EA045602B1 - COMPLEMENT COMPONENT COMPONENT COMPOSITIONS BASED ON iRNA AND METHODS OF THEIR APPLICATION - Google Patents

Description

List of sequences

This application includes a sequence listing that was filed electronically in ASCII format and is therefore incorporated herein by reference in its entirety. The listed ASCII copy of the file, created on December 11, 2014, is named 121301-01120_SL.txt and is 266080 bytes in size.

Related applications

This application claims benefit from U.S. Provisional Patent Application No. 61/915,210, filed December 12, 2013, the entire contents of which are incorporated herein by reference.

State of the art

Complement was first discovered in the 1890s when heat-stable antibodies present in normal serum were found to promote or complete killing of bacteria (Walport, M.J. (2001) N Engl J Med. 344:1058). The complement system consists of more than 30 proteins that are either present as soluble proteins in the blood or present as membrane-associated proteins. Activation of complement leads to a sequential cascade of enzymatic reactions known as the complement activation pathway, resulting in the formation of the potent anaphylatoxins C3a and C5a, which cause a variety of physiological reactions ranging from chemoattraction to apoptosis. Complement was originally thought to play an important role in innate immunity, resulting in the establishment of a robust and rapid response against invading pathogens. However, it has recently become increasingly clear that complement also plays an important role in adaptive immunity with the participation of T and B cells, which help in the elimination of pathogenic microorganisms (Dunkelberger J.R. and Song W.C. (2010) Cell Res. 20: 34; Molina H., et al. (1996) Proc Natl Acad Sci USA. 93:3357), in maintaining immunological memory, preventing pathogen re-infection, and has been implicated in numerous human pathological conditions (Qu, H., et al. (2009) Mol Immunol. 47:185; Wagner, E. and Frank M. M. (2010) Nat Rev Drug Discov. 9:43).

As is known, complement activation occurs through three different pathways: alternative, classical and lectin (Fig. 1), which involve proteins that mainly exist as inactive proenzymes, which are then sequentially cleaved and activated.

The classical pathway is often activated by antibody-antigen complexes or C-reactive protein (CRP), both of which interact with the complement component C1q. In addition, the classical pathway can be activated by phosphatidylserine present in apoptotic bodies in the absence of immune complexes.

The lectin pathway is initiated by mannose-binding lectins (MBLs), which bind to complex carbohydrate residues on the surface of pathogens. Activation of the classical pathway or lectin pathway leads to activation of (C4b2b) C3 convertase.

The alternative pathway is activated by the binding of C3b, which is spontaneously formed upon hydrolysis of C3, on target surfaces. This surface-bound C3b is then recognized by factor B, forming the C3bB complex. The C3bB complex is in turn cleaved by factor D to produce the active form of C3 convertase in AP (C3bBb). Both types of C3 convertases will cleave C3 to form C33. C3b then either binds to new factor B, enhancing complement activation via AP (the so-called alternative or amplification loop), or leads to the formation of active C5 convertase (C3bBbC3b or C4bC2bC3b), which cleaves C5 and triggers further events that result in the formation of a membrane attack agent. complex (MAC) (C5b-9).

Inappropriate activation of the complement system is responsible for the propagation and/or occurrence of pathology in many different diseases, including, for example, paroxysmal nocturnal hemoglobinuria, atypical hemolytic uremic syndrome, rheumatoid arthritis, ischemic reperfusion injury and neurodegenerative diseases.

To date, only one therapeutic agent that specifically targets the C5-C5a axis is available for the treatment of complement component diseases, the anti-C5 antibody eculizumab (Soliris®). Although eculizumab has been shown to be effective for the treatment of paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), and is currently being evaluated in clinical trials for additional complement-related diseases, eculizumab therapy requires high-dose weekly infusions , followed by biweekly maintenance infusions at high cost. Moreover, approximately 50% of eculizumab-treated subjects with PNH have low rates of hemolysis and require residual blood transfusions (Hill A., et al. (2010) Haematologica 95(4):567-73). Accordingly, there is a need in the art for alternative therapies and combination therapies for subjects with complement-related disease.

Brief description of the invention

The present invention provides iRNA-based compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts

- 1,045,602 CFB gene. The CFB gene may be located in a cell, such as a cell of a subject such as a human.

The present invention also provides iRNA compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of C3 gene RNA transcripts. The C3 gene may be present in a cell, such as a cell of a subject such as a human.

In addition, the present invention provides iRNA-based compositions that affect the RNA-induced silencing complex (RISC)-mediated cleavage of C9 gene RNA transcripts. The C9 gene may be present in a cell, such as a cell of a subject such as a human.

The present invention also provides methods and combination therapies for treating a subject with a disorder that would benefit from inhibition or reduction of CFB, C3 and/or C9 gene expression, for example a complement component disorder such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), using iRNA-based compositions that target RNA-induced silencing complex (RISC)-mediated cleavage of CFB, C3 and/or C9 gene RNA transcripts to inhibit CFB, C3 and/or C9 gene expression .

Accordingly, in one aspect, the present invention provides double-stranded ribonucleic acids (dsRNA) for inhibiting the expression of complement factor B (CFB) in a cell, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the sense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any of the nucleotide sequences of SEQ ID NOs: 1-5, 27 and 30, and the antisense strand contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any of the nucleotide sequences of SEQ ID NOs: 12-16, 33 and 36.

In another aspect, the present invention provides double-stranded ribonucleic acids (dsRNA) for inhibiting the expression of complement factor B (CFB) in a cell, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity that contains at least 15 contiguous nucleotides that differ no more than 3 nucleotides from any of the antisense sequences given in table. 3 and 4.

In one embodiment, the sense and antisense strands contain sequences selected from the group consisting of AD-60304, AD-60331, and AD-60344, and any of the agents listed in table. 3 and 4.

In one embodiment, the region of complementarity consists of a nucleotide sequence with one of the antisense sequences from any of the tables. 3 and 4.

In one embodiment, the dsRNA comprises a sense strand consisting of a nucleotide sequence with a sense strand sequence selected from a sequence in any of the tables. 3 and 4, and an antisense strand consisting of the nucleotide sequence of an antisense sequence selected from sequences from any of the tables. 3 and 4.

In another aspect, the present invention provides double-stranded ribonucleic acids (dsRNA) for inhibiting the expression of complement component C3 in a cell, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the sense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from either nucleotide sequences SEQ ID NOs: 6-8, 28 and 31, and the antisense strand contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any of the nucleotide sequences SEQ ID NOs: 17-19, 34 and 37.

In yet another aspect, the present invention provides double-stranded ribonucleic acids (dsRNA) for inhibiting the expression of complement component C3 in a cell, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity that contains at least 15 contiguous nucleotides that differ by no more than than 3 nucleotides from any of the antisense sequences given in table. 5 and 6.

In one embodiment, the sense and antisense strands comprise sequences selected from the group consisting of AD-60169 and any of the agents listed in Table 1. 5 and 6.

In one embodiment, the region of complementarity consists of a nucleotide sequence with one of the antisense sequences from any of the tables. 5 and 6.

In one embodiment, the dsRNA comprises a sense strand consisting of a nucleotide sequence with a sense strand sequence selected from a sequence in any of the tables. 5 and 6, and an antisense strand consisting of the nucleotide sequence of an antisense sequence selected from sequences from any of the tables. 5 and 6.

In yet another aspect, the present invention provides double-stranded ribonucleic acids (dsRNA) for inhibiting the expression of complement component C9 in a cell, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the sense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any from nucleotide sequences SEQ ID NOs: 9-11, 29 and 32, and the antisense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any of the nucleotide sequences

- 2 045602 items SEQ ID NO: 20-22, 35 and 38.

In yet another aspect, the present invention provides double-stranded ribonucleic acids (dsRNA) for inhibiting the expression of complement component C9 in a cell, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand contains a region of complementarity that contains at least 15 contiguous nucleotides that differ by no difference. more than 3 nucleotides from any of the antisense sequences given in table. 7 and 8.

In one embodiment, the sense and antisense strands contain sequences selected from the group consisting of any of the agents listed in table. 7 and 8.

In one embodiment, the region of complementarity consists of a nucleotide sequence with one of the antisense sequences from any of the tables. 7 and 8.

In one embodiment, the dsRNA comprises a sense strand consisting of a nucleotide sequence with a sense strand sequence selected from a sequence in any of the tables. 7 and 8, and an antisense strand consisting of the nucleotide sequence of an antisense sequence selected from sequences from any of the tables. 7 and 8.

The dsRNA may include at least one modified nucleotide, e.g., a 2'-Omethyl-modified nucleotide, a 5'-phosphorothioate group-containing nucleotide, a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl-modified nucleotide, 2'fluoro-modified nucleotide, 2'-deoxy-modified nucleotide, terminal nucleotide linked to a cholesterol derivative or dodecanoic acid bisdecylamide group, 2'deoxy-2'-fluoro-modified nucleotide, locked nucleotide, open nucleotide, conformationally restricted nucleotide, hindered ethyl nucleotide, baseless nucleotide, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'- O-alkyl-modified nucleotide, morpholino-nucleotide, phosphoramidate, nucleotide containing unnatural bases, tetrahydropyran-modified nucleotide, 1,5-anhydrohexite-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide containing phosphorothioate group, nucleotide containing methylphosphonate group, nucleotide , containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In one embodiment, substantially all of the nucleotides of the sense strand and antisense strand are modified nucleotides. In another embodiment, all nucleotides of the sense strand and antisense strand are modified nucleotides.

The complementarity region may be at least 17 nucleotides in length, such as 19 nucleotides, or no more than 30 nucleotides.

The complementarity region can be from 19 to 21 nucleotides in length.

The at least one dsRNA strand may include a 3' overhang of at least 1 nucleotide or at least 2 nucleotides.

The dsRNA may further include a ligand. In one embodiment, the ligand is conjugated to the 3' end of the sense strand of the dsRNA. In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative. In one embodiment, the ligand is

AcHN

HoV--p7v ^o ·

AcHN

In one embodiment, the dsRNA is conjugated to a ligand, as shown in the following diagram:

- 3 045602

and where X represents O or S.

In one embodiment, X is O.

In yet another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement factor B (CFB) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding CFB, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense:

5' np -Na -(X X X) i-Nb -Y Y Y -Nb -(Ζ Ζ Z)j -Na

- nq 3' antisense: 3' n _p '-Na'-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')iN _a 'n _q '5' (III) where each of i, j, k and l is independently equal to 0 or 1;

each of p, p', q and q' is independently equal to 0-6;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of np, np', nq and nq', each of which may or may not be present, is independently an overhanging nucleotide;

each of XXX, YYY, ZZZ, X'X'X', YYY and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides;

Nb modifications are different from Y modifications, and Nb' modifications are different from Y' modifications; and wherein the sense strand is conjugated to at least one ligand.

In yet another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 3 (C3) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C3, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense:

antisense:

5' np -Na -(X X X) i-Nb -Y Y Y -Nb -(Ζ Ζ Z)j -Na - nq 3'

3' n _p '-Na'-(X'X'X') _k -N _b '-Y'Y'Y'-Nb'-(Z'Z'Z')i-Na'- n _q ' 5 '(Ш) where each of i, j, k and l is independently equal to 0 or 1;

each of p, p', q and q' is independently equal to 0-6;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of np, np', nq and nq', each of which may or may not be present, is independently an overhanging nucleotide;

- 4 045602 each of XXX, YYY, ZZZ, X'X'X', YYY and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides;

modifications Nb differ from modification Y, and modifications Nb' differ from modification

Y'; and wherein the sense strand is conjugated to at least one ligand.

In a further aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 9 (C9) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III): sense: 5' pr -Na -(XXX) i-Nb -YYY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p -N _a '-(X'X'X') _k -Nb'-YYY'-Nb'-(Z'Z'Z')iN _a '- n _q '5' (ΙΠ) where each of i, j, k and l is independently equal to 0 or 1; each of p, p', q and q' is independently equal to 0-6;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of np, np', nq and nq', each of which may or may not be present, is independently an overhanging nucleotide;

each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides;

Nb modifications are different from Y modifications, and Nb' modifications are different from Y' modifications; and wherein the sense strand is conjugated to at least one ligand.

In one embodiment, i is 0; j equals 0; i equals 1; j equals 1; both i and j are 0 or both i and j are 1.

In one embodiment, k is 0; l equals 0; k equals 1; l equals 1; both k and l are 0; or both k and l equal 1.

In one embodiment, XXX is complementary to X'X'X', YYY is complementary to Y'YY', and ZZZ is complementary to Z'Z'Z'.

In one embodiment, the YYY motif is located at or adjacent to a sense strand cleavage site.

In one embodiment, the Y'Y'Y' motif is located at positions 11, 12, and 13 of the antisense strand from the 5' end.

In one embodiment, Y' is 2'-O-methyl.

In one embodiment, formula (III) is represented by formula (IIIa) sense: 5'np-Na-Y Y Y-Na - nq 3' antisense: 3' n _P '-N _a '- ΥΎΎ'- N _a '- n _q - 5' (Sha).

In one embodiment, formula (III) is represented by formula (IIIb):

Isense: 5' np -Na -YYY -Nb -ZZZ -Na - nq 3' antisense: 3' n _P '-N _a '- YY'Y'-Nb'-Z'Z'Z'- N _a '- n _q '5' (IIIb) where each Nb and Nb' independently represents an oligonucleotide sequence containing 1-5 modified nucleotides.

In one embodiment, formula (III) is represented by formula (IIIc) Isense: 5' np -Na -XXX -Nb -YYY -Na - nq 3' antisense: 3'n _P '-N _a '-Χ'Χ'Χ' -Νκ-ΥΎΥ-N _a '-n _q -5' (IIIc) where each N _b and N _b ' independently represents an oligonucleotide sequence containing 1-5 modified nucleotides. According to yet another embodiment, formula (III) is represented by formula (IIId) sense: 5' np -Na -XX X- Nb -YYY -Nb -Ζ Ζ Z -Na nq 3' antisense: 3' n _P '-N _a - X'X'X'- Nb'-Y'Y'Y'-Nb'-Z'Z'Z'- N _a '- n _q - 5' where each N _b and N _b ' independently represents an oligonucleotide sequence, containing 1-5 modified nucleotides, and each N _a and N _a ' independently represents an oligonucleotide sequence containing 2-10 modified nucleotides.

- 5 045602

The double-stranded region may be 15-30 bp, 17-23 bp, 17-25 bp, 23-27 bp, 19-21 bp, or 21-23 bp in length.

In one embodiment, each strand contains 15-30 nucleotides.

In one embodiment, the nucleotide modifications are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2 '-deoxy, 2'-hydroxyl and their combinations.

In another embodiment, the nucleotide modifications are 2'-O-methyl or 2'-fluoro modifications.

In one embodiment, the ligand is one or more GalNAc derivatives linked via a divalent or trivalent branched linker.

In one embodiment, the ligand is

In one embodiment, the ligand is attached to the 3' end of the sense strand.

In one embodiment, the RNAi agent is conjugated to a ligand, as shown in the following diagram

and where X represents O or S.

In one embodiment, X is O.

In one embodiment, the agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3' end of one strand. In one embodiment, the strand is an antisense strand. In another embodiment, the circuit is a semantic circuit.

In yet another embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5' end of one strand. In one embodiment, the strand is an antisense strand. In another embodiment, the circuit is a semantic circuit.

In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at both the 5' and 3' ends of one strand. In one embodiment, the strand is an antisense strand.

In one embodiment, the base pair at position 1 of the 5' end of the antisense strand of the duplex is the AU base pair.

In one embodiment, the Y nucleotides have a 2'-fluoro modification.

In one embodiment, the Y' nucleotides have a 2'-O-methyl modification.

In one embodiment, p'>0. In another embodiment, p'=2.

In one embodiment, q'=0, p=0, q=0, and the overhanging nucleotides p' are complementary to the target mRNA.

In another embodiment, q'=0, p=0, q=0, and the overhanging nucleotides p' are not complementary to the target mRNA.

In one embodiment, the sense strand contains a total of 21 nucleotides and the antisense strand contains a total of 23 nucleotides.

In one embodiment, at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond. In yet another embodiment, all n _p ' are linked to adjacent nucleotides via phosphorothioate bonds.

In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in Table. 3 and 4. In one embodiment, the RNAi agent is selected from the group of RNAi agents AD-60304, AD-60331 and AD-60344.

In another embodiment, the RNAi agent is selected from the group of RNAi agents listed in Table. 5 and 6.

In yet another embodiment, the RNAi agent is selected from the group of RNAi agents listed in Table. 7 and 8.

In one aspect, the present invention provides double-stranded RNAi agents, including the RNAi agents listed in any of Tables. 3, 5 and 7.

In one aspect, the present invention provides compositions comprising a modified antisense polynucleotide agent. The agents are capable of inhibiting the expression of complement factor B (CFB) in a cell and include a sequence complementary to a sense sequence selected from the group of sequences shown in table. 3, wherein the polynucleotide is from about 14 to about 30 nucleotides in length.

In another aspect, the present invention provides compositions containing a modified antisense polynucleotide agent. The agents are capable of inhibiting the expression of complement component 3 (C3) in a cell and include a sequence complementary to a sense sequence selected from the group of sequences given in table. 5, wherein the polynucleotide is from about 14 to about 30 nucleotides in length.

In yet another aspect, the present invention provides compositions containing a modified antisense polynucleotide agent. The agents are capable of inhibiting the expression of complement component 9 (C9) in a cell and include a sequence complementary to a sense sequence selected from the group of sequences given in table. 7, wherein the polynucleotide is from about 14 to about 30 nucleotides in length.

In one aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement factor B (CFB) in a cell. The agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding CFB, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

semantic:

antisense:

5' pr -Na -(X X X) i-Nb -Y Y Y -Nb -(Ζ Ζ Z)j -Na - nq 3'

3' n _p '-Na'-(X'X'X') _k -Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')iN _a '- n _q '5' ( III) where each of i, j, k and l is independently equal to 0 or 1;

each of p, p', q and q' is independently equal to 0-6;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof; each of np, np', nq and nq', each of which may or may not be present, is independently an overhanging nucleotide;

each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b differ from modification Y, and modifications N _b ' differ from modification

Y'; and wherein the sense strand is conjugated to at least one ligand.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement factor B (CFB) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding CFB, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense:

antisense:

5' pr -Na -(X X X) i-Nb -Y Y Y -Nb -(Ζ Ζ Z)j -Na - nq 3'

3'np'-Na'-(X'X'X') _k -Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')i-Na'- n _q '5' ( _Sh )

- 7 045602 where each of i, j, k and l is independently equal to 0 or 1; each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide;

each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', YYY' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'- fluorine modifications;

modifications N _b differ from modification Y, and modifications N _b ' differ from modification Y'; and wherein the sense strand is conjugated to at least one ligand.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement factor B (CFB) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding CFB, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense: 5' np -Na -(XXX) i-Nb -Υ YY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-Na'-(X'X'X')kN _b '- YYY'-N _b '-(Z'Z'Z')iN _a '- n _q '5' (Ш) where each of i, j, k and l is independently equal to 0 or 1; each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b differ from modification Y, and modifications N _b ' differ from modification Y'; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In yet another additional aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement factor B (CFB) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding CFB, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III)

Isense: 5' np -Na -(XXX) i-Nb -Υ YY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-Na'-(X'X'X' )kN _b '-YYY'-N _b '-(Z'Z'Z')iN _a '- n _q '5' (III) where i, j, k and l are each independently equal to 0 or 1; each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' is independently an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in different ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', ΥΎΎ' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'- fluorine modifications;

modifications N _b differ from modification Y, and modifications Nb' differ from modification Y';

wherein the sense strand contains at least one phosphorothioate bond; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement factor B (CFB) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding CFB, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III)

Isense: 5' n _p -N _a -YYY - N _a - n _q 3' antisense: 3' n _p '-N _a '- Y'Y'Y'- N _a '- n _q '5' (Sha) wherein each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

each of YYY and Y'Y'Y' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-O-methyl or 2'-fluoro modifications;

wherein the sense strand contains at least one phosphorothioate bond; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In one aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 3 (C3) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C3, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense: 5' np -Na -(XXX) i-Nb -YYY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-N _a '-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')iN _a - n _q '5' (u) where each of i, j, k and l is independently equal to 0 or 1;

each of p, p', q and q' is independently equal to 0-6;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof; each of np, np', nq and nq', each of which may or may not be present, is independently an overhanging nucleotide;

each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b differ from modification Y, and modifications N _b ' differ from modification Y'; and wherein the sense strand is conjugated to at least one ligand.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 3 (C3) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C3, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III)

Isense: 5' pr -Na -(XXX) i-Nb -YYY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-Na'-(X'X'X') k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')i-Na'- n _q '5' (Ш) where each of i, j, k and l is independently equal to 0 or 1; each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', ΎΎΎ' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'- fluorine modifications;

modifications Nb differ from modification Ύ, and modifications Nb' differ from modification Ύ'; and wherein the sense strand is conjugated to at least one ligand.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 3 (C3) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C3, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense: 5' np -Na -(XXX) i-Nb -YYY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-N _a '-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')iN _a '- n _q '5' (Ш) where each of i, j, k and l is independently equal to 0 or 1; each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, ΎΎΎ, ZZZ, X'X'X', Ύ'Ύ'Ύ' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b differ from modification Ύ, and modifications N _b ' differ from modification Ύ'; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In yet another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 3 (C3) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C3, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense: 5' np -Na -(XXX) i-Nb -YYY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-N _a '-(X'X'X') _k -Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')iN _a '- n _q '5' (Ш) where each of i, j, k and l is independently equal to 0 or 1; each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' is independently an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', ΎΎΎ' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'- fluorine modifications;

modifications N _b differ from modification Ύ, and modifications N _b ' differ from modification Ύ';

wherein the sense strand contains at least one phosphorothioate bond; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In one aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 3 (C3) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C3, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III)

Isense: 5' n _p -N _a -YYY - N _a - n _q 3' antisense: 3' n _p '-N _a '- Y'Y'Y'- N _a '- n _q '5' (Sha) wherein each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

each of ΎΎΎ and ΎΎΎ' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-O-methyl or 2'-fluoro modifications;

wherein the sense strand contains at least one phosphorothioate bond; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 9 (C9) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense: 5' np -Na -(XXX) i-Nb -Υ YY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-N _a '-(X'X'X') _k -Nb '-Y'Y'Y'-Nb'-(Z'Z'Z')iN _a '- n _q '5' (Ш) where each of i, j, k and l is independently equal to 0 or 1;

each of p, p', q and q' is independently equal to 0-6;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of np, np', nq and nq', each of which may or may not be present, is independently an overhanging nucleotide;

each of XXX, ΎΎΎ, ZZZ, X'X'X', Ύ'Ύ'Ύ' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b differ from modification Ύ, and modifications N _b ' differ from modification Ύ'; and wherein the sense strand is conjugated to at least one ligand.

In one aspect, the present invention provides double-stranded RNAi agents for

- 11 045602 inhibition of expression of complement component 9 (C9) in the cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense: 5' -Na -(XXX) i-Nb -Υ YY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-N _a '-(X'X'X')k-Nb '-Y'Y'Y'-Nb'-(Z'Z'Z')iN _a '- n _q '5' where each of i, j, k and l is independently equal to 0 or 1; each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' is independently an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', ΎΎΎ' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'- fluorine modifications;

modifications N _b differ from modification Ύ, and modifications N _b ' differ from modification Ύ'; and wherein the sense strand is conjugated to at least one ligand.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 9 (C9) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III) sense: 5' np -Na -(XXX) i-Nb -YYY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-N _a '-(X'X'X')k-Nb'-YYY'-Nb'-(Z'Z'Z')iN _a '- n _q '5' (Ш) where each of i, j, k and l is independently equal to 0 or 1; each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, ΎΎΎ, ZZZ, X'X'X', Ύ'Ύ'Ύ' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b differ from modification Ύ, and modifications N _b ' differ from modification Ύ'; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 9 (C9) in a cell. The agents comprise a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III): sense: 5' np -Na -(XXX) i-Nb -Υ YY -Nb -(Ζ Ζ Z)j -Na - nq 3' antisense: 3' n _p '-N _a '-(X'X'X')k- Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')iN _a '- n _q '5' (Ш) where each of i, j, k and l is independently equal to 0 or 1; each of np, nq, and nq', each of which may or may not be present, is independently an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

Nb and Nb' are each independently an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', YYY and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro - modifications;

Nb modifications are different from Y modifications, and Nb' modifications are different from Y' modifications;

wherein the sense strand contains at least one phosphorothioate bond; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In a further aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component 9 (C9) in a cell. The agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III)

Isense: 5' n _p -N _a -YYY - N _a - n _q 3' antisense: 3' n _p '-N _a '- ΥΎΎ'- N _a '- n _q '5' (Sha) where each of np , nq, and nq', each of which may or may not be present, independently represents an overhanging nucleotide; each of p, q and q' is independently equal to 0-6; np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

each of YYY and Y'Y'Y' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-O-methyl or 2'-fluoro modifications;

wherein the sense strand contains at least one phosphorothioate bond; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement factor B (CFB) in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand contains at least 15 contiguous nucleotides differing by no more than less than 3 nucleotides from the nucleotide sequence of any of SEQ ID NOs: 1-5, 27 and 30, and the antisense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any of the nucleotide sequences of SEQ ID NO: 12-16, 33 and 36, wherein substantially all of the nucleotides of the sense strand contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, wherein the sense strand contains two phosphorothioate internucleotide bonds at the 5' end, wherein substantially all of the nucleotides of the antisense strand contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, wherein the antisense strand contains two phosphorothioate internucleotide bonds at the 5' end and two phosphorothioate internucleotide bonds at the 3' end, and wherein the sense strand is conjugated to one or more GalNAc derivatives attached via a branched divalent or trivalent linker at the 3' end.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component C3 in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides. from the nucleotide sequence of any of SEQ ID NOs: 6-8, 28 and 31, and the antisense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any of the nucleotide sequences of SEQ ID NOs: 17-19, 34 and 37 , where almost everything is made of nucleotides

- 13 045602 sense strand contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, where the sense strand contains two phosphorothioate internucleotide bonds at the 5' end, where substantially all of the nucleotides of the antisense strand contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, where the antisense strand contains two phosphorothioate internucleotide bonds at the 5' end and two phosphorothioate internucleotide bonds at the 3' end, and wherein the sense strand is conjugated to one or more GalNAc derivatives attached via a branched divalent or trivalent linker at the 3' end.

In yet another aspect, the present invention provides double-stranded RNAi agents for inhibiting the expression of complement component C9 in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of any of SEQ ID NOs: 9-11, 29 and 32, and the antisense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any of the nucleotide sequences of SEQ ID NOs: 20-22, 35 and 38, wherein substantially all of the nucleotides of the sense strand contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, wherein the sense strand contains two phosphorothioate internucleotide bonds at the 5' end, wherein substantially all of the nucleotides of the antisense strand contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, where the antisense strand contains two phosphorothioate internucleotide bonds at the 5' end and two phosphorothioate internucleotide bonds at the 3 '-end, and where the sense strand is conjugated to one or more GalNAc derivatives attached via a branched divalent or trivalent linker at the 3' end.

In one embodiment, all nucleotides of the sense strand and all nucleotides of the antisense strand contain modifications.

In another aspect, the present invention provides cells containing the agents of the present invention.

In one aspect, the present invention provides vectors encoding at least one chain in the agents of the present invention.

In another aspect, the present invention provides cells containing vectors of the present invention.

In one aspect, the present invention provides pharmaceutical compositions for inhibiting complement factor B gene expression comprising agents of the present invention.

In another aspect, the present invention provides pharmaceutical compositions for inhibiting the expression of the complement component C3 gene, containing the agents of the present invention.

In yet another aspect, the present invention provides pharmaceutical compositions for inhibiting complement component C9 gene expression comprising agents of the present invention.

In one embodiment, the RNAi agent is administered in an unbuffered solution.

In one embodiment, the unbuffered solution is saline or water.

In one embodiment, the RNAi agent is administered in a buffer solution.

In one embodiment, the buffer solution contains acetate, citrate, prolamine, carbonate or phosphate, or any combination thereof.

In one embodiment, the buffer solution is phosphate buffered saline (PBS).

In one aspect, the present invention provides methods for inhibiting the expression of complement factor B (CFB) in a cell. The methods include contacting a cell with an agent of the present invention or a pharmaceutical composition of the present invention and maintaining the resulting cell for a time sufficient to destroy the CFB gene mRNA transcript, thereby inhibiting expression of the CFB gene in the cell.

In another aspect, the present invention provides methods for inhibiting the expression of complement component 3 (C3) in a cell. The methods include contacting a cell with an agent of the present invention or a pharmaceutical composition of the present invention and maintaining the resulting cell for a time sufficient to destroy the C3 gene mRNA transcript, thereby inhibiting expression of the C3 gene in the cell.

In yet another aspect, the present invention provides methods for inhibiting the expression of complement component 9 (C9) in a cell. The methods include contacting a cell with an agent of the present invention or a pharmaceutical composition of the present invention and maintaining the resulting cell for a time sufficient to cause destruction

- 14 045602 mRNA transcript of the C9 gene, thereby inhibiting the expression of the C9 gene in the cell.

In one embodiment, the cell is located in a subject.

In one embodiment, the subject is a human.

In one embodiment, the human subject suffers from a disease associated with a complement component.

In one embodiment, the complement component disease is selected from the group consisting of paroxysmal nocturnal hemoglobinuria (PNH), asthma, rheumatoid arthritis, systemic lupus erythematosus, glomerulonephritis, psoriasis, dermatomyositis with bullous pemphigoid, atypical hemolytic uremic syndrome, hemolytic uremic syndrome associated with Shiga-like toxin E. coli, myasthenia gravis, neuromyelitis optica, dense sediment disease, C3 neuropathy, age-related macular degeneration, cold agglutinin disease, antineutrophil cytoplasmic antibody-associated vasculitis, graft rejection reactions caused by humoral and vascular mechanisms, graft dysfunction, myocardial infarction, sensitized transplant recipient and sepsis.

In one embodiment, the complement component disorder is paroxysmal nocturnal hemoglobinuria (PNH).

In another embodiment, the complement component disorder is atypical hemolytic uremic syndrome (aHUS).

In one embodiment, CFB expression is inhibited by at least about 30%.

In one embodiment, C3 expression is inhibited by at least about 30%.

In one embodiment, C9 expression is inhibited by at least about 30%.

In one embodiment, the agent is administered at a dose of from about 0.01 mg/kg to about 10 mg/kg, or from about 0.5 mg/kg to about 50 mg/kg.

In another embodiment, the agent is administered at a dose of from about 10 mg/kg to about 30 mg/kg.

In one embodiment, the agent is administered subcutaneously.

In another embodiment, the agent is administered intravenously.

In one aspect, the present invention provides methods for treating a subject with a disorder that would benefit from decreased expression of complement factor B (CFB). The methods include administering to a subject a therapeutically effective amount of an agent of the present invention, thereby treating the subject.

In another aspect, the present invention provides methods for preventing at least one symptom in a subject with a disease or disorder that would benefit from decreased expression of complement factor B (CFB). The methods include administering to a subject a therapeutically effective amount of an agent of the present invention, thereby preventing at least one symptom in a subject with a disorder that would benefit from reduction in CFB expression.

In yet another aspect, the present invention provides methods for treating a subject with a disorder that would benefit from decreased expression of complement component C3 (C3). The methods include administering to a subject a therapeutically effective amount of an agent of the present invention, thereby treating the subject.

In one aspect, the present invention provides methods for preventing at least one symptom in a subject with a disease or disorder that would benefit from decreased expression of complement component C3 (C3). The methods include administering to a subject a therapeutically effective amount of an agent of the present invention, thereby preventing at least one symptom in a subject with a disorder that would benefit from reduction in C3 expression.

In one aspect, the present invention provides methods for treating a subject with a disorder that would benefit from decreased expression of complement component C9 (C9). The methods include administering to a subject a therapeutically effective amount of an agent of the present invention, thereby treating the subject.

In one aspect, the present invention provides methods for preventing at least one symptom in a subject with a disease or disorder that would benefit from decreased expression of complement component C9 (C9). The methods include administering to a subject a therapeutically effective amount of an agent of the present invention, thereby preventing at least one symptom in a subject with a disorder that would benefit from reduction in C9 expression.

In one embodiment, the disorder is a complement component disorder.

- 15 045602

In one embodiment, the complement component disease is selected from the group consisting of paroxysmal nocturnal hemoglobinuria (PNH), asthma, rheumatoid arthritis, systemic lupus erythematosus, glomerulonephritis, psoriasis, dermatomyositis with bullous pemphigoid, atypical hemolytic uremic syndrome, hemolytic uremic syndrome associated with Shiga-like toxin E. coli, myasthenia gravis, neuromyelitis optica, dense sediment disease, C3 neuropathy, age-related macular degeneration, cold agglutinin disease, antineutrophil cytoplasmic antibody-associated vasculitis, graft rejection reactions caused by humoral and vascular mechanisms, graft dysfunction, myocardial infarction, sensitized transplant recipient and sepsis.

In one embodiment, the complement component disorder is paroxysmal nocturnal hemoglobinuria (PNH).

In another embodiment, the complement component disorder is atypical hemolytic uremic syndrome (aHUS).

In one embodiment, administration of the agent to a subject results in decreased hemolysis and/or decreased accumulation of CFB protein.

In one embodiment, administration of the agent to a subject results in decreased hemolysis and/or decreased accumulation of C3 protein.

In one embodiment, administration of the agent to a subject results in decreased hemolysis and/or decreased accumulation of C9 protein.

In one embodiment, the methods further comprise administering eculizumab to the subject.

In another embodiment, the methods further comprise administering compstatin to a subject.

In one embodiment, the agent is administered at a dose of from about 0.01 mg/kg to about 10 mg/kg, or from about 0.5 mg/kg to about 50 mg/kg.

In another embodiment, the agent is administered at a dose of from about 10 mg/kg to about 30 mg/kg.

In yet another embodiment, the agent is administered at a dose selected from the group consisting of 0.5, 1, 1.5, 3, 10 and 30 mg/kg.

In one embodiment, the agent is administered to the subject once a week.

In another embodiment, the agent is administered to the subject twice a month.

In one embodiment, the methods further include measuring LDH levels in a subject.

In one aspect, the present invention provides methods for inhibiting the expression of complement factor B (CFB) in a subject. The methods include administering to a subject a therapeutically effective amount of an agent of the present invention, thereby inhibiting the expression of CFB in the subject.

In another aspect, the present invention provides methods for inhibiting the expression of complement component C3 (C3) in a subject. The methods include administering to a subject a therapeutically effective amount of an agent of the present invention, thereby inhibiting C3 expression in the subject.

In yet another aspect, the present invention provides methods for inhibiting the expression of complement component C9 (C9) in a subject. The methods include administering to a subject a therapeutically effective amount of an agent according to any of the embodiments of the present invention, thereby inhibiting C9 expression in the subject.

In one embodiment, the methods further comprise administering eculizumab to the subject.

In another embodiment, the methods further comprise administering compstatin to a subject.

In one embodiment, the agent is administered at a dose of from about 0.01 mg/kg to about 10 mg/kg, or from about 0.5 mg/kg to about 50 mg/kg.

In another embodiment, the agent is administered at a dose of from about 10 mg/kg to about 30 mg/kg.

In yet another embodiment, the agent is administered at a dose selected from the group consisting of 1, 3, 10 and 30 mg/kg.

In one embodiment, the agent is administered to the subject once a week.

In another embodiment, the dsRNA-based agent is administered to a subject twice a month.

Brief description of graphic materials

Fig. Figure 1 is a diagram of the three complement pathways: alternative, classical, and lectin.

Fig. 2 is a graph showing the percentage of complement factor B (CFB) mRNA remaining in C57BL/6 mice 96 hours after a single dose of 1 or 10 mg/kg of the indicated iRNAs.

- 16 045602

Fig. 3 is a graph showing the percentage of complement factor B (CFB) mRNA remaining in C57BL/6 mice 72 hours after a single dose of 1.25, 2.5, or 10 mg/kg

AD-60331.

Detailed Description of the Invention

The present invention provides iRNA-based compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of complement component gene RNA transcripts, i.e. CFB gene, C3 or C9. The gene may be located in a cell, for example, a cell of a subject such as a human.

The present invention also provides methods and combination therapies for treating a subject with a disorder that would benefit from inhibition or reduction of CFB, C9, and/or C3 gene expression, such as a complement component disorder such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), using iRNA-based compositions that target RNA-induced silencing complex (RISC)-mediated cleavage of CFB, C3 and/or C9 gene RNA transcripts.

The present invention also provides methods for preventing at least one symptom, such as hemolysis, in a subject with a disorder that would benefit from inhibition or reduction of CFB, C9, and/or C3 gene expression, such as a complement component disorder such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS).

The iRNAs of the present invention include an RNA strand (antisense strand) with a region that is approximately 30 nucleotides in length or less, for example 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15 -24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26 ,

18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19- 24, 19-23, 19-22, 19-21,

19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21- 29, 21-28, 21-27, 21-26,

21-25, 21-24, 21-23 or 21-22 nucleotides, wherein this region is substantially complementary to at least part of the CFB, C3 or C9 gene transcript mRNA. The use of these iRNAs allows targeted cleavage of the mRNA of the corresponding gene (CFB, C3 or C9 gene) in mammals. Very low dosages of iRNA according to the present invention can, in particular, specifically and effectively mediate RNA interference (RNAi), resulting in significant inhibition of the expression of the corresponding gene (CFB, C3 or C9 gene). Using cellular assays, we have demonstrated that iRNAs targeting the genes of these complement components can mediate RNAi, resulting in significant inhibition of complement gene expression (ie, CFB, C3 or C9). Thus, methods and compositions comprising these iRNAs are useful for treating a subject with a complement component-related disease such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS).

The following detailed description discloses how to prepare and use compositions containing iRNA to inhibit the expression of a complement gene (i.e., CFB, C3 or C9), as well as compositions, uses and methods for treating subjects with diseases and disorders that will be affected by have the beneficial effect of inhibiting and/or reducing the expression of these genes.

I. Definitions.

In order that the present invention may be more easily understood, relevant terms are first defined. In addition, it should be noted that where this document lists a value or range of values of a variable, values and ranges intermediate to the listed values are also intended to be part of the present invention.

The singular form is used throughout this document to denote one or more (i.e., at least one) grammatical entities of an article. By way of example, an element means one element or multiple elements, such as a plurality of elements.

The expression including is used herein to denote the phrase including without limitation and is used interchangeably with it.

The expression or is used herein to refer to the expression and/or and is used interchangeably with it unless the context clearly indicates otherwise.

As used herein, the expression complement factor B, used interchangeably with CFB, refers to the well-known gene and polypeptide also known in the art as AHUS, BF, CFAB, BFD, FB, GBG, FBI12, B factor, properdin, H2 -Bf, glycine-rich beta-glycoprotein, C3 proaccelerator, properdin factor 2B, C3 proactivator, PBF2, glycine-rich beta-glycoprotein, C3/C5 convertase, EC 3.4.21 and EC 3.4.21.473. The expression CFB includes human CFB, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI:189181756; Mouse CFB, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession numbers GI: 218156288 and

- 17 045602

GI:218156290; Rat CFB, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI: 218156284; and chimpanzee CFB, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI:57114201. The expression CFB also includes the CFB of Macasa fascicularis, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI:544428919 and in the account for the gene, ENSMMUP00000000985 (locus=scaffold3881:47830:53620), on the project website Decoding the Masas genome (http://macaque.genomics.org.cn/page/species/index.jsp). Additional examples of CFB mRNA sequences are readily available using, for example, GenBank, UniProt, 0MIM, and the Masas Genome Project website.

Exemplary CFB nucleotide sequences can also be found in SEQ ID NOs: 1-5, 27 and 30. SEQ ID NOs: 12-16, 33 and 36 are antisense sequences of SEQ ID NOs: 15, 27 and 30, respectively.

As used herein, the expression CFB also refers to naturally occurring changes in the DNA sequence of the CFB gene. Non-limiting examples of sequence changes in the CFB gene include 1598A>G in exon 12, resulting in a lysine to arginine substitution at amino acid residue 533; 858C>G in exon 6, resulting in the substitution of phenylalanine for leucine at amino acid residue 286; and 967A>G in exon 7, resulting in a lysine to alanine substitution at amino acid residue 323 (Tawadrous H. et al. (2010) Pediatr Nephrol. 25:947; Goicoechea de Jorge E. et al. (2007) Proc Natl Acad Sci USA 104:240). As used herein, the expression CFB also refers to single nucleotide polymorphisms in the CFB gene. Numerous sequence changes in the CFB gene have been identified and can be found, for example, in the NCBI and UniProt dbSNPs (see, for example, ncbi.nlm.nih.gov/snp).

As used herein, the expression complement component 3, used interchangeably with the expression C3, refers to the well-known gene and polypeptide also known in the art as ARMD9, anaphylatoxin C3a, ASP, complement component C3a, C3a, complement component C3b, C3b, prepro -C3, cleavage product of acylation-promoting protein CPAMD1, complement C3, C3 and PZP-like alpha-2-macroglobulin domain-containing protein 1, complement component C3 and AHUS5. The expression C3 includes human C3, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI:115298677; Mouse C3, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI: 126518316; and rat C3, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI: 158138560. The C3 expression also includes the CFB of Macasa fascicularis, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI:544508182 and in the accession for the gene, ENSP00000245907 (locus=cN9:6921416:6963034), on the project website Decoding the Masas genome (http://macaque.genomics.org.cn/page/species/index.jsp). Additional examples of C3 mRNA sequences are readily available using, for example, GenBank, UniProt, 0MIM, and the Masas Genome Project website.

Exemplary C3 nucleotide sequences can also be found in SEQ ID NOs: 6-8, 28 and 31. SEQ ID NOs: 17-19, 34 and 37 are the antisense sequences of SEQ ID NOs: 6-8, 28 and 31, respectively.

As used herein, the expression C3 also refers to naturally occurring changes in the DNA sequence of the C3 gene. Numerous sequence changes in the C3 gene have been identified and can be found, for example, in the NCBI and UniProt dbSNPs (see, for example, ncbi.nlm.nih.gov/snp).

As used herein, the expression complement component 9, used interchangeably with the expression C9, refers to a well-known gene and polypeptide. The expression C9 includes human C9, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI:187608340; Mouse C9, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI: 15375311; and rat C9, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI: 16924005. The C9 expression also includes the Macacafascicularis CFB, the amino acid and nucleotide sequence of which can be found, for example, in GenBank under accession number GI:544436867 and in the gene account isotig05361 (isogroup03350; length=2955; numContigs=1) on the Decoding Project website Macaque genome (http://macaque.genomics.org.cn/page/species/index.jsp). Additional examples of C3 mRNA sequences are readily available using, for example, GenBank, UniProt, OMIM, and the Masasa Genome Sequencing Project website.

Exemplary C9 nucleotide sequences can also be found in SEQ ID NOs: 9-11, 29 and 32. SEQ ID NOs: 20-22, 35 and 38 are the antisense sequences of SEQ ID NOs: 911, 29 and 32, respectively.

As used herein, the expression C9 also refers to naturally occurring changes in the DNA sequence of the C9 gene. Numerous sequence changes in the C9 gene have been identified and can be found, for example, in the NCBI and UniProt dbSNP (see, for example, ncbi.nlm.nih.gov/snp).

As used herein, a target sequence refers to the contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a CFB, C3, or C9 gene, including mRNA that is the product of RNA processing of the primary transcription product. In one embodiment, the target sequence region will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule generated during transcription of the CFB, C3, or C9 gene.

The target sequence may be approximately 9-36 nucleotides in length, such as approximately 15-30 nucleotides in length. For example, the target sequence may be approximately 15-30 nucleotides in length, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 1521, 15- 20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 1930, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 2025, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 nucleotides.

Ranges and lengths intermediate to the ranges and lengths listed above are also contemplated as part of the present invention.

As used herein, the expression chain containing sequence refers to an oligonucleotide containing a chain of nucleotides that is characterized by a sequence designated using standard nucleotide nomenclature.

Each of G, C, A, T and U generally means a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the expression ribonucleotide or nucleotide can also mean a modified nucleotide, which is described in more detail below, or a nucleotide-mimicking replacement fragment (see, for example, Table 2). It is well known to one skilled in the art that guanine, cytosine, adenine and uracil can be replaced by other moieties without significantly changing the base-pairing properties of the oligonucleotide containing the nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide containing inosine as a base may form a base pair with nucleotides containing adenine, cytosine or uracil. Therefore, nucleotides containing uracil, guanine or adenine can be replaced in the dsRNA nucleotide sequences described in the present invention by nucleotides containing, for example, inosine. In another example, adenine and cytosine at any point on the oligonucleotide can be replaced by guanine and uracil, respectively, to form ambiguous G-U base pairing with the target mRNA. Sequences containing such replacement fragments are suitable for the compositions and methods described in the present invention.

The expressions mRNA, RNAi agent, mRNA agent, RNA interference agent, used interchangeably herein, mean an agent that contains RNA as defined herein and that mediates targeted cleavage of RNA -transcript through the RNA-induced silencing complex (RISC) pathway. mRNA directs sequence-specific destruction of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, eg inhibits, the expression of a target gene in a cell, eg a cell of a subject, such as a mammalian subject.

In one embodiment, the RNAi agent of the present invention includes a single-stranded RNA that interacts with a target RNA sequence, such as a CFB, C3, or C9 mRNA target sequence, to direct cleavage of the target RNA. Without being bound by theory, it is believed that long double-stranded RNA introduced into cells is cut into siRNA by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a type III ribonuclease-like enzyme, is involved in the processing of dsRNA into short interfering RNAs of 19-23 base pairs in length with characteristic two-base overhangs at the 3' end (Bernstein, et al. (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC), in which one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to direct target recognition (Nykanen, et al. (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases in RISC cleave the target to induce silencing (Elbashir, et al. (2001) Genes Dev. 15:188). Thus, in one aspect, the present invention relates to a single-stranded RNA (siRNA) that is produced within a cell and promotes the formation of a RISC complex to effect silencing of a target gene, i.e. CFB gene, C3 or C9. Accordingly, the expression siRNA is also used herein to refer to RNAi described above.

In another embodiment, the RNAi agent may be a single-stranded siRNA that is introduced into a cell or organism to inhibit the target mRNA. Single-stranded RNAi agents bind to Argonaute 2, which has endonuclease activity in the RISC complex, which then cleaves off the target mRNA. Single-stranded siRNAs are typically 15–30 nucleotides long and are chemically modified. The design and testing of single-stranded siRNAs are described in US Pat. No. 8,101,348 and Lima et al. (2012) Cell 150: 883-894, the entire contents of each of which are therefore incorporated herein by reference. Any antisense nucleotide sequences described herein can be used as single-stranded siRNA that are described herein or that are chemically modified by the methods described in Lima et al. (2012) Cell 150:883–894.

In another embodiment, the mRNA for use in the compositions, applications and methods of the present invention is double-stranded RNA and is referred to herein as a double-stranded RNAi agent, a double-stranded RNA molecule (dsRNA), a dsRNA agent, or a dsRNA. The expression dsRNA refers to a complex of ribonucleic acid molecules with a duplex structure, containing two antiparallel and practically complementary nucleic acid chains, considered as having sense and antisense orientation with respect to the target RNA, i.e. to the CFB, C3 or C9 gene. In some embodiments of the present invention, double-stranded RNA (dsRNA) triggers the cleavage of target RNA, such as mRNA, through a post-translational gene silencing mechanism, referred to herein as RNA interference or RNAi. In general, the majority of the nucleotides in each strand of a dsRNA molecule are ribonucleotides, but, as described in detail herein, each or both strands may also include one or more non-ribonucleotide nucleotides, such as a deoxyribonucleotide and/or a modified nucleotide. In addition, as used herein, the RNAi agent may include ribonucleotides with chemical modifications; the RNAi agent may involve significant modifications to multiple nucleotides.

As used herein, the expression modified nucleotide refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and/or a modified nucleotide base. Thus, the expression modified nucleotide covers substitutions, additions or deletions, for example, of a functional group or atom, in internucleoside linkages, sugar moieties, or nucleotide bases. Modifications suitable for use in the agents of the present invention include all types of modifications disclosed herein or known in the art. Any such modifications that are applied to the siRNA molecule are covered by the expression RNAi agent within the context of the specification and claims.

The duplex region can be of any length that allows specific cleavage of the desired target RNA by the RISC pathway, and the length can range from about 9 to 36 base pairs, such as about 15 to 30 base pairs, such as about 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 base pairs , such as approximately 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 1522, 15-21, 15-20, 15-19 , 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 1820 , 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20 -29, 20-28, 20-27, 2026, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21 -26, 21-25, 21-24, 21-23 or 21-22 base pairs. Ranges and lengths intermediate to the ranges and lengths listed above are also contemplated as part of the present invention.

The two strands forming a duplex structure may be different parts of one larger RNA molecule, or they may be separate RNA molecules. When two strands are part of one larger molecule and are therefore connected by an uninterrupted chain of nucleotides from the 3' end of one strand to the 5' end of the corresponding other strand, forming a duplex structure connecting the RNA strand, it is called a hairpin loop. The loop hairpin may contain at least one unpaired nucleotide. In some embodiments, the loop pin may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least at least 10, at least 20, at least 23 or more unpaired nucleotides.

If two practically complementary dsRNA strands are composed of separate RNA molecules, then these molecules should not, but can, be joined by a covalent bond. When two strands are joined covalently in a manner other than an uninterrupted chain of nucleotides from the 3' end of one strand to the 5' end of the corresponding other strand forming a duplex structure, the connecting structure is called a linker. RNA chains can have the same or different numbers of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest dsRNA strand minus any overhangs that are present in the duplex. In addition to the duplex structure, the RNAi agent may contain one or more nucleotide overhangs.

As used herein, the expression nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of an mRNA, such as a dsRNA. For example, when the 3' end of one dsRNA strand extends beyond the 5' end of the other strand, or vice versa, a nucleotide overhang exists. dsRNA may contain an overhang of at least one nucleotide; alternatively, the overhang may contain at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five or more nucleotides. The nucleotide overhang may contain or consist of a nucleotide/nucleoside analogue, including a deoxynucleotide/nucleoside. The protrusion(s) may be on the sense strand, antisense strand, or any combination thereof. In addition, the overhang nucleotide(s) may be at the 5' end, 3' end, or both ends of either the antisense or sense strand of the dsRNA.

In one embodiment, the antisense dsRNA strand contains 1-10 nucleotides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or nucleotides extending at the 3' end and/or 5' end . In one embodiment, the dsRNA sense strand contains 1-10 nucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or nucleotides extending at the 3' end and/or 5' end. In another embodiment, one or more nucleotides of the overhang are replaced with a nucleoside thiophosphate.

A blunt end or blunt end means that there are no unpaired nucleotides at the end of the double-stranded RNAi agent, i.e. no nucleotide overhang. Blunt-ended RNAi is a dsRNA that is double-stranded throughout its length, i.e., it does not have a nucleotide overhang at either end of the molecule. The RNAi agents of the present invention include RNAi agents with nucleotide overhangs at one end (ie, means with one overhang and one blunt end) or with nucleotide overhangs at both ends.

The expression antisense strand or guide strand refers to an iRNA strand, eg dsRNA, that includes a region that is substantially complementary to the target sequence, eg CFB, C3 or C9 mRNA. As used herein, the expression region of complementarity refers to a region on the antisense strand that is substantially complementary to a sequence, for example, a target sequence, such as the nucleotide sequence CFB, C3 or C9, as defined herein. In cases where the complementarity region is not completely complementary to the target sequence, mismatches may be present in the internal or terminal regions of the molecule. Typically, the most suitable mismatches are located in terminal regions, for example within 5, 4, 3 or 2 nucleotides of the 5' and/or 3' end of the mRNA.

The expression sense strand or passenger strand, as used herein, means an mRNA strand that includes a region that is substantially complementary to a region of the antisense strand as the term is defined herein.

As used herein, the expression cleavage site refers to a region that is adjacent to the cleavage site. The cleavage site is the target site at which cleavage occurs. In some embodiments, the cleavage site comprises three bases at either end of the cleavage site and adjacent to it. In some embodiments, the cleavage site comprises two bases at either end of the cleavage site and adjacent to it. In some embodiments, the cleavage site is primarily located at a site adjacent to nucleotides 10 and 11 of the antisense strand, and the cleavage site comprises nucleotides 11, 12, and 13.

As used herein, and unless otherwise indicated, the expression complementary when used to describe a first nucleotide sequence with respect to a second nucleotide sequence means the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with the oligonucleotide or polynucleotide containing a second nucleotide sequence, as will be understood by one skilled in the art. Such conditions may, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washout ( see, for example, Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions may apply, such as physiologically relevant conditions that may occur in the body. One skilled in the art will be able to determine the set of conditions most suitable for analyzing the complementarity of two sequences in accordance with the end use of the hybridized nucleotides.

Complementary sequences in an iRNA, such as a dsRNA described herein, involve base pairing an oligonucleotide or polynucleotide containing a first polynucleotide sequence with an oligonucleotide or polynucleotide containing a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences may be referred to as being fully complementary to each other herein. However, in the case where the first sequence is considered substantially complementary to the second sequence herein, the two sequences may be completely complementary, or there may be one or more mismatches, but typically no more than 5. 4, 3 or 2 bp when hybridized to form a duplex of up to 30 bp while maintaining the ability to hybridize under conditions best suited to their end use, such as expression inhibition

- 21,045,602 genes via the RISC pathway. However, when two oligonucleotides are intended to form one or more single-stranded overhangs upon hybridization, such overhangs will not be considered mismatches for purposes of determining complementarity. For example, a dsRNA containing one oligonucleotide of 21 nucleotides in length and another oligonucleotide of 23 nucleotides in length, where the longer oligonucleotide contains a 21 nucleotide sequence that is fully complementary to the shorter oligonucleotide, may still be referred to as fully complementary for purposes described herein.

Complementary sequences used herein may also include or may be formed entirely from non-Watson-Crick base pairs and/or base pairs formed from unnatural and modified nucleotides to the extent that the above requirements are met in relation to their ability to hybridize. Such non-Watson-Crick base pairs include, but are not limited to, ambiguous or Hoogsteen G:U base pairing.

The expressions complementary, fully complementary, and substantially complementary as used herein can be applied to a base match between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an mRNA agent and a target sequence, as will be understood from the context of their application.

As used herein, a polynucleotide that is substantially complementary to at least a portion of messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (eg, mRNA encoding CFB, C3, or C9). For example, a polynucleotide is complementary to at least a portion of the CFB mRNA if the sequence is substantially complementary to a continuous portion of the CFB-encoding mRNA.

In general, the majority of the nucleotides of each chain are ribonucleotides, but, as described in detail herein, each or both chains may also include one or more nucleotides that are not ribonucleotides, such as a deoxyribonucleotide and/or a modified nucleotide. In addition, mRNA may include ribonucleotides with chemical modification. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications that are used in the mRNA molecule are covered by the expression mRNA within the context of the specification and claims.

In one aspect of the present invention, the agent for use in the methods and compositions of the present invention is a single-stranded antisense RNA molecule that inhibits a target mRNA through an antisense RNA inhibitory mechanism. A single-stranded antisense RNA molecule is complementary to a sequence in the target mRNA. Single-stranded antisense oligonucleotides can inhibit translation in a stoichiometric manner by base pairing with the mRNA and physically interfering with the translation machinery, see Dias, N. et al. (2002) Mol Cancer Ther 1:347–355. The single-stranded antisense RNA molecule can be from about 15 to about 30 nucleotides in length and have a sequence complementary to the target sequence. For example, a single-stranded antisense RNA molecule may contain a sequence that is at least about 15, 16, 17, 18, 19, 20 or more contiguous nucleotides from any of the antisense sequences described herein.

The phrase contacting a cell with an RNAi agent, such as dsRNA, as used herein, includes contacting the cell in any possible manner. Contacting a cell with an RNAi agent includes contacting a cell with mRNA in vitro or contacting a cell with mRNA in vivo. Bringing into contact can be carried out directly or indirectly. Thus, for example, the RNAi agent can be brought into physical contact with a cell by a separate implementation of the method or, alternatively, the RNAi agent can be placed in an environment that allows or causes the agent to come into contact with the cell.

Cell contacting in vitro can be accomplished, for example, by incubating the cell with an RNAi agent. Contacting a cell in vivo can be accomplished, for example, by injecting an RNAi agent into or near the tissue in which the cell is located, or by injecting an RNAi agent into another area, such as the bloodstream or subcutaneous space, such that the agent will subsequently reach the tissue containing the cell that needs to be brought into contact with the product. For example, the RNAi agent may contain and/or be associated with a ligand, such as GalNAc3, which directs the RNAi agent to a site of interest, such as the liver. Combinations of in vitro and in vivo contact methods are also possible. For example, the cell can also be contacted with an RNAi agent in vitro and subsequently transplanted into a subject.

The subject used herein is an animal, such as a mammal, including primates (such as human, non-human primate, such as ape and chimpanzee), non-primate (such as cow, pig, camel, llama, horse, goat , rabbit, sheep, hamster,

- 22 045602 guinea pig, cat, dog, rat, mouse, horse and whale) or birds (eg duck or goose). In an embodiment, the subject is a human, such as a human being treated for or being evaluated for a disease, disorder or condition that would benefit from decreased expression of CFB, C3 and/or C9; a person at risk of developing a disease, disorder or condition that would benefit from decreased expression of CFB, C3 and/or C9; a person with a disease, disorder or condition that would benefit from decreased expression of CFB, C3 and/or C9; and/or a person receiving treatment for a disease, disorder or condition that would be benefited by a reduction in the expression of CFB, C3 and/or C9 as described herein.

As used herein, the expression complement component disease is a disease or disorder that is caused by or associated with complement activation. The expression complement component-related disease includes a disease, disorder or condition that would be benefited by decreased expression of CFB (i.e., CFB-related disease), C3 (i.e., C3-related disease), and/or C9 (i.e. disease associated with C9). Such diseases are typically associated with inflammation and/or activation of the immune system, such as membrane attack complex-mediated lysis, anaphylaxis and/or hemolysis. Non-limiting examples of diseases associated with complement components include paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid antibody syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense sediment disease (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (eg, age-related macular degeneration (AMD)); syndrome including hemolysis, increased liver enzymes and decreased platelet count (HELLP); thrombocytopenic thrombohemolytic purpura (TTP); spontaneous fetal loss; pauci-immune vasculitis; epidermolysis bullosa; recurrent fetal loss; preeclampsia, traumatic brain injury, myasthenia gravis, Cold agglutinin disease, dermatomyositis with bullous pemphigoid, hemolytic uremic syndrome associated with E. coli Shiga-like toxin, C3 neuropathy, vasculitis associated with antibodies to the cytoplasm of neutrophils (eg, granulomatosis with polyangiitis (formerly known as Wegener's granulomatosis), Churg-Strauss syndrome and microscopic polyangiitis), graft rejection reactions caused by humoral and vascular mechanisms, graft dysfunction, myocardial infarction (eg, tissue damage and ischemia in myocardial infarction), allogeneic transplantation, sepsis ( eg, adverse outcome in sepsis), coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, sepsis associated with systemic inflammatory response, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AHA), ITP, Goodpasture syndrome, Degos disease, antiphospholipid syndrome (APS), catastrophic APS (CAPS), cardiovascular disorder, myocarditis, cerebrovascular disorder, peripheral (eg, musculoskeletal) vascular disorder, renovascular disorder , mesenteric/intestinal vascular disorder, vasculitis, Henoch-Schönlein nephritis, systemic lupus erythematosus-associated vasculitis, rheumatoid arthritis-associated vasculitis, immune complex-associated vasculitis, Takayasu disease, dilated cardiomyopathy, diabetic angiopathy, Kawasaki disease (arteritis) , venous gas embolism (VGE) and restenosis after stent placement, rotational atherectomy and percutaneous transluminal coronary angioplasty (PTCA) (see, for example, Holers (2008) Immunological Reviews 223:300-316; Holers and Thurman (2004) Molecular Immunology 41:147–152; US Patent Publication No. 20070172483).

In one embodiment, the complement component disorder is paroxysmal nocturnal hemoglobinuria (PNH). PNH may be classic PNH or PNH in the setting of other bone marrow failure syndrome and/or myelodysplastic syndrome (MDS), such as cytopenia. In another embodiment, the complement component disorder is atypical hemolytic uremic syndrome (aHUS). In yet another embodiment, the complement component-related disease is rheumatoid arthritis.

A therapeutically effective amount as used herein is meant to include an amount of an RNAi agent that, when administered to a subject with a complement component-related disease, is sufficient to effect treatment of the disease (e.g., by reducing, ameliorating, or maintaining an existing disease or one or more symptoms of the disease ). The therapeutically effective amount may vary depending on the RNAi agent, antibody or antigen-binding fragment thereof, route of administration of the agent, disease and its severity and history, age, weight, family history, genetic makeup, types of prior or concomitant treatment, if any, and others individual characteristics of the subject to be treated.

- 23 045602

A prophylactically effective amount as used herein is meant to include an amount of an iRNA agent that, when administered to a subject having a complement component-related disease but not yet (or currently) experiencing or exhibiting symptoms of the disease, and/or a subject, at risk of developing a complement component-related disease, e.g., a subject having a tissue and/or graft, e.g., a sensitized or allogeneic recipient, a subject with sepsis, and/or a subject with myocardial infarction, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Disease mitigation involves slowing the progression of a disease or reducing the severity of a disease that develops later. The prophylactically effective amount may vary depending on the iRNA agent, route of administration, disease risk and medical history, age, weight, family history, genetic makeup, types of prior or concomitant treatments, if any, and other individual patient characteristics. which is subject to treatment.

A therapeutically effective amount or prophylactically effective amount also includes an amount of an RNAi agent that provides some desired local or systemic effect at an acceptable benefit/risk ratio relative to any treatment. The iRNA agents used in the methods of the present invention can be administered in sufficient quantities to provide an acceptable benefit/risk ratio for such treatment.

The expression sample as used herein includes the selection of similar fluids, cells or tissues isolated from the body of the subject, as well as fluids, cells or tissues present in the body of the subject. Examples of biological fluids include blood, serum and serous fluids, plasma, urine, lymph, cerebrospinal fluid, intraocular fluids, saliva, and the like. Tissue samples may include samples from tissues, organs, or local sites. For example, samples may be obtained from specific organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples can be obtained from the liver (eg, the entire liver, or certain segments of the liver, or certain types of cells in the liver, such as, for example, hepatocytes). In preferred embodiments, the sample obtained from the subject means blood or plasma obtained from the subject. In further embodiments, the sample obtained from the subject means liver tissue (or its components) obtained from the subject.

II. mRNA according to the present invention.

The present invention provides iRNAs that inhibit the expression of a complement component gene. In one embodiment, the iRNA-based agent comprises double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of a CFB gene in a cell, such as a cell of a subject, e.g., a mammal, such as a person with a complement component disorder as described herein, for example PNH. In another embodiment, the iRNA-based agent comprises double-stranded ribonucleic acid (dsRNA) molecules for inhibiting C3 gene expression in a cell, such as a cell from a subject, such as a mammal, such as a human with a complement component-related disease as described herein, e.g. PNH. In a further embodiment, the iRNA-based agent comprises double-stranded ribonucleic acid (dsRNA) molecules for inhibiting expression of the C9 gene in a cell, such as a cell from a subject, such as a mammal, such as a human with a complement component disorder as described herein, e.g. , PNH. dsRNA includes an antisense strand having a complementarity region that is complementary to at least a portion of the mRNA produced by expression of the target gene, i.e. CFB gene, C3 or C9. The complementarity region is approximately 30 nucleotides or less in length (eg, approximately 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length). Upon contact with a cell expressing a target gene, the iRNA inhibits expression of the target gene (e.g., human, primate, non-primate, or avian CFB, C3, or C9 gene) by at least about 10% when assayed with, e.g. using PCR or a branched DNA (bDNA) method, or using a protein detection method, such as immunofluorescence analysis, using, for example, Western blotting or flow cytometry techniques.

dsRNA contains two strands of RNA that are complementary and hybridize to form a duplex structure under the conditions under which the dsRNA will be applied. One dsRNA strand (antisense strand) includes a complementarity region that is substantially complementary and usually completely complementary to the target sequence. The target sequence can be obtained from the mRNA sequence generated during expression of the CFB, C3 or C9 gene. The other strand (sense strand) includes a region that is complementary to the antisense strand such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described herein and as is known in the art, complementary dsRNA sequences may also be contained as regions complementary to themselves.

- 24 045602 of one nucleic acid molecule, instead of being located on separate oligonucleotides.

Typically, the duplex structure is 15 to 30 base pairs long, for example, it has a length of 1529, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 1827, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 1922, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21- 28, 21-

27, 21-26, 21-25, 21-24, 21-23 or 21-22 base pairs. Ranges and lengths intermediate to the ranges and lengths listed above are also contemplated as part of the present invention.

Similarly, the region of complementarity with the target sequence is from 15 to 30 nucleotides in length, for example has a length of 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22 , 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18 -23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22 , 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21 -30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 nucleotides. Ranges and lengths intermediate to the ranges and lengths listed above are also contemplated as part of the present invention.

In some embodiments, the dsRNA is about 15 to about 20 nucleotides in length, or about 25 to about 30 nucleotides in length. In one embodiment, the RNAi agent of the present invention is a 24-30 nucleotide dsRNA that interacts with a target RNA sequence, i.e. with the target mRNA sequence CFB, C3 or C9, directing the cleavage of the target RNA. In general, dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, as is well known in the art, dsRNAs greater than about 21-23 nucleotides in length can serve as substrates for Dicer. As will also be appreciated by one of ordinary skill in the art, the region of RNA that is the target for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where appropriate, part of the target mRNA is a contiguous sequence of the target mRNA of sufficient length to allow it to be a substrate for RNAi-directed cleavage (ie, cleavage via the RISC pathway).

One skilled in the art will also appreciate that a duplex region is the major functional portion of a dsRNA, for example a duplex region of about 9-36 base pairs, for example about 10-36, 11-36, 12-36, 13-36, 14- 36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11- 32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15- 17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20- 28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 base pairs. Thus, in one embodiment, until the region is processed into a functional duplex of, for example, 1530 base pairs that directs the desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs, are dsRNA. Thus, one skilled in the art will appreciate that in one embodiment, the miRNAs are dsRNAs. In another embodiment, the dsRNA is a non-naturally occurring miRNA. In another embodiment, the iRNA agent useful for targeting the expression of CFB, C3 or C9 is not produced in the target cell by cleavage of a larger dsRNA.

The dsRNA described herein may further include one or more single-stranded nucleotide overhangs, such as 1, 2, 3 or 4 nucleotides. dsRNAs having at least one nucleotide overhang may have unexpectedly high inhibitory properties relative to their blunt-ended counterparts. The nucleotide overhang may contain or consist of a nucleotide/nucleoside analogue, including a deoxynucleotide/nucleoside. The protrusion(s) may be on the sense strand, antisense strand, or any combination thereof. In addition, the overhang nucleotide(s) may be at the 5' end, 3' end, or both ends of either the antisense or sense strand of the dsRNA.

dsRNA can be synthesized using standard methods known in the art, as described below, for example, using an automated DNA synthesizer such as those commercially available from, for example, Biosearch, Applied Biosystems, Inc.

The mRNA compounds of the present invention can be prepared using a two-step procedure. First, the individual strands of a double-stranded RNA molecule are produced separately. The component chains are then annealed. Single chain siRNA compounds can be prepared using liquid phase synthesis or solid phase organic synthesis, or both. Organic synthesis has the advantage that oligonucleotide chains containing unnatural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the present invention can be prepared using liquid phase synthesis or solid phase organic synthesis, or both.

- 25 045602

In one aspect, the dsRNA of the present invention contains at least two nucleotide sequences, a sense sequence and an antisense sequence.

In one embodiment, the dsRNA of the present invention that specifically targets CFB includes a sense strand selected from the group of sequences listed in any of the tables. 3 and 4, and the corresponding antisense strand for the sense strand is selected from the group of sequences from any of the tables. 3 and 4. In this aspect, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to the mRNA sequence generated by expression of the CFB gene. Therefore, in this aspect, the dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand in any of the tables. 3 and 4, and the second oligonucleotide is described as the corresponding antisense strand for the sense strand in any of the tables. 3 and 4. In one embodiment, substantially complementary dsRNA sequences are contained on separate oligonucleotides. In another embodiment, substantially complementary dsRNA sequences are contained in a single oligonucleotide.

In one embodiment, the dsRNA of the present invention that targets C3 includes a sense strand selected from the group of sequences listed in any of the tables. 5 and 6, and the corresponding antisense strand for the sense strand is selected from the group of sequences from any of the tables. 5 and 6. In this aspect, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to the mRNA sequence generated by expression of the C3 gene. Therefore, in this aspect, the dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand in any of the tables. 5 and 6, and the second oligonucleotide is described as the corresponding antisense strand for the sense strand in any of the tables. 5 and 6. In one embodiment, substantially complementary dsRNA sequences are contained on separate oligonucleotides. In another embodiment, substantially complementary dsRNA sequences are contained in a single oligonucleotide.

In one embodiment, the dsRNA of the present invention targeting C9 includes a sense strand selected from the group of sequences listed in any of the tables. 7 and 8, and the corresponding antisense strand for the sense strand is selected from the group of sequences from any of the tables. 7 and 8. In this aspect, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to the mRNA sequence generated by expression of the C9 gene. Therefore, in this aspect, the dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand in any of the tables. 7 and 8, and the second oligonucleotide is described as the corresponding antisense strand for the sense strand in any of the tables. 7 and 8. In one embodiment, substantially complementary dsRNA sequences are contained on separate oligonucleotides. In another embodiment, substantially complementary dsRNA sequences are contained in a single oligonucleotide.

It will be clear that although some of the sequences in table. 3-8 are described as modified and/or conjugated sequences, the RNA in the iRNA according to the present invention, for example, dsRNA according to the present invention, may contain any of the sequences set forth in table. 3-8, which is unmodified, unconjugated, and/or modified, and/or conjugated otherwise than described therein.

It is well known to one skilled in the art that dsRNAs with duplex structures of approximately 20 and 23 base pairs, such as 21 base pairs, have been found to be particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877- 6888). However, other authors have found that shorter or longer duplex RNA structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222226). In the above-described embodiments, in accordance with the nature of the oligonucleotide sequences shown in any of the tables. 3-8, dsRNAs described herein may include at least one strand of at least 21 nucleotides in length. It can be assumed with reasonable probability that shorter duplexes with one of the sequences from any of the tables. 3–8, with the exception of only a few nucleotides at one or both ends, may be as effective as the dsRNAs described above. Therefore, it is within the scope of the present invention to have a dsRNA with a sequence of at least 15, 16, 17, 18, 19, 20 or more contiguous nucleotides derived from one of the sequences from any of the tables. 3-8, and characterized by their ability to inhibit expression of the target gene by no more than about 5, 10, 15, 20, 25 or 30% inhibition of the dsRNA containing the complete sequence.

In addition, the RNAs listed in any of the tables. 3 and 4 identify site(s) in the CFB transcript that are sensitive to RISC-mediated cleavage. Similarly, RNAs listed in any of the tables. 5 and 6 identify the site(s) in the C3 transcript that are sensitive to RISC-mediated cleavage and the RNAs listed in either table. 7 and 8,

- 26 045602 identifies the site(s) in the C9 transcript that are sensitive to RISC-mediated cleavage. Thus, the present invention further describes mRNAs that target one of these sites. As used herein, an mRNA is said to target a specific site on an RNA transcript if the mRNA promotes cleavage of the transcript at any location at that specific site. Such an iRNA will typically include at least 15 contiguous nucleotides from one of the sequences shown in any of the tables. 3-8, combined with additional nucleotide sequences taken from a region adjacent to the selected sequence in the target gene.

While the target sequence is typically approximately 15-30 nucleotides in length, there is great variability in the suitability of specific sequences within this range for directing cleavage of any given target RNA. The various software packages and principles outlined herein provide guidance for identifying optimal target sequences for any given target gene, but it is also possible to adopt an empirical approach in which a window or mask of a given size (as a non-limiting example, 21 nucleotides) literally or figuratively (including, for example, in silicon), placed on the target RNA sequence to identify sequences in a range of sizes that can serve as target sequences. By gradually moving the single nucleotide sequence window above or below the starting position of the target sequence, the next potential target sequence can be identified until the full set of possible sequences is determined for any given target size selected. This method, when combined with systematic synthesis and testing of identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally, can identify those RNA sequences that when targeted with the agent , which is an mRNA, mediate better inhibition of target gene expression. Thus, although the sequences identified, for example, in any of the tables. 3-8 represent effective target sequences, it is suggested that further optimization of inhibition efficiency can be achieved by gradually moving the window one nucleotide higher or lower relative to the target sequences to identify sequences with the same or better inhibition characteristics.

In addition, it is also assumed that for any sequence identified, for example, in any of the tables. 3-8, further optimization can be achieved by either systematically adding or removing nucleotides to create longer or shorter sequences and examining these sequences obtained by moving a longer or shorter size window up or down the target RNA from a given point. Again, coupling this approach to generating new targets in candidate candidates with mRNA potency testing based on those target sequences in inhibition assays known in the art and/or as described herein can lead to further improvements in inhibition potency. Further, such optimized sequences can be adjusted by, for example, introducing modified nucleotides as described herein or as known in the art, adding or changing an overhang, or other modifications known in the art and/or described herein. to further optimize the molecule (e.g., increasing serum stability or circulation half-life, increasing thermostability, improving transmembrane delivery, targeting a specific position or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.

The mRNA, as described herein, may contain one or more mismatches to the target sequence. In one embodiment, the mRNA as described herein contains no more than 3 mismatches. If the antisense strand of the mRNA contains mismatches with the target sequence, it is preferable that the region of the mismatch is not in the center of the region of complementarity. If the antisense strand of the mRNA contains mismatches with the target sequence, it is preferable that the mismatch be limited to within the last 5 nucleotides from either the 5' or 3' end of the complementarity region. For example, in the case of a 23 nucleotide iRNA agent whose RNA strand is complementary to a region of, for example, the CFB gene, it typically does not contain any mismatch in the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting expression of a target gene, for example, the CFB, C3, or C9 gene. Consideration of the effectiveness of mismatched iRNA in inhibiting target gene expression is important, especially if a particular complementarity site in the target gene is known to have polymorphic sequence changes in the population.

III. Modified mRNAs of the present invention.

- 27 045602

In one embodiment, the RNA of the mRNAs of the present invention, for example, dsRNA, is unmodified and does not contain, for example, chemical modifications and/or conjugations known in the art and described herein. In another embodiment, the RNA of the mRNAs of the present invention, such as dsRNA, is chemically modified to improve stability or other beneficial characteristics. In some embodiments of the present invention, substantially all of the mRNA nucleotides of the present invention are modified. In other embodiments of the present invention, all of the nucleotides in the iRNA of the present invention are modified by an iRNA of the present invention in which substantially all of the nucleotides are modified, are highly, but not completely, modified, and may include no more than 5.4 , 3, 2 or 1 unmodified nucleotide.

The nucleic acids described in the present invention can be synthesized and/or modified by methods well known in the art, such as those described in Current protocols in nucleic acid chemistry, Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is therefore incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3'-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, for example, substitution with stabilizing bases, destabilizing bases or bases that pair with an expanded repertoire of partners, removal of bases (nucleotides lacking a nitrogenous base) or conjugate bases; sugar modifications (eg at the 2' position or 4' position) or sugar substitution; and/or skeletal modifications, including modification or replacement of phosphodiester bonds. Specific examples of mRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or non-naturally occurring internucleoside linkages. RNAs containing modified backbones include, but are not limited to, those that do not contain a phosphorus atom in the backbone. In the context of this description and as is sometimes mentioned in the art, modified RNAs that do not contain a phosphorus atom in their internucleoside backbone can also be considered oligonucleosides. In some embodiments, the modified mRNA will contain a phosphorus atom in its internucleoside backbone.

Modified RNA backbones include, for example, phosphothioates, chiral phosphothioates, phosphodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-amino phosphoramidate and aminoalkyl phosphoramidates, thionophosphoramide idates, thionoalkylphosphonates , thionoalkyl phosphotriesters and boranophosphates with normal 3'-5' bonds, their 2'-5'-linked analogues, as well as those whose polarity is inverted, where adjacent pairs of nucleoside units are linked through 3'-5'- to 5'-3 '- or 2'-5'- with 5'-2'-. Also included are various salts, mixed salts and free acid forms.

Illustrative US patents that describe the preparation of the above-mentioned phosphorus-containing linkages include, without limitation, US patent No. 3687808; 4469863; 4476301; 5023243; 5177195; 5188897; 5264423; 5276019; 5278302; 5286717; 5321131; 5399676; 5405939; 5453496; 5455233;

5466677; 5476925; 5519126; 5536821; 5541316; 5550111; 5563253; 5571799; 5587361; 5625050; 6028188;

6124445; 6160109; 6169170; 6172209; 6239265; 6277603; 6326199; 6346614; 6444423; 6531590; 6534639;

6608035; 6683167; 6858715; 6867294; 6878805; 7015315; 7041816; 7273933; 7,321,029 and US Patent Document RE39464, the entire contents of which are hereby incorporated by reference.

Modified RNA backbones that do not include a phosphorus atom are backbones that are formed by internucleoside linkages of short alkyl or cycloalkyl chains, mixed internucleoside linkages of heteroatoms and alkyl or cycloalkyl chains, or internucleoside linkages of one or more shorter heteroatom or heterocyclic chains. These include those that have morpholino linkages (formed in part from the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone skeletons; formacetyl and thioformacetyl backbones; methylene-formacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamate backbones; methylene-imino and methylene-hydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and others, including mixed components N, O, S and CH ₂ .

Illustrative US patents that describe the preparation of the above oligonucleosides include, without limitation, US patent No. 5034506; 5166315; 5185444; 5214134; 5216141; 5235033; 564562; 5264564; 5405938; 5434257; 5466677; 5470967; 5489677; 5541307; 5561225; 5596086; 5602240; 5608046; 5610289; 5618704; 5623070; 5663312; 5633360; 5677437 and 5677439, the entire contents of which are hereby incorporated herein by reference.

In other embodiments, suitable RNA mimetics are contemplated for use in

- 28 045602 mRNA, in which both a sugar bond and an internucleoside bond, i.e. the backbone of nucleotide units are replaced by new groups. The base units are maintained during hybridization with the target compound of the corresponding nucleic acid. One such oligomeric compound, an RNA mimetic, which has demonstrated excellent hybridization characteristics is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone in RNA is replaced by an amide-containing backbone, particularly an aminoethylglycine backbone. Nitrogenous bases retain and bind directly or indirectly to the nitrogen atoms of the aza group of the amide part of the backbone. Illustrative US patents that describe the preparation of PNA compounds include, without limitation, US Patent Nos. 5,539,082, 5,714,331, each of which is incorporated herein by reference in its entirety. Additional PNA compounds suitable for use in the mRNA of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

Some embodiments described in the present invention include RNA with phosphorothioate backbones and oligonucleosides with heteroatomic backbones, and in particular, --CH2--NH--CH2-, --CH ₂ --N(CH ₃ )--O --CH ₂ --[known as methylene (methylimino) or MMI backbone], --CH2--O--N(CH ₃ )-CH ₂ --, --CH ₂ --N(CH ₃ )-- N(CH ₃ )--CH ₂ --H--N(CH ₃ )--CH ₂ --CH ₂ -[where the native phosphodiester backbone is represented as --O--P--O--CH2--] from the aforementioned U.S. Patent No. 5,489,677 and the amide backbones from the aforementioned U.S. Patent No. 5,602,240. In some embodiments, the RNAs described herein have a morpholino backbone structure as in the aforementioned U.S. Patent No. 5,034,506.

Modified RNAs may also contain one or more substituted sugar fragments. mRNAs, such as dsRNAs, described herein may include one of the following substituents at the 2' position: OH; F; O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl and alkynyl may be substituted or unsubstituted with C1- _C10 alkyl or _C2 - _C10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2)nO] _mCH3 , O(CH2) _nOCH3 , O( _CH2 ) _nNH2 , O( _CH2 )nCH3, O( _CH2 ) _nONH2 , and O( _CH2 ) _n ON[(CH ₂ ) _n CH ₃ )] ₂ where n and m are from 1 to about 10. In other embodiments, the dsRNA includes one of the following substituents at the 2' position: C ₁ -C ₁₀ lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH ₃ , OCN, Cl, Br, CN, CF ₃ , OCF ₃ , SOCH3, SO2CH3, ONO2, NO2, N ₃ , NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino-, polyalkylamino-, substituted silyl, RNA cleavage group, reporter group, intercalator, group to improve the pharmacokinetic properties of mRNA, or a group to improve the pharmacodynamic properties of mRNA, and other substituents having similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O--CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e. alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e. the O(CH ₂ ) ₂ ON(CH ₃ ) ₂ group, also known as 2'-DMAOE, as described in the examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e. 2'-O--CH ₂ --O--CH ₂ --N(CH ₂ ) ₂ .

Other modifications include 2'-methoxy (2'-OCH ₃ ), 2'-aminopropoxy (2'-OCH ₂ CH ₂ CH2NH2) and 2'fluoro (2'-F). Similar modifications can be made at other positions of the RNA among the mRNAs, in particular at the 3' sugar position at the 3' end of the nucleotide, or at the 2'-5'-linked dsRNA and the 5' position of the 5' terminal nucleotide. mRNA can also have sugar mimetics, such as cyclobutyl moieties in place of the pentofuranosyl sugar. Illustrative US patents that describe the preparation of such modified sugar structures include, but are not limited to, US Patent No. 4,981,957; 5118800; 5319080; 5359044; 5393878; 5446137; 5466786; 5514785; 5519134;5567811; 5576427; 5591722; 5597909; 5610300; 5627053; 5639873; 5646265; 5658873; 5670633 and 5700920, some of which belong to the authors of this application. The entire contents of each of the above applications are incorporated herein by reference.

The mRNA may also include modifications or substitutions of a nitrogenous base (often referred to in the art simply as a base). Unmodified or natural nitrogenous bases used herein include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nitrogenous bases include other synthetic and natural nitrogenous bases such as deoxythymine (dT), 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halogen uracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5- uracil (pseudouracil), 4-thiouracil, 8-halogen, 8-amino, 8thiol, 8-thioalkyl, 8-hydroxyl anal and other 8-substituted adenines and guanines, 5-halogen, in particular 5-bromo, 5-trifluoromethyl and others 5 -substituted compounds of uracil and cytosine, 7-methylguanine and 7methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Additional nitrogenous bases include those described in US Pat. No. 3,687,808, which are described in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; which are described in The Concise Encyclopedia Of Polymer Science And Engineering,

- 29 045602 pages 858-859, Kloschwitz, J.L., ed. John Wiley & Sons, 1990, which are described by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613 and which are described by Sanghvi, Y.S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, V., Ed., CRC Press, 1993. Some of these nitrogenous bases are particularly useful for increasing the binding affinity of the oligomeric compounds described in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. Substitutions of 5-methylcytosine have demonstrated an increase in the stability of the nucleic acid duplex at 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more preferably in combination with a 2'-O-methoxyethyl sugar modification.

Illustrative US patents that describe the preparation of some of the above modified nucleotide bases, as well as other modified nucleotide bases, include, but are not limited to, the aforementioned US Patent Nos. 3,687,808, 4,845,205; 513030; 5134066; 5175273; 5367066; 5432272; 5457187; 5459255; 5484908; 5502177; 5525711; 5552540; 5587469; 5594121, 5596091; 5614617; 5681941; 5750692; 6015886; 6147200; 6166197; 6222025; 6235887; 6380368; 6528640; 6639062; 6617438; 7045610; 7427672 and 7495088, the entire contents of which are hereby incorporated herein by reference.

The iRNA RNA can also be modified to include one or more bicyclic sugar moieties. A bicyclic sugar is a furanosyl ring modified by bridging two atoms. A bicyclic nucleoside (BNA) is a nucleoside with a sugar moiety containing a bridge connecting the two carbon atoms of the sugar ring, thus forming a bicyclic ring system. In certain embodiments, a bridge connects a 4' carbon and a 2' carbon on the sugar ring. Thus, in some embodiments, an agent of the present invention may include one or more locked nucleic acids (LNA). A closed nucleic acid is a nucleotide containing a modified ribose fragment, where the ribose fragment contains an additional bridge connecting the 2' and 4' carbon atoms. In other words, LNA is a nucleotide containing a bicyclic sugar moiety containing a 4'-CH ₂ -O-2' bridge. This structure effectively locks ribose into a 3'-endo structural conformation. Addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al. (2005) Nucleic Acids Research 33(1):439-447; Mook, OR et al. (2007) Mol Canc Ther 6(3):833-843 Grunweller, A. et al (2003) Nucleic Acids Research 31(12):31853193). Examples of bicyclic nucleosides for use in the polynucleotides of the present invention include, but are not limited to, nucleosides containing a bridge between the 4' and 2' atoms of the ribosyl ring. In certain embodiments, the antisense polynucleotide agents of the present invention include one or more bicyclic nucleosides containing a 4'-2' bridge. Examples of such 4'-2' bridged bicyclic nucleosides include, but are not limited to, 4'-(CH ₂ )--O-2'(LNA);4'-(CH ₂ )--S-2';4'-(CH ₂ )2--O-2'(ENA);4'-CH(CH ₃ )--O-2' (also called hindered ethyl or cEt) and 4'-CH(CH ₂ OCH ₃ )--O-2' (and their analogs; see, for example, the patent US No. 7399845); 4'-C(CH ₃ )(CH ₃ )--O-2' (and analogs thereof; see, for example, US Pat. No. 8278283); 4'-CH ₂ -N(OCH ₃ )-2' (and analogs thereof; see, for example, US Pat. No. 8278425); 4'-CH ₂ --O--N(CH ₃ )-2' (see, for example, US Patent Publication No. 2004/0171570); 4'-CH2--N(R)--O-2', where R represents H, C1C ₁₂ alkyl or a protecting group (see, for example, US Pat. No. 7427672); 4'-CH ₂ --C(H)(CH ₃ )-2' (see, for example, Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH ₂ --C(=CH ₂ )-2' (and analogs thereof; see, for example, US Pat. No. 8278426). The entire contents of each of the above references are hereby incorporated herein by reference.

Additional illustrative US patents and US patent publications that describe the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: US Patent No. 6,268,490; 6525191; 6670461; 6770748; 6794499; 6998484; 7053207; 7034133;7084125; 7399845; 7427672; 7569686; 7741457; 8022193; 8030467; 8278425; 8278426; 8278283; US 2008/0039618 and US 2009/0012281, the entire contents of each of which are incorporated herein by reference.

Any of the above bicyclic nucleosides having one or more stereochemical sugar configurations can be prepared, including, for example, α-L-ribofuranose and β-D-ribofuranose (see WO 99/14226).

The iRNA RNA can also be modified to include one or more hindered ethyl nucleotides. As used herein, a hindered ethyl nucleotide or cEt is a locked nucleic acid containing a bicyclic sugar moiety containing a 4'-CH(CH ₃ )-O-2' bridge. In one embodiment, the hindered ethyl nucleotide is in the S conformation, referred to herein as S-cEt.

The iRNA of the present invention may also include one or more conformationally restricted nucleotides (CRNs). CRNs are nucleotide analogues with a linker,

- 30 045602 connecting the C2'- and C4'-carbons of ribose or the C3- and C5'-carbons of ribose. CRN locks the ribose ring into a stable conformation and increases affinity for mRNA upon hybridization. The linker is long enough to place the oxygen in the optimal position for stability and affinity, resulting in less bending of the ribose ring.

Illustrative publications that describe the production of certain of the above CRNs include, without limitation, US Patent Publication 2013/0190383; and PCT publication WO 2013/036868, the entire contents of each of which are hereby incorporated by reference herein.

One or more of the iRNA nucleotides of the present invention may also include a hydroxymethyl-substituted nucleotide. Hydroxymethyl-substituted nucleotide is an acyclic 2'-3'-seco-nucleotide, also called uncoupled nucleic acid (UNA) modification.

Illustrative US publications that describe the preparation of UNA include, without limitation, US Patent No. 8314227; and US Patent Publications No. 2013/0096289; 2013/0011922 and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference. Potential stabilizing modifications at the ends of RNA molecules may include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp -NHAc), thymidine-2'-O-deoxythymidine (ester), N(aminocaproyl)-4-hydroxyprolinol (Nur-C6-amino), 2-docosanoyl-uridine-3-phosphate, inverted base dT(idT), etc. A disclosure of this modification can be found in PCT Publication No. WO 2011/005861.

A. Modified mRNAs containing motifs of the present invention.

In some aspects of the present invention, the double-stranded RNAi agents of the present invention include agents with chemical modifications that are disclosed, for example, in US Provisional Patent Application No. 61/561,710, filed Nov. 18, 2011, or PCT/US2012/065691, complete contents each of which is hereby incorporated herein by reference.

As shown herein and in Provisional Application No. 61/561710 or PCT/US2012/065691, excellent results can be obtained by introducing one or more motifs of three identical modifications of three consecutive nucleotides into the sense strand and/or antisense strand of an RNAi agent, specifically at or near the cleavage site. In some embodiments, the sense strand and antisense strand of the RNAi agent may be otherwise completely modified. The introduction of such motifs disrupts the pattern of modifications, if any, of the semantic and/or antisense strand. The RNAi agent, for example the sense strand, may optionally be conjugated to a GalNAc derivative ligand. The resulting RNAi agents exhibit superior gene silencing activity.

More specifically, it has been unexpectedly discovered that in cases where the sense strand and antisense strand of a double-stranded RNAi agent are completely modified to have one or more motifs of three identical modifications of three consecutive nucleotides at or adjacent to the cleavage site of at least one strand of the RNAi agent with it, then the gene silencing activity of the RNAi agent was best enhanced.

Accordingly, the present invention provides double-stranded RNAi agents for inhibiting the expression of a target gene (ie, CFB, C3 or C9 gene) in vivo. The RNAi agent contains a sense strand and an antisense strand. Each strand of an RNAi agent can vary in length from 12 to 30 nucleotides. For example, each strand may be 14 to 30 nucleotides long, 17 to 30 nucleotides long, 25 to 30 nucleotides long, 27 to 30 nucleotides long, 17 to 23 nucleotides long, 17 to 21 nucleotide in length, 17 to 19 nucleotides in length, 19 to 25 nucleotides in length, 19 to 23 nucleotides in length, 19 to 21 nucleotides in length, 21 to 25 nucleotides in length, or 21 to 23 nucleotides in length.

The sense strand and antisense strand typically form a double-stranded RNA duplex (dsRNA), also referred to herein as an RNAi agent. The duplex region of the RNAi agent can be 12-30 base pairs in length. For example, a duplex region may be 14-30 bp in length, 17-30 bp in length, 27-30 bp in length, 17-23 bp in length, 17-21 bp in length, 17-19 bp nucleotides in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 and 27 nucleotides in length.

In one embodiment, the RNAi agent may contain one or more overhangs and/or blocking groups at the 3' end, 5' end, or both ends of one or both strands. The overhang may be 1-6 nucleotides in length, for example 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides V

- 31 045602 length, 2-3 nucleotides in length or 1-2 nucleotides in length. The protrusions may be the result of one thread being longer than the other, or two threads of the same length being staggered. The overhang may form a mismatch with the target mRNA, or it may be complementary to the gene sequences with which the target interaction occurs, or may have a different sequence. The first and second strands may also be connected, for example, by additional bases to form a hairpin or by other non-base linkers.

In one embodiment, each of the nucleotides in the overhang of the RNAi agent may independently be a modified or unmodified nucleotide, including, without limitation, a 2'-modified sugar such as 2-F, 2'-O-methyl, thymidine ( T), 2'-O-methoxyethyl-5methyluridine (Teo), T-O-methoxyethyladenosine (Aeo), 2-O-methoxyethyl-5-methylcytidine (m5Ceo) and any combinations thereof. For example, a CT can be a salient sequence for any end on any strand. The overhang may form a mismatch with the target mRNA, or it may be complementary to the gene sequences with which the target interaction occurs, or it may have a different sequence.

The 5' or 3' overhangs of the sense strand, antisense strand, or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang(s) comprise(s) two nucleotides with a phosphorothioate between the two nucleotides, wherein the two nucleotides may be the same or different. In one embodiment, the overhang is present at the 3' end of the sense strand, the antisense strand, or both. In one embodiment, this 3' overhang is present on the antisense strand. In one embodiment, this 3' overhang is present on the sense strand.

The RNAi agent may comprise only one protrusion, which can enhance the interfering activity of the RNAi without affecting its overall stability. For example, the single-stranded overhang may be located at the 3' end of the sense strand or, alternatively, at the 3' end of the antisense strand. RNAi may also have a blunt end located at the 5' end of the antisense strand (or 3' end of the sense strand) or vice versa. Typically, the RNAi antisense strand has a nucleotide overhang at the 3' end and a blunt end at the 5' end. Without wishing to be bound by theory, the asymmetric blunt end at the 5' end of the antisense strand and the overhang at the 3' end of the antisense strand facilitate the incorporation of the guide strand into the RISC process.

In one embodiment, the RNAi agent is a blunt-ended oligomer, 19 nucleotides in length, where the sense strand contains at least one motif of three 2'-F modifications of three consecutive nucleotides at positions 7, 8, 9 from 5' -end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In another embodiment, the RNAi agent is a blunt-ended oligomer, 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-F modifications of three consecutive nucleotides at positions 8, 9, 10 from 5 'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In yet another embodiment, the RNAi agent is a blunt-ended oligomer, 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-P modifications of three consecutive nucleotides at positions 9, 10, 11 from 5 'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In one embodiment, the RNAi agent comprises a sense strand of 21 nucleotides and an antisense strand of 23 nucleotides, where the sense strand contains at least one motif of three 2' P modifications of three consecutive nucleotides at positions 9, 10, 11 from 5'-end; the antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end, where one end of the RNAi agent is blunt while the other end contains a protrusion from 2 nucleotides. Preferably, the 2-nucleotide overhang is at the 3' end of the antisense strand. In cases where a 2-nucleotide overhang is at the 3' end of the antisense strand, there may be two phosphorothioate internucleotide bonds between the terminal three nucleotides, with two of the three nucleotides being overhanging nucleotides and the third nucleotide being a paired nucleotide adjacent to the overhanging nucleotide. In one embodiment, the RNAi agent further comprises two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5' end of the sense strand and the 5' end of the antisense strand. In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent, including nucleotides that are part of motifs, are modified nucleotides. In one embodiment, each residue is independently modified with 2'-O-methyl or 3'-fluoro, for example in an alternating motif. Optionally, the RNAi agent further contains a ligand (preferably GalNAC ₃ ).

In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein

- 32 045602 the sense strand is 25-30 nucleotide residues in length, in which, starting from the 5'-terminal nucleotide (position 1), positions 1 to 23 of the first strand contain at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3'-terminal nucleotide, contains at least 8 ribonucleotides at positions paired with positions 1-23 of the sense strand to form a duplex; wherein at least the 3'-terminal nucleotide of the antisense strand is unpaired with the sense strand and up to 6 consecutive 3'-terminal nucleotides are unpaired with the sense strand, thereby forming a 3'-single-stranded overhang of 1-6 nucleotides; where the 5' end of the antisense strand contains 10-30 consecutive nucleotides unpaired with the sense strand, thereby forming a 5' single-stranded overhang of 10-30 nucleotides; wherein at least the 5'-terminal and 3'-terminal nucleotides of the sense strand are base-paired with nucleotides of the antisense strand, the sense and antisense strands being aligned for maximum complementarity, thereby forming a substantially duplex region between the sense and antisense strands; and the antisense strand is sufficiently complementary to the target RNA over a length of at least 19 ribonucleotides of the antisense strand to reduce expression of the target gene upon introduction of the double-stranded nucleic acid into a mammalian cell; and wherein the sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides, wherein at least one of the motifs occurs at or adjacent to a cleavage site. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at or near the cleavage site.

In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand with a length that is at least 25 and at most 29 nucleotides, and a second strand with a length that is at most 30 nucleotides, at least at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end; wherein the 3' end of the first strand and the 5' end of the second strand form a blunt end, and the second strand is 1-4 nucleotides longer at the 3' end than the first strand, wherein the duplex region is at least 25 nucleotides in length, and the second strand is sufficiently complementary to the target mRNA for at least 19 nucleotides of the length of the second strand to reduce expression of the target gene, wherein the RNAi agent is introduced into the mammalian cells, and wherein cleavage of the RNAi agent by a dicer preferably results in an siRNA containing 3' end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further contains a ligand.

In one embodiment, the sense strand of the RNAi agent comprises at least one motif of three identical modifications of three consecutive nucleotides, where one of the motifs is located at a cleavage site in the sense strand.

In one embodiment, the antisense strand of the RNAi agent may also contain at least one motif of three identical modifications of three consecutive nucleotides, where one of the motifs is at or adjacent to a cleavage site in the sense strand.

For an RNAi agent with a duplex region of 17-23 nucleotides in length, the antisense strand cleavage site is typically located at approximately 10, 11, and 12 positions from the 5' end. Thus, motifs from three identical modifications can be located in positions 9, 10, 11; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions or 13, 14, 15 positions of the antisense chain, while the counting starts from the 1st nucleotide from the 5' end of the antisense chain or the counting starts from the 1st paired nucleotide in the duplex region from the 5' end of the antisense chain. The cleavage site on the antisense strand may also vary according to the length of the RNAi duplex region from the 5' end.

The sense strand of an RNAi agent may contain at least one motif of three identical modifications to three consecutive nucleotides at a strand cleavage site; and the antisense strand may be characterized by at least one motif of three identical modifications to three consecutive nucleotides at or near the strand cleavage site. In cases where the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand may be aligned such that one three-nucleotide motif on the sense strand and one three-nucleotide motif on the antisense strand have at least one nucleotide overlap , i.e. at least one of the three motif nucleotides in the sense strand forms a base pair with at least one of the three motif nucleotides in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

In one embodiment, the sense strand of an RNAi agent may contain multiple motifs of three identical modifications of three consecutive nucleotides. The first motif may be at or near the strand cleavage site, and the other motifs may be flanking modifications. The expression flanking modification as used herein means a motif occurring in another part of the chain that is separate from a motif at or near a cleavage site on the same chain. The flanking modification is either adjacent to the first motif or separated by at least one or more nucleotides. In cases where the motives are directly adjacent to each other,

- 33 045602 then the chemical structures of the motifs are different from each other, and when the motifs are separated by one or more nucleotides, then the chemical structures may be the same or different. Two or more flanking modifications may be present. For example, when two flanking modifications are present, each flanking modification may be at one end of a first motif that is at or adjacent to the cleavage site or on both sides of the leading motif.

Like the sense strand, the antisense strand of an RNAi agent may contain multiple motifs of three identical modifications of three consecutive nucleotides, with at least one of the motifs located at or near a strand cleavage site. A given antisense strand may also contain one or more flanking modifications, in alignment similar to flanking modifications that may be present on the sense strand.

In one embodiment, the flanking modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or first two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.

In another embodiment, the flanking modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or first two paired nucleotides in the duplex region at the 3' end, 5' end, or both ends of the strand.

In cases where the sense strand and antisense strand of the RNAi agent each contain at least one flanking modification, the flanking modifications may occur at the same end of the duplex region and have an overlap of one, two, or three nucleotides.

In cases where the sense strand and antisense strand of the RNAi agent each contain at least two flanking modifications, the sense strand and antisense strand can be aligned such that two modifications, each from the same strand, fall on one end of the duplex region with an overlap of one, two or three nucleotides; two modifications, each from the same strand, fall at the other end of the duplex region with an overlap of one, two or three nucleotides; two modifications of the same strand fall on either side of the leading motif with an overlap of one, two, or three nucleotides in the duplex region.

In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent, including nucleotides that are part of motifs, can be modified. Each nucleotide may be modified by the same or a different modification, which may include one or more changes to one or both of the unlinked phosphate oxygen atoms and/or one or more linked phosphate oxygen atoms; changing the ribose sugar component, for example, the 2'-hydroxyl in the ribose sugar; complete replacement of the phosphate fragment with dephosphorized linkers; modification or replacement of a naturally occurring base; and replacement or modification of a ribose phosphate backbone.

Since nucleic acids are polymers of subunits, many of the modifications occur at a position that is repeated in the nucleic acid, such as modification of a base, or a phosphate moiety, or an unlinked O phosphate moiety. In some cases the modification will occur at all positions in the nucleic acid under consideration, but in many cases it will not. As an example, the modification may occur only at the 3' or 5' terminal position, may occur only at the terminal region, for example, at the terminal nucleotide position or in the last 2, 3, 4, 5 or 10 nucleotides of the chain. The modification may occur in a double-stranded region, a single-stranded region, or both. The modification may occur only in a double-stranded region of RNA or may occur only in a single-stranded region of RNA. For example, a phosphorothioate modification at the unbound O position may occur at only one or both ends, may occur only at a terminal region, such as the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of a chain, or may occur in a double-stranded and single-stranded regions, in particular at the end. The 5' end or ends may be phosphorylated.

This may be possible, for example, to improve stability, to incorporate specific bases into overhangs, or to incorporate modified nucleotides or nucleotide substituents into single-stranded overhangs, such as the 5' or 3' overhang or both. For example, it may be desirable to include purine nucleotides in the protrusions. In some embodiments, all or some of the bases in the 3' or 5' overhang may be modified, for example, using the modifications described herein. Modifications may include, for example, the use of modifications at the 2' position of the ribose sugar using modifications that are known in the art, for example, the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro- (2'-F) or 2'- O-methyl modified instead of the ribose sugar nitrogenous base, and modification of the phosphate group, for example, phosphorothioate modification. The overhangs may not be homologous to the target sequence.

In one embodiment, each sense strand and antisense strand residue is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-Oallyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl or 2'-fluoro. Chains may contain several modifications. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

At least two different modifications are typically present in the sense strand and the antisense strand. These two modifications may be 2'-O-methyl or 2'-fluoro modifications or others.

In one embodiment, Na and/or Nb has alternating pattern modifications. The expression alternating motif, as used herein, means a motif with one or more modifications, each modification occurring at alternating nucleotides on the same strand. The expression alternating nucleotide can mean one for every two nucleotides, or one for every three nucleotides, or a similar pattern. For example, if A, B, and C each represent one type of nucleotide modification, then the alternating motif could be AVAVAVAVAVAV..., AAVVAAVVAAVV..., AAVAAVAAVVAAV..., AAAAAAAAAAAV..., AAAVVVAAVVVV... or ABCAWSAWSAVS. .. etc.

The type of modifications contained in the alternating motif may be the same or different. For example, if each of A, B, C, D represents one type of nucleotide modification, then the alternating pattern, i.e. modifications of every second nucleotide may be the same, but each of the sense strand or antisense strand may be selected from several possible modifications in an alternating motif, such as ABABAB..., ACACAC..., BDBDBD... or CDCDCD... . etc.

In one embodiment, the RNAi agent of the present invention comprises a modification pattern for a sense strand alternating motif that is shifted relative to the modification pattern for an antisense strand alternating motif. The shift may be such that a modified group of nucleotides of the sense chain corresponds to a group of nucleotides of the antisense chain modified in a different way and vice versa. For example, when pairing a sense strand with an antisense strand in a dsRNA duplex, the alternating motif in the sense strand may begin with ABABAB from the 5'-3' end of the strand, and the alternating motif in the antisense strand may begin with BABABA from the 5'-3' end of the strand. duplex plot. As another example, an alternating motif in the sense strand may begin with AABBAABB from the 5'-3' end of the strand, and an alternating motif in the antisense strand may begin with BBAABBAA from the 5'-3' end of the strand in the duplex region, so that between between the sense chain and the antisense chain, there is a complete or partial shift in modification patterns.

In one embodiment, the RNAi agent initially contains a pattern of alternating 2'-O-methyl modification and 2'-P modification motifs on the sense strand and initially has a shift in the pattern of alternating 2'-O-methyl modification and 2'- modification motifs. F-modifications in the antisense strand, i.e., a 2'-O-methyl-modified nucleotide in base pairs in the sense strand with a 2'-F-modified nucleotide in the antisense strand and vice versa. 1 position in the sense strand may begin with a 2'-F modification, and 1 position in the antisense strand may begin with a 2'-Omethyl modification.

The introduction of one or more motifs of three identical modifications of three consecutive nucleotides into the sense strand and/or antisense strand disrupts the original pattern of modifications present in the sense strand and/or antisense strand. Such disruption of the sense and/or antisense strand modification pattern by introducing one or more motifs of three identical modifications of three consecutive nucleotides into the sense and/or antisense strand unexpectedly increases gene silencing activity against the target gene.

In one embodiment, in cases where a motif of three identical modifications of three consecutive nucleotides is introduced into any of the strands, the modification of the nucleotide following the motif is a modification other than the modification of the motif. For example, part of the sequence containing the motif is ...NaYYYNb..., where Y represents a modification of the motif of three identical modifications of three consecutive nucleotides, and Na and Nb represent a modification of the nucleotide following the YYY motif, which is different from the modification Y, and where Na and Nb can be the same or different modifications. Alternatively, Na and/or Nb may or may not be present when the flanking modification is present.

The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. Modification of a phosphorothioate or methylphosphonate internucleotide bond can occur at any nucleotide of the sense strand, or the antisense strand, or both, at any position in the chain. For example, modification of an internucleotide bond may occur at each nucleotide of the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern in the sense strand and/or antisense strand; either the sense strand or the antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating internucleotide linkage modification pattern of the sense strand may be the same or different from the antisense strand, and the alternating internucleotide linkage modification pattern of the sense strand may be characterized by a shift relative to the alternating internucleotide linkage modification pattern of the antisense strand. In one

- 35 045602 embodiment, the double-stranded RNAi agent contains 6-8 phosphorothioate internucleotide bonds. In one embodiment, the antisense strand contains two phosphorothioate internucleotide bonds at the 5' end and two phosphorothioate internucleotide bonds at the 3' end, and the sense strand contains at least two phosphorothioate internucleotide bonds at either the 5' end or the 3' end.

In one embodiment, RNAi has a modification of a phosphorothioate or methylphosphonate internucleotide linkage at the overhang. For example, the overhang may contain two nucleotides with a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications can also be made to connect overhanging nucleotides to terminal paired nucleotides in a duplex region. For example, at least 2, 3, 4, or all of the overhanging nucleotides may be linked through a phosphorothioate or methylphosphonate internucleotide linkage, and optionally, additional phosphorothioate or methylphosphonate internucleotide linkages may be present connecting the overhanging nucleotide to a paired nucleotide that follows the overhanging nucleotide. For example, there may be at least two phosphorothioate internucleotide bonds between the terminal three nucleotides, where two of the three nucleotides are overhang nucleotides and the third is a paired nucleotide adjacent to the overhang nucleotide. These terminal three nucleotides may be at the 3' end of the antisense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and/or the 5' end of the antisense strand.

In one embodiment, a 2-nucleotide overhang is located at the 3' end of the antisense strand and two phosphorothioate internucleotide bonds are present between the terminal three nucleotides, wherein two of the three nucleotides are overhanging nucleotides and the third nucleotide is a paired nucleotide adjacent to the overhanging nucleotide. Optionally, the RNAi agent may additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5' end of the sense strand and the 5' end of the antisense strand.

In one embodiment, the RNAi agent comprises the target mismatch(es) in the duplex or combinations thereof. The mismatch may occur in a protruding region or a duplex region. Base pairs can be ordered based on their propensity to promote dissociation or melting (e.g., by the free energy of association or dissociation of a particular pairing; the simplest approach is to study the pairs on an individual base pair basis, although next-adjacent analysis or similar can also be performed). In terms of promoting dissociation: A:U is more preferable than G:C; G:U is more preferable than G:C; and T:C is preferred over G:C (1=inosine). Mismatches, such as non-canonical or non-canonical mating types (which are described elsewhere in this document), are preferred over canonical mating types (A:T, A:U, G:C); and pairing types that include universal bases are preferred over canonical pairing types.

In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4 or 5 base pairs in duplex regions from the 5' end of the antisense strand independently selected from the group consisting of: A:U, G:U , T:C and mismatched pairs, such as non-canonical or non-canonical mating types or mating types that include universal bases, to promote dissociation of the antisense strand at the 5' end of the duplex.

In one embodiment, the nucleotide at position 1 in the duplex region from the 5' end in the antisense strand is selected from the group consisting of A, dA, dU, U and dT. Alternatively, at least one of the first 1, 2 or 3 base pairs in the duplex region from the 5' end of the antisense strand is an AU base pair. For example, the first base pair in the duplex region from the 5' end of the antisense strand is the AU base pair.

In another embodiment, the nucleotide at the 3' end of the sense strand is deoxy-thymine (dT). In another embodiment, the nucleotide at the 3' end of the antisense strand is deoxy-thymine (dT). In one embodiment, a short sequence of deoxy-thymine nucleotides is present, for example, two dT nucleotides at the 3' end of the sense and/or antisense strand.

In one embodiment, the sequence of the sense chain can be represented by formula (I):

5' np-Na-(X X X )i-Nb-Y Y Y -Nb-(Z Ζ Ζ )j-Na-nq 3' (I) where each of i and j is independently equal to 0 or 1;

each of p and q is independently equal to 0-6;

each of Na independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, with each sequence containing at least two nucleotides modified in various ways;

each Nb independently represents an oligonucleotide sequence containing 0-10 modified nucleotides;

- 36 045602 each of pr and nq independently represents a protruding nucleotide;

where Nb and Y have different modifications; and each of XXX, YYY and ZZZ independently represents one motif of three identical modifications of three consecutive nucleotides. Preferably, in YYY all nucleotides are 2'X-modified.

In one embodiment, Na and/or Nb has alternating pattern modifications.

In one embodiment, the YYY motif is located at or adjacent to a sense strand cleavage site. For example, if the RNAi tool contains a duplex region that is 17-23 nucleotides in length, the YYY motif may be at or near the cleavage site (e.g., may be at positions 6, 7, 8; 7, 8, 9; 8 , 9, 10; 9, 10, 11; 10, 11, 12 or 11, 12, 13) in the sense strand, with the counting starting from the 1st nucleotide from the 5' end or, optionally, the counting starting from the 1st th paired nucleotide in the duplex region from the 5' end.

In one embodiment, i is 1, a j is 0, or i is 0, a j is 1, or both i and j are 1. The semantic chain can thus be represented by the following formulas:

5' np-Na-YYY-Nb-ZZZ-Na-nq 3' (lb);

5' np-Na-XXX-Nb-YYY-Na-nq 3' (1c) or

5' np-Na-XXX-Nb-YYY-Nb-ZZZ-Na-nq 3' (Id).

In cases where the sense strand is represented by formula (Ib), Nb is an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the sense strand is represented by formula (Ic), Nb is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the sense strand is represented by formula (Id), each Nb independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Preferably, N _b is 0, 1, 2, 3, 4, 5 or 6. Each Na can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Each of X, Y and Z can be the same or different from the others.

In other embodiments, i is 0 and j is 0, and the semantic chain can be represented by the formula

5' Pr-Na-YYY- Na-nq 3' (la).

In cases where the sense strand is represented by formula (Ia), each Na can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In one embodiment, the RNAi antisense strand sequence may be represented by Formula (II)

5' nq'-Na'-(Z'Z'Z')k-Nb'-Y'Y'Y'-Nb'-(X'X'X')l-N'a-np' 3' ( ii) where each of k and l is independently equal to 0 or 1;

each of p' and q' is independently equal to 0-6;

each of Na' independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, with each sequence containing at least two nucleotides modified in various ways;

each of Nb' independently represents an oligonucleotide sequence containing 0-10 modified nucleotides;

np' and nq' are each independently an overhanging nucleotide;

where Nb' and Y' have different modifications; and each of X'X'X', ΥΎΎ' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides.

In one embodiment, Na' and/or Nb' have alternating pattern modifications.

The Y'Y'Y' motif is located at or near the antisense strand cleavage site. For example, if the RNAi agent contains a duplex region that is 17-23 nucleotides in length, then the ΥΎΎ' motif may be at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14 or 13, 14, 15 of the antisense strand, wherein the counting starts from the 1st nucleotide from the 5' end or, optionally, the counting starts from the 1st paired nucleotide in the duplex region from the 5' end. Preferably, the Y'Y'Y' motif is at positions 11, 12, 13.

- 37 045602

In one embodiment, in the ΎΎ'Ύ' motif, all nucleotides are 2'-OMe-modified.

In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

The antisense strand can thus be represented by the following formulas:

5' nq'-Na'-Z'Z'Z'-Nb'-Y'Y'Y'-Na'-np' 3' (IIb);

5' n _q '-Na'-YYY-Nb'-X'X'X'-n _P '3' (Ps) or

5' n _q '-Na'- Z'Z'Z'-Nb'-Y'Y'Y'-Nb'- X'X'X'-N _a '-n _P '3' (lid).

In cases where the antisense strand is represented by formula (IIb), Nb' is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the antisense strand is represented by formula (IIc), Nb' is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the antisense strand is represented by formula (IId), each of the Nb' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 02 or 0 modified nucleotides. Each Na' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides. Preferably, Nb is 0, 1, 2, 3, 4, 5 or 6.

In other embodiments, k is 0 and l is 0, and the antisense strand can be represented by the formula

5'np'-Na'-ΥΎΎ ¹ -Na ^,_ n _q '3' (la).

In cases where the antisense strand is represented by formula (IIa), each Na' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Each of X', Ύ' and Z' may be the same or different from the others.

Each nucleotide of the sense strand and antisense strand can independently be modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl or 2' fluorine For example, each nucleotide of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro. X, Ύ, Z, X', Ύ' and Z' can each, in particular, be a 2'-Omethyl modification or a 2'-fluoro modification.

In one embodiment, the sense strand of the RNAi agent may contain a ΎΎΎ motif located at positions 9, 10, and 11 of the strand in cases where the duplex region is 21 nucleotides, counting from the 1st nucleotide from the 5' end or, optional, counting starts from the 1st paired nucleotide in the duplex region from the 5' end; and Ύ represents a 2'^-modification. The sense strand may further contain an XXX motif or ZZZ motifs as flanking modifications at the opposite end of the duplex region; and each of XXX and ZZZ is independently a 2'-OMe modification or a 2'^ modification.

In one embodiment, the antisense strand may contain a Ύ'Ύ'Ύ' motif located at positions 11, 12, 13 of the strand, with the count starting at the 1st nucleotide from the 5' end or, optionally, the counting starting at the 1st a paired nucleotide in the duplex region from the 5' end; and Ύ' represents a 2'-O-methyl modification. The antisense strand may further contain an X'X'X' motif or Z'Z'Z' motifs as flanking modifications at the opposite end of the duplex region; and each of X'X'X' and Z'Z'Z' is independently a 2'-OMe modification or a 2'-F modification.

The sense strand represented by any of the above formulas (Ia), (Ib), (Ic) and (Id) forms a duplex with the antisense strand represented by any of the formulas (IIa), (IIb), (IIc) and (IId), respectively.

Accordingly, RNAi agents for use in the methods of the present invention may comprise a sense strand and an antisense strand, each strand containing from 14 to 30 nucleotides, the RNAi duplex represented by formula (III) sense:

antisense:

5' np -Na-(X X X)i -Nb- Υ Y Y -Nb -(Ζ Z Z)j-Na-nq 3'

3' np'-Na'-(X'X'X')k-Nb'-YYY'-Nb'-(Z'Z'Z')l-Na'-nq' 5' (ΙΠ) where each i, j, k and l are independently equal to 0 or 1;

each of p, p', q and q' is independently equal to 0-6;

each of Na and Na' independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, with each sequence containing at least two nucleotides modified in various ways;

- 38 045602 each of Nb and Nb' independently represents an oligonucleotide sequence containing 0-10 modified nucleotides; wherein each of np', np, nq' and nq, each of which may or may not be present, is independently an overhanging nucleotide; and each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides.

In one embodiment, i is 0 and j is 0; or i equals 1 and j equals 0; or i equals 0 and j equals 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k equals 1 and l equals 0; k is 0 and l is 1; or both k and l are 0; or both k and l equal 1.

Exemplary combinations of sense strand and antisense strand forming an RNAi duplex include the formulas below:

5' pr - Na -Y Y Y -Na-nq 3'

3' np'-Na'-ΥΎΎ' -Na'nq' 5' (Sha)

5' pr -Na -Y Y Y -Nb -Ζ Ζ Z -Na-nq 3'

3' np'-Na'-YYY'-Nb'-Z'Z'Z'-Na'nq' 5' (Illb)

5' np-Na- X X X -Nb -Y Y Y - Na-nq 3'

3' np'-Na'-X'X'X'-Nb'-Y'YY'-Na'-nq' 5' (Shs)

5' np -Na -XXX -Nb-Y Y Y -Nb- ZZZ -Na-nq 3'

3' np'-Na'-X'X'X'-Nb'-Y'Y'Y'-Nb'-Z'Z'Z'-Na-nq' 5' (Illd)

In cases where the RNAi agent is represented by formula (IIIa), each Na is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the RNAi agent is represented by formula (IIIb), each of the Nb independently represents an oligonucleotide sequence containing 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each Na is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the RNAi agent is represented by formula (IIIc), each of Nb, Nb' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 02 or 0 modified nucleotides. Each Na is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the RNAi agent is represented by form (IIId), each of Nb, Nb' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 02 or 0 modified nucleotides. Each of Na, Na' independently represents an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides. Each of Na, Na', Nb and Nb' independently contains modifications of the alternating pattern.

Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc) and (IIId) may be the same or different from the others.

In cases where the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides base pair with the corresponding Y' nucleotides; or all three of the Y nucleotides form base pairs with the corresponding Y' nucleotides.

In cases where the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides base pair with the corresponding Z' nucleotides; or all three of the Z nucleotides form base pairs with the corresponding Z' nucleotides.

In cases where the RNAi agent is represented by formula (IIIc) or (IIId), at least one of the nucleotides X may form a base pair with one of the nucleotides X'. Alternatively, at least two of the X nucleotides base pair with the corresponding X' nucleotides; or all three of the X nucleotides form base pairs with the corresponding X' nucleotides.

In one embodiment, the modification of nucleotide Y is different from the modification of nucleotide Y', the modification of nucleotide Z is different from the modification of nucleotide Z', and/or the modification of nucleotide X is different from the modification of nucleotide X'.

In one embodiment, when the RNAi agent is represented by formula (IIId), the Na modifications are 2'-O-methyl or 2'-fluoro modifications. In another embodiment, where the RNAi agent is represented by formula (IIId), the Na modifications are 2'-Omethyl or 2'-fluoro modifications, and np'>0, and at least one np' is connected to an adjacent nucleotide via a phosphorothioate bond. In yet another embodiment, where the RNAi agent is represented by formula (IIId), the Na modifications are 2'-O-methyl or 2'-fluoro modifications, np'>0, and at least one np' is connected to adjacent nucleotide via a phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker (described below). In another embodiment, in cases where the RNAi agent is represented by formula (IIId), the Na modifications are 2'-O-methyl or 2'-fluoro modification, np'>0, and at least one np' is linked to an adjacent nucleotide by a phosphorothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In one embodiment, where the RNAi agent is represented by formula (IIIa), the Na modifications are 2'-O-methyl or 2'-fluoro modifications, np'>0, and at least one np' is connected to an adjacent nucleotide via a phosphothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), where the duplexes are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further contains a ligand. Each of the duplexes may target the same gene or two different genes, or each of the duplexes may target the same gene at two different target sites.

In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), where the duplexes are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further contains a ligand. Each of the duplexes may target the same gene or two different genes, or each of the duplexes may target the same gene at two different target sites.

In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId) are connected to each other at the 5' end, and one or both 3' ends are optionally conjugated with a ligand. Each of the agents may target the same gene or two different genes, or each of the agents may target the same gene at two different target sites.

Various publications describe multimeric RNAi agents that can be used in the methods of the present invention. Such publications include WO 2007/091269, US Patent No. 7858769, WO 2010/141511, WO 2007/117686, WO 2009/014887 and WO 2011/031520, the entire contents of which are therefore incorporated herein by reference.

As described in more detail below, an RNAi agent containing one or more carbohydrate moieties conjugated to the RNAi agent can improve one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to the modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of the dsRNA agent can be replaced by other moieties, for example, a non-carbohydrate (preferably cyclic) carrier to which the carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been substituted in this manner is referred to herein as a ribose modified-substitution subunit (RRMS). The cyclic support may be a carbocyclic ring system, i.e. all atoms in the ring are carbon atoms, or a heterocyclic ring system, i.e. one or more atoms in the ring can be heteroatoms, for example nitrogen, oxygen, sulfur. The cyclic support may be a monocyclic ring system or may contain two or more rings, for example fused rings. The cyclic support may be a fully saturated ring system or it may contain one or more double bonds.

The ligand can be attached to the polynucleotide via a carrier. The supports include (i) at least one attachment point to the frame, preferably two attachment points to the frame, and (ii) at least one linking attachment point. The expression point of attachment to the backbone, as used herein, means a functional group, such as a hydroxyl group, or, generally, a bond accessible and suitable for introducing a support into the backbone, for example, a phosphate or a modified phosphate, for example, a sulfur-containing ribo backbone

- 40 045602 nucleic acid. The term binding attachment point (TAP) in some embodiments means a ring atom of a cyclic support, such as a carbon atom or a heteroatom (other than the atom that provides the point of attachment to the backbone) to which the selected moiety binds. The moiety may be, for example, a carbohydrate, such as a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected fragment is interconnected to a cyclic carrier. Thus, the cyclic support will often include a functional group, such as an amino group, or typically provide a linkage that is suitable for introducing or linking another chemical building block, such as a ligand, to the constituent ring.

RNAi agents can be conjugated to a ligand via a carrier, where the carrier can be a cyclic group or an acyclic group; preferably the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]-dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably the acyclic group is selected from a serinol backbone or a diethanolamine backbone.

In certain specific embodiments, the RNAi agent for use in the methods of the present invention is an agent selected from the group of agents listed in any of the tables. 3-8. Such agents may further contain a ligand.

IV. mRNAs conjugated to ligands.

Another modification of RNA among the mRNAs of the present invention includes chemical binding to one or more RNA ligands, fragments or conjugates that enhance the activity, cellular distribution or cellular uptake of the mRNA. Such moieties include, but are not limited to, lipid moieties such as cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem Let., 1994, 4:10531060), a thioester, for example, beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chain, such as dodecanediol or undecyl residues (Saison Behmoaras et al. ., EMbO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett, 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipid, e.g. -hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:36513654; Shea et al., Nucl. Acids Res ., 1990, 18:3777-3783), a polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973) or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine, or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Then, 1996, 277:923-937).

In one embodiment, the ligand modifies the distribution, targeting, or lifetime of the mRNA agent into which it is introduced. In preferred embodiments, the ligand provides increased affinity for a selected target, e.g., a molecule, cell or cell type, compartment, e.g., a cellular compartment, or part of an organ, tissue, organ, or body site, e.g., compared to species that lack such ligand . Preferred ligands will not participate in duplex pairing in a duplex nucleic acid.

Ligands may include a naturally occurring substance such as a protein (eg, human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (eg, dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine or hyaluronic acid) or lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, such as a synthetic polyamino acid. Examples of polyamino acids include polyamino acid polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, L-lactide-glycolide copolymer, divinyl ether-maleic anhydride copolymer, N-( 2hydroxypropyl) meacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethyl acrylic acid), N-isopropylacrylamide polymers or polyphosphazine. Examples of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide polyamine, polyamine peptidomimetic, polyamine dendrimer, arginine, amidine, protamine, cationic lipid, cationic porphyrin, polyamine quaternary salt, or alpha helical peptide.

Ligands also include targeting moieties, such as a cell or tissue targeting agent, such as a lectin, glycoprotein, lipid, or protein, such as an antibody, that binds to a specific cell type, such as a kidney cell. The targeting group may be thyrotropin, melanotropin, lectin, glycoprotein, surface protein A, carbohydrate mucin, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose,

- 41 045602 polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, vitamin A, biotin or RGD peptide, or RGD peptide mimetic.

Other examples of ligands include dyes, intercalating agents (e.g., acridines), cross-linkers (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphirin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules, e.g. cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol , heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine and peptide conjugates (e.g. antennapedia peptide, Tat-peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g. PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption aides (e.g. aspirin, vitamin E, folic acid), synthetic ribonucleotides (e.g. imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3 complex ⁺ tetraazamacrocycles), dinitrophenyl, HRP or AP.

Ligands may be proteins, such as glycoproteins, or peptides, such as molecules with a specific affinity for a co-ligand, or antibodies, such as an antibody that binds to a specific cell type, such as a liver cell. Ligands may also include hormones and hormone receptors. They may also include species other than peptides, such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent glucose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose or polyvalent fucose. The ligand, for example, may be a lipopolysaccharide, a p38 MAP kinase activator, or an NF-kB activator.

The ligand may be a substance, such as a drug, that can increase the uptake of the mRNA agent into a cell, for example by disrupting the cytoskeleton of the cell, for example by disrupting microtubules, microfilaments and/or intermediate filaments of the cell. The drug, for example, may be taxon, vincristine, vinblastine, cytochalasin, nocodazole, yaplakinolide, latrunculin A, phalloidin, swingolide A, indanocin or myoservin.

In some embodiments, the ligand is attached to the mRNA, as described herein, and acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophils, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, vitamins, etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkyl glycerides, diacyl glyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, etc. Oligonucleotides that contain some phosphorothioate linkages are also known to bind to whey protein, thus short oligonucleotides, e.g., oligonucleotides of approximately 5 bases, 10 bases, 15 bases, or 20 bases, containing many phosphorothioate linkages in the backbone are also useful in the present invention as ligands (eg as PK-modulating ligands). In addition, aptamers that bind to serum moieties (eg, whey proteins) are also suitable for use as PK-modulating ligands in the embodiments described herein.

Ligand-conjugated oligonucleotides of the present invention can be synthesized using an oligonucleotide that carries pendant reactive functionality, such as those derived from the attachment of a binding molecule to the oligonucleotide (described below). This reactive oligonucleotide can be directly reacted with commercially available ligands, ligands that are synthesized to have any of a variety of protecting groups, or ligands that have a linking moiety attached to it.

The oligonucleotides used in the conjugates of the present invention can be prepared conveniently and conventionally by well known solid phase synthesis. Equipment for such synthesis is sold by several suppliers, including, for example, Applied Biosystems (Foster City, Calif.). Additionally or alternatively, any other means for such synthesis known in the art may be used. It is also known to use similar methods for the preparation of other oligonucleotides, such as phosphorothioates and alkylated derivatives.

Ligand-conjugated oligonucleotides and ligand-molecule carrying the sequence-specific linked nucleosides of the present invention, oligonucleotides and oligonucleosides can be assembled on a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already carry a binding moiety, ligand-nucleotide precursors or nucleoside-conjugates that already carry a ligand molecule, or building blocks that carry a ligand other than the nucleoside.

When using nucleotide conjugate precursors that already carry a binding moiety, the synthesis of the sequence-specific bound nucleosides is typically completed and the ligand molecule is then reacted with the binding moiety to form a ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized using an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates, in addition to standard phosphoramidites and non-standard phosphoramidites that are commercially available and commonly used in oligonucleotide synthesis.

A. Lipid conjugates.

In one embodiment, the ligand or conjugate is a lipid or a lipid-based molecule. Such lipids or lipid molecules preferentially bind to a serum protein, such as human serum albumin (HSA). The HSA-binding ligand allows the conjugate to be distributed into a target tissue, such as a target tissue other than the kidney tissue of the body. For example, the target tissue may be the liver, including liver parenchymal cells. Other molecules that can bind to HSA can also be used as ligands. For example, you can use naproxen or aspirin. The lipid or lipid ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport to the target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, such as HSA.

The lipid ligand can be used to inhibit, for example regulate, the binding of the conjugate to the target tissue. For example, a lipid or lipid ligand that binds more strongly to HSA is less likely to target the kidneys and thus less likely to be excreted from the body. A lipid or lipid ligand that binds less strongly to HSA can be used to target the conjugate to the kidneys.

In a preferred embodiment, the lipid ligand binds to HSA. Preferably, it binds to HSA with sufficient affinity such that the conjugate will preferentially distribute to tissue other than kidney tissue. However, it is preferable that the affinity is not so strong that HSA-ligand binding is irreversible.

In another preferred embodiment, the lipid ligand binds weakly or not at all to HSA, such that the conjugate will preferentially distribute to the kidney. Other moieties that target kidney cells can also be used instead of or in addition to lipid ligands.

In another aspect, the ligand is a moiety, such as a vitamin, that is taken up by a target cell, such as a proliferating cell. These are particularly suitable for the treatment of disorders characterized by unwanted proliferation of cells, for example of a malignant or benign type, for example cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include B vitamins, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients absorbed by target cells, such as liver cells. Also included are HAS and low-density lipoprotein (LDL).

B. Means that ensure penetration into the cell.

In another aspect, the ligand is a cell penetrating agent, preferably a helical cell penetrating agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it may be modified, including peptidyl mimetic, invertomers other than peptide or pseudopeptide linkages and the use of D-amino acids. The helical agent is preferably an alpha helical agent, which is preferably characterized by a lipophilic and lipophobic phase.

The ligand may be a peptide or a peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a specific three-dimensional structure similar to a naturally occurring peptide. Attachment of peptide and peptidomimetics to mRNA agents can affect the pharmacokinetic distribution of the mRNA, for example by increasing cellular recognition and absorption. The peptide or peptidomimetic fragment may be about 5-50 amino acids in length, such as about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acids in length.

The peptide or peptidomimetic, for example, can be a cell penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (eg, consisting primarily of Tyr, Trp, or Phe). The peptide moiety may be a peptide dendrimer, a hindered peptide, or a cross-linked peptide. In another alternative, the peptide fragment may include a hydrophobic membrane trafficking sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF with the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 23).

An RFGF analog (for example, the amino acid sequence AALLPVLLAAP (SEQ ID NO: 24) _containing a hydrophobic MTS can also be a targeting moiety. The moiety represents

- 43 045602 which is a peptide, can be a delivery peptide that can transport large polar molecules, including peptides, oligonucleotides and proteins, across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 25) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 26)) have been found to function as delivery peptides. The peptide or peptidomimetic may be encoded by random DNA sequences , such as a peptide identified from a phage display library or a one-bead-one-compound (SOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991).An example of a peptide or peptidomimetic associated with an agent representing The dsRNA, by means of an introduced monomeric unit for the purpose of targeting a cell, is an arginine glycine aspartic acid (RGD) containing peptide or RGD mimetic.The peptide fragment can be characterized by a length ranging from about 5 amino acids to about 40 amino acids. which are peptides, may be characterized by structural modification, such as to increase stability or control conformational properties. Any of the structural modifications described below can be applied.

The RGD peptide for use in the compositions and methods of the present invention may be linear or cyclic, and may be modified, for example, glycosylated or methylated to facilitate targeting to specific tissue(s). RGD-containing peptides and peptidomimetics may include D-amino acids as well as synthetic RGD mimetics. In addition to RGD, other fragments that target the integrin ligand can be used. Preferred conjugates with such a ligand target PECAM-1 or VEGF.

The cell-penetrating peptide is capable of penetrating a cell, for example, a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. The microbial cell penetrating peptide, for example, may be an α-helical linear peptide (e.g., LL-37 or Ceropin PI), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin, or bactenecin), or a peptide containing only one or two predominant amino acids (for example, PR-39 or indolicidin). The cell entry peptide may also include a cellular nuclear localization signal (NLS). For example, the cell entry peptide may be a two-component amphipathic peptide such as MPG, which is derived from the fusion domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31: 2717-2724, 2003).

C. Carbohydrate conjugates.

In some embodiments, the compositions and methods of the present invention provide an mRNA oligonucleotide further comprising a carbohydrate. Carbohydrate-conjugated mRNA is preferred for in vivo delivery of nucleic acids, as well as in compositions suitable for in vivo therapeutic use, as described herein. As used herein, carbohydrate refers to a compound that is either a carbohydrate per se, consisting of one or more monosaccharide units having at least 6 carbon atoms (which may be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom attached attached to each carbon atom; or a compound having a carbohydrate moiety as part thereof, consisting of one or more monosaccharide units having at least 6 carbon atoms (which may be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom attached to each carbon atom. Typical carbohydrates include sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8 or 9 monosaccharide units) and polysaccharides such as starches, cellulose, glycogen and polysaccharide gums. Certain monosaccharides include C5 or more (eg, C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars with two or three monosaccharide units (for example, C5, C6, C7 or C8).

In one embodiment, the carbohydrate conjugate for use in the compositions and methods of the present invention is a monosaccharide. In one embodiment, the monosaccharide is N-acetylgalactosamine, such as

In another embodiment, a carbohydrate conjugate for use in compositions and methods of

- 44 045602 of the present invention is selected from the group consisting of

- 45 045602

- 46 045602

- 47 045602

Formula XVII,

Formula XVIII,

Formula XIX,

Formula XX,

Formula XXI,

Formula XXII.

Other exemplary carbohydrate conjugates for use in the embodiments described herein include, but are not limited to

- 48 045602

(Formula XXIII) wherein one of X or Y is an oligonucleotide and the other is hydrogen.

In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell entry peptide.

D. Linkers.

In some embodiments, a conjugate or ligand described herein may be attached to an mRNA oligonucleotide by various linkers, which may be cleavable or non-cleavable.

The expression linker or linking group means an organic group that connects two parts of a compound, for example covalently attaching two parts of a compound. Linkers typically contain a straight bond or atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, SO2NH, or a chain of atoms such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl , alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroa rilalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynyl heterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl, where one or more methylene groups may be interrupted or removed at O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or an unsubstituted heterocycle; where R8 represents hydrogen, acyl, an aliphatic compound or a substituted aliphatic compound. In one embodiment, the linker is between about 1-24 carbon atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18, 7-17 , 8-17, 6-16, 7-16 or 8-16 atoms.

The cleavable linking group is fairly stable outside the cell, but upon entering the target cell it is cleaved, releasing two parts that the linker holds together. In a preferred embodiment, the cleavable linking group is cleavable by at least about 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in the target cell or first transmission condition (which may, for example, be selected to mimic or represent intracellular conditions) than in the subject's blood, or second transmission condition (which may, for example, be selected to simulate or represent conditions detected in blood or serum).

Cleavable linking groups are sensitive to cleavage agents, such as pH, redox potential, or the presence of degenerative molecules. Typically, degradants are more abundant or found at higher levels or activity within cells than in serum or blood. Examples of such degenerative agents include: reducing agents that are selected for specific substrates or that do not have substrate specificity, including, for example, oxidative or reducing enzymes or reducing agents such as mercaptans present in cells that can degrade the redox cleavable linking group by restoring - 49 045602; esterase; endosomes or agents capable of creating an acidic environment, such as those that result in a pH of five or less; enzymes that can hydrolyze or destroy an acid-cleavable linking group, acting as a normal acid, peptidases (which can be substrate specific) and phosphatases.

A cleavable linking group, such as a disulfide bond, may be pH sensitive. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from approximately 7.1 to 7.3. Endosomes are characterized by a more acidic environment with a pH in the range of 5.5-6.0, and lysosomes are characterized by an even more acidic environment with a pH in the range of 5.0. Some linkers will have a cleavable linking group that cleaves under preferred pH conditions, thereby releasing the cationic lipid from the ligand into the cell or into the desired cell compartment.

The linker may contain a cleavable linking group that is cleaved by a particular enzyme. The type of cleavable linking group introduced into the linker may depend on the target cell. For example, a liver-targeting ligand may be linked to a cationic lipid through a linker that contains an ester group. Liver cells are rich in esterases and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not rich in esterase. Other cell types rich in esterases include lung, renal cortex, and testicular cells.

Linkers containing peptide bonds can be used to target cell types rich in peptidase, such as liver cells and synoviocytes.

Typically, the suitability of a candidate cleavable linking group can be assessed by assessing the ability of the disrupting agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for its ability to resist cleavage in the blood or when brought into contact with other non-target tissues. In this way, the relative sensitivity to cleavage can be determined between the first and second condition, where the first is selected as an indicator of cleavage in the target cell and the second is selected as an indicator of cleavage in other tissues or biological fluids, such as blood or serum. Assessments may be performed in free cell systems, in cells, in cell culture, in organ or tissue culture, or in animals in general. It may be useful to make initial assessments in free-cell or culture conditions and confirm with further assessments in aggregate animals. In preferred embodiments, the beneficial candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times faster in the cell (or in vitro conditions chosen to mimic intracellular conditions) compared to blood or serum (or in vitro conditions chosen to mimic extracellular conditions).

i. Redox cleavable linking groups.

In one embodiment, the cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of a reductive cleavable linking group is a disulfide linking group (-S-S-). To determine the suitability of a candidate cleavable linking group to be a reducing cleavable linking group or, for example, to be suitable for use in a particular mRNA fragment and a particular targeting agent, the methods described herein can be used. For example, a candidate can be assessed by incubation with dithiothreitol (DTT) or other reducing agents using reagents known in the art that mimic the rate of degradation that can be observed in a cell, such as a target cell. The candidate may also be evaluated under conditions selected to mimic conditions in blood or serum. In one embodiment, the candidate compounds are cleaved to no more than about 10% in the blood. In other embodiments, beneficial candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times faster in a cell (or under in vitro conditions chosen to mimic intracellular conditions) compared to blood (or in vitro conditions chosen to mimic extracellular conditions). The rate of degradation of candidate compounds can be determined using standard enzyme kinetics assays under conditions selected to simulate the intracellular environment and compared to conditions selected to simulate the extracellular environment.

ii. i. Cleavable phosphate-based linking groups.

In another embodiment, the cleavable linker contains a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that destroy or hydrolyze the phosphate group. An example of an agent that breaks down phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are -O-P(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(O)(ORk )-O-, -O-P(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk)- O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -S-P(O)(Rk)-O-, -S-P(S)(Rk)-O- , -S-P(O)(Rk)-S-, -O-P(S)(Rk)-S-. Preferred embodiments are -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH) )-O-,

- 50 045602

-O-P(O)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P (O)(H)-O-, -O-P(S)(H)-O-,

-S-P(O)(H)-O, -S-P(S)(H)-O-, -S-P(O)(H)-S-, -O-P(S)(H)-S-. A preferred embodiment is -O-P(O)(OH)-O-. These candidates can be assessed using methods similar to those described above.

iii. i. Acid-cleavable linking groups.

In another embodiment, the cleavable linker contains an acid-cleavable linking group. An acid-cleavable linking group is a linking group that is cleaved in the presence of an acid. In preferred embodiments, the acid-cleavable linking groups are cleaved under acidic conditions at a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0 or lower), or with using means such as enzymes, which can act like ordinary acid. Specific organelles in the cell whose contents have a low pH value, such as endosomes and lysosomes, can provide conditions for the cleavage of acid-cleavable linking groups. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and amino acid esters. Acid-cleavable groups may have the general formula -C=NN, C(O)O, or

-OS(O). In a preferred embodiment, when a carbon is attached to an ester oxygen (alkoxy group), an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethyl-pentyl or tert-butyl is involved. These candidates can be assessed using methods similar to those described above.

iv. Ester-based linking groups.

In another embodiment, the cleavable linker contains an ester linking group. The cleavable ester linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of cleavable ester linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. Cleavable ester linking groups are represented by the general formula -C(O)O- or -OC(O)-. These candidates can be assessed using methods similar to those described above.

v. Peptide-based cleavable groups.

In another embodiment, the cleavable linker comprises a peptide-based cleavable linking group. The peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to form oligopeptides (eg, dipeptides, tripeptides, etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene or alkynene. A peptide bond is a special type of amide bond formed between amino acids to form peptides and proteins. A peptide-based cleavable group is typically limited to the peptide bond (ie, amide bond) formed between amino acids to form peptides and proteins, and does not include the entire amide functionality. The peptide-based cleavable linking groups are represented by the general formula -NHCHRAC(O)NHCHRBC(O)-, where RA and RB represent the R groups of two adjacent amino acids. These candidates can be assessed using methods similar to those described above. In one embodiment, the mRNA of the present invention is conjugated to a carbohydrate via a linker. Non-limiting examples of carbohydrate mRNA conjugates with linkers from the compositions and methods of the present invention include, but are not limited to

- 51 045602

(formulas XXVIII),

- 52 045602

(Formula XXXI) where one of X and Y is an oligonucleotide, the other is hydrogen.

In some embodiments of the compositions and methods of the present invention, the ligand is one or more GalNAc (N-acetylgalactosamine) derivatives attached via a divalent or trivalent branched linker.

In one embodiment, the dsRNA of the present invention is conjugated to a divalent and trivalent branched linker selected from the group of structures shown in any of formulas (XXXII)-(XXXV):

Formula XXXII

Formula XXXIII

BEHIND

Formula XXXIV Formula XXXV

Where q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C independently represent for each case 0-20 and where the repeat units may be the same or different;

each of P2A, P2B, P3A, P3B, P4A, P4B, P5A, P5B, P5C, T2A, T2B, T3A, T3B, T4A, T4B, T4A, T5B, T5C is absent independently for each case, rearranges CO, NH, O , S, OC(O), NHC(O),

- 53 045602

CH ₂ , CH2NH or CH ₂ O;

Q2A, Q2B, Q3A, Q3B, Q4A, Q4B, Q5A, Q5B, Q5C independently for each case absent, is an alkylene, a substituted alkylene, where one or more methylenes may be interrupted or terminated by one or more of O, S, S(O ), SO2, N(RN), C(R')=C(R), C=C or C(O);

each of R ^2A , R ^2B , R ^3A , R 3B , R ^4A , R ^4B , R ^5A , ^{R 5B ,} R ^5C is absent independently for each case, represents NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R ^a )C(O), -C(O)-CH(R ^a )-NH-, CO, CH=NO, o

whether heterocyclyl;

L2A, L2B, L3A, L3B, L4A, L4B, L5A, L5B and L5C are the ligand; those. each independently in each case is a monosaccharide (eg, GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide or polysaccharide; and Ra represents H or an amino acid side chain. Trivalent conjugated derivatives of GalNac are particularly useful for use with RNAi agents to inhibit target gene expression, such as those represented by formula (XXXV) formula XXXV

(VII) wherein L5A, L5B and L5C are a monosaccharide such as a GalNAc derivative.

Examples of suitable divalent and trivalent branched linker groups conjugated to GalNac derivatives include, but are not limited to, the structures listed above as formulas II, VII, XI, X and XIII.

Illustrative U.S. patents that describe the preparation of RNA conjugates include, but are not limited to, U.S. Patent No.

4828979;

4948882;5218105; 5525465; 5541313;5545730; 5552538; 5578717, 5580731;

5591584;5109124; 5118802; 5138045; 5414077; 5486603; 5512439; 5578718;

5608046; 4587044; 4605735; 4667025; 4762779; 4789737; 4824941; 4835263;

4876335; 4904582; 4958013; 5082830; 5112963; 5214136; 5082830; 5112963;

5214136; 5245022; 5254469; 5258506; 5262536; 5272250; 5292873; 5317098;

5371241, 5391723; 5416203, 5451463; 5510475; 5512667; 5514785;5565552;

5567810; 5574142; 5585.481; 5587371; 5595726; 5597696; 5599923; 5599928 and

5688941;6294664; 6320017; 6576752; 6783931; 6900297; 7037646; 8106022, the entire contents of each of which are hereby incorporated herein by reference.

It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the above modifications may be included in a single compound or even a single nucleoside within an mRNA. The present invention also includes mRNA compounds that are chimeric compounds.

Chimeric mRNA compounds or chimeras in the context of the present invention are mRNA compounds, preferably dsRNA, which contain two or more chemically different regions, each of which consists of at least one monomer, i.e. nucleotide in the case of a dsRNA junction. Such mRNAs typically contain at least one region where the RNA is modified to provide the mRNA with increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. Additionally, the mRNA region can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. As an example, RNase H is a cellular endonuclease that cleaves the RNA strand in an RNA:DNA duplex. Activation of RNase H consequently leads to cleavage of the target RNA, thereby significantly increasing the efficiency of mRNA inhibition on gene expression. Therefore, comparable results can often be obtained with shorter mRNAs when using chimeric dsRNAs compared to phosphorothioate ones

- 54 045602 deoxy hybridizations of dsRNA of the same target region. Cleavage of target RNA can usually be detected by gel electrophoresis and, if necessary, coupled nucleic acid hybridization techniques known in the art.

In some cases, an mRNA RNA may be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to mRNA to enhance the activity, cellular distribution or cellular uptake of the mRNA, and methods for performing such conjugations are available in the scientific literature. Such non-ligand moieties include lipid moieties such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), thioester, eg hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), thiocholesterol (Oberhauser et al., Nucl. Acids Res. , 1992, 20:533), an aliphatic chain, for example dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid such as di-hexadecyl-rac-glycerol or triethyl ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al. , Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969) or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229) or octadecylamine, or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Then, 1996, 277:923). Illustrative US patents that describe the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of RNAs bearing an amino linker at one or more positions in the sequence. The amino group then reacts with the molecule to be conjugated using appropriate combination or activating reagents. The conjugation reaction can be performed either with RNA still bound to the solid support or after cleavage of the RNA in solution phase. Purification of an RNA conjugate by HPLC generally results in a pure conjugate.

V. Delivery of iRNA according to the present invention.

Delivery of the iRNA of the present invention to a cell, for example a cell of a subject, such as a human subject (eg, a subject in need thereof, such as a subject with a complement component-related disease as described herein), can be accomplished in a variety of ways. For example, delivery can be accomplished by contacting a cell with the mRNA of the present invention either in vitro or in vivo. In vivo delivery can also be accomplished directly by administering a composition containing mRNA, eg dsRNA, to a subject. Alternatively, in vivo delivery can be accomplished indirectly by introducing one or more vectors that encode and direct the expression of the mRNA. Such alternative cases are described further below.

In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the mRNA of the present invention (see, for example, Akhtar S. and Julian R.L. (1992) Trends Cell. Biol. 2(5) : 139-144; and WO 94/02595, which are incorporated herein by reference in their entirety). With regard to in vivo delivery, factors that are considered in the context of delivery of an mRNA molecule include, for example, the biological stability of the delivered molecule, prevention of nonspecific action, and accumulation of the delivered molecule in the target tissue. The nonspecific effects of mRNA can be minimized by local administration, such as direct injection or tissue implantation, or topical administration of the drug. Local administration at the treatment site maximizes the local concentration of the agent, limits exposure of the agent to systemic tissues that may otherwise be damaged by the agent or that may degrade the agent, and allows for the administration of a lower total dose of the mRNA molecule. Several studies have shown effective knockdown of gene products when mRNA is administered locally. For example, intraocular delivery of dsRNA to VEGF has been shown by both intravitreal injections in cynomolgus monkeys (Tolentino, M.J., et al. (2004) Retina 24:132–138) and subretinal injections in mice (Reich, S.J., et al. al (2003) Mol Vis 9:210-216) prevent neovascularization in an experimental model of age-related macular degeneration. Additionally, direct intratumoral injection of dsRNA into mice reduces tumor volume (Pille, J., et al. (2005) Mol. Ther. 11:267274) and can prolong the survival of tumor-bearing mice (Kim, W.J., et al. (2006) Mol. Ther. 14:343-350; Li, S., et al. (2007) Mol. Ther. 15:515-523). RNA interference has also been shown to be successful when delivered locally to the CNS by direct injection Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, P.H., et al. (2005) Gene Ther. 12:59-66; Makimura, H., et al. (2002) BMC Neurosci. 3:18; Shishkina, G.T., et al. (2004) Neuroscience 129:521-528; Thakker, E. R., et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al. (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, KA., et al. (2006) Mol. Ther. 14:476-484; Zhang, X., et al. (2004) J. Biol. Chem 279:10677-10684 Bitko, V., et al (2005) Nat Med 11:50-55). With regard to administering mRNA systemically to treat a disease, the RNA may be modified or, alternatively, delivered via a drug delivery system; both methods act to prevent rapid degradation of dsRNA by endo- and exonucleases in vivo. Modification of the RNA or pharmaceutical carrier may also allow the targeting of the mRNA composition to the target tissue and may avoid unwanted off-target effects. mRNA molecules can be modified by chemical conjugation with lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, mRNA directed against ApoB and conjugated to a lipophilic cholesterol moiety was administered systemically to mice and resulted in knockdown of apoB mRNA in both the liver and small intestine (Soutschek, J., et al. (2004) Nature 432 :173-178). Conjugation of mRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in mouse models of prostate cancer (McNamara, J.O., et al. (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the mRNA can be delivered using drug delivery systems such as a nanoparticle, dendrimer, polymer, liposome or cationic delivery system. Positively charged cationic delivery systems promote binding of the (negatively charged) mRNA molecule and also increase interactions at the negatively charged cell membrane to ensure efficient uptake of mRNA into the cell. Cationic lipids, dendrimers or polymers can be either bound to the mRNA or acted upon to form a vesicle or micelle (see, e.g., Kim S.H., et al. (2008) Journal of Controlled Release 129(2): 107-116) , which contain mRNA. The formation of vesicles or micelles also prevents destruction of the mRNA when administered systemically. Methods for preparing and introducing cationic complexes with iRNA are within the skill of the person skilled in the art (see, for example, Sorensen, D.R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U.N., et al. (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A. S. et al. (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems suitable for systemic delivery of mRNA include DOTAP (Sorensen, D.R., et al. (2003), supra; Verma, U.N., et al. (2003), supra), oligofectamine, nucleic acid particulates acid-lipidome (Zimmermann, T.S., et al. (2Οθ6) Nature 441:111-114), cardiolipin (Chien, P.Y., et al. (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al. (2005) Int J. Oncol. 26:1087-1091), polyethylenimine (Bonnet M.E., et al. (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), ArgGly-Asp (RGD) containing peptides (Liu, S. (2006) Mol. Pharm. 3:472-487) and polyamidoamines (Tomalia, D.A., et al. (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999) Pharm. Res. 16:1799-1804). In some embodiments, the mRNA is complexed with cyclodextrin for systemic administration. Methods of administration and pharmaceutical compositions of mRNA and cyclodextrins can be found in US Pat. No. 7,427,605, which is incorporated herein by reference in its entirety.

A. Encoded by the iRNA vector of the present invention, iRNAs targeting the CFB, C3 or C9 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, for example, Couture, A., et al., TIG (1996), 12:5-10; Skillern, A., et al., PCT International Publication No. WO 00/22113, Conrad, PCT International Publication No. WO 00/22114 and Conrad US Patent No. 6054299). Expression may be transient (approximately hours to weeks) or long-lasting (weeks to months or longer) depending on the specific construct used and the target tissue or cell type. Such transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be engineered to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

Individual strands or chains of mRNA can be transcribed from the promoter of an expression vector. Two separate expression vectors can be co-introduced into a target cell (eg, by transfection or infection) to express two separate strands to produce, for example, dsRNA. Alternatively, each individual dsRNA strand can be transcribed by promoters that are both located in the same and the same expression plasmid. In one embodiment, the dsRNA is expressed as inverted repeat polynucleotides connected by a linker polynucleotide sequence such that the dsRNA has a stem-loop structure.

mRNA expression vectors are typically DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably compatible with vertebrate cells, can be used to generate recombinant mRNA expression constructs as described herein. Expression vectors for eukaryotic cells are well known in the art and are available from a number of commercial sources. Typically, vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of the mRNA expression vectors may be systemic, such as by intravenous or intramuscular administration, by administration to target cells explanted from a patient and then reintroduced to the patient, or by any other method that allows administration to the desired target cell.

Target cells can be transfected with mRNA expression plasmids in the form of a complex with carrier

- 56 045602 cationic lipids (eg Oligofectamine) or carriers based on non-cationic lipids (eg Transit-TKOTM). The present invention also contemplates multiple lipid-assisted transfections for types of mRNA-mediated knockdown targeting different regions of the target RNA over a period of a week or more. The successful introduction of vectors into host cells can be controlled using a variety of known methods. For example, transient transfection can be detected using a reporter, such as a fluorescent marker, for example, green fluorescent protein (GFP). Stable transfection of cells ex vivo can be confirmed by using markers that confer resistance to certain environmental factors (eg, antibiotics and drugs) to the transfected cell, such as resistance to hygromycin B.

Viral vector systems that can be used with the methods and compositions described herein include, without limitation, (a) adenoviral vectors; (b) retroviral vectors, including, without limitation, lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40-based vectors; (f) polyoma virus vectors; (g) papillomavirus-based vectors; (h) picornavirus-based vectors; (i) vectors based on a poxvirus, such as orthopox, for example, vectors based on vaccinia virus, or avipox, for example, canaripox or fowlpox; and (j) helper-dependent or weak adenovirus. Viruses with impaired replication may also be advantageous. Different vectors will or will not integrate into the genome of cells. If desired, the constructs may include viral sequences for transfection. Alternatively, the construct can be inserted into vectors capable of episomal replication, such as EPV- and EBV-based vectors. To ensure expression of mRNA in target cells, recombinant mRNA expression constructs typically require the presence of regulatory elements, such as promoters, enhancers, etc. Other considerations regarding vectors and constructs are described further below.

Vectors suitable for delivering mRNA will include regulatory elements (promoter, enhancer, etc.) sufficient to allow expression of the mRNA in the desired target cell or tissue. Regulatory elements can be selected to achieve either constitutive or regulated/inducible expression.

Expression of mRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, such as circulating glucose levels or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems suitable for controlling dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, chemical dimerization inducers, and isopropyl beta-Dthiogalactopyranoside (IPTG). One of ordinary skill in the art will be able to select the appropriate regulatory/promoter sequence based on the intended use of the mRNA transgene.

Viral vectors that contain nucleic acid sequences encoding mRNA can be used. For example, it is possible to use a retroviral vector (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). Such retroviral vectors contain components necessary for proper packaging of the viral genome and integration into the DNA of the host cell. The nucleic acid sequences encoding the mRNA are cloned into one or more vectors that facilitate delivery of the nucleic acid to the patient. A more detailed description of retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy include: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Development. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV-based vectors described in US Pat. No. 6,143,520; 5665557 and 5981276, which are incorporated herein by reference.

Adenoviruses are also contemplated for use in delivering the mRNA of the present invention. Adenoviruses are particularly promising vehicles, for example, for gene delivery to the respiratory epithelium. Adenoviruses naturally infect the respiratory epithelium, where they cause mild disease. Other targets for adenovirus-based delivery systems include the liver, central nervous system, endothelial cells and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499–503 (1993) provides a review article on adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenoviral vectors to transfer genes into the respiratory epithelium of rhesus monkeys. Additional examples of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al.,J.

- 57 045602

Clin. Invest. 91:225-234 (1993); PCT Publications WO 94/12649 and Wang, et al., Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing the mRNA described in the present invention, a method for constructing a recombinant AV vector and a method for delivering the vector to target cells are described in Xia

H. et al. (2002), Nat. Biotech. 20: 1006-1010.

Adeno-associated virus (AAV) vectors can also be used to deliver iRNA according to the present invention (Walsh et al., Proc. Soc. Exp. Sci., USA 204:289-300 (1993); US patent No. 5436146). In one embodiment, the mRNA can be expressed as two separate complementary single-stranded RNA molecules using a recombinant AAV vector, for example, with either the RNA promoters, U6 or H1, or the cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA described in the present invention, methods for constructing a recombinant AV vector, and methods for delivering the vectors to target cells are described in Samulski R. et al. (1987), J. Virol. 61: 3096-3101; Fisher K.J. et al. (1996), J. Virol, 70: 520-532; Samulski R. et al. (1989), J. Virol. 63: 3822-3826; US Patent No. 5252479; US patent No. 5139941; International Patent Application No. WO 94/13788 and International Patent Application No. WO 93/24641, the entire disclosure of which is incorporated herein by reference.

Another viral vector suitable for delivering the mRNA of the present invention is a poxvirus such as vaccinia virus, for example an attenuated vaccinia virus such as modified Ankara virus (MVA) or NYVAC, avipox such as fowlpox or canaripox .

The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses or by replacing various viral capsid proteins, as appropriate. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies virus, Ebola virus, Mokola virus, and the like. AAV vectors can be designed to target different cells by designing the vectors to express different serotypes of capsid proteins; see, for example, Rabinowitz J.E. et al. (2002), J Virol 76:791-801, the entire disclosure of which is incorporated herein by reference.

The vector pharmaceutical preparation may include the vector in a suitable diluent or may include a sustained release matrix in which the gene delivery vehicle is included. In the alternative, where the whole gene delivery vector can be produced by native recombinant cells, such as retroviral vectors, then the pharmaceutical preparation may include one or more cells that produce the gene delivery system.

VI. Pharmaceutical compositions according to the present invention.

The present invention also includes pharmaceutical compositions and formulations that include the mRNA of the present invention. In one embodiment, provided herein are pharmaceutical compositions comprising the mRNAs described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing iRNA are useful for the treatment of a disease or disorder associated with the expression or activity of the CFB, C3 and/or C9 gene, such as the complement component disease described herein. Such pharmaceutical compositions are formulated depending on the method of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, such as subcutaneous (SC) or intravenous (IV) delivery. Another example is compositions that are formulated for direct delivery to the brain parenchyma, for example by infusion into the brain, such as continuous infusion using a pump. The pharmaceutical compositions of the present invention can be administered in doses sufficient to inhibit the expression of the target gene. Typically, a suitable dose of mRNA of the present invention will range from about 0.001 to about 200.0 milligrams per kilogram of body weight of the recipient per day, typically in the range from about 1 to 50 mg per kilogram of body weight per day. For example, dsRNA can be administered in an amount of about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg , approximately 3 mg/kg, approximately 10 mg/kg, approximately 20 mg/kg, approximately 30 mg/kg, approximately 40 mg/kg, or approximately 50 mg/kg per single dose.

For example, dsRNA can be administered at a dose of approximately

0.1, 0.2, 0.3, 0.4,

0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3, 1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4, 4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5, 7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9

- 58 045602 or approximately 10 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

In another embodiment, the dsRNA is administered at a dose of about 0.1 to about mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about mg/kg, about 0.75 to about 50 mg/kg, from approximately 1 to approximately 50 mg/kg, mg/kg, mg/kg, mg/kg, mg/kg, mg/kg, mg/kg, from from from from from from from from approximately 1.5 approximately 2.5 approximately 3.5 approximately 4.5 approximately 7.5 to to to to to approximately 50 mg/kg, approximately 50 mg/kg, approximately 50 mg/kg, approximately 50 mg/kg, from from from from approximately approximately approximately approximately 50 mg/kg, approximately 10 approximately 15 to approximately 50 mg/kg, approximately 20 approximately 20 to approximately 50 mg/kg, approximately 25 to to to to to to to approximately approximately approximately 50 approximately 50 about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg /kg, from approximately 1 approximately 1.5 approximately 2.5 approximately 3.5 approximately 4.5 approximately 7.5 to to to to to approximately 45 mg/kg, approximately 45 mg/kg, approximately 45 mg/kg, approximately 45 mg/kg, from from from from about 2 about 3 about 4 about 5 about 45 mg/kg, from about 10 about 15 to about 45 mg/kg, from about 20 about 20 to about 45 mg/kg, from about 25 to to to to to to to to to approximately 45 mg/kg, from approximately 45 mg/kg, approximately 45 mg/kg, approximately 45 mg/kg, approximately 45 mg/kg, from from from from approximately 45 mg/kg, from about 45 mg/kg, about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg kg, from about 0.1 to about 40 mg/kg, from about 0.25 to about 40 mg/kg, from about 0.5 to about 40 mg/kg, from about 0.75 to about 40 mg/kg, from approximately approximately approximately approximately approximately

2

4 to to to to to approximately 40 mg/kg, approximately 40 mg/kg, approximately 40 mg/kg, approximately 40 mg/kg, approximately 40 mg/kg, from from from from from approximately 1.5 approximately 2.5 approximately 3.5 approximately 4.5 approximately 7.5 approximately 20 approximately 25 approximately 30 to to to to approximately 40 mg/kg, from approximately 15 to approximately 40 mg/kg, from approximately 20 to approximately 40 mg/kg, from approximately 25 to approximately 40 mg/kg, from about 35 to to to to to to to to to about 40 mg/kg, from about 40 mg/kg, from about 40 mg/kg, from about 40 mg/kg, from about 40 mg/kg, from about 40 mg/kg, from about 40 mg/kg, from about 40 mg/kg, from about 40 mg/kg, from about 0.1 to about 30 mg/kg, from about 0.25 to about 30 mg/ kg, from about 0.5 to about 30 mg/kg, from about 0.75 to about 30 mg/kg, from about about about about about about

2

4 to to to to to approximately 30 mg/kg, approximately 30 mg/kg, approximately 30 mg/kg, approximately 30 mg/kg, approximately 30 mg/kg, from from from from from approximately 1.5 approximately 2.5 approximately 3.5 approximately 4.5 approximately 7.5 approximately 10 to approximately 30 mg/kg, approximately 15 to to to to to to approximately 30 mg/kg, approximately 30 mg/kg, approximately 30 mg/kg, approximately 30 mg /kg, approximately 30 mg/kg, from from from from from approximately 30 mg/kg, from approximately 20 to approximately 30 mg/kg, approximately 20 to approximately 30 mg/kg, from approximately 25 to approximately 30 mg/kg, from about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 0.75 to about 20 mg/kg, about 1 to about 1.5, about 2 ,5 approximately 3.5 approximately 4.5 approximately 7.5 to to to to approximately 20 mg/kg, approximately 20 mg/kg, approximately 20 mg/kg, approximately 20 mg/kg, from from from from approximately 2 approximately 3 approximately 4 approximately 5 to approximately 20 mg/kg, approximately 10 to approximately 20 mg/kg, approximately 20 mg/kg, approximately 20 mg/kg, approximately 20 mg/kg, approximately 20 mg /kg, from about 20 mg/kg, from about 20 mg/kg, or from about 15 to about 20 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

For example, dsRNA can be administered at a dose of approximately

- 59 045602

0.01, 0.02, 0.03,

0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0, 7, 0.8, 0.9, 1, 1.1, 1.2,

1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3,1,3,2,

3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5,1,5,2,

5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7,1,7,2,

7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9,1,9,2,

9.3, 9.4, 9.5, 9.6, 9.7, 9.8,9.9 or approximately 10 mg/kg. Values and ranges intermediate to the values listed are also intended to be part of the present invention.

In another embodiment, the dsRNA is administered at a dose of about 0.5 to about mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/kg, about 1.5 to about 50 mg /kg, from about 2 to about 50 mg/kg, from about 2.5 to about 50 mg/kg, from about 3 to about 50 mg/kg, from about 3.5 to about 50 mg/kg, from about 4 to about 50 mg/kg, from about 4.5 to about 50 mg/kg, from about 5 to about 50 mg/kg, from about 7.5 to about 50 mg/kg, from about 10 to about 50 mg/kg , from about 15 to about 50 mg/kg, from about 20 to about 50 mg/kg, from about 20 to about 50 mg/kg, from about 25 to about 50 mg/kg, from about 25 to about 50 mg/kg , about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.5 to about 45 mg/kg kg, from about 0.75 to about 45 mg/kg, from about 1 to about 45 mg/kg, from about 1.5 to about 45 mg/kg, from about 2 to about 45 mg/kg, from about 2, 5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg /kg, from about 40 to about 45 mg/kg, from about 0.5 to about 40 mg/kg, from about 0.75 to about 40 mg/kg, from about 1 to about 40 mg/kg, from about 1 .5 to about 40 mg/kg, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg /kg, from about 4 to about 40 mg/kg, from about 4.5 to about 40 mg/kg, from about 5 to about 40 mg/kg, from about 7.5 to about 40 mg/kg, from about 10 to about 40 mg/kg, from about 15 to about 40 mg/kg, from about 20 to about 40 mg/kg, from about 20 to about 40 mg/kg, from about 25 to about 40 mg/kg, from about 25 to about 40 mg/kg, from about 30 to about 40 mg/kg, from about 35 to about 40 mg/kg, from about 0.5 to about 30 mg/kg, from about 0.75 to about 30 mg/kg , from about 1 to about 30 mg/kg, from about 1.5 to about 30 mg/kg, from about 2 to about 30 mg/kg, from about 2.5 to about 30 mg/kg, from about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, from about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, from about 25 to about 30 mg/kg, from about 0.5 to about 20 mg/kg, from about 0.75 to about 20 mg/kg, from about 1 to about 20 mg/kg, from about 1.5 to about 20 mg/kg, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg or from about 15 to about 20 mg/kg. In one embodiment, the dsRNA is administered at a dose of from about 10 mg/kg to about 30 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

For example, subjects may be administered, for example, subcutaneously or intravenously, one therapeutic

- 60 045602 amount of iRNA such as approx.

0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0, 5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2, 1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3, 4,

3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4,

5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4,

7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4,

9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, I, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or approximately 50 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

In some embodiments, subjects are administered, for example, subcutaneously or intravenously, multiple doses of a therapeutic amount of iRNA, such as a dose of approximately

0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275,

0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0, 7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1, 4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2, 7, 2.8, 2.9, 3,

3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9.5,

5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9,7,

7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9,9,

9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, I, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20, 5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or approximately 50 mg/kg.

A multi-dose regimen may involve administering a therapeutic amount of mRNA daily, for example, for two days, three days, four days, five days, six days, seven days, or longer.

In other embodiments, subjects are administered, for example, subcutaneously or intravenously, a repeated dose of a therapeutic amount of iRNA, such as a dose of approximately

0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25,

0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8,

4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6, 2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8,

6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8, 2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8,

8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, I, 11.5, 12, 12.5, 13, 13.5,

14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5,

23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34,

34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or approximately 50 mg/kg. A repeat-dose regimen may involve administering a therapeutic amount of iRNA on a regular basis, such as every other day, every three days, every four days, twice a week, once a week, every two weeks, or once a month.

The pharmaceutical composition can be administered by intravenous infusion over a period of time, such as during periods 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 and 21, 22, 23, 24 or approximately 25 minutes. Administration may be repeated, for example, regularly, such as once a week, every two weeks (ie, every two weeks) for one month, two months, three months, four months or longer. Following the initial treatment regimen, treatments may be administered less frequently. For example, after administration once a week or once every two weeks for three months, administration

- 61 045602 can be repeated once a month for six months, or a year, or longer.

The pharmaceutical composition can be administered once a day, or the mRNA can be administered in two, three or more dosage units at regular intervals throughout the day, or even by continuous infusion or delivery via a controlled release formulation. In such a case, the amount of mRNA contained in each portion of the dose must be correspondingly less to provide the total daily dose. The dosage unit can also be formulated for delivery over several days, for example, using a traditional sustained release formulation that provides sustained release of the mRNA over a period of several days. Sustained release formulations are well known in the art and are particularly useful for delivering agents to a specific site, such as those that may be used with the agents of the present invention. In such an embodiment, the dosage unit contains an appropriate multiple of the daily dose.

In other embodiments, a single dose of the pharmaceutical compositions may be long-acting such that subsequent doses are administered at intervals of no more than 3, 4, or 5 days, or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of the present invention, a single dose of the pharmaceutical compositions of the present invention is administered once a week. In other embodiments of the present invention, a single dose of the pharmaceutical compositions of the present invention is administered every two months.

One of ordinary skill in the art will appreciate that certain factors may influence the dosage and time frame required to effectively treat a subject, including, without limitation, the severity of the disease or disorder, types of prior treatment, general health and/or age of the subject, and others. existing diseases. In addition, treatment of a subject with a therapeutically effective amount of the composition may include a single treatment period or a series of treatment periods. Estimates of effective doses and in vivo half-lives for individual mRNAs covered by the present invention can be obtained using traditional methodologies, or based on in vivo studies using an appropriate animal model, as described elsewhere in this document.

Advances in mouse genetics have provided a number of mouse models for studying various human diseases, such as disorders that would be benefited by reducing the expression of CFB, C3 or C9. Such models can be used to conduct in vivo studies of mRNA, as well as to determine a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, the mouse model of collagen-induced arthritis (Courtenay, J.S., et al. (1980) Nature 283, 666-668), myocardial ischemia (Homeister J.W. and Lucchesi B.R. (1994) Annu Rev Pharmacol Toxicol 34:17-40), mouse models of ovalbumin-induced asthma (eg, Tomkinson A., et al. (2001). J. Immunol. 166, 5792-5800), (NZBxNZW)Fl, MRL/Faslpr (MRL/lpr ) and the BXSB mouse model (Theofilopoulos, A.N. and Kono, D.H. 1999. Murine lupus models: genespecific and genome-wide studies. In Lahita R.G., ed., Systemic Lupus Erythematosus, 3rd edn, p. 145. Academic Press, San Diego, CA), aHUS mouse model (Goicoechea de Jorge et al. (2011) Development of atypical hemolytic uremic syndrome depends on complement C5, J Am Soc Nephrol 22:137–145.

The pharmaceutical compositions of the present invention can be administered in various ways depending on whether local or systemic treatment is required and the area to be treated. Administration may be local (for example, using a transdermal patch), pulmonary, for example, by inhalation or blowing powders or aerosols, including using an inhaler; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, for example through an implanted device; or intracranial, for example, intraparenchymal, intrathecal or intraventricular administration.

The mRNA can be delivered in such a way that it targets a specific tissue, such as the liver (eg, liver hepatocytes).

Pharmaceutical and topical compositions may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Traditional pharmaceutical carriers, aqueous, powder or oily bases, thickeners, etc. may be necessary or desirable. Covered condoms, gloves, etc. can also be used. Suitable topical formulations include those in which the mRNAs described herein are in admixture with a topical delivery vehicle such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (eg, dioleoyl phosphatidylethanolamine (DOPE), dimyristoyl phosphatidylcholine (DMPC), distearoyl phosphatidylcholine), negative (eg, dimyristoyl phosphatidylglycerol (DMPG)) and cationic (eg, dioleoyltetramethylaminopropyl (DOTAP) and dioleoyl phosphatidylethanolamine (DOTMA) ). The mRNAs described in the present invention may be encapsulated in liposomes or may form complexes with

- 62 045602 them, in particular with cationic liposomes. Alternatively, mRNAs can form complexes with lipids, in particular cationic lipids. Suitable fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl-1-monocaprate, 1-dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine or C ₁ . ₂ oalkyl esters (eg, isopropyl myristate (IPM)), monoglyceride, diglyceride, or a pharmaceutically acceptable salt thereof. Topical formulations are described in detail in US Pat. No. 6,747,014, which is incorporated herein by reference.

A. iRNA formulations containing membrane molecular assemblies.

The mRNAs for use in the compositions and methods of the present invention can be formulated for delivery into a membrane molecular assembly, such as a liposome or micelle. As used herein, the term liposome refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, such as one bilayer or multiple bilayers. Liposomes include single-layer and multilayer vesicles that have a membrane formed of lipophilic material and an aqueous interior. The aqueous part contains a composition with mRNA. The lipophilic material separates the aqueous internal environment from the aqueous external environment, which typically does not include an mRNA composition, although in some examples it may. Liposomes are suitable for carrying and delivering active ingredients to the site of action. Due to the fact that the liposome membrane is structurally similar to biological membranes, when liposomes are applied to tissues, the liposome bilayer fuses with the bilayer of cell membranes. As liposome-cell fusion proceeds, the internal aqueous contents, which include mRNA, are delivered into the cell, where the mRNA can specifically bind to the target RNA and can mediate RNAi. In some cases, liposomes are also specifically targeted, for example to direct mRNA to specific cell types.

Liposomes containing the RNAi agent can be prepared in a number of ways. In one example, the lipid component of the liposome is dissolved in detergent to form a micelle with the lipid component. For example, the lipid component may be an amphipathic cationic lipid or a lipid conjugate. The detergent may have a high critical micelle concentration and may be non-ionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate and lauroyl sarcosine. The RNAi agent formulation is then added to micelles that include a lipid component. The cationic groups of the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, for example by dialysis, to obtain a liposomal preparation of the RNAi agent.

If necessary, a carrier compound that promotes condensation can be added during the condensation reaction, for example, by controlled addition. For example, the carrier compound may be a polymer other than a nucleic acid (eg, spermine or spermidine). The pH can also be adjusted to promote condensation.

Methods for preparing stable polynucleotide delivery vehicles that include a polynucleotide/cationic lipid complex as structural components of the delivery vehicles are further described, for example, in WO 96/37194, the entire contents of which are incorporated herein by reference. The formation of liposomes may also include one or more aspects of the illustrative methods described in Feigner, P.L. et al., Proc. Natl. Acad. Sci USA 8:7413-7417, 1987; US Patent No. 4897355; US Patent No. 5171678; Bangham, et al., M. Mol. Biol. 23:238, 1965; Olson, et al., Biochim. Biophys. Acta 557:9, 1979; Szoka, et al., Proc. Natl. Acad. Sci. 75:4194, 1978; Mayhew, et al., Biochim. Biophys. Acta 775:169, 1984; Kim, et al., Biochim. Biophys. Acta 728:339, 1983; and Fukunaga, et al., Endocrinol. 115:757, 1984. Commonly used techniques for preparing lipid aggregates of a size suitable for use as delivery vehicles include sonication and freeze-thaw extrusion (see, for example, Mayer, et al., Biochim. Biophys. Acta 858 :161, 1986). Microfluidization can be used in applications where consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew, et al., Biochim. Biophys. Acta 775:169, 1984). Such methods are easily adapted to package the RNAi agent formulation into liposomes.

Liposomes are divided into two broad classes. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form stable complexes. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized into the endosome. Due to the acidic pH inside the endosome, liposomes rupture, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

Liposomes, which are pH-sensitive or negatively charged, trap nucleic acids instead of forming a complex with them. Since both the nucleic acid and the lipid have the same charge, repulsion occurs instead of forming a complex. However, some of the nucleic acids are trapped in the aqueous internal environment of these liposomes. pH-sensitive liposomes were used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Exogenous gene expression was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

One main type of liposomal composition includes phospholipids other than naturally occurring phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are typically formed from dimyristoylphosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleylphosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC), such as, for example, soybean PC and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

Examples of other methods for in vitro and in vivo introduction of liposomes into cells include US Pat. No. 5,283,185; US Patent No. 5171678; WO 94/00569; WO 93/24640; WO 91/16024; Feigner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss EMBO J. 11:417, 1992.

Nonionic liposome systems have also been studied to determine their suitability for drug delivery to the skin, in particular systems containing nonionic surfactant and cholesterol. Nonionic liposome formulations containing NovasomeTM I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and NovasomeTM II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporine-A to the dermal layer of mouse skin. The results showed that such non-ionic liposome systems were effective in ensuring the deposition of cyclosporine A in various layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4(6) 466).

Liposomes also include sterically stabilized liposomes, which as used herein means liposomes containing one or more special lipids that, when incorporated into liposomes, result in increased lifetime in the bloodstream compared to liposomes that lack such special lipids. Examples of sterically stabilized liposomes are those in which the vesicle portion of the lipid moiety of the liposome (A) contains one or more glycolipids, such as monosialoganglioside GM1, or (B) is derived from one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety . Without wishing to be bound by any particular theory, it is believed in the art that at least for spatially stabilized liposomes containing gangliosides, sphingomyelin or PEG-derived lipids, the increased half-life in the circulation of these spatially stabilized liposomes is a consequence of reduced uptake by cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

A variety of liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY Acad. Sci., 1987, 507, 64) described the ability of monosialoganglioside G _M1 , galactocerebroside sulfate and phosphatidylinositol to increase the half-life of liposomes in the blood. These findings were commented on by Gabizon et al. (Proc. Natl. Acad. Sci. USA, 1988, 85, 6949). US Pat. No. 4,837,028 and WO 88/04924, both of Allen et al., disclose liposomes containing (1) sphingomyelin and (2) GM1 ganglioside or galactocerebroside sulfate esters. US Pat. No. 5,543,152 (Webb et al.) discloses liposomes containing sphingomyelin. Liposomes containing 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.).

In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage of being able to fuse with the cell membrane. Noncationic liposomes, although they cannot fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.

Additional advantages of liposomes include the following: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can include a wide range of water and fat-soluble drugs; liposomes can protect encapsulated RNAi agents in internal compartments from metabolism and degradation (Rosoff in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important aspects in the preparation of liposome formulations are the surface charge of the lipid, the vesicle size and the aqueous volume of the liposomes.

A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), can be used to form small liposomes that spontaneously react with nucleic acid to form lipid-nucleic acid complexes acid, which are able to fuse with negatively charged lipids of the cell membranes of tissue culture cells, which leads to the delivery of the RNAi agent (see, for example, Feigner, P.L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987; and U.S. Pat. No. 4897355 regarding the description of DOTMA and its use with DNA).

DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonium)propane (DOTAP), can be used

- 64 045602 in combination with a phospholipid to form vesicles that form a complex with DNA. Lipofectin™ (Bethesda Research Laboratories, Gaithersburg, MD) is an effective delivery agent for highly anionic nucleic acids into living tissue culture cells that contains positively charged DOTMA liposomes that spontaneously react with negatively charged polynucleotides to form complexes. The total charge of the resulting complexes is also positive in cases where liposomes with a sufficient positive charge are used. Positively charged complexes produced in this manner spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids, for example, to tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonium)propane (DOTAP) (Boehringer Mannheim, Indianapolis, IN), differs from DOTMA in that the oleyl moieties are ester-linked rather than ether-linked connections.

Other published cationic lipid compounds include those that have been conjugated to a number of moieties, including, for example, carboxyspermine, which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (DOGS) (Transfectam™, Promega , Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (DPPES) (see, for example, US Pat. No. 5,171,678).

Another cationic lipid conjugate includes derived cholesterol lipid derivatives (DC-Choi) that have been formulated as liposomes in combination with DOPE (see, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179 :280, 1991). Lipopolysine, produced by conjugating polylysine to DOPE, has been reported to be effective when transfected in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). For certain cell lines, such liposomes containing conjugated cationic lipids are known to exhibit lower toxicity and provide more efficient transfection than DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, CA) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, MD). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

Liposome formulations are particularly suitable for topical application, with liposomes exhibiting some advantages over other formulations. Such advantages include reduced side effects relative to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to deliver the RNAi agent into the skin. In some embodiments, liposomes are used to deliver the RNAi agent to epidermal cells and also to enhance the penetration of the RNAi agent into dermal tissues, such as skin. For example, liposomes can be applied topically. Local delivery of drugs formulated as liposomes to the skin has been documented (see, for example, Weiner et al., Journal of Drug Targeting, 1992, vol. 2,405-410; and du Plessis et al., Antiviral Research, 18 , 1992, 259-265; Mannino, R. J. and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al., Gene 56:267-276. 1987; Nicolau, S. et al. ., Meth. Enz. 149:157-176, 1987; Straubinger, R. M. and Papahadjopoulos, D. Meth. Enz. 101:512-527, 1983; Wang, C. Y. and Huang, L., Proc. Natl. Acad. Sci. USA 84:7851-7855, 1987).

Nonionic liposome systems have also been studied to determine their suitability for drug delivery to the skin, in particular systems containing nonionic surfactant and cholesterol. Nonionic liposome formulations containing Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver drug to the dermal layer of mouse skin. Such RNAi agent formulations are useful for the treatment of a dermatological disorder.

Liposomes that include mRNA can be produced with high deformability. This deformability may allow liposomes to penetrate through a pore that is smaller than the average radius of the liposome. For example, a type of deformable liposome is transfersome. Transferosomes can be prepared by adding surface interfacial activators, usually surfactants, to a standard liposome composition. Transfersomes that include an RNAi agent can be delivered, for example, by subcutaneous injection to deliver the RNAi agent to keratinocytes in the skin. To pass through intact mammalian skin, lipid vesicles must penetrate a series of small pores, each less than 50 nm in diameter, under the influence of a suitable intradermal gradient. In addition, due to the properties of lipids, such transferosomes can be self-optimizing (adapting to the shape of pores, such as in skin), self-repairing, and can often reach their targets without fragmentation, and can often be self-loading.

Other compositions useful in the present invention are described in US Provisional Application Serial No. 61/018616, filed January 2, 2008; 61/018611, filed January 2, 2008; 61/039748,

- 65 045602 filed March 26, 2008; 61/047087, filed April 22, 2008, and 61/051528, filed May 8, 2008. B

PCT Application No. PCT/US2007/080331, filed October 3, 2007, also describes compositions useful in the present invention.

Transfersomes are another type of liposome and are highly deformable lipid aggregates that are promising candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets that have such a high deformability that they can easily penetrate through pores smaller than droplets. Transfersomes are adaptive to the environment in which they are used, for example, they are self-optimizing (adapting to the shape of the pores in the skin), self-repairing, often reach targets without fragmentation, and can often be self-booting. To produce transfersomes, surface interfacial activators, typically surfactants, can be added to a standard liposome composition. Transfersomes have been used to deliver serum albumin into the skin. Transfersome-mediated delivery of serum albumin was shown to be as effective as subcutaneous injection of a solution containing serum albumin.

Surfactants are widely used in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and rank the properties of many different types of surfactants, both natural and synthetic, is using the hydrolipid balance (HLB). The nature of the hydrophilic group (also known as the head) provides the most effective means for categorizing the various surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285 ).

If the surfactant molecule is not ionized, then it is classified as a nonionic surfactant. Nonionic surfactants are widely used in pharmaceutical and cosmetic products and can be used over a wide range of pH values. Typically their HLB values range from 2 to about 18, depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters and ethoxylated esters. Nonionic alkanoamides and esters, such as fatty alcohol ethoxylates, propoxylated alcohols and ethoxylated/propoxylated block copolymers, are also included in this class. Polyoxyethylene surfactants are the most common members of the nonionic surfactant class.

If a surfactant molecule carries a negative charge when dissolved or dispersed in water, then the surfactant is classified as anionic. Anionic surfactants include carboxylates such as saponifiers, acyl lactylates, amino acid acylamides, sulfuric acid esters such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the class of anionic surfactants are alkyl sulfates and saponifiers.

If a surfactant molecule carries a positive charge when dissolved or dispersed in water, then the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines.

Quaternary ammonium salts are the most used representatives of this class.

If a surfactant molecule has the ability to carry either a positive or negative charge, then the surfactant is classified as amphoteric.

Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkyl betaines and phosphatides. The use of surfactants in finished dosage forms, formulations and emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

The mRNA for use in the methods of the present invention may also be provided in micellar formulations. Micelles are defined herein as a specific type of molecular assembly in which the amphipathic molecules are organized in a spherical structure such that all the hydrophobic portions of the molecule face inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The opposite arrangement occurs if the environment is hydrophobic.

A mixed micellar formulation suitable for delivery across intradermal membranes can be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal C ₈ -C _{2 2} alkyl sulfate, and micelle-forming compounds. Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil , evening primrose oil, menthol, trihydroxyoxocholanyl glycine and its pharmaceutically acceptable salts, glycerin, polyglycerol, lysine, polylysine, triolein, polyoxyethylene ethers and their analogs, polidocanol alkyl ethers and their analogs, chenodeoxycholate, deoxycholate and mixtures thereof. Micelle-forming compounds can be added during or after the addition of the alkali metal alkyl sulfate. Mixed micelles will form from essentially any type of mixing of ingredients other than vigorous stirring to produce smaller micelles.

In one method, a first micellar composition is prepared that contains an siRNA composition and at least an alkali metal alkyl sulfate. The first micellar composition is then mixed with at least three micellar compounds to form a mixed micellar composition. In another method, a micellar composition is prepared by mixing the siRNA composition, an alkali metal alkyl sulfate and at least one of the micelle-forming compounds, followed by vigorously mixing the remaining micelle-forming compounds.

Phenol and/or m-cresol can be added to the mixed micellar composition to stabilize the composition and protect against bacterial growth. Alternatively, phenol and/or m-cresol can be added with micelle-forming ingredients. An isotonic agent such as glycerin can also be added after the mixed micellar composition is formed.

To deliver a micellar formulation as a spray, the formulation can be placed in an aerosol dispenser and the dispenser charged with propellant. The propellant gas, which is under pressure, is found in liquid form in the nebulizer. The ratios of the ingredients are adjusted so that the aqueous phase and the propellant phase become one, i.e. there is one phase. If there are two phases, then it is necessary to shake the sprayer before spraying part of the contents, for example, by means of a dosing valve. The atomized dose of pharmaceutical agent is expelled from the dosing valve in the form of a fine stream.

Propellant gases may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2-tetrafluoroethane) can be used.

Specific concentrations of the main ingredients can be determined by performing relatively simple experiments. Oral absorption often requires increasing, eg at least doubling or tripling, the dose intended for injection or gastrointestinal administration.

B. Lipid particles.

The mRNA, for example the dsRNA of the present invention, can be completely encapsulated in a lipid composition, for example an LNP or other nucleic acid-lipid particle.

As used herein, the expression LNP refers to a stable nucleic acid-lipid particle. LNPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents particle aggregation (eg, a PEG-lipid conjugate). LNPs are highly suitable for systemic applications because they have a long lifetime in the bloodstream after intravenous (i.v.) injection and accumulate at distal sites (eg, sites physically separated from the injection site). LNPs include pSPLP, which includes an encapsulated condenser-nucleic acid complex, which is described in PCT Publication No. WO 00/03683. The particles of the present invention typically have an average diameter of from about 50 nm to about 150 nm, more often from about 60 nm to about 130 nm, more often from about 70 nm to about 110 nm, most often from about 70 nm to about 90 nm, and generally are non-toxic. In addition, the nucleic acids, when present in the nucleic acid-lipid particles of the present invention, are resistant to nuclease degradation in aqueous solution. Nucleic acid-lipid particles and the method for their preparation are disclosed, for example, in US patent No. 5976567; 5981501; 6534484; 6586410; 6815432; US Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.

In one embodiment, the lipid to drug ratio (w/w ratio) (e.g., lipid to dsRNA ratio) will range from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the ranges listed above are also contemplated as part of the present invention.

The cationic lipid may be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3 -dioleoyloxy)propyl)-N,N,N-trimethylammonium (DOTAP), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl- 2,3-Dilinoleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3

- 67 045602 dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), chloride salt of 1,2-dilinoleyloxy- 3-trimethylaminopropane (DLin-TMA.Cl), chloride salt of 1,2-dilinoleoyl-3-trimethylaminopropane (DLin-TAP.Cl), 1,2-dilinoleyloxy-3-(X-methylpiperazino)propane (DLin-MPZ) or 3-(N,Ndilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylαamino)-1,2-npropαnediol (DOAP), 1,2dilinoleyloxo-3-(2-N,N-dimethylamino )ethoxypropane (DLin-EG-DMA), 1,2-dilinolenuloxu-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or its analogues, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aNcyclopenta[d][1,3]dioxol- 5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4(dimethylamino)butanoate (MS3), 1,1'-(2- (4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1) or a mixture thereof . The cationic lipid may comprise from about 20 mol% to about 50 mol% or about 40 mol% of the total lipid content present in the particle.

In another embodiment, the compound 2,2-dilinoleyl-4dimethylaminoethyl-[1,3]-dioxolane can be used to produce lipid-siRNA nanoparticles. The synthesis of 2,2-dilinoleyl-4dimethylaminoethyl-[1,3]-dioxolane is described in US provisional application number 61/107998, filed October 23, 2008, which is incorporated herein by reference.

In one embodiment, the lipid-siRNA particles include 40% 2,2-dilinoleyl-4dimethylaminoethyl-[1,3]-dioxolane; 10% DSPC; 40% cholesterol; 10% PEG-C-DOMG (mol percent) with a particle size of 63.0 ± 20 nm and a siRNA/lipid ratio of 0.027.

The ionizable/non-cationic lipid may be an anionic lipid or a neutral lipid, including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE) ), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(M-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE ), 16-Omonomethyl-PE, 16-O-dimethyl-PE, 18-1-trans-PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), cholesterol or a mixture thereof. The non-cationic lipid may comprise from about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% if cholesterol is included, of the total lipid content present in the particle.

The conjugated lipid that inhibits particle aggregation may be, for example, a polyethylene glycol (PEG)-lipid conjugate, including, but not limited to, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer) or a mixture thereof. The PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl (Ci2), PEG-dimyristoyloxypropyl (Ci4), PEG-dipalmityloxypropyl (Ci6) or PEG-distearyloxypropyl (Ci8). The conjugated lipid that prevents particle aggregation can range from 0 mol% to about 20 mol% or about 2 mol% of the total lipid content present in the particle.

In some embodiments, the nucleic acid-lipid particle further includes cholesterol in an amount, for example, from about 10 mol.% to about 60 mol.% or about 48 mol.% of the total lipid content present in the particle.

In one embodiment, the lipidoid ND98-4HQ (MW 1487) (see US Patent Application No. 12/056230, filed March 26, 2008, which is incorporated herein by reference), cholesterol (Sigma-Aldrich), and PEG- C16 ceramide (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (i.e., LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; cholesterol, 25 mg/ml, PEG-ceramide C16, 100 mg/ml. Stock solutions of ND98, cholesterol and PEG-ceramide C16 can then be combined, for example in a molar ratio of 42:48:10. The pooled lipid solution can be mixed with an aqueous solution of dsRNA (eg, sodium acetate, pH 5) such that the final ethanol concentration is approximately 3545% and the final sodium acetate concentration is approximately 100-300 mM. LipiddsRNA nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the resulting nanoparticle mixture can be extruded through a polycarbonate membrane (eg, 100 nm size cutoff) using, for example, a thermal barrel extruder such as a Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step can be skipped. Ethanol removal and simultaneous buffer exchange can be accomplished, for example, by dialysis or tangential flow filtration. The buffer can be replaced, for example, by phosphate buffered saline (PBS) with a pH of about 7, for example, a pH of about 6.9, a pH of about 7.0, a pH of about 7.1, a pH of about 7.2, a pH of about 7.3, or pH approximately 7.4.

- 68 045602 n

Formula 1

The compositions of LNP01 are described, for example, in International Application Publication No. WO 2008/042973, which is therefore incorporated by reference.

Additional exemplary lipid-dsRNA formulations are described in Table 1. 1.

Table 1

Ionizable/cationic lipid Cationic lipid/non-cationic lipid/cholesterol/PEG-lipid conjugate Lipid:siRNA ratio SNALP- 1 1,2-dilino le nyloxy-Ν,Νdimethyl lamino pro naH(DLinDM A) DLinDMA/DPPC/xonecTepHH/PEG-cDMA (57.1/7.1/34.4/1.4) lipid: siRNA ~ 7:1 2-XTS 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) CTC/ORRS/cholesterol/RES-sOMA 57.1/7.1/34.4/1.4 lipid: siRNA ~ 7:1 LNP05 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 57.5/7.5/31.5/3.5 lipid:siRNA ~ 6:1 LNP06 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 57.5/7.5/31.5/3.5 lipid: siRNA ~ 11:1 LNP07 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 60/7.5/31/1.5, lipid: siRNA ~ 6:1 LNP08 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) CTC/O8RS/cholesterol/RES-OMS 60/7.5/31/1.5, lipid:81РХА - 11:1 LNP09 2,2-dilino leyl-4-dimethylamino ethyl-[1,3]dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 50/10/38.5/1.5 lipid: siRNA 10:1

- 69 045602

LNP10 (3aR,5s,6aS)-N,N^HMeTHn-2,2^H((9Z,12Z)octadeca-9,12-dienyl) tetrahydro-3 aHcyclopenta[c1] [1,3] dioxo l-5- amine (ALN100) ALN100/D SPC/xo lesterol/PEG-DMG 50/10/38.5/1.5 lipid:811ША 10:1 LNP11 (6Z,9Z,28Z,3^)-heptatriaconta-6,9,28,31 tetraen-19-yl-4-(dimethylamino)butanoate (MSZ) MC-3/DSPC/Xo lesterol/PEG-DMG 50/10/38.5/1.5 lipid:811ША 10:1 LNP12 1,G-(2-(4-(2-((2-(bis(2- hydroxydodecyl)amino)ethyl)(2- hydroxydodecyl)amino)ethyl)piperazine-1- yl)ethylazanediyl)didodecan-2-ol (Tech G1) Tech Gl/DSPC/xonecTepnH/PEG-DMG 50/10/38.5/1.5 lipid:811ША 10:1 LNP13 XTS XTC/DSPC/xon/PEG-DMG 50/10/38.5/1.5 lipid:siRNA: 33:1 LNP14 MSZ MC3/DSPC/xon/PEG-DMG 40/15/40/5 lipid: siRNA: 11:1 LNP15 MSZ MC3/DSPC/xon/PEG-DSG/GalNAc-PEG-DSG 50/10/35/4.5/0.5 lipid: siRNA: 11:1 LNP16 MSZ MC3/DSPC/xon/PEG-DMG 50/10/38.5/1.5 lipid:siRNA: 7:1 LNP17 MSZ MC3/DSPC/xon/PEG-DSG 50/10/38.5/1.5 HHHHj:siRNA: 10:1 LNP18 MSZ MC3/DSPC/xon/PEG-DMG 50/10/38.5/1.5 nnniu:siRNA: 12:1 LNP19 MSZ MC3/DSPC/xon/PEG-DMG 50/10/35/5 lipid:siRNA: 8:1 LNP20 MSZ MC3/DSPC/xoa/PEG-DPG 50/10/38.5/1.5 lipid:511SA: 10:1 LNP21 S12-200 C12-200/DSPC/x(M/PEG-DSG 50/10/38.5/1.5 lipid:siRNA: 7:1 LNP22 XTS XTC/DSPC/xon/PEG-DSG 50/10/38.5/1.5 lipid:511SA: 10:1

DSPC: distearoylphosphatidylcholine;

- 70 045602

DPPC: dipalmitoylphosphatidylcholine;

PEG-DMG: PEG-didimyristoylglycerol (C14-PEG or PEG-C14) (PEG average molecular weight 2000);

PEG-DSG: PEG-distyrylglycerol (C18-PEG or PEG-C18) (PEG average molecular weight 2000);

PEG-cDMA: PEG-carbamoyl-1,2-dimyristoyloxypropylamine (PEG average molecular weight 2000).

Formulations containing SNALP (1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) are described in International Publication No. WO 2009/127060, filed April 15, 2009, which is therefore incorporated by reference.

CTS-containing compositions are described, for example, in US provisional application Serial No. 61/148366, filed January 29, 2009; US Provisional Application Serial No. 61/156851, filed March 2, 2009; US Provisional Application Serial No. filed June 10, 2009; US Provisional Application Serial No. 61/228373, filed July 24, 2009; US Provisional Application Serial No. 61/239686, filed September 3, 2009, and International Application No. PCT/US2010/022614, filed January 29, 2010, which are hereby incorporated by reference.

MC3-containing compositions are described, for example, in US Publication No. 2010/0324120, filed June 10, 2010, the entire contents of which are therefore incorporated by reference.

ALNY-100-containing compositions are described, for example, in international patent application number PCT/US09/63933, filed November 10, 2009, which is therefore incorporated by reference.

C12-200-containing compositions are described in US Provisional Application Serial No. 61/175770, filed May 5, 2009, and International Application No. PCT/US10/33777, filed May 5, 2010, which are therefore incorporated by reference to links.

Synthesis of ionizable/cationic lipids.

Any of the compounds, eg cationic lipids and the like, used in the nucleic acid-lipid particles of the present invention can be prepared using known organic synthesis techniques, including those described in more detail in the Examples. All substituents are as defined below unless otherwise noted.

Alkyl means a straight chain or branched, non-cyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Typical straight chain saturated alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl and the like. Typical saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like; whereas unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl and the like.

Alkenyl means alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Typical straight chain and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl -2butenyl, etc.

Alkynyl means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent carbon atoms. Representative straight chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1-butynyl, and the like.

Acyl means any alkyl, alkenyl or alkynyl in which the carbon atom at the point of attachment is replaced by an oxo group, as defined below. For example, -C(=O)alkyl, -C(=O)alkenyl and -C(=O)alkynyl are acyl groups.

Heterocycle means a 5-7 membered monocyclic or 7-10 membered bicyclic, heterocyclic ring which is either saturated, unsaturated or aromatic and which contains 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and where the heteroatoms are nitrogen and sulfurs may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle can be attached via any heteroatom or carbon atom. Heterocycles include heteroaryls, which are defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperisinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, those trahydrothiophenyl, tetrahydrothiopyranyl, etc.

The expressions optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl and optionally substituted heterocycle mean that upon substitution, at least one hydrogen atom is replaced by a substituent. In the case of an oxo substituent (=O), two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, -CN, -OR _x , -NR _x R _y , -NR _x C(=O)R _y , -NR _x SO ₂ R _y , -C(=O )R _x , -C(=O)OR _x , -C(=O)NR _x R _y , -SO _n R _x and -SO _n NR _x R _y , where n is 0, 1 or 2, R _x and R _y are the same or different and independently represent hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents may be further substituted by one or more of oxo, halogen, -OH, -CN, alkyl, -OR _x , heterocycle, -NR _x Ry, -NR _x C(=O)Ry, -NR _x SO2Ry, -C(=O)R _x , -C(=O)OR _x ,

-C(=O)NR _x Ry, -SOnRx and -SOnNRxRy.

Halogen means fluorine, chlorine, bromine and iodine.

In some embodiments, the methods of the present invention may require the use of protecting groups. The technique of using protecting groups is well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green, T.W. et al., Wiley-Interscience, New York City, 1999). Briefly, protecting groups in the context of the present invention are any group that reduces or eliminates the undesirable chemical activity of a functional group. A protecting group can be added to a functional group to block its chemical activity during certain reactions and then removed to reveal the original functional group. In some embodiments, a protecting group is used for the alcohol group. A protecting group for an alcohol group is any group that reduces or eliminates the undesirable chemical activity of the alcohol functionality. Protecting groups can be added and removed using techniques well known in the art.

Synthesis of formula A.

In some embodiments, the nucleic acid-lipid particles of the present invention are formulated using a cationic lipid of the formula A ^R 3 \ N---R ₄ wherein R ₁ and R 2 are independently alkyl, alkenyl or alkynyl, each optionally being substituted, a R ₃ and R ₄ independently represent lower alkyl, or R ₃ and R ₄ may, taken together, form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is CTS, (2,2-dilinoleyl-4-dimethylaminoethyl[1,3]-dioxolane). In general, the lipid of Formula A above can be prepared by the following Reaction Schemes 1 or 2, wherein all substituents are as defined above unless otherwise indicated.

Scheme 1

Lipid A prepared in Scheme 1, wherein R ¹ and R ² are independently alkyl, alkenyl or alkynyl, each optionally being substituted, and R ³ and R ⁴ are independently lower alkyl or R ³ and R ⁴ can be combined to form an optionally substituted heterocyclic ring. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to one skilled in the art. The reaction between 1 and 2 gives ketal 3. Treatment of ketal 3 with amine 4 gives lipids of formula A. Lipids of formula A can be converted to the corresponding ammonium salt using an organic salt of formula 5, where X is an anion, a counterion selected from halogen, hydroxide, phosphate, sulphate or the like.

- 72 045602

Scheme 2

Alternatively, ketone starting material 1 can be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to one skilled in the art. The reaction between 6 and 7 gives ketone 1. The conversion of ketone 1 to the corresponding lipids of formula A is as described in Scheme 1.

Synthesis of MS3.

The preparation of DLin-M-C3-DMA (ie (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraene-19-ul-4(dimethylamino)butanoate) was as follows. Solution of (6Z,9Z,28Z,31Z)-heptatriaconte-6,9,28,31-tetraen19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4-N ,N-dimethylaminopyridine (0.61 g) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 ml) were stirred at room temperature overnight. The solution was washed with dilute hydrochloric acid followed by dilute aqueous sodium bicarbonate. The organic fractions were dried over anhydrous magnesium sulfate, filtered and the solvent was removed using a rotary vacuum evaporator. The residue was passed through a silica gel column (20 g) using a 1-5% methanol/dichloromethane elution gradient. The fractions containing the purified product were combined and the solvent was removed to give a colorless oil (0.54 g).

Synthesis of ALNY-100.

The synthesis of ketal 519 [ALNY-100] was carried out using the following scheme 3:

Synthesis 515.

To a stirred suspension of LiAlH ₄ (3.74 g, 0.09852 mol) in 200 ml anhydrous THF in two-neck RBF (1 L), a solution of 514 (10 g, 0.04926 mol) in 70 ml THF was slowly added at 0°C in nitrogen atmosphere. After addition was complete, the reaction mixture was warmed to room temperature and then heated until condensation occurred for 4 hours. The reaction progress was monitored by TLC. Once the reaction was complete (determined by TLC), the mixture was cooled to 0°C and quenched by careful addition of saturated Na ₂ SO ₄ solution. The reaction mixture was stirred for 4 hours at room temperature and filtered. The residue was washed well with THF. The filtrate and the precipitate obtained by washing were mixed and diluted with 400 ml of dioxane and 26 ml of conc. HCl, and stirred for 20 min at room temperature. Volatiles were distilled off in vacuo to give hydrochloride salt 515 as a white solid. Yield: 7.12 g ¹ H-NMR (DMSO, 400 MHz): δ=9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66 -2.60 (m, 2H), 2.50-2.45 (m, 5H).

Synthesis 516.

NEt ₃ (37.2 mL, 0.2669 mol) was added to a stirred solution of compound 515 in 100 mL dry DCM in 250 mL double neck RBF and cooled to 0° C. under nitrogen. After slowly adding N(benzyloxycarbonyloxy)succinimide (20 g, 0.08007 mol) to 50 mL of dry DCM, the reaction mixture was allowed to warm to room temperature. After completion of the reaction (2-3 hours, determined by TLC), the mixture was washed successively with a 1N solution. HCl (1x100 ml) and saturated solution

- 73 045602

NaHCO ₃ (1x50 ml). The organic layer was then dried over anhydrous. The Na ₂ SO ₄ and solvent were evaporated to give crude material, which was purified by silica gel column chromatography to give 516 as a sticky mass. Yield: 11 g (89%). ¹ H-NMR (CDCl ₃ , 400 MHz):

δ=7.36-7.27 (m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1H) 2.74 (s, ZN) , 2.60 (m, 2H), 2.30-2.25 (m, 2H).

LC-MS [M+H] -232.3 (96.94%).

Synthesis of 517A and 517B.

Cyclopentene 516 (5 g, 0.02164 mol) was dissolved in a solution of 220 ml of acetone and water (10:1) in one-neck 500 ml of RBF and N-methylmorpholine-N-oxide (7.6 g, 0.06492 mol) was added ), followed by 4.2 ml of a 7.6% solution of OsO ₄ (0.275 g, 0.00108 mol) in tert-butanol at room temperature. After completion of the reaction (~3 hours), the mixture was quenched by adding solid Na ₂ SO ₃ and the resulting mixture was stirred for 1.5 hours at room temperature. The reaction mixture was diluted with DCM (300 ml) and washed with water (2x100 ml), followed by saturated NaHCO ₃ solution (1x50 ml), water (1x30 ml) and finally brine (1x50 ml). The organic phase was dried over anhydrous. Na ₂ SO ₄ and the solvent were removed in vacuo. As a result of purification of the crude material using column chromatography with silica gel, a mixture of diastereoisomers was obtained, which were separated using Rev. HPLC. Yield: - 6 g of crude product.

517A - peak-1 (white solid), 5.13 g (96%). ¹ H-NMR (DMSO, 400 MHz): δ=7.39-7.31 (m, 5H), 5.04 (s, 2H), 4.78-4.73 (m, 1H), 4. 48-4.47 (d, 2H), 3.94-3.93 (m, 2H), 2.71 (s, ZH), 1.72-1.67 (m, 4H). LCMS - [M+H]-266.3, [M+NH4 +]-283.5 present, HPLC-97.86%. Stereochemistry was confirmed using X-ray diffraction.

Synthesis 518.

Using a procedure similar to that described for the synthesis of compound 505, compound 518 (1.2 g, 41%) was obtained as a colorless oil. ¹ H-NMR (CDCl ₃ , 400 MHz): δ=7.35-7.33 (m, 4H), 7.30-7.27 (m, 1H), 5.37-5.27 (m, 8H), 5.12 (s, 2H), 4.75 (m, 1H), 4.58-4.57 (m,2H), 2.78-2.74 (m,7H), 2.06 -2.00 (m, 8H), 1.96-1.91 (m, 2H), 1.62 (m, 4H), 1.48 (m, 2H), 1.37-1.25 (br m, 36H), 0.87 (m, 6H). HPLC-98.65%.

General procedure for the synthesis of compound 519.

A solution of compound 518 (1 eq.) in hexane (15 ml) was added dropwise to an ice-cold solution of LAH in THF (1 M, 2 eq.). After addition was complete, the mixture was heated at 40°C for 0.5 h, then cooled again in an ice bath. The mixture was carefully hydrolyzed with saturated aqueous Na2SO4, then filtered through celite and converted into oil. Column chromatography provided pure 519 (1.3 g, 68%), which was obtained as a colorless oil. ¹³ C NMR δ=130.2, 130.1 (x2), 127.9 (x3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5, 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 ( x2), 27.2 (x3), 25.6, 24.5, 23.3, 226, 14.1; Electrospray MS (+ve): Molecular weight for C ₄₄ H ₈₀ NO ₂ (M+H)+ calc. 654.6, detected 654.6.

Compositions produced either by the standard process or by the non-extrusion process are characterized in the same way. For example, formulations are typically characterized by visual inspection. These should be whitish transparent solutions in which there are no aggregates or sediment. Particle size and particle size distribution of lipid nanoparticles can be measured using light scattering using, for example, Malvern Zetasizer Nano ZS (Malvern, USA). The particle size should be approximately 20-300 nm, for example 40-100 nm. The particle size distribution should be univertex. The total concentration of dsRNA in the formulation as well as the captured fraction is determined using a dye exclusion assay. A sample of formulated dsRNA can be incubated with an RNA-binding dye, such as Ribogreen (Molecular Probes), in the presence or absence of a disrupting surfactant, such as 0.5% Triton-X100. The total dsRNA in the formulation can be determined by the signal from the surfactant-containing sample relative to the calibration curve. The captured fraction is determined by subtracting the free dsRNA content (as measured by the signal in the absence of surfactant) from the total dsRNA content. The percentage of dsRNA captured is typically >85%. For the SNALP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least at least 100 nm, at least 110 nm and at least 120 nm. A suitable range is generally from at least about 50 nm to at least 110 nm, from at least about 60 nm to at least 100 nm, or from at least about 80 nm to at least 90 nm. nm.

Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous media, capsules, gelatin capsules, powder packets, tablets or mini-tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersants or binders may be necessary. In some embodiments, oral formulations are those in which the dsRNAs described herein are administered in combination with one or more penetration agents, surfactants, and chelators. Suitable

- 74 045602 active surfactants include fatty acids and/or their esters or salts, bile acids and/or their salts. Suitable bile acids/bile salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, tauro-24,25- sodium dihydrofusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine or monoglyceride, diglyceride or a pharmaceutically acceptable salt thereof (eg sodium). In some embodiments, combinations of penetration promoting substances are used, for example fatty acids/fatty acid salts in combination with bile acids/bile salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Additional penetration aids include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. The dsRNAs described in the present invention can be delivered orally, in the form of granules, including spray-dried particles, or complexed to form micro- or nanoparticles. Complexing agents for dsRNA include poly-amino acids; polyimines; polyacrylates; polyalkyl acrylates, polyoxethanes, polyalkyl cyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethylene glycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derived polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene (PTDAE), polyaminostyrene (e.g. p-amino), poly(methyl cyanoacrylate), poly(ethyl cyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcyanoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), copolymer DL-lactic and glycolic acid (PLGA), alginate and polyethylene glycol (PEG).

Oral formulations for dsRNA and their preparation are described in detail in US Patent No. 6887906, US Publication No. 20030027780 and US Patent No. 6747014, each of which is incorporated herein by reference.

Compositions and formulations for parenteral, intraparenchymal (brain), intrathecal, intraventricular, or intrahepatic administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other appropriate additives such as, but not limited to, penetration agents, compounds- carriers and other pharmaceutically acceptable carriers or excipients.

The pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. Such compositions can be prepared from a number of components, which includes, but is not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semi-solids. In particular, compositions that specifically target the liver for the treatment of liver diseases such as hepatocarcinoma are preferred.

The pharmaceutical compositions of the present invention, which for convenience may be in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of contacting the active ingredients with pharmaceutical carrier(s) or excipient(s). Typically, formulations are prepared by uniformly and thoroughly bringing the active ingredients into contact with liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product.

The compositions of the present invention can be formulated in any of many possible dosage forms, such as, but not limited to, tablets, capsules, gelatin capsules, liquid syrups, plastic gels, suppositories and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may additionally contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

C. Additional compounds.

i. Emulsions.

The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another, in the form of droplets, the diameter of which usually exceeds 0.1 microns (see, for example, Ansel's Pharmaceutical

- 75 045602

Dosage Forms and Drug Delivery Systems, Allen, L.V., Popovich N.G., and Ansel H.C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often two-phase systems containing two immiscible liquid phases, thoroughly mixed and dispersed within each other. Typically, emulsions can be either water-in-oil (w/o) or oil-in-water (o/w) emulsions. In cases where the aqueous phase is finely atomized in the total volume of the oil phase and dispersed in the form of tiny droplets therein, then the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, in cases where the oil phase is finely atomized in the bulk of the aqueous phase and dispersed as minute droplets therein, then the resulting composition is referred to as an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in either the aqueous phase, the oil phase, or as such as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, colorants and antioxidants may be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that consist of more than two phases, such as in the case of oil-in-water-in-oil (o/w/o) and water-in-oil emulsions. input (w/o/w). Such complex formulations often provide certain benefits that simple two-component emulsions do not provide. Multiple emulsions in which the individual oil droplets of the o/w emulsion include small water droplets constitute a w/o/w emulsion. Likewise, a system of oil droplets contained within water droplets stabilized in an oil dispersant phase provides an o/w/o emulsion.

Emulsions are characterized by low thermodynamic stability or its absence. Often the dispersed or dispersed phase of the emulsion is well dispersed in the dispersed or dispersed phase and is maintained in that form by emulsifiers or the viscosity of the formulation. Any phase of the emulsion may be semi-solid or solid, as is the case with emulsion-like ointment bases and creams. Other methods for stabilizing emulsions involve the use of emulsifiers, which can be included in any phase of the emulsion. Emulsifiers can generally be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and fine solids (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L.V., Popovich N.G., and Ansel H.C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

Synthetic surfactants, also known as surfactants, have found widespread use in emulsion formulations and have been reviewed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins ( ^8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, NY, 1988, volume 1, p. 199). Surfactants are usually amphiphilic and contain a hydrophilic and a hydrophobic part. The ratio of hydrophilic to hydrophobic nature of a surfactant is called the hydrolipid balance (HLB) and is a valuable tool in categorizing and selecting surfactants in formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic, and amphoteric (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins ( ^8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285 ).

Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and gum arabic. Absorbent bases such as anhydrous lanolin and hydrophilic petrolatum have hydrophilic properties so that they can absorb water to form w/o emulsions while maintaining their semi-solid consistency. Finely divided solids have also been used as suitable emulsifiers, especially in combination with surfactants and in viscous preparations. These include polar inorganic solids such as heavy metal hydroxides, non-swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminosilicate, pigments and non-polar solids such as carbon or glyceryl tristearate.

A wide variety of non-emulsifying materials are also included in emulsion formulations and improve the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty

- 76 045602 esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel

Dekker, Inc., New York, N.Y., volume 1, p. 199).

Hydrophilic colloids or hydrocolloids include naturally occurring resins and synthetic polymers such as polysaccharides (eg, gum arabic, agar, alginic acid, carrageenan, guar gum, gum caraya and tragacanth), cellulose derivatives (eg, carboxymethylcellulose and carboxypropylcellulose) and synthetic polymers ( e.g. carbomers, cellulose ethers and carboxyvinyl polymers). They disperse or swell in water to form colloidal solutions, which stabilize emulsions by forming strong interfacial films around droplets of the dispersed phase and by increasing the viscosity of the dispersed phase.

Because emulsions often contain a number of ingredients, such as carbohydrates, proteins, sterols and phosphatides, which can readily support microbial growth, such formulations often include preservatives. Commonly used preservatives included in emulsion formulations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, rhydroxybenzoic acid esters, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent breakdown of the formulation. The antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium matabisulfite, and antioxidant synergists such as citric acid, tartaric acid and lecithin.

The use of emulsion formulations through the dermatological, oral and parenteral routes and methods for their preparation have been reviewed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L.V., Popovich N.G., and Ansel H.C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery are very widely used due to ease of formulation, as well as effectiveness in absorption and bioavailability (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L.V., Popovich N.G., and Ansel H.C., 2004 , Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral oil laxatives, fat-soluble vitamins, and high-fat nutritional preparations are among the materials commonly administered orally as o/w emulsions.

ii. Microemulsions.

In one embodiment of the present invention, the mRNA and nucleic acid compositions are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphilic substance that is a separate optically isotropic and thermodynamically stable liquid solution (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV, Popovich NG, and Ansel HC, 2004 , Lippincott Williams & Wilkins ( ^8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Typically, microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding enough of a fourth component, typically a medium chain alcohol, to form a clear system. Thus, microemulsions have also been described as thermodynamically stable, isotropically pure dispersions of two immiscible liquids that are stabilized by interfacial films of surfactant molecules (Leung and Shah, in Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions are typically prepared by combining three to five components, which include oil, water, surfactant, secondary surfactant, and electrolyte. Whether a microemulsion is a water-in-oil (w/o) or an oil-in-water (o/w) emulsion depends on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules. (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

The phenomenological phase diagram approach has been extensively studied and has provided extensive data on how to formulate microemulsions by those skilled in the art (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins ( ^8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY , volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335). Compared to traditional emulsions, micro-emulsions have the advantage of stabilizing water-insoluble drugs in thermodynamically stable droplets that form spontaneously.

Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750) alone or in combination with secondary surfactants. The secondary surfactant, usually a short chain alcohol such as ethanol, 1-propanol and 1-butanol, serves to increase interfacial fluidity by penetrating the surfactant film and consequently creating a disordered film due to void space, formed among surfactant molecules. However, microemulsions can be prepared without the use of secondary surfactants, and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may generally be water, an aqueous drug solution, glycerol, PEG300, PEG400, polyglycerols, propylene glycols and ethylene glycol derivatives. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain ( _C8 -C12) mono-, di- and triglycerides, polyoxyethylated fatty acid glyceryl esters, fatty acids alcohols, polyglycolyzed glycerides, saturated polyglycolyzed _C8 - _C10 glycerides, vegetable oils and silicone oil.

Microemulsions are of particular interest in terms of drug solubility and increased drug absorption. Lipid microemulsions (both o/w and w/o) have been proposed to increase the oral bioavailability of drugs, including peptides (see, for example, US Pat. No. 6191105; 7063860; 7070802; 7157099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions provide benefits such as improved drug solubility, protection of drug from enzymatic hydrolysis, possible increase in drug absorption due to surfactant-induced changes in membrane fluidity and permeability, ease of preparation, ease of oral administration compared to solid dosage form, improved clinical effectiveness and reduced toxicity (see, for example, US patent No. 6191105; 7063860; 7070802; 7157099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85 , 138-143). Often microemulsions can form spontaneously when their components are combined at ambient temperature. This may be particularly useful when heat-labile drugs, peptides or mRNA are formulated. Microemulsions have also been effective in the transdermal delivery of active ingredients in both cosmetic and pharmaceutical applications. The compositions and microemulsion formulations of the present invention are expected to promote increased systemic absorption of mRNA and nucleic acids from the gastrointestinal tract, as well as improve local cellular uptake of mRNA and nucleic acids.

The microemulsions of the present invention may also contain additional components and additives, such as sorbitan monostearate (Grill 3), Labrasol and penetration aids, to improve the properties of the formulation and to enhance the absorption of the mRNA and nucleic acids of the present invention. The penetration aids used in the microemulsions of the present invention can be classified as belonging to one of five general categories: surfactants, fatty acids, bile salts, chelating agents and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above above.

iii. Microparticles.

The RNAi agent of the present invention may be included in a particle, such as a microparticle. Microparticles can be produced by spray drying, but can also be produced by other methods, including lyophilization, evaporation, fluidized bed drying, vacuum drying, or a combination of these techniques.

iv. Substances that promote penetration.

In one embodiment, the present invention uses a variety of penetration promoting agents to influence the efficient delivery of nucleic acids, particularly mRNA, into the skin of animals. Most drugs are present in solution in both ionized and non-ionized forms. However, as a rule, only fat-soluble or lipophilic drugs readily pass through cell membranes. It has been found that even non-lipophilic drugs can pass through cell membranes if the membrane through which the penetration occurs is treated with a substance that promotes penetration. In addition to ensuring the diffusion of non-lipophilic drugs through cellular

- 78 045602 membrane penetration promoting agents also increase permeability to lipophilic drugs.

Penetration agents can be classified as belonging to one of five main categories, i.e. surfactants, fatty acids, bile salts, chelating agents and non-chelating non-surfactants (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above classes of penetration agents is described in more detail below.

Surfactants (or surfactants) are chemical entities that, when dissolved in an aqueous solution, reduce the surface tension of a solution or the interfacial tension between an aqueous solution and another liquid, resulting in increased mucosal absorption of mRNA. In addition to bile salts and fatty acids, permeation aids include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92) and perfluorinated emulsions such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

A variety of fatty acids and their derivatives that act as penetration promoters include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate , tricaprate, monoolein (1-monooleoyl-racglycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecyl acycloheptan-2-one, acylcarnitines, acylcholines, their C1_ ₂₀ alkyl esters (for example, methyl, isopropyl and t-butyl) and their mono- and diglycerides (i.e. oleate, laurate, caprate, myistate, palmitate, stearate, linoleate, etc.) (see, for example, Touitou, E., et al., Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

The physiological role of bile includes assisting in the distribution and absorption of lipids and fat-soluble vitamins (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman &Gilman's The Pharmacological Basis of Therapeutics, ^9th Ed., Hardman et al., Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts and their synthetic derivatives act as permeation promoters. Thus, the expression bile salts includes any naturally occurring components of bile, as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycolic acid (sodium glycolate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydrofusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems , 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, ^18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Then, 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

Chelating agents used in connection with the present invention can be defined as compounds that remove metal ions from solution by forming complexes with them, resulting in increased mucosal absorption of mRNA. With respect to their use as penetration promoters in the present invention, chelating agents have the added benefit of also serving as DNase inhibitors, since most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate, and homovalinate), N-acyl derivatives of collagen, laureth-9, and N-aminoacyl derivatives of beta-diketones (enamines) (see eg Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, M.A., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi , Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

As used herein, non-chelating non-surfactant permeation promoting compounds can be defined as compounds that exhibit little activity as chelating agents or as surfactants, but which nevertheless enhance the absorption of mRNA through the digestive mucosa. tract (see, for example, Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration agents includes, for example, unsaturated cycloureas, 1-alkyl 1-alkenyl azacycloalkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92) and non-steroidal anti-inflammatory drugs such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

Agents that enhance the uptake of mRNA at the cellular level can also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids such as lipofectin (Junichi et al., US Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules such as polylysine (Lollo et al., PCT application WO 97/30731) are also known to enhance cellular uptake of dsRNA. Examples of commercially available transfection reagents include, but are not limited to, Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad, CA), California), DMRIE-C™ (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine™ (Invitrogen; Carlsbad, CA), RNAiMAX ( Invitrogen; Carlsbad, CA), Oligofectamine™ (Invitrogen; Carlsbad, CA), Optifect™ (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 transfection reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP liposome transfection reagent (Grenzacherstrasse, Switzerland), DOSPER liposome transfection reagent (Grensacherstrasse, Switzerland) or Fugene (Grensacherstrasse, Switzerland), Transfectam® reagent (Promega; Madison, WI), TransFast™ transfection reagent (Promega; Madison, WI), Tfx™-20 reagent (Promega; Madison, WI), Tfx™-50 reagent (Promega; Madison, WI), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPassa D1 transfection reagent (New England Biolabs; Ipswich , Massachusetts, USA) LyoVec™/LipoGen™ (Invitrogen; San Diego, CA, USA), PerFectin transfection reagent (Genlantis; San Diego, CA, USA), NeuroPORTER transfection reagent (Genlantis; San Diego, CA , USA), GenePORTER transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin transfection reagent (Genlantis; San Diego, CA, USA), BaculoPORTER transfection reagent (Genlantis; San Diego, CA, USA), TroganPORTER™ transfection reagent (Genlantis; San Diego, CA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton , Massachusetts, USA), UniFECTOR (B-Bridge International; Mountain View, California, USA), SureFECTOR (B-Bridge International; Mountain View, California, USA) or HiFect™ (B-Bridge International, Mountain View, California, USA).

Other agents can be used to enhance penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, azones, and terpenes such as limonene and menthone.

v. Carriers.

Certain compositions of the present invention also contain carrier compounds. As used herein, the expressions carrier compound or carrier may mean a nucleic acid or analogue thereof that is inert (i.e., has no biological activity per se) but is recognized as a nucleic acid in vivo by processes that reduce the bioavailability of the nucleic acid with biological activity, for example by destroying biologically active nucleic acid or by promoting its removal from the bloodstream. Co-administration of a nucleic acid and a carrier compound, usually with an excess of the latter, can result in a significant reduction in the amount of nucleic acid processed by the liver, kidney or other extravascular sites, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, hepatic processing of partially phosphorothioate dsRNA may be reduced when coadministered with polyinosinic acid, dextran sulfate, polycytidic acid, or 4-acetamido4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev. , 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.

vi. Fillers.

In contrast to a carrier compound, a pharmaceutical carrier or excipient is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected based on the intended route of administration so as to provide the required volume, consistency, etc., when combined with the nucleic acid and other components of the pharmaceutical composition. Tee

- 80 045602 typical pharmaceutical carriers include, without limitation, binders (for example, pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (eg lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethylcellulose, polyacrylates or dicalcium phosphate, etc.); lubricants (eg, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (for example, starch, sodium starch glycolate, etc.); and wetting agents (eg sodium lauryl sulfate, etc.).

Pharmaceutically acceptable organic or inorganic excipients suitable for administration other than parenteral, which do not react adversely with nucleic acids, can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

Formulations for topical application of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of nucleic acids in liquid or solid oil bases. Solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for administration other than parenteral that do not adversely interact with nucleic acids may be used.

Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

vii. Other components.

The compositions of the present invention may additionally contain other auxiliary components conventionally found in pharmaceutical compositions at levels of use established in the art. Thus, for example, the compositions may contain additional compatible pharmaceutically active materials, such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials suitable for physically formulating the compositions of the present invention in various dosage forms, such as colorants, flavoring agents, preservatives, antioxidants, opacifiers, thickeners and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The compositions can be sterile and, if necessary, they can be mixed with auxiliary agents, for example, lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts to influence osmotic pressure, buffers, coloring agents, flavoring agents and/or fragrances and the like, which do not interact adversely with the nucleic acid(s) of the composition.

Aqueous suspensions may contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

In some embodiments, the pharmaceutical compositions described herein include (a) one or more mRNA compounds, and (b) one or more agents that act by a mechanism other than RNAi and that are useful in the treatment of hemolytic violations. Examples of such agents include, but are not limited to, an anti-inflammatory agent, an anti-steatosis agent, an antiviral agent, and/or an anti-fibrosis agent. In addition, other substances commonly used to protect the liver, such as silymarin, can also be used in combination with the mRNAs described herein. Other agents useful for the treatment of liver diseases include telbivudine, entecavir and protease inhibitors such as telaprevir and others disclosed, for example, in US Patent Application Publications No. 2005/0148548, 2004/0167116 and 2003/0144217, Tung et al. , and US Patent Application Publication No. 2004/0127488, Hale et al.

The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the LD ₅₀ (dose lethal to 50% of the population) and ED ₅₀ (dose therapeutically effective to 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD ₅₀ /ED ₅₀ . Preference is given to compounds that have a high therapeutic index.

Data obtained from cell culture assays and animal studies can be used to formulate dosage ranges for use in humans. In the present invention, the dose of the compositions described herein is generally within the circulating concentration range

- 81 045602 tions, which include ED ₅₀ with little or no toxicity. The dose may vary within this range depending on the dosage form used and the route of administration used. For any compound used in the methods described in the present invention, a therapeutically effective dose can initially be determined by the results of cell culture assays. The dose can be formulated in animal models to achieve a range of concentrations of the circulating plasma compound or, if necessary, the polypeptide product of the target sequence (eg, achieving a reduced concentration of the polypeptide), which includes the IC ₅₀ (i.e., the concentration of the test compound that achieves half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine the appropriate dose in humans. Plasma levels can be measured, for example, using high performance liquid chromatography.

In addition to their administration discussed above, the iRNAs described in the present invention can be administered in combination with other known agents effective in the treatment of pathological processes mediated by the expression of CFB, C3 and/or C9. In any case, the supervising physician may adjust the amount and timing of mRNA administration based on the results observed using standard performance measures known in the art or described herein.

VII. Methods for inhibiting complement component expression.

The present invention provides methods for inhibiting the expression of a complement component as described herein. In one aspect, the present invention provides methods for inhibiting the expression of CFB in a cell. The methods include contacting a cell with an RNAi agent, for example, a double-stranded RNAi agent, in an amount effective to inhibit expression of CFB in the cell, thereby inhibiting expression of CFB in the cell.

The present invention also provides methods for inhibiting C3 expression in a cell. The methods include contacting a cell with an RNAi agent, for example, a double-stranded RNAi agent, in an amount effective to inhibit expression of C3 in the cell, thereby inhibiting expression of C3 in the cell.

In addition, the present invention provides methods for inhibiting the expression of C9 in a cell. The methods include contacting a cell with an RNAi agent, for example, a double-stranded RNAi agent, in an amount effective to inhibit expression of C9 in the cell, thereby inhibiting expression of C9 in the cell.

Bringing a cell into contact with a double-stranded RNAi agent can be performed in vitro or in vivo. Contacting a cell with an RNAi agent in vivo involves bringing a cell or group of cells of a subject, such as a human subject, into contact with the RNAi agent. Combinations of in vitro and in vivo contact methods are also possible. Bringing into contact can be direct or indirect, as discussed above. Moreover, cell contact can be accomplished by a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate moiety, such as a GalNAc3 ligand, or any other ligand that directs the RNAi agent to a site of interest, such as the liver of a subject.

The expression inhibition as used herein is used interchangeably with contraction, silencing, down-regulation and other similar expressions and includes any level of inhibition.

The phrase inhibiting CFB expression is intended to mean inhibiting the expression of any CFB gene (such as, for example, a mouse CFB gene, a rat CFB gene, a monkey CFB gene, or a human CFB gene), as well as variants or mutants of the CFB gene. Thus, a CFB gene may be a wild-type CFB gene, a mutant CFB gene, or a transgenic CFB gene in the context of cells, a group of cells, or an organism that has been genetically manipulated.

Inhibition of CFB gene expression includes any level of inhibition of the CFB gene, such as at least partial suppression of CFB gene expression. CFB gene expression can be assessed based on the level or change in the level of any variable parameter associated with CFB gene expression, e.g., CFB mRNA level, CFB protein level, or e.g., CH ₅₀ activity as a measure of total hemolytic complement, AH ₅₀ as a measure of hemolytic activity alternative complement pathway, and/or lactate dehydrogenase (LDH) levels as a measure of intravascular hemolysis, and/or hemoglobin levels. Levels of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex can also be measured to assess CFB expression. Inhibition can be assessed by a decrease in the absolute or relative level of one or more of these variables compared to the control level. The control level may be any type of control level that is used in the art, such as a pre-dose baseline level or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, for example, a buffer-only control or control with inactive agent).

- 82 045602

The phrase inhibiting C3 expression is intended to mean inhibiting the expression of any C3 gene (such as, for example, a mouse C3 gene, a rat C3 gene, a monkey C3 gene, or a human C3 gene), as well as variants or mutants of the C3 gene. Thus, the C3 gene may be a wild-type C3 gene, a mutant C3 gene, or a transgenic C3 gene in the context of cells, a group of cells, or an organism that has been genetically manipulated.

Inhibition of C3 gene expression includes any level of inhibition of the C3 gene, such as at least partial suppression of C3 gene expression. C3 gene expression can be assessed based on the level or change in the level of any variable parameter associated with C3 gene expression, e.g., C3 mRNA level, C3 protein level, or e.g., CH ₅₀ activity as a measure of total hemolytic complement, AH ₅₀ as a measure of hemolytic activity alternative complement pathway, and/or lactate dehydrogenase (LDH) levels as a measure of intravascular hemolysis, and/or hemoglobin levels. Levels of CFB, C9, C5, C5a, C5b, and soluble C5b-9 complex can also be measured to assess C3 expression. Inhibition can be assessed by a decrease in the absolute or relative level of one or more of these variables compared to the control level. The control level may be any type of control level that is used in the art, such as a pre-dose baseline level or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, for example, a buffer-only control or control with inactive agent).

The phrase inhibiting C9 expression is intended to mean inhibiting the expression of any C9 gene (such as, for example, a mouse C9 gene, a rat C9 gene, a monkey C9 gene, or a human C9 gene), as well as variants or mutants of the C9 gene. Thus, the C9 gene may be a wild-type C9 gene, a mutant C9 gene, or a transgenic C9 gene in the context of cells, a group of cells, or an organism that has been genetically manipulated.

Inhibition of C9 gene expression includes any level of inhibition of the C9 gene, such as at least partial suppression of C9 gene expression. C9 gene expression can be assessed based on the level or change in the level of any variable parameter associated with C9 gene expression, for example, C9 mRNA level, C9 protein level, or, for example, CH ₅₀ activity as a measure of total hemolytic complement, AH ₅₀ as a measure of hemolytic activity alternative complement pathway, and/or lactate dehydrogenase (LDH) levels as a measure of intravascular hemolysis, and/or hemoglobin levels. Levels of CFB, C3, C5, C5a, C5b, and soluble C5b-9 complex can also be measured to assess C9 expression. Inhibition can be assessed by a decrease in the absolute or relative level of one or more of these variables compared to the control level. The control level may be any type of control level that is used in the art, such as a pre-dose baseline level or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, for example, a buffer-only control or control with inactive agent).

In some embodiments of the methods of the present invention, expression of a target gene, such as the CFB, C3, or C9 gene, is inhibited by at least about 5%, at least about 10%, at least about 15%, at least by about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50 %, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

Evidence of inhibition of expression of a target gene, such as a CFB, C3, or C9 gene, may be a decrease in the amount of mRNA expressed by the first cell or group of cells (such cells may be present, for example, in a sample obtained from a subject) in which the target gene is transcribed and which or which have been treated (for example, by contacting a cell or cells with an RNAi agent of the present invention or by administering an RNAi agent of the present invention to a subject in whose body the cells are or have been) such that expression of the target gene is inhibited relative to a second a cell or second group of cells substantially identical to the first cell or group of cells, but which or which were not treated (control cell(s)). In preferred embodiments, inhibition is assessed by expressing the mRNA level in treated cells as a percentage of the mRNA level in control cells using the following formula:

- 83 045602 (mRNA of control cells - mRNA of treated cells) mRNA of control cells

Evidence of inhibition of complement component protein expression may be a decrease in the level of a protein that is expressed by a cell or group of cells (eg, the level of a protein expressed in a sample obtained from a subject). As explained above with respect to the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of treated cells can similarly be expressed as a percentage of the protein level in a control cell or group of control cells.

A control cell or group of control cells that can be used to assess inhibition of target gene expression includes a cell or group of cells that have not yet been exposed to the RNAi agent of the present invention. For example, a control cell or group of control cells may be obtained from a single subject (eg, a human subject or an animal subject) before treating the subject with an RNAi agent.

The level of CFB, C3, or C9 mRNA that is expressed by a cell or group of cells can be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of CFB, C3 and/or C9 in a sample is determined by detecting a transcribed polynucleotide or portion thereof, such as CFB, C3 and/or C9 gene mRNA. RNA can be extracted from cells using RNA extraction techniques, including, for example, acidic phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats that use ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays (Melton et al., Nuc. Acids Res. 12:7035), Northern blotting, in situ hybridization, and microarray analyses.

In one embodiment, the expression level of CFB, C3 and/or C9 is determined using a nucleic acid probe. The expression probe as used herein means any molecule that is capable of selectively binding to a specific CFB, C3 or C9. The probes can be synthesized by one skilled in the art or obtained from appropriate biological preparations. Probes containing the label may be specially designed. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

The isolated mRNAs can be used in hybridization or amplification based assays, which include, but are not limited to, Southern or Northern blot assays, polymerase chain reaction (PCR) assays, and probe arrays. One method for determining mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize, for example, specifically hybridize with CFB, C3, or C9 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and brought into contact with a probe, for example, by passing the isolated mRNA through an agarose gel and transferring the mRNA from the gel to a membrane such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is brought into contact with the probe(s), for example, on an Affymetrix gene microarray. One skilled in the art can easily adapt known mRNA detection methods for use in determining CFB, C3 and/or C9 mRNA levels.

An alternative method for determining the level of expression of CFB, C3 and/or C9 in a sample includes a method of amplifying nucleic acid and/or reverse transcription (to produce cDNA), such as mRNA, in the sample, for example, using RT-PCR (experimental embodiment set forth in Mullis, 1987, US Patent No. 4683202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustaining sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. USA 88:189-193 . Sci. USA 87:1874-1878), transcription amplification systems (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-beta replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., US Pat. No. 5,854,033), or any other method of nucleic acid amplification followed by detection of the amplified molecules using techniques well known to one skilled in the art. Such detection schemes are particularly suitable for detecting nucleic acid molecules if such molecules are present in very small quantities. In specific aspects of the present invention, the level of expression of CFB, C3 and/or C9 is determined using quantitative fluorogenic RT-PCR (ie, the TaqMan™ system).

Expression levels of CFB, C3 and/or C9 mRNA can be monitored using a membrane blot (such as that used in hybridization assays such as Northern, Southern, Dot, etc.) or microwells, test tubes, gels, beads or fibers ( or any solid support containing bound nucleic acid). See US Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195, and 5,445,934, which are incorporated herein by reference. Determining the level of PCSK9 expression may also involve the use of nucleic acid probes in solution.

In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) or real-time PCR (qPCR) assays. The use of such methods is described and illustrated in the Examples section presented herein.

The level of protein expression of CFB, C3 and/or C9 can be determined using any method known in the art for measuring protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, liquid or gel precipitation reactions, absorption spectroscopy, colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISA), immunofluorescence assays, electrochemiluminescent assays, etc.

The expression sample, as used herein, means the selection of similar fluids, cells or tissues isolated from the body of a subject, as well as fluids, cells or tissues present in the body of the subject. Examples of biological fluids include blood, serum and serous fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, intraocular fluids, and the like. Tissue samples may include samples from tissues, organs, or local sites. For example, samples may be obtained from specific organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples can be obtained from the liver (eg, the entire liver, or certain segments of the liver, or certain types of cells in the liver, such as, for example, hepatocytes). In preferred embodiments, the sample obtained from the subject means blood or plasma obtained from the subject. In further embodiments, the sample obtained from the subject means liver tissue obtained from the subject.

In some embodiments of the methods of the present invention, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site in the subject's body. Inhibition of CFB, C3 and/or C9 expression can be assessed by measuring the level or change in the level of CFB, C3, and/or C9 mRNA and/or CFB, C3 and/or C9 protein in a sample obtained from fluid or tissue from a specific location in the subject's body. In preferred embodiments, the site is the liver. A site may also be a subsection or subgroup of cells from any of the above locations. The site may also include cells that express a particular type of receptor.

VIII. Methods for treating or preventing disease associated with a complement component.

The present invention provides therapeutic and prophylactic methods that include administering to a subject with a complement component disorder as described herein, such as PNH or aHUS, an iRNA agent, pharmaceutical compositions containing an iRNA agent, or a vector containing an iRNA according to the present invention.

It should be understood that any of the methods of the present invention can be practiced using a single iRNA agent of the present invention or a combination of iRNA agents of the present invention. For example, in some aspects, the methods (and uses) of the present invention include the use of an iRNA agent targeting the CFB gene and an iRNA agent targeting the C3 gene. In some aspects, the methods (and applications) of the present invention include the use of an iRNA agent that targets the CFB gene and an iRNA agent that targets the C9 gene. In some aspects, the methods (and applications) of the present invention include the use of an iRNA agent that targets the C3 gene and an iRNA agent that targets the C9 gene. In other aspects, the methods (and applications) of the present invention include the use of an iRNA agent targeting the CFB gene, an iRNA agent targeting the C3 gene, and an iRNA agent targeting the C9 gene. In some aspects of the present invention, methods that include either a single iRNA agent of the present invention or a combination of iRNA agents further comprise administering to the subject one or more additional therapeutic agents, such as, for example, Soliris® (which is further described below).

In one aspect, the present invention provides methods for treating a subject with a disorder that would benefit from decreased expression of CFB, such as a complement component-related disease, such as PNH, aHUS, or rheumatoid arthritis. The methods of treatment (and use) of the present invention include administering to a subject, such as a human, a therapeutically effective amount of an iRNA agent that targets the CFB gene, or a pharmaceutical composition containing an iRNA agent that targets the CFB gene, thereby effecting treatment a subject with a disorder that will benefit from decreased CFB expression.

In another aspect, the present invention provides methods for treating a subject with a disorder that would benefit from decreased C3 expression, such as a complement component disorder, such as PNH, aHUS, or rheumatoid arthritis. The methods of treatment (and use) of the present invention include administering to a subject, such as a human, a therapeutically effective amount of an iRNA agent targeting the C3 gene, or a pharmaceutical composition containing an iRNA agent targeting the C3 gene, thereby effecting treatment a subject with a disorder that will benefit from decreased C3 expression.

In a further aspect, the present invention provides methods for treating a subject with a disorder that would benefit from decreased expression of C9, such as a complement component disorder, such as PNH, aHUS, or rheumatoid arthritis. The methods of treatment (and use) of the present invention include administering to a subject, such as a human, a therapeutically effective amount of an iRNA agent targeting the C9 gene, or a pharmaceutical composition containing an iRNA agent targeting the C9 gene, thereby effecting treatment a subject with a disorder that will benefit from decreased C9 expression.

In one aspect, the present invention provides methods for preventing at least one symptom in a subject with a disorder that would benefit from reduction of CFB expression, such as a complement component disorder, such as PNH, aHUS, or rheumatoid arthritis. The methods include administering to a subject a therapeutically effective amount of an iRNA agent, such as dsRNA, or a vector of the present invention, thereby preventing at least one symptom in a subject with a disorder that would benefit from reduction of CFB expression. For example, the present invention provides methods for preventing hemolysis in a subject suffering from a disorder that would benefit from decreased expression of CFB, such as a complement component disorder such as PNH, aHUS, or rheumatoid arthritis.

In one aspect, the present invention provides methods for preventing at least one symptom in a subject with a disorder that would benefit from reduction in C3 expression, such as a complement component disorder such as PNH, aHUS, or rheumatoid arthritis. The methods include administering to a subject a therapeutically effective amount of an iRNA agent, such as dsRNA, or a vector of the present invention, thereby preventing at least one symptom in a subject with a disorder that would benefit from reduction of C3 expression. For example, the present invention provides methods for preventing hemolysis in a subject suffering from a disorder that would benefit from decreased C3 expression, such as a complement component disorder such as PNH, aHUS, or rheumatoid arthritis.

In one aspect, the present invention provides methods for preventing at least one symptom in a subject with a disorder that would benefit from reduction in C9 expression, such as a complement component disorder, such as PNH, aHUS, or rheumatoid arthritis. The methods include administering to a subject a therapeutically effective amount of an iRNA agent, such as dsRNA, or a vector of the present invention, thereby preventing at least one symptom in a subject with a disorder that would benefit from reduction of C9 expression. For example, the present invention provides methods for preventing hemolysis in a subject suffering from a disorder that would benefit from decreased C9 expression, such as a complement component disorder such as PNH, aHUS, or rheumatoid arthritis.

In another aspect, the present invention provides for the use of a therapeutically effective amount of an iRNA agent of the present invention for treating a subject, for example a subject who would benefit from reduction and/or inhibition of CFB expression.

In a further aspect, the present invention provides for the use of a therapeutically effective amount of an iRNA agent of the present invention for treating a subject, for example, a subject who would benefit from reduction and/or inhibition of C3 expression.

In yet another aspect, the present invention provides for the use of a therapeutically effective amount of an iRNA agent of the present invention for treating a subject, for example, a subject who would benefit from reduction and/or inhibition of C9 expression.

In yet another aspect, the present invention provides the use of an iRNA agent, such as a dsRNA, of the present invention that targets a CFB gene, or a pharmaceutical composition comprising an iRNA agent that targets a CFB gene, in the manufacture of a medicament for treating a subject. for example, a subject that would benefit from reduction and/or inhibition of CFB expression, such as a subject with a disorder that would benefit from reduction in CFB expression, such as a complement component disorder, e.g.

- 86 045602

PNH, aHUS or rheumatoid arthritis.

In a further aspect, the present invention provides the use of an iRNA agent, such as a dsRNA, of the present invention that targets the C3 gene, or a pharmaceutical composition comprising an iRNA agent that targets the C3 gene, in the manufacture of a medicament for treating a subject, e.g. a subject that would benefit from reduction and/or inhibition of C3 expression, such as a subject with a disorder that would benefit from reduction in C3 expression, such as a complement component disorder, such as PNH, aHUS, or rheumatoid arthritis .

In yet another further aspect, the present invention provides the use of an iRNA agent, such as a dsRNA, of the present invention that targets the C9 gene, or a pharmaceutical composition containing an iRNA agent that targets the C9 gene, in the manufacture of a medicament for treating a subject. , for example, a subject that would benefit from reduction and/or inhibition of C9 expression, such as a subject with a disorder that would benefit from reduction in C9 expression, such as a complement component disorder, such as PNH, aHUS, or rheumatoid arthritis.

In another aspect, the present invention provides uses of iRNA, such as dsRNA, according to the present invention for the prevention of at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of CFB expression, such as a disorder associated with a component complement, such as PNH, aHUS or rheumatoid arthritis.

In yet another aspect, the present invention provides uses of iRNA, such as dsRNA, according to the present invention to prevent at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of C3 expression, such as a disease associated with a complement component, such as PNH aHUS or rheumatoid arthritis.

In yet another aspect, the present invention provides uses of iRNA, such as dsRNA, according to the present invention to prevent at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of C9 expression, such as a disease associated with a complement component, such as PNH, aHUS or rheumatoid arthritis.

In a further aspect, the present invention provides uses of the iRNA agent of the present invention in the manufacture of a medicament for the prevention of at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of CFB expression, such as a disease associated with a complement component, such as PNH, aHUS or rheumatoid arthritis.

In a further aspect, the present invention provides uses of the iRNA agent of the present invention in the manufacture of a medicament for the prevention of at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of C3 expression, such as a disease associated with a complement component, such as PNH, aHUS or rheumatoid arthritis.

In a further aspect, the present invention provides uses of the iRNA agent of the present invention in the manufacture of a medicament for the prevention of at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of C9 expression, such as a disease associated with a complement component, such as PNH, aHUS or rheumatoid arthritis.

In some aspects of the present invention, methods that include either a single iRNA agent of the present invention or a combination of iRNA agents further comprise administering one or more additional therapeutic agents to the subject.

In some aspects, the additional therapeutic agent is an iRNA-based agent that specifically targets the C5 gene, such as those described in US Provisional Patent Application No. 61/782,531, filed March 14, 2013, in US Provisional Patent Application No. 61/ 8373991, filed June 20, 2013, and US Provisional Patent Application No. 61/904579, filed November 15, 2013, the entire contents of each of which are incorporated herein by reference.

In other aspects, the additional therapeutic agent is an antibody to complement component C5 or an antigen-binding fragment thereof (eg, eculizumab). Eculizumab is a humanized monoclonal IgG2/4 kappa light chain antibody that specifically binds to complement component C5 with high affinity and inhibits the cleavage of C5 to C5a and C5b, thereby inhibiting the formation of the final complement complex C5b-9. Eculizumab is described in US Patent No. 6355245, the entire contents of which are included in this document.

- 87 045602 ment via link.

In further other aspects, the additional therapeutic agent is a C3 inhibitor peptide or analogs thereof. In one embodiment, the C3 inhibitor peptide is compstatin. Compstatin is a cyclic tridecapeptide with potent and selective C3 inhibitory activity. Compstatin and its analogues are described in US Patent Nos. 7888323, 7989589 and 8442776, US Patent Publications 2012/0178694 and 2013/0053302 and PCT Publications Nos. WO 2012/174055, WO 2012/2178083, WO 2013/0367 78, the full contents of each which are incorporated herein by reference.

Accordingly, in one aspect, the present invention provides methods for treating a subject with a disorder that would benefit from reduction of CFB expression, such as a complement component-related disease, such as PNH, aHUS, or rheumatoid arthritis, which comprises administering to the subject, such as a human , a therapeutically effective amount of an iRNA agent targeting CFB, or a pharmaceutical composition comprising an iRNA agent targeting the CFB gene, and an additional therapeutic agent such as an anti-complement C5 antibody or antigen-binding fragment thereof (e.g., eculizumab ), an iRNA-based agent that specifically targets complement component C5 and/or a C3 inhibitor peptide (eg, compstatin), thereby treating a subject with a disorder that would benefit from reduction of CFB expression.

In another aspect, the present invention provides methods for treating a subject with a disorder that would benefit from reduction in C3 expression, such as a complement component-related disorder, such as PNH, aHUS, or rheumatoid arthritis, which comprises administering to the subject, such as a human, a therapeutically effective an amount of an iRNA agent targeting C3, or a pharmaceutical composition comprising an iRNA agent targeting the C3 gene, and an additional therapeutic agent, such as an antibody to complement component C5 or an antigen-binding fragment thereof (e.g., eculizumab), the agent based on an iRNA that specifically targets complement component C5 and/or a C3 inhibitor peptide (eg, compstatin), thereby treating a subject with a disorder that would benefit from reduction in C3 expression.

In another aspect, the present invention provides methods for treating a subject with a disorder that would benefit from reduction in C9 expression, such as a complement component disorder, such as PNH, aHUS, or rheumatoid arthritis, which comprises administering to the subject, such as a human, a therapeutically effective amount an iRNA agent targeting C9, or a pharmaceutical composition containing an iRNA agent targeting the C9 gene, and an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (e.g., eculizumab), an agent targeting based on an iRNA that specifically targets complement component C5 and/or a C3 inhibitor peptide (eg, compstatin), thereby treating a subject with a disorder that would benefit from reduction in C9 expression.

In another aspect, the present invention provides methods for preventing at least one symptom in a subject with a disorder that would benefit from reduction of CFB expression, such as a complement component disorder, such as PNH, aHUS, or rheumatoid arthritis. The methods include administering to a subject a therapeutically effective amount of an iRNA agent, such as dsRNA, or a vector of the present invention and an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent that specifically targets a C5 complement component, and/or a C3 inhibitor peptide (eg, compstatin), thereby preventing at least one symptom in a subject with a disorder that would benefit from decreased CFB expression.

In another aspect, the present invention provides methods for preventing at least one symptom in a subject with a disorder that would benefit from reduction in C3 expression, such as a complement component disorder, such as PNH, aHUS, or rheumatoid arthritis. The methods include administering to a subject a therapeutically effective amount of an iRNA agent, such as dsRNA, or a vector of the present invention and an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent that specifically targets a C5 complement component, and/or a C3 inhibitor peptide (eg, compstatin), thereby preventing at least one symptom in a subject with a disorder that would benefit from decreased C3 expression.

In another aspect, the present invention provides methods for preventing

- 88 045602 at least one symptom in a subject with a disorder that would benefit from reduction of C9 expression, for example a complement component related disease such as PNH, aHUS or rheumatoid arthritis. The methods include administering to a subject a therapeutically effective amount of an iRNA agent, such as dsRNA, or a vector of the present invention and an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent that specifically targets a C5 complement component, and/or a C3 inhibitor peptide (eg, compstatin), thereby preventing at least one symptom in a subject with a disorder that would benefit from decreased C9 expression.

In another aspect, the present invention provides for the use of a therapeutically effective amount of an iRNA agent of the present invention and an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent that specifically targets complement component C5. , and/or a C3 inhibitor peptide (eg, compstatin), for treating a subject, for example, a subject who would benefit from reduction and/or inhibition of CFB expression.

In another aspect, the present invention provides for the use of a therapeutically effective amount of an iRNA agent of the present invention and an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent that specifically targets complement component C5. , and/or a C3 inhibitor peptide (eg, compstatin), for treating a subject, for example, a subject who would benefit from reduction and/or inhibition of C3 expression.

In another aspect, the present invention provides for the use of a therapeutically effective amount of an iRNA agent of the present invention and an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent that specifically targets complement component C5. , and/or a C3 inhibitor peptide (eg, compstatin), for treating a subject, for example, a subject who would benefit from reduction and/or inhibition of C9 expression.

In another aspect, the present invention provides for the use of an iRNA agent, such as a dsRNA, of the present invention that targets a CFB gene, or a pharmaceutical composition comprising an iRNA agent that targets a CFB gene, in the manufacture of a medicament for use in combination with an additional therapeutic agent, such as an anti-complement component CFB antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent targeting complement component C5, and/or a C3 inhibitor peptide (eg, compstatin), for treating a subject, for example, a subject who would benefit from reduction and/or inhibition of CFB expression, for example, with a complement component disease such as PNH, aHUS or rheumatoid arthritis.

In another aspect, the present invention provides for the use of an iRNA agent, such as a dsRNA, of the present invention that targets the C3 gene, or a pharmaceutical composition containing an iRNA agent that targets the C3 gene, in the manufacture of a medicament for use in combination with an additional therapeutic agent, such as an antibody to complement component C3 or an antigen-binding fragment thereof (e.g., eculizumab), an iRNA agent targeting complement component C5, and/or a C3 inhibitor peptide (e.g., compstatin), for treating a subject, for example, a subject who would benefit from reduction and/or inhibition of C3 expression, for example, with a complement component disease such as PNH, aHUS or rheumatoid arthritis.

In another aspect, the present invention provides for the use of an iRNA agent, such as a dsRNA, of the present invention that targets the C9 gene, or a pharmaceutical composition containing an iRNA agent that targets the C9 gene, in the manufacture of a medicament for use in combination with an additional therapeutic agent, such as an antibody to complement component C9 or an antigen-binding fragment thereof (e.g., eculizumab), an iRNA agent targeting complement component C5, and/or a C3 inhibitor peptide (e.g., compstatin), for treating a subject, for example, a subject who would benefit from reduction and/or inhibition of C9 expression, for example with a complement component disease such as PNH, aHUS or rheumatoid arthritis.

In yet another aspect, the present invention provides for the use of an iRNA agent, such as a dsRNA, of the present invention and additional therapeutic vehicles.

- 89 045602 agent, such as an antibody to complement component C5 or its antigen-binding fragment (for example, eculizumab), an iRNA-based agent that specifically targets complement component C5, and/or a C3 inhibitor peptide (for example, compstatin), for the prevention of at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of CFB expression, such as a complement component disorder such as PNH, aHUS, or rheumatoid arthritis.

In yet another aspect, the present invention provides the use of an iRNA agent, such as a dsRNA, according to the present invention and an additional therapeutic agent, such as an antibody to complement component C5 or an antigen binding fragment thereof (eg, eculizumab), an iRNA agent that specifically targets the component complement C5, and/or a C3 inhibitor peptide (e.g., compstatin), to prevent at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of C3 expression, such as a disease associated with a complement component, such as PNH, aHUS or rheumatoid arthritis.

In yet another aspect, the present invention provides the use of an iRNA agent, such as a dsRNA, according to the present invention and an additional therapeutic agent, such as an antibody to complement component C5 or an antigen binding fragment thereof (eg, eculizumab), an iRNA agent that specifically targets the component complement C5, and/or a C3 inhibitor peptide (e.g., compstatin), to prevent at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of C9 expression, such as a disease associated with a complement component, such as PNH, aHUS or rheumatoid arthritis.

In a further aspect, the present invention provides uses of the iRNA agent of the present invention in the manufacture of a medicament for use in combination with an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent, specifically targeting a complement component C5, and/or a C3 inhibitor peptide (e.g., compstatin), to prevent at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of CFB expression, such as a disease , associated with a complement component, such as PNH, aHUS or rheumatoid arthritis.

In a further aspect, the present invention provides uses of the iRNA agent of the present invention in the manufacture of a medicament for use in combination with an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent, specifically targeting a complement component C5, and/or a C3 inhibitor peptide (e.g., compstatin), to prevent at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of C3 expression, such as a disease , associated with a complement component, such as PNH, aHUS or rheumatoid arthritis.

In a further aspect, the present invention provides uses of the iRNA agent of the present invention in the manufacture of a medicament for use in combination with an additional therapeutic agent, such as an anti-complement C5 antibody or antigen-binding fragment thereof (eg, eculizumab), an iRNA agent, specifically targeting a complement component C5, and/or a C3 inhibitor peptide (e.g., compstatin), to prevent at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of C9 expression, such as a disease , associated with a complement component, such as PNH, aHUS or rheumatoid arthritis.

In one embodiment, an iRNA-based agent targeting CFB, C3, or C9 is administered to a subject with a complement component-related disease as described herein such that the levels of CFB, C3, and/or C9, e.g. cell, tissue, blood, urine or other tissue or fluid of the subject, decreased by at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98% or according at least about 99% or more, and then the subject is administered an additional therapeutic agent.

The additional therapeutic agent may be an antibody to complement component C5, or an antigen-binding fragment thereof, or a derivative thereof. In one embodiment, the anti-complement component C5 antibody is eculizumab (SOLIRIS®), or an antigen-binding fragment or derivative thereof.

- 90 045602

The methods of the present invention comprising administering to a subject an mRNA agent of the present invention and eculizumab may further comprise administering to the subject a meningococcal vaccine.

An additional therapeutic agent, such as eculizumab and/or a meningococcal vaccine, can be administered to a subject simultaneously with an iRNA agent targeting CFB, C3, and/or C9 (and/or C5), or at different times.

Moreover, an additional therapeutic agent, such as eculizumab, can be administered to a subject in the same formulation as the iRNA-based agent targeting CFB, C3 and/or C9 (and/or C5), or in different formulations with the iRNA-based agent. iRNA targeting CFB, C3 and/or C9 (and/or C5).

The dosage regimen for eculizumab is described, for example, in the product label for eculizumab (SOLIRIS®) and US Patent Application No. 2012/0225056, each of which is incorporated herein by reference in its entirety. In exemplary methods of the present invention for treating a complement component-related disease, e.g., PNH, aHUS, or rheumatoid arthritis, an iRNA agent targeting, e.g., CFB, C3, or C9 is administered (e.g., subcutaneously) to the subject first such such that the subject's C5 levels decrease (e.g., by at least about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,

37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 62, 64, 65, 66,

67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,

97, 98%, or at least about 99% or more), and then administer eculizumab at lower doses than those described in the package insert for SOLIRIS®. For example, eculizumab can be administered to a subject once per week at a dose of less than about 600 mg for 4 weeks, followed by a fifth dose after about one week of less than about 900 mg, and then at a dose of less than about 900 mg approximately every two weeks thereafter. Eculizumab may also be administered to a subject once per week at a dose of less than about 900 mg for 4 weeks, followed by a fifth dose after about one week of less than about 1200 mg, and then at a dose of less than about 1200 mg approximately every two weeks thereafter. If the subject is under 18 years of age, eculizumab may be administered to the subject once per week at a dose of less than about 900 mg for 4 weeks, followed by a fifth dose one week later at a dose of less than about 1,200 mg, and then at a dose of less than about 1,200 mg approximately every two weeks after that; or if the subject is under 18 years of age, eculizumab may be administered to the subject once per week at a dose of less than about 600 mg for 2 weeks, followed by a third dose after about one week at a dose of less than about 900 mg, and then at a dose of less than about 900 mg every two weeks thereafter; or if the subject is under 18 years of age, eculizumab may be administered to the subject once per week at a dose of less than about 600 mg for 2 weeks, followed by a third dose approximately one week later at a dose of less than about 600 mg, and then at a dose of less than about 600 mg approximately every two weeks thereafter; or if the subject is under 18 years of age, eculizumab may be administered to the subject once weekly at a dose of less than about 600 mg for 1 week, followed by a second dose after about one week at a dose of less than about 300 mg, and then at a dose of less than about 300 mg approximately every two weeks thereafter; or if the subject is under 18 years of age, eculizumab may be administered to the subject once per week at a dose of less than about 300 mg for 1 week, followed by a second dose after about one week at a dose of less than about 300 mg, and then at a dose of less than about 300 mg approximately every two weeks thereafter. If the subject is undergoing plasmapheresis or plasma replacement, eculizumab may be administered to the subject at a dose of less than about 300 mg (eg, if the last dose of eculizumab was approximately 300 mg) or less than about 600 mg (for example, if the last dose of eculizumab was approximately 600 mg or more). If the subject is receiving a plasma infusion, eculizumab may be administered to the subject at a dose of less than about 300 mg (eg, if the last dose of eculizumab was approximately 300 mg or more). Lower doses of eculizumab can be administered either subcutaneously or intravenously.

In a combination therapy of the present invention including eculizumab, eculizumab may be administered to a subject, for example, subcutaneously at a dose of about 0.01 mg/kg to about 10 mg/kg, or about 5 mg/kg to about 10 mg/kg, or from about 0.5 mg/kg to about 15 mg/kg. For example, eculizumab can be administered to a subject, for example, subcutaneously at a dose of 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6, 5, 7, 7.5 mg/kg, at a dose of 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14 , 14.5 or 15 mg/kg.

The methods and uses of the present invention involve administering the composition described herein such that the expression of the target gene CFB, C3 and/or C9 (and/or C5) is reduced, such as decreased over a period of about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76 or approximately 80 hours in one In an embodiment, expression of the target gene is reduced over a longer period of time, for example, for at least about two, three, four, five, six, seven days or more, for example, for about one week, two weeks, three weeks or about four weeks or longer.

Administration of dsRNA in accordance with the methods and uses of the present invention may result in a reduction in severity, attenuation of signs, symptoms and/or markers of such diseases or disorders in a patient with a complement component-related disease. A decrease in this context implies a statistically significant decrease in that level. The reduction may occur, for example, by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95%, or approximately 100%.

The effectiveness of treating or preventing a disease can be assessed, for example, by determining disease progression, remission, symptom severity, pain reduction, quality of life, dose of drug required to maintain treatment effect, disease marker level, or any other measurable parameter appropriate for the disease. being treated or aimed at preventing it. It is well within the ability of one skilled in the art to monitor the effectiveness of treatment or prophylaxis by measuring any of such parameters or any combination of parameters. For example, the effectiveness of treatment of a hemolytic disorder can be assessed, for example, by periodic monitoring of LDH and CH ₅₀ levels. Comparison of late readings with initial readings provides the physician with an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor the effectiveness of treatment or prophylaxis by measuring any of such parameters or any combination of parameters. With respect to the administration of an iRNA targeting CFB, C3 and/or C9, or a pharmaceutical composition thereof, efficacy against a complement component-related disease indicates that administration in a clinically acceptable manner results in a beneficial effect of at least in a statistically significant proportion of patients, such as improvement in symptoms, cure, attenuation of disease, prolongation of life, improvement in quality of life, or other effect generally considered positive by a physician familiar with the treatment of complement component-related disease and related issues.

A treatment effect or preventative effect is evident when there is a statistically significant improvement in one or more indicators of a disease state, or by the absence of worsening or development of symptoms where they would otherwise be predicted. As an example, a favorable change in a measured disease index of at least 10% and preferably at least 20, 30, 40, 50% or more may be indicative of effective treatment. The effectiveness of a given iRNA drug or composition of this drug can also be judged using an experimental animal model for a given disease that is known in the art. When using an experimental animal model, treatment is proven to be effective when a statistically significant reduction in a marker or symptom is observed.

In addition, effectiveness can be assessed by reducing disease severity, as determined by one skilled in the art, based on a clinically accepted disease severity scale, such as the Rheumatoid Arthritis Severity Score (RASS) as one example. Any positive change resulting, for example, in a reduction in disease severity as assessed using an appropriate scale constitutes adequate treatment with the mRNA or mRNA composition as described herein.

A therapeutic amount of mRNA may be administered to a subject, for example, approximately 0.01, 0.02, 0.03, 0.04, 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0, 95, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5 mg/kg dsRNA, 2.6 mg/kg dsRNA, 2.7 mg/kg dsRNA, 2.8 mg/kg dsRNA, 2.9 mg/kg dsRNA, 3.0 mg/kg dsRNA, 3.1 mg/kg dsRNA, 3.2 mg/kg dsRNA, 3.3 mg/kg dsRNA, 3.4 mg/kg dsRNA, 3.5 mg/kg dsRNA, 3.6 mg/kg dsRNA, 3.7 mg/kg dsRNA, 3.8 mg/kg dsRNA, 3.9 mg/kg dsRNA, 4.0 mg/kg dsRNA, 4.1 mg/kg dsRNA, 4, 2 mg/kg dsRNA, 4.3 mg/kg dsRNA, 4.4 mg/kg dsRNA, 4.5 mg/kg dsRNA, 4.6 mg/kg dsRNA, 4.7 mg/kg dsRNA, 4.8 mg /kg dsRNA, 4.9 mg/kg dsRNA, 5.0 mg/kg dsRNA, 5.1 mg/kg dsRNA, 5.2 mg/kg dsRNA, 5.3 mg/kg dsRNA, 5.4 mg/kg dsRNA, 5.5 mg/kg dsRNA, 5.6 mg/kg dsRNA, 5.7 mg/kg dsRNA, 5.8 mg/kg dsRNA, 5.9 mg/kg dsRNA, 6.0 mg/kg dsRNA, 6.1 mg/kg dsRNA, 6.2 mg/kg dsRNA, 6.3 mg/kg dsRNA, 6.4 mg/kg dsRNA, 6.5 mg/kg dsRNA, 6.6 mg/kg dsRNA, 6, 7 mg/kg dsRNA, 6.8 mg/kg dsRNA, 6.9 mg/kg dsRNA, 7.0 mg/kg dsRNA, 7.1 mg/kg dsRNA, 7.2 mg/kg dsRNA, 7.3 mg /kg dsRNA, 7.4 mg/kg dsRNA, 7.5 mg/kg dsRNA, 7.6 mg/kg dsRNA, 7.7 mg/kg dsRNA, 7.8 mg/kg dsRNA, 7.9 mg/kg dsRNA, 8.0 mg/kg dsRNA, 8.1 mg/kg dsRNA, 8.2 mg/kg dsRNA, 8.3 mg/kg dsRNA, 8.4 mg/kg dsRNA, 8.5 mg/kg dsRNA, 8.6 mg/kg dsRNA, 8.7 mg/kg dsRNA, 8.8 mg/kg dsRNA, 8.9 mg/kg dsRNA, 9.0 mg/kg dsRNA, 9.1 mg/kg dsRNA, 9, 2 mg/kg dsRNA, 9.3 mg/kg dsRNA, 9.4 mg/kg dsRNA, 9.5 mg/kg dsRNA, 9.6 mg/kg dsRNA, 9.7 mg/kg dsRNA, 9.8 mg /kg dsRNA, 9.9 mg/kg dsRNA, 9.0 mg/kg dsRNA, 10 mg/kg dsRNA, 15 mg/kg dsRNA, 20 mg/kg dsRNA, 25 mg/kg dsRNA, 30 mg/kg dsRNA, 35 mg/kg dsRNA, 40 mg/kg dsRNA, 45 mg/kg dsRNA, or approximately 50 mg/kg dsRNA. Values and ranges intermediate to the values listed are also intended to be

- 92 045602 part of the present invention.

In some embodiments, for example, when the composition of the present invention includes dsRNA, as described herein, and a lipid, subjects can be administered a therapeutic amount of mRNA, for example, from about 0.01 mg/kg to about 5 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.05 mg/kg to about 5 mg/kg, from about 0.05 mg/kg to about 10 mg/kg, from about 0.1 mg/kg kg to about 5 mg/kg, about 0.1 mg/kg to about 10 mg/kg, about 0.2 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 10 mg /kg, from about 0.3 mg/kg to about 5 mg/kg, from about 0.3 mg/kg to about 10 mg/kg, from about 0.4 mg/kg to about 5 mg/kg, from about 0.4 mg/kg to about 10 mg/kg, about 0.5 mg/kg to about 5 mg/kg, about 0.5 mg/kg to about 10 mg/kg, about 1 mg/kg to about 5 mg/kg, about 1 mg/kg to about 10 mg/kg, about 1.5 mg/kg to about 5 mg/kg, about 1.5 mg/kg to about 10 mg/kg, from about 2 mg/kg to about 2.5 mg/kg, about 2 mg/kg to about 10 mg/kg, about 3 mg/kg to about 5 mg/kg, about 3 mg/kg to about 10 mg/kg, from about 3.5 mg/kg to about 5 mg/kg, from about 4 mg/kg to about 5 mg/kg, from about 4.5 mg/kg to about 5 mg/kg, from about 4 mg/kg to about 10 mg/kg, about 4.5 mg/kg to about 10 mg/kg, about 5 mg/kg to about 10 mg/kg, about 5.5 mg/kg to about 10 mg/kg, from about 6 mg/kg to about 10 mg/kg, from about 6.5 mg/kg to about 10 mg/kg, from about 7 mg/kg to about 10 mg/kg, from about 7.5 mg/kg to about 10 mg/kg, about 8 mg/kg to about 10 mg/kg, about 8.5 mg/kg to about 10 mg/kg, about 9 mg/kg to about 10 mg/kg or from about 9.5 mg/kg to about 10 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

For example, dsRNA can be administered at a dose of approximately

0.1, 0.2, 0.3, 0.4,

0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3,2.4,

2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3,4.4,

4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3,6.4,

6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3,8.4,

8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9 or approximately 10 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

In other embodiments, for example, when the composition of the present invention contains dsRNA, as described herein, and N-acetylgalactosamine, a therapeutic amount of mRNA, for example, at a dose of from about 0.1 to about 50 mg/kg, can be administered to the subject, from about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/kg, about 1.5 to about 50 mg/kg, from about 2 to about 50 mg/kg, from about 2.5 to about 50 mg/kg, from about 3 to about 50 mg/kg, from about 3.5 to about 50 mg/kg , from about 4 to about 50 mg/kg, from about 4.5 to about 50 mg/kg, from about 5 to about 50 mg/kg, from about 7.5 to about 50 mg/kg, from about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/kg kg, from about 1.5 to about 45 mg/kg, from about 2 to about 45 mg/kg, from about 2.5 to about 45 mg/kg, from about 3 to about 45 mg/kg, from about 3, 5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg kg, from about 10 to about 45 mg/kg, from about 15 to about 45 mg/kg, from about 20 to about 45 mg/kg, from about 20 to about 45 mg/kg, from about 25 to about 45 mg/kg kg, from about 25 to about 45 mg/kg, from about 30 to about 45 mg/kg, from at

- 93 045602 about 35 to about 45 mg/kg, from about 40 to about 45 mg/kg, from about 0.1 to about 40 mg/kg, from about 0.25 to about 40 mg/kg, from about 0, 5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/kg, about 1.5 to about 40 mg/kg, about 2 to about 40 mg/kg kg, from about 2.5 to about 40 mg/kg, from about 3 to about 40 mg/kg, from about 3.5 to about 40 mg/kg, from about 4 to about 40 mg/kg, from about 4, 5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, from about 20 to about 40 mg/kg, from about 20 to about 40 mg/kg, from about 25 to about 40 mg/kg, from about 25 to about 40 mg/kg, from about 30 to about 40 mg/kg, from about 35 to about 40 mg/kg, from about 0.1 to about 30 mg/kg, from about 0.25 to about 30 mg/kg, from about 0.5 to about 30 mg/kg, from about 0. 75 to about 30 mg/kg, about 1 to about 30 mg/kg, about 1.5 to about 30 mg/kg, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg kg, from about 3 to about 30 mg/kg, from about 3.5 to about 30 mg/kg, from about 4 to about 30 mg/kg, from about 4.5 to about 30 mg/kg, from about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, from about 25 to about 30 mg/kg, from about 0.1 to about 20 mg/kg, from about 0.25 to about 20 mg/kg, from about 0.5 to about 20 mg /kg, from about 0.75 to about 20 mg/kg, from about 1 to about 20 mg/kg, from about 1.5 to about 20 mg/kg, from about 2 to about 20 mg/kg, from about 2 .5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg /kg, from about 5 to about 20 mg/kg, from about 7.5 to about 20 mg/kg, from about 10 to about 20 mg/kg, or from about 15 to about 20 mg/kg. In one embodiment, where the composition of the present invention contains dsRNA, as described herein, and N-acetylgalactosamine, a therapeutic amount of from about 10 to about 30 mg/kg of dsRNA can be administered to the subject. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

For example, subjects may be administered a therapeutic amount of iRNA, such as about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1. 1.1, 1.2, 1.3,

1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2,3.3,

3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5,2,5,3,

5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2,7.3,

7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2,9.3,

9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, I, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22, 5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39,

40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or approximately 50 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

In certain embodiments of the present invention, for example, when the double-stranded RNAi agent includes a modification (e.g., one or more motifs of three identical modifications of three consecutive nucleotides) comprising one such motif at or adjacent to the agent's cleavage site, six phosphorothioate linkages, and a ligand, such agent is administered at a dose of from about 0.01 to about 0.5 mg/kg, from about 0.01 to about 0.4 mg/kg, from about 0.01 to about 0.3 mg/kg, from about 0 .01 to about 0.2 mg/kg, from about 0.01 to about 0.1 mg/kg, from about 0.01 mg/kg to about 0.09 mg/kg, from about 0.01 mg/kg to about 0.08 mg/kg, from about 0.01 mg/kg to about 0.07 mg/kg, from about 0.01 mg/kg to about 0.06 mg/kg, from about 0.01 mg/kg kg to about 0.05 mg/kg, from about 0.02 to about 0.5 mg/kg, from about 0.02 to about 0.4 mg/kg, from about 0.02 to about 0.3 mg/kg kg, from about 0.02 to about 0.2 mg/kg, from about 0.02 to about 0.1 mg/kg, from about 0.02 mg/kg to about 0.09 mg/kg, from about 0 .02 mg/kg up to

- 94 045602 approximately 0.08 mg/kg, from approximately 0.02 mg/kg to approximately 0.07 mg/kg, from approximately 0.02 mg/kg to approximately 0.06 mg/kg, from approximately 0.02 mg/kg to about 0.05 mg/kg, about 0.03 to about 0.5 mg/kg, about 0.03 to about 0.4 mg/kg, about 0.03 to about 0.3 mg/kg, from about 0.03 to about 0.2 mg/kg, from about 0.03 to about 0.1 mg/kg, from about 0.03 mg/kg to about 0.09 mg/kg, from about 0.03 mg/kg to about 0.08 mg/kg, about 0.03 mg/kg to about 0.07 mg/kg, about 0.03 mg/kg to about 0.06 mg/kg, from about 0.03 mg/kg to about 0.05 mg/kg, from about 0.04 to about 0.5 mg/kg, from about 0.04 to about 0.4 mg/kg, from about 0.04 to about 0.3 mg/kg, from about 0.04 to about 0.2 mg/kg, from about 0.04 to about 0.1 mg/kg, from about 0.04 mg/kg to about 0.09 mg/kg, from about 0.04 mg/kg to about 0.08 mg/kg, from about 0.04 mg/kg to about 0.07 mg/kg, from about 0.04 mg/kg to about 0. 06 mg/kg, from about 0.05 to about 0.5 mg/kg, from about 0.05 to about 0.4 mg/kg, from about 0.05 to about 0.3 mg/kg, from about 0 .05 to about 0.2 mg/kg, from about 0.05 to about 0.1 mg/kg, from about 0.05 mg/kg to about 0.09 mg/kg, from about 0.05 mg/kg to about 0.08 mg/kg or from about 0.05 mg/kg to about 0.07 mg/kg. Values and ranges intermediate to the above are also part of the present invention, for example, an RNAi agent can be administered to a subject at a dose of from about 0.015 mg/kg to about 0.45 mg/mg.

For example, an RNAi agent, such as an RNAi agent in a pharmaceutical composition, can be administered at a dose of approximately 0.01, 0.0125, 0.015, 0.0175, 0.02, 0.0225, 0.025, 0.0275, 0. 03, 0.0325, 0.035, 0.0375, 0.04, 0.0425, 0.045, 0.0475, 0.05, 0.0525, 0.055, 0.0575, 0.06, 0.0625, 0.065, 0.0675, 0.07, 0.0725, 0.075, 0.0775, 0.08, 0.0825, 0.085, 0.0875, 0.09, 0.0925, 0.095, 0.0975, 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475 mg/kg or approximately 0. 5 mg/kg. Values intermediate to the listed values are also part of the present invention.

The mRNA can be administered by intravenous infusion over a period of time, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or approximately 25 minute period. Administration may be repeated, for example, regularly, such as once a week, every two weeks (ie, every two weeks) for one month, two months, three months, four months or longer. After the primary treatment regimen, treatments can be administered less frequently. For example, after administration once a week or every two weeks for three months, administration can be repeated once a month for six months, or a year, or longer.

Administration of iRNA can reduce the levels of CFB, C3 and/or C9 (and/or C5), for example, in a cell, tissue, blood, urine or other part of the patient's body by at least about 5, 6, 7, 8, 9. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,

41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,

71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98% or at least about 99% or more.

Before administering a full dose of mRNA, patients can be given a smaller dose, such as a 5% infusion, and monitored for adverse effects, such as allergic reactions. In another example, the patient may be monitored for undesirable immunostimulatory effects, such as increased levels of a cytokine (eg, TNF-alpha or INF-alpha).

Due to its inhibitory effects on the expression of CFB, C3 and/or C9, the composition of the present invention or a pharmaceutical composition derived therefrom can improve quality of life.

The mRNA of the present invention can be administered in naked form or as free mRNA. Naked mRNA is administered in the absence of a pharmaceutical composition. Naked mRNA can be in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolamine, carbonate or phosphate or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the mRNA buffer solution can be adjusted so that it is suitable for administration to the subject.

Alternatively, the mRNA of the present invention can be administered as a pharmaceutical composition, for example, as part of a liposomal dsRNA.

Subjects who will benefit from reduction and/or inhibition of CFB, C3 and/or C9 gene expression are those with a complement component related disease or disorder as described herein. In one embodiment, a subject with a complement component disorder has paroxysmal nocturnal hemoglobinuria (PNH). In another embodiment, the subject with a complement component-related disease has asthma. In another embodiment, a subject with a complement component-related disease has rheumatoid arthritis. In yet another embodiment

- 95 045602 a subject with a disease associated with a complement component has systemic lupus erythematosus. In one embodiment, a subject with a complement component-related disease has glomerulonephritis. In another embodiment, a subject with a complement component-related disease has psoriasis. In yet another embodiment, a subject with a complement component-related disease has dermatomyositis with bullous pemphigoid. In one embodiment, a subject with a complement component disorder has atypical hemolytic uremic syndrome. In another embodiment, a subject with a complement component disorder has hemolytic uremic syndrome associated with E. coli Shiga-like toxin. In another embodiment, a subject with a complement component-related disease has myasthenia gravis. In yet another embodiment, a subject with a complement component-related disease has neuromyelitis optica. In one embodiment, a subject with a complement component-related disease has dense sediment disease. In one embodiment, a subject with a complement component-related disease has C3 neuropathy. In another embodiment, a subject with a complement component-related disease has age-related macular degeneration. In one embodiment, a subject with a complement component-related disease has Cold agglutinin disease. In one embodiment, a subject with a complement component-related disease has anti-neutrophil cytoplasmic antibody-associated vasculitis. In one embodiment, a subject with a complement component-related disease has graft rejection caused by humoral and vascular mechanisms. In one embodiment, a subject with a complement component-related disease has graft dysfunction. In one embodiment, a subject with a complement component-related disease has had a myocardial infarction. In another embodiment, the subject with a complement component-related disease is a sensitized transplant recipient. In yet another embodiment, a subject with a complement component-related disease has sepsis.

Treatment of a subject who would benefit from reduction and/or inhibition of CFB, C3 and/or C9 gene expression includes therapeutic and prophylactic treatment (eg, the subject would undergo surgery with sensitization transplantation (or allogeneic transplantation).

The present invention further provides methods and uses of an iRNA agent or a pharmaceutical composition thereof (including methods and uses of an iRNA agent or a pharmaceutical composition comprising an iRNA agent and an additional therapeutic agent, e.g., an antibody to complement component C5 or its antigen-binding fragment) for treating a subject who would benefit from reduction and/or inhibition of expression of a target gene according to the present invention, for example CFB, C3 and C9, for example a subject with a complement component-related disease, in combination with other pharmaceutical agents and/ or other therapeutic methods, for example, with known pharmaceuticals and/or known therapeutic methods, such as, for example, those currently used to treat these disorders. For example, in certain embodiments, an iRNA targeting CFB is administered in combination, for example, with an agent useful in treating a complement component-related disease as described elsewhere herein.

For example, additional therapeutic agents and therapeutic methods suitable for treating a subject who would benefit from decreased expression of CFB, C3, and/or C9, such as a subject with a complement component-related disease, include the following: plasmapheresis, thrombolytic therapy (eg, streptokinase), antiplatelet agents, folic acid, corticosteroids; immunosuppressive drugs; Estrogens, methotrexate, 6-MR, azathioprine sulfasalazine, mesalazine, olsalazine, chlorokhinin/hydrochlorokhin, penicillalamin, aurotiomalat (intramuscular and oral), azathioprine, colchicin, corticosteroids (perural, inhalation and local injection), agonists of beta-adr-ader-adords. Enoreceptors (Salbutamol , TERBUTALIN, SALMETERAL), Xanthines (theophylline, aminophylline), cromlycat, short -circuit, ketotifen, iprotropy and oxytropy, cyclosporine, fk506, rapamycin, mycophenolat Moopherine, leflunomide, for example, ibuprofen, corticosteroids, such as prerequisite, sog Phosfodesterase battles, adenosine agonists, antithrombotics, complement inhibitors, adrenergic agents, agents that interfere with the signaling of proinflammatory cytokines such as TNF-α or IL-1 (for example, inhibitors of IRAK, NIK, IKK, p38 or MAP kinases), IL- 1β-converting enzyme, TNFa-converting enzyme (TACE) inhibitors, T cell signal transduction inhibitors such as kinase inhibitors, metalloproteinase inhibitors, sulfasalazine, azathioprine, 6-mercaptopurines, angiotensin converting enzyme inhibitors, soluble cytokine receptors and their derivatives (eg, soluble p55 or p75 TNF receptors and p75TNFRIgG derivatives (Enbrel™ and p55TNFRIgG (Lenercept)), sIL-1RI, sIL-1RII and sIL-6R), anti-inflammatory

- 96 045602 cytokines (e.g. IL-4, IL-10, IL-11, IL-13 and TGFe), celecoxib, folic acid, hydroxychloroquine sulfate, rofecoxib, etanercept, infliximonoclonal antibody, naproxen, valdecoxib, sulfasalazine, methylprednisolone, meloxicam , methylprednisolone acetate, gold-sodium thiomalate, aspirin, triamcinolone acetonide, propoxyphene nasylate/acetoaminophen, folate, nabumetone, diclofenac, piroxicam, etodolac, diclofenac sodium, oxaprozin, oxycodone hydrochloride, hydrocodone bitartrate/acetoaminophen, diclofenac sodium/misoprostol, fentanyl, anakinra , human recombinant molecules, tramadol hydrochloride, salsalate, sulindac, cyanocobalamin/folic acid/pyridoxine, acetaminophen, sodium alendronate, prednisolone, morphine sulfate, lidocaine hydrochloride, indomethacin, glucosamine sulfate/chondroitin, amitriptyline hydrochloride, sulfadiazine, oxycodone hydrochloride/acetaminophen, olopatadine hydrochloride, misoprostol, naproxen sodium, omeprazole, cyclophosphamide, rituxmonoclonal antibody, IL-1 TRAP, MRA, CTLA4-IG, IL-18 BP, anti-IL-18 antibody, anti-IL5 antibody, BIRB-796, SCIO-469, VX- 702, AMG-548, VX-740, roflumilast, IC-485, CDC801, mesopram, cyclosporine, cytokine-suppressing anti-inflammatory drug(s) (CSAID); CDP-571/BAY-10-3356 (humanized anti-TNFa antibody; Celltech/Bayer); cA2/infliximonoclonal antibody (chimeric anti-TNFa antibody; Centocor); 75 kdTNFR-IgG/etanercept (75 kDa TNF receptor-IgG fusion protein; Immunex; see, for example, (1994) Arthr. Rheum. 37: S295; (1996) J. Invest. Med. 44: 235A); 55 kDa TNF-IgG (55 kDa TNF-IgG receptor fusion protein HoffmannLaRoche); IDEC-CE9.1/SB 210396 (non-depleting primatized anti-CD4 antibody; IDEC/SmithKline; see, for example, (1995) Arthr. Rheum. 38: S185); DAB 486-IL-2 and/or DAB 389-IL-2 (IL-2 fusion proteins; Seragen; see, for example, (1993) Arthrit. Rheum. 36: 1223); anti-Tac antibody (humanized anti-IL-2Ra antibody; Protein Design Labs/Roche); IL-4 (anti-inflammatory cytokine; DNAX/Schering); IL-10 (SCH 52000; recombinant IL-10, anti-inflammatory cytokine; DNAX/Schering); IL-4; IL10 and/or IL-4 agonists (eg, agonist antibodies); IL-1RA (IL-1 receptor antagonist; Synergen/Amgen); anakinra (Kineret®/Amgen); TNF-bp/s-TNF (soluble TNF-binding protein; see, for example, (1996) Arthr. Rheum. 39(9 (supplement)): S284; (1995) Amer. J. Physiol. - Heart and Circ. Physiol 268: 37-42); R973401 (phosphodiesterase type IV inhibitor; see, for example, (1996) Arthr. Rheum. 39(9 (supplement): S282); MK-966 (COX-2 inhibitor; see, for example, (1996) Arthr. Rheum 39(9 (supplement): S81); iloprost (see, for example, (1996) Arthr. Rheum. 39(9 (supplement): S82); methotrexate; thalidomide (see, for example, (1996) Arthr. Rheum 39(9 (supplement): S282) and thalidomide-related drugs (eg Celgen); leflunomide (anti-inflammatory and cytokine inhibitor, see for example (1996) Arthr. Rheum. 39(9 (supplement): S131); ( 1996) Inflamm. Res. 45: 103-107); tranexamic acid (plasminogen activation inhibitor, see, for example, (1996) Arthr. Rheum. 39(9 (supplement): S284); T-614 (cytokine inhibitor; see , for example, (1996) Arthr. Rheum. 39(9 (supplement): S282); prostaglandin El (see, for example, (1996) Arthr. Rheum. 39(9 (supplement): S282); tenidap (non-steroidal anti-inflammatory drug drug; see, for example, (1996) Arthr. Rheum. 39(9 (supplement): S280); naproxen (non-steroidal anti-inflammatory drug; see, for example, (1996) Neuro. Report 7: 12091213); meloxicam (non-steroidal anti-inflammatory drug); ibuprofen (non-steroidal anti-inflammatory drug); piroxicam (non-steroidal anti-inflammatory drug); diclofenac (non-steroidal anti-inflammatory drug); indomethacin (non-steroidal anti-inflammatory drug); sulfasalazine (see eg (1996) Arthr. Rheum. 39(9 (supplement): S281); azathioprine (see eg (1996) Arthr. Rheum. 39(9 (supplement): S281); ICE inhibitor (interleukin-1B converting enzyme inhibitor); zap-70 and/or lck inhibitor (zap-70 or lck tyrosine kinase inhibitor); VEGF inhibitor and/or VEGF-R inhibitor (vascular endothelial cell growth factor inhibitors or vascular endothelial cell growth factor receptor ; angiogenesis inhibitors); corticosteroid anti-inflammatory drugs (for example, SB203580); TNF convertase inhibitors; antibodies to IL-12; antibodies to IL18; interleukin-11 (see, for example, (1996) Arthr. Rheum. 39 (9 (supplement ): S296); interleukin-13 (see, for example, (1996) Arthr. Rheum. 39(9 (supplement): S308); interleukin-17 inhibitors (see, for example, (1996) Arthr. Rheum. 39( 9 (supplement): S120); gold; penicillamine; chloroquine; chlorambucil; hydroxychloroquine; cyclosporine; cyclophosphamide; total irradiation of lymphoid tissue; antiplatelet globulin; antibodies to CD4; CD5 toxins; orally administered peptides and collagen; lobenzarite disodium; cytokine regulatory agents (CRAs) HP228 and HP466 (Houghten Pharmaceuticals, Inc.); antisense phosphorothioate oligodeoxynucleotides to ICAM-1 (ISIS 2302; Isis Pharmaceuticals, Inc.); soluble complement receptor 1 (TP10; T Cell Sciences, Inc.); prednisone; orgoteine; glycosaminoglycan polysulfate; minocycline; antibodies to IL2R; lipids from marine organisms and plants (fatty acids from fish and plant seeds; see, for example, DeLuca et al. (1995) Rheum. Dis. Clin. North Am. 21: 759777); auranofin; phenylbutazone; meclofenamic acid; flufenamic acid; intravenous immune globulin; zileuton; azaribine; mycophenolic acid (RS-61443); tacrolimus (FK-506); sirolimus (rapamycin); amiprilose (terafectin); cladribine (2-chlorodeoxyadenosine); methotrexate; bcl-2 inhibitors (see Bruncko, M. et al. (2007) J. Med. Chem. 50(4): 641-662); antiviral and immunomodulatory agents, small molecule KDR inhibitor, small molecule Tie-2 inhibitor; methotrexate;

- 97 045602 prednisone; celecoxib; folic acid; hydroxychloroquine sulfate; rofecoxib; etanercept; infliximonoclonal antibody; leflunomide; naproxen; valdecoxib; sulfasalazine; methylprednisolone; ibuprofen; meloxicam; methylprednisolone acetate; gold sodium thiomalate; aspirin; azathioprine; triamcinolone acetonide; propoxyphene nasylate/acetoaminophen; folate; nabumetone; diclofenac; piroxicam; etodolac; diclofenac sodium; oxaprozin; oxycodone-hcl; hydrocodone bitartrate/acetoaminophen; diclofenac sodium/misoprostol; fentanyl; anakinra, human recombinant molecules; tramadol-hcl; salsanate; sulindac; cyanocobalamin/fa/pyridoxine; acetaminophen; sodium alendronate; prednisolone; morphine sulfate; lidocaine hydrochloride; indomethacin; glucosamine sulfate/chondroitin; cyclosporine; Amyltriptyline hydrochloride; sulfadiazine; oxycodonehcl/acetaminophen; olopatadine-hcl; misoprostol; naproxen sodium; omeprazole; mycophenolate mofetil; cyclophosphamide; rituxmonoclonal antibody; IL-1 TRAP; MRA; CTLA4-IG; IL-18 BP; IL-12/23; anti-IL 18 antibody; anti-IL 15 antibody; BIRB-796; SCIO-469; VX-702; AMG-548; VX-740; roflumilast; IC485; CDC-801; mesopram, albuterol, salmeterol/fluticasone, montelukast sodium, fluticasone propionate, budesonide, prednisone, salmeterol xinafoate, levalbuterol-hcl, albuterol sulfate/ipratropium, prednisolone sodium phosphate, triamcinolone acetonide, beclomethasone dipropionate, ipratropium bromide, azithromycin , pirbuterol acetate, prednisolone, theophylline anhydrous, methylprednisolone sodium succinate, clarithromycin, zafirlukast, formoterol fumarate, influenza virus vaccine, methylprednisolone, amoxicillin trihydrate, flunisolide, antiallergy injection, cromolyn sodium, fexofenadine hydrochloride, flunisolide/menthol, amoxicillin/clavulanate, levofloxacin, auxiliary device for inhalation, guaifenesin, dexamethasone sodium phosphate, moxifloxacin-hcl, doxycycline hyclate, guaifenesin/d-methoprane, r-ephedrine/cod/chlorfenir, gatifloxacin, cetirizine hydrochloride, mometasone furoate, salmeterol xinafoate, benzonatate, cephalexin, re/hydrocodone/chlorfenir, cetirizine - hcl/pseudoephedrine, phenylephrine/cod/promethazine, codeine/promethazine, cefprozil, dexamethasone, guaifenesin/pseudoephedrine, chlorpheniramine/hydrocodone, nedocromil sodium, terbutaline sulfate, epinephrine, methylprednisolone, metaproterenol sulfate, aspirin, nitroglycerin, metoprolol tar trat, enoxaparin sodium, heparin sodium, clopidogrel bisulfate, carvedilol, atenolol, morphine sulfate, metoprolol succinate, warfarin sodium, lisinopril, isosorbide mononitrate, digoxin, furosemide, simvastatin, ramipril, tenecteplase, enalapril maleate, torsemide, retavase, losartan potassium, quinapril-hcl/car magnesium bonate, bumetanide, alteplase, enalaprilat, amiodarone hydrochloride, tirofiban-hcl m-hydrate, diltiazem hydrochloride, captopril, irbesartan, valsartan, propanolol hydrochloride, fosinopril sodium, lidocaine hydrochloride, eptifibatide, cefazolin sodium, atropine sulfate, aminocaproic acid, spiro nolactone, interferon, sotalol hydrochloride, potassium chloride, docusate sodium, dobutamine-hcl, alprazolam, pravastatin sodium, atorvastatin calcium, midazolam hydrochloride, meperidine hydrochloride, isosorbide dinitrate, epinephrine, dopamine hydrochloride, bivalirudin, rosuvastatin, ezetimibe/simvastatin, avasimibe and cariporide.

The mRNA (and/or anti-complement C5 antibody) agent and the additional therapeutic agent and/or treatment may be administered simultaneously and/or in one combination, for example, parenterally, or the additional therapeutic agent may be administered as part of a separate formulation, or different times, and/or other methods known in the art or described herein.

Unless otherwise specified, all technical and scientific terms used herein have the meaning that is commonly understood by one skilled in the art to which the present invention relates. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the mRNA and methods described in the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other literature references herein are incorporated by reference in their entirety. In the event of a conflict, this description, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.

Examples

Example 1. Synthesis of mRNA.

Origin of reagents.

If the origin of a reagent is not specifically stated herein, the reagent can be obtained from any molecular biology reagent supplier of standard quality/purity for molecular biology use.

Transcripts.

SiRNA design was carried out to identify siRNAs that specifically target transcripts from humans (Homo sapiens), cynomolgus monkey (Macaca fascicularis, hereafter cyno), mouse (Mus musculus) and rat (Rattus norvegicus). In general, human, mouse, and rat transcripts from the NCBI reference sequence collection annotated in the NCBI gene database ( http://www.ncbi.nlm.nih.gov/gene/ ) were used in the construction of duplexes. In the case of cyno, transcripts downloaded from the M. fascicularis genome project website were used in the construction

- 98 045602 (http://macaque.genomics.org.cn/page/species/download.jsp), and/or transcripts obtained from a liver-derived cDNA library.

The following from the NCBI reference sequence collection were used in the construction of siRNA for CFB: human - NM_001710; Cyno (from the M. fascicularis genome project) ENSMMUP00000000985 (locus=scaffold3881:47830:53620); mouse - NM_001142706 and NM_008198; and rat - NM_212466.3.

The following from the NCBI reference sequence collection were used in the construction of siRNA for C3: human - NM_000064; Cyno (from the M. fascicularis genome project) ENSP00000245907 (locus=chrl9:6921416:6963034); mouse - NM_009778; and rat - NM_016994.

The following from the NCBI reference sequence collection were used in the construction of siRNA for C9: human - NM_001737; Cyno (from liver cDNA library) - isotig05361; mouse NM_013485; and rat - NM_057146.

siRNA duplexes were constructed in several separate batches, including, but not limited to, batches that contained duplexes matching only human transcripts; human and cyno transcripts; human, cyno and mouse transcripts and human, cyno, mouse and rat transcripts. Most siRNA duplexes were designed to have 100% identity with the human transcript shown and the other species transcripts considered in each batch constructed (above). However, in some cases where the complementary base pair antisense strand:target mRNA was a GC or CG pair, siRNA duplexes were constructed with mispaired bases between the duplex and target mRNA at the first position in the antisense (last in the sense) strand (see ., for example, Table 5, oligonucleotides labeled G21U, G21A, C21A, G21A). In these cases, duplexes were constructed with base pairs UA or AU in the antisense first base:last base pair in the sense strand. Thus, the duplexes retained complementarity but were mismatched with respect to the target (U:C, U:G, A:C, or A:G).

siRNA design, specificity and efficacy prediction.

The predicted specificity of all possible 19mers was predicted from each sequence. Then 19mers candidates were selected that did not have repeats of more than 7 nucleotides.

The following sets of candidate siRNAs were used in extensive searches against the corresponding transcriptomes (defined as the set of NM_ and XM_ entries within the human, mouse, or rat reference sequence sets at NCBI, and the set of cyno transcriptomes within the NCBI Nucleotide Database) using an exhaustive brute force algorithm , included in the 'BruteForce.py' script in the Python programming language.

C3: 46 people/cyno/mouse/rat, 80 people/cyno/mouse, 2384 people/cyno.

C9: 7 people/cyno/mouse/rat, 12 people/cyno/mouse, 816 people/cyno.

CFB: 23 people/cyno/mouse, 1232 people/cyno.

The script was then parsed into transcript-oligo alignments to create a score based on the position and number of mismatches between the siRNA and any potential off-target transcript. The off-target score was weighted to highlight differences in the origin region of siRNAs, positions 2–9 from the 5′ end of the molecule.

Each oligo-transcript pair from the exhaustive search was given a mismatch score by summing the individual mismatch scores; mismatches at positions 2-9 were counted as 2.8, mismatches at cleavage site positions 10-11 were counted as 1.2, and mismatches at site 12-19 were counted as 1.0. Additional off-target prediction was performed by comparing the frequencies of heptamers and octomers derived from 3 different, derived parent hexamers of each oligonucleotide. Hexamers from positions 2-7 relative to the 5' start were used to create 2 heptamers and one octamer. Heptamer 1 was created by adding 3′-A to the hexamer; heptamer 2 was created by adding 5'-A to the hexamer; An octomer was created by adding A to both the 5′ and 3′ ends of the hexamer. The frequency of octamers and heptamers in the 3′-UTRome of human, rhesus macaque, mouse, or rat (defined as a subsequence of the transcriptome from the NCBI RefSeq database where the end of the coding region, the CDS, is well defined) was previously calculated. The octamer frequency was adjusted to the heptamer frequency using the average of the octamer frequency range. The mirSeedScore was then calculated by calculating the sum of (3x matched octamer count) (2x heptamer 2 count) (1x heptamer 1 count)).

Both siRNA strands were assigned to the specificity category according to the calculated scores: a score above 3 qualifies as highly specific, a score of 3 as specific, and between 2.2 and 2.8 as moderately specific. Duplexes were sorted by antisense strand specificity, and those duplexes were selected whose antisense oligonucleotides did not contain a GC at the first position, did not contain a G at both positions 13 and 14, and contained 3 or more U or A in the parent region.

For GalNaC-conjugated duplexes, sense 21mer and antisense 23mer oligonucleotides were designed by extending the antisense 19mers (described above) to 23 nucleotides per

- 99 045602 target complementary sequence. All transcript species included in the batch design were checked for complementarity. Only 23mers that retained 100% sequence complementarity in at least 2 species were used. For each duplex, semantic

21mer as reverse complementarity of the first 21 nucleotides of the antisense strand. SiRNA sequence selection.

The following sets of duplexes of 21/23 monomer units were synthesized and duplexed to construct the GalNac conjugate.

C3: pairs derived from twenty sense and 20 antisense oligonucleotides from human/cyno/mouse/rat, including 6 where the first position in the antisense strand was changed to UA (above); pairs derived from 10 sense and 10 antisense oligonucleotides from human/cyno/mouse, including 3 where the first position in the antisense strand was changed to UA (above); pairs derived from 12 sense and 12 antisense oligonucleotides from human/cyno.

C9: a pair derived from one sense and one antisense oligonucleotide from human/cyno/mouse/rat; pairs derived from 2 sense and 2 antisense oligonucleotides from human/cyno/mouse; a pair derived from 1 sense and 1 antisense oligonucleotide from human/cyno/rat; pairs derived from 19 sense and 19 antisense oligonucleotides from human/cyno.

CFB: pairs derived from nine sense and 9 antisense oligonucleotides from human/cyno/mouse, including 4 where the first position in the antisense strand was changed to UA (above); pairs derived from 23 sense and 23 antisense oligonucleotides from human/cyno.

A detailed list of sense and antisense strand sequences for CFB is given in Table. 3-4.

A detailed list of sequences of sense and antisense chains for C3 is given in table. 5-6.

A detailed list of sequences of sense and antisense chains for C9 is given in table. 7-8.

siRNA synthesis.

General Methods for Synthesizing Small and Medium-sized RNA.

RNA oligonucleotides were synthesized on scales between 0.2-500 µM using commercially available 5'-O-(4,4'-dimethoxytrityl)-2'-O-t-butyldimethylsilyl-3'-O-(2-cyanoethyl- N,N-Diisopropyl)phosphoramidite monomers uridine, 4-N-acetylcytidine, 6-N-benzoyladenosine and 2-N-isobutyrguanosine and the corresponding 2'-O-methyl and 2'-fluorophosphoramidites, according to standard protocols for the synthesis of oligonucleotides in solid phase. Amidite solutions were prepared at a concentration of 0.1-0.15 M and 5-ethylthio-1H-tetrazole (0.25-0.6 M in acetonitrile) was used as an activator. During the synthesis, phosphorothioate modifications of the backbone were introduced using 0.2 M phenylacetyl disulfide (PADS) into lutidine: acetonitrile (1:1) (v/v) or 0.1 M 3-(dimethylaminomethylene) amino-3H-1,2, 4-dithiazole-5 thione (DDTT) in pyridine for the oxidation step. After completion of the synthesis, the sequences were cleaved from the solid support and deprotected using methylamine followed by trimethylamine 3HF to remove the 2'-O-t-butyldimethylsilyl protecting groups present.

For synthesis scales between sequences (5-500 µM and fully 2'-modified 2'-fluoro and/or 2'-O-methyl or combinations thereof), the oligonucleotides were deprotected using a 3:1 (v/v) ratio. ) ethanol and concentrated (28-32%) aqueous ammonia solution either at 35°C for 16 hours, or at 55°C for 5.5 hours. Before removing the ammonia protecting group, the oligonucleotides were treated with 0.5 M piperidine in acetonitrile for 20 minutes on a solid substrate. Crude oligonucleotides were analyzed by LC-MS and anion exchange HPLC (IEX-HPLC). Oligonucleotides were purified using IEX HPLC using: 20 mM phosphate, 10-15% ACN, pH=8.5 (buffer A) and 20 mM phosphate, 10-15% ACN, 1M NaBr, pH=8.5 (buffer IN). Fractions were analyzed for purity by analytical HPLC. Product-containing fractions of acceptable purity were pooled and concentrated on a rotary evaporator until desalted. Samples were desalted using size exclusion chromatography and lyophilized to dryness. Equal molar amounts of sense and antisense strands were annealed in 1x PBS buffer to obtain the corresponding siRNA duplexes.

For small scales (0.2-1 µmol), the synthesis was carried out on a MerMade 192 synthesizer in a 96-well format. In the case of fully 2'-modified sequences (2'-fluorine and/or 2'-O-methyl or combinations thereof), the oligonucleotides were deprotected using methylamine at room temperature for 30-60 min, followed by incubation at 60°C C for 30 min or using 3:1 (v/v) ethanol and concentrated (28-32%) aqueous ammonia solution at room temperature for 30-60 min followed by incubation at 40°C for 1. 5 hours. The crude oligonucleotides were then precipitated in a solution of acetonitrile:acetone (9:1) and isolated by centrifugation and decanting of the supernatant. The crude oligonucleotide pellet was resuspended in 20 mM NaOAc buffer and analyzed by LC-MS and anion exchange HPLC. Crude oligonucleotide sequences were desalted in deep 96-well plates on a HiTrap Se-100 045602 phadex G25 5 ml column (GE Healthcare). From each well, 1.5 ml of samples corresponding to the individual sequence were taken. These purified desalted oligonucleotides were analyzed by LC-MS and anion exchange chromatography. Duplexes were prepared by annealing equimolar amounts of sense and antisense sequences on a Tesap robot. The concentration of duplexes was adjusted to 10 μM in 1x PBS buffer.

I. Synthesis of GalNAc-conjugated oligonucleotides for analysis.

In Vivo.

Oligonucleotides conjugated to a GalNAc ligand at their 3' end were synthesized on scales between 0.2-500 μM using a solid support preloaded with a Y-linker bearing a 4,4-dimethoxytrityl (DMT)-hydroxy primary protecting group for synthesis of the oligonucleotide and the GalNAc ligand attached through the fragment.

To synthesize GalNAc conjugates on scales between 5-500 μM, the following modifications were added to the specified RNA synthesis protocol: For polystyrene-based synthesis supports, 5% dichloroacetic acid in toluene was used for DMT digestion during the synthesis process. Cleavage from the substrate and removal of the protection were carried out as described above. Phosphothioate-rich sequences (typically >5 phosphorothioates) were synthesized without removal of the terminal 5'-OMT group (with DMT) and, after cleavage and deprotection as described above, purified by reverse phase HPLC using 50 mM ammonium acetate in water (buffer A) and 50 mM ammonium acetate in 80% acetonitrile (buffer B). Fractions were analyzed for purity using analytical HPLC and/or LC-MS. Fractions containing the product of acceptable purity were combined and concentrated on a rotary evaporator. The DMT group was removed using 20-25% acetic acid in water until the process was complete. Samples were desalted using size exclusion chromatography and lyophilized to dryness. Equal molar amounts of sense and antisense strands were annealed in 1x PBS buffer to obtain the corresponding siRNA duplexes.

To synthesize small-scale GalNAc conjugates (0.2-1 μM), including sequences with multiple phosphorothioate linkages, the protocols described above for the synthesis of RNA or all-2'L/2'-OMe-containing sequences on the MerMade platform were used. The synthesis was carried out on prepacked columns containing a GalNAc-functionalized controlled glass pore support.

Example 2: In vitro screening.

Cell culture and transfections.

Hep3B cells (ATCC, Manassas, VA) were grown to near confluence at 37°C under 5% CO ₂ in Eagle's minimal maintenance medium (ATCC) supplemented with 10% FBS, streptomycin, and glutamine (ATCC) before being separated from the Petri dish by trypsin treatment. Cells were washed and resuspended to 0.25 x 10 ⁶ cells/ml. During transfections, cells were seeded in a 96-well plate with approximately 20,000 cells per well.

Primary mouse hepatocytes (PMH) were isolated immediately prior to the procedure from female C57BL/6 mice (Charles River Laboratories International, Inc. Willmington, MA), less than 1 h before transfections, and grown in primary hepatocyte medium. Cells were resuspended at a concentration of 0.11 x 10 ⁶ cells/ml in InVitroGRO CP Rat (Celsis In Vitro Technologies, catalog number S01494). During transfection, cells were seeded onto a 96-well BD Biocoat collagen plate (BD, 356407), 10,000 cells per well, and incubated at 37°C in an atmosphere of 5% CO ₂ .

For Hep3B and PMN, transfection was performed by adding 14.8 μl of Opti-MEM with 0.2 μl of Lipofectamine RNAiMax per well (Invitrogen, Cralsbad, CA, catalog no. 13778-150) to 5 μl of each siRNA duplex in a separate well in 96- well plate. The mixture was then incubated at room temperature for 20 minutes. Eighty μl of antibiotic-free complete culture media containing the appropriate number of cells was then added to the siRNA mixture. Cells were incubated for 24 h before RNA purification.

Single dose experiments were performed with a final duplex concentration of 1 nM and 0.01 nM for the GalNAc-modified sequences. Dose-response experiments were performed at 3.1, 0.3, 0.1, 0.037, 0.0123, 0.00412, and 0.00137 nM final duplex concentration for primary mouse hepatocytes and at 3.1, 0.3. 0.1, 0.037, 0.0123, 0.00412, 0.00137, 0.00046, 0.00015, 0.00005 and 0.000017 nM final duplex concentration for Hep3B cells.

Isolation of total RNA using the DYNABEADS mRNA Isolation Kit (Invitrogen, cat. no. 610-12).

Cells were collected and lysed in 150 μl of lysis/binding buffer, then mixed for 5 min at 850 rpm using an Eppendorf Thermomixer (mixing speed was constant throughout the process). Ten microliters of magnetic beads and 80 μl of the lysis/binding buffer mixture were added to the round bottom plate and mixed for 1 min. Magnetic beads were fixed using a magnetic stand and the supernatant was removed without displacing the beads. After removing the supernatant, the lysed cells were added to the remaining beads and mixed for 5 min. After removing the supernatant, the magnetic beads were washed 2 times with 150 μl of wash buffer A and mixed for 1 min. The beads were fixed and the supernatant was removed. The beads were then washed with 150 Lin of wash buffer B, fixed, and the supernatant was discarded. The beads were then washed with 150 ml of wash buffer B, fixed and the supernatant was removed. Finally, the pellets were allowed to dry for 2 min. After drying, 50 μL of elution buffer was added and mixed for 5 min at 70°C. The granules were fixed on a magnet for 5 min. Forty-five μl of supernatant was removed and added to another 96-well plate.

cDNA synthesis using the ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Forster City, CA, cat. no. 4368813)

A master mix was prepared from 2 μl of 10x buffer, 0.8 μl of 25x dNTPs, 2 μl of random primers, 1 μl of reverse transcriptase, 1 μl of RNase inhibitor and 3.2 μl of H ₂ O per reaction. Equal volumes of master mix and RNA were mixed to a final volume of 12 μl for in vitro screening or 20 μl for in vivo screening of samples. cDNA was prepared using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, Calif.) through the following steps: 25°C for 10 min, 37°C for 120 min, 85°C for 5 s, and storage at 4°C.

Real-time PCR.

Two μl of cDNA was added to a master mix containing 2 μl of H2O, 0.5 μl of GAPDH TaqMan probe (Life Technologies, catalog number 4326317E for Hep3B cells, catalog number 352339E for primary mouse hepatocytes, or a custom probe for primary cynomolgus hepatocytes), 0.5 µl of the appropriate TaqMan probe (Life Technologies, catalog number Hs00156197_ml for Hep3B cells or mm00439275_ml for primary mouse hepatocytes, or a custom probe for primary cynomolgus hepatocytes) and 5 µl of mastermix with probe Lightcycler 480 (Roche, part number 04887301001) per well in 384-well plates (Roche, part number 04887301001). Real-time PCR was performed on a Roche LC480 Real Time PCR system (Roche) using a ΔΔCt(RQ) assay. For in vitro screening, each duplex was tested with two biological replicates unless otherwise stated, and real-time PCR was performed in identical technical replicates each time. For in vitro screening, each duplex was tested in one or more experiments (3 mice per group) and real-time PCR was performed in identical technical replicates each time.

To calculate the relative fold change in mRNA levels, real-time data were analyzed using the ΔΔCt method and normalized to analyzes performed with cells transfected with 10 nM AD-1955 or mock transfected cells. IC ₅₀ was calculated using a 4-way fit model using XLFit and normalized to those of cells transfected with AD-1955 at the same dose range or its lowest dose.

AD-1955 sense and antisense sequences are:

semantic: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO: 39);

antisense: UCGAAGuACUcAGCGuAAGdTsdT (SEQ ID NO: 40).

In table 9 shows the results of a single dose screen in Hep3B cells transfected with the indicated GalNAC-conjugated anti-CFB iRNA. Data are expressed as the percentage of messenger RNA remaining compared to untreated cells.

In table 10 shows the results of a single dose screen in primary mouse hepatocytes transfected with the indicated GalNAC-conjugated anti-CFB iRNA. Data are expressed as the percentage of messenger RNA remaining compared to untreated cells.

In table 11 shows the dose-dependent effect in Hep3B cells transfected with the indicated GalNAC-conjugated anti-CFB iRNA. The IC ₅₀ values reported represent IC ₅₀ values compared to untreated cells.

In table 12 shows the dose-dependent effect in primary mouse hepatocytes transfected with the indicated GalNAC-conjugated anti-CFB iRNA. The IC ₅₀ values reported represent IC ₅₀ values compared to untreated cells.

In table 13 shows the results of a single dose screen in primary mouse hepatocytes transfected with the indicated GalNAC-conjugated C9 iRNA. Data are expressed as the percentage of messenger RNA remaining compared to untreated cells.

In table 14 shows the results of a single dose screen in primary mouse hepatocytes transfected with the indicated GalNAC-conjugated anti-C3 iRNA. Data are expressed as the percentage of messenger RNA remaining compared to untreated cells.

In table 15 shows the results of single dose screening in Hep3B cells transfected with the indicated GalNAC-conjugated anti-C3 iRNA. Data are expressed as the percentage of messenger RNA remaining compared to untreated cells.

In table 16 shows the dose-dependent effect in primary mouse hepatocytes transfected with the indicated GalNAC-conjugated anti-C3 iRNA. The IC ₅₀ values shown represent the values

- 102 045602

IC ₅₀ compared to untreated cells.

In table 17 shows the dose-dependent effect in HepZV cells transfected with the indicated GalNAC-conjugated anti-C3 iRNA. The IC50 values reported represent the IC50 values compared to untreated cells.

Table 2. Nucleotide monomer abbreviations used in representing nucleic acid sequences. It should be understood that these monomers, if present in the oligonucleotide, are interconnected by 5'-3' phosphodiester bonds

Reduction Nucleotide(s) A Adenosine 3'-phosphate Af 2'-fluoroadenosine-3'-phosphate Afs 2'-fluoroadenosine-3'-phosphothioate As adenosine 3'-phosphothioate WITH cytidine 3'-phosphate Cf 2'-fluorocytide in-3'-phosphate Cfs 2'-fluorocytidine-3'-phosphothioate Cs cytidine-3'-phosphothioate G guanosine-3'-phosphate Gf 2'-fluoroguanosine-3'-phosphate Gfs 2'-fluoroguanosine-3'-phosphothioate Gs T Tf Tfs Ts U Uf Ufs Us N a as c cs g gs guanosine-3'-phosphothioate 5'-methyluridine-3'-phosphate 2'-fluoro-5-methyluridine-3'-phosphate 2'-fluoro-5-methyluridine-3'-phosphothioate 5-methyluridine-3'-phosphothioate uridine -3'-phosphate 2'-fluorouridine-3'-phosphate 2'-fluorouridine-3'-phosphothioate uridine-3'-phosphothioate any nucleotide (G, A, C, T or U) 2'-O-methyladenosine-3'-phosphate 2'-O-methyladenosine-3'-phosphothioate 2'-O-methylcytidine-3'-phosphate 2'-O -methylcytidine-3'-phosphothioate 2'-O-methylguanosine-3'-phosphate 2'-O-methylguanosine-3'-phosphothioate t 2'-O-methyl-5-methyluridine-3'-phosphate ts 2'-O-methyl-5-methyluridine-3'-phosphothioate u 2'-O-methyluridine-3'-phosphate us 2'-O-methyluridine-3'-phosphothioate s phosphorothioate bond L96 u-[tris(Oa1uAc-alkyl)-amidodecanoyl)]-4hydroxyprolinol-Nur-(Oa1uAc-alkyl)3

- 103 045602

Table 3. Unmodified complement factor B (CFB) sequences

Human CFB sequences Sequence (SEQ ID NO: 41-71, Antisense Duplex ID ID semantic Provision in NM 001710.5 ID antisense sequence (SEQ ID NO: 72-102, Provision in NM 001710.5 accordingly, in order) accordingly, in order) AD-60315.1 A-122021.1 AUUCCUGAAUUUUAUGACUAU j 1987-2007 A-122022.1 AUAGUCAUAAAAUUCAGGAAUUC 1985-2007 AD-60326.1 A-122009.1 CCUGAUCAAGCUCAAGAAUAA j 2016-2036 A-122010.1 UUAUUCUUGAGCUUGAUCAGGGC 2014-2036 AD-60303.1 A-122017.1 GAAGCAGGAAUUCCUGAAUUU i 1978-1998 A-122018.1 AAAUUCAGGAAUUCCUGCUUCUU 1976-1998 AD-60331.1 A-121995.1 AGCAACAUGUGUUCAAAGUCA [ 1628-1648 A-121996.1 UGACUUUGAACACAUGUUGCUCA 1626-1648 AD-60344.1 A-122015.1 GCUGUGGUGUCUGAGUACUUU । 1822-1842 A-122016.1 AAAG UAC U CAGACACCACAG CCC 1820-1842 AD-60345.1 A-122031.1 AAGUGUCUAGUCAACUUAAUU ] 1153-1173 A-122032.1 AAUUAAGUUGACUAGACACCUUUU 1151-1173 AD-60319.1 A-121991.1 AGCUGUGAGAGAGAUGCUCAA [ 2245-2265 A-121992.1 UUGAGCAUCUCUCUCACAGCUGC 2243-2265 AD-60308.1 A-122003.1 AGCCAAAAAGUGUCUAGUCAA I 1146-1166 A-122004.1 UUGACUAGACACUUUUUGGCUCC 1144-1166 AD-60332.1 A-122011.1 UGUGAGUGAUGAGAUCUCUU] 648-668 A-122012.1 AAAGAGAUCUCACUCACACAUU 646-668 AD-60313.1 A-121989.1 AAUUGAGAAGGUGGCAAGUUA j 1170-1190 A-121990.1 UAACUUGCCACCUUCUCAAUUAA 1168-1190 AD-60321.1 A-122023.1 CAACAUGUGUUCAAAGUCAAG i 1630-1650 A-122024.1 CUUGACUUUGAACACAUGUUGCU 1628-1650 AD-60327.1 A-122025.1 UGUGAGAGAGAUGCUCAAUAU [ 2248-2268 A-122026.1 AUAUUGAGCAUCUCUCUCACAGC 2246-2268 AD-60302.1 A-122001.1 GUCUAGUCAACUUAAUUGAGA) 1157-1177 A-122002.1 UCUCAAUUAAGUUGACUAGACAC 1155-1177 AD-60325.1 A-121993.1 UCCAAGAAAGACAAUGAGCAA j 1612-1632 A-121994.1 UUGCUCAUUGUCUUUCUUGGAAG 1610-1632 AD-60337.1 A-121997.1 UGUGUUCAAAGUCAAGGAUAU [ 1635-1655 A-121998.1 AUAUCCUUGACUUUGAACACAUG 1633-1655 AD-60333.1 A-122027.1 AUUGAUGAGAUCCGGGGACUUG i 1486-1506 A-122028.1 CAAGUCCCGGAUCUCAUCAAUGA 1484-1506 AD-60314.1 A-122005.1 CUGUGAGAGAGAUGCUCAAUA [ 2247-2267 A-122006.1 UAUUGAGCAUCUCUCUCACAGCU 2245-2267 AD-60320.1 A-122007.1 GAGCCAAAAAGUGUCUAGUCA] 1145-1165 A-122008.1 UGACUAGACACCUUUUUGGCUCCU 1143-1165 AD-60339.1 A-122029.1 UCCAAGAUGAGGAUUUGGGUU i 2549-2569 A-122030.1 AACCCAAAUCCUCAUCUUGGAGU 2547-2569 AD-60338.1 A-122013.1 CCCUUGAUAGUUCACAAGAGA [ 2386-2406 A-122014.1 UCUCUUGUGAACUAUCAAGGGGC 2384-2406 AD-60307.1 A-121987.1 CAAAGUCAAGGAAUGGAAAA j 1641-1661 A-121988.1 UUUUCCAUAUCCUUGACUUUGAA 1639-1661 AD-60309.1 A-122019.1 UAGUUCACAAGAGAAGUCGUU j 2393-2413 A-122020.1 AACGACUUCUCUUGUGAACUAUC 2391-2413 AD-60343.1 A-121999.1 GGCCCUUGAUAGUUCACAAG [ 2383-2403 A-122000.1 CUUGUGAACUAUCAAGGGGCCGC 2381-2403 AD-60324.1 A-121977.1 UGGUGCUAGAUGGAUCAGACA । 1100-1120 A-121978.1 UGUCUGAUCCAUCUAGCACCAGG 1098-1120 AD-60318.1 A-121975.1 GCUAGAUGGAUCAGACAGCAU i 1104-1124 A-121976.1 AUGCUGUCUGAUCCAUCUAGCAC 1102-1124 AD-60300.1 A-121969.1 UACCUGGUGCUAGAUGGAUCA j GGUGCUAGAUGGGAUCAGACAA j 1096-1116 1101-1121 (G19A) A-121970.1 UGAUCCAUCUAGCACCAGGUAGA 1094-1116 1099-1121 AD-60330.1 A-121979.1 A-121980.1 UUGUCUGAUCCAUCUAGCACCAG (G19A) AD-60306.1 A-121971.1 UCUGAGUCUCUGUGGCAUGGU । 1704-1724 A-121972.1 ACCAUGCCACAGAGACUCAGAGA 1702-1724 AD-60336.1 A-121981.1 GUGCUAGAUGGAUCAGACAGA j 1102-1122 (C19A) A-121982.1 UCUGUCUGAUCCAUCUAGCACCA 1100-1122 (C19A) AD-60301.1 A-121985.1 CUACCUGGUGCUAGAUGGAUA j 1095-1115 (C19A) A-121986.1 UAUCCAUCUAGCACCAGGUAGAU 1093-1115 (C19A) ACCUGGUGCUAGAUGGAUCAA I 1097-1117 (G19A) 1095-1117 AD-60342.1 A-121983.1 A-121984.1 UUGAUCCAUCUAGCACCAGGUAG (G19A) Rodent CFB sequences Sequence (SEQ ID NO: 103-117, Antisense Duplex ID ID semantic Position in NM 001142706.1 ID antisense sequence (SEQ ID NO: 118-132, Position in NM 001142706.1 accordingly, in order) accordingly, in order) AD-60334.1 A-122043.1 GCAAGCCAAGAUCUCAGUCAC 1888-1908 A-122044.1 GUGACUGAGAUCUUGGCUUGCCA 1886-1908 AD-60304.1 A-122033.1 GAUUGAGAAGGUGGCGAGUUA 1291-1311 A-122034.1 UAACUCGCCACCUUCUCAAUCAA 1289-1311 AD-60310.1 A-122035.1 CACAAGAGAAGCCGCUUCAUU 2515-2535 A-122036.1 AAUGAAGCGGCUUCUCUUGUGAA 2513-2535 AD-60328.1 A-122041.1 UUGUGAGAGAGAUGCUACAAA 2364-2384 A-122042.1 UUUGUAGCAUCUCUCUCACAACU 2362-2384 AD-60322.1 A-122039.1 UCCUUCAUGAAUGUUCCGGGGA 193-213 A-122040.1 UCCCGGAACAUUCAUGAAGGAGG 191-213 AD-60316.1 A-122037.1 UCACAGAGAAGCUCAACCAAA 1407-1427 A-122038.1 UUUGGUUGAGCUUCUCUGUGACC 1405-1427 AD-60346.1 A-122047.1 CUCAACCAAAUCAGUUAUGAA 1418-1438 A-122048.1 UUCAUAACUGAUUUGGUUGAGCU 1416-1438 AD-60335.1 A-122059.1 CCCUGACAGAGACCAUCGAAG 1113-1133 A-122060.1 CUUCGAUGGUCUCUGUCAGGGAG 1111-1133 AD-60323.1 A-122055.1 GAGCAGAU U GCAUAAAAGG U U 261-281 A-122056.1 AACCUUUUAUGCAAUCUGCUCUG 259-281 AD-60340.1 A-122045.1 CUUCAUGAAUGUUCCGGGGAAG 195-215 A-122046.1 CUUCCCGGAACAUUCAUGAAGGA 193-215 AD-60305.1 A-122049.1 CUUCAUUCAAGUUGGUGUGAU 2529-2549 A-122050.1 AU CACACCAACU U GAAUGAAGCG 2527-2549 AD-60317.1 A-122053.1 GAUUGAAGAGGGUCCUGUUCCA 2050-2070 A-122054.1 UGGAACAGGACCUCUUCAAUCUC 2048-2070 AD-60329.1 A-122057.1 AUUUCUUUUCAAUGCUAUGAU 782-802 A-122058.1 AUCAUAGCAUUGAAAAGAAAUCU 780-802 AD-60341.1 A-122061.1 CCAGAGCAGAUUGCAUAAAAG 258-278 A-122062.1 CUUUUAUGCAAUCUGCUCUGGCA 256-278 AD-60311.1 A-122051.1 CACAGAGAAGCUCAACCAAAU 1408-1428 A-122052.1 AUUUGGUUGAGCUUCUCUGUGAC 1406-1428

- 104 045602

Table 4. Modified complement factor B (CFB) sequences

Human CFB sequences Duplex ID ID semantic Sequence of meaning (SEQID NO 133-163, respectively, in order) ID antisense Antisense sequence (SEQID NO 164-194, respectively in order) AD-60315.1 A-122021.1 AfsusUfcCfuGfaAfUfUfuUfaUfgAfcUfaUfL96 A-122022.1 asUfsaGfuCfaUfaAfauUfcAfgGfaAfususc AD-60326.1 A-122009.1 CfscsUfgAfuCfaAfGfCfuCfaAfgAfaUfaAfL96 A-122O1O.1 usUfsaUfuCfuUfgAfgcuUfgAfuCfaGfgsgsc AD-60303.1 A-122017.1 GfsasAfgCfaGfgAfAfUfuCfcUfgAfaUfuUfL96 A-122018.1 asAfsaUfuCfaGfgAfauuCfcUfgCfuUfcsusu AD-60331.1 A-121995.1 Afsgs Cf a Af with Af u G f U f G f u U f with Af a Afg U f with Af L9 6 A-121996.1 usGfsaCfuUfuGfaAfcacAfuGfuUfgCfuscsa AD-60344.1 A-122015.1 GfscsUfgUfgGfuGfUfCfuGfaGfuAfcUfuUfL96 A-122016.1 asAfsaGfuAfcUfcAfgacAfcCfaCfaGfcscsc AD-60345.1 A-122031.1 AfsasGfuGfuCfuAfGfUfcAfaCfuUfaAfuUfL96 A-122032.1 asAfsuUfaAfgUfuGfacuAfgAfcAfcUfususu AD-60319.1 A-121991.1 AfsgsCfuGfuGfaGfAfGfaGfaUfgCfuCfaAfL96 A-121992.1 usUfsgAfgCfaUfcUfcucUfcAfcAfgCfusgsc AD-60308.1 A-122003.1 AfsgsCfcAfaAfaAfGfUfgUfcUfaGfuCfaAfL96 A-122004.1 usUfsgAfcUfaGfaCfacuUfuUfuGfgCfuscsc AD-60332.1 A-122011.1 UfsgsUfgAfgUfgAfUfGfaGfaUfcUfcUfuUfL96 A-122012.1 asAfsaGfaGfaUfcUfcauCfaCfuCfaCfasusu AD-60313.1 A-121989.1 AfsasUfuGfaGfaAfGfGfuGfgCfaAfgUfuAfL96 A-121990.1 usAfsaCfuUfgCfcAfccuUfcUfcAfaUfusasa AD-60321.1 A-122023.1 CfsasAfcAfuGfuGfUfUfcAfaAfgUfcAfaGfL96 A-122024.1 csUfsuGfaCfuUfuGfaacAfcAfuGfuUfgscsu AD-60327.1 A-122025.1 UfsgsUfgAfgAfgAfGfAfuGfcUfcAfaUfaUfL96 A-122026.1 asUfsaUfuGfaGfcAfucuCfuCfuCfaCfasgsc AD-60302.1 A-122001.1 GfsusCfuAfgUfcAfAfCfuUfaAfuUfgAfgAfL96 A-122OO2.1 usCfsuCfaAfuUfaAfguuGfaCfuAfgAfcsasc AD-60325.1 A-121993.1 UfscsCfaAfgAfaAfGfAfcAfaUfgAfgCfaAfL96 A-121994.1 usUfsgCfuCfaUfuGfucuUfuCfuUfgGfasasg AD-60337.1 A-121997.1 UfsgsUfgUfuCfaAfAfGfuCfaAfgGfaUfaUfL96 A-121998.1 asUfsaUfcCfuUfgAfcuuUfgAfaCfaCfasusg AD-60333.1 A-122027.1 AfsusUfgAfuGfaGfAfUfcCfgGfgAfcUfuGfL96 A-122028.1 csAfsaGfuCfcCfgGfaucUfcAfuCfaAfusgsa AD-60314.1 A-122005.1 CfsusGfuGfaGfaGfAfGfaUfgCfuCfaAfuAfL96 A-122OO6.1 us Af s u U f g Af gCf a U f c u c U f c U f c Af c Afgs cs u AD-60320.1 A-122007.1 GfsasGfcCfaAfaAfAfGfuGfuCfuAfgUfcAfL96 A-122OO8.1 usGfsaCfuAfgAfcAfcuuUfuUfgGfcUfcscsu AD-60339.1 A-122029.1 UfscsCfaAfgAfuGfAfGfgAfuUfuGfgGfuUfL96 A-122O3O.1 asAfscCfcAfaAfuCfcucAfuCfuUfgGfasgsu AD-60338.1 A-122013.1 CfscsCfuUfgAfuAfGfUfuCfaCfaAfgAfgAfL96 A-122014.1 usCfsuCfuUfgUfgAfacuAfuCfaAfgGfgsgsc AD-60307.1 A-121987.1 CfsasAfaGfuCfaAfGfGfaUfaUfgGfaAfaAfL96 A-121988.1 usUfsuUfcCfaUfaUfccuUfgAfcUfuUfgsasa AD-60309.1 A-122019.1 UfsasGfuUfcAfcAfAfGfaGfaAfgUfcGfuUfL96 A-122O2O.1 asAfscGfaCfuUfcUfcuuGfuGfaAfcUfasusc AD-60343.1 A-121999.1 GfsgsCfcCfcUfuGfAfUfaGfuUfcAfcAfaGfL96 A-122OOO.1 csUfsuGfuGfaAfcUfaucAfaGfgGfgCfcsgsc AD-60324.1 A-121977.1 UfsgsGfuGfcUfaGfAfUfgGfaUfcAfgAfcAfL96 A-121978.1 usGfsuCfuGfaUfcCfaucUfaGfcAfcCfasgsg AD-60318.1 A-121975.1 GfscsUfaGfaUfgGfAfUfcAfgAfcAfgCfaUfL96 A-121976.1 asUfsgCfuGfuCfuGfaucCfaUfcUfaGfcsasc AD-60300.1 A-121969.1 UfsasCfcUfgGfuGfCf UfaGfa UfgGfa UfcAf L96 A-121970.1 usGfsaUfcCfaUfcUfagcAfcCfaGfgUfasgsa AD-60330.1 A-121979.1 G fsgs U f gCf u Afg Af U f G fg Af u Cf a G f a Cf a Af L9 6 A-121980.1 usUfsgUfcUfgAfuCfcauCfuAfgCfaCfcsasg AD-60306.1 A-121971.1 UfscsUfgAfgUfcUfCfUfgUfgGfcAfuGfgUfL96 A-121972.1 asCfscAfuGfcCfaCfagaGfaCfuCfaGfasgsa AD-60336.1 A-121981.1 GfsusGfcUfaGfaUfGfGfaUfcAfgAfcAfgAfL96 A-121982.1 usCfsuGfuCfuGfaUfccaUfcUfaGfcAfcscsa AD-60301.1 A-121985.1 CfsusAfcCfuGfgUfGfCfuAfgAfuGfgAfuAfL96 A-121986.1 usAfs u CfcAf u Cf u Afgca CfcAfgGf u Afgsas u AD-60342.1 A-121983.1 AfscsCfuGfgUfgCfUfAfgAfuGfgAfuCfaAfL96 A-121984.1 usUfsgAfuCfcAfuCfuagCfaCfcAfgGfusasg Rodent CFB sequences Duplex ID ID semantic Sequence of meaning (SEQID NO 195-209, respectively, no order) ID antisense Antisense sequence (SEQID NO 210-224, respectively in order) AD-60334.1 A-122043.1 GfscsAfaGfcCfaAfGfAfuCfuCfaGfuCfaCfL96 A-122044.1 gsUfsgAfcUfgAfgAfucuUfgGfcUfuGfcscsa AD-60304.1 A-122033.1 GfsasUfuGfaGfaAfGfGfuGfgCfgAfgUfuAfL96 A-122034.1 usAfsaCfuCfgCfcAfccuUfcUfcAfaUfcsasa AD-60310.1 A-122035.1 CfsasCfaAfgAfgAfAfGfcCfgCfuUfcAfuUfL96 A-122036.1 asAfsuGfaAfgCfgGfcuuCfuCfuUfgUfgsasa AD-60328.1 A-122041.1 UfsusGfuGfaGfaGfAfGfaUfgCfuAfcAfaAfL96 A-122042.1 usUfsuGfuAfgCfaUfcucUfcUfcAfcAfascsu AD-60322.1 A-122039.1 UfscsCfuUfcAfuGfAfAfuGfuUfcCfgGfgAfL96 A-122040.1 usCfscCfgGfaAfcAfuucAfuGfaAfgGfasgsg AD-60316.1 A-122037.1 UfscsAfcAfgAfgAfAfGfcUfcAfaCfcAfaAfL96 A-122038.1 usUfsuGfgUfuGfaGfcuuCfuCfuGfuGfascsc AD-60346.1 A-122047.1 CfsusCfaAfcCfaAfAfUfcAfgUfuAfuGfaAfL96 A-122048.1 usUfscAfuAfaCfuGfauuUfgGfuUfgAfgscsu AD-60335.1 A-122059.1 Cfs csCf u G f a Cf a G fAf G f a Cf c Af u Cf g Af a G f L9 6 A-122O6O.1 csUfsuCfgAfuGfgUfcucUfgUfcAfgGfgsasg AD-60323.1 A-122055.1 GfsasGfcAfgAfuUfGfCfaUfaAfaAfgGfuUfL96 A-122056.1 asAfscCfuUfuUfaUfgcaAfuCfuGfcUfcsusg AD-60340.1 A-122045.1 CfsusUfcAfuGfaAfUfGfuUfcCfgGfgAfaGfL96 A-122046.1 csUfsuCfcCfgGfaAfcauUfcAfuGfaAfgsgsa AD-60305.1 A-122049.1 CfsusUfcAfuUfcAfAfGfuUfgGfuGfuGfaUfL96 A-122O5O.1 a s U fs c Af c Af cCf a Af c u u G f a Af u G f a Af gscsg AD-60317.1 A-122053.1 GfsasUfuGfaAfgAfGfGfuCfcUfgUfuCfcAfL96 A-122054.1 usGfsgAfaCfaGfgAfccuCfuUfcAfaUfcsusc AD-60329.1 A-122057.1 AfsusUfuCfuUfuUfCfAfaUfgCfuAfuGfaUfL96 A-122058.1 asUfscAfuAfgCfaUfugaAfaAfgAfaAfuscsu AD-60341.1 A-122061.1 Cfscs AfgAfgCfa GfAf U f u Gf cAf u Afa Af a Gf L96 A-122062.1 csUfsuUfuAfuGfcAfaucUfgCfuCfuGfgscsa AD-60311.1 A-122051.1 CfsasCfaGfaGfaAfGfCfuCfaAfcCfaAfaUfL96 A-122052.1 asUfsuUfgGfuUfgAfgcuUfcUfcUfgUfgsasc

- 105 045602

Table 5. Unmodified C3 sequences

Duplex ID ID semantic Sequence of meaning (SEQ ID NO 225-265, respectively, in order) Position in NM_000064.2 ID antisense oh Antisense sequence (SEQ ID NO 266-306, respectively, no order) Position in NM_000064.2 AD-60149.1 A-121853.1 CGUGGUCAAGGUCUUCUCUCUJ 3309-3329 A-121854.1 AGAGAGAAGACCUUGACCACGUA 3307-3329 AD-60151.1 A-121885.1 ACGUGGUCAAGGUCUUCUCUA J 33083324_C21A A-121886.1 UAGAGAAGACCUUGACCACGUAG 3306-3324_C21A AD-6O152.1 A-121901.1 UUUGACCUCAUGGUGUUCGUG [ 1174-1194 A-121902.1 CACG AACACCAU G AG G U CAAAG G 1172-1194 AD-6O153.1 A-121917.1 GGAGAAUUGCUUCAUACAAAJ 4611-4631 A-121918.1 UUUUGUAUGAAGCAAUUCUCCCUC 4609-4631 AD-60154.1 A-121933.1 UGUUAAAUGGCUGAUCCUGGA J 3375-3395 A-121934.1 UCCAGGAUCAGCCAUUUACAGC 3373-3395 AD-60155.1 A-121855.1 GACAGACAAAGACCAUCUACAC J 465-485 A-121856.1 GUGUAGAUGGUCUUGUCUGUCUG 463-485 AD-60156.1 A-121871.1 CCAGACAGACAAGACCAUCUA J 462-482 A-121872.1 UAGAUGGUCUUGUCUGUCUGGAU 460-482 AD-6O157.1 A-121887.1 CCAGAUCCACUUCACCAAGAA! 1125- 1141 C21A A-121888.1 UUCUUGGUGAAGUGGAUCUGGUA 1123-1141_C21A AD-60158.1 A-121903.1 UUGACCUCAUGGUGUUCGUGA J 1175-1195 A-121904.1 UCACGACACCAUGAGGUCAAAG 1173-1195 AD-6O159.1 A-121919.1 CCCCUUCGAGGUCACAGUAAU J 2523-2543 A-121920.1 AUUACUGUGACCUCGAAGGGGUC 2521-2543 AD-60160.1 A-121935.1 AUGAACAAAACUGUGGCUGUU J 2878-2898 A-121936.1 AACAGCCACAGU U U UG U UCAU U C 2876-2898 AD-60161.1 A-121857.1 AGACAGACAAGACCAUCUACA J 464-484 A-121858.1 UGUAGAUGGUCUUGUCUGUCUGG 462-484 AD-60162.1 A-121873.1 CCAGAUCCACUUCACCAAGAC [ 1125-1145 A-121874.1 GUCUUGGUGAAGUGGAUCUGGUA 1123-1145 AD-60163.1 A-121889.1 AGGGAUCUGUGUGGCAGACCA j 25052521_C21A A-121890.1 UGGUCUGCCACACAGAUCCCUUU 2503-2521_C21A AD-60164.1 A-121905.1 GACAAGACCAUCUACACCCCU J 469-489 A-121906.1 AGGGGUGUAGAUGGUCUUGUCUG 467-489 AD-60165.1 A-121921.1 GCUGAGGAGAAUUGCUUCAUA J 4606-4626 A-121922.1 UAUGAAGCAAUUCUCCUCAGCAC 4604-4626 AD-60166.1 A-121859.1 ACGUGGUCAAGGUCUUCUCUC J 3308-3328 A-121860.1 GAGAGAAGACCUUGACCACGUAG 3306-3328 AD-60167.1 A-121875.1 GGAUCUGUGUGGCAGACCCCU! 2507-2527 A-121876.1 AGGGGUCUGCCACACAGAUCCCU 2505-2527 AD-60168.1 A-121891.1 ACAGACAAGACCAUCUACACA ι 466-482_C21A A-121892.1 UGUGUAGAUGGUCUUGUCUGUCU 464-482_C21A AD-60169.1 A-121907.1 AUCCAGACAGACAAGACCAUU ι 460-476_C21U A-121908.1 AAUGGUCUUGUCUGUCUGGAUGA 458-476_C21U AD-60170.1 A-121923.1 CUCCGUGUGGGUGGACGCUCAA ι 1713-1733 A-121924.1 UUGACGUCCACCCACACGGAGUC 1711-1733 AD-60171.1 A-121861.1 UCCAGACAGACAAGACCAUCU ι 461-481 A-121862.1 AGAUGGUCUUGUCUGUCUGGAUG 459-481 AD-6O172.1 A-121877.1 AGGGAUCUGUGUGGCAGACCCC 2505-2525 A-121878.1 GGGUCUGCCACACAGAUCCCUUU 2503-2525 AD-6O173.1 A-121893.1 CAAGAAAGGGAUCUGUGUGGA 24992515_C21A A-121894.1 UCCACACAGAUCCCUUUCUUGUC 2497-2515_C21A AD-60174.1 A-121909.1 UGACCUCAUGGUGUUCGUGAU ι 1176- 1192 C21U A-121910.1 AUCACGAACACCAUGAGGUCAAA 1174-1192_C21U AD-60175.1 A-121925.1 GCAGCUAAAAGACUUUGACUU ι 3789-3809 A-121926.1 AAGUCAAAGUCUUUUAGCUGCAG 3787-3809 AD-60176.1 A-121863.1 CAUCCAGACAGACAAGACCAU ι 459-479 A-121864.1 AUGGUCUUGUCUGUCUGGAUGAA 457-479 AD-6O177.1 A-121879.1 ACAGACAAGACCAUCUACACC ι 466-486 A-121880.1 GGUGUAGAUGGUCUUGUCUGUCU 464-486 AD-60178.1 A-121895.1 AUCCAGACAGACAAGACCAUC ι 460-480 A-121896.1 GAUGGUCUUGUCUGUCUGGAUGA 458-480 AD-6O179.1 A-121911.1 UUUGACCUCAUGGUGUUCGUU ι 1174- 1190_G21U A-121912.1 AACGAACACCAUGAGGUCAAAGG 1172-1190_G21U AD-60180.1 A-121927.1 GGAUGCCAAGAACACUAUGAU ι 4200-4220 A-121928.1 AUCAUAGUGUUCUUGGCAUCCUG 4198-4220 AD-60181.1 A-121865.1 AAGAAAGGGAUCUGUGUGGCA I 2500-2520 A-121866.1 UGCCACACAGAUCCCUUUCUUGU 2498-2520 AD-60182.1 A-121881.1 CAAGAAAGGGAUCUGUGUGGC ι 2499-2519 A-121882.1 GCCACACAGAUCCCUUUCUUGUC 2497-2519 AD-60183.1 A-121897.1 UACGUGGUCAAGGUCUUCUCU ι 3307-3327 A-121898.1 AGAGAAGACCUUGACCACGUAGG 3305-3327 AD-60184.1 A-121913.1 CAGUUUCGAGGUCAUAGUGGA ι 756-776 A-121914.1 UCCACUAUGACCUCGAAACUGGG 754-776 AD-60185.1 A-121929.1 CGUGCCGGAAGGAAUCAGAAU ι 2859-2879 A-121930.1 AUUCUGAUUCCUUCCGGCACGAC 2857-2879 AD-60186.1 A-121867.1 GAAAGGGAUCUGUGUGGCAGA ι 2502-2522 A-121868.1 UCUGCCACACAGAUCCCUUUCUU 2500-2522 AD-60187.1 A-121883.1 GACAGACAAAGACCAUCUACAA 465-481_C21A A-121884.1 UUGUAGAUGGUCUUGUCUGUCUG 463-481_C21A AD-60188.1 A-121899.1 UGACCUCAUGGUGUUCGUGAC 1176-1196 A-121900.1 GUCACGAACACCAUGAGGUCAAA 1174-1196 AD-60189.1 A-121915.1 UGUAAAUAAAUUCGACCUCAAG 4138-4158 A-121916.1 CUUGAGGUCGAAUUUAUUACAGG 4136-4158 AD-60190.1 A-121931.1 AACUACAUGAACCUACAGGAGA 3601-3621 A-121932.1 UCUCUGUAGGUUCAUGUAGUUGG 3599-3621

- 106 045602

Table 6. Modified C3 sequences

Duplex ID ID semantic Sequence of meaning (SEQ ID NO 308-347, respectively, in order) ID antisense Antisense sequence (SEQ ID NOs 348-388, respectively in order) AD-60149.1 A-121853.1 CfsgsUfgGfuCfaAfGfGfuCfuUfcUfcUfcUfL96 A-121854.1 asGfsaGfaGfaAfgAfccuUfgAfcCfaCfgsusa AD-60151.1 A-121885.1 AfscsGfuGfgUfcAfAfGfgUfcUfuCfuCfuAfL96 A-121886.1 usAfsgAfgAfaGfaCfcuuGfaCfcAfcGfusasg AD-6O152.1 A-121901.1 UfsusUfgAfcCfuCfAfUfgGfuGfuUfcGfuGfL96 A-121902.1 csAfscGfaAfcAfcCfaugAfgGfuCfaAfasgsg AD-6O153.1 A-121917.1 GfsgsAfgAfa Ufu GfCfUfuCfa UfaCfa Afa Af L96 A-121918.1 usUfsuUfgUfaUfgAfagcAfaUfuCfuCfcsusc AD-60154.1 A-121933.1 UfsgsUfuAfaAfuGfGfCfuGfaUfcCfuGfgAfL96 A-121934.1 usCfscAfgGfaUfcAfgccAfuUfuAfaCfasgsc AD-6O155.1 A-121855.1 GfsasCfaGfaCfaAfGfAfcCfaUfcUfaCfaCfL96 A-121856.1 gsUfsgUfaGfaUfgGfucuUfgUfcUfgUfcsusg AD-60156.1 A-121871.1 CfscsAfgAfcAfgAfCfAfaGfaCfcAfuCfuAfL96 A-121872.1 usAfsgAfuGfgUfcUfuguCfuGfuCfuGfgsasu AD-6O157.1 A-121887.1 CfscsAfgAfuCfcAfCfUfuCfaCfcAfaGfaAfL96 A-121888.1 usUfscUfuGfgUfgAfaguGfgAfuCfuGfgsusa AD-60158.1 A-121903.1 UfsusGfaCfcUfcAfUfGfgUfgUfuCfgUfgAfL96 A-121904.1 usCfsaCfgAfaCfaCfcauGfaGfgUfcAfasasg AD-6O159.1 A-121919.1 CfscsCfcUfuCfgAfGfGfuCfaCfaGfuAfaUfL96 A-121920.1 asUfsuAfcUfgUfgAfccuCfgAfaGfgGfgsusc AD-60160.1 A-121935.1 AfsusGfaAfcAfaAfAfCfuGfuGfgCfuGfuUfL96 A-121936.1 asAfscAfgCfcAfcAfguuUfuGfuUfcAfususc AD-60161.1 A-121857.1 AfsgsAfcAfgAfcAfAfGfaCfcAfuCfuAfcAfL96 A-121858.1 usGfsuAfgAfuGfgUfcuuGfuCfuGfuCfusgsg AD-60162.1 A-121873.1 CfscsAfgAfuCfcAfCfUfuCfaCfcAfaGfaCfL96 A-121874.1 gsUfscUfuGfgUfgAfaguGfgAfuCfuGfgsusa AD-60163.1 A-121889.1 AfsgsGfgAfuCfuGfUfGfuGfgCfaGfaCfcAfL96 A-121890.1 usGfsgUfcUfgCfcAfcacAfgAfuCfcCfususu AD-60164.1 A-121905.1 GfsasCfaAfgAfcCfAfUfcUfaCfaCfcCfcUfL96 A-121906.1 asGfsgGfgUfgUfaGfaugGfuCfuUfgUfcsusg AD-60165.1 A-121921.1 GfscsUfgAfgGfaGfAfAfuUfgCfuUfcAfuAfL96 A-121922.1 usAfsuGfaAfgCfaAfuucUfcCfuCfaGfcsasc AD-60166.1 A-121859.1 AfscsGfuGfgUfcAfAfGfgUfcUfuCfuCfuCfL96 A-121860.1 gsAfsgAfgAfaGfaCfcuuGfaCfcAfcGfusasg AD-60167.1 A-121875.1 GfsgsAfuCfuGfuGfUfGfgCfaGfaCfcCfcUfL96 A-121876.1 asGfsgGfgUfcUfgCfcacAfcAfgAfuCfcscsu AD-60168.1 A-121891.1 AfscsAfgAfcAfaGfAfCfcAfuCfuAfcAfcAfL96 A-121892.1 usGfsuGfuAfgAfuGfgucUfuGfuCfuGfuscsu AD-60169.1 A-121907.1 Afs usCfcAfgAf cAf Gf AfcAf a Gfa CfcAf u UfL96 A-121908.1 asAfsuGfgUfcUfuGfucuGfuCfuGfgAfusgsa AD-60170.1 A-121923.1 CfsusCfcGfuGfuGfGfGfuGfgAfcGfuCfaAfL96 A-121924.1 usUfsgAfcGfuCfcAfcccAfcAfcGfgAfgsusc AD-60171.1 A-121861.1 UfscsCfaGfaCfaGfAfCfaAfgAfcCfaUfcUfL96 A-121862.1 asGfsaUfgGfuCfuUfgucUfgUfcUfgGfasusg AD-6O172.1 A-121877.1 AfsgsGfgAfuCfuGfUfGfuGfgCfaGfaCfcCfL96 A-121878.1 gsGfsgUfcUfgCfcAfcacAfgAfuCfcCfususu AD-6O173.1 A-121893.1 CfsasAfgAfaAfgGfGfAfuCfuGfuGfuGfgAfL96 A-121894.1 usCfscAfcAfcAfgAfuccCfuUfuCfuUfgsusc AD-60174.1 A-121909.1 UfsgsAfcCfuCfaUfGfGfuGfuUfcGfuGfaUfL96 A-121910.1 asUfscAfcGfaAfcAfccaUfgAfgGfuCfasasa AD-6O175.1 A-121925.1 GfscsAfgCfuAfaAfAfGfaCfuUfuGfaCfuUfL96 A-121926.1 asAfsgUfcAfaAfgUfcuuUfuAfgCfuGfcsasg AD-60176.1 A-121863.1 CfsasUfcCfaGfaCfAfGfaCfaAfgAfcCfaUfL96 A-121864.1 asUfsgGfuCfuUfgUfcugUfcUfgGfaUfgsasa AD-6O177.1 A-121879.1 AfscsAfgAfcAfaGfAfCfcAfuCfuAfcAfcCfL96 A-121880.1 gsGfsuGfuAfgAfuGfgucUfuGfuCfuGfuscsu AD-60178.1 A-121895.1 AfsusCfcAfgAfcAfGfAfcAfa Gfa CfcAf uCfL96 A-121896.1 gsAfsuGfgUfcUfuGfucuGfuCfuGfgAfusgsa AD-6O179.1 A-121911.1 UfsusUfgAfcCfuCfAfUfgGfuGfuUfcGfuUfL96 A-121912.1 asAfscGfaAfcAfcCfaugAfgGfuCfaAfasgsg AD-60180.1 A-121927.1 GfsgsAfuGfcCfaAfGfAfaCfaCfuAfuGfaUfL96 A-121928.1 a s U fs cAf u Af g UfgUfucuUfgGfcAfuCfcsusg AD-60181.1 A-121865.1 AfsasGfaAfaGfgGfAfUfcUfgUfgUfgGfcAfL96 A-121866.1 usGfscCfaCfaCfaGfaucCfcUfuUfcUfusgsu AD-60182.1 A-121881.1 CfsasAfgAfaAfgGfGfAfuCfuGfuGfuGfgCfL96 A-121882.1 gsCfscAfcAfcAfgAfuccCfuUfuCfuUfgsusc AD-60183.1 A-121897.1 UfsasCfgUfgGfuCfAfAfgGfuCfuUfcUfcUfL96 A-121898.1 asGfsaGfaAfgAfcCfuugAfcCfaCfgUfasgsg AD-60184.1 A-121913.1 CfsasGfuUfuCfgAfGfGfuCfaUfaGfuGfgAfL96 A-121914.1 usCfscAfcUfaUfgAfccuCfgAfaAfcUfgsgsg AD-60185.1 A-121929.1 CfsgsUfgCfcGfgAfAfGfgAfa UfcAfgAfa UfL96 A-121930.1 asUfsuCfuGfaUfuCfcuuCfcGfgCfaCfgsasc AD-60186.1 A-121867.1 GfsasAfaGfgGfaUfCfUfgUfgUfgGfcAfgAfL96 A-121868.1 usCfsuGfcCfaCfaCfagaUfcCfcUfuUfcsusu AD-60187.1 A-121883.1 GfsasCfaGfaCfaAfGfAfcCfaUfcUfaCfaAfL96 A-121884.1 usUfsgUfaGfaUfgGfucuUfgUfcUfgUfcsusg AD-60188.1 A-121899.1 UfsgsAfcCfuCfaUfGfGfuGfuUfcGfuGfaCfL96 A-1219OO.1 gsUfscAfcGfaAfcAfccaUfgAfgGfuCfasasa AD-60189.1 A-121915.1 UfsgsUfaAfuAfaAfUfUfcGfaCfcUfcAfaGfL96 A-121916.1 csUfsuGfaGfgUfcGfaauUfuAfuUfaCfasgsg AD-60190.1 A-121931.1 Afs a s Cf u Af c Af u G fAf Af cCf u Af c Af g Af g Af L9 6 A-121932.1 usCfsuCfuGfuAfgGfuucAfuGfuAfgUfusgsg

- 107 045602

Table 7. Unmodified C9 sequences

Duplex ID ID semantic Sequence of meaning (SEQ ID NO 389-411, respectively, in order) Position in NM_001737.3 ID antisense Y Antisense sequence (SEQ ID NO 412-434, respectively in order) Position in NM_001737.3 AD-59663.1 A-121046.1 UUUUGACAAUGAGUUCUACAA i 606-626 A-121047.1 UUGUAGAACUCAUGUCAAAAGG 604-626 AD-59664.1 A-121062.1 AUCAAUGAAUUUAGUGUAAGA ι 1597-1617 A-121063.1 UCUUACACUAAAAUUCAUUGAUAU 1595-1617 AD-59665.1 A-121078.1 AGACAAAUGUUUCGUUCAAGA ι 268-288 A-121079.1 UCUUGAACGAAACAUUUGUCUGA 266-288 AD-59668.1 A-121048.1 CUUUUGACAAUGAGUUCUACA ι 605-625 A-121049.1 UGUAGAACUCAUGUCAAAAGGU 603-625 AD-59669.1 A-121064.1 AACUUGGAAAGAGCCAUUGAAx 1570-1590 A-121065.1 UUCAAUGGCUCUUUCCAAGUUUU 1568-1590 AD-5967O.1 A-121080.1 UACCUGAGAAGCUGAUUAACAx 2589-2609 A-121081.1 UGUUAAUCAGCUUCUCAGGUAGG 2587-2609 AD-59673.1 A-121050.1 ACCUUUUGACAAUGAGUUCUA । 603-623 A-121051.1 UAGAACUCAUUGUCAAAAGGUGU 601-623 AD-59674.1 A-121066.1 GACUGCGGAAAUGACUUUCAA 391-411 A-121067.1 UUGAAAGUCAUUCCGCAGUCAU 389-411 AD-59675.1 A-121082.1 GCCCAUUCAAAUUUGAGGGAA 1682-1702 A-121083.1 UUCCCUCAAAUUUGAAUGGGCAG 1680-1702 AD-59678.1 A-121052.1 UUUUGGAUAAAGCUUCCAUGA 1175-1195 A-121053.1 UCAUGGAAGCUUUAUCCAAAACA 1173-1195 AD-59679.1 A-121068.1 AACCAAAGGGCGAGAAAAAUUU 708-728 A-121069.1 AAAUUUUUCUCGCCUUUGGUUUC 706-728 AD-59680.1 A-121084.1 CUUUGCCAACUACCUAUGAAA' 1067-1087 A-121085.1 UUUCAUAGGUAGUUGGCAAAGCU 1065-1087 AD-59683.1 A-121054.1 CACCUUUUGACAAUGAGUUCU 602-622 A-121055.1 AGAACUCAUGUCAAAAGGUGUG 600-622 AD-59684.1 A-121070.1 GAGAAGACAUCAAAUUUUAAU ¹ 781-801 A-121071.1 AUUAAAAUUUGAUGUCUUCUCUU 779-801 AD-59685.1 A-121086.1 GACAAUGAGUUCUACAAUGGA ¹ 610-630 A-121087.1 UCCAUUGUAGAAUCAUUGUCAA 608-630 AD-59688.1 A-121056.1 UUUGGAUAAAGCUUCCAUGAA J 1176-1196 A-121057.1 UUCAUGGAAGCUUUAUCCAAAAC 1174-1196 AD-59689.1 A-121072.1 AUCUAUGAAACCAAAGGCGAG J 700-720 A-121073.1 CUCGCCUUUGGUUUCAUAGAUCA 698-720 AD-5969O.1 A-121088.1 AUAUCAAUGAAUUUAGUGUAA J 1595-1615 A-121089.1 UUACACUAAAUUCAUUGAUAUAG 1593-1615 AD-59692.1 A-121058.1 CACACCUUUUGACAAUGAGUU J 600-620 A-121059.1 AACUCAUUGUCAAAAGGUGUGCU 598-620 AD-59693.1 A-121074.1 UAGGGUCUGAGACCUUUUGAA J 2648-2668 A-121075.1 UUCAAAAGGUCUCAGACCCUAAG 2646-2668 AD-59694.1 A-121090.1 CAAAACUUGGAAAGAGCCAUU J 1567-1587 A-121091.1 AAUGGCUCUUUCCAAGUUUUGUU 1565-1587 AD-59696.1 A-121060.1 GCACACCUUUUGACAAUGAGUx | 599-619 A-121061.1 ACUCAUUGUCAAAAGGUGUGCUU 597-619 AD-59697.1 A-121076.1 UGAAACCAAAGGCGAGAAAAA[ 705-725 A-121077.1 UUUUUCUCGCCUUUGGUUUCAUA 703-725

Table 8. Modified C9 sequences

Duplex ID ID semantic Sequence of meaning (SEQ ID NO 435-457, respectively, no order) ID antisense Antisense sequence (SEQ ID NOS 458-480, respectively, no order) AD-59663.1 A-121046.1 UfsusUfuGfaCfaAfUfGfaGfuUfcUfaCfaAfL96 A-121047.1 usUfsgUfaGfaAfcUfcauUfgUfcAfaAfasgsg AD-59664.1 A-121062.1 AfsusCfaAfuGfaAfUfUfuAfgUfgUfaAfgAfL96 A-121063.1 usCfsuUfaCfaCfuAfauUfcAfullfgAfusasu AD-59665.1 A-121078.1 AfsgsAfcAfaAfuGfUfUfuCfgUfuCfaAfgAfL96 A-121079.1 usCfsuUfgAfaCfgAfaacAfuUfuGfuCfusgsa AD-59668.1 A-121048.1 Cfs us U f u UfgAf cAf Af U fgAfg Uf u Cf u Af c Af L9 6 A-121049.1 usGfsuAfgAfa CfuCfauuGfuCfaAfaAfgsgsu AD-59669.1 A-121064.1 AfsasCfuUfgGfaAfAfGfaGfcCfaUfuGfaAfL96 A-121065.1 usUfscAfaUfgGfcUfcuuUfcCfaAfgUfususu AD-59670.1 A-121080.1 UfsasCfcUfgAfgAfAfGfcUfgAfuUfaAfcAfL96 A-121081.1 usGfsuUfaAfuCfaGfcuuCfuCfaGfgUfasgsg AD-59673.1 A-121050.1 AfscsCfuUfuUfgAfCfAfaUfgAfgUfuCfuAfL96 A-121051.1 usAfsgAfaCfuCfaUfuguCfaAfaAfgGfusgsu AD-59674.1 A-121066.1 GfsasCfuGfcGfgAfAfAfuGfaCfuUfuCfaAfL96 A-121067.1 usUfsgAfaAfgUfcAfuuuCfcGfcAfgUfcsasu AD-59675.1 A-121082.1 GfscsCfcAfuUfcAfAfAfuUfuGfaGfgGfaAfL96 A-121083.1 us U fscCfc U fcAf a Af u u u Gf a Af u Gf gGf csasg AD-59678.1 A-121052.1 UfsusUfuGfgAfuAfAfAfgCfuUfcCfaUfgAfL96 A-121053.1 usCfsaUfgGfaAfgCfuuuAfuCfcAfaAfascsa AD-59679.1 A-121068.1 AfsasCfcAfaAfgGfCfGfaGfaAfaAfaUfuUfL96 A-121069.1 asAfsaUfuUfuUfcUfcgcCfuUfuGfgUfususc AD-59680.1 A-121084.1 CfsusUfuGfcCfaAfCfUfaCfcUfaUfgAfaAfL96 A-121085.1 usUfsuCfaUfaGfgUfaguUfgGfcAfaAfgscsu AD-59683.1 A-121054.1 CfsasCfcUfuUfuGfAfCfaAfuGfaGfuUfcUfL96 A-121055.1 asGfsaAfcUfcAfuUfgucAfaAfaGfgUfgsusg AD-59684.1 A-121070.1 GfsasGfaAfgAfcAfUfCfaAfaUfuUfuAfaUfL96 A-121071.1 asUfsuAfaAfaUfuUfgauGfuCfuUfcUfcsusu AD-59685.1 A-121086.1 GfsasCfaAfuGfaGfUfUfcUfaCfaAfuGfgAfL96 A-121087.1 usCfscAfuUfgUfaGfaacUfcAfullfgUfcsasa AD-59688.1 A-121056.1 UfsusUfgGfaUfaAfAfGfcUfuCfcAfuGfaAfL96 A-121057.1 usUfscAfuGfgAfaGfcuuUfaUfcCfaAfasasc AD-59689.1 A-121072.1 AfsusCfuAfuGfaAfAfCfcAfaAfgGfcGfaGfL96 A-121073.1 csUfscGfcCfuUfuGfguuUfcAfuAfgAfuscsa AD-59690.1 A-121088.1 AfsusAfuCfaAfuGfAfAfuUfuAfgUfgUfaAfL96 A-121089.1 usUfsaCfaCfuAfaAfuucAfuUfgAfuAfusasg AD-59692.1 A-121058.1 CfsasCfaCfcUfuUfUfGfaCfaAfuGfaGfuUfL96 A-121059.1 asAfscUfcAfullfgUfcaaAfaGfgUfgUfgscsu AD-59693.1 A-121074.1 UfsasGfgGfuCfuGfAfGfaCfcUfuUfuGfaAfL96 A-121075.1 usUfscAfaAfaGfgllfcucAfgAfcCfcUfasasg AD-59694.1 A-121090.1 CfsasAfaAfcUfuGfGfAfaAfgAfgCfcAfuUfL96 A-121091.1 asAfsuGfgCfuCfuUfuccAfaGfuUfullfgsusu AD-59696.1 A-121060.1 GfscsAfcAfcCfuUfUfUfgAfcAfaUfgAfgUfL96 A-121061.1 asCfsuCfallfuGfuCfaaaAfgGfuGfuGfcsusu AD-59697.1 A-121076.1 UfsgsAfaAfcCfaAfAfGfgCfgAfgAfaAfaAfL96 A-121077.1 usUfsuUfuCfuCfgCfcuuUfgGfuUfuCfasusa

- 108 045602

Table 9. Single dose screening for CFB in NerZV cells

10 nM 0.1 nM 10 nM, SD 0.1 nM, SD AD-60315.1 22.82 17.15 20.03 9.73 AD-60326.1 9.33 17.49 0.29 4.75 AD-60303.1 8.45 28.08 4.67 10.75 AD-60331.1 14.47 29.99 4.36 4.99 AD-60344.1 17.61 30.59 6.96 1.70 AD-60345.1 8.98 33.88 0.65 7.11 AD-60319.1 14.36 33.98 1.17 12.16 AD-60308.1 12.64 34.07 0.19 11.41 AD-60332.1 20.19 35.92 3.53 3.23 AD-60313.1 23.94 38.26 19.92 13.16 AD-60321.1 13.32 46.50 4.83 1.00 AD-60327.1 18.44 50.40 6.45 5.21 AD-60302.1 13.82 53.31 4.21 12.46 AD-60325.1 11.73 54.59 0.27 15.34 AD-60337.1 16.17 56.04 3.64 33.50 AD-60333.1 17.72 65.14 2.22 8.79 AD-60314.1 27.79 67.44 2.02 9.10 AD-60320.1 18.12 85.78 5.39 33.24 AD-60339.1 20.86 88.73 9.59 10.47 AD-60338.1 18.14 91.03 4.11 10.07 AD-60307.1 21.76 91.13 3.49 43.21 AD-60309.1 20.64 95.13 0.34 53.77 AD-60343.1 61.82 112.57 5.56 17.11 AD-60324.1 24.20 81.08 3.41 18.95 AD-60318.1 43.11 99.07 13.83 17.69 AD-60300.1 35.21 111.33 5.35 12.86 AD-60330.1 58.80 111.85 8.86 32.76 AD-60306.1 85.87 113.97 12.01 33.11 AD-60336.1 35.90 119.80 3.75 4.92 AD-60301.1 28.95 121.90 7.73 23.23 AD-60342.1 49.16 123.56 17.53 14.88 AD-60334.1 26.12 55.28 22.52 7.86 AD-60304.1 20.62 74.38 4.43 16.50 AD-60310.1 18.93 77.08 0.87 35.20 AD-60328.1 63.55 86.20 1.91 4.07 AD-60322.1 81.67 86.30 21.22 25.58 AD-60316.1 105.01 93.22 8.55 14.39 AD-60346.1 109.11 99.09 2.07 25.51 AD-60335.1 42.63 101.00 5.91 54.15 AD-60323.1 81.31 103.20 4.03 3.86 AD-60340.1 50.41 109.25 20.73 1.67 AD-60305.1 30.06 114.59 5.00 17.97 AD-60317.1 102.87 126.87 1.95 30.25 AD-60329.1 106.30 131.90 0.20 53.49 AD-60341.1 112.98 137.99 3.94 31.92 AD-60311.1 162.39 140.07 10.04 63.65

- 109045602

Table 10. Single dose screening for CFB in primary mouse hepatocytes

Avg. 10 nM Avg. 0.1 nM 10 nM, SD 0.1 nM, SD AD-60302.1 112.73 109.72 15.29 1.75 AD-60303.1 119.44 102.70 0.15 23.82 AD-60307.1 67.92 99.67 2.91 6.47 AD-60308.1 116.89 111.68 12.15 4.51 AD-60309.1 100.72 112.85 10.72 4.84 AD-60313.1 50.21 102.05 10.08 4.13 AD-60314.1 74.12 113.15 4.99 12.59 AD-60315.1 101.22 104.79 6.07 29.27 AD-60319.1 18.56 81.28 4.22 6.27 AD-60320.1 103.08 123.28 8.71 18.51 AD-60321.1 45.03 104.98 3.91 25.35 AD-60325.1 121.99 127.67 4.63 24.72 AD-60326.1 55.24 102.10 4.66 13.35 AD-60327.1 79.42 108.21 4.77 21.99 AD-60331.1 4.51 52.03 0.35 8.06 AD-60332.1 115.05 120.93 6.06 4.00 AD-60333.1 102.19 113.88 0.38 31.81 AD-60337.1 3.93 31.08 1.12 0.49 AD-60338.1 120.85 115.74 9.02 8.93 AD-60339.1 16.97 75.02 0.27 10.17 AD-60343.1 126.10 131.79 24.11 14.66 AD-60344.1 8.06 35.14 0.31 11.86 AD-60345.1 132.64 133.75 7.96 27.82 AD-60300.1 27.05 81.40 8.63 8.86 AD-60301.1 10.24 72.49 0.46 5.41 AD-60306.1 97.07 114.32 4.87 18.27 AD-60318.1 37.73 98.00 3.09 7.56 AD-60324.1 42.83 99.93 1.21 12.09 AD-60330.1 70.05 116.47 1.46 15.23 AD-60336.1 31.97 95.19 13.63 1.75 AD-60342.1 38.22 108.31 4.90 6.76 AD-60304.1 7.88 18.03 3.57 18.03 AD-60305.1 13.09 64.61 2.19 11.26 AD-60310.1 1.36 21.17 0.24 1.27 AD-6O311.1 2.11 28.70 0.22 4.79 AD-60316.1 2.23 28.29 1.11 4.66 AD-60317.1 60.25 84.11 5.23 5.66 AD-60322.1 70.53 115.47 1.47 11.72 AD-6O323.1 108.71 117.31 17.38 7.90 AD-60328.1 4.04 38.52 0.21 10.03 AD-60329.1 6.73 36.47 0.21 8.72 AD-60334.1 49.74 99.41 2.74 8.64 AD-60335.1 34.99 99.57 3.64 1.59 AD-60340.1 99.13 106.94 5.71 9.81 AD-60341.1 92.74 112.17 0.34 8.10 AD-60346.1 5.65 53.30 0.52 5.28

Table 11. Dose-Response Screening for CFB in Hep3B Cells

Duplex ID IC50 in NerZV (nM) AD-60303.1 0.119 AD-60326.1 0.062 AD-60319.1 0.351 AD-60331.1 0.225 AD-60337.1 0.418 AD-60344.1 0.347 AD-60304.1 >10 AD-60324.1 7,039

- 110 045602

Table 12. Dose-Response Screening for CFB in Primary Mouse Hepatocytes

Duplex ID IC50 in primary mouse hepatocytes (nM) AD-60303.1 Not achieved AD-60326.1 4,063 AD-60319.1 0.162 AD-60331.1 0.031 AD-60337.1 0.014 AD-60344.1 0.003 AD-60304.1 0.028 AD-60324.1 0.854

Table 13. Single dose screening for C9 in primary mouse hepatocytes

Duplex ID Avg. 10 nM Avg. 0.1 nM SD 10 nM SD 0.1 nM AD-59663.1 5.92 27.33 2.13 16.40 AD-59664.1 83.71 76.56 42.80 21.75 AD-59665.1 91.76 85.56 20.62 26.31 AD-59668.1 30.66 49.06 4.23 13.47 AD-59669.1 95.36 64.74 18.69 19.30 AD-59670.1 96.91 103.65 26.38 7.23 AD-59673.1 22.34 31.20 7.34 20.44 AD-59674.1 12.16 45.36 5.13 14.79 AD-59675.1 93.18 109.59 3.77 8.45 AD-59678.1 47.33 47.23 14.22 6.86 AD-59679.1 98.53 30.06 12.88 32.30 AD-59680.1 33.75 86.68 1.20 28.07 AD-59683.1 25.81 44.31 9.78 23.12 AD-59684.1 58.89 96.75 16.45 21.05 AD-59685.1 68.90 115.36 8.17 6.36 AD-59688.1 32.69 41.63 6.49 21.72 AD-59689.1 86.86 102.46 24.47 0.38 AD-59690.1 101.98 131.95 4.87 0.16 AD-59692.1 33.98 36.81 9.73 3.38 AD-59693.1 84.70 75.60 35.91 16.09 AD-59694.1 108.88 132.73 2.53 45.43 AD-59696.1 32.87 45.82 9.72 15.79 AD-59697.1 110.00 120.20 1.21 3.98 AD-1955 109.44 92.04 24.08 32.14 AD-1955 105.93 104.33 4.54 6.01 AD-1955 87.62 93.01 6.11 3.30 AD-1955 90.95 117.91 3.90 29.31 AD-1955 91.04 93.49 6.80 8.35 AD-1955 106.63 107.78 1.44 9.89 AD-1955 95.33 82.10 9.45 2.92 AD-1955 123.15 121.27 44.13 11.42

- 111 045602

Table 14. Single dose screening for C3 in primary mouse hepatocytes

Duplex ID Avg. 10 nM Avg. 0.1 nM 10 nM, SD 0.1 nM, SD AD-60149.1 0.08 33.89 0.04 44.73 AD-60151.1 0.11 81.49 0.14 7.88 AD-60152.1 1.72 92.02 0.89 9.34 AD-60153.1 93.57 97.06 17.16 4.16 AD-60154.1 97.73 122.73 0.66 28.17 AD-60155.1 12.94 91.38 17.39 9.28 AD-60156.1 8.02 41.58 9.16 56.27 AD-60157.1 23.61 98.22 33.22 8.77 AD-60158.1 0.75 77.42 0.76 8.61 AD-60159.1 100.47 93.53 11.61 7.44 AD-60160.1 89.34 92.97 18.42 9.21 AD-60161.1 2.33 82.37 0.32 21.06 AD-60162.1 60.59 46.83 1.37 65.96 AD-60163.1 104.09 53.32 5.42 75.38 AD-60164.1 61.13 40.41 5.57 57.13 AD-60165.1 61.93 86.61 4.44 11.53 AD-60166.1 2.27 96.48 0.70 17.52 AD-60167.1 87.51 84.41 3.70 9.19 AD-60168.1 35.16 98.47 0.28 20.95 AD-60169.1 0.42 51.78 0.13 18.79 AD-60170.1 125.00 99.12 1.46 12.72 AD-60171.1 0.44 59.53 0.01 1.82 AD-60172.1 89.05 102.11 4.20 10.62 AD-60173.1 81.29 95.39 16.08 3.86 AD-60174.1 0.06 25.26 0.02 31.64 AD-60175.1 0.89 80.59 0.23 6.61 AD-60176.1 0.88 52.71 0.02 6.12 AD-60177.1 63.14 85.00 16.41 9.25 AD-60178.1 42.97 64.33 4.75 14.00 AD-60179.1 0.12 54.36 0.01 6.05 AD-60180.1 94.57 98.11 13.68 5.65 AD-60181.1 69.28 85.66 6.99 31.48 AD-60182.1 84.22 79.05 2.63 8.99 AD-60183.1 0.08 44.17 0.05 7.27 AD-60184.1 80.50 81.13 9.59 14.73 AD-60185.1 92.21 99.75 12.00 2.32 AD-60186.1 60.60 93.85 18.81 29.73 AD-60187.1 2.33 71.77 0.20 1.49 AD-60188.1 0.33 78.13 0.37 14.56 AD-60189.1 57.75 91.38 43.16 14.16 AD-60190.1 29.40 94.84 41.57 7.55 AD-1955 103.85 90.86 8.96 3.45 AD-1955 71.27 115.36 36.17 13.40 AD-1955 99.16 95.85 5.16 8.09 AD-1955 112.29 104.37 3.65 12.88 AD-1955 108.44 97.01 1.40 0.36 AD-1955 118.26 109.90 2.10 12.76 AD-1955 98.09 98.72 11.81 1.81

- 112 045602

Table . 15. Single dose screening for C3 in NerZV cells

Duplex ID Avg. 10 nM Avg. 0.1 nM 10 nM, SD 0.1 nM, SD AD-60149.1 7.49 55.90 7.75 4.41 AD-60151.1 24.05 101.65 14.22 8.27 AD-60152.1 16.58 112.51 10.66 19.82 AD-60153.1 20.13 22.40 22.87 3.76 AD-60154.1 24.21 112.90 8.93 25.58 AD-60155.1 20.48 68.97 2.10 1.73 AD-60156.1 18.22 66.39 0.80 1.67 AD-60157.1 29.07 125.72 5.80 8.08 AD-60158.1 81.03 105.18 14.03 14.20 AD-60159.1 27.58 92.91 4.77 2.22 AD-60160.1 11.49 60.48 4.68 11.60 AD-60161.1 27.49 80.57 10.88 16.13 AD-60162.1 49.58 89.22 3.76 6.06 AD-60163.1 91.18 99.19 5.14 21.40 AD-60164.1 33.93 85.93 4.07 1.00 AD-60165.1 5.54 13.05 0.43 2.69 AD-60166.1 35.21 81.66 21.31 14.48 AD-60167.1 106.64 115.02 8.09 39.17 AD-60168.1 26.91 92.99 2.50 5.86 AD-60169.1 10.66 49.63 6.66 17.36 AD-60170.1 52.73 104.43 2.71 22.03 AD-60171.1 23.77 60.35 7.94 7.27 AD-60172.1 143.57 99.22 8.09 11.58 AD-60173.1 100.25 108.80 12.25 44.49 AD-60174.1 16.68 92.68 0.45 45.25 AD-60175.1 24.94 42.14 4.74 7.68 AD-60176.1 17.30 66.19 8.83 13.81 AD-60177.1 50.71 116.18 20.19 1.49 AD-60178.1 22.65 90.84 5.82 15.23 AD-60179.1 15.21 85.30 3.55 23.07 AD-60180.1 45.91 93.35 16.19 28.54 AD-60181.1 63.50 109.82 10.07 14.56 AD-60182.1 110.82 121.62 1.09 6.78 AD-60183.1 13.82 69.24 8.64 3.35 AD-60184.1 26.47 97.94 9.64 9.88 AD-60185.1 41.42 103.45 7.77 2.47 AD-60186.1 72.24 88.39 6.37 51.31 AD-60187.1 9.49 51.15 3.28 11.65 AD-60188.1 55.44 95.66 7.05 30.36 AD-60189.1 52.59 89.41 4.25 20.79 AD-60190.1 16.67 95.38 1.22 11.83

- 113 045602

Table 16. Screening for dose response

Example 3: In vivo screening.

A subset of three GalNAC-conjugated anti-CFB iRNAs were selected for additional in vivo evaluation, AD-60304, AD-60331, and AD-60344. The nucleotide sequences of the sense and antisense strands of these iRNA-based agents are given in Table. 18. As indicated in table. 19, the nucleotide sequence of AD-60304 closely matches the nucleotide sequences of mouse and rat. The nucleotide sequence of AD-60331 and the nucleotide sequence of AD-60344 have mismatched nucleotides (MM; see bolded and underlined nucleotides) with the mouse gene but are active in mouse hepatocytes.

C57BL/6 mice (N=3 per group) were injected subcutaneously with either 1 mg/kg or 10 mg/kg GalNAc-conjugated duplexes or an equal volume of 1x Dulbecco's phosphate buffer saline (DPBS) (Life Technologies, cat. no. 14040133). . 96 h later, mice were sacrificed and livers were excised and snap frozen in liquid nitrogen. Livers were ground in a 2000 Geno/Grinder (SPEX, SamplePrep, Metuchen, NJ). Approximately 10 mg of liver powder per sample was used for RNA extraction. Samples were first homogenized in TissueLyserII (Qiagen Inc., Valencia, CA) and then RNA was extracted with an RNeasy 96 Universal Tissue Kit (Qiagen Inc., part number 74881) according to the manufacturer's protocol using vacuum/squeeze technology. RNA concentration was measured using a NanoDrop 8000 (Thermo Scientific, Wilmington, DE) and adjusted to 100 ng/μl. DNA was prepared and RT-PCR was performed as described above.

In fig. 2 demonstrates the effectiveness of anti-CFB iRNA in inhibiting anti-CFB mRNA at a dose of either 1 mg/kg or 10 mg/kg. At a dose of 10 mg/kg, an average of approximately 80% silencing was observed for all three iRNAs tested. At a dose of 1 mg/kg, an average of approximately 30% silencing was observed for AD-60331 and AD-60344.

The ability of AD-60331 to suppress CFB mRNA expression in vivo was also assessed using single doses of 1.25, 2.5 and 10 mg/kg. C57BL/6 mice were administered the following doses by subcutaneous injection, and the mice were sacrificed 70 h later. Isolation of RNA from animal livers, DNA preparation and RT-PCR were carried out as described above. In fig. 3 demonstrates that AD-60331 reduces CFB mRNA levels in a dose-dependent manner with an ED ₅₀ of approximately 2.5 mg/kg. When administered to human subjects, these iRNAs are expected to be even more effective based on their sequence design.

- 114 -

Claims (11)

Table 18 Duplex Semantic sequence (SEQ ID NOs 481-483, respectively, in order) Antisense sequence (SEO ID NO 484-486, respectively, in order) view AD-60304.1 GfsasUfuGfaGfaAfGfGfuGfgCfgAfgUfuAfL96 usAfsaCfuCfgCfcAfccuUfcUfcAfaUfcsasa M.R. AD-60331.1 AfsgsCfaAfcAfuGfUfGfuUfcAfaAfgUfcAfL96 usGfsaCfuUfuGfaAfcacAfuGfuUfgCfuscsa NS AD-60344.1 GfscsUfgUfgGfuGfUfCfuGfaGfuAfcUfuUfL96 asAfsaGfuAfcUfcAfgacAfcCfaCfaGfcscsc NS Table 19 Duplex Antisense MM to mouse (in bold and underlined) (SEQ ID NOs 487-489, respectively, in order) Antisense MM to rat (in bold and underlined) (SEQ ID NOs 490-492, respectively, in order) IC50 in primary mouse hepatocytes (nM) IC50 in stainless steel (nM) AD-60304.1 UAACUCGCCACCUUCUCAAUCAA UAACUCGCCACCUUCUCAAUCAA 0.028 2,876 AD-60331.1 UGACUUUGAACACAUGUUGCUCA UGACUUUGAACACAUGUUGCUCA 0.031 0.225 AD-60344.1 AAAGUACUCAGACACCACAGCCC AAAGUACUCAGACACCACAGCCC 0.017 0.347 CLAIM 1. A double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of complement component C3 in a cell, wherein the dsRNA contains a sense strand and an antisense strand forming a double-stranded region, where the sense strand contains at least 18 contiguous nucleotides from the nucleotide sequence 5'-CGUGGUCAAGGUCUUCUCUCUCU-3 ' (SEQ ID NO: 225) and the antisense strand contains at least 18 contiguous nucleotides from the nucleotide sequence 5'AGAGAGAAGACCUUGACCACGUA-3' (SEQ ID NO: 266), where the sense strand is 18-21 nucleotides long and the antisense strand is 18 nucleotides long -23 nucleotides, where all the nucleotides of the sense strand and all the nucleotides of the antisense strand are modified nucleotides, and at least one of the modified nucleotides is a 2'-Omethyl-modified nucleotide or a 2'-fluoro-modified nucleotide, and where at least one strand conjugated to a ligand that is one or more N-acetylgalactosamine (GalNAc) derivatives. 2. dsRNA according to claim 1, where at least one modified nucleotide has a nucleotide modification selected from the group consisting of LNA, CRN, cET, UNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2 '-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl and combinations thereof. 3. dsRNA according to claim 1, wherein all modified nucleotides independently contain a 2'-O-methyl modification or a 2'-fluoro modification. 4. dsRNA according to claim 1, wherein said agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage. 5. Isolated cell containing dsRNA according to claim 1. 6. Pharmaceutical composition for inhibiting the expression of the complement component C3 gene, containing dsRNA according to claim 1. 7. A method for inhibiting the expression of the complement component C3 gene in a cell, including: (a) bringing the cell into contact with the dsRNA according to claim 1 or the pharmaceutical composition according to claim 6; and (b) maintaining the cell obtained in step (a) for a time sufficient to destroy the complement C3 gene mRNA transcript, thereby inhibiting expression of the C3 complement gene in the cell. 8. The method of claim 7, wherein said cell is located in a subject. 9. The method according to claim 8, where the subject is a person. 10. The method of claim 9, wherein the human subject suffers from a disease associated with complement component C3. 11. The method according to claim 10, where the disease associated with the complement component C3 is selected from the group consisting of paroxysmal nocturnal hemoglobinuria (PNH), asthma, rheumatoid arthritis, systemic lupus erythematosus, glomerulonephritis, psoriasis, dermatomyositis with bullous pemphigoid, atypical hemolytic -uremic syndrome, hemolytic-uremic syndrome associated with Shiga-like toxin E.coH, myasthenia gravis, neuromyelitis optica, dense sediment disease, C3 neuropathy, age-related macular degeneration, cold agglutinin disease, vasculitis associated with antibodies to the cytoplasm of neutrophils, reactions transplant rejection caused by gu- - 115 -