on light liquid paraffin oil (European Pharmacopoeia type); isoprenoid oil such as squalane or squalene; oil obtained after oligomerization of alkenes, in particular isobutyl or decene; esters of acids or alcohols containing a linear alkyl group, more particularly vegetable oils, ethyl oleate, di-(caprylate/caprate) propylene glycol, tri-(caprylate/caprate) glyceryl or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular esters of isostearic acid. To obtain an emulsion, the oil is used in combination with emulsifiers. Emulsifiers are preferably non-ionic surfactants, in particular esters of sorbitan, mannitol (eg anhydromannite oleate), glycol, polyglycerol, propylene glycol and oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene block copolymers -polyoxyethylene, in particular Pluronic products, in particular L121. See Hunter et al., The Theory and Practical Application of Adjuvants (Ed. Stewart-Tull, D.E.S.), JohnWiley and Sons, NY, p. 51-94 (1995); and Todd et al., Vaccine, 15:564-570 (1997). Exemplary adjuvants are the SPT emulsion described on p. 147 in Vaccine Design, The Subunit and Adjuvant Approach, ed. M. Powell, M. Newman, Plenum Press, 1995, and the MF59 emulsion described on p. 183 of the same book.

A further example of an adjuvant is a compound selected from polymers of acrylic

- 10 045753 or methacrylic acid and copolymers of maleic anhydride and an alkenyl derivative. Preferred adjuvant compounds are polymers of acrylic or methacrylic acid which are cross-linked, especially with polyalkenyl ethers of sugars or polyhydric alcohols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2 June 1996). Those skilled in the art may also refer to US Pat. No. 2,909,462, which describes such acrylic polymers cross-linked with a polyhydroxylated compound that has at least 3 hydroxyl groups, preferably no more than 8, wherein the hydrogen atoms of at least three hydroxyls are replaced unsaturated aliphatic radicals containing at least 2 carbon atoms. Preferred radicals are those containing from 2 to 4 carbon atoms, for example vinyls, allyls and other ethylenically unsaturated groups. Unsaturated radicals may themselves contain other substituents such as methyl. Particularly suitable are the products sold under the name Carbopol; (BF Goodrich, Ohio, USA). They are cross-linked with allylsucrose or allylpentaerythritol. Among them we can mention Carbopol 974P, 934P and 971P. The most preferred is the use of Carbopol 971P. Among the copolymers of maleic anhydride and an alkenyl derivative are the EMA copolymers (Monsanto), which are copolymers of maleic anhydride and ethylene. Dissolution of these polymers in water provides an acidic solution that will be neutralized, preferably to physiological pH, to obtain an adjuvant solution into which the immunogenic, immunological or vaccine composition itself will be included.

Additionally, suitable adjuvants include, but are not limited to, RIBI adjuvant system (Ribi Inc.), block copolymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, lipid amine adjuvant avridine , heat labile enterotoxin from E. coli (recombinant or other), cholera toxin, IMS 1314 or muramyl dipeptide, or naturally occurring or recombinant cytokines or analogs thereof, or stimulators of endogenous cytokine release, among many others.

It is contemplated that the adjuvant may be added in an amount of about 100 μg to about 10 mg per dose, preferably in an amount of about 100 μg to about 10 mg per dose, more preferably in an amount of about 500 μg to about 5 mg per dose, even more preferably in an amount of from about 750 μg to about 2.5 mg per dose, and most preferably in an amount from about 1 mg per dose. Alternatively, the adjuvant may be present at a concentration of from about 0.01 to 50%, preferably at a concentration from about 2 to 30%, more preferably at a concentration from about 5 to 25%, even more preferably at a concentration from about 7 to 22%, and most preferably at a concentration of 10 to 20% by volume of the final product.

In another specific aspect of the immunogenic composition in accordance with the present invention, the immunogenic composition is effective in treating and/or preventing clinical signs caused by IBD in a subject in need. The terms treatment and/or prevention, clinical signs and need have been defined elsewhere.

In another specific aspect of the immunogenic composition in accordance with the present invention, the immunogenic composition protects against infection by a strain of HIV virus genotype or serotype of the heterologous spike protein.

In another specific aspect of the immunogenic composition of the present invention, the immunogenic composition protects against infection by genotype 4/91, QX, Q1, Arkansas, Variant 2, or Brazil strains.

In another specific aspect of the immunogenic composition in accordance with the present invention, the immunogenic composition protects against infection by genotype 4/91 strains.

In another specific aspect of the immunogenic composition in accordance with the present invention, said immunogenic composition is formulated for single administration.

The volume for a single dose has been defined elsewhere in the present invention.

Moreover, it has been shown that one dose of the immunogenic composition according to the present invention is effective after administration of such a single dose of said immunogenic composition.

In another specific aspect of the immunogenic composition of the present invention, the immunogenic composition is administered subcutaneously, intramuscularly, orally, in ovo, as a spray, in drinking water, or as eye drops.

In another specific aspect of the immunogenic composition in accordance with the present invention, the immunogenic composition contains from 1 to 10 log ₁₀ EID50 per dose of VIB.

In another specific aspect of the immunogenic composition in accordance with the present invention, the immunogenic composition contains from 2 to 5 log ₁₀ EID50 per dose of VIB.

In another specific aspect of the immunogenic composition in accordance with the present invention, the immunogenic composition contains from 2 to 4 log ₁₀ EID50 per dose of VIB.

Sets.

If desired, the compositions may be presented in a package or dispensing device that

- 11 045753 These may contain one or more unit dosage forms containing the active substance. The package may comprise, for example, metal or plastic foil, such as a blister pack. Instructions for use may be provided with the package or dosing device, preferably for administration to subjects, especially poultry. Such container(s) may be accompanied by a notice in a form prescribed by the government agency regulating the manufacture, use, or sale of pharmaceutical or biological products, which notice reflects the agency's approval of the manufacture, use, or sale for administration to humans.

Thus, the present invention provides a kit containing a VIB or immunogenic composition as described in the present invention.

In one particular aspect of the kit in accordance with the present invention, the kit further contains instructions for the treatment and/or prevention of diseases in birds.

In one particular aspect of the kit in accordance with the present invention, the kit further contains instructions for the treatment and/or prevention of diseases in poultry.

In one particular aspect of the kit in accordance with the present invention, the kit further contains instructions for the treatment and/or prevention of IB (infectious bronchitis).

Method of treatment.

In addition, the present invention provides a method of immunizing a subject, comprising administering to such subject an immunogenic composition as described in the present invention.

The term immunization refers to active immunization by administering an immunogenic composition to a subject to be immunized, thereby eliciting an immunological response against an antigen included in such immunogenic composition.

Preferably, immunization results in a reduction in the incidence of a particular FIV infection in the flock or a reduction in the severity of clinical signs caused by or associated with a particular FIV infection.

In addition, immunization of a subject in need thereof with immunogenic compositions as provided in the present invention results in the prevention of infection of the subject by HIV infection. Even more preferably, immunization results in an effective, long-lasting immunological response against infection by HIV. It will be understood that said period of time will be greater than 1 month, preferably greater than 2 months, preferably greater than 3 months, more preferably greater than 4 months, more preferably greater than 5 months, more preferably greater than 6 months. It should be understood that immunization may not be effective in all immunized subjects. However, the term implies that a significant proportion of animals are immunized.

Preferably, in this context, a group of subjects are considered who normally, that is, without immunization, develop clinical signs usually caused by or associated with infection with VIV. One skilled in the art can determine without much effort whether the animals in the flock are effectively immunized. Preferably, immunization should be effective if clinical signs are present in at least 33%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, even more preferably in at least 95% and most preferably 100% of the individuals in a given flock have decreased in frequency or severity by at least 10%, more preferably by at least 20%, even more preferably by at least 30%, even more preferably by by at least 40%, even more preferably by at least 50%, even more preferably by at least 60%, even more preferably by at least 70%, even more preferably by at least 80%, even more preferably by at least 90%, even more preferably at least 95%, and most preferably 100% compared to subjects who were either not immunized or immunized with an immunogenic composition that was available prior to the present invention but were subsequently infected with a particular HIV infection .

In addition, the present invention provides a method of treating or preventing clinical symptoms caused by IBD in a subject in need, the method comprising administering to the subject a therapeutically effective amount of an immunogenic composition as described in the present invention.

The term treatment or prophylaxis refers to reducing the incidence of a particular EBV infection in a flock or reducing the severity of clinical signs caused by or associated with a particular EBV infection. Thus, the term treatment or prophylaxis also refers to a reduction in the number of individuals in a flock infected with a particular JIV infection (=reduction in the incidence of a particular JIV infection) or to a reduction in the severity of clinical signs typically associated with or caused by a JIV infection, or a reduction in viral shedding following infection by JIV , or preventing or reducing the decline in egg production in laying hens following infection with a particular HIV infection in a group of subjects where the subjects received an effective amount of an immunogenic composition as provided in the present invention, compared to a group of subjects who did not receive such an immunogenic composition.

- 12 045753

The term treatment or prophylaxis generally includes administering an effective amount of an immunogenic composition in accordance with the present invention to a subject or group of subjects in need of such treatment/prophylaxis or who would benefit from such treatment/prophylaxis. The term "treatment" refers to the administration of an effective amount of an immunogenic composition after a subject, or at least some of the subjects of the flock, have already been infected with such HIV infection and such subjects have already exhibited certain clinical signs caused by or associated with such infection. The term prophylaxis refers to administration to a subject prior to any infection of such subject by a VIV or at least when such subject or none of the subjects in a group of subjects exhibits any clinical signs caused by or associated with infection by such VDV. The terms prophylaxis and prevention are used interchangeably in this invention.

The term effective amount as used in the present invention means, but is not limited to, an amount of antigen that causes or is capable of causing an immune response in a subject. Such an effective amount is capable of reducing the frequency of a particular infection by FIV in a flock or reducing the severity of clinical signs of a particular infection of FIV.

Preferably, the clinical signs are reduced in frequency or severity by at least 10%, more preferably by at least 20%, even more preferably by at least 30%, even more preferably by at least 40%, even more preferably by at least by 50%, even more preferably by at least 60%, even more preferably by at least 70%, even more preferably by at least 80%, even more preferably by at least 90%, even more preferably by at least 95% and most preferably 100% compared to subjects who were either untreated or treated with an immunogenic composition that was available prior to the present invention but were subsequently infected with a particular HIV infection.

The term clinical signs as used in the present invention refers to the signs of infection of a subject by HIV infection. Clinical signs of infection depend on the pathogen chosen. Examples of such clinical signs include, but are not limited to, respiratory distress syndrome, nephritis, salphingitis, abnormal egg production, ruffled feathers, depression, decreased growth rate, and decreased appetite. Signs of respiratory distress include respiratory signs including choking, coughing, sneezing, tracheal wheezing, nasal and ocular discharge, tracheal lesions, and tracheal ciliostasis. Signs of nephritis include kidney damage and watery diarrhea. Signs of abnormal egg production include decreased egg production, smaller eggs, poor shells, decreased internal egg quality, eggs with thin whites, and ciliostasis in the oviduct. However, clinical signs also include, but are not limited to, clinical signs that are directly observed in a living animal. Examples of clinical signs that are directly observed in a living animal include nasal and eye discharge, cough, difficulty breathing, sneezing, tracheal wheezing, ruffled feathers, conjunctivitis, weight loss, decreased growth rate, decreased appetite, dehydration, watery diarrhea, lameness , lethargy, exhaustion and thinness, etc.

Preferably, clinical signs decreased in frequency or severity in a treated subject compared to subjects who were either untreated or treated with an immunogenic composition that was available prior to the present invention but subsequently became infected with a particular HIV infection relate to decreased ciliostasis, decreased wheezing, increasing egg production, reducing kidney damage, reducing watery diarrhea, reducing weight loss, reducing viral load, reducing the release of viruses or their combinations.

The term needy or necessary as used in the present invention means that the administration/treatment is associated with an increase or improvement in health status or clinical signs, or any other beneficial therapeutic effect on the health of subjects who receive the immunogenic composition in accordance with the present invention.

The term reduction, or reduced, or lower, or lower is used interchangeably in this invention. The term reduction means that the clinical symptom is reduced by at least 10%, more preferably by at least 20%, even more preferably by at least 30%, even more preferably by at least 40%, even more preferably by at least by 50%, even more preferably by at least 60%, even more preferably by at least 70%, even more preferably by at least 80%, even more preferably by at least 90%, even more preferably by at least 95% is most preferable to 100% compared to subjects who are not treated (not immunized) but are subsequently infected with a specific HIV infection.

In addition, the present invention provides a method of reducing ciliostasis in a subject in need compared to a subject from a non-immunized control group of the same species, the method comprising administering to the subject a therapeutically effective amount of an immunogenic composition as described in the present invention.

As shown in the examples, the immunogenic composition provided herein has been proven to be effective in reducing ciliostasis.

- 13 045753

The term ciliostasis refers to decreased movement of cilia in the trachea. Thus, ciliostasis can be determined by examining the inner lining of the tracheal rings for ciliary movement. One skilled in the art will know how to detect the movement of cilia in the trachea.

Preferably, ciliary movement does not decrease from day 10 after infection or infection, more preferably from day 5 after infection or infection, more preferably from day 4 after infection or infection, more preferably from day 3 after infection or infection, and most preferably from 1 or 2 days after challenge or infection with IDV compared with a non-immunized control subject of the same species.

The term reduced ciliostasis means that ciliostasis is reduced by at least 10%, preferably by at least 20%, more preferably by at least 30%, even more preferably by at least 40%, even more preferably by at least 50 %, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95 % and most preferably 100% compared to a non-immunized control subject of the same species. One skilled in the art will know how to measure the reduction of ciliostasis.

In one aspect of the present invention, said subject is a bird.

The concept of bird is well known to one skilled in the art. The term bird covers all birds, including poultry.

In one aspect of the present invention, the subject is poultry.

The concept of poultry is well known to one skilled in the art. The term poultry includes chickens, turkeys, quails, pheasants, guinea fowl, geese and ducks. Additionally, the term chicken includes broilers, laying hens and breeding stock for both as they are also considered breeding birds.

In one aspect of the present invention, the subject is selected from a list including chicken, turkey, quail or pheasant.

In one aspect of the present invention, said subject is a chicken.

In one aspect of the present invention, the immunogenic composition is administered once.

It is clear that a single dose is administered only once. As shown in the examples, the immunogenic composition provided herein was effective after a single dose was administered to a subject in need.

The dose volume per bird depends on the vaccination method and the age of the bird.

Typically, eye drop vaccines are administered in a volume of 1 to 100 µl per dose at any age. Preferably, a single dose of eye drop vaccines has a total volume of from about 5 to 70 μl, and more preferably from about 20 to 50 μl, with a preferred single dose of 20, 25, 30, 35, 40, 45 or 50 μl. Most preferably, a single dose of eye drop vaccines has a total volume of about 30 to 50 μl, with a single dose of 30, 35, 40, 45 or 50 μl being preferred.

Spray vaccines can contain dose volumes ranging from 25 to 1000 µl for poultry one day of age. Preferably, a single dose for spray vaccines has a total volume of from about 50 to 5000 μl, more preferably from about 75 to 2000 μl, more preferably from about 100 to 1000 μl, even more preferably from about 200 to 900 μl, even more preferably from about 300 to 800 µl and even more preferably from about 400 to 700 µl with a preferred single dose of 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675 or 700 µl. Most preferably, the unit dose has a total volume of 400, 450, 500, 550, 600, 650 or 700 μl.

The vaccine for in ovo vaccination may contain a dose volume of 50 to 100 μl, preferably 50 μl. Preferably, a single dose for in ovo vaccines has a total volume of from about 10 to 250 μl, more preferably from about 15 to 200 μl, even more preferably from about 20 to 150 μl, even more preferably from about 30 to 100 μl, even more preferably about from 30 to 75 µl and with a preferred single dose of 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75 µl. Most preferably, the single dose has a total volume of 40, 45, 50, 55 or 60 μl.

A vaccine for intramuscular or subcutaneous vaccination, or a single dose of vaccine for drinking water, may contain a dose volume of 30 to 1000 μl. Preferably, the total unit dose volume is from about 30 to 1000 μl, more preferably from about 50 to 500 μl, more preferably from about 75 to 250 μl, and even more preferably from about 100 to 200 μl, with the most preferred single dose being 100, 110, 120, 125, 130, 135, 140, 145, 150, 160, 170, 175, 180, 190, 155 or 200 µl.

In one aspect of the present invention, the immunogenic composition is administered in two or more doses.

However, the immunogenic composition can be administered in two or more doses, with the first dose administered before the second (booster) dose.

- 14 045753

In a preferred aspect of the double dosing regimen, both the first and second doses of the immunogenic composition are administered in equal amounts. Preferably, each dose is in the preferred amounts specified above. In addition to the first and second dosage regimens, an alternative embodiment includes additional subsequent doses. For example, in these aspects, a third, fourth, or fifth dose may be administered. Preferably, the subsequent third, fourth and fifth dosage regimens are administered in the same amount as the first dose, with the time frame between doses corresponding to the time between the first and second doses mentioned above.

Preferably, the first administration of the vaccine is carried out during the first three weeks of life, more preferably during the first week of life and most preferably at one day of age using the methods described below. The second administration can be carried out at the first 20 weeks of age, preferably at 16-18 weeks of age, more preferably at 6-12 weeks of age. For example, the initial (first) vaccination is carried out at the age of 1-10 days, and the second vaccination (booster) is carried out with a live or inactivated vaccine at the age of 6-12 or 16-18 weeks. More preferably, the initial (first) vaccination is given at one day of age, and the second vaccination (booster) is given with live or inactivated vaccine at 6-12 or 16-18 weeks of age.

When in ovo vaccination is used, preferably the first administration is carried out when the embryos are between 15 and 19 days old, preferably on day 17, 18 or 19, most preferably on embryonic day 18. The second administration can be carried out during the first three weeks of life, preferably during the first 10 days of life.

In one aspect of the present invention, said immunogenic composition is administered subcutaneously, intramuscularly, orally, in ovo, as a spray, in drinking water, or as eye drops.

The immunogenic composition is preferably administered locally or systemically. Suitable routes of administration commonly used are oral or parenteral administration, such as intranasal, intravenous, intradermal, transdermal, intramuscular, intraperitoneal, subcutaneous, as well as inhalation, in ovo, spray, drinking water or eye drops. . However, depending on the nature and mode of action of the compound, the immunogenic composition may also be administered by other routes. For example, such other routes include intradermal, intravenous, intravascular, intraarterial, intraperitoneal, intrathecal, intratracheal, intradermal, intracardial, intralobal, intralobar, intramedullary, intrapulmonary, intrarectal, and intravaginal. Most preferably, however, the immunogenic composition is administered subcutaneously, intramuscularly, orally, in ovo, as a spray, in drinking water, or as eye drops.

Live HIV vaccines are preferably administered individually as eye drops, intranasally, intramuscularly or subcutaneously.

It is more preferable to use mass application methods, including vaccination using drinking water and aerosol spraying. It is also preferable to use the vaccines as embryonic vaccines (so-called in ovo vaccines), as described below.

For example, broilers can be vaccinated at one day or 1-3 weeks of age, especially broilers with high MDA levels. Initially, laying hens or reproductive birds can be vaccinated at the age of 1-10 days and intensively vaccinated at the age of 7-12 or 16-18 weeks.

Introduction in ovo.

As stated above, the present invention also provides a vaccine against FIV that can be safely administered by in ovo route and at the same time is capable of inducing a protective immune response. In ovo administration is well known to one of ordinary skill in the art and such person can carry out in ovo administration without much effort. In ovo vaccination involves administering the vaccine to the avian embryo in the egg (for a review of in ovo vaccination, see Ricks et al., Advances in Vet. Med., 495-515, 1999). The vaccine can be administered to any suitable part of the egg (eg, allantoic fluid, yolk sac, amnion, air cell or embryo) as described in the prior art (Sharma, Am. J. Vet. Res., 45, 1619-1623, 1984). Preferably, the vaccine is administered under the tunica (air cavity) membrane and the chorioallantoic membrane.

Preferably, the vaccine is injected into embryonated eggs during the late embryonic stages, usually during the last quarter of the incubation period, preferably 3-4 days before hatching. Preferably, administration is carried out when the embryos are between 15 and 19 days old, preferably on days 17, 18 or 19, most preferably at 18 days of age. Subsequently, the vaccinated eggs with embryos are transferred to an incubator for hatching. The in ovo injection process can be automated using a robotic injection process as described in the prior art.

In general, conventional vaccines for post-hatch vaccination of poultry cannot be used for in ovo vaccination because late stage embryos are very susceptible to infection by most of the vaccine viruses tested. However, international patent application WO 01/64244 describes that vaccines against FIV can be used for in ovo administration, provided they are used in very low doses. In addition, Wakenell et al., 1986 (Am. J. Vet.

- 15 045753

Res., 47 933-938) describes that passage of IB vaccine virus in tissue culture rendered the virus apathogenic to embryos.

In one aspect of the present invention, said immunogenic composition is administered in the form of eye drops.

Typically, a live vaccine for post-incubation administration contains an attenuated VIB at a concentration of 101 to 108 _EID50 (50% egg challenge dose) per dose, preferably at a concentration of ¹⁰² to ¹⁰⁵ EID50 per dose, and more preferably at a concentration of 10 ² to 10 ⁴ EID50 per dose unit and even more preferably at a concentration of 10 ² to 103 EID ₅₀ per dose.

A live vaccine for in ovo administration typically contains an amount of attenuated VIV from 10 ² to 10 ⁷ EID50/embryo, preferably from 10 ² to 103 EID50/embryo in a volume of 50 to 100 μl, preferably 50 μl.

Preferably, the immunogenic composition in accordance with the present invention contains the VIB in accordance with the present invention in amounts of from about 1 to about 10 log ₁₀ EID (egg challenge dose) ₅₀ /ml per dose, preferably from about 2 to about 8 log ₁₀ EID ₅₀ per dose dose, preferably in an amount of about 2 to about 7 log ₁₀ EID ₅₀ per dose, more preferably in an amount of about 2 to about 6 log ₁₀ EID ₅₀ per dose, even more preferably in an amount of about 2 to about 5 log ₁₀ EID ₅₀ per dose, even more preferably in an amount of about 2 to about 4 log ₁₀ EID ₅₀ per dose, most preferably in an amount of about 2 to about 3 log ₁₀ EID ₅₀ per dose. More preferably, the immunogenic composition of the present invention contains the VIB of the present invention in amounts of about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, or log ₁₀ EID ₅₀ per dose.

In one aspect of the present invention, the immunogenic composition contains from 1 to 10 log ₁₀ EID ₅₀ per dose of VIB.

In one aspect of the present invention, the immunogenic composition contains from 2 to 5 log ₁₀ EID ₅₀ per dose of VIB.

In one aspect of the present invention, the immunogenic composition contains from 2 to 4 log ₁₀ EID ₅₀ per dose of VIB.

In one aspect of the present invention, the immunogenic composition is administered to subjects during the first week of life, during the first three days of life, during the first two days of life, or during the first day of life.

Preferably, the age of the subject to be immunized is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 days. More preferably, the age of said subject to be immunized is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 days. Most preferably, the age of the subject to be immunized is 1, 2, 3, 4, 5, 6 or 7 days.

However, it should be understood that after vaccination of a subject several days old, it does take several days for the poultry's immune system to develop immunity against FIV infection. Therefore, it is preferable that subjects are immunized within the first 24 hours of life.

In one aspect of the present invention, the immunogenic composition is administered to subjects during the first day of life. As shown in the examples, the immunogenic composition proposed in the present invention was safe and effective when administered to poultry at one day of age.

In one aspect of the present invention, the method results in an improvement in an effectiveness parameter selected from the group consisting of: preventing or reducing ciliostasis, preventing or reducing wheezing, preventing or reducing decreased egg production, preventing or reducing kidney damage, preventing or reducing watery diarrhea, preventing or reduced weight loss, reduced viral load, reduced viral shedding, or a combination thereof, compared to an untreated control subject of the same species.

The terms treatment and/or prophylaxis have been defined elsewhere, where the terms prophylaxis and prevention or prevention are used interchangeably in this invention. Additionally, the term allocation has also been defined elsewhere.

The term reduced, reduced, diminished or lower means that the effectiveness parameter (ciliostasis, wheezing, decreased egg production, kidney damage, watery diarrhea, weight loss, viral load, viral shedding) is reduced by at least 10%, preferably by at least 20%, more preferably at least 30%, even more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70 %, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95% and most preferably 100% compared to a non-immunized control subject of the same species. One skilled in the art will generally know how to measure improvements in performance parameters.

The term viral load is well known to one skilled in the art. In the present invention, the term viral load is used interchangeably with the term viral titer. Viral load or viral titer is a measure of the severity of an active viral infection and can be determined by methods known to one of ordinary skill in the art. Determination may be based on detection of viral proteins, such as antibody binding to viral proteins and further detection, or alternatively, detection of viral RNA by amplification methods such as RT-PCR. Monitoring virion-associated viral RNA in plasma using nucleic acid amplification techniques is a widely used parameter to assess the status and progression of retroviral disease, as well as to assess the effectiveness of preventive and therapeutic interventions. For example, viral load or virus titer can be calculated by estimating the amount of live virus in the affected body fluid, such as the number of RNA copies per milliliter of blood plasma.

The term ciliostasis is well known to those skilled in the art. The surface of the trachea is covered with special epithelial cells, which are lined with numerous mobile hair-like structures called cilia. The term ciliostasis includes reduction or loss of cilia and/or loss or partial loss of cilia activity. Ciliostasis can be determined without much difficulty by a specialist in the field.

The term wheezing is well known to one skilled in the art. However, the term rales covers crackles in the trachea and refers to sounds emanating from the bronchi. Wheezing can be identified without any problems by a person skilled in the field.

The term decreased egg production is well known to one skilled in the art. The term decreased egg production refers to a decrease in egg production.

In one aspect of the present invention, the treatment or prophylaxis results in the prevention or reduction of ciliostasis compared to untreated control subjects of the same species.

In one aspect of the present invention, the treatment or prophylaxis results in the prevention or reduction of kidney lesions compared to untreated control subjects of the same species.

In one aspect of the present invention, the treatment or prophylaxis prevents or reduces the decline in egg production compared to untreated control subjects of the same species.

In addition, the present invention provides a VIB or immunogenic composition as described in the present invention for therapeutic use.

In addition, the present invention provides a VIB or immunogenic composition as described in the present invention for use as an immunogen or vaccine.

In addition, the present invention provides a VIB or immunogenic composition as described in the present invention for use as a medicine.

In addition, the present invention provides for the use of a VIB or an immunogenic composition as described in the present invention for the manufacture of a medicament.

In addition, the present invention provides for the use of IPV or an immunogenic composition as described in the present invention for the treatment and/or prevention of IPV infections in a subject.

In addition, the present invention provides an immunogenic composition containing VIB H52 (infectious bronchitis virus), encoding a heterologous S (spike) protein or a fragment thereof, where said VIB H52 contains a nucleocaspid (N) protein, an envelope (E) protein or a membrane (M) protein ) a glycoprotein having the amino acid sequence as shown for SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, AY044185 (SEQ ID NO: 80), AF352310 (SEQ ID NO: 81), AF317210 (SEQ ID NO: 82) or AF286185 (SEQ ID NO: 83) or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity thereto, and wherein the heterologous S protein or fragment thereof is selected from a list of genotypes or serotypes including 4/91, QX, Q1, Arkansas, Option 2 and Brazil or from an amino acid sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

In another specific aspect of the immunogenic composition in accordance with the present invention, the heterologous S protein is a full-length spike protein.

In another specific aspect of the immunogenic composition of the present invention, the heterologous S (spike) protein fragment is at least 500, 750, 1000, or 1077 amino acids in length from the N-terminus.

In another specific aspect of the immunogenic composition of the present invention, the heterologous S (spike) protein fragment is an ectodomain of the spike protein.

In another specific aspect of the immunogenic composition in accordance with the present invention, the VIB is attenuated.

In addition, the present invention provides a method for preparing an immunogenic composition for

- 17 045753 treatment and/or prevention of HIV infections in a subject, including

a) providing an H52 VIB comprising a spike (S) protein, a nucleocapsid (N) protein, an envelope (E) protein, or a membrane (M) glycoprotein having the amino acid sequence as shown for SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, AF3 52315 (SEQ ID NO: 79), AY044185 (SEQ ID NO: 80), AF352310 (SEQ ID NO: 81), AF317210 (SEQ ID NO: 82) or AF286185 (SEQ ID NO: 83) or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99, 95, 99.98 or 99.99% identity with her; And

b) providing a heterologous S protein or fragment thereof selected from the list of genotypes or serotypes including 4/91, QX, Q1, Arkansas, Variant 2 and Brazil or from the amino acid sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16, or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it; And

c) replacing the spike protein or a fragment thereof with the H52 VIB from a) with the said heterologous S (spike) protein or a fragment thereof from b) to obtain the H52 VIB with the heterologous S protein or a fragment thereof; And

d) obtaining the specified VIB H52 with a heterologous S protein or a fragment thereof; And

d) adding a pharmaceutically acceptable carrier.

The term production includes the collection, isolation, purification and/or composition (eg, completion, inactivation and/or mixing) of the specified H52 VIB with a heterologous S protein or a fragment thereof.

The term collection refers to the collection or isolation of the specified H52 VIB with heterologous S protein or a fragment thereof from transfected or infected cells or cell line. Any conventional method known in the art may be used, for example any separation method. Methods well known in the art include centrifugation or filtration, for example the use of a semi-permeable membrane with a defined pore size.

The term isolation includes the step of isolating said H52 VIB with a heterologous S protein or a fragment thereof. Methods for isolation from transfected or infected cells or cell lines are known to one skilled in the art. These methods include physical and/or chemical methods, including, but not limited to, freeze-thaw cycles, sonication, and the like.

Methods for purifying said H52 VIB with heterologous S protein or a fragment thereof from an isolate are known to one skilled in the art, for example, by the methods described in Methods for Purifying Proteins - a Practical Approach (E.L.V. Harris, S. Angel, eds., IRL Press at Oxford University Press ). These methods include, but are not limited to, separation by centrifugation and/or filtration, precipitation, size exclusion chromatography (gel filtration) chromatography, affinity chromatography, metal chelate chromatography, ion exchange chromatography, covalent chromatography, hydrophobic interaction chromatography, and the like. The vector may be produced in purified pure form or without or substantially without other cellular materials or culture medium, etc. After said isolation and/or purification, the antigen exhibits at least 80% purity, preferably 80-90%, more preferably 90-97%, most preferably greater than 97% purity to an absolutely pure form without any contamination.

In a further aspect, the concept of preparation as used in the present invention may also include additional finishing steps as part of the final preparation process, such as buffer addition, inactivation steps, neutralization steps, and the like.

In another specific aspect of the method of producing an immunogenic composition in accordance with the present invention, the heterologous S (spike) protein fragment is an ectodomain of the spike protein.

In another specific aspect of the immunogenic composition in accordance with the present invention, said pharmaceutically acceptable carrier is selected from the group consisting of solvents, dispersion media, coatings, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption retardants, adjuvants, immunostimulants and their combinations.

In another specific aspect of the method of producing an immunogenic composition in accordance with the present invention, the heterologous S protein is the ectodomain of the spike protein.

In addition, the present invention relates to a plasmid containing a nucleic acid encoding a partial genome of IBV H52 (infectious bronchitis virus), including heterologous IBV S (spike) protein or a fragment thereof, such as the donor plasmid pUC57-s H52 rIBV CR88 S Ecto (SEQ ID NO: 21).

Items

The following items are also described in the present invention.

1. VIB H52 IBV (infectious bronchitis virus), encoding the heterologous S (spike) protein of IBV or its fragment.

2. Immunogenic composition containing VIB H52 (infectious bronchitis virus), encoding

- 18 045753 pure heterologous S (spike) protein or its fragment.

3. An immunogenic composition containing IBV (infectious bronchitis virus) according to claim 1.

VIB H52- Determination by protein coding sequences

4. The VIB or immunogenic composition according to any one of claims 1 to 3, wherein the H52 VIB has or consists of or contains a nucleotide sequence as shown for EU817497 (SEQ ID NO: 78) or a sequence having at least 95, 96, 97 , 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

5. VIB or immunogenic composition according to any one of claims 1 to 4, wherein strain VIB H52 has or consists of or contains a spike (S1) protein having the amino acid sequence as shown for AF352315 (SEQ ID NO: 79) or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

6. VIB or immunogenic composition according to any one of claims 1 to 5, wherein the VIB strain H52 has or consists of or contains a spike (S) protein having an amino acid sequence as shown in SEQ ID NO: 1 or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

7. The VIB or immunogenic composition according to any one of claims 1 to 6, wherein the H52 VIB has or consists of or contains a nucleocaspid (N) protein having the amino acid sequence as shown for AY044185 (SEQ ID NO: 80) or AF352310 (SEQ ID NO: 81) sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99, 98 or 99.99% identity with her.

8. The VIB or immunogenic composition according to any one of claims 1 to 7, wherein the H52 VIB has or consists of or contains a nucleocaspid (N) protein having an amino acid sequence as shown in SEQ ID NO: 2 or a sequence having at least 95 , 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

9. The VIB or immunogenic composition according to any one of claims 1 to 8, wherein the H52 VIB has or consists of or contains an envelope (E) protein having the amino acid sequence as shown for AF317210 (SEQ ID NO: 82) or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

10. The VIB or immunogenic composition according to any one of claims 1 to 9, wherein the H52 VIB has or consists of or contains an envelope (E) protein having an amino acid sequence as shown in SEQ ID NO: 3 or a sequence having at least 95 , 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

11. The VIB or immunogenic composition according to any one of claims 1 to 10, wherein the H52 VIB has or consists of or contains a membrane glycoprotein (M) protein having the amino acid sequence as shown for AF286185 (SEQ ID NO: 83) or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

12. The VIB or immunogenic composition according to any one of claims 1 to 11, wherein the H52 VIB has or consists of or contains a membrane glycoprotein (M) protein having an amino acid sequence as shown in SEQ ID NO: 4 or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

Heterologous S protein.

13. The HIV or immunogenic composition according to any one of claims 1 to 12, wherein the heterologous spike protein is of a genotype or serotype other than Massachusetts.

14. The HIV or immunogenic composition according to any one of claims 1 to 13, wherein the heterologous S protein or fragment thereof belongs to the HIV with a genotype or serotype selected from the list consisting of Arkansas (such as Arkansas 99), Brazil (such as BR- 1, BR-2, 23/2013, IBV/Brazil/351/1984), California (such as California 1734/04, California 99), Connecticut, Delaware (such as Delaware 98), Dutch (such as D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (such as Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holt, Iowa (such as Iowa 97 and Iowa 69), Italy (such as Italy 02), JMK, LDT3, Maine (such as Maine 209), Pennsylvania (such as Pennsylvania 1220/98, Pennsylvania Wolg/98), PL84084, Qu (such as Qu-mv), QX (such as GB341/96), Q1, SE 17, Option 2 (such as IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016) and 4/91 (793B, CR88).

15. VIB or immunogenic composition according to any one of claims 1 to 14, where the heterologous S protein or a fragment thereof comes from a VIB selected from the list of genotypes or serotypes, including 4/91, QX, Q1, Italy 02, Arkansas, Connecticut , Georgia, LDT3, PL84084, Option 2 or Brazil.

16. A VIB or immunogenic composition according to any one of claims 1 to 15, wherein the heterologous S protein or fragment thereof is derived from a VIB selected from the list of genotypes or serotypes including 4/91, QX, Q1, Arkansas, Option 2 and Brazil .

17. VIB or immunogenic composition according to claim 16, where strain 4/91 is selected from the list including Spain/98/328, Spain/92/35, IR-3654-VM, FR-CR88061-88, FR-85131 -85, UK-1233-95, UK/3/91, Spain/00/336, UK/7/91, 4/91-pathogenic, 4/91-attenuated, IB4-91 and CR88.

18. VIB or immunogenic composition according to claim 16, where the QX strain is selected from the list including FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV/Ck/SP /170/09, IBV/Ck/SP/79/08,

- 19 045753

IBV/Ck/SP/248/09, HBN, IBVQX, LX4, BJQ, CK/CH/LGD/03 and GB341/96.

19. VIB or immunogenic composition according to claim 16, where strain Q1 is selected from the list including CK/CH/LDL/98I, CK/CH/LSD/08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295 -10.

20. VIB or immunogenic composition according to claim 16, wherein the Arkansas strain is selected from the list including Ark99, ArkGA, ArkDPI, AL/5364/00, ARKDPI11, AL/0803/01, AL/7149/00, ArkDPI101, AL /1221/01, AL/1793/01 and AL/4614/98.

21. VIB or immunogenic composition according to claim 16, where strain Option 2 is selected from the list including IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016, Eg/CLEVB-2/IBV/012, Dl344/2/4/10_EG, TR8 and IB VAR2-06.

22. IBV or immunogenic composition according to claim 16, where the Brazil strain is selected from the list including: BR-1, BR-2, 23/2013 and IBV/Brazil/351/1984.

23. VIB or immunogenic composition according to any one of claims 1 to 22, where the heterologous S protein or its fragment belongs to the genotype or serotype.

24. VIB or immunogenic composition according to any one of claims 1 to 23, where the heterologous S protein or fragment thereof has a genotype or serotype of 4/91, having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 5 or 6 or a heterologous S protein or fragment thereof consists of or contains an amino acid sequence as shown in SEQ ID NO: 5 or 6 or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 , 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

25. VIB or immunogenic composition according to any one of claims 1 to 24, where the heterologous S protein or fragment thereof has a genotype or serotype QX having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 7 or 8 or heterologous The S protein or fragment thereof consists of or contains an amino acid sequence as shown in SEQ ID NO: 7 or 8 or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 ,2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

26. VIB or immunogenic composition according to any one of claims 1 to 25, where the heterologous S protein or fragment thereof has a Q1 genotype or serotype having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 9 or 10 or heterologous The S protein or fragment thereof consists of or contains an amino acid sequence as shown in SEQ ID NO: 9 or 10 or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 ,2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

27. VIB or immunogenic composition according to any one of claims 1 to 26, where the heterologous S protein or fragment thereof has an Arkansas genotype or serotype of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 11 or 12 or heterologous The S protein or fragment thereof consists of or contains an amino acid sequence as shown in SEQ ID NO: 11 or 12 or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 ,2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

28. VIB or immunogenic composition according to any one of claims 1 to 27, where the heterologous S protein or fragment thereof has a genotype or serotype of Option 2 having at least 90, 91, 92, 93, 94, 95, 96, 97, 98 , 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% sequence identity to SEQ ID NO: 13 or 14 or a heterologous S protein or fragment thereof consists of or contains an amino acid sequence as shown in SEQ ID NO: 13 or 14 or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with her.

29. VIB or immunogenic composition according to any one of claims 1 to 28, where the heterologous S protein or fragment thereof has a Brazil genotype or serotype having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98, or 99.99% sequence identity to SEQ ID NO: 15 or 16 or heterologous The S protein or fragment thereof consists of or contains an amino acid sequence as shown in SEQ ID NO: 15 or 16 or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 ,2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

30. VIB or immunogenic composition according to any one of claims 1 to 29, where the heterologous S protein or fragment thereof is selected from the list including SEQ ID NO: 5, 6, 7, 8, 9, 10, 11,12, 13 , 14, 15 or 16.

31. VIB or immunogenic composition according to any one of claims 1 to 30, where the heterologous S protein is a full-length spike protein.

32. VIB or immunogenic composition according to any one of claims 1 to 31, wherein the fragment of the heterologous S (spike) protein has a length of at least 500, 750, 1000 or 1077 amino acids.

33. The VIB or immunogenic composition according to any one of claims 1 to 32, wherein the fragment of the heterologous S (spike) protein has a length of at least 500, 750, 1000 or 1077 amino acids from the N-terminus.

34. VIB or immunogenic composition according to any one of claims 1 to 33, wherein the fragment of the heterologous S (spike) protein has a length of at least 1000 amino acids.

- 20 045753

35. The VIB or immunogenic composition according to any one of claims 1 to 34, wherein the fragment of the heterologous S (spike) protein is an ectodomain of the spike protein.

36. VIB or immunogenic composition according to any one of claims 1 to 35, where the heterologous S (spike) protein or fragment thereof replaces the homologous S protein or fragment thereof.

37. VIB or immunogenic composition according to any one of claims 1 to 36, wherein the heterologous S (spike) protein or fragment thereof replaces a naturally occurring S protein or fragment thereof.

38. VIB or immunogenic composition according to any one of claims 1 to 37, wherein the heterologous S (spike) protein or fragment thereof replaces the S protein or fragment thereof in H52.

39. VIB or immunogenic composition according to any one of claims 1-38, where VIB is attenuated.

40. VIB or immunogenic composition according to any one of claims 1-39, where VIB is inactivated.

41. VIB or immunogenic composition according to any one of claims 1-40, where VIB is genetically engineered.

42. VIB or immunogenic composition according to any one of claims 1-41, where VIB is a recombinant VIB.

43. An immunogenic composition according to any one of claims 2 to 42, where the immunogenic composition is a vaccine.

44. An immunogenic composition according to any one of claims 2 to 43, wherein the immunogenic composition contains a pharmaceutically acceptable carrier.

45. The immunogenic composition of claim 44, wherein the pharmaceutically acceptable carrier is phosphate buffered saline.

46. An immunogenic composition according to any one of claims 2 to 45, wherein the immunogenic composition is effective in treating and/or preventing clinical signs caused by IBD in a subject in need.

47. An immunogenic composition according to any one of claims 2 to 46, where the immunogenic composition protects against infection by a strain of HIV virus genotype or serotype of the heterologous spike protein.

48. The immunogenic composition according to any one of claims 2 to 47, where the immunogenic composition protects against infection by strains of genotype 4/91, QX, Q1, Arkansas Option 2 or Brazil.

49. Immunogenic composition according to any one of claims 2 to 48, where the immunogenic composition protects against infection by genotype 4/91 strains.

50. An immunogenic composition according to any one of claims 2 to 49, wherein said immunogenic composition is formulated for single administration.

51. An immunogenic composition according to any one of claims 2 to 50, wherein said immunogenic composition is administered subcutaneously, intramuscularly, orally, in ovo, as a spray, with drinking water or as eye drops.

52. The immunogenic composition according to any one of claims 2 to 51, where the immunogenic composition contains from 1 to 10 log ₁₀ EID ₅₀ per dose of VIB.

53. The immunogenic composition according to any one of claims 2 to 52, where the immunogenic composition contains from 2 to 5 log ₁₀ EID ₅₀ per dose of VIB.

54. The immunogenic composition according to any one of claims 2 to 53, where the immunogenic composition contains from 2 to 4 log ₁₀ EID ₅₀ per dose of VIB.

55. A kit containing VIB or an immunogenic composition according to any one of claims 1-54.

56. The kit according to claim 55, where the kit additionally contains instructions for the treatment and/or prevention of bird diseases.

57. The kit according to claim 55, where the kit additionally contains instructions for the treatment and/or prevention of diseases in poultry.

58. The kit according to claim 55, where the kit additionally contains instructions for the treatment and/or prevention of IB.

59. A method of immunizing a subject, comprising administering to such subject an immunogenic composition according to any one of claims 2 to 54.

60. A method of treating or preventing clinical signs caused by IBD in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an immunogenic composition according to any one of claims 2 to 54.

61. A method of reducing ciliostasis in a subject in need thereof, compared to a subject in a non-immunized control group of the same species, the method comprising administering to the subject a therapeutically effective amount of an immunogenic composition according to any one of claims 2 to 54.

62. An immunogenic composition according to any one of claims 2 to 54 for use in a method of immunizing a subject, comprising administering to the subject a therapeutically effective amount of said immunogenic composition.

63. An immunogenic composition according to any one of claims 2 to 54 for use in a method of treating or preventing clinical signs caused by IBD in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of said immunogenic composition.

64. An immunogenic composition according to any one of claims 2 to 54 for use in a method of reducing ciliostasis in a subject in need thereof compared to a non-immunized control subject

- 21 045753 group of the same type, the method comprising administering to a subject a therapeutically effective amount of said immunogenic composition.

65. The method or use according to any one of claims 59 to 64, wherein said subject is a bird.

66. The method or use according to any one of claims 59 to 65, wherein said subject is poultry.

67. The method or use according to any one of claims 59 to 66, wherein said subject is selected from the list including chicken, turkey, quail or pheasant.

68. The method or use according to any one of claims 59 to 67, wherein said subject is chicken.

69. Method or use according to any one of claims 59-68, where the immunogenic composition is administered once.

70. The method or use according to any one of claims 59 to 68, wherein the immunogenic composition is administered in two or more doses.

71. The method or use according to any one of claims 59-70, where the specified immunogenic composition is administered subcutaneously, intramuscularly, orally, in ovo, in the form of a spray, with drinking water or in the form of eye drops.

72. The method or use according to any one of claims 59 to 71, wherein said immunogenic composition is administered in the form of eye drops.

73. The method or use according to any one of claims 59-72, where the immunogenic composition contains from 1 to 10 log ₁₀ EID ₅₀ per dose of VIB.

74. The method or use according to any one of claims 59 to 73, wherein the immunogenic composition contains from 2 to 5 log ₁₀ EID ₅₀ per dose of VIB.

75. The method or use according to any one of claims 59 to 74, wherein the immunogenic composition contains from 2 to 4 log ₁₀ EID ₅₀ per dose of VIB.

76. The method or use of any one of claims 59 to 75, wherein the immunogenic composition is administered to subjects during the first week of life, during the first three days of life, during the first two days of life, or during the first day of life.

77. The method or use of any one of claims 59 to 76, wherein the immunogenic composition is administered to subjects during the first day of life.

78. The method or use according to any one of claims 59 to 77, where the said method leads to an improvement in an effectiveness parameter selected from the group consisting of preventing or reducing ciliostasis, preventing or reducing wheezing, preventing or reducing a decrease in egg production, preventing or reducing kidney damage , preventing or reducing watery diarrhea, preventing or reducing weight loss, reducing viral load, reducing viral shedding, or a combination thereof, compared to an untreated control subject of the same species.

79. The method or use of any one of claims 59 to 78, wherein the treatment or prophylaxis results in the prevention or reduction of ciliostasis compared to untreated control subjects of the same species.

80. The method or use of any one of claims 59 to 79, wherein the treatment or prophylaxis results in the prevention or reduction of kidney damage compared to untreated control subjects of the same species.

81. The method or use of any one of claims 59 to 80, wherein the treatment or prophylaxis results in the prevention or reduction of a decline in egg production compared to untreated control subjects of the same species.

82. VIB or immunogenic composition according to any one of claims 1-54 for therapeutic use.

83. VIB or immunogenic composition according to any one of claims 1-54 for use as an immunogen or vaccine.

84. VIB or immunogenic composition according to any one of claims 1-54 for use as a medicine.

85. Use of VIB or immunogenic composition according to any one of claims 1-54 for the manufacture of a medicinal product.

86. Use of an INV or immunogenic composition according to any one of claims 1 to 54 for the treatment and/or prevention of INV infections in a subject.

87. An immunogenic composition containing H52 IBV (infectious bronchitis virus) encoding a heterologous S (spike) protein or a fragment thereof, where said IBV H52 contains a nucleocaspid (N) protein, an envelope (E) protein or a membrane glycoprotein (M) having or consisting of or containing the amino acid sequence as shown for SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, AY044185 (SEQ ID NO: 80), AF352310 (SEQ ID NO: 81), AF317210 (SEQ ID NO: 82) or AF286185 (SEQ ID NO: 83) or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it, and where the heterologous S protein or fragment thereof is selected from a list of genotypes or serotypes, including

- 22 045753 self 4/91, QX, Q1, Arkansas, Option 2 and Brazil or from the amino acid sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity thereto or a heterologous S protein or fragment thereof consists of or contains the amino acid sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16, or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99, 6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it.

88. The immunogenic composition according to claim 87, wherein the heterologous S protein is an ectodomain of the spike protein.

89. The immunogenic composition of claim 87, wherein the heterologous S (spike) protein fragment is at least 500, 750, 1000 or 1077 amino acids in length from the N-terminus.

90. The immunogenic composition of claim 87 or 89, wherein the heterologous S (spike) protein fragment is an ectodomain of the spike protein.

91. Immunogenic composition according to any one of paragraphs 87-90, where the VIB is attenuated.

92. A method for producing an immunogenic composition for the treatment and/or prevention of HIV infections in a subject, including

a) providing an H52 VIB comprising a spike (S) protein, a nucleocapsid (N) protein, an envelope (E) protein, or a membrane glycoprotein (M) having or consisting of or containing the amino acid sequence as shown for SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, AF352315 (SEQ ID NO: 79), AY044185 (SEQ ID NO: 80), AF352310 (SEQ ID NO: 81), AF317210 (SEQ ID NO: 82) or AF286185 (SEQ ID NO: 83) or a sequence having at least 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99, 9, 99.95, 99.98 or 99.99% identity with her; And

b) providing a heterologous S protein or fragment thereof selected from the list of genotypes or serotypes including 4/91, QX, Q1, Arkansas, Variant 2 and Brazil or from the amino acid sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16, or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity therewith or providing a heterologous S protein or fragment thereof consisting of or containing the amino acid sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 or a sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identity with it; And

c) replacing the spike protein VIB H52 from a) with the specified heterologous S (spike) protein or a fragment thereof from b) to obtain VIB H52 with a heterologous S protein or a fragment thereof; And

d) obtaining the specified VIB H52 with a heterologous S protein or a fragment thereof; And

d) adding a pharmaceutically acceptable carrier.

93. The method of claim 92, wherein the heterologous S (spike) protein fragment is an ectodomain of the spike protein.

94. The method according to claim 92 or 93, where the specified pharmaceutically acceptable carrier is selected from the group consisting of solvents, dispersion media, coatings, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption retardants, adjuvants, immunostimulants and their combinations.

95. The method according to any one of claims 92 or 94, wherein the heterologous S protein is an ectodomain of a spike protein.

Brief description of the figures

In fig. Figure 1 shows the in ovo replication kinetics for H52 rIBV CR88 S ecto compared to recombinant wild-type viruses H52 and CR88. Data points represent the average of 5 samples per time point. Error bars indicate standard deviation.

In fig. Figure 2 shows a summary of the assessment of ciliostasis. The sum of 10 individual scores for 10 rings of one animal is calculated and displayed on the graph as one point. Maximum ciliostasis is represented by a score of 40, while no ciliostasis is represented by a score of 0. Mean and significance are calculated using GraphPad Prism and a conventional one-way ANOVA test (p<0.007).

In fig. Figure 3 shows a summary of the RT-qPCR results of kidney tissues. Each individual bird is represented by one data point.

In fig. Figure 4 shows a summary of RT-qPCR results from choanal swab eluates. Each individual bird is represented by one data point.

In fig. Figure 5 shows a summary of the assessment of ciliostasis. The sum of 10 individual scores for 10 rings of one animal is calculated, which is displayed on the graph as one point. Maximum ciliostasis is represented by a score of 40, while no ciliostasis is represented by a score of 0. Mean and significance are calculated using GraphPad Prism and a conventional one-way ANOVA test (p<0.0001).

Sequence overview

SEQ ID NO: 1: spike (S) protein VIB H52.

- 23 045753

SEQ ID NO: 2: VIB H52 nucleocapsid (N) protein.

SEQ ID NO: 3: envelope (E) protein VIB H52.

SEQ ID NO: 4: membrane (M) glycoprotein protein VIB H52.

SEQ ID NO: 5 and 6: heterologous S protein or fragment thereof from genotype or serotype 4/91.

SEQ ID NO: 7 and 8: heterologous S protein or fragment thereof from genotype or serotype QX.

SEQ ID NO: 9 and 10: heterologous S protein or fragment thereof from genotype or serotype Q1.

SEQ ID NO: 11 and 12: heterologous S protein or fragment thereof from the Arkansas genotype or serotype.

SEQ ID NO: 13 and 14: heterologous S protein or fragment thereof from genotype or serotype Option 2.

SEQ ID NO: 15 and 16: heterologous S protein or fragment thereof from genotype or serotype Brazil.

SEQ ID NO: 17: nucleic acid sequence encoding the VIB spike protein CR88.

SEQ ID NO: 18: nucleic acid sequence encoding the spike ectodomain of H52 VIB

SEQ ID NO: 19: donor plasmid pUC57-s H52 rIBV.

SEQ ID NO: 20: nucleic acid sequence encoding the VIB CR88 spike ectodomain.

SEQ ID NO: 21: donor plasmid pUC57-s H52 rIBV CR88 S Ecto.

SEQ ID NO: 22 - SEQ ID NO: 77: primer.

SEQ ID NO: 78: EU817497 (nucleotide sequence of VIB H52).

SEQ ID NO: 79: AF352315 (amino acid sequence of S protein VIB H52).

SEQ ID NO: 80: AY044185 (amino acid sequence of N protein VIB H52).

SEQ ID NO: 81: AF352310 (amino acid sequence of N protein VIB H52).

SEQ ID NO: 82: AF317210 (amino acid sequence E of VIB H52 protein).

SEQ ID NO: 83: AF286185 (amino acid sequence of M protein VIB H52).

SEQ ID NO: 84 and SEQ ID NO: 85: primer.

Examples

The following examples are presented to illustrate specific embodiments of the present invention. These examples are merely illustrative and are not intended to limit the scope or principles of the present invention.

Example 1. Creation of a recombinant H52 VIB in which the sequence encoding the H52 spike protein or the ectodomain of the spike protein is replaced with a sequence encoding a heterologous spike protein or the ectodomain of the spike protein.

Construction of donor plasmid.

An example of replacing the ectodomain of the H52 spike protein with the CR88 ectodomain is described in detail: the nucleic acid sequence encoding the CR88 spike protein VIB (SEQ ID NO: 17) was synthesized by a commercial supplier. It is used as a template to replace the nucleic acid sequence encoding the ectodomain of the IBV H52 spike protein (SEQ ID NO: 18) in the donor plasmid pUC57-s IBV-5-1b-S-SIR-3T, described by van Beurden et al. (Virol J., 2017, 14(1):109), hereinafter referred to as the donor plasmid pUC57-s H52 rIBV (SEQ ID NO: 19). Bases 1717-4941 of SEQ ID NO: 19 are replaced by the corresponding nucleic acid sequence encoding the ectodomain of the VIB spike protein CR88 (SEQ ID NO: 20), which corresponds to bases 55-3285 of SEQ ID NO: 15, respectively. This creates the donor plasmid pUC57-s H52 rIBV CR88 S Ecto (SEQ ID NO: 21), in which the ectodomain of the CR88 IBV spike protein is encoded by bases 1717-4947. To do this, the donor plasmid pUC57-s H52 rIBV (SEQ ID NO: 19) is cleaved using unique restriction sites 5' (EcoRV) and 3' (PmlI), close to the sequence encoding the H52 spike protein, to linearize the plasmid and remove the spike protein H52 and flanking sequences. The QIAquick Gel Extraction Kit (Qiagen) is used to purify the band corresponding to the pUC57-s IBV H52 backbone without the H52 spike protein coding sequence. The nucleic acid sequence encoding the ectodomain of the CR88 spike protein and the 5' and 3' flanking sequences of the H52 VIB were amplified in three separate PCR reactions using Q5® High Fidelity DNA Polymerase (NEB; see primers in Table 1). PCR products were purified using QIAquick gel extraction (Qiagen) and used for Gibson assembly using the NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the kit protocol to generate the donor plasmid pUC57-s H52 rIBV CR88 S Ecto.

Table 1

Gibson assembly primers designed by NEB using the NEBuilder online tool and used to generate PCR products for assembly of the donor plasmid pUC57-s H52 rIBV CR88 S Ecto

PCR Product Primer 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO:22) tatcatagagcaaagcactacatagtgcacac (SEQ ID NO:23)

- 24 045753

Ectodomain actatgtagtgctttgctctatgataataatacttacg (SEQ ID NO 24) 2 SPIKE PROTEIN CR88 cataccaaggccatttaatataagttttgagaattgagag (SEQ NO:25) ID 3 H52 3' flanking region aacttatattaaatggccttggtatgtgtgg (SEQ ID NO:26) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc ID NO:27) (SEQ

Targeted RNA recombination and rescue of recombinant VIB To create recombinant VIB, a targeted RNA recombination method is used, as described by van Beurden et al. (Virol J., 2017, 14(1): 109). Briefly, murinized (m)VIB H52 was prepared as described. To generate H52 rIBV CR88 S Ecto, LR7 cells were infected with H52 mVIB and electroporated with in vitro transcript derived from the donor plasmid pUC57-s H52 rIBV CR88 S Ecto and then injected into 8-day-old SPF hen eggs with SPF embryos (VALO BioMedia) . After 9 days of incubation at 37.5°C and 60% humidity, the allantoic fluids of all eggs were analyzed separately to rescue recombinant HIV after RNA isolation using the QIAamp Viral RNA e Mini Kit (Qiagen) and Superscript™ III One-Step OT -PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO1323 and PO1729 are used, which bind the H52 IBV lab and CR88 IBV S ectodomain (Table 2), specific for recombinant VIB, but not for mVIB. Positive allantoic fluid from eggs inoculated with maximal dilution LR7 cells was collected for two final dilution series in 8-day-old SPF eggs. Isolation of nucleic acids from limiting dilution samples is performed using the MagMAX™ Nucleic Acid Core Purification Kit (ThermoFisher) with the KingFisher™ Duo Prime Purification System (ThermoFisher) and then analyzed for the presence of rVIB using RT-PCR described above. After the second maximum dilution, the allantoic fluid of the eggs inoculated at the maximum dilution is used for propagation in 10-day-old SPF embryonated chicken eggs. Allantoic fluid is diluted 1:1000 in 1xPBS and 100 µl is injected per egg. Allantoic fluid is collected 48 hours after inoculation, cleared of debris and stored at -80°C. To confirm the sequence obtained from the donor plasmid in the created rVIB, viral nucleic acids are isolated using the QIAamp viral RNA mini kit followed by one-step Superscript III RT-PCR using the primers listed in Table. 3, QIAquick PCR purification and subsequent Sanger sequencing with the same primers performed by a commercial supplier.

table 2

Primers for identification of recombinant VIB after rescue

Name Subsequence Region Amplicon [bp] PO1323 TCAGCATGGACGTGTGGTTA (SEQ ID NO:28) lab -970 PO1729 aggttggcacctatatgggg (SEQ ID NO:29) Spike protein

Table 3

Sequencing primers to confirm the sequence of the donor region in H52 rIBV CR88 S Ecto

PCR Name Subsequence Region Amplicon [bp] 1 RO765 tgacttggtttgaagatggc (SEQ ID NO:30) Pol lab 904 PO730 aagagatgttggtaacacct (SEQ ID NO:31) Pol lab 2 RO706 gacagagcacaagtttgatc (SEQ ID NO:32) Pol lab 1044 RO1409 ggagtgaaaacaagatcacc (SEQ ID NO:33) S 3 RO1398 aatttaacagttagcgtatc (SEQ ID NO:34) S 801 RO1410 tttgtatacgagagccatca (SEQ ID NO:35) S 4 RO1399 ggtcctactagatgtaaggg (SEQ ID NO:36) S 809 RO1411 ctctctttgacctacaccat (SEQ ID NO:37) S 5 PO1400 ttgccttcagtatgtttgtg (SEQ ID NO:38) S 803 RO1412 agtgaagaaagtctacctgt (SEQ ID NO:39) S 6 RO1401 atttcctccgtacttcaaga (SEQ ID NO:40) S 786 RO1413 tgaagataataatggcaaaagc (SEQ ID NO:41) S 7 RO1402 tcttgaaacactctcaattct (SEQ ID NO:42) S 1471 RO715 ggtcaccagtatatttctgc (SEQ ID NO:43) M 8 PO710 ggtcaacaatgtaattttgct (SEQ ID NO:44) 5ab 958 RO734 cttgtcctgctttgttaaga (SEQ ID NO:45) 5ab 9 RO1405 ttataggttggcttgtacgc (SEQ ID NO:46) 5ab 1025 RO716 gcccatccttaataccttcc (SEQ ID NO:47) N 10 RO759 ctcgcattacaaaggctaag (SEQ ID NO:48) N 1123 RO719 gctctaactctatactagcct (SEQ ID NO:49) 3'-UTR

Creation and characterization of recombinant H52 VIB, in which the sequence encoding the spike protein or the ectodomain of the H52 spike protein is replaced by a sequence encoding the spike protein or the ectodomain of the spike protein from another VIB genotype.

The same methods described for the generation of H52 rIBV CR88 S Ecto are used to generate and characterize recombinant H52 IBV in which the spike protein coding sequence (bases 1663 to 5151 in SEQ ID NO: 19) or the H52 spike protein ectodomain (bases 1717 to 4941 SEQ ID NO: 19) is replaced by sequences encoding the spike proteins or ectodomains of the spike proteins of the VIB serotypes and genotypes listed in table. 4.

Table 4

Primers used for Gibson assembly of donor plasmids rVIB H52 with heterologous spike protein or ectodomain of the spike protein

Spike protein PCR Product Primer CR88 S SEQ ID NO: 5 1 H52 5' flanking section cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO:22) gtttgtccaacatctcttaccagtaacttacc (SEQ ID NO:50) 2 CR8 8S ttactggtaagagatgttggacaaaccgcttttac (SEQ ID NO:51) ggactttggatcattaaacagactttttaggtctgtattg (SEQ ID NO:52) 3 H52 3' flanking region aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO:53) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO:27) QX S SEQ ID NO: 7 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO:22) acttcaccaacatctcttaccagtaacttacc (SEQ ID NO:54) 2 QX S ttactggtaagagatgttggtgaagtcactg (SEQ ID NO:55) ggactttggatcattaaacagactttttaggtctg (SEQ ID NO:52) 3 H52 3' flanking region aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO:53) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO:27) QX S Ecto SEQ ID NO: 8 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO:22) aatcaaacaaattagcactacatagtgcacac (SEQ ID NO:56) 2 QX S ecto actatgtagtgctaatttgtttgattctgataataattatg (SEQ ID NO:57) cataccaaggccacttaatataagttttaattattgaaagttcttc (SEQ ID NO:58) 3 H52 3' flanking region aacttatattaagtggccttggtatgtgtgg (SEQ ID NO:59) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO:27) QI S SEQ ID NO: 9 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatg (SEQ ID NO:60) acttccccaacatctcttaccagtaacttacc (SEQ ID NO:61) 2 Ql S ttactggtaagagatgttggggaagtcactg (SEQ ID NO:62) ggactttggatcattaaacagactttttaggtctg (SEQ ID NO:52) 3 H52 3' flanking region aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO:53) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaag (SEQ ID NO:63) QI S Ecto SEQ ID NO: 10 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO:22) tatcaaacaaagcagcactacatagtgcacac (SEQ ID NO:64) 2 Ql S Ecto actatgtagtgctgctttgtttgataataatgaaac (SEQ ID NO:65) cataccaaggccattaatataagtcttgagtattgaaag (SEQ ID NO:66) 3 H52 3' flanking region gacttatattaaatggccttggtatgtgtgg (SEQ ID NO:67) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO:27) Ark S SEQ ID NO 11 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatg (SEQ ID NO:60) acttcaccaacatctcttaccagtaacttacc (SEQ ID NO:54) 2 Ark S ttactggtaagagatgttggtgaagtcactg (SEQ ID NO:55) ctttggatcattaaacagactttttaggtctg (SEQ ID NO:84) 3 H52 3' flanking region gtctgtttaatgatccaaagtcccactag (SEQ ID NO:85) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaag (SEQ ID NO:63) Ark S Ecto SEQ ID NO 12 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO:22) tgtcatataaattagcactacatagtgcacac (SEQ ID NO:68) 2 Ark S Ecto actatgtagtgctaatttatatgacaacgaatcttttg (SEQ ID NO:69) cataccaaggccacttaatataagttttgagtattgaaag (SEQ ID

- 26 045753

NO:70) 3 H52 3' flanking region aacttatattaagtggccttggtatgtgtgg (SEQ ID NO:59) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO:27) Option 2 S SEQ ID NO 13 1 H52 5' flanking section cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatg (SEQ ID NO:60) acttcaccaacatctcttaccagtaacttacc (SEQ ID NO:54) 2 Option 2 S ttactggtaagagatgttggtgaagtcactg (SEQ ID NO:55) ggactttggatcattaaacagactttttaggtctg (SEQ ID NO:52) 3 H52 3' flanking region aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO:53) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaag (SEQ ID NO:63) Option 2 S Ecto SEQ ID NO 14 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO:22) tatcaaacagagcagcactacatagtgcacac (SEQ ID NO:71) 2 Option S Ecto actatgtagtgctgctctgtttgataataatcag (SEQ ID NO:72) cataccaaggccacttaatataagttttaattattgaaagttcttc (SEQ ID NO:58) 3 H52 3' flanking region aacttatattaagtggccttggtatgtgtgg (SEQ ID NO:59) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO:27) Brazil S SEQ ID NO 15 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatg (SEQ ID NO:60) gttgaaccaacatctcttaccagtaacttacc (SEQ ID NO:73) 2 BR-l S ttactggtaagagatgttggttcaacctcttttac (SEQ ID NO:74) ggactttggatcattaaacagactttttaggtctg (SEQ ID NO:52) 3 H52 3' flanking region aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO:53) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaag (SEQ ID NO:63) Brazil S Ecto SEQ ID NO 16 1 H52 5' flanking region cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO:22) tattgtacaaagaagcactacatagtgcacac (SEQ ID NO:75) 2 BR-l S Ecto actatgtagtgcttctttgtacaataatgatagctatg (SEQ ID NO:76) cataccaaggccatttaatataagtttttaaaatagaaagtgtttc (SEQ ID NO:77) 3 H52 3' flanking region aacttatattaaatggccttggtatgtgtgg (SEQ ID NO:26) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO:27)

Primers in table. 2 and 3 are used to identify and sequence various recombinant viruses and, if necessary, adapt to the corresponding spike protein sequence.

Example 2. Kinetics of IN OVO replication.

Eight eight-day-old embryonated chicken eggs are inoculated with 102 EID50 rVIB and appropriate controls. The eggs are incubated at 37.5°C, 60% humidity and candled daily at 0, 8, 24, 34, 48 and 72 hours after inoculation, and embryo death is recorded. Five pre-selected eggs per sample and at a given time are removed and transferred to 4°C for at least 2 hours. Subsequently, the allantoic fluid is collected and stored at -80°C. For analysis, samples are thawed and diluted 1:10 in 1xPBS without Ca and Mg, and nucleic acids are extracted with a QIAamp DNA Blood Mini kit (Qiagen) supplemented with carrier RNA using a Hamilton Starlet robot pipette. Extracted nucleic acids were analyzed by RT-qPCR for relative amounts of IPV RNA with a protocol adapted from Callison et al. (J. Virol. Methods., 2006, 138(l-2):60-5). Briefly, the same primers and probe are used, and the thermoprofile is adapted for use with the TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the ABITM 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific). All nucleic acid samples were analyzed in triplicate using a series of 10-fold dilutions of H52 VIB as reference.

For H52 rIBV CR88 S Ecto, compared with wild-type recombinant viruses H52 and CR88, slightly similar replication kinetics were observed at early time points. However, after 32 h, all viruses reach comparable control values. All embryos are alive 32 h postinoculation, while at 48 h postinoculation all remaining embryos are dead for all samples. Therefore, replication of H52 rIBV CR88 S ecto is considered to be as efficient as that of wild-type viruses (see Fig. 1).

Example 3. Preparation of vaccine and virus for infection.

To demonstrate the effectiveness of rVIB H52 with heterologous spike protein or spike protein ectodomain in chickens, an aliquot of the parent virus was thawed and diluted 10-fold in 1xPBS to determine the 50% embryo infectious dose (EID ₅₀ ) by inoculating 100 μl onto five 8-day-old chicken eggs. with embryos for breeding. The eggs are incubated at 37.5°C,

- 27 045753 humidity 60% until 7 days after inoculation. Eggs with dead embryos are excluded from the experiment after 24 hours. All other eggs with dead embryos 7 days after inoculation are considered positive. All eggs with live embryos are candled from below 7 days after inoculation to identify dwarfs considered positive. EID ₅₀ /ml is calculated using the formula of Reed and Muench (Am. J. Epidemiol., 1938, 27(3):493-497). For vaccination, the starting viral material is diluted in 1xPBS to obtain a titer of 10 ⁴ ' ³ EID ₅₀ /ml (103 EID50 per chicken in 50 μl).

Challenge viruses for genotypes and serotypes 793B, QX, Q1, Ark, Option 2 and Brazil are propagated in SPF eggs with 10-day embryos. 24 hours after inoculation, eggs are transferred to 4°C for at least 2 hours. Allantoic fluid is collected, aliquoted and stored at -80°C. The virus titer was determined as described above. The titer is set to 10 ⁴ ' ³ to 10 ⁵ ' ³ EID ₅₀ /ml by dilution with 1xPBS (10 to 10 ⁴ EID50 per chicken in 50 µl).

Example 4. Determination of vaccine effectiveness.

Fertilized SPF eggs are incubated for 18 days in a setter at 99.7°F and 50% humidity at 1 revolution per hour. On day 18 of incubation, eggs are candled and fertilized eggs are transferred to a hatcher and incubated at 99°F and 70% humidity until hatching. Chicks without clinical signs or deformities are randomly assigned to the appropriate treatment groups and transferred to separate isolation rooms. At least two chickens serve as a strict negative control (SNC) group, five chickens are included in a challenge control (CC) group, and at least 10 chickens are included in groups that are vaccinated with recombinant IPV with heterologous spike protein or ectodomain of the spike protein and subsequently infected. Animals are kept in conditions that comply with local and national animal welfare regulations. The light mode is set to 16 hours of light per day. Food and water are provided without restrictions. After transfer to the isolation room, chicks (one day old) are vaccinated with 103 EID50 per chick by eye drops (total volume 50 µl, 25 µl per eye, while the SNC and CC groups remain untreated. 21 days after vaccination, chicks from CC and vaccinated groups are challenged with 103 to 10 ⁴ EID50 per chicken of the corresponding challenge strain with homologous spike protein (793B, QX, Q1, Ark, Variant 2 or Brazil) by eye drops (total volume 50 μl, 25 μl per eye).After 7 days after infection, all chicks are sacrificed, choanae are swabbed, kidneys are removed and stored in RNAlater stabilizing solution (ThermoFisher) at 4°C for HIB-specific RT-qPCR analysis, tracheas are also removed and transferred to 50 ml tubes with warm water. cell culture medium.The tracheas are then cleared of connective tissue and washed with cell culture medium.The tracheas are cut into tracheal rings using a Mcllwain tissue chopper set to a slice thickness of 0.6-0.8 mm. On the trachea, three rings in the upper part, four rings in the middle part and three rings in the lower part are analyzed for ciliary beating using light microscopy and ciliostasis is assessed (see Table 5). The ring is considered normal if more than 50% of the inner ring shows strong cilia movement (score 2 or lower). The ring is considered positive for ciliostasis if less than 50% of the cilia beat (score 3 and 4). For the VIB-specific RT-qPCR assay, kidney tissue pieces are warmed to room temperature and transferred into separate 2 mL Precellys tubes that are filled with medium and PBS, respectively. The kidneys were homogenized using a Precellys® tissue homogenizer (Bertin Instruments) for 1x20 s at 6800 rpm. Choanal swabs are eluted in 2 ml 1xPBS. Nucleic acids were isolated from 200 μl of eluate and tissue homogenate, respectively, using the MagMAX™ Nucleic Acid Core Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher). RT-qPCR was performed as described above for in ovo kinetics, except using the StepOnePlus™ Real-Time PCR System (ThermoFisher) for analysis in duplicate.

Table 5

Assessment of ciliostasis in tracheal rings

Example 5. Efficiency of recombinant VIB H52 encoding a heterologous spike protein or the ectodomain of a spike protein.

The purpose of the study is to demonstrate that vaccination with recombinant FIV H52 (gentotype Mass), encoding the heterologous heterologous spike protein or its fragment, can

- 28 045753 is able to provide protection against infection by a strain with a homologous styloid protein.

An analysis was carried out to determine whether recombinant VIB H52, encoding the ectodomain of the VIB spike protein CR88 (genotype 4/9), can provide protection against infection by the virulent strain 793B (genotype 4/91), which is considered a homologous infection for the ectodomain encoded by the spike protein of VIB CR88 and as a heterologous infection, taking into account the core of the H52 VIB. All chickens are examined daily for clinical signs. After vaccination or infection, no clinical signs are recorded. Back titration for vaccination with H52 rIBV CR88 S Ecto at 1 day of age results in a titer of 104.13 EID ₅₀ /ml (target 10 ^4.3 EID50 /ml) and 10 ^4.69 EID50 /ml (target 10 ^4.3 EID ₅₀ /ml) for the 793B challenge virus, applied 21 days after vaccination, respectively. Ciliostasis was assessed as described above and the results are shown in FIG. 2 and summarized in table. 6.

Table 6

Summary of ciliostasis assessment data for protection at 28 days post-vaccination and 7 days post-challenge

Group Vaccine Infection Average ciliostasis score Not damaged [%] 1 - - 0.83 100 2 - 793B 32.9 20 3 H52 rIBV CR88 S Ecto 793B 10.64 82

The average ciliostasis score for each group is calculated by adding the sum of the scores of individual chicks per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0). An animal is considered healthy if at least 9 out of 10 rings show normal cilia activity.

All animals in the strict negative control group show normal cilia movements, while all animals in the challenge control group have a positive effect of ciliostasis. In contrast, 82% of animals vaccinated with H52 rIBV CR88 S Ecto are protected. In addition, the viral load in the kidneys of animals vaccinated with H52 CR88 S Ecto is reduced compared to animals from the control group (Figs. 3 and 4).

In addition, it was analyzed whether the recombinant H52 INV, encoding the QX INV spike protein, could provide protection against infection by the virulent D388 QX strain, which is considered as a homologous infection for the encoded INV QX spike protein and as a heterologous infection, given the H52 INV backbone. All chickens are examined daily for clinical signs. After vaccination or infection, no clinical signs are recorded. Back titration for vaccination with H52 rIBV QX S at 1 day of age results in a titer of 10 _EID50 /ml, while QX vaccines exceed a titer of 10 ⁵ EID50/ml (target 10 EID50/ml). A titer of 10 ^4.83 EID50/ml (target 10 ^4.3 EID ₅₀ /ml) was determined for the D388 QX challenge virus applied 21 days after vaccination, respectively. Ciliostasis was assessed as described above and the results are shown in FIG. 5 and summarized in table. 7.

Table 7

Summary of ciliostasis assessment data for protection at 28 days post-vaccination and 7 days post-challenge

Group Vaccine Infection Average ciliostasis score Not damaged [%] 1 - - 0 100 2 - D388 QX 38.4 0 3 Vaccine QX D388 QX 3.5 100 3 H52 rIBV QX S D388 QX 5.9 100

The average ciliostasis score for each group is calculated by adding the sum of the scores of individual chicks per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0). An animal is considered healthy if at least 9 out of 10 rings show normal cilia activity.

All animals in the strict negative control group exhibit normal cilia movement, while all animals in the challenge control group are positive for ciliostasis. In contrast, 100% of animals vaccinated with H52 rIBV QX S or QX vaccine are protected.

Similar results were obtained with other H52 rVIBs with heterologous spike proteins or spike protein ectodomains.

The results highlight the suitability of VIB 4/91 strains as a strong scaffold for the generation of recombinant VIB with heterologous spike protein and show excellent results, particularly when compared to prior art data for the Beaudette VIB scaffold.

Claims (15)

1. Genetically engineered H52 infectious bronchitis virus (IBV), encoding a heterologous IBV S (spike) protein, at least 90% identical to the sequences of SEQ ID NO: 5-16. 2. An immunogenic composition containing a genetically engineered H52 VIB encoding a heterologous S (spike) protein, at least 90% identical to the sequences of SEQ ID NO: 5-16. 3. Immunogenic composition containing genetically engineered H52 VIB according to claim 1. 4. Genetically engineered H52 HIV infection or immunogenic composition according to any one of claims 1 to 3, where the heterologous S protein belongs to an HIV infection with a genotype or serotype selected from the list consisting of Arkansas (such as Arkansas 99), Brazil (such as BR -1, BR-2, 23/2013, IBV/Brazil/351/1984), California (such as California 1734/04, California 99), Connecticut, Delaware (such as Delaware 98), Dutch (such as D207, D212 , D274, D3128, D3896, D8880, D1466), Florida, Georgia (such as Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holt, Iowa (such as Iowa 97 and Iowa 69) , Italy (such as Italy 02), JMK, LDT3, Maine (such as Maine 209), Pennsylvania (such as Pennsylvania 1220/98, Pennsylvania Wolg/98), PL84084, Qu (such as Qu-mv), QX (such as as GB341/96), Q1, SE 17, Option 2 (such as IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016) and 4/91 (793B , CR88). 5. Genetically engineered H52 HIV infection or immunogenic composition according to any one of claims 1-4, where the heterologous S protein comes from an HIV infection selected from the list of genotypes or serotypes, including 4/91, QX, Q1, Arkansas, Option 2 and Brazil. 6. Genetically engineered H52 HIV infection or immunogenic composition according to any one of claims 1 to 5, where the heterologous S protein is selected from the list of genotypes or serotypes, including 4/91, QX, Q1, Arkansas, Option 2 and Brazil or consists of or contains an amino acid sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16, or a sequence of at least 90, 91, 92, 93 , 94, 95, 96, 97, 98, 99, 99.2, 99.5, 99.6, 99.7, 99.8, 99.9, 99.95, 99.98 or 99.99% identical with her. 7. Genetically engineered H52 VIB or immunogenic composition according to any one of claims 1 to 6, where the heterologous S protein is a full-length spike protein. 8. Genetically engineered H52 VIB or immunogenic composition according to any one of claims 1-7, where H52 VIB is attenuated or H52 VIB is a recombinant VIB. 9. Immunogenic composition according to any one of claims 2 to 8, where the immunogenic composition is a vaccine. 10. A kit for the treatment or prevention of infectious bronchitis, containing H52 VIB or an immunogenic composition according to any of claims 1-9. 11. A method of immunizing a subject, comprising administering to such subject an immunogenic composition according to any one of claims 2 to 9. 12. A method of treating or preventing clinical signs caused by IBD in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an immunogenic composition according to any one of claims 2 to 9. 13. A method of reducing ciliostasis in a subject in need thereof compared to a non-immunized control subject of the same species, which comprises administering to the subject a therapeutically effective amount of an immunogenic composition according to any one of claims 2 to 9. 14. Method according to any one of paragraphs. 11-13, wherein said subject is poultry. 15. The method according to any one of claims 11 to 14, where the said method leads to an improvement in an effectiveness parameter selected from the group consisting of preventing or reducing ciliostasis, preventing or reducing wheezing, preventing or reducing decreased egg production, preventing or reducing kidney damage, preventing or a reduction in watery diarrhea, prevention or reduction of weight loss, reduction in viral load, reduction in viral shedding, or a combination thereof, compared with an untreated control subject of the same species.