EA045521B1 - ANTISENSE OLIGOMERS FOR TREATING CONDITIONS AND DISEASES - Google Patents

Description

Link

This application claims priority to U.S. Provisional Application No. 62/550,462, filed Aug. 25, 2017, U.S. Provisional Application No. 62/575,901, filed Oct. 23, 2017, U.S. Provisional Application No. 62/ 667356, filed May 4, 2018, US Provisional Patent Application No. 62/671745, filed May 15, 2018, each of which is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

Disorders of the nervous system are often associated with channelopathy, characterized by impaired function of ion channels that mediate neuronal excitability, neuronal interactions, and overall brain function. Mutations in the SCN1 A gene, part of the SCN1A-SCN2ASCN3A gene cluster, which encodes the alpha pores that form the subunits of the neuronal voltage-gated sodium channel, are associated with the development of a large number of diseases and conditions, such as Dravet syndrome (DS) (Miller, et al., 1993 -2015, GeneReviews, Eds. Pagon RA, et al. Seattle (WA): University of Washington, Seattle, Bookshelf ID: NBK1318 and Mulley, et al., 2005, Hum. Mutat. 25: 535-542).

Brief Disclosure of the Invention

In some embodiments, a method is disclosed for modulating the expression of the SCN1A protein in a cell containing mRNA that contains a nonsense-mediated RNA decay exon (NMD exon mRNA) and encodes the SCN1A protein, the method comprising contacting a therapeutic agent with the cell, wherein the therapeutic agent modulates splicing NMD exon from the SCNIA protein-encoding mRNA with the NMD exon, thereby modulating the content of processed mRNA encoding the SCN1A protein and modulating the expression of the SCN1A protein in the cell. In some embodiments, the therapeutic agent (a) binds to a target portion of the SCN1A-encoding mRNA with the NMD exon; (b) modulates the binding of a factor involved in mRNA splicing to the NMD exon; or (c) performs a combination of (a) and (b). In some embodiments, the therapeutic agent prevents the binding of a factor involved in NMD exon splicing from the target region. In some embodiments, the target portion is proximal to an NMD exon. In some embodiments, the target portion is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides upstream from the 5' end of the NMD exon. In some embodiments, the target portion is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotides, approximately 2 nucleotides, approximately 1 nucleotide upstream from the 5' end of the NMD exon. In some embodiments, the target portion is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides downstream of the 3' end of the NMD exon. In some embodiments, the target portion is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotides, approximately 2 nucleotides, approximately 1 nucleotide downstream from the 3' end of the NMD exon. In some embodiments, the target portion is located in an intronic region between two canonical exonic regions of the SCN1A-encoding mRNA with an NMD exon, and wherein the intronic region comprises an NMD exon. In some embodiments, the target portion at least partially overlaps with an NMD exon. According to some embodiments, the target portion is

- 1 045521 overlaps at least partially with an intron upstream of the NMD exon. In some embodiments, the target portion comprises a 5' exon-NMD-intron junction or a 3' exon-NMD-intron junction. In some embodiments, the target portion is within an NMD exon. In some embodiments, the target portion comprises approximately 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 3ο or more consecutive nucleotides of the NMD exon. In some embodiments, the SCNIA encoding mRNA with an NMD exon contains a sequence with at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any of SEQ ID NO: 2 or 7- 10. In some embodiments, the SCN1A-encoding mRNA with an NMD exon is encoded by a genetic sequence with at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to SEQ ID NO: 1 or 3-6 . In some embodiments, the target portion is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides upstream of the genomic site GRCh37/hg19: chr2:166863803. In some embodiments, the target portion is located at about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotide, approximately 2 nucleotides, approximately 1 nucleotide upstream of the genomic site GRCh37/hg19: chr2:166863803. In some embodiments, the target portion is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides downstream of the GRCh37/hg19 genomic site: chr2:166863740. In some embodiments, the target portion is located at about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotide, approximately 2 nucleotides, approximately 1 nucleotide downstream of the genomic site GRCh37/hg19: chr2:166863740. In some embodiments, the target portion of the SCN1A encoding mRNA with an NMD exon comprises a sequence with at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region containing at least 8 contiguous nucleic acids SEQ ID NO: 2 or 7-10. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NO: 21 -67, 210-256 or 304-379. In some embodiments, the target portion of the SCN1A-encoding mRNA with the NMD exon is located within the nonsense-mediated RNA decay-inducing exon 20x of SCN1A. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NO: 42 -50 or 231-239. In some embodiments, the target portion of the SCN1A-encoding mRNA with the NMD exon is located upstream or downstream of the nonsense-mediated RNA decay-inducing exon 20x of SCN1A. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NO: 21 -38, 53-67, 210-227 or 242-256. In some embodiments, the target portion of the NMD exon mRNA comprises an exon-intron junction of exon 20x of SCN1A. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), where

- 2 045521 than the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97% or 100% identical to any of SEQ ID NO: 39-41, 51, 52, 228-230, 240 or 241. In some embodiments, the therapeutic agent promotes exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein. In some embodiments, exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, from about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times, according to compared with the exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in a control cell. In some embodiments, the therapeutic agent increases the amount of processed mRNA encoding the SCN1A protein in a cell. In some embodiments, the amount of processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is increased by a factor of about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10-fold. about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2 times .5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the total the amount of processed mRNA encoding the SCN1A protein in the control cell. In some embodiments, the therapeutic agent increases the expression of SCN1A protein in a cell. In some embodiments, the amount of SCN1A produced in a cell exposed to the therapeutic agent is increased by a factor of about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, from about 3 to about 10 times, from about 4 to about 10 times, from about 1.1 to about 5 times, from about 1.1 to about 6 times, from about 1.1 to about 7 times, from about 1, 1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 7 times about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the total amount of SCN1A produced in the control cell. In some embodiments, the therapeutic agent inhibits exclusion of the NMD exon from processed mRNA encoding the SCN1A protein. In some embodiments, exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is reduced by a factor of about 1.1 to about 10-fold, from about 1.5 to about

- 3 045521 specifically 10 times, from about 2 to about 10 times, from about 3 to about 10 times, from about 4 to about 10 times, from about 1.1 to about 5 times, from about 1.1 to about 6 times , from about 1.1 to about 7 times, from about 1.1 to about 8 times, from about 1.1 to about 9 times, from about 2 to about 5 times, from about 2 to about 6 times, from about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times or more at least approximately 10-fold compared with the exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in the control cell. In some embodiments, the therapeutic agent reduces the amount of processed mRNA encoding the SCN1A protein in a cell. In some embodiments, the amount of processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is reduced by a factor of about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10-fold. about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2 times .5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the total the amount of processed mRNA encoding the SCN1A protein in the control cell. In some embodiments, the therapeutic agent reduces the expression of SCN1A protein in a cell. In some embodiments, the amount of SCN1A produced in a cell exposed to the therapeutic agent is reduced by a factor of about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10-fold, from about 3 to about 10 times, from about 4 to about 10 times, from about 1.1 to about 5 times, from about 1.1 to about 6 times, from about 1.1 to about 7 times, from about 1, 1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 7 times about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the total amount of SCN1A produced in the control cell. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer contains a backbone modification containing a phosphorothioate linkage or a phosphorodiamide linkage. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer comprises a morpholino phosphorodiamidate, a capped nucleic acid, a peptide nucleic acid, a T O-methyl, 2'-fluoro-, or 2'-O-methoxyethyl moiety. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), and wherein the antisense oligomer contains at least one modified sugar moiety. In some embodiments, each sugar moiety is a modified sugar moiety. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer consists of from 8 to 50 nucleotides

- 4 045521 bases, from 8 to 40 nucleotide bases, from 8 to 35 nucleotide bases, from 8 to 30 nucleotide bases, from 8 to 25 nucleotide bases, from 8 to 20 nucleotide bases, from 8 to 15 nucleotide bases, from 9 to 50 nucleotide bases, 9 to 40 nucleotide bases, 9 to 35 nucleotide bases, 9 to 30 nucleotide bases, 9 to 25 nucleotide bases, 9 to 20 nucleotide bases, 9 to 15 nucleotide bases, 10 to 50 nucleotide bases, from 10 to 40 nucleotide bases, from 10 to 35 nucleotide bases, from 10 to 30 nucleotide bases, from 10 to 25 nucleotide bases, from 10 to 20 nucleotide bases, from 10 to 15 nucleotide bases, from 11 to 50 nucleotide bases bases, 11 to 40 nucleotide bases, 11 to 35 nucleotide bases, 11 to 30 nucleotide bases, 11 to 25 nucleotide bases, 11 to 20 nucleotide bases, 11 to 15 nucleotide bases, 12 to 50 nucleotide bases , 12 to 40 nucleotide bases, 12 to 35 nucleotide bases, 12 to 30 nucleotide bases, 12 to 25 nucleotide bases, 12 to 20 nucleotide bases, or 12 to 15 nucleotide bases. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), and wherein the antisense oligomer is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the target portion of the protein-coding mRNA with the NMD exon. In some embodiments, the method further comprises assessing the expression of SCN1A mRNA or protein. In some embodiments, the cells are ex vivo.

In some embodiments, disclosed herein is a method of treating a disease or condition in a subject in need thereof by modulating the expression of the SCN1A protein in a cell of the subject, comprising: contacting the cell of the subject with a therapeutic agent that modulates the splicing of a nonsense-mediated decay of mRNA exon (NMD exon) from an mRNA in a cell that contains the NMD exon and encodes SCN1A, thereby modulating the content of processed mRNA encoding the SCN1A protein and modulating the expression of the SCN1A protein in the cell of the subject. In some embodiments, the therapeutic agent (a) binds to a target portion of the SCN1A-encoding mRNA with the NMD exon; (b) modulates the binding of a factor involved in mRNA splicing to the NMD exon; or (c) performs a combination of (a) and (b). In some embodiments, the therapeutic agent prevents the binding of a factor involved in NMD exon splicing from the target region. In some embodiments, the target portion is proximal to an NMD exon. In some embodiments, the target portion is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides upstream from the 5' end of the NMD exon. In some embodiments, the target portion is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotides, approximately 2 nucleotides, approximately 1 nucleotide upstream from the 5' end of the NMD exon. In some embodiments, the target portion is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides downstream of the 3' end of the NMD exon. In some embodiments, the target portion is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotides, approximately 2 nucleotides, approximately 1 nucleotide downstream from the 3' end of the NMD exon.

- 5 045521

In some embodiments, the target portion is located in an intronic region between two canonical exonic regions of the SCNIA-encoding mRNA with an NMD exon, and wherein the intronic region comprises an NMD exon. In some embodiments, the target portion at least partially overlaps with an NMD exon. In some embodiments, the target portion at least partially overlaps with an intron upstream of the NMD exon. In some embodiments, the target portion comprises a 5' exon-NMD-intron junction or a 3' exon-NMD-intron junction. In some embodiments, the target portion is within an NMD exon. In some embodiments, the target portion comprises approximately 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the NMD exon. In some embodiments, the SCN1A encoding mRNA with an NMD exon contains a sequence with at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any of SEQ ID NO: 2 or 7 -10. In some embodiments, the SCN1A-encoding mRNA with an NMD exon is encoded by a genetic sequence with at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to SEQ ID NO: 1 or 3-6 . In some embodiments, the target portion is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides upstream of the genomic site GRCh37/hg19: chr2:166863803. In some embodiments, the target portion is located at about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotide, approximately 2 nucleotides, approximately 1 nucleotide upstream of the genomic site GRCh37/hg19: chr2:166863803. In some embodiments, the target portion is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides downstream of the GRCh37/hg19 genomic site: chr2:166863740. In some embodiments, the target portion is located at about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotide, approximately 2 nucleotides, approximately 1 nucleotide downstream of the genomic site GRCh37/hg19: chr2:166863740. In some embodiments, the target portion of the SCN1A encoding mRNA with an NMD exon comprises a sequence with at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region containing at least 8 contiguous nucleic acids SEQ ID NO: 2 or 7-10. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NO: 21-67, 210-256 or 304-379. In some embodiments, the target portion of the SCN1A-encoding mRNA with the NMD exon is located within the nonsense-mediated RNA decay-inducing exon 20x of SCN1A. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NO: 42-50 or 231-239. In some embodiments, the target portion of the SCN1A-encoding mRNA with the NMD exon is located upstream or downstream of the nonsense-mediated RNA decay-inducing exon 20x of SCN1A. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains

- 6 045521 sequence that is at least about 80%, 85%, 90%, 95%, 97% or 100% identical to any of SEQ ID NO: 21-38, 53-67, 210-227 or 242-256 . In some embodiments, the target portion of the NMD exon mRNA comprises an exon-intron junction of exon 20x of SCN1A. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 10% identical to any of SEQ ID NO: 39-41, 51, 52, 228-230, 240, or 241. In some embodiments, the therapeutic agent promotes exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein. In some embodiments, exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is increased by a factor of about 1.1 to about 10-fold, from about 1.5 to about 10-fold, from about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times, compared with the exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in the control cell. In some embodiments, the therapeutic agent increases the amount of processed mRNA encoding the SCN1A protein in a cell. In some embodiments, the amount of processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is increased by a factor of about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10-fold. about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2 times .5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the total the amount of processed mRNA encoding the SCN1A protein in the control cell. In some embodiments, the therapeutic agent increases the expression of SCN1A protein in a cell. In some embodiments, the amount of SCN1A produced in a cell exposed to the therapeutic agent is increased by a factor of about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, from about 3 to about 10 times, from about 4 to about 10 times, from about 1.1 to about 5 times, from about 1.1 to about 6 times, from about 1.1 to about 7 times, from about 1, 1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 7 times about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the total amount of SCN1A produced in the control cell. According to some

- 7 045521 embodiments, the therapeutic agent inhibits exclusion of the NMD exon from processed mRNA encoding the SCN1A protein. In some embodiments, exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is reduced by a factor of about 1.1 to about 10-fold, from about 1.5 to about 10-fold, from about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times, according to compared with the exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in a control cell. In some embodiments, the therapeutic agent reduces the amount of processed mRNA encoding the SCN1A protein in a cell. In some embodiments, the amount of processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is reduced by a factor of about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, from about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times , from about 2 to about 9 times, from about 3 to about 6 times, from about 3 to about 7 times, from about 3 to about 8 times, from about 3 to about 9 times, from about 4 to about 7 times, from about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2, 5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the total amount processed mRNA encoding the SCN1A protein in a control cell. In some embodiments, the therapeutic agent reduces the expression of SCN1A protein in a cell. In some embodiments, the amount of SCN1A produced in a cell exposed to the therapeutic agent is reduced by a factor of about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10-fold, from about 3 to about 10 times, from about 4 to about 10 times, from about 1.1 to about 5 times, from about 1.1 to about 6 times, from about 1.1 to about 7 times, from about 1, 1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 7 times about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the total amount of SCN1A produced in the control cell. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer comprises a backbone modification containing a phosphorothioate linkage or a phosphorodiamide linkage. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), and wherein the antisense oligomer comprises a morpholino phosphorodiamidate, a capped nucleic acid, a peptide nucleic acid, a 2'-O-methyl, 2'-fluoro-, or 2'-O-methoxyethyl moiety . In some embodiments, the therapeutic agent is an antisense

- 8 045521 howl oligomer (ASO), and wherein the antisense oligomer contains at least one modified sugar moiety. In some embodiments, each sugar moiety is a modified sugar moiety. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer consists of 8 to 50 nucleotide bases, 8 to 40 nucleotide bases, 8 to 35 nucleotide bases, 8 to 30 nucleotide bases, 8 up to 25 nucleotide bases, from 8 to 20 nucleotide bases, from 8 to 15 nucleotide bases, from 9 to 50 nucleotide bases, from 9 to 40 nucleotide bases, from 9 to 35 nucleotide bases, from 9 to 30 nucleotide bases, from 9 to 25 nucleotide bases, 9 to 20 nucleotide bases, 9 to 15 nucleotide bases, 10 to 50 nucleotide bases, 10 to 40 nucleotide bases, 10 to 35 nucleotide bases, 10 to 30 nucleotide bases, 10 to 25 nucleotide bases, from 10 to 20 nucleotide bases, from 10 to 15 nucleotide bases, from 11 to 50 nucleotide bases, from 11 to 40 nucleotide bases, from 11 to 35 nucleotide bases, from 11 to 30 nucleotide bases, from 11 to 25 nucleotide bases bases, 11 to 20 nucleotide bases, 11 to 15 nucleotide bases, 12 to 50 nucleotide bases, 12 to 40 nucleotide bases, 12 to 35 nucleotide bases, 12 to 30 nucleotide bases, 12 to 25 nucleotide bases , 12 to 20 nucleotide bases or 12 to 15 nucleotide bases. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), and wherein the antisense oligomer is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the target portion of the protein-coding mRNA with the NMD exon. In some embodiments, the method further comprises assessing the expression of SCN1A mRNA or protein. In some embodiments, the disease or condition is induced by a loss-of-function mutation in Na _v ll. In some embodiments, the disease or condition is due to haploinsufficiency of the SCN1A gene, and wherein the subject contains a first allele encoding functional SCN1A and a second allele from which SCN1A is not produced or produced in reduced quantities, or a second allele encoding nonfunctional SCN1A or partially functional SCN1A. In some embodiments, the disease or condition is encephalopathy. In some embodiments, the encephalopathy is an epileptic encephalopathy. In some embodiments, the disease or condition is Dravet syndrome (DS); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic spasms; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); sick sinus syndrome 1; autism or malignant migratory partial seizures of infancy. In some embodiments, GEFS+ is epilepsy, generalized, with febrile seizures plus, type 2. In some embodiments, the febrile seizures is febrile seizures, familial, 3A. In some embodiments, the SMEB is SMEB without generalized spike-wave (SMEB-SW), SMEB without myoclonic seizures (SMEB-M), SMEB without more than one feature of SMEI (SMEB-O), or persistent childhood epilepsy with generalized tonic-clonic seizures. seizures (ICEGTC). In some embodiments, the therapeutic agent promotes exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein and increases the expression of SCN1A in the cell. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to any of SEQ ID NO: 22-24, 26, 27, 29-35, 37-62, 64-67 or 304-379. In some embodiments, the disease or condition is induced by a gain-of-function mutation in Na _v 1.1. In some embodiments, the subject contains an allele from which SCN1A is produced in increased amounts, or an allele encoding a mutant SCN1A that induces increased Na _v 1.1 activity in the cell. In some embodiments, the disease or condition is migraine. In some embodiments, the migraine is familial hemiplegic migraine, 3. In some embodiments, the disease or condition is Nav1.1 genetic epilepsy. In some embodiments, the therapeutic agent inhibits exclusion of the NMD exon from processed mRNA encoding the SCN1A protein and reduces the expression of SCN1A in the cell. In some embodiments, the therapeutic agent is an antisense oligomer (ASO), and wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to any of SEQ

- 9 045521

ID NO: 21, 25, 28, 36, or 63. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human animal. In some embodiments, the subject is a fetus, embryo, or child. In some embodiments, the therapeutic agent is administered by intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravitreal or intravenous injection to a subject. In some embodiments, the method further comprises administering a second therapeutic agent to the subject. In some embodiments, the second therapeutic agent is a small molecule. In some embodiments, the second therapeutic agent is an ASO. In some embodiments, the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to any of SEQ ID NO: 115-161. In some embodiments, the second therapeutic agent corrects intron retention. In some embodiments, the disease or condition is Alzheimer's disease, SCN2A encephalopathy, SCN8A encephalopathy, or SCN5A arrhythmia. In some embodiments, the disease or condition is Alzheimer's disease, SCN2A encephalopathy, SCN8A encephalopathy, or SCN5A arrhythmia. In some embodiments, the cell is ex vivo.

Incorporation by reference

All publications, patents and patent applications referenced herein are incorporated herein by reference to the same extent that each individual publication, patent or patent application is specifically and individually indicated to be incorporated by reference.

Brief description of graphic materials

The novel features of the present invention are set forth in detail in the accompanying claims. A better understanding of the features and advantages of the present invention will be obtained with reference to the following detailed description, which contains illustrative embodiments employing the principles of the present invention and the accompanying drawings in which: FIG. 1 shows a schematic representation of a target mRNA that contains a nonsense-mediated RNA decay-inducing exon (NMD exon mRNA) and therapeutic-mediated exclusion of the nonsense-mediated RNA decay-inducing exon to increase expression of the full-length target protein or functional RNA. In fig. Figure 1A shows a cell divided into nuclear and cytoplasmic compartments. In the nucleus, the pre-mRNA transcript of the target gene is spliced to produce mRNA, and this mRNA is exported to the cytoplasm and translated into the target protein. For this target gene, some portion of the mRNA contains a nonsense-mediated RNA decay exon (NMD exon mRNA) that is degraded in the cytoplasm, thus not resulting in the production of the target protein. In fig. Figure 1B shows an example of the same cell divided into nuclear and cytoplasmic compartments. Treatment with a therapeutic agent, such as an antisense oligomer (ASO), promotes exclusion of the nonsense-mediated RNA decay-inducing exon and results in an increase in mRNA, which in turn is translated into higher amounts of the target protein. Fig. 1C is a schematic representation of therapeutic ASO-mediated exclusion of a nonsense-mediated RNA decay exon that converts non-productive mRNA into productive mRNA and increases expression of full-length target protein from productive mRNA.

In fig. 2 depicts the identification of an exemplary nonsense-mediated decay (NMD)-inducing exon in the SCN1A gene. Identification of an NMD-inducing exon in the SCN1A gene using comparative genomics is demonstrated through visualization in the UCSC genome browser. The top panel shows a graphical representation of the SCN1A gene for scaling. Conservation rates for 100 vertebrate species are shown as peaks. The highest peaks correspond to exons (black boxes), while no peaks are observed for most introns (lines with arrows). Peaks of conservation were identified in intron 20 (NM_006920), shown in the middle panel. Inspection of conserved sequences revealed a 64-bp exon-like sequence. (bottom panel, sequence in grey) flanked by 3' and 5' splice sites (underlined sequence). Inclusion of this exon results in a frameshift and the introduction of a premature termination codon in exon 21, making the transcript a target of NMD.

In fig. Figure 3A shows confirmation of the NMD-inducing exon by cycloheximide treatment. RT-PCR analysis using cytoplasmic RNA from DMSO-treated (CHX-) or cycloheximide-treated (CHX+) Neuro 2A (mouse neural progenitor cells) and primers in exon 21 and exon downstream confirmed the presence of an NMD-inducing band exon (21x). The identity of the product was confirmed by sequencing. Densitometric band analysis was performed to calculate the percentage of exon 21x inclusion of the total SCN1A transcripts. Treatment of Neuro 2A with cycloheximide (CHX+) to inhibit NMD resulted in a 2-fold increase in the product corresponding to the NMD-inducing exon 21x in the cytoplasm.

- 10 045521 plasma fraction (compare the light gray band, CHX-, with the dark gray band, CHX+). In fig. Figure 3B shows confirmation of the NMD-inducing exon by cycloheximide treatment. RT-PCR analysis using cytoplasmic RNA from DMSO-treated (CHX-) or cycloheximide-treated (CHX+) RenCell BM (human neural progenitor cells) and primers in exon 20 and exon 23 confirmed the presence of a band corresponding to the NMD-inducing exon (20x ). The identity of the product was confirmed by sequencing. Densitometric analysis of bands was performed to calculate the percentage of exon 20x inclusion of total SCN1A transcripts. Treatment of RenCell BM with cycloheximide (CHX+) to inhibit NMD resulted in a 2-fold increase in the product corresponding to the NMD-inducing exon 20x in the cytoplasmic fraction (compare the light gray band, CHX−, with the dark gray band, CHX+).

In fig. 4 depicts an exemplary walk of the ASO region of exon 20x of SCN1A. Shown is a graphical representation of the ASO walk performed for sequences targeting the SCN1A exon 20x region, upstream of the 3' splice site through the 3' splice site, exon 20x, through the 5' splice site, and downstream of the 5' splice site. '-splice site using 2'-MOE ASO, PS backbone. ASOs were designed to cover these regions by shifting 5 nucleotides at a time.

In fig. Figure 5A depicts a walk from the ASO region of exon 20x of SCN1A assessed by RT-PCR. An exemplary PAGE shows SYBR-safe stained RT-PCR products treated with mock SCN1A (placebo), treated with SMN control ASO (SMN), or treated with a 2'-MOE ASO targeting the exon 20x region as described herein in the Examples and Description fig. 4, at a concentration of 20 μM in RenCell BM cells via Gymnosis uptake. Two products corresponding to exon 20x inclusion (top band) and full length (exon 20x exclusion, bottom band) were quantified. In fig. 5B is a graph depicting the percentage of exon 20x inclusion from the data in FIG. 5A. The black line indicates no change with respect to placebo.

In fig. 5C depicts a plot of full-length products normalized to the internal control RPL32 and a plot of fold change relative to placebo. The black line indicates a ratio of 1 and no change relative to placebo.

In fig. 6 depicts an exemplary ASO walk of the SCN1A exon 20x region assessed by RT-qPCR. SCN1A SYBR-green RT-qPCR amplification results normalized to RPL32 obtained using the same ASO uptake experiment assessed by SYBR-safe RT-PCR as shown in FIG. 5 are plotted as fold change relative to placebo, confirming the SYBR-safe RT-PCR results. The black line indicates a ratio of 1 (no change relative to placebo).

In fig. 7A shows a table with representatives of the alpha subunit of the voltage-gated sodium channel. The arrows correspond to the colors of the stripes in Fig. 7B. X indicates no expression detected.

In fig. 7B depicts selected ASOs assessed by Taqman qPCR of SCN1A, SCN2A, SCN3A, SCN8A and SCN9A to assess target selectivity. Taqman-qPCR amplification results normalized to RPL32 obtained using ASO Ex20x+1, IVS20x+18, and IVS20x+33 were plotted as fold changes relative to placebo. The black line indicates a ratio of 1 (no change relative to placebo).

In fig. 8A depicts an exemplary dose-dependent effect of a selected ASO in SCN-treated cells. Shown is a representative PAGE showing SYBR-safe stained RT-PCR products of Scnla mice treated with mock (mock, RNAiMAX only), or treated with ASO Ex21x+1 2'-MOE targeting exon 21x (mouse nomenclature, corresponding to human exon 20x), in concentrations 30 nm, 80 nm and 200 nm into Neuro 2A (mouse neuroblastoma) cells by RNAiMAX transfection. Ex21x+1 (mouse nomenclature) and Ex20x+1 (human nomenclature) are identical. Two products corresponding to exon 20x inclusion (top band) and full length (exon 20x exclusion, bottom band) were quantified.

In fig. 8B is a graph depicting the percentage of exon 20x inclusion from the data in FIG. 7A. The black line indicates no change with respect to placebo.

In fig. 8C depicts an exemplary plot of full-length products normalized to internal control Hprt and fold change relative to placebo. The black line indicates a ratio of 1 and no change relative to placebo.

In fig. 9A shows exemplary results of intravitreal (IVT) injection of selected ASOs in C57BL6J mice (male, 3 months old). Shown are PAGE gels of SYBR-safe stained mouse Scnla RT-PCR products from PBS (1 μl) injected into the left eye (-) or IVS20x-21, Ex21x+1, IVS21x+18, IVS21x+33, or Ser290 (negative control ASO; Gerard et al, Mol. Ther. Nuc. Ac, 2015) 2'-MOE ASO-injected (1 μl) into the right eye (+) at a concentration of 10 mM. Ex21x+1, IVS21x+18 and IVS21x+33 (mouse nomenclature) and Ex20x+1, IVS20x+18 and IVS20x+33 (human nomenclature) are identical. Two products corresponding to the inclusion of exon 21x were quantified (upper

- 11 045521 band) and full length (exclusion of exon 21x, bottom band).

In fig. 9B is a graph depicting the percentage of exon 21x inclusion from the data in FIG. 9A. White bars correspond to ASO-injected eyes and gray bars correspond to PBS-injected eyes, n=5 in each group.

In fig. 9C depicts a normalization plot of full-length Gapdh internal control products and fold change in ASO-injected eyes relative to PBS-injected eyes. Black line indicates ratio of 1 and no change relative to PBS, n=5 in each group.

In fig. 10A shows exemplary results of intraperitoneal (ICV) injection of selected ASOs into C57BL6J mice (male, 3 months old). Shown are PAGE gels of SYBR-safe stained Scnla mouse RT-PCR products from the brain without injection (-, control without ASO) or after injection of 300 μg Ser290 (negative control ASO; Gerard et al, Mol. Ther. Nuc. Ac, 2015) , Ex21x+1, IVS21x+18, IVS21x+33 2'-MOE ASO. Ex21x+1, IVS21x+18 and IVS21x+33 (mouse nomenclature) and Ex20x+1, IVS20x+18 and IVS20x+33 (human nomenclature) are identical. Two products corresponding to exon 21x inclusion (top band) and full length (exon 21x exclusion, bottom band) were quantified.

In fig. 10B is a graph depicting the percentage of exon 21x inclusion from the data in FIG. 10A, n=6 (each targeting ASO), n=5 (Cep290 ASO), n=1 (no injection, no ASO control).

In fig. 10C depicts a graph from the results of a Taqman qPCR assay performed using two different probes covering the junction of exons 21 and 22. Products were normalized to the internal control Gapdh and fold change plotted in ASO-injected brains versus Ser290-injected brains. Black line indicates ratio of 1 and no change relative to Ser290, n=6 (each targeting ASO), n=5 (Cer290 ASO), n=1 (no treatment, no ASO control).

In fig. 11A shows exemplary results of intraperitoneal (ICV) injection of selected ASOs in C57BL6J mice (male, 3 months old). Shown are PAGE gels of SYBR-safe stained RT-PCR products of Scnla from mouse brain after administration of 300 μg Ser290 (negative control ASO; Gerard et al, Mol. Ther. Nuc. Ac, 2015) or 33 μg, 100 μg and 300 μg 1 Ex21x+1 2'-MOE ASO. Ex21x+1 (mouse nomenclature) and Ex20x+1 (human nomenclature) are identical. Two products corresponding to exon 21x inclusion (top band) and full length (exon 21x exclusion, bottom band) were quantified.

In fig. 11B is a graph depicting the percentage of exon 21x inclusion from the data in FIG. 11A, n=5 (each group).

In fig. 11C is a graph from a Taqman qPCR assay performed using two different probes spanning the junction of exons 21 and 22. Products were normalized to the internal control Gapdh and the fold change in ASO brain was plotted relative to Ser290 administered. Black line indicates ratio of 1 and no change relative to Ser290, n=5 (each group).

In fig. 12A shows exemplary results of intraperitoneal injection (ICV) of selected ASO C57BL6J mice (postnatal day 2). Shown are PAG gels of SYBR-safe-stained Scnla mouse RT-PCR products from the brain without injection (-, control without ASO) or after injection of 20 μg of Ex21x+1 2'-MOE ASO.

Two products corresponding to exon 21x inclusion (top band) and full length (exon 21x exclusion, bottom band) were quantified. Ex21x+1 (mouse nomenclature) and Ex20x+1 (human nomenclature) are identical.

In fig. 12B is a graph depicting the percentage of exon 21x inclusion from the data in FIG. 12A, n=4 (each group).

In fig. 12C depicts a graph from the results of a Taqman qPCR assay performed using two different probes spanning the junction of exons 21 and 22. Products were normalized to the internal control Gapdh and the fold change in ASO brain was plotted against the no-ASO control. Black line indicates ratio of 1 and no change relative to non-ASO control, n=4 (each group).

In fig. 13A is a graph depicting the percentage of exon 21x inclusion in the indicated mouse CNS samples.

In fig. 13B is a graph depicting the percentage of exon 20x inclusion in the indicated human CNS samples.

In fig. 14A is a graph showing the percentage reduction in exon 21x inclusion at the indicated doses.

In fig. 14B is a graph showing the percentage increase in Scnla mRNA at the indicated doses.

In fig. 14C is a graph showing the percentage increase in Nav 1.1 protein at the indicated doses.

In fig. 15A is a graph showing the percentage reduction in exon 21x inclusion at the indicated doses.

- 12 045521

In fig. 15B is a graph showing the percentage increase in Scnla mRNA at the indicated doses.

In fig. 16 depicts a selected Scnla-targeting ASO administered at a dose of 10 μg via ICV injection to mice on postnatal day 2, assessed on day 5 post-injection by Taqman qPCR SCN1A, SCN2A, SCN3A, SCN4A, SCN5A, SCN7A, SCN8A, SCN9A, SCN10A and SCN11A to evaluate target selectivity. Taqman-qPCR amplification results normalized to Gapdh obtained using Ex20x+1 ASO are plotted against fold change versus PBS-treated mice.

In fig. 17 depicts exemplary results of intraperitoneal (ICV) injection on postpartum day 2 of a selected ASO at the indicated dose in wild-type (WT) or Dravet heterozygous (Dravet syndrome) F1 mice from 129S-Scnla ^tm1Kea x C57BL/6J crosses 3 days after injection. .

In fig. 17A is a graph from the results of a Taqman qPCR assay performed using a probe spanning exons 21 and 22. Products were normalized to the internal control Gapdh and the fold change in ASO brain was plotted against PBS brain.

In fig. 17B is a graph from a Western blot performed using anti-Nav1.1 antibody. Products were normalized to Ponceau-stained bands, and the fold change in ASO-administered brain was plotted against PBS-injected brain.

In fig. 18 depicts exemplary results of microtraversal of the ASO region of SCN1A exon 20x in RenCell by free uptake. The ASOs were designed to cover the regions around the three previously identified targeting ASOs in Fig. 6 (marked with stars) by shifting 1 nucleotide at a time (6-41) or by reducing the length of ASO 17 (1-5). The graph shows the percentage of exon 20x inclusion measured by SYBR-green qPCR. The black line indicates no change relative to ASO (-).

Fig. 19 is a graph of the increase in Scnla mRNA in coronal sections of mouse brains over time after injection of the SCN1A-targeting ASO. As shown, the increase in Scnla mRNA was maintained for at least 80 days after injection.

Fig. 20 is an exemplary survival curve demonstrating 100% survival provided by SCN1A-targeting ASO in a mouse model of Dravet syndrome. +/+ denotes the WT genotype and +/- denotes the heterozygous 129S-scnla ^tm1Kea genotype (Dravet syndrome mouse model); A denotes PBS treatment and B denotes ASO treatment. As shown, mice in group +/ (mice with Dravet syndrome treated with PBS) began to die around day 16 after birth, whereas all mice in the other three groups, including group B +/- (mice with Dravet syndrome treated treatment with ASO) survived for at least 35 days after birth.

Detailed Description of the Invention

Splicing and nonsense-mediated decay of mRNA.

The spacer sequences, or introns, are removed by a large and highly dynamic RNA-protein complex called the spliceosome, which orchestrates complex interactions between primary transcripts, small nuclear RNAs (snRNAs), and a large number of proteins. Spliceosomes assemble ad hoc on each intron in an orderly manner, starting with recognition of the 5' splice site (5'ss) by the U1 snRNA or the 3' splice site (3'ss) by the U2 pathway, which involves binding of the U2 accessory factor (U2AF) with the 3' ss region to facilitate U2 binding to the branch point sequence (BPS). U2AF is a stable heterodimer consisting of a 65 kDa encoded U2AF2 subunit (U2AF65), which binds the polypyrimidine tract (PPT), and a 35 kDa encoded U2AF1 subunit (U2AF35), which interacts with highly conserved AG dinucleotides in the 3'ss and stabilizes binding U2AF65. In addition to the BPS/PPT and 3'ss/5'ss box, precise splicing requires auxiliary sequences or structures that activate or suppress splice site recognition, known as intronic or exonic enhancers or splice silencers. These elements make it possible to recognize genuine splice sites among the huge excess of crypto- or pseudo-sites in the genome of higher eukaryotes, which have the same sequences but are an order of magnitude larger than the authentic sites. Although they often have a regulatory function, the precise mechanisms of their activation or repression are poorly understood.

The decision of whether to splice or not can generally be modeled as through a stochastic rather than a deterministic process, so that even the most specific splicing signals can sometimes be spliced incorrectly. However, under normal conditions, pre-mRNA splicing occurs with surprisingly high precision. This is partly explained by the activity of adjacent cis-acting accessory exonic and intronic splicing regulatory elements (ESR or ISR). Typically, these functional elements are classified as either exonic or intronic splicing enhancers (ESE or ISE) or splicing silencers (ESS or ISS) based on their ability to promote or inhibit splicing, respectively. Although currently

- 13 045521 While there is evidence that some accessory cis-acting elements may act to influence the kinetics of spliceosome assembly, such as the location of the complex between the U1 snRNP and the 5'ss, it seems likely that many elements function in concert with trans-acting RNAs -binding proteins (RBPs). For example, the serine- and arginine-rich RBP family (SR proteins) is a conserved family of proteins that play a key role in exon definition. SR proteins stimulate exon recognition by recruiting pre-spliceosomal components to adjacent splice sites or by antagonizing the effects of ESSs in the vicinity. The repressive effects of ESS may be mediated by members of the heterogeneous nuclear ribonucleoprotein (hnRNP) family and may alter the recruitment of core splicing factors to adjacent splice sites. In addition to their role in splicing regulation, silencer elements have been proposed to play a role in suppressing pseudo-exons, sets of intronic splice trap sites with typical exon spacing but without a functional open reading frame. ESE and ESS, in collaboration with their cognate trans -acting RBPs, are important components in the repertoire of splicing controls that determine how, where, and when mRNAs are assembled from their precursors.

Exon-intron boundary sequences represent degenerative signals of varying strength that can occur with high frequency in human genes. In multi-exon genes, different pairs of splice sites can be linked together in many different combinations, creating a diverse array of transcripts from a single gene. This is generally referred to as alternative splicing of pre-mRNA. Although most mRNA isoforms produced by alternative splicing can be exported from the nucleus and translated into functional polypeptides, different mRNA isoforms from the same gene can vary greatly in their translation efficiency. These are mRNA isoforms with at least 50 bp of premature termination codons (PTCs). upstream of the exon junction complex are likely targets for degradation via nonsense-mediated mRNA decay (NMD). Mutations in traditional (BPS/PPT/3'ss/5'ss) and accessory splice motifs can cause aberrant splicing, such as exon jumping or cryptic (or pseudo-) exon inclusion or splice site activation, and contribute significantly to disease and human mortality. Both aberrant and alternative splicing patterns can be influenced by naturally occurring DNA variants in exons and introns. Given that exon-intron boundaries can occur at any of the three codon positions, it is clear that only a subset of alternative splicing events can maintain a canonical open reading frame. For example, only exons evenly divided into 3 can be skipped or included in the mRNA without any change in the reading frame. Splicing events that do not have compatible phases will cause a frameshift. If events downstream are not reversed, frameshifts can certainly lead to one or more PTS, which is likely to lead to subsequent degradation through NMD. NMD is a translation-related mechanism that eliminates PTC-containing mRNAs. NMD may function as a control process that exists in all eukaryotes. NMD can reduce errors in gene expression by eliminating mRNA transcripts that contain premature stop codons. Translation of these aberrant mRNAs can in some cases lead to deleterious gain of function or dominant negative activity of the resulting proteins. NMD targets not only PTC transcripts, but also a broad array of mRNA isoforms expressed by many endogenous genes, suggesting that NMD is a master regulator that provides both fine and coarse regulation of cellular RNA content in a sustained manner. condition.

The NMD-inducing exon (NIE) is an exon or pseudo-exon that is a region within an intron and can activate the NMD pathway if included in a mature RNA transcript. In constitutive splicing events, the intron containing NIE is typically spliced, but the intron or part of it (eg, NIE) may be retained during alternative or aberrant splicing events. Mature mRNA transcripts containing such NIE may be nonproductive due to the frameshift that induces the NMD pathway. Incorporation of NIE into mature RNA transcripts may down-regulate gene expression. NIE-containing mRNA transcripts may be referred to herein as NIE-containing mRNA or NMD exon mRNA.

Cryptic (or pseudo) splice sites are characterized by the same splice recognition sequences as genuine splice sites, but are not used in splicing reactions. They outnumber genuine splice sites in the human genome by an order of magnitude and are typically repressed by still poorly understood molecular mechanisms. Cryptic 5' splice sites contain the consensus NNN/GUNNN or NNN/GCNNN, where N is any nucleotide and/or is the boundary of an exonintron. Cryptic 3' splice sites contain the NAG/N consensus. Their activation is positively influenced by surrounding nucleotides, which make them more similar to the optimal consensus of authentic splice sites, namely MAG/GURAGU and YAG/G, respectively, where M represents C or A, R represents G or A, and Y represents is C or U.

- 14 045521

Splicing sites and their regulatory sequences can be easily identified by one skilled in the art using suitable publicly available algorithms, listed for example in Kralovicova, J. and Vorechovsky, I. (2007) Global control of aberrant splice site activation by auxiliary splicing sequences: evidence for a gradient in exon and intron definition. Nucleic Acids Res., 35, 63996413,(http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2095810/pdf/gkm680.pdf). Cryptic splice sites or splice regulatory sequences may compete for RNA-binding proteins such as U2AF with the NIE splice site. In one embodiment, the agent can bind to cryptic splice site or splice regulatory sequences to prevent binding of RNA binding proteins and thereby promote the use of NIE splice sites.

In one embodiment, the cryptic splice site may not contain a 5' or 3' NIE splice site. The cryptic splice site may be at least 10 nucleotides upstream of the 5' NIE splice site. The cryptic splice site may be at least 20 nucleotides upstream of the 5' NIE splice site. The cryptic splice site may be at least 50 nucleotides upstream of the 5' NIE splice site. The cryptic splice site may be at least 100 nucleotides upstream of the 5' NIE splice site. The cryptic splice site may be at least 200 nucleotides upstream of the 5' NIE splice site.

The cryptic splice site may be at least 10 nucleotides downstream of the 3' NIE splice site. The cryptic splice site may be at least 20 nucleotides downstream of the 3' NIE splice site. The cryptic splice site may be at least 50 nucleotides downstream of the 3' NIE splice site. The cryptic splice site may be at least 100 nucleotides downstream of the 3' NIE splice site. The cryptic splice site may be at least 200 nucleotides downstream of the 3' NIE splice site. Target transcripts

In some embodiments, the methods of the present invention utilize the presence of NIE in pre-mRNA transcribed from the SCN1A gene. Splicing of identified forms of the SAME SCN1A pre-mRNA to produce functional mature SCN1A mRNA can be induced using a therapeutic agent, such as ASO, that stimulates NIE exon skipping. Induction of exon skipping may lead to inhibition of the NMD pathway. The resulting mature SCN1A mRNA can be translated normally without activating the NMD pathway, thereby increasing the amount of SCN1A protein in the patient's cells and alleviating the symptoms of SCN1A deficiency conditions such as Dravet syndrome (DS); epilepsy, generalized, with febrile seizures plus, type 2; febrile seizures, familial, 3A; autism; epileptic encephalopathy, early infancy, 13; sick sinus syndrome 1; Alzheimer's disease or SUDEP.

In various embodiments, the present invention provides a therapeutic agent that can target SCN1A mRNA transcripts to modulate, for example, upregulate or inhibit splicing or protein expression level. The therapeutic agent may be a small molecule, polynucleotide, or polypeptide. In some embodiments, the therapeutic agent is an ASO. Different regions or sequences on the SCN1A pre-mRNA can be targeted by a therapeutic agent such as an ASO. In some embodiments, the ASO targets the SCN1A pre-mRNA transcript containing the NIE. In some embodiments, the ASO targets a sequence in the NIE of the SCN1A pre-mRNA transcript. In some embodiments, the ASO targets a sequence upstream (or 5') of the 5' NIE (3'ss) end of the SCN1A pre-mRNA transcript. In some embodiments, the ASO targets a sequence located downstream (or 3' from the 3' end of the NIE (5'ss) of the SCN1A premRNA transcript. In some embodiments, the ASO targets a sequence that is within an intron flanking the 5' - NIE end of the SCN1A pre-mRNA transcript. In some embodiments, the ASO targets a sequence that is within an intron flanking the 3' end of the NIE of the SCN1A pre-mRNA transcript. In some embodiments, the ASO targets a sequence comprising the NIE-intron boundary of the transcript SCN1A pre-mRNA. The NIE-intron boundary may refer to the junction of the intronic sequence and the NIE region. The intronic sequence may flank the 5' end of the NIE or the 3' end of the NIE. In some embodiments, the ASO targets a sequence in an exon of the SCN1A pre-mRNA transcript. According to In some embodiments, the ASO targets a sequence in an intron of the SCN1A pre-mRNA transcript. In some embodiments, the ASO targets a sequence comprising both a portion of an intron and a portion of an exon.

In some embodiments, a therapeutic agent described herein modulates the binding of a factor involved in mRNA splicing to the NMD exon.

- 15 045521

In some embodiments, a therapeutic agent described herein prevents a factor involved in mRNA splicing from binding to the NMD exon.

In some embodiments, a therapeutic agent described herein prevents a factor involved in mRNA splicing from binding to the NMD exon.

In some embodiments, the therapeutic agent targets a target portion located in the intronic region between two canonical exon regions of the SCN1A encoding mRNA with an NMD exon, and wherein the intronic region comprises an NMD exon.

In some embodiments, the therapeutic agent targets a target portion that at least partially overlaps the NMD exon.

In some embodiments, the therapeutic agent targets a target portion that at least partially overlaps with an intron upstream of the NMD exon.

In some embodiments, the therapeutic agent targets a target portion in the NMD exon.

In some embodiments, the therapeutic agent targets a target moiety comprising at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the NMD exon. In some embodiments, the therapeutic agent targets a target moiety comprising no more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the NMD exon. In some embodiments, the therapeutic agent targets a target moiety comprising approximately 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 , 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the NMD exon. In some embodiments, the therapeutic agent targets a target portion proximal to the NMD exon.

In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides upstream (or 5') from the 5' end of the NIE. In some embodiments, the ASO targets a sequence located from about 1 to about 20 nucleotides, from about 20 to about 50 nucleotides, from about 50 to about 100 nucleotides, from about 100 to about 150 nucleotides, from about 150 to about 200 nucleotides, from about 200 to about 250 nucleotides, from about 250 to about 300, from about 250 to about 300 nucleotides, from about 350 to about 400 nucleotides, from about 450 to about 500 nucleotides, from about 550 to about 600 nucleotides, from about 650 to about 700 nucleotides, about 750 to about 800 nucleotides, about 850 to about 900 nucleotides, about 950 to about 1000 nucleotides, about 1050 to about 1100 nucleotides, about 1150 to about 1200 nucleotides, about 1250 up to about 1300 nucleotides, about 1350 to about 1400 nucleotides, or about 1450 to about 1500 nucleotides upstream (or 5') from the 5' end of the NIE region. In some embodiments, the ASO may be targeted to a sequence located more than 300 nucleotides upstream of the 5' end of the NIE. In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides downstream (or 3') from the 3' end of the NIE. In some embodiments, the ASO targets a sequence located from about 1 to about 20 nucleotides, from about 20 to about 50 nucleotides, from about 50 to about 100 nucleotides, from about 100 to about 150 nucleotides, from about 150 to about 200 nucleotides, from about 200 to about 250 nucleotides, from about 250 to about 300 nucleotides, from about 350 to about 400 nucleotides, from about 450 to about 500 nucleotides, from about 550 to about 600 nucleotides, from about 650 to about 700 nucleotides, from about 750 to about 800 nucleotides, from about 850 to about 900 nucleotides, from about 950 to about 1000 nucleotides, from about 1050 to about 1100 nucleotides, from about 1150 to about 1200 nucleotides, from about 1250 to about 1300 nucleotides, from about 1350 to about 1400 nucleotides or about 1450 to about 1500 nucleotides downstream from the 3' end of the NIE. In some embodiments, the ASO targets a sequence located more than 300 nucleotides downstream of the 3' end of the NIE.

In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides upstream (or 5') from the 5' end of the NIE. In some embodiments, ASO is targeted after

- 16 045521 sequence located at least about 1 nucleotide, at least about 10 nucleotides, at least about 20 nucleotides, at least about 50 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, at least about 96 nucleotides, at least about 97 nucleotides, at least about 98 nucleotides, at least about 99 nucleotides, at least about 100 nucleotides, at least about 101 nucleotides, at least about 102 nucleotides, at least about 103 nucleotides, at least about 104 nucleotides, at least about 105 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, or at least about 1000 nucleotides upstream ( or 5') from the 5' end of the NIE region. In some embodiments, the ASO targets a sequence located 4 to 300 nucleotides downstream (or 3') of the 3' end of the NIE. In some embodiments, the ASO targets a sequence located at least about 1 nucleotide, at least about 10 nucleotides, at least about 20 nucleotides, at least about 50 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, at least about 96 nucleotides, at least about 97 nucleotides, at least about 98 nucleotides, at least at least about 99 nucleotides, at least about 100 nucleotides, at least about 101 nucleotides, at least about 102 nucleotides, at least about 103 nucleotides, at least about 104 nucleotides, at least about at least about 105 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, or at least about 1000 nucleotides down downstream of the 3' end of NIE. In some embodiments, the ASO targets a sequence located more than 300 nucleotides downstream of the 3' end of the NIE.

In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides upstream (or 5') from the 5' end of the NIE. In some embodiments, the ASO targets a sequence no more than about 10 nucleotides, no more than about 20 nucleotides, no more than about 50 nucleotides, no more than about 80 nucleotides, no more than about 85 nucleotides, no more than about 90 nucleotides, no more than about 96 nucleotides, no more than about 97 nucleotides, no more than about 98 nucleotides, no more than about 99 no more than about 100 nucleotides, no more than about by 101 nucleotides, not more than about 102 nucleotides, not more than about 103 nucleotides, not more than about 104 nucleotides, not more than about 105 nucleotides, not more than about 110 nucleotides, not more than about 120 nucleotides, no more than about 150 nucleotides, no more than about 200 nucleotides, no more than about 300 nucleotides, no more than about 400 nucleotides, no more than about 500 nucleotides, no more than about 600 nucleotides, no more than about 700 nucleotides, no more than about 800 nucleotides, no more than about 900 nucleotides, no more than about 1000 nucleotides, no more than about 1100 nucleotides, no more than about 1200 nucleotides, no more less than about 1300 nucleotides, no more than about 1400 nucleotides, or no more than about 1500 nucleotides upstream (or 5') from the 5' end of the NIE region. In some embodiments, the ASO targets a sequence located 4 to 300 nucleotides downstream (or 3') of the 3' end of the NIE. In some embodiments, the ASO targets a sequence located no more than about 10 nucleotides, no more than about 20 nucleotides, no more than

- 17 045521 approximately 50 nucleotides, not more than approximately 80 nucleotides, not more than approximately 85 nucleotides, not more than approximately 90 nucleotides, not more than approximately 95 nucleotides, not more than approximately 96 nucleotides, not more no more than about 97 nucleotides, no more than about 98 nucleotides, no more than about 99 nucleotides, no more than about 100 nucleotides, no more than about 101 nucleotides, no more than about 102 nucleotides, no more than about no more than about 103 nucleotides, no more than about 104 nucleotides, no more than about 105 nucleotides, no more than about 110 nucleotides, no more than about 120 nucleotides, no more than about 150 nucleotides, no more than about 200 nucleotides, no more than about 300 nucleotides, no more than about 400 nucleotides, no more than about 500 nucleotides, no more than about 600 nucleotides, no more than about 700 nucleotides, no more than about 800 nucleotides, no more than about 900 nucleotides or no more than about 1000 nucleotides, no more than about 1100 nucleotides, no more than about 1200 nucleotides, no more than about 1300 nucleotides, no more than about 1400 nucleotides or no more than approximately 1500 nucleotides downstream from the 3' end of NIE. In some embodiments, the ASO targets a sequence located more than 300 nucleotides downstream of the 3' end of the NIE.

In some embodiments, the NIE, as described herein, is between GRCh37/hg19: chr2:166863740 and GRCh37/hg19: chr2:166863803, as shown in FIG. 2. In some embodiments, the 5' end of the NIE is located in GRCh37/hg19: chr2:166863803. In some embodiments, the 3' end of the NIE is located in GRCh37/hg19: chr2:166863740. In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides upstream (or 5') of the GRCh37/hg19 genomic site: chr2:166863803. In some embodiments, the ASO targets a sequence located from about 1 to about 20 nucleotides, from about 20 to about 50 nucleotides, from about 50 to about 100 nucleotides, from about 100 to about 150 nucleotides, from about 150 to about 200 nucleotides, from about 200 to about 250 nucleotides, from about 250 to about 300, from about 250 to about 300 nucleotides, from about 350 to about 400 nucleotides, from about 450 to about 500 nucleotides, from about 550 to about 600 nucleotides, from about 650 to about 700 nucleotides, from about 750 to about 800 nucleotides, from about 850 to about 900 nucleotides, from about 950 to about 1000 nucleotides, from about 1050 to about 1100 nucleotides, from about 1150 to about 1200 nucleotides, from about 1250 to about 1300 nucleotides, about 1350 to about 1400 nucleotides, or about 1450 to about 1500 nucleotides upstream (or 5') of the GRCh37/hg19 genomic site: chr2:166863803. In some embodiments, the ASO may target a sequence located more than 300 nucleotides upstream of the GRCh37/hg19 genomic site: chr2:166863803. In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides downstream (or 3') of GRCh37/hg19: chr2:166863740. In some embodiments, the ASO targets a sequence located from about 1 to about 20 nucleotides, from about 20 to about 50 nucleotides, from about 50 to about 100 nucleotides, from about 100 to about 150 nucleotides, from about 150 to about 200 nucleotides, from about 200 to about 250 nucleotides, from about 250 to about 300 nucleotides, from about 350 to about 400 nucleotides, from about 450 to about 500 nucleotides, from about 550 to about 600 nucleotides, from about 650 to about 700 nucleotides, from about 750 to about 800 nucleotides, from about 850 to about 900 nucleotides, from about 950 to about 1000 nucleotides, from about 1050 to about 1100 nucleotides, from about 1150 to about 1200 nucleotides, from about 1250 to about 1300 nucleotides, from about 1350 to approximately 1400 nucleotides or approximately 1450 to approximately 1500 nucleotides downstream of GRCh37/hg19: chr2:166863740. In some embodiments, the ASO targets a sequence located more than 300 nucleotides downstream of GRCh37/hg19: chr2:166863740.

In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides upstream (or 5') of the GRCh37/hg19 genomic site: chr2:166863803. In some embodiments, the ASO targets a sequence located at least about 1

- 18 045521 nucleotides, at least about 10 nucleotides, at least about 20 nucleotides, at least about 50 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, at least about 96 nucleotides, at least about 97 nucleotides, at least about 98 nucleotides, at least about 99 nucleotides, at least about 100 nucleotides , at least about 101 nucleotides, at least about 102 nucleotides, at least about 103 nucleotides, at least about 104 nucleotides, at least about 105 nucleotides, at least about 110 nucleotides, according to at least about 120 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, or at least about 1000 nucleotides upstream (or 5') of the GRCh37 genomic site hg19: chr2:166863803. In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides downstream (or 3') of GRCh37/hg19: chr2:166863740. In some embodiments, the ASO targets a sequence located at least about 1 nucleotide, at least about 10 nucleotides, at least about 20 nucleotides, at least about 50 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, at least about 96 nucleotides, at least about 97 nucleotides, at least about 98 nucleotides, at least at least about 99 nucleotides, at least about 100 nucleotides, at least about 101 nucleotides, at least about 102 nucleotides, at least about 103 nucleotides, at least about 104 nucleotides, at least about at least about 105 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, or at least about 1000 nucleotides downstream of GRCh37/hg19: chr2:166863740. In some embodiments, the ASO targets a sequence located more than 300 nucleotides downstream of GRCh37/hg19: chr2:166863740.

In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides upstream (or 5') of the GRCh37/hg19 genomic site: chr2:166863803. In some embodiments, the ASO targets a sequence no more than about 10 nucleotides, no more than about 20 nucleotides, no more than about 50 nucleotides, no more than about 80 nucleotides, no more than about 85 nucleotides, not more than about 90 nucleotides, not more than about 95 nucleotides, not more than about 96 nucleotides, not more than about 97 nucleotides, not more than about 98 nucleotides, not more than about 99 nucleotides, not more than no more than about 100 nucleotides, no more than about 101 nucleotides, no more than about 102 nucleotides, no more than about 103 nucleotides, no more than about 104 nucleotides, no more than about 105 nucleotides, no more than about no more than about 110 nucleotides, no more than about 120 nucleotides, no more than about 150 nucleotides, no more than about 200 nucleotides, no more than about 300 nucleotides, no more than about 400 nucleotides, no more than about 500 nucleotides, no more than about 600 nucleotides, no more than about 700 nucleotides, no more than about 800 nucleotides, no more than about 900 nucleotides, no more than about 1000 nucleotides, no more than about 1100 nucleotides, no more than about 1200 nucleotides, no more than about 1300 nucleotides, no more than about 1400 nucleotides, or no more than about 1500 nucleotides upstream (or 5') of the GRCh37/hg19 genomic site: chr2:166863803 . In some embodiments, the ASO targets a sequence located between about 4 and about 300 nucleotides away

- 19 045521 downstream (or 3') of GRCh37/hg19: chr2:166863740. In some embodiments, the ASO targets a sequence no more than about 10 nucleotides, no more than about 20 nucleotides, no more than about 50 nucleotides, no more than about 80 nucleotides, no more than about 85 nucleotides, not more than about 90 nucleotides, not more than about 95 nucleotides, not more than about 96 nucleotides, not more than about 97 nucleotides, not more than about 98 nucleotides, not more than about 99 nucleotides, not more than no more than about 100 nucleotides, no more than about 101 nucleotides, no more than about 102 nucleotides, no more than about 103 nucleotides, no more than about 104 nucleotides, no more than about 105 nucleotides, no more than about no more than about 110 nucleotides, no more than about 120 nucleotides, no more than about 150 nucleotides, no more than about 200 nucleotides, no more than about 300 nucleotides, no more than about 400 nucleotides, no more than about 500 nucleotides, no more than about 600 nucleotides, no more than about 700 nucleotides, no more than about 800 nucleotides, no more than about 900 nucleotides, or no more than about 1000 nucleotides, no more than about 1100 nucleotides, no more than about 1200 nucleotides, no more than about 1300 nucleotides, no more than about 1400 nucleotides, or no more than about 1500 nucleotides downstream of GRCh37/hg19: chr2:166863740. In some embodiments, the ASO targets a sequence located more than 300 nucleotides downstream of GRCh37/hg19: chr2:166863740.

As described herein in the Examples, the SCN1A gene (SEQ ID NO: 1) was analyzed for NIE and inclusion of a portion of intron 20 (SEQ ID NO: 4) (this portion is referred to as exon 20x in the present disclosure). In some embodiments, ASOs disclosed herein target an NIE-containing pre-mRNA (SEQ ID NO. 2) transcribed from the SCN1A genomic sequence. In some embodiments, the ASO targets an NIE-containing pre-mRNA transcript from the SCN1A genomic sequence containing a portion of intron 20. In some embodiments, the ASO targets an NIE-containing pre-mRNA transcript from the SCN1A genomic sequence containing exon 20x (SEQ ID NO: 6 ). In some embodiments, the ASO targets an NIE-containing pre-mRNA transcript of SEQ ID NO. 2 or 12. In some embodiments, the ASO targets an NIE-containing pre-mRNA transcript of SEQ ID NO. 2 or 12 containing NIE. In some embodiments, the ASO targets an NIE-containing pre-mRNA transcript of SEQ ID NO. 2 containing exon 20x (SEQ ID NO: 10). In some embodiments, the ASOs disclosed herein target the SCN1A pre-mRNA sequence (SEQ ID NO: 2 or 12). In some embodiments, the ASO targets the SCN1A pre-mRNA sequence containing the NIE (SEQ ID NO. 10 or 20). In some embodiments, the ASO targets the SCN1A pre-mRNA sequence according to any of SEQ ID NOs: 7-10 or 17-20. In some embodiments, the ASO is characterized by a sequence according to any of SEQ ID NO: 21-67. In some embodiments, the ASO is characterized by a sequence according to any of SEQ ID NO: 68-114. In some embodiments, the ASO is characterized by a sequence according to any of SEQ ID NO: 115-209. In some embodiments, the ASO is characterized by a sequence according to any of SEQ ID NOs: 210-256. In some embodiments, the ASO is characterized by a sequence according to any of SEQ ID NOs: 257-303. In some embodiments, the ASO is characterized by a sequence according to any of SEQ ID NO: 304-341. In some embodiments, the ASO is characterized by a sequence according to any of SEQ ID NOs: 342-379.

In some embodiments, the NIE-containing SCN1A pre-mRNA transcript is encoded by a genetic sequence with at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. to SEQ ID NO.: 1 or 11. In some embodiments, the NIE-containing SCN1A premRNA transcript comprises a sequence with at least about 80%, 85%, 90%, 95%, 96%, 97%, 98 sequence identity %, 99% or 100% relative to any of SEQ ID NO: 2-10 and 12-20.

In some embodiments, the NIE-containing SCN1A pre-mRNA transcript (or NMD exon mRNA) contains a sequence with at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any from SEQ ID NO: 2, 7-10, 12 and 17-20. In some embodiments, the NIE-containing SCN1A pre-mRNA transcript (or NMD exon mRNA) is encoded by a sequence with at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to SEQ ID NO: 1, 3-6, 11 and 13-16. In some embodiments, the target portion of the NMD exon mRNA comprises a sequence with the identity sequentially

- 20 045521 of at least about 80%, 85%, 90%, 95%, 97% or 100% with respect to the region containing at least 8 contiguous nucleic acids SEQ ID NO: 2, 7-10, 12 and 17-20.

In some embodiments, the ASO targets exon 20 of the NIE-containing SCN1A premRNA containing NIE exon 20x. In some embodiments, the ASO targets a sequence in exon 21 downstream (or 3') of exon 20x of NIE. In some embodiments, the ASO targets a sequence located 4 to 300 nucleotides upstream (or 5') from the 5' end of exon 20x. In some embodiments, the ASO targets a sequence located from about 4 to about 300 nucleotides downstream (or 3') from the 3' end of exon 20x. In some embodiments, the ASO is characterized by a sequence according to any of SEQ ID NO: 21-67. In some embodiments, the ASO is characterized by a sequence according to any of SEQ ID NOs: 210-256. In some embodiments, the ASO is targeted to a sequence upstream of the 5' end of the NIE. For example, ASOs targeting a sequence upstream of the 5' end of the NIE (e.g. exon 20x in human SCN1A or exon 21x in mouse SCN1A) may contain a sequence with at least 80%, 85%, 90 sequence identity %, 95%, 97% or 100% relative to any of SEQ ID NO: 21-38. In another example, ASOs targeting a sequence upstream of the 5' end of the NIE (e.g., exon 20x in human SCN1A or exon 21x in mouse SCN1A) may contain a sequence with at least 80%, 85% sequence identity , 90%, 95%, 97% or 100% relative to any of SEQ ID NO: 68-85. In some embodiments, the ASOs target a sequence containing an exon-intron boundary (or junction). For example, ASOs targeting a sequence containing an exon-intron boundary may contain a sequence with at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any of SEQ ID NOs : 39-41, 51, 52, 228-230, 240 or 241. In another example, ASOs targeting a sequence containing an exon-intron boundary may contain a sequence with at least 80%, 85%, 90 sequence identity %, 95%, 97% or 100% relative to any of SEQ ID NOs: 86-88 and 98-99. In some embodiments, the ASOs are targeted to a sequence downstream of the 3' end of the NIE. For example, ASOs targeting a sequence downstream of the NIE (e.g., exon 20x in human SCN1A or exon 21x in mouse SCN1A) may contain a sequence with at least 80%, 85% sequence identity , 90%, 95%, 97% or 100% relative to any of SEQ ID NO: 53-67. In another example, ASOs targeting a sequence downstream of the 3' end of the NIE (e.g., exon 20x in human SCN1A or exon 21x in mouse SCN1A) may contain a sequence with at least 80% sequence identity. 85%, 90%, 95%, 97% or 100% relative to any of SEQ ID NO: 100-114. In some embodiments, the ASOs target a sequence in the NIE. For example, ASOs targeting a sequence in NIE (e.g., exon 20x in human SCN1A or exon 21x in mouse SCN1A) may contain a sequence with at least 80%, 85%, 90%, 95%, 97% sequence identity or 100% with respect to any of SEQ ID NO: 42-50 or 231-239. In another example, ASOs targeting a sequence in NIE (e.g. exon 20x in human SCN1A or exon 21x in mouse SCN1A) may contain a sequence with at least 80%, 85%, 90%, 95% sequence identity, 97 % or 100% relative to any of SEQ ID NO: 89-97.

In some embodiments, the ASO targets exon 20x in the NIE-containing SCN1A premRNA containing exon 20x. In some embodiments, the ASO targets a sequence of exon 20x downstream (or 3') of the 5' end of exon 20x of the SCN1A pre-mRNA. In some embodiments, the ASO targets a sequence of exon 20x upstream (or 5') of the 3' end of exon 20x of the SCN1A pre-mRNA. In some embodiments, the target portion of the NIE-containing SCN1A pre-mRNA is located in intron 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, 20, 21, 22, 23, 24, or 25 (intron numbering corresponds to the mRNA sequence in NM_006920). In some embodiments, hybridization of an ASO to a targeted portion of the pre-mRNA with an NIE results in exon skipping of at least one of the NIEs in intron 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25, and subsequent production of SCN1A. In some embodiments, hybridization of the ASO to a targeted portion of the pre-mRNA with an NIE inhibits or blocks exon skipping of at least one of the NIEs within intron 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 or 25 and subsequently reduces the production of SCN1A protein. In some embodiments, the target portion of the NIE-containing SCN1A pre-mRNA is located in intron 20. One skilled in the art can determine the appropriate intron number in any isoform based on the intron sequence provided herein or using the number provided with respect to the mRNA sequence , in NM_006920, NM_001202435, NM_001165964 or

- 21 045521

NM_001165963. One skilled in the art can also determine the flanking exon sequences in any SCN1A isoform for targeting using the methods of the present invention based on the intronic sequence provided herein or using the intronic number provided for the mRNA sequence in NM_006920, NM_001202435, NM_001165964 or NM_001165963.

In some embodiments, the methods and compositions of the present invention are used to modulate, for example, increase or decrease, SCN1A expression by inducing or inhibiting pseudoexon exon skipping of NIE-containing SCN1A pre-mRNA. In some embodiments, a pseudo exon is a sequence within any of introns 1-25. In some embodiments, a pseudo exon is a sequence within any of introns 2, 4, 6, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, and 25. In some embodiments, a pseudo exon is sequence within any of introns 15, 18, and 19. In some embodiments, the pseudo exon may be any or part of an SCN1A intron. In some embodiments, the pseudo-exon is located within intron 20. The SCN1A intron numbering used herein corresponds to the mRNA sequence in NM_006920. It is understood that the intron numbering may change relative to the other SCN1A isoform sequence.

SCN1A protein.

The SCN1A gene may encode the protein SCN1A (sodium channel, voltage-gated, type I, alpha subunit), which can also be called voltage-gated sodium channel Na _v 1.1 alpha subunit. Also, the SCN1A mutations in DS described above are distributed throughout the protein. More than 100 new mutations have been identified throughout the gene, with more destructive ones occurring de novo. They contain truncations (47%), missense mutations (43%), deletions (3%), and splice site mutations (7%). The percentage of subjects carrying SCN1A mutations ranges from 33 to 100%. Most mutations are new changes (88%). In some embodiments, the methods described herein are used to modulate, for example, increase or decrease, the production of functional SCN1A protein. As used herein, the term functional refers to the amount of activity or function of the SCN1A protein that is required to eliminate any one or more symptoms of the condition being treated, for example, Dravet syndrome (DS); epilepsy, generalized, with febrile seizures plus, type 2; febrile seizures, familial, 3A; autism; epileptic encephalopathy, early infancy, 13; sick sinus syndrome 1; Alzheimer's disease or SUDEP. In some embodiments, the methods are used to increase the production of a partially functional SCN1A protein. As used herein, the term partially functional refers to any amount of SCN1A protein activity or function that is less than the amount of activity or function that is necessary to eliminate or prevent any one or several symptoms of a disease or condition. In some embodiments, the partially functional protein or RNA will be characterized by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% less active than completely functional protein or RNA.

In some embodiments, the method is a method of increasing the expression of the SCN1A protein by cells of a subject characterized by the presence of NIE-containing pre-mRNA encoding the SCN1A protein, wherein the subject has Dravet syndrome caused by insufficient amount of SCN1A protein activity, and wherein the insufficient amount of SCN1A protein is caused by haploinsufficiency of the protein SCN1A. In such an embodiment, the subject contains a first allele that encodes a functional SCN1A protein and a second allele that does not produce SCN1A protein. In another such embodiment, the subject contains a first allele encoding a functional SCN1A protein and a second allele encoding a non-functional SCN1A protein. In another such embodiment, the subject contains a first allele encoding a functional SCN1A protein and a second allele encoding a partially functional SCN1A protein. In any one of these embodiments, the antisense oligomer binds to the target portion of the NIE-containing pre-mRNA transcribed from the second allele, thereby inducing exon skipping of the pseudo-exon from the pre-mRNA, and causing an increase in the content of the mature mRNA encoding the functional SCN1 A protein and an increase in expression SCN1A protein in the subject's cells.

In related embodiments, the method is a method of using an ASO to increase the expression of a protein or functional RNA. In some embodiments, an ASO is used to increase expression of the SCN1A protein in cells of a subject characterized by the presence of NIE-containing pre-mRNA encoding the SCN1A protein, wherein the subject has a deficiency in the amount or function of the SCN1A protein, e.g., Dravet syndrome (DS) (also known as SMEI ); severe myoclonic epilepsy of infants (SMEI) - borderline form (SMEB); Phoebus

- 22 045521 rile convulsions (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic spasms; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); sick sinus syndrome 1; early infantile SCN1A encephalopathy; early infantile epileptic encephalopathy (EIEE) or autism. In some embodiments, the ASO is used to increase SCN1A protein expression in cells of a subject, wherein the subject has a deficiency, for example, early childhood epileptic encephalopathy, 13; in the amount or function of the SCN8A protein. In some embodiments, an ASO is used to increase expression of SCN1A protein in cells of a subject, wherein the subject is deficient, for example in sick sinus syndrome 1, in the amount or function of SCN5A protein.

In some embodiments, an NIE-containing pre-mRNA transcript encoding a protein that is the cause of a disease or condition is targeted by ASOs described herein. In some embodiments, an NIE-containing pre-mRNA transcript that encodes a protein that is not a disease cause is targeted by ASOs. For example, a disease that results from a mutation or deficiency of a first protein in a particular pathway can be attenuated by targeting an NIE-containing pre-mRNA that encodes a second protein, thereby increasing production of the second protein. In some embodiments, the function of the second protein is capable of compensating for a mutation or deficiency in the first protein (which is the cause of the disease or condition). In some embodiments, the subject comprises:

(a) a first mutant allele from which (i) the SCN1A protein is produced in reduced amount compared to that from the wild-type allele, (ii) the SCN1A protein is produced in a form characterized by reduced function compared to the equivalent wild-type protein, or (iii) ) SCNIA protein or functional RNA is not produced; and (b) a second mutant allele from which (i) the SCN1A protein is produced in reduced amount compared to that from the wild-type allele, (ii) the SCN1A protein is produced in a form characterized by reduced function compared to the equivalent wild-type protein, or ( iii) the SCN1A protein is not produced, and wherein the NIE-containing pre-mRNA is transcribed from the first allele and/or the second allele. In these embodiments, ASO binds to the target portion of the NIE-containing pre-mRNA transcribed from the first allele or the second allele, thereby inducing exon skipping of the pseudo-exon from the NIE-containing pre-mRNA, and causing an increase in the content of the mRNA encoding the SCN1A protein and an increase in the expression of the target protein or functional RNA in the subject's cells. In these embodiments, the target protein or functional RNA that is overexpressed as a result of pseudoexon exon skipping from the NIE-containing pre-mRNA is either in a form characterized by reduced function compared to the equivalent wild-type protein (partially functional) or characterized by full function compared to the equivalent wild-type protein (fully functional).

In some embodiments, the amount of mRNA encoding the SCN1A protein is increased by 1.1 to 10 times the amount of mRNA encoding the SCN1A protein that is produced in a control cell, e.g., a cell not treated with an antisense oligomer or a cell treated with an antisense oligomer. an oligomer that does not bind to the target portion of the NIE-containing SCN1A pre-mRNA.

In some embodiments, a subject treated using the methods of the present disclosure expresses a partially functional SCN1A protein from a single allele, wherein the partially functional SCN1A protein is caused by a frameshift mutation, nonsense mutation, missense mutation, or partial deletion of the gene. In some embodiments, a subject treated using the methods of the present invention expresses a nonfunctional SCN1A protein from one allele, wherein the nonfunctional SCN1A protein is caused by a frameshift mutation, nonsense mutation, missense mutation, or partial deletion of a gene in one allele. In some embodiments, a subject treated using the methods of the present invention has a deletion of the entire SCN1A gene on one allele. In some embodiments, the method is a method of reducing expression of the SCN1A protein by cells of a subject having an NIE-containing pre-mRNA encoding the SCN1A protein, and wherein the subject has a gain-of-function mutation in Na _v 1.1. In such an embodiment, the subject has an allele from which the SCN1A protein is produced in increased amounts, or an allele encoding a mutant SCN1A that induces increased Na _v 1.1 activity in the cell. In some embodiments, increased Na _v 1.1 activity is characterized by a prolonged or nearly persistent sodium flux mediated by the mutant

- 23 045521 by the Na _v 1.1 channel, slowing down fast inactivation, positive shift in steady-state inactivation, higher channel availability with repeated stimulation, increasing non-inactivated depolarization-induced sodium direct currents, delayed entry into inactivation, accelerated recovery from fast inactivation and/or rescue from folding defects by incubation at a lower temperature or coexpression of interacting proteins. In any one of these embodiments, the antisense oligomer binds to the target portion of the NIE-containing pre-mRNA transcribed from the second allele, thereby inhibiting or blocking pseudoexon exon skipping from the pre-mRNA, and causing a decrease in the content of the mature mRNA encoding the functional SCN1 A protein, and decreased SCNIA protein expression in the subject's cells.

In related embodiments, the method is a method of using an ASO to reduce the expression of a protein or functional RNA. In some embodiments, an ASO is used to reduce SCN1A protein expression in cells of a subject having an NIE-containing pre-mRNA encoding the SCN1A protein. In some embodiments, the subject is characterized by having a gain-of-function mutation in Na _v 1.1, such as migraine. In some embodiments, ASO is used to reduce SCN1A protein expression in cells of a subject that has a gain-of-function mutation in Na _v 1.1, such as migraine hereditary hemiplegic 3.

In some embodiments, the amount of mRNA encoding the SCN1A protein is reduced by 1.1- to 10-fold compared to the amount of mRNA encoding the SCN1A protein that is produced in a control cell, e.g., a cell not treated with an antisense oligomer or a cell treated with an antisense oligomer. an oligomer that does not bind to the target portion of the NIE-containing SCN1A pre-mRNA.

In some embodiments, a subject treated using the methods of the present disclosure expresses a mutant SCN1A protein from a single allele, wherein the mutant SCN1A protein is caused by a frameshift mutation, a nonsense mutation, a missense mutation, or a partial gene deletion, and wherein the mutant SCN1A protein is caused by increased level of Na _v 1.1 activity. In some embodiments, a subject treated using the methods of the present disclosure expresses an increased amount of SCN1A protein from one allele due to a frameshift mutation, nonsense mutation, missense mutation, or partial deletion of the gene.

In embodiments of the present invention, a subject may have a mutation in SCN1A. Mutations in SCN1A can spread throughout the entire gene. The SCN1A protein can consist of four domains. These SCN1A domains may contain transmembrane segments. Mutations in the specified SCN1A protein can occur throughout the specified protein. Said SCN1A protein may consist of at least two isoforms. Mutations in SCN1A may include R931C, R946C, M934I, R1648C, or R1648H. In some cases, mutations may be observed at the end of the SCN1A protein. Mutations in the SCN1A protein can also be found in the loops between segments 5 and 6 of the first three domains of the specified SCN1A protein. In some cases, mutations may be observed at the N-terminus of the SCN1A protein. Exemplary mutations in SCN1A include, but are not limited to, R222X, R712X, I227S, R1892X, W952X, R1245X, R1407X, W1434R, c.4338+1G>A, S1516X, L1670fsX1678, or K1846fsX1856. Mutations that can be targeted in the present invention can also encode ion channel pores.

In some embodiments, the methods and compositions described herein can be used to treat DS. In other embodiments, the methods and compositions described herein can be used to treat severe myoclonic epilepsy of infancy (SMEI). In other embodiments, the methods and compositions described herein can be used to treat a borderline form of Dravet syndrome (DS); epilepsy, generalized, with febrile seizures plus, type 2; febrile seizures, hereditary, 3A; migraine, hereditary hemiplegic, 3; autism; epileptic encephalopathy, early infancy, 13; sick sinus syndrome 1; Alzheimer's disease or SUDEP. The methods and compositions described herein may also be used to treat borderline SMEI. In addition, the methods and compositions described herein can be used to treat generalized epilepsy with febrile seizures plus (GEFS+). GEFS+ may be associated with mutations in ion channel subunits associated with epilepsy, such as SCN1B or GABRG2. The methods and compositions described herein may also be used to treat sodium channelopathies. Sodium channelopathies may be associated with mutations in SCN1A. Sodium channelopathies may also be associated with subunits of SCN1A, such as the beta subunit, SCN1B. In some cases, additional diseases associated with SCN1A mutations may also be treated according to the present disclosure. SCN1A comorbidities associated with SCN1A mutations include, but are not limited to, atypical myotonia congenita, hyperkalemic periodic paralysis, and paramyotonia congenita.

In some embodiments, an entity characterized by the presence of any mu

- 24 045521 SCN1A mutations known in the art and described in the literature cited above (eg, Hamdan, et al., 2009, Mulley, et al., 2005) can be treated using the methods described herein and compositions. In some embodiments, the mutation is within any intron or exon of SCN1A.

Exon inclusion.

As used herein, the term NIE-containing pre-mRNA is a pre-mRNA transcript that contains at least one pseudoexon. Alternative or aberrant splicing can result in the inclusion of at least one pseudoexon in mature mRNA transcripts. The terms mature mRNA and fully spliced mRNA are used interchangeably herein to describe fully processed mRNA. Inclusion of at least one pseudoexon may represent nonproductive mRNA and result in NMD of the mature mRNA. NIE-containing mature mRNA can sometimes lead to aberrant protein expression.

In some embodiments, the included pseudoexon is the most abundant pseudoexon in a population of NIE-containing pre-mRNAs transcribed from a gene encoding a target protein in the cell. In some embodiments, the included pseudo-exon is the most abundant pseudo-exon in a population of NIE-containing pre-mRNAs transcribed from a gene encoding a target protein in the cell, wherein the population of NIE-containing pre-mRNAs contains two or more included pseudo-exons. In some embodiments, an antisense oligomer targeting the most abundant pseudoexon in a population of NIE-containing pre-mRNAs encoding the target protein induces exon skipping of one or two or more pseudoexons in the population, including the pseudoexon targeted by or with which the antisense oligomer contacts. In embodiments, the target region is located in a pseudoexon, which is the most abundant pseudoexon in the NIE-containing pre-mRNA encoding the SCN1A protein.

The extent of exon inclusion can be expressed as the percentage of exon inclusion, for example, the percentage of transcripts in which a given pseudoexon is included. Briefly, percent exon inclusion can be calculated as the percentage of the number of RNA transcripts with exon inclusion from the sum of the average number of RNA transcripts with exon inclusion plus the average number of RNA transcripts with exon exclusion. In some embodiments, an included pseudoexon is an exon that is identified as an included pseudoexon based on an inclusion determination of at least about 5%, at least about 10%, at least about 15%, at least about 20%, according to at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50%. In embodiments, an included pseudoexon is an exon that is identified as an included pseudoexon based on an inclusion definition of from about 5% to about 100%, from about 5% to about 95%, from about 5% to about 90%, from about 5 % to about 85%, from about 5% to about 80%, from about 5% to about 75%, from about 5% to about 70%, from about 5% to about 65%, from about 5% to about 60% , from about 5% to about 55%, from about 5% to about 50%, from about 5% to about 45%, from about 5% to about 40%, from about 5% to about 35%, from about 5% to about 30%, from about 5% to about 25%, from about 5% to about 20%, from about 5% to about 15%, from about 10% to about 100%, from about 10% to about 95%, from about 10% to about 90%, from about 10% to about 85%, from about 10% to about 80%, from about 10% to about 75%, from about 10% to about 70%, from about 10% to about 65%, from about 10% to about 60%, from about 10% to about 55%, from about 10% to about 50%, from about 10% to about 45%, from about 10% to about 40%, from about 10% to about 35%, about 10% to about 30%, about 10% to about 25%, about 10% to about 20%, about 15% to about 100%, about 15% to about 95%, from about 15% to about 90%, from about 15% to about 85%, from about 15% to about 80%, from about 15% to about 75%, from about 15% to about 70%, from about 15% to about 65%, from about 15% to about 60%, from about 15% to about 55%, from about 15% to about 50%, from about 15% to about 45%, from about 15% to about 40 %, from about 15% to about 35%, from about 15% to about 30%, from about 15% to about 25%, from about 20% to about 100%, from about 20% to about 95%,

- 25 045521 from about 20% to about 90%, from about 20% to about 85%, from about 20% to about 80%, from about 20% to about 75%, from about 20% to about 70%, from about 20% to about 65%, from about 20% to about 60%, from about 20% to about 55%, from about 20% to about 50%, from about 20% to about 45%, from about 20% to about 40 %, from about 20% to about 35%, from about 20% to about 30%, from about 25% to about 100%, from about 25% to about 95%, from about 25% to about 90%, from about 25 % to about 85%, from about 25% to about 80%, from about 25% to about 75%, from about 25% to about 70%, from about 25% to about 65%, from about 25% to about 60% , from about 25% to about 55%, from about 25% to about 50%, from about 25% to about 45%, from about 25% to about 40%, or from about 25% to about 35%. ENCODE data (described, for example, by Tilgner, et al., 2012, Deep sequencing of subcellular RNA fractions shows splicing to be predominantly co-transcriptional in the human genome but ineffective for lncRNAs, Genome Research 22(9): 1616-25) may be used to aid in the identification of exon inclusion.

In some embodiments, contacting cells with an ASO that is complementary to the target portion of the SCN1A pre-mRNA transcript results in an increase in the amount of SCN1A protein produced by at least 10, 20, 30, 40, 50, 60, 80, 100, 150, 200, 250, 300, 350, 4θ0, 450, 500 or 1000%, compared to the amount of protein produced by the cell in the absence of ASO/no treatment. In some embodiments, the total amount of SCN1A protein produced by the cell contacted by the antisense oligomer is increased by a factor of about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times , about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1 .1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, from about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, from about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times , at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the amount of target protein, produced by the control connection. The control compound may be, for example, an oligonucleotide that is not complementary to the target portion of the pre-mRNA. In some embodiments, exposing cells to an ASO that is complementary to the target portion of the SCN1A pre-mRNA transcript results in a decrease in the amount of SCN1A protein produced by at least 10, 20, 30, 40, 50, 6θ, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500 or 1000%, compared to the amount of protein produced by the cell in the absence of ASO/no treatment. In some embodiments, the total amount of SCN1A protein produced by the cell contacted by the antisense oligomer is reduced by a factor of about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10-fold , about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1 .1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, from about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, from about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times , at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the amount of target protein, produced by the control connection. The control compound may be, for example, an oligonucleotide that is not complementary to the target portion of the pre-mRNA. In some embodiments, exposing cells to an ASO that is complementary to the target portion of the SCN1A pre-mRNA transcript results in an increase

- 26 045521 amount of mRNA encoding SCN1A, including mature mRNA encoding the target protein. In some embodiments, the amount of mRNA encoding the SCN1A protein or mature mRNA encoding the SCN1A protein is increased by at least 10, 20, 30, 40, 50, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500 or 1000%, compared to the amount of protein produced by the cell in the absence of ASO/no treatment. In some embodiments, the total amount of SCN1A protein encoding mRNA or mature SCN1A protein encoding mRNA produced in the cell contacted by the antisense oligomer is increased by a factor of about 1.1 to about 10 times, from about 1. 5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times or at least at least approximately 10 times the amount of mature RNA produced in an unprocessed cell, eg, an untreated cell or a cell treated with a control compound. The control compound may be, for example, an oligonucleotide that is not complementary to the target portion of the NIE-containing SCN1A pre-mRNA.

In some embodiments, exposing cells to an ASO that is complementary to the target portion of the SCN1A pre-mRNA transcript results in a decrease in the amount of mRNA encoding SCN1A, including mature mRNA encoding the target protein. In some embodiments, the amount of mRNA encoding the SCN1A protein or mature mRNA encoding the SCN1A protein is reduced by at least 10, 20, 30, 40, 50, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500 or 1000%, compared to the amount of protein produced by the cell in the absence of ASO/no treatment. In some embodiments, the total amount of SCN1A protein-encoding mRNA or mature SCN1A protein-encoding mRNA produced in the cell contacted by the antisense oligomer is reduced by a factor of about 1.1 to about 10 times, from about 1. 5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times or at least at least approximately 10 times the amount of mature RNA produced in an unprocessed cell, eg, an untreated cell or a cell treated with a control compound. The control compound may be, for example, an oligonucleotide that is not complementary to the target portion of the NIE-containing SCN1A premRNA.

The NIE can be of any length. In some embodiments, the NIE contains the entire intron sequence, in which case it may be referred to as intron retention. In some embodiments, the NIE may be part of an intron. In some embodiments, the NIE may be the 5' terminal portion of the intron, including the 5'ss sequence. In some embodiments, the NIE may be the 3' portion of the intron, including the 3'ss sequence. In some embodiments, the NIE may be a portion of an intron without including the 5'ss sequence. In some embodiments, the NIE may be a portion of an intron without including the 3'ss sequence. In some embodiments, the NIE may be a portion within an intron without including the 5'ss or 3'ss sequence. According to some

- 27 045521 in embodiments, the NIE may be from 5 nucleotides to 10 nucleotides in length, from 10 nucleotides to 15 nucleotides in length, from 15 nucleotides to 20 nucleotides in length, from 20 nucleotides to 25 nucleotides in length, from 25 nucleotides to 30 nucleotides in length, from 30 nucleotides to 35 nucleotides in length, from 35 nucleotides to 40 nucleotides in length, from 40 nucleotides to 45 nucleotides in length, from 45 nucleotides to 50 nucleotides in length, from 50 nucleotides to 55 nucleotides in length, from 55 nucleotides to 60 nucleotides in length, from 60 nucleotides to 65 nucleotides in length, from 65 nucleotides to 70 nucleotides in length, from 70 nucleotides to 75 nucleotides in length, from 75 nucleotides to 80 nucleotides in length, from 80 nucleotides to 85 nucleotides in length, from 85 nucleotides to 90 nucleotides in length, from 90 nucleotides to 95 nucleotides in length, or from 95 nucleotides to 100 nucleotides in length. In some embodiments, the NIE may be at least 10 nucleotides, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides in length, at least 90 nucleotides in length, or at least 100 nucleotides in length. In some embodiments, the NIE may be 100 to 200 nucleotides in length, 200 to 300 nucleotides in length, 300 to 400 nucleotides in length, 400 to 500 nucleotides in length, 500 to 600 nucleotides in length, 600 to 700 nucleotides long, 700 to 800 nucleotides long, 800 to 900 nucleotides long, 900 to 1000 nucleotides long. In some embodiments, the NIE may be greater than 1000 nucleotides in length. Inclusion of a pseudoexon can result in a frameshift and the introduction of a premature termination codon (PIC) into the mature mRNA transcript, making the transcript a target of NMD. The mature mRNA transcript containing NIE may be a non-productive mRNA transcript that does not result in protein expression. The PIC can be in any position after the NIE. In some embodiments, the PIC may be present in any exon after NIE. In some embodiments, the PIC may be present in the NIE. For example, inclusion of exon 20x in the mRNA transcript encoded by the SCN1A gene can induce a PIC in the mRNA transcript, such as a PIC in exon 21 of the mRNA transcript.

Therapeutic agents.

According to various embodiments of the present disclosure, compositions and methods are provided comprising a therapeutic agent for modulating the level of expression of the SCN1A protein. In some embodiments, the present invention provides compositions and methods for modulating alternative splicing of SCNA1 pre-mRNA. In some embodiments, the present invention provides compositions and methods for inducing exon skipping during splicing of SCN1A pre-mRNA, for example, for inducing pseudo-exon skipping during splicing of SCN1A pre-mRNA. In other embodiments, therapeutic agents can be used to induce exon inclusion to reduce the level of protein expression.

In some embodiments, a therapeutic agent described herein is a small molecule, polypeptide, or polynucleic acid polymer. In some cases, the therapeutic agent is a small molecule. In some cases, the therapeutic agent is a polypeptide. In some cases, the therapeutic agent is a polynucleic acid polymer. In some cases, the therapeutic agent is a repressor. In additional cases, the therapeutic agent is an enhancer.

A therapeutic agent described herein may be a NIE repressor. The therapeutic agent may comprise a polynucleic acid polymer.

In accordance with one aspect of the present disclosure, provided herein is a method of treating or preventing a condition associated with deficiency of functional SCN1A protein, comprising administering an NIE repressor agent to a subject with increased levels of functional SCN1A protein; wherein the agent binds to a region of the pre-mRNA transcript to reduce the incorporation of NIE into the mature transcript. For example, provided herein is a method of treating or preventing a condition associated with deficiency of functional SCN1A protein, comprising administering an NIE repressor to a subject to increase functional SCN1A protein levels, wherein the agent binds to an intronic region containing NIE (e.g., intron 20 in the human SCN1A gene) pre-mRNA transcript or with a NIE-activating regulatory sequence in that NIE intron itself. When reference is made to a reduction in NIE incorporation into mature mRNA, the reduction may be complete, for example 100%, or may be partial. The reduction may be clinically significant. The reduction/correction may be relative to the level of NIE inclusion in a subject without treatment or relative to the amount of NIE inclusion in a population of similar subjects. The reduction/correction may be at least 10% less than the NIE inclusion relative to the average subject or pre-treatment subject. The reduction may be at least 20% less than the inclusion of NIE relative to the average subject or pre-treatment subject. The reduction may be at least 40% less than the inclusion of NIE relative to the average subject or pre-treatment subject. The reduction may be at least

- 28 045521 50% less NIE inclusion relative to the average subject or pre-treatment subject. The reduction may be at least 60% less than the inclusion of NIE relative to the average subject or pre-treatment subject. The reduction may be at least 80% less than the inclusion of NIE relative to the average subject or pre-treatment subject. The reduction may be at least 90% less than the inclusion of NIE relative to the average subject or pre-treatment subject.

When reference is made to an increase in active SCN1A protein, the increase may be clinically significant. The increase may be relative to the amount of active SCNIA protein in a subject without treatment or relative to the amount of active SCN1A protein in a population of similar subjects. The increase may be at least 10% more active SCN1A protein compared to the average subject or pre-treatment subject. The increase may be at least 20% more active SCN1A protein compared to the average subject or pre-treatment subject. The increase may be at least 40% more active SCN1A protein compared to the average subject or pre-treatment subject. The increase may be at least 50% more active SCN1A protein compared to the average subject or pre-treatment subject. The increase may be at least 80% more active SCN1A protein compared to the average subject or pre-treatment subject. The increase may be at least 100% more active SCN1A protein compared to the average subject or pre-treatment subject. The increase may be at least 200% more active SCN1A protein compared to the average subject or pre-treatment subject. The increase may be at least 500% more active SCN1A protein compared to the average subject or pre-treatment subject.

In embodiments in which the NIE repressor agent comprises a polynucleic acid polymer, the polynucleic acid polymer may be approximately 50 nucleotides in length. The polynucleic acid polymer may be approximately 45 nucleotides in length. The polynucleic acid polymer may be approximately 40 nucleotides in length. The polynucleic acid polymer may be approximately 35 nucleotides in length. The polynucleic acid polymer may be approximately 30 nucleotides in length. The polynucleic acid polymer may be approximately 24 nucleotides in length. The polynucleic acid polymer may be approximately 25 nucleotides in length. The polynucleic acid polymer may be approximately 20 nucleotides in length. The polynucleic acid polymer may be approximately 19 nucleotides in length. The polynucleic acid polymer may be approximately 18 nucleotides in length. The polynucleic acid polymer may be approximately 17 nucleotides in length. The polynucleic acid polymer may be approximately 16 nucleotides in length. The polynucleic acid polymer may be approximately 15 nucleotides in length. The polynucleic acid polymer may be approximately 14 nucleotides in length. The polynucleic acid polymer may be approximately 13 nucleotides in length. The polynucleic acid polymer may be approximately 12 nucleotides in length. The polynucleic acid polymer may be approximately 11 nucleotides in length. The polynucleic acid polymer may be approximately 10 nucleotides in length.

The polynucleic acid polymer can be from about 10 to about 50 nucleotides in length. The polynucleic acid polymer can be from about 10 to about 45 nucleotides in length. The polynucleic acid polymer can be from about 10 to about 40 nucleotides in length. The polynucleic acid polymer can be from about 10 to about 35 nucleotides in length. The polynucleic acid polymer may be from about 10 to about 30 nucleotides in length. The polynucleic acid polymer may be from about 10 to about 25 nucleotides in length. The polynucleic acid polymer may be from about 10 to about 20 nucleotides in length. The polynucleic acid polymer may be from about 15 to about 25 nucleotides in length. The polynucleic acid polymer may be from about 15 to about 30 nucleotides in length. The polynucleic acid polymer can be from about 12 to about 30 nucleotides in length.

The polynucleic acid polymer sequence may have complementarity of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98%, 99%, or 99.5% relative to the target mRNA transcript sequence, for example, a partially processed mRNA transcript. The polynucleic acid polymer sequence may be 100% complementary to the target pre-mRNA transcript sequence.

The polynucleic acid polymer sequence may have 4 or fewer mismatches with the target pre-mRNA transcript sequence. The polynucleic acid polymer sequence may have 3 or fewer mismatches with the target pre-mRNA transcript sequence. The polynucleic acid polymer sequence may have 2 or fewer mismatches with the target pre-mRNA transcript sequence. The polynucleic acid polymer sequence may have 1 or fewer mismatches with the target sequence trans

- 29 045521 pre-mRNA crypt. The polynucleic acid polymer sequence may not have any mismatches with the target pre-mRNA transcript sequence.

The polynucleic acid polymer can specifically hybridize to the target sequence of the pre-mRNA transcript. For example, a polynucleic acid polymer may have sequence complementarity of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% to the target sequence pre-mRNA transcript. Hybridization can be carried out under conditions of high hybridization stringency. The polynucleic acid polymer may have a sequence identity of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% relative to a sequence selected from the group consisting of SEQ ID NOs: 21-67. The polynucleic acid polymer may have a sequence with 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 21-67. In some cases, the polynucleic acid polymer may have a sequence identity of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92% , 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% relative to a sequence selected from the group consisting of SEQ ID NO: 68-114. In some cases, the polynucleic acid polymer may have a sequence with 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 68-114.

When reference is made to a polynucleic acid polymer sequence, one skilled in the art will appreciate that one or more substitutions may be permitted, optionally two substitutions may be permitted, in the sequence such that it retains the ability to hybridize to the target sequence; or when the substitution is in the target sequence, the ability to be recognized as the target sequence. Sequence identity references can be determined by BLAST sequence alignment using standard/default parameters. For example, a sequence can have 99% identity and still function in accordance with the present invention. In other embodiments, the sequence may have 98% identity and still function in accordance with the present disclosure. In another embodiment, the sequence may have 95% identity and still function in accordance with the present disclosure. In another embodiment, the sequence may have 90% identity and still function in accordance with the present disclosure. Antisense oligomers

Provided herein is a composition comprising an antisense oligomer that induces exon skipping by binding to a target portion of the NIE-containing SCN1A pre-mRNA. As used herein, the terms ASO and antisense oligomer are used interchangeably and refer to an oligomer, such as a polynucleotide, containing nucleosides that hybridize to a target nucleic acid sequence (eg, containing NIE SCN1A premRNA) by Watson-Crick base pairing or ambiguous base pairing (G-U ). An ASO may have the exact sequence complementary to the target sequence or close complementarity (eg, sufficient complementarity to bind the target sequence and enhance splicing at the splice site). ASOs are designed such that they bind (hybridize) to a target nucleic acid (eg, the target portion of a pre-mRNA transcript) and remain hybridized under physiological conditions. Typically, if they hybridize to a site other than the intended (target) nucleic acid sequence, they will hybridize to a limited number of sequences that are not the target nucleic acid (a few sites other than the target nucleic acid). The design of an ASO may take into account the occurrence of a nucleic acid sequence of the target portion of a pre-mRNA transcript, or a sufficiently similar nucleic acid sequence elsewhere in the genome or cellular pre-mRNA or transcriptome, such that the likelihood is that the ASO will bind to other sites and cause off-target effects , limited. Any antisense oligomers known in the art, for example, in PCT application No. PCT/US2014/054151, published as WO 2015/035091, entitled Reading Sterepth-Mediated mRNA Decay, incorporated herein by reference, can be used for practical application of the methods described herein.

In some embodiments, the ASOs specifically hybridize or are specific to the target nucleic acid or target portion of the NIE-containing pre-mRNA. Typically, such hybridization occurs with a T _m substantially greater than 37°C, preferably at least 50°C, and typically from 60°C to about 90°C. Such hybridization preferably follows stringent hybridization conditions. At a given ionic strength and pH, T _m is the temperature at which 50% of the target sequence hybridizes to the complementary oligonucleotide.

- 30 045521

Oligomers, such as oligonucleotides, are complementary to each other when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides. A double-stranded polynucleotide can be complementary to another polynucleotide if hybridization can occur between one of the strands of the first polynucleotide and the second. Complementarity (the degree to which one polynucleotide is complementary to another) is quantified in terms of the proportion (e.g., percentage) of bases on opposing strands that are expected to form hydrogen bonds with each other according to generally accepted base pairing rules. The sequence of an antisense oligomer (ASO) does not need to be 100% complementary to its target nucleic acid sequence for hybridization. In some embodiments, ASOs may comprise a sequence complementary to at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95 %, at least 96%, at least 97%, at least 98%, or at least 99% relative to the target region in the target nucleic acid sequence they are targeting. For example, an ASO in which 18 of the 20 nucleotide bases of the oligomeric compound are complementary to the target region and therefore must hybridize specifically would represent 90% complementarity. In this example, the remaining non-complementary nucleosides may be grouped together or intertwined with complementary nucleotide bases and need not be adjacent to each other or to the complementary nucleotide bases. The percentage of complementarity of an ASO with a region of the target nucleic acid can be determined in a conventional manner using the BLAST (Basic Local Alignment Search Tools) and PowerBLAST programs known in the art (Altschul, et al., J. Mol. Biol., 1990, 215 , 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). An ASO does not need to hybridize to all nucleotide bases in the target sequence, and the nucleotide bases to which it hybridizes may be contiguous or non-contiguous. ASOs can hybridize over one or more pre-mRNA transcript segments such that intervening or adjacent segments do not participate in the hybridization event (e.g., a loop or hairpin structure may be formed). In some embodiments, the ASO hybridizes to non-contiguous nucleotide bases in the target pre-mRNA transcript. For example, ASO can hybridize to nucleotide bases in a pre-mRNA transcript that are separated by one or more nucleotide bases to which ASO does not hybridize. The ASOs described herein contain nucleotide bases that are complementary to the nucleotide bases present in the target portion of the NIE pre-mRNA. The term ASO includes oligonucleotides and any other oligomeric molecule that contains nucleotide bases capable of hybridizing with a complementary nucleotide base on the target mRNA, but does not contain a sugar moiety such as a peptide nucleic acid (PNA). ASOs may contain naturally occurring nucleotides, nucleotide analogues, modified nucleotides, or any combination of two or three of the foregoing. The term natural nucleotides includes deoxyribonucleotides and ribonucleotides. The term modified nucleotides includes nucleotides with modified or substituted sugar groups and/or containing a modified backbone. In some embodiments, all ASO nucleotides are modified nucleotides. Chemical modifications of ASO or components of ASO that are compatible with the methods and compositions described herein will be apparent to one skilled in the art and can be found, for example, in US Patent No. 8,258,109 B2, US Patent No. 5,656,612, US Patent Publication No. 2012 /0190728 and in Dias and Stein, Mol. Cancer Ther. 2002, 347-355, incorporated herein by reference in its entirety.

The one or more ASO nucleotide bases may be any naturally occurring, unmodified nucleotide bases such as adenine, guanine, cytosine, thymine, and uracil, or any synthetic or modified nucleotide bases that are sufficiently similar to the unmodified nucleotide bases that they are capable of hydrogen bonding with nucleotide bases present on the target pre-mRNA. Examples of modified nucleotide bases include, but are not limited to, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5-hydroxymethoylcytosine. The ASOs described herein also contain a backbone structure that connects the components of the oligomer. The terms backbone structure and oligomeric linkages can be used interchangeably and refer to the connection between ASO monomers. In natural oligonucleotides, the backbone contains a 3'-5' phosphodiester bond connecting the sugar moieties of the oligomer. The backbone structure or oligomeric linkages of the ASOs described herein may include, but are not limited to, phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphodiselenoate, phosphoroanilotioate, phosphoranyl ladate, phosphoramidate, and the like. See, for example, LaPlanche, et al., Nucleic Acids Res. 14:9081 (1986); Stec, et al., J. Am. Chem. Soc. 106:6077 (1984), Stein, et al., Nucleic Acids Res. 16:3209 (1988), Zon, et al., Anti-Cancer Drug Design 6:539 (1991); Zon, et al., Oligonucleotides and Analogues: A Practical Approach, pp. 87-108 (F. Eckstein, Ed., Oxford Uni

- 31 045521 versity Press, Oxford England (1991)); Stec, et al., US Patent No. 5151510; Uhlmann and Peyman, Chemical Reviews 90:543 (1990). In some embodiments, the ASO backbone structure does not contain phosphorus, but rather contains peptide bonds, for example, in peptide nucleic acid (PNA) or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups. In some embodiments, the backbone modification is a phosphorothioate bond. In some embodiments, the backbone modification is a phosphoramidate linkage.

In embodiments, the stereochemistry of each of the phosphorus internucleotide bonds of the ASO backbone is random. In embodiments, the stereochemistry at each of the phosphorus internucleotide bonds of the ASO backbone is controlled and is not random. For example, U.S. Patent Application Publication No. 2014/0194610, Methods for Synthesizing Functionalized Nucleic Acids, incorporated herein by reference, describes methods for independently selecting the chirality of each phosphorus atom in a nucleic acid oligomer. In embodiments, the ASO used in the methods of the present invention, including, without limitation, any of the ASOs presented herein in Tables 5 and 6, includes an ASO containing phosphorus internucleotide linkages that are non-random. In embodiments, the composition used in the methods of the present invention contains pure diastereomeric ASO. In embodiments, the composition used in the methods of the present invention includes an ASO that has a diastereomeric purity of at least about 90%, at least about 91%, at least about 92%, at least about 93% , at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, about 100%, from about 90 % to about 100%, from about 91% to about 100%, from about 92% to about 100%, from about 93% to about 100%, from about 94% to about 100%, from about 95% to about 100% , from about 96% to about 100%, from about 97% to about 100%, from about 98% to about 100%, or from about 99% to about 100%.

In embodiments, the ASO has a non-random mixture of Rp and Sp configurations in its phosphorus internucleotide linkages. For example, it has been suggested that antisense oligonucleotides require a mixture of Rp and Sp to achieve a balance between good activity and nuclease stability (Wan, et al., 2014, Synthesis, biophysical properties and biological activity of second generation antisense oligonucleotides containing chiral phosphorothioate linkages, Nucleic Acids Research 42(22): 13456-13468, incorporated herein by reference). In embodiments, the ASO used in the methods of the present invention, including, without limitation, any of the ASOs set forth herein in SEQ ID NO: 21-114, contains about 5-100% Rp, at least about 5% Rp , at least about 10% Rp, at least about 15% Rp, at least about 20% Rp, at least about 25% Rp, at least about 30% Rp, at least about 35% Rp, according to at least about 40% Rp, at least about 45% Rp, at least about 50% Rp, at least about 55% Rp, at least about 60% Rp, at least about 65% Rp, at least about 70% Rp, at least about 75% Rp, at least about 80% Rp, at least about 85% Rp, at least about 90% Rp, or at least about 95% Rp, with the remainder Sp, or approximately 100% Rp. In embodiments, the ASO used in the methods of the present invention, including, without limitation, any of the ASOs set forth herein in SEQ ID NO: 21-114, contains from about 10% to about 100% Rp, from about 15% to about 100% Rp, from about 20% to about 100% Rp, from about 25% to about 100% Rp, from about 30% to about 100% Rp, from about 35% to about 100% Rp, from about 40% to about 100% Rp, from about 45% to about 100% Rp, from about 50% to about 100% Rp, from about 55% to about 100% Rp, from about 60% to about 100% Rp, from about 65% to about 100% Rp, from about 70% to about 100% Rp, from about 75% to about 100% Rp, from about 80% to about 100% Rp, from about 85% to about 100% Rp, from about 90% to about 100% Rp or from about 95% to about 100% Rp, from about 20% to about 80% Rp, from about 25% to about 75% Rp, from about 30% to about 70% Rp, from about 40% to about 60% Rp, or about 45% to about 55% Rp, with the remainder Sp.

In embodiments, the ASO used in the methods of the present invention is

- 32 045521 including, without limitation, any of the ASOs set forth herein in SEQ ID NO: 21-114, contains about 5-100% Sp, at least about 5% Sp, at least about 10% Sp , at least about 15% Sp, at least about 20% Sp, at least about 25% Sp, at least about 30% Sp, at least about 35% Sp, at least about 40% Sp, according to at least about 45% Sp, at least about 50% Sp, at least about 55% Sp, at least about 60% Sp, at least about 65% Sp, at least about 70% Sp, at least about 75% Sp, at least about 80% Sp, at least about 85% Sp, at least about 90% Sp, or at least about 95% Sp, with the remainder Rp, or about 100% Sp. In embodiments, the ASO used in the methods of the present invention, including, without limitation, any of the ASOs set forth herein in SEQ ID NO: 21-114, contains from about 10% to about 100% Sp, from about 15% to about 100% Sp, from about 20% to about 100% Sp, from about 25% to about 100% Sp, from about 30% to about 100% Sp, from about 35% to about 100% Sp, from about 40% to about 100% Sp, from about 45% to about 100% Sp, from about 50% to about 100% Sp, from about 55% to about 100% Sp, from about 60% to about 100% Sp, from about 65% to about 100% Sp, from about 70% to about 100% Sp, from about 75% to about 100% Sp, from about 80% to about 100% Sp, from about 85% to about 100% Sp, from about 90% to about 100% Sp or from about 95% to about 100% Sp, from about 20% to about 80% Sp, from about 25% to about 75% Sp, from about 30% to about 70% Sp, from about 40% to about 60% Sp, or about 45% to about 55% Sp, with the remainder Rp.

Any of the ASOs described herein may contain a sugar moiety that contains ribose or deoxyribose found in natural nucleotides, or a modified sugar moiety or sugar analog including a morpholine ring. Non-limiting examples of modified sugar moieties include 2' substitutions such as 2'-O-methyl (2'-O-Me), 2'O-methoxyethyl (2'MOE), 2'-O-aminoethyl, 2'F ; N3'->P5' phosphoramidate, 2'dimethylaminooxyethoxy, 2'dimethylaminoethoxy, 2'-guanidine, 2'-O-guanidinethyl, carbamate modified sugars and bicyclic modified sugars. In some embodiments, the sugar moiety modification is selected from 2'-O-Me, 2'F, and 2'MOE. In some embodiments, the modification to the sugar moiety is an additional bridging linkage, such as in a blocked nucleic acid (LNA). In some embodiments, the sugar analog contains a morpholine ring, such as morpholino phosphorodiamidate (PMO). In some embodiments, the sugar moiety comprises a ribofuranosyl or 2'deoxyribofuranosyl modification. In some embodiments, the sugar moiety contains a 2'4' conformationally hindered 2'-O-methyloxyethyl (cMOE) modification. In some embodiments, the sugar moiety contains a cEt 2',4' conformationally hindered 2'O ethyl BNA modification. In some embodiments, the sugar moiety comprises tricycloDNA (tcDNA) modifications. In some embodiments, the sugar moiety contains ethylene nucleic acid (ENA) modifications. In some embodiments, the sugar moiety contains MCE modifications. Modifications are known in the art and are described in the literature, for example, in Jarver, et al., 2014, A Chemical View of Oligonucleotides for Exon Skipping and Related Drug Applications, Nucleic Acid Therapeutics 24(1): 37-47, included herein goals by reference.

In some embodiments, each ASO monomer is modified in such a NIE manner, for example, each ASO backbone linkage contains a phosphorothioate linkage or each ribose sugar moiety contains a 2'-O-methyl modification. Such modifications, which are present on each of the monomeric components of ASO, are called homogeneous modifications. In some examples, a combination of different modifications may be desirable, for example, an ASO may contain a combination of phosphorodiamide linkages and sugar moieties containing morpholine rings (morpholinos). Combinations of different ASO modifications are called mixed modifications or mixed chemical compounds. In some embodiments, the ASO comprises one or more backbone modifications. In some embodiments, the ASO contains one or more sugar moiety modifications. In some embodiments, the ASO contains one or more backbone modifications and one or more sugar moiety modifications. In some embodiments, the ASO contains a 2'MOE modification and a phosphorothioate backbone. In some embodiments, the ASO comprises morpholino phosphorodiamidate (PMO). In some embodiments, the ASO comprises a peptide nucleic acid (PNA). Any of the ASOs or any component of an ASO (for example, a nucleotide backbone

- 33 045521 nie, sugar fragment, backbone) described herein can be modified to achieve the desired properties or activity of the ASO or reduce the undesirable properties or activity of the ASO. For example, an ASO or one or more components of any ASO may be modified to enhance binding affinity to a target sequence on a pre-mRNA transcript; reducing binding to any non-target sequence; reducing degradation by cellular nucleases (i.e. RNase H); improving the uptake of ASO into the cell and/or into the cell nucleus; altering the pharmacokinetics or pharmacodynamics of an ASO and/or modulating the half-life of an ASO.

In some embodiments, ASOs are composed of 2'-O-(2-methoxyethyl) (MOE) phosphorothioate-modified nucleotides. ASOs consisting of such nucleotides are particularly well suited for the methods described herein; Oligomers having such modifications have been shown to have significantly increased resistance to nuclease degradation and increased bioavailability, making them suitable, for example, for oral delivery according to some embodiments described herein. See, for example, Geary, et al., J Pharmacol Exp Ther. 2001; 296(3):890-7; Geary, et al., J Pharmacol Exp Ther. 2001; 296(3):898-904.

Methods for synthesizing ASO will be known to one skilled in the art. Alternatively or in addition, ASOs may be obtained from a commercial source.

Unless otherwise indicated, the left end of a single-stranded nucleic acid sequence (eg, pre-mRNA transcript, oligonucleotide, ASO, etc.) is the 5' end and the left direction of the sequence of single- or double-stranded nucleic acid sequences is called the 5' direction. Likewise, the right end or direction of a nucleic acid sequence (single-stranded or double-stranded) is the 3' end or direction. Generally, the region or sequence that is 5' to the checkpoint in the nucleic acid is called upstream, and the region or sequence that is 3' to the checkpoint in the nucleic acid is called downstream. Typically, the 5' end or end of the mRNA is where the initiation or start codon is located, while the 3' end or end is where the terminal codon is located. In some aspects, nucleotides that are upstream of a breakpoint in a nucleic acid may be designated by a negative number, while nucleotides that are downstream of a breakpoint may be designated by a positive number. For example, a breakpoint (e.g., an exon exon junction in an mRNA) may be designated as a null site, and a nucleotide that is immediately adjacent and upstream of the breakpoint is designated as minus one, such as -1, while the nucleotide , which is immediately adjacent and downstream of the breakpoint, is designated as plus one, for example, +1.

In some embodiments, the ASOs are complementary to (and bind to) a target portion of the NIE-containing SCN1A pre-mRNA that is downstream (in the 3' direction) of the 5' splice site (or 3' end of the NIE) of the included exon in the NIE-containing SCN1A pre-mRNA (eg, the direction indicated by positive numbers relative to the 5' splice site). In some embodiments, the ASOs are complementary to a target portion of the NIE-containing SCN1A premRNA that lies within a region of about +1 to about +500 relative to the 5' splice site (or 3' end) of the included exon. In some embodiments, the ASOs may be complementary to a target portion of the NIE-containing SCN1A pre-mRNA that lies within the region between nucleotides +6 and +496 relative to the 5' splice site (or 3' end) of the included exon. In some aspects, ASOs are complementary to a target portion that is within the region of about +1 to about +500, from about +1 to about +490, from about +1 to about +480, from about +1 to about +470, from about +1 to about +460, about +1 to about +450, about +1 to about +440, about +1 to about +430, about +1 to about +420, about +1 to about +410, from about +1 to about +400, from about +1 to about +390, from about +1 to about +380, from about +1 to about +370, from about +1 to about +360, from about +1 to about +350, about +1 to about +340, about +1 to about +330, about +1 to about +320, about +1 to about +310, about +1 to about + 300, from about +1 to about +290, from about +1 to about +280, from about +1 to about +270, from about +1 to about +260, from about +1 to about +250, from about + 1 to about +240, about +1 to about +230, about +1 to about +220, about +1 to about +210, about +1 to about +200, about +1 to about +190 , from about +1 to about +180, from about +1 to about +170, from about +1 to about +160, from about +1 to about +150, from about +1 to about +140, from about +1 to approximately +130, from approx.

- 34 045521 positive +1 to about +120, from about +1 to about +110, from about +1 to about +100, from about +1 to about +90, from about +1 to about +80, from about + 1 to about +70, about +1 to about +60, about +1 to about +50, about +1 to about +40, about +1 to about +30, or about +1 to about +20 relative to the 5' splice site (or 3' end) of the included exon. In some aspects, the ASOs are complementary to a target portion that is within the region of about +1 to about +100, about +100 to about +200, about +200 to about +300, about +300 to about +400, or approximately +400 to approximately +500 relative to the 5' splice site (or 3' end) of the included exon.

In some embodiments, the ASOs are complementary to (and bind to) a target portion of the NIE-containing SCN1A pre-mRNA that is located upstream of the 5' splice site (or 3' end) of the included exon in the NIE-containing pre-mRNA. SCN1A mRNA (eg, the direction indicated by negative numbers relative to the 5' splice site). In some embodiments, the ASOs are complementary to a target portion of the NIE-containing SCN1A pre-mRNA that lies within a region of about -4 to about -270 relative to the 5' splice site (or 3' end) of the included exon. In some embodiments, the ASOs may be complementary to a target portion of the NIE-containing SCN1A pre-mRNA that lies within the region between nucleotides -1 and -264 relative to the 5' splice site (or 3' end) of the included exon. In some aspects, the ASOs are complementary to a target portion that is within the region of about -1 to about -270, about -1 to about -260, about -1 to about -250, about -1 to about -240, from about -1 to about -230, about -1 to about 220, about -1 to about -210, about -1 to about -200, about -1 to about -190, about -1 to about - 180, from about -1 to about -170, from about -1 to about -160, from about -1 to about -150, from about -1 to about -140, from about -1 to about -130, from about - 1 to about -120, about -1 to about 110, about -1 to about -100, about -1 to about -90, about -1 to about -80, about -1 to about -70, from about 1 to about -60, from about -1 to about -50, from about -1 to about -40, from about -1 to about -30, or from about -1 to about -20 relative to the 5' splice site ( or 3' end) of the included exon. In some aspects, ASOs are complementary to a target portion that is within the range of about -1 to about -50, about -50 to about -100, about -100 to about -150, about -150 to about -200, or approximately -200 to approximately -250 relative to the 5' splice site (or 3' end) of the included exon.

In some embodiments, the ASOs are complementary to a target portion of the NIE-containing SCN1A pre-mRNA that is upstream of the 3' splice site (or 5' end) of the included exon in the NIE-containing SCN1A pre-mRNA ( for example, in the direction indicated by negative numbers). In some embodiments, the ASOs are complementary to a target portion of the NIE-containing SCN1A pre-mRNA that lies within a region of about -1 to about -500 relative to the 3' splice site (or 5' end) of the included exon. In some embodiments, the ASOs are complementary to a target portion of the NIE-containing SCN1A pre-mRNA that lies within the region -1 to -496 relative to the 3' splice site of the included exon. In some aspects, the ASOs are complementary to a target portion that is within the range of about -1 to about -500, about -1 to about -490, about -1 to about -480, about -1 to about -470, from about -1 to about -460, about -1 to about -450, about -1 to about -440, about -1 to about 430, about -1 to about -420, about -1 to about - 410, from about -1 to about -400, from about -1 to about -390, from about -1 to about -380, from about -1 to about -370, from about -1 to about -360, from about - 1 to about -350, about -1 to about -340, about -1 to about -330, about -1 to about 320, about -1 to about -310, about -1 to about -300, from about -1 to about -290, from about -1 to about -280, from about -1 to about -270, from about -1 to about -260, from about -1 to about -250, from about -1 to about -240, about -1 to about -230, about -1 to about -220, about -1 to about 210, about -1 to about -200, about -1 to about -190, about -1 to about -180, from about -1 to about -170, from approx.

- 35 045521 specifically -1 to about -160, from about -1 to about -150, from about -1 to about -140, from about -1 to about -130, from about -1 to about -120, from about - 1 to about -110, about -1 to about 100, about -1 to about -90, about -1 to about -80, about -1 to about -70, about -1 to about -60, from about 1 to about -50, from about -1 to about -40, or from about -1 to about -30 relative to the 3' splice site of the included exon. In some aspects, the ASOs are complementary to a target portion that is within the range of about -1 to about -100, about -100 to about -200, about -200 to about -300, about -300 to about -400, or approximately -400 to approximately -500 relative to the 3' splice site of the included exon.

In some embodiments, the ASOs are complementary to a target region of the NIE-containing SCN1A pre-mRNA that is downstream (in the 3' direction) of the 3' splice site (5' end) of the included exon in the NIE-containing SCN1A pre-mRNA (eg , in the direction indicated by positive numbers). In some embodiments, the ASOs are complementary to a target region containing the NIE of the SCN1A pre-mRNA that is in the region from about +1 to about +100 relative to the 3' splice site of the included exon. In some aspects, ASOs are complementary to a target portion that is in the region of about +1 to about +90, about +1 to about +80, about +1 to about +70, about +1 to about +60, from about +1 to about +50, about +1 to about +40, about +1 to about +30, about +1 to about +20, or about +1 to about +10 relative to the 3' splice site of the included exon .

In some embodiments, the target portion of the NIE-containing SCN1A pre-mRNA is in the region from +100 relative to the 5' splice site (3' end) of the included exon to -100 relative to the 3' splice site. (5' end) of the included exon. In some embodiments, the target portion of the NIE-containing SCN1A pre-mRNA is within the NIE. In some embodiments, the target portion of the NIE-containing SCN1A pre-mRNA comprises a pseudoexon-intron boundary.

ASOs can be of any length suitable for specific binding and efficient splicing enhancement. In some embodiments, ASOs consist of 8 to 50 nucleotide bases. For example, ASO could be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 , 31, 32, 33, 34, 35, 40, 45 or 50 nucleotide bases in length. In some embodiments, ASOs consist of more than 50 nucleotide bases. In some embodiments, the ASO is 8 to 50 nucleotide bases, 8 to 40 nucleotide bases, 8 to 35 nucleotide bases, 8 to 30 nucleotide bases, 8 to 25 nucleotide bases, 8 to 20 nucleotide bases, 8 up to 15 nucleotide bases, from 9 to 50 nucleotide bases, from 9 to 40 nucleotide bases, from 9 to 35 nucleotide bases, from 9 to 30 nucleotide bases, from 9 to 25 nucleotide bases, from 9 to 20 nucleotide bases, from 9 to 15 nucleotide bases, 10 to 50 nucleotide bases, 10 to 40 nucleotide bases, 10 to 35 nucleotide bases, 10 to 30 nucleotide bases, 10 to 25 nucleotide bases, 10 to 20 nucleotide bases, 10 to 15 nucleotide bases, from 11 to 50 nucleotide bases, from 11 to 40 nucleotide bases, from 11 to 35 nucleotide bases, from 11 to 30 nucleotide bases, from 11 to 25 nucleotide bases, from 11 to 20 nucleotide bases, from 11 to 15 nucleotide bases bases, 12 to 50 nucleotide bases, 12 to 40 nucleotide bases, 12 to 35 nucleotide bases, 12 to 30 nucleotide bases, 12 to 25 nucleotide bases, 12 to 20 nucleotide bases, 12 to 15 nucleotide bases , from 13 to 50 nucleotide bases, from 13 to 40 nucleotide bases, from 13 to 35 nucleotide bases, from 13 to 30 nucleotide bases, from 13 to 25 nucleotide bases, from 13 to 20 nucleotide bases, from 14 to 50 nucleotide bases, from 14 to 40 nucleotide bases, from 14 to 35 nucleotide bases, from 14 to 30 nucleotide bases, from 14 to 25 nucleotide bases, from 14 to 20 nucleotide bases, from 15 to 50 nucleotide bases, from 15 to 40 nucleotide bases, from 15 to 35 nucleotide bases, 15 to 30 nucleotide bases, 15 to 25 nucleotide bases, 15 to 20 nucleotide bases, 20 to 50 nucleotide bases, 20 to 40 nucleotide bases, 20 to 35 nucleotide bases, 20 up to 30 nucleotide bases, 20 to 25 nucleotide bases, 25 to 50 nucleotide bases, 25 to 40 nucleotide bases, 25 to 35 nucleotide bases, or 25 to 30 nucleotide bases in length. In some embodiments, ASOs are 18 nucleotides in length. In some embodiments, ASOs are 15 nucleotides in length. In some embodiments, ASOs are 25 nucleotides in length.

In some embodiments, two or more ASOs with different chemical species but complementary to the same NIE target moiety containing the NIE pre are used.

- 36 045521 mRNA. In some embodiments, two or more ASOs are used that are complementary to different target portions of the NIE-containing pre-mRNA.

In embodiments, the antisense oligonucleotides of the present invention are chemically linked to one or more moieties or conjugates, for example, a targeting moiety or other conjugate that enhances the activity or cellular uptake of the oligonucleotide. Such moieties include, but are not limited to, a lipid moiety, such as a cholesterol moiety, a cholesteryl moiety, an aliphatic chain, such as dodecanediol or undecyl moieties, a polyamine or polyethylene glycol chain, or adamantane acetic acid. Oligonucleotides containing lipophilic moieties and methods of preparation are described in the published literature. In embodiments, the antisense oligonucleotide is conjugated to a moiety including, but not limited to, a base-deleted nucleotide, a polyether, a polyamine, a polyamide, peptides, a carbohydrate, e.g., N-acetylgalactosamine (GalNAc), N-Ac-glucosamine (GluNAc) or mannose (eg, mannose-6-phosphate), lipid or polycarbonate compound. Conjugates can be linked to one or more of any nucleotides containing an antisense oligonucleotide at any of several positions on a sugar, base, or phosphate group as understood in the art and described in the literature, for example, using a linker. Linkers may include a divalent or trivalent branched linker. In embodiments, the conjugate is attached to the 3' end of an antisense oligonucleotide. Methods for preparing oligonucleotide conjugates are described, for example, in US Pat. No. 8,450,467, Carbohydrate Conjugates as Oligonucleotide Delivery Vehicles, which is incorporated herein by reference. In some embodiments, the nucleic acid to be targeted to the ASO is an NIE-containing SCN1A pre-mRNA expressed in a cell, such as a eukaryotic cell. In some embodiments, the term cell may refer to a population of cells. In some embodiments, the cell is in the subject. In some embodiments, the cell is isolated from a subject. In some embodiments, the cell is ex vivo. In some embodiments, the cell is a condition or disease-relevant cell or cell line. In some embodiments, the cell is in vitro (eg, in a cell culture).

Pharmaceutical compositions.

Pharmaceutical compositions or compositions containing an agent, such as an antisense oligonucleotide, of the compositions described and for use in any of the methods described can be prepared in accordance with conventional techniques well known in the pharmaceutical industry and described in the published literature. In embodiments, a pharmaceutical composition or composition for treating a subject comprises an effective amount of any antisense oligomer as described herein, or a pharmaceutically acceptable salt, solvate, hydrate, or ester thereof. The pharmaceutical composition containing the antisense oligomer may further contain a pharmaceutically acceptable excipient, diluent or carrier.

Pharmaceutically acceptable salts are suitable for use in contact with tissues of humans and lower animals without undue toxicity, irritation, allergic reaction, etc. and commensurate with a reasonable benefit/risk ratio (see, for example, S. M. Berge, et al., J. Pharmaceutical Sciences, 66: 1-19 (1977), incorporated herein by reference for this purpose). The salts can be prepared in situ during the final isolation and purification of the compounds or separately by reacting the free base function with a suitable organic acid. Examples of pharmaceutically acceptable non-toxic acid addition salts are amino salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid. acid, citric acid, succinic acid or malonic acid, or using other documented techniques such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentane propionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate , heptaniat, hexanoate, hydroeodidide, 2-hydroxyeathanate, lactobionate, lactate, laureate, laryl sulfate, malate, maleat, Malonat, Metansonat, 2Naftinutalinate, Nicotinat, Nitrate, Oleat, Oksalat, Palmitat, Pamoat, Pectinat, Pectinat, Pectinat, Pectinate, Pectinate, Pectinate, Pectinate, Pectinat phenylpropionate, phosphate, Pikrat , pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, ptoluenesulfonate, undecanoate, valence salts, etc. Typical alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium and the like. Other pharmaceutically acceptable salts include, when appropriate, non-toxic ammonium, quaternary ammonium and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate and arylsulfonate.

- 37 045521

In embodiments, the compositions are formulated in any of many possible dosage forms, such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. In embodiments, the compositions are formulated as suspensions in an aqueous, non-aqueous, or mixed medium. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers. In embodiments, the pharmaceutical formulation or composition of the present invention includes, but is not limited to, a solution, emulsion, microemulsion, foam, or liposome-containing formulation (eg, cationic or non-cationic liposomes).

The pharmaceutical composition or formulation described herein may contain one or more penetration enhancers, carriers, excipients, or other active or inactive ingredients, as appropriate and well known to those skilled in the art or described in the published literature. In embodiments, liposomes also include sterically stabilized liposomes, for example, liposomes containing one or more specialized lipids. These specialized lipids result in liposomes with extended circulation times. In embodiments, the sterically stabilized liposome contains one or more glycolipids or is derived from one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. In embodiments, the surfactant is included in the pharmaceutical composition or compositions. The use of surfactants in drug products, formulations and emulsions is well known in the art. In embodiments, the present invention uses a penetration enhancer to effect effective delivery of an antisense oligonucleotide, for example, to promote diffusion across cell membranes and/or enhance the permeability of a lipophilic drug. In embodiments, the penetration enhancers are a surfactant, a fatty acid, a bile salt, a chelating agent, or a non-chelating non-surfactant.

In embodiments, the pharmaceutical composition contains a plurality of antisense oligonucleotides. In embodiments, the antisense oligonucleotide is administered in combination with another drug or therapeutic agent.

Combination therapy.

In some embodiments, ASOs disclosed herein may be used in combination with one or more additional therapeutic agents. In some embodiments, one or more additional therapeutic agents may comprise a small molecule. For example, one or more additional therapeutic agents may comprise a small molecule described in WO2016128343A1, WO2017053982A1, WO2016196386A1, WO201428459A1, W0201524876A2, W02013119916A2 and W02014209841A2. which are incorporated by reference herein in their entirety. In some embodiments, the one or more additional therapeutic agents comprise an ASO that can be used to correct intron retention. In some embodiments, one or more other agents are selected from the ASOs listed in Table. 1a or 1b.

Table 1a

Illustrative ASOs for adjusting intron retention

SEQ ID NO: Name Sequence (5’-3’) Retained intron 115 SCN1A-IVS21+6 CAGAGAAAAUAGUGUUCA 21 116 SCN1A-IVS21+11 AUAUUCAGAGAAAAUAGU 21 117 SCN1A-IVS21+16 UAAAAAUAUUCAGAGAAA 21 118 SCN1A-IVS21+21 AACAAUAAAAAUAUUCAG 21 119 SCN1A-IVS21+26 UUCCAAAACAAUAAAAAAUA 21 120 SCN1A-IVS21+31 UAUUAUUCCAAACAAUAA 21 121 SCN1A-IVS21+36 UUUGUUAUUAUUCCAAAC 21 122 SCN1A-IVS21+41 AUUAUUUUGUUAUUAUUC 21 123 SCN1A-IVS21+46 AUGUCAUUAUUUUGUUAU 21 124 SCN1A-IVS21+51 GAUGUAUGUCAAUUAUUUU 21 125 SCN1A-IVS21+56 UAAUAGAUGUAUGUCAUU 21 126 SCN1A-IVS21+61 CUAAAUAAUAGAUGUAUG 21 127 SCN1A-IVS21+66 AGGAACUAAAUAAUAGAU 21 128 SCN1A-IVS21+71 UUCUUAGGAACUAAAUAA 21 129 SCN1A-IVS21+76 ACUUUUUCUUAGGAACUA 21

- 38 045521

130 SCN1A-IVS21+81 UAUAUACUUUUUCUUAGG 21 131 SCN1A-IVS21-16 UGCAUGUUUUACUUUGGA 21 132 SCN1A-IVS21-21 GUUUUACUUUGGAGUAAA 21 133 SCN1A-IVS21-26 ACUUUGGAGUAAAAAUAA 21 134 SCN1A-IVS21-31 GGAGUAAAAAAUAAUUUAG 21 135 SCN1A-IVS21-36 AAAAAUAAUUUAGACCUG 21 136 SCN1A-IVS21-41 UAAUUUAGACCUGAUGUU 21 137 SCN1A-IVS21-46 UAGACCUGAUGUUUAAUA 21 138 SCN1A-IVS21-51 CUGAUGUUUAAUAAAAUAU 21 139 SCN1A-IVS21-56 GUUUAAUAAAUAUUCUUA 21 140 SCN1A-IVS21-61 AUAAAUAUUCUUACUGAU 21 141 SCN1A-IVS21-66 UAUUCUUACUGAUAUAAU 21 142 SCN1A-IVS21-71 UUACUGAUAUAAUUUUCA 21 143 SCN1A-IVS21-76 GAUUAAUUUUCAAAAGG 21 144 SCN1A-IVS21-81 AAUUUUCAAAAGGGAAUA 21 145 SCN1A-IVS21-27 CUUUGGAGUAAAAUAAUAU 21 146 SCN1A-IVS21-28 UUUGGAGUAAAAAAUAAUU 21 148 SCN1A-IVS21-29 UUGGAGUAAAAAAUAAUUU 21 149 SCN1A-IVS21-30 UGGAGUAAAAUAAUUUA 21 150 SCN1A-IVS21-32 GAGUAAAAAAAUAUUUAGA 21 151 SCN1A-IVS21-33 AGUAAAAAAUAAUUUAGAC 21 152 SCN1A-IVS21-34 GUAAAAUAAUAUUUAGACC 21 153 SCN1A-IVS21-35 UAAAAAUAAUUUAGACCU 21 154 SCN1A-IVS21-72 UACUGAUAUAAUUUUCAA 21 155 SCN1A-IVS21-73 ACUGAUAUAAUUUUCAAA 21 156 SCN1A-IVS21-74 CUGAUAUAAUUUUCAAAA 21 157 SCN1A-IVS21-75 UGAUAUAAUUUUCAAAAG 21 158 SCN1A-IVS21-77 AUAUAAUUUUCAAAAGGG 21 159 SCN1A-IVS21-78 UAUAAUUUUCAAAAGGGA 21 160 SCN1A-IVS21-79 AUAAUUUUCAAAAGGGAA 21 161 SCN1A-IVS21-80 UAAUUUUCAAAAGGGAAU 21 162 CAAGGAUUAAAAGGUAGCA 21

Table 1b

Illustrative ASOs for adjusting intron retention

SEQ ID NO: Name Sequence (5’-3’) Retained intron 163 SCN1A-IVS21+6 CAGAGAAAATAGTGTTCA 21 164 SCN1A-IVS21+11 ATATTCAGAGAAAATAGT 21 165 SCN1A-IVS21+16 TAAAAATATTCAGAGAAA 21 166 SCN1A-IVS21+21 AACAATAAAAATTTCAG 21 167 SCN1A-IVS21+26 TTSSAAAAAAATAAAAATA 21 168 SCN1A-IVS21+31 TATTTTTSSAAASAATAA 21 169 SCN1A-IVS21+36 TTTGTTATTATTCCAAAC 21 170 SCN1A-IVS21+41 ATTATTTTTGTTATTATTTC 21 171 SCN1A-IVS21+46 ATGTCATTATTTTTGTTAT 21 172 SCN1A-IVS21+51 GATGTATGTCATTATTTT 21 173 SCN1A-IVS21+56 TAATAGATGTATGTCATT 21 174 SCN1A-IVS21+61 CTAAAAATAGATGTATG 21

- 39 045521

175 SCN1A-IVS21+66 AGGAACTAAATAATAGAT 21 176 SCN1A-IVS21+71 TTCTTAGGAACTAAATAA 21 177 SCN1A-IVS21+76 ACTTTTTCTTAGGAACTA 21 178 SCN1A-IVS21+81 TATATACTTTTTCTTAGG 21 179 SCN1A-IVS21-16 TGCATGTTTTACTTTGGA 21 180 SCN1A-IVS21-21 GTTTTACTTTGGAGTAAA 21 181 SCN1A-IVS21-26 ACTTTGGAGTAAAAATAA 21 182 SCN1A-IVS21-31 GGAGTAAAAATAATTTAG 21 183 SCN1A-IVS21-36 AAAAATAATTTAGACCTG 21 184 SCN1A-IVS21-41 TAATTTAGACCTGATGTT 21 185 SCN1A-IVS21-46 TAGACCTGATGTTTAATA 21 186 SCN1A-IVS21-51 CTGATGTTTAATAAATAT 21 187 SCN1A-IVS21-56 GTTTAATAAAATATTCTTA 21 188 SCN1A-IVS21-61 ATAAATATTTCTTACTGAT 21 189 SCN1A-IVS21-66 TATTCTTACTGATATAAT 21 190 SCN1A-IVS21-71 TTACTGATATAATTTTCA 21 191 SCN1A-IVS21-76 GATATAATTTTCAAAAGG 21 192 SCN1A-IVS21-81 AATTTTCAAAAGGGAATA 21 193 SCN1A-IVS21-27 CTTTGGAGTAAAAATAAT 21 194 SCN1A-IVS21-28 TTTGGAGTAAAAATAATT 21 195 SCN1A-IVS21-29 TTGGAGTAAAAATAATTT 21 196 SCN1A-IVS21-30 TGGAGTAAAAATAATTTA 21 197 SCN1A-IVS21-32 GAGTAAAAATAATTTAGA 21 198 SCN1A-IVS21-33 AGTAAAAATAATTTAGAC 21 199 SCN1A-IVS21-34 GTAAAAATAATTTAGACC 21 200 SCN1A-IVS21-35 TAAAAATAATTTAGACCT 21 201 SCN1A-IVS21-72 TACTGATATAATTTTCAA 21 202 SCN1A-IVS21-73 ACTGATATAATTTTCAAA 21 203 SCN1A-IVS21-74 CTGATATAATTTTCAAAA 21 204 SCN1A-IVS21-75 TGATATAATTTTCAAAAG 21 205 SCN1A-IVS21-77 ATATAATTTTCAAAAGGG 21 206 SCN1A-IVS21-78 TATAATTTTCAAAAGGGA 21 207 SCN1A-IVS21-79 ATAATTTTCAAAAGGGAA 21 208 SCN1A-IVS21-80 TAATTTTCAAAAGGGAAT 21 209 CAAGGATTAAAGGTAGCA 21

Treatment of subjects.

Any of the compositions presented herein can be administered to an individual. Individual can be used interchangeably with subject or patient. The individual may be a mammal, such as a human, or an animal such as a non-human primate, rodent, rabbit, rat, mouse, horse, donkey, goat, cat, dog, cow, pig or sheep. In embodiments, the individual is a human. In embodiments, the individual is a fetus, embryo, or child. In other embodiments, the individual may be another eukaryotic organism, such as a plant. In some embodiments, the compositions provided herein are administered ex vivo to a cell.

In some embodiments, compositions provided herein are administered to an individual as a method of treating a disease or disorder. In some embodiments, the individual has a genetic disease, such as any of the diseases described herein. In some embodiments, the individual is at risk of a disease, such as any of the diseases described herein. In some embodiments, the individual is at increased risk of a disease or disorder caused by insufficient protein or insufficient protein activity. If a person is at increased risk of a disease or disorder caused by insufficient protein or insufficient protein activity, the method provides preventive or prophylactic treatment. For example, an individual may be at increased risk for such a disease or disorder due to a family history of the disease. In general, people at increased risk for such a disease or disorder will benefit from preventive treatment (eg, by preventing or delaying the onset or progression of the disease or disorder). In embodiments, the fetus is treated in utero, for example, by administering the ASO composition to the fetus directly or indirectly (eg, through the mother).

Suitable routes of administration of the ASOs of the present invention may vary depending on the type of cells into which delivery of the ASOs is desired. Multiple tissues and organs are affected due to Dravet syndrome (DS); epilepsy, generalized, with febrile seizures plus, type 2; febrile seizures, familial, 3A; migraine, hereditary hemiplegia, autism; epileptic encephalopathy, early infancy, 13; sick sinus syndrome 1; Alzheimer's disease or SUDEP, with the brain being the most significantly affected tissue. The ASO of the present invention can be administered to patients parenterally, for example, by intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection

- 40 045521 injection, subcutaneous injection, intravitreal injection or intravenous injection.

In some embodiments, the disease or condition is induced by a mutation in Na _v 1.1 (the protein encoded by the SCN1A gene). In some cases, the mutation is a loss-of-function mutation in Na _v 1.1. In some cases, a loss-of-function mutation in Na _v 1.1 includes one or more mutations that reduce or impair the function of Na _v 1.1 (eg, by 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80%, 90%, 95% or more) relative to wild-type Na _v 1.1 function. In some cases, the loss-of-function mutation in Na _v 1.1 includes one or more mutations that lead to a disease phenotype. Exemplary loss-of-function mutations include, but are not limited to, R859C, T875M, V1353L, I1656M, R1657C, A1685V, M1841T, and R1916G.

In other cases, the mutation is a gain-of-function mutation in Na _v 1.1. In such cases, the gain-of-function mutation includes one or more mutations that prolong the activation of Na _v 1.1 (eg, by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 %, 95% or more) relative to the function of wild type Na _v 1.1. In such cases, the gain-of-function mutation in Nav1.1 involves one or more mutations that lead to the disease phenotype. Exemplary gain-of-function mutations include, but are not limited to, D188V, W1204R, R1648H, and D1866Y.

In some embodiments, the disease or condition is encephalopathy. In some cases, encephalopathy is caused by a loss-of-function mutation in Na _v 1.1.

In some embodiments, the encephalopathy is an epileptic encephalopathy. Illustrative epileptic encephalopathies include, but are not limited to, Dravet syndrome (DS) (also known as severe myoclonic epilepsy of infancy or SMEI); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic seizures; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); early childhood encephalopathy SCN1A; early childhood epileptic encephalopathy (EIEE) or sick sinus syndrome 1. In some embodiments, the disease or condition is an epileptic encephalopathy, optionally selected from Dravet syndrome (DS) (also known as severe myoclonic epilepsy of infancy or SMEI); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy generalized with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic seizures; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP) and sick sinus syndrome 1.

In some cases, GEFS+ is epilepsy, generalized with febrile seizures plus, type 2.

In some cases, febrile seizures are febrile seizures, familial, 3A.

Some cases of SMEB are SMEB without generalized spike-wave (SMEBSW), SMEB without myoclonic seizures (SMEB-M), SMEB without more than one feature of SMEI (SMEB-O), or persistent epilepsy of children with generalized tonic-clonic seizures (ICEGTC ).

In some embodiments, diseases or conditions caused by a loss-of-function mutation in Na _v 1.1 include, but are not limited to, Dravet syndrome (DS) (also known as SMEI); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic seizures; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); sick sinus syndrome 1; early childhood encephalopathy SCN1A; early childhood epileptic encephalopathy (EIEE); autism or malignant migratory partial seizures of infancy.

In some embodiments, the disease or condition is induced by a gain-of-function mutation in Na _v 1.1. Exemplary diseases or conditions associated with a gain-of-function mutation in Na _v 1.1 include, but are not limited to, migraine. In some cases, for

- 41 045521 the disease or condition caused by the gain-of-function mutation BNa _v 1.1 is migraine. In some cases, the migraine is familial hemiplegic migraine, 3. In some embodiments, the disease or condition is Na _v 1.1 genetic epilepsy. Na _v 1.1 genetic epilepsy may involve a loss-of-function mutation in Na _v 1.1 or a gain-of-function mutation in Na _v 1.1. In some cases, Na _v 1.1 genetic epilepsy includes one or more inherited mutations. In other cases, Na _v 1.1 genetic epilepsy involves one or more de novo mutations. Some cases of Na _v 1.1 genetic epilepsy include Dravet syndrome (DS) (also known as severe myoclonic epilepsy of infancy or SMEI); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic seizures; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; early childhood encephalopathy SCN1A; early childhood epileptic encephalopathy (EIEE); sudden unexpected death in epilepsy (SUDEP) or malignant migratory partial seizures of infancy. Some cases of Na _v 1.1 genetic epilepsy associated with a loss-of-function mutation in Na _v 1.1 include Dravet syndrome (DS) (also known as severe myoclonic epilepsy of infancy or SMEI); severe myoclonic epilepsy of infancy (SMEI)-borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic seizures; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; early childhood encephalopathy SCN1A; early childhood epileptic encephalopathy (EIEE); sudden unexpected death in epilepsy (SUDEP) or malignant migratory partial seizures of infancy. In some embodiments, the disease or condition is associated with haploinsufficiency of the SCN1A gene. Exemplary diseases or conditions associated with haploinsufficiency of the SCN1A gene include, but are not limited to, Dravet syndrome (DS) (also known as SMEI); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic seizures; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); sick sinus syndrome 1; early childhood encephalopathy SCN1A; early childhood epileptic encephalopathy (EIEE) or malignant migratory partial seizures of infancy. In some cases, the disease or condition is Dravet syndrome (DS) (also known as SMEI); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic seizures; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); sick sinus syndrome 1; early childhood encephalopathy SCN1A; early childhood epileptic encephalopathy (EIEE) or malignant migratory partial seizures of infancy.

In some cases, the disease or condition is Dravet syndrome (DS).

Dravet syndrome (DS), also known as severe myoclonic epilepsy of infancy (SMEI), is an epileptic encephalopathy that manifests in the first year of life. Dravet syndrome is an increasingly recognized epileptic encephalopathy in which the clinical diagnosis is supported by the finding of sodium channel gene mutations in approximately 70-80% of patients. Mutations in ion channel genes play a major role in the pathogenesis of a number of epilepsy syndromes, leading to some epilepsies being considered channelopathies. Voltage-gated sodium channels (VGSCs) play an important role in neuronal excitability; therefore, it is not surprising that many mutations associated with DS have been identified in the gene encoding the VGSC subunit. The disease is described, for example, by Mulley, et al., 2005, and the disease description in 0MIM #607208 (Online Mendelian Inheritance in Man, Johns Hopkins University, 1966-2015), both incorporated herein by reference.

- 42 045521

Between 70% and 80% of patients are characterized by abnormalities of the sodium channel α1 subunit gene (SCN1A), and truncating mutations account for approximately 40% and have a significant correlation with earlier age of seizure. Sequencing mutations are detected in approximately 70% of cases and include truncation mutations (40%) and missense mutations (40%) with the remainder being splice site alterations. Most mutations occur de novo, but familial mutations occur in 5-10% of cases and are typically missense mutations in nature. The remaining SCN1A mutations include splice site and missense mutations, most of which fall in the pore-forming region of the sodium channel. Currently, more than 500 mutations are associated with DS and are randomly distributed throughout the gene (Mulley, et al., Neurol. 2006, 67, 1094-1095).

The SCN1A gene is located in the sodium channel gene cluster on human chromosome 2q24 and encodes the alpha pore-forming subunits known as Nav1.1, a neuronal voltage-gated sodium channel. The SCN1A gene spans approximately 100 kb. genomic DNA and includes 26 exons. The SCN1A protein consists of four domains, each with six transmembrane segments. Two splice variants have been identified that result in a long and short isoform that differ in the presence or absence of 11 amino acids in the cytoplasmic loop between domains 1 and 2 in exon 11 (Miller, et al., 1993-2015 and Mulley, et al., 2005 , 25, 535-542, incorporated herein by reference). Alternative splicing events in the SCN1A gene can lead to non-productive mRNA transcripts, which in turn can lead to aberrant protein expression, and therapeutics that can target alternative splicing events in the SCN1A gene can modulate the expression level of functional proteins in patients with DS and/or suppress aberrant protein expression. Such therapeutic agents may be used to treat the condition caused by SCN1 A protein deficiency.

One alternative splicing event that can lead to nonproductive mRNA transcripts is the inclusion of an additional exon in the mRNA transcript, which can induce nonsense-mediated mRNA decay.

The present disclosure provides compositions and methods for modulating alternative splicing of SCN1A to increase the production of protein-coding mature mRNA and, thereby, translated functional SCN1A protein. These compositions and methods provide antisense oligomers (ASOs) that can cause exon skipping and promote constitutive splicing of SCN1A pre-mRNA. In various embodiments, functional SCN1A protein can be increased using the methods of the present invention to treat a condition caused by SCNIA protein deficiency.

In some cases, the disease or condition is SMEB.

In some cases, the disease or condition is GEFS+.

In some cases, the disease or condition is febrile seizures (eg, febrile seizures, familial, 3A).

In some cases, the disease or condition is autism (also known as autism spectrum disorder or ASD).

In some cases, the disease or condition is migraine (eg, hereditary hemiplegic migraine, 3).

In some cases, the disease or condition is Alzheimer's disease.

In some embodiments, the disease or condition is an SCN2A encephalopathy.

In some embodiments, the disease or condition is an SCN8A encephalopathy.

In some embodiments, the disease or condition is an SCN5A arrhythmia.

In embodiments, the antisense oligonucleotide is administered with one or more agents capable of promoting the penetration of the subject antisense oligonucleotide across the blood-brain barrier by any method known in the art. For example, delivery of agents by administration of an adenoviral vector to muscle motor neurons is described in US Pat. No. 6,632,427, Adenoviral Vector-Mediated Gene Transfer into Medullary Motor Neurons, incorporated herein by reference. Delivery of vectors directly to the brain, e.g., striatum, thalamus, hippocampus, or substantia nigra, is described, for example, in U.S. Patent No. 6,756,523 Adenoviral vectors for the transfer of foreign genes into cells of the central nervous system, especially in the brain, incorporated herein by reference .

In embodiments, the antisense oligonucleotides are linked or conjugated to agents that provide the desired pharmaceutical or pharmacodynamic properties. In embodiments, the antisense oligonucleotide is coupled to a substance known in the art to promote penetration or transport across the blood-brain barrier, for example, an anti-transferrin receptor antibody. According to embodiments

- 43 045521 The antisense oligonucleotide is linked to a viral vector, for example, to make the antisense compound more effective or to increase transport across the blood-brain barrier. In embodiments, osmotic disruption of the blood-brain barrier is aided by infusion of Sugars, e.g., mesoerythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myo-inositol, L(-) fructose, D(- ) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(- ) ribose, adonite, D(+) arabitol, L(-) arabitol, D(+) fucose, L(-) fucose, D(-) lyxose, L(+) lyxose and L(-) lyxose, or amino acids, for example, glutamine, lysine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glycine, histidine, leucine, methionine, phenylalanine, proline, serine, threonine, tyrosine, valine and taurine. Methods and materials for enhancing penetration of the blood-brain barrier are described, for example, in US Patent No. 9193969, Compositions and methods for selective delivery of oligonucleotide molecules to specific types of neurons, US Patent No. 4866042, Method of delivering genetic material across the blood-brain barrier, US Patent No. 6294520, Material to cross the blood-brain barrier and US Pat. No. 6,936,589 Parenteral Delivery Systems, each of which is incorporated herein by reference.

In embodiments, the ASO of the present invention is combined with a dopamine reuptake inhibitor (DRI), a selective serotonin reuptake inhibitor (SSRI), a norepinephrine reuptake inhibitor (NRI), a norepinephrine-dopamine reuptake inhibitor (NDRI), and a serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI) using methods described, for example, in US patent No. 9193969, incorporated herein by reference.

In embodiments, subjects treated with the methods and compositions are assessed for improvement using any methods known and described in the art. Methods for Identifying Additional ASOs that Induce Exon Skipping Also within the scope of the present disclosure are methods for identifying or determining ASOs that induce exon skipping of NIE-containing SCN1A pre-mRNA. For example, the method may involve identifying or determining ASOs that cause pseudoexon skipping of the NIE-containing SCN1 pre-mRNA. ASOs that specifically hybridize to different nucleotides in the target region of the pre-mRNA can be screened to identify or identify ASOs that improve the frequency and/or extent of splicing of the target intron. In some embodiments, an ASO may block or interfere with the splicing repressor(s)/silencer binding site(s). Any method known in the art can be used to identify an ASO that, when hybridized to a target exon region, produces a desired effect (eg, pseudoexon skipping, production of a protein, or functional RNA). These methods can also be used to identify ASOs that cause included exon skipping by binding to a target region in an intron flanking the included exon or in an unincluded exon. An example of a method that can be used is presented below.

A round of screening called an ASO walk can be performed using ASOs that have been designed to hybridize to the target region of the pre-mRNA. For example, ASOs used in an ASO walk can be split every 5 nucleotides from approximately 100 nucleotides upstream of the 3' splice site of an included exon (e.g., the portion of the exon sequence located upstream of the target/included exon ) to approximately 100 nucleotides downstream of the 3' target/included exon splice site and/or from approximately 100 nucleotides upstream of the 5' included exon splice site to approximately 100 nucleotides downstream of the 5' target splice site /included exon (for example, part of the exon sequence located downstream of the target/included exon). For example, a first ASO of 15 nucleotides in length can be designed to specifically hybridize to nucleotides +6 to +20 relative to the 3' splice site of the target/included exon. The second ASO can be designed to specifically hybridize to nucleotides +11 to +25 relative to the 3' splice site of the target/included exon. ASOs are designed as such to span the target region of the pre-mRNA. In embodiments, ASOs may be more closely spaced, such as every 1, 2, 3, or 4 nucleotides. In addition, ASOs can be broken into fragments from 100 nucleotides downstream of the 5' splice site to 100 nucleotides upstream of the 3' splice site. In some embodiments, ASOs may be mosaiced from about 1160 nucleotides upstream of the 3' splice site to about 500 nucleotides downstream of the 5' splice site. In some embodiments, ASOs may be mosaiced from about 500 nucleotides upstream of the 3' splice site to about 1920 nucleotides downstream of the 3' splice site.

One or more ASOs or a control ASO (ASO with a scrambled sequence,

- 44 045521 sequence that is not expected to hybridize with the target region) is delivered, for example, by transfection, into a disease-relevant cell line that expresses the target pre-mRNA (for example, containing the NIE pre-mRNA described herein) . The effects of exon skipping of each ASO can be assessed by any method known in the art, for example, by reverse transcriptase (RT)-PCR using primers that span the splice site as described in Example 4. Reduction or absence of more long RT-PCR product obtained using primers spanning the region containing the included exon (e.g., including flanking NIE exons) in ASO-treated cells compared with control ASO-treated cells, indicating that splicing of the target NIE was strengthened. In some embodiments, exon skipping efficiency (or splicing efficiency for a spliced intron-containing NIE), ratio of spliced to unspliced pre-mRNA, splicing frequency, or splicing extent can be improved using ASOs described herein. The amount of protein or functional RNA that is encoded by the target pre-mRNA can also be assessed to determine whether each ASO has achieved the desired effect (eg, increased production of a functional protein). Any method known in the art for assessing and/or quantifying protein production can be used, such as Western blotting, flow cytometry, immunofluorescence microscopy and ELISA.

A second round of screening, called ASO microwalking, can be performed using ASOs that have been designed to hybridize to the target region of the pre-mRNA. ASOs used in ASO microwalk are arranged in a 1-nucleotide mosaic to further refine the pre-mRNA nucleic acid sequence that, when hybridized with an ASO, results in exon skipping (or increased NIE splicing).

Regions defined by ASOs that promote splicing of the target intron are examined in more detail using ASO microwalks, which include ASOs spaced in 1-nucleotide increments as well as longer ASOs, typically 18–25 nucleotides.

As described for ASO walking above, ASO microwalking is performed by delivering one or more ASOs or a control ASO (a scrambled sequence ASO, a sequence that should not hybridize to the target region), for example, by transfection into an appropriate cell line that expresses the target pre-mRNA. The splicing-inducing effects of each ASO can be assessed by any method known in the art, for example, by reverse transcriptase (RT)-PCR using primers that span the NIE, as described herein (see, for example, Example 4). Reduced or absent longer RT-PCR product obtained using primers spanning NIE in ASO-treated cells compared to control ASO-treated cells indicates that exon skipping (or splicing of the target intron containing NIE) was improved . In some embodiments, exon skipping efficiency (or splicing efficiency for splicing an intron containing an NIE), spliced to unspliced pre-mRNA ratio, splicing frequency, or splicing extent can be improved using ASOs described herein. The amount of protein or functional RNA that is encoded by the target pre-mRNA can also be assessed to determine whether each ASO has achieved the desired effect (eg, increased production of a functional protein). Any method known in the art for assessing and/or quantifying protein production can be used, such as Western blotting, flow cytometry, immunofluorescence microscopy and ELISA.

ASOs that, when hybridized to a region of pre-mRNA, result in exon skipping (or increased splicing of the NIE-containing intron) and increased protein production can be studied in vivo using animal models, such as transgenic mouse models in which the full-length human gene, or in humanized mouse models of the disease. Suitable routes of administration of ASO may vary depending on the disease and/or cell types into which delivery of the ASO is desired. ASO can be administered, for example, by intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravitreal injection, or intravenous injection. After administration, cells, tissues and/or organs of animal models can be assessed to determine the effect of ASO treatment, for example, by assessing splicing (efficiency, frequency, extent) and protein production by methods known in the art and described herein. Animal models can also be any phenotypic or behavioral indication of disease or disease severity. As described herein in various examples, exon 20x in the human SCN1A gene is equivalent to exon 21x in the mouse SCN1A gene.

Also included within the scope of the present disclosure is a method for identifying or testing an NMD-inducing exon in the presence of an NMD inhibitor, such as cycloheximide. An exemplary method is shown in FIG. 3 and in example 2.

- 45 045521

Specific Embodiments

Embodiment 1. A method of modulating the expression of the SCN1A protein in a cell having an mRNA that contains a nonsense-mediated RNA decay exon (NMD exon mRNA) and encodes the SCN1A protein, the method comprising contacting a therapeutic agent with the cell, whereby the therapeutic agent modulates splicing of the NMD exon from the SCN1A protein-encoding mRNA with the NMD exon, thereby modulating the content of processed SCN1A protein-encoding mRNA and modulating the expression of the SCNIA protein in the cell.

Embodiment 2. A method of treating a disease or condition in a subject in need thereof by modulating the expression of the SCN1A protein in a cell of the subject, comprising: contacting the cell of the subject with a therapeutic agent that modulates the splicing of a nonsense-mediated RNA decay-inducing exon (NMD exon) from an mRNA in the cell , which contains the NMD exon and encodes SCN1A, thereby modulating the content of processed mRNA encoding the SCN1A protein and modulating the expression of the SCN1A protein in the subject's cell.

Embodiment 3. The method of embodiment 1 or 2, wherein the therapeutic agent:

(a) binds to the target portion of the NMD exon-containing mRNA encoding SCN1A;

(b) modulates the binding of a factor involved in the splicing of NMD exon-containing mRNA, or (c) is a combination of (a) and (b).

Embodiment 4. The method of Embodiment 3, wherein the therapeutic agent prevents a factor involved in splicing the NMD exon from binding to the target portion region.

Embodiment 5. The method of embodiment 3 or 4, wherein the target portion is proximal to the NMD exon.

Embodiment 6. The method of any one of Embodiments 3-5, wherein the target moiety is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides away , approximately 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides upstream from the 5' end of the NMD exon.

Embodiment 7. The method of any one of Embodiments 3-6, wherein the target moiety is separated by at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, approximately 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotides, approximately 2 nucleotides, approximately 1 nucleotide upstream from the 5' end of the NMD exon.

Embodiment 8. The method of any one of Embodiments 3-5, wherein the target moiety is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides away , approximately 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides downstream of the 3' end of the NMD exon.

Embodiment 9. The method of any one of Embodiments 3-5 or 8, wherein the target moiety is separated by at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, approximately 400 nucleotides, approximately 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotides, approximately 2 nucleotides, approximately 1 nucleotide downstream from the 3' end of the NMD exon.

Embodiment 10. The method as in any one of embodiments 3-9, wherein the target portion is located in an intronic region between two canonical exonic regions of the SCN1A-encoding mRNA with an NMD exon, and wherein the intronic region contains an NMD exon.

Embodiment 11. The method of any one of embodiments 3-10, wherein the target portion at least partially overlaps with the NMD exon.

- 46 045521

Embodiment 12. The method of any one of embodiments 3-11, wherein the target portion at least partially overlaps with an intron upstream of the NMD exon.

Embodiment 13. The method as in any one of embodiments 3 to 12, wherein the target portion comprises a 5' exon-NMD-intron junction or a 3' exon-NMD-intron junction.

Embodiment 14. The method of any one of embodiments 3-13, wherein the target portion is within an NMD exon.

Embodiment 15. The method as in any one of embodiments 3-14, wherein the target portion comprises approximately 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18. 19. 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the NMD exon.

Embodiment 16. The method of any one of Embodiments 1-15, wherein the SCNIA-encoding mRNA with an NMD exon contains a sequence with at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity. with respect to any of SEQ ID NO: 2 or 7-10.

Embodiment 17. The method of any one of Embodiments 1-16, wherein the SCN1A-encoding mRNA with the NMD exon is encoded by a genetic sequence having a sequence identity of at least about 80%, 85%, 90%, 95%, 97%, or 100 % relative to SEQ ID NO: 1 or 3-6.

Embodiment 18. The method of any one of Embodiments 3-17, wherein the target moiety is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides away , approximately 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides upstream of the genomic site GRCh37/hg19: chr2:166863803.

Embodiment 19. The method of any one of Embodiments 3-18, wherein the target moiety is located at a distance of about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotides, approximately 2 nucleotides , approximately 1 nucleotide upstream of the genomic site GRCh37/hg19: chr2:166863803.

Embodiment 20. The method of any one of Embodiments 3-17, wherein the target moiety is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides away , approximately 300 nucleotides, approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides downstream of the genomic site GRCh37/hg19: chr2:166863740.

Embodiment 21. The method of any one of Embodiments 3-17 or 20, wherein the target moiety is located at a distance of about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides , approximately 200 nucleotides, approximately 100 nucleotides, approximately 80 nucleotides, approximately 70 nucleotides, approximately 60 nucleotides, approximately 50 nucleotides, approximately 40 nucleotides, approximately 30 nucleotides, approximately 20 nucleotides, approximately 10 nucleotides, approximately 5 nucleotides, approximately 4 nucleotides, approximately 2 nucleotides, approximately 1 nucleotide downstream of the GRCh37/hg19 genomic site: chr2:166863740.

Embodiment 22. The method of any one of embodiments 3-21, wherein the target region of the SCN1A encoding mRNA with the NMD exon contains a sequence with at least 80%, 85%, 90%, 95%, 97% or 100% relative to the region containing at least 8 contiguous nucleic acids SEQ ID NO: SEQ ID NO: 2 or 7-10.

Embodiment 23. The method of Embodiment 22, wherein the therapeutic agent is an antisense oligomer (ASO) and wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100 % identical to any of SEQ ID NO: 21-67, 210-256 or 304-379.

Embodiment 24. The method of any one of embodiments 3-21, wherein the target portion of the SCN1A-encoding mRNA with the NMD exon is located within the nonsense-mediated RNA decay-inducing exon 20x of SCN1A.

- 47 045521

Embodiment 25. The method of Embodiment 24, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NO: 42-50 or 231-239.

Embodiment 26. The method as in any one of embodiments 3-21, wherein the target portion of the SCN1A encoding mRNA with the NMD exon is located upstream or downstream of the nonsense-mediated RNA decay-inducing exon 20x of SCN1 A.

Embodiment 27. The method of Embodiment 26, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NO: 21-38, 53-67, 210-227 or 242-256.

Embodiment 28. The method of any one of embodiments 3-21, wherein the target portion of the NMD exon mRNA comprises an SCNIA exon 20x exon-intron junction.

Embodiment 29. The method of Embodiment 28, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NO: 39-41, 51, 52, 228-230, 240 or 241.

Embodiment 30. The method of any one of embodiments 1-29, wherein the therapeutic agent promotes exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein.

Embodiment 31. The method of Embodiment 30, wherein exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is increased by a factor of about 1.1 to about 10-fold, from about 1-fold. .5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times , from about 1.1 to about 7 times, from about 1.1 to about 8 times, from about 1.1 to about 9 times, from about 2 to about 5 times, from about 2 to about 6 times, from about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times or more at least approximately 10-fold compared with the exclusion of the NMD exon from the processed mRNA encoding the SCN1 A protein in the control cell.

Embodiment 32. The method of Embodiment 30 or 31, wherein the therapeutic agent increases the content of processed mRNA encoding the SCN1A protein in the cell.

Embodiment 33. The method of any one of Embodiments 30-32, wherein the amount of processed mRNA encoding the SCN1A protein in a cell contacted with the therapeutic agent is increased by a factor of about 1.1 to about 10 times, from about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 8 times about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least approximately 10-fold compared to the total amount of processed SCN1A protein-encoding mRNA in a control cell.

Embodiment 34. The method of any one of embodiments 30-33, wherein the therapeutic agent increases the expression of SCN1A protein in the cell.

Embodiment 35. The method of any one of embodiments 30-34, wherein the amount of SCN1A produced in a cell contacted with the therapeutic agent increases

- 48 045521 in a number of times ranging from about 1.1 to about 10 times, from about 1.5 to about 10 times, from about 2 to about 10 times, from about 3 to about 10 times, from about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times , from about 3 to about 7 times, from about 3 to about 8 times, from about 3 to about 9 times, from about 4 to about 7 times, from about 4 to about 8 times, from about 4 to about 9 times, according to at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3 times 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times the total amount of SCNIA produced in the control cell.

Embodiment 36. The method of any one of embodiments 2-35, wherein the disease or condition is induced by a loss-of-function mutation in Na _v 1.1.

Embodiment 37. The method of any one of Embodiments 2-36, wherein the disease or condition is associated with haploinsufficiency of the SCN1A gene, wherein the subject has a first allele encoding functional SCN1A and a second allele from which no or reduced amount of SCN1A is produced. , or a second allele encoding nonfunctional SCN1A or partially functional SCN1A.

Embodiment 38. The method of any one of embodiments 2-37, wherein the disease or condition is encephalopathy.

Embodiment 39. The method of Embodiment 38, wherein the encephalopathy is epileptic encephalopathy.

Embodiment 40. The method of any one of embodiments 2-37, wherein the disease or condition is Dravet syndrome (DS); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic spasms; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); sick sinus syndrome 1; autism or malignant migratory partial seizures of infancy.

Embodiment 41. The method of Embodiment 40, wherein GEFS+ is epilepsy, generalized with febrile seizures plus, type 2.

Embodiment 42. The method of Embodiment 40, wherein the febrile seizures are febrile seizures, familial, 3A.

Embodiment 43. The method of Embodiment 40, wherein the SMEB is SMEB without generalized spike wave (SMEB-SW), SMEB without myoclonic seizures (SMEB-M), SMEB without more than one SMEI feature (SMEB-O), or persistent epilepsy of children with generalized tonic-clonic seizures (ICEGTC).

Embodiment 44. The method of any one of embodiments 1-43, wherein the therapeutic agent promotes exclusion of the NMD exon from the processed mRNA encoding the SCN1 A protein and increases the expression of SCN1A in the cell.

Embodiment 45. The method of any one of embodiments 1-44, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97 % or 100% complementary to any of SEQ ID NO: 22-24, 26, 27, 29-35, 37-62, 64-67 or 304-379.

Embodiment 46. The method of any one of embodiments 1-29, wherein the therapeutic agent inhibits exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein.

Embodiment 47. The method of Embodiment 46, wherein exclusion of the NMD exon from the processed mRNA encoding the SCN1A protein in a cell exposed to the therapeutic agent is reduced by a factor of about 1.1 to about 10 times, from about 1. .5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times , from about 1.1 to about 7 times, from about 1.1 to about 8 times, from about 1.1

- 49 045521 to about 9 times, from about 2 to about 5 times, from about 2 to about 6 times, from about 2 to about 7 times, from about 2 to about 8 times, from about 2 to about 9 times, from about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 8 times about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold, compared to the exclusion of the NMD exon from the processed SCNIA protein-encoding mRNA in the control cage.

Embodiment 48. The method of Embodiment 46 or 47, wherein the therapeutic agent reduces the amount of processed mRNA encoding the SCN1A protein in the cell.

Embodiment 49. The method of any one of Embodiments 46-48, wherein the amount of processed mRNA encoding the SCN1A protein in a cell contacted with the therapeutic agent is reduced by a factor of from about 1.1 to about 10 times, from about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 8 times about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least approximately 10-fold compared to the total amount of processed SCN1A protein-encoding mRNA in the control cell.

Embodiment 50. The method of any one of embodiments 46-49, wherein the therapeutic agent reduces the expression of SCN1A protein in the cell.

Embodiment 51. The method of any one of Embodiments 46-50, wherein the amount of SCN1A produced in a cell contacted with the therapeutic agent is reduced by a factor of about 1.1 to about 10-fold, from about 1.5 to about 10-fold. about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times or at least about 10-fold compared to the total amount of SCN1A produced in the control cell.

Embodiment 52. The method of any one of embodiments 2-29 or 46-49, wherein the disease or condition is induced by a gain-of-function mutation in Nav1.1.

Embodiment 53. The method of Embodiment 52, wherein the subject has an allele that produces increased amounts of SCN1A, or an allele encoding a mutant SCN1A that induces increased Nav1.1 activity in the cell.

Embodiment 54. The method of Embodiment 52 or 53, wherein the disease or condition is migraine.

Embodiment 55. The method of Embodiment 54, wherein the migraine is hereditary hemiplegic migraine, 3.

Embodiment 56. The method of any one of embodiments 2-49, wherein the disease or condition is Nav1.1 genetic epilepsy.

- 50 045521

Embodiment 57. The method as in any one of embodiments 46-56, wherein the therapeutic agent inhibits exclusion of the NMD exon from processed mRNA encoding the SCN1A protein and reduces the expression of SCN1A in the cell.

Embodiment 58. The method of any one of embodiments 46-57, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97 % or 100% complementary to any of SEQ ID NO: 21, 25, 28, 36 or 63.

Embodiment 59. The method of any of the preceding embodiments, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer contains a backbone modification containing a phosphorothioate linkage or a phosphorodiamidate linkage.

Embodiment 60. The method of any of the preceding embodiments, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer comprises morpholino phosphorodiamidate, capped nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro or a 2'-O-methoxyethyl moiety.

Embodiment 61. The method of any of the preceding embodiments, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer contains at least one modified sugar moiety.

Embodiment 62. The method of Embodiment 61, wherein each sugar moiety is a modified sugar moiety.

Embodiment 63. The method of any of the preceding embodiments, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer consists of 8 to 50 nucleotide bases, 8 to 40 nucleotide bases, 8 to 35 nucleotide bases, 8 to 30 nucleotide bases, 8 to 25 nucleotide bases, 8 to 20 nucleotide bases, 8 to 15 nucleotide bases, 9 to 50 nucleotide bases, 9 to 40 nucleotide bases, 9 to 35 nucleotide bases, 9 up to 30 nucleotide bases, from 9 to 25 nucleotide bases, from 9 to 15 nucleotide bases, from 10 to 50 nucleotide bases, from 10 to 40 nucleotide bases, from 10 to 35 nucleotide bases, from 10 to 30 nucleotide bases, from 10 to 25 nucleotide bases, 10 to 20 nucleotide bases, 10 to 15 nucleotide bases, 11 to 50 nucleotide bases, 11 to 35 nucleotide bases, 11 to 30 nucleotide bases, 11 to 25 nucleotide bases, 11 to 20 nucleotide bases bases, 11 to 15 nucleotide bases, 12 to 50 nucleotide bases, 12 to 40 nucleotide bases, 12 to 35 nucleotide bases, 12 to 30 nucleotide bases, 12 to 25 nucleotide bases, 12 to 20 nucleotide bases or 12 to 15 nucleotide bases.

Embodiment 64. The method of any one of embodiments 3-63, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the oligomer is at least 80% antisense, at least 85%, at least 90%, is at least 95%, at least 98%, at least 99%, or 100% complementary to the target portion of the protein-coding mRNA with the NMD exon.

Embodiment 65. The method of any of the preceding embodiments, wherein the method further comprises assessing the expression of SCN1A mRNA or protein.

Embodiment 66. In any one embodiment, the subject is a human.

Embodiment 67. In any one embodiment, the subject is a non-human animal.

Embodiment 68. In any one embodiment, the subject is a fetus, embryo, or child.

implementation implementation implementation

2-65,

2-65,

2-65, at which at which at which

Embodiment 69. The method according to any of the previous embodiments, wherein the cells are ex vivo.

Embodiment 70. The method as in any one of Embodiments 2-69, wherein the therapeutic agent is administered to the subject by intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravitreal or intravenous injection.

Embodiment 71. The method of any one of embodiments 2-65, wherein the method further comprises administering a second therapeutic agent to the subject.

Embodiment 72. The method of Embodiment 71, wherein the second therapeutic agent is a small molecule.

Embodiment 73. The method of Embodiment 71, wherein the second therapeutic agent is an ASO.

Embodiment 74. The method of Embodiment 73, wherein the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to any of SEQ ID NOs: 115-161.

- 51 045521

Embodiment 75. The method of Embodiment 71, wherein the second therapeutic agent corrects intron retention.

Embodiment 76. The method as in any one of embodiments 2-65, wherein the disease or condition is Alzheimer's disease, SCN2A encephalopathy, SCN8A encephalopathy, or SCN5A arrhythmia.

Embodiment 77. The method of Embodiment 30, 32, or 34, wherein the disease or condition is Alzheimer's disease, SCN2A encephalopathy, SCN8A encephalopathy, or SCN5A arrhythmia.

Embodiment 78. Method for treating Dravet syndrome (DS); epilepsy, generalized with febrile seizures plus, type 2; febrile seizures, familial, 3A; migraine, hereditary hemiplegic, 3; autism; epileptic encephalopathy, early childhood, 13; sick sinus syndrome 1; Alzheimer's disease or sudden unexpected death in epilepsy (SUDEP) in a subject in need thereof by increasing expression of a target protein or functional RNA by a cell of the subject, wherein the cell has an mRNA that contains an inducing nonsense-mediated RNA decay exon (NMD exon mRNA), and wherein the mRNA with the NMD exon encodes a target protein or functional RNA, wherein the method involves contacting a cell of the subject with a therapeutic agent that binds to a target portion of the NMD exon mRNA encoding the target protein or functional RNA, whereby the nonsense-mediated RNA decay-inducing exon is excluded from the NMD exon mRNA, encoding a target protein or functional RNA, thereby increasing the content of processed mRNA encoding the target protein or functional RNA, and increasing the expression of the target protein or functional RNA in a cell of the subject.

Embodiment 79. The method of Embodiment 78, wherein the target protein is SCNIA.

Embodiment 80. A method of increasing the expression of the SCN1A protein by a cell having an mRNA that contains an inducing nonsense-mediated RNA decay exon (mRNA with an NMD exon) and encodes the SCN1A protein, the method comprising contacting the cell with an agent that binds to a target portion encoding the SCN1A protein mRNA with an NMD exon, whereby the nonsense-mediated RNA decay-inducing exon is eliminated from the SCN1A protein-encoding mRNA with an NMD exon, thereby increasing the content of processed SCN1A protein-encoding mRNA and increasing the expression of the SCNIA protein in the cell.

Embodiment 81. A method of treating a disease or condition in a subject in need thereof by increasing expression of the SCN1A protein in a cell of the subject, comprising: contacting the cell of the subject with a therapeutic agent that binds to a target portion of an mRNA with a nonsense-mediated decay-inducing exon encoding the SCN1A protein. or functional SCN1A RNA, whereby the nonsense-mediated RNA decay-inducing exon is eliminated from the NMD exon mRNA encoding the SCN1A protein or functional SCN1A RNA, thereby increasing the content of the processed mRNA encoding the SCN1A protein or functional SCN1A RNA, and increasing the expression of the SCN1A protein or functional SCN1A RNA in the subject's cell; wherein the disease or condition is associated with a mutation of a gene other than the SCN1A gene, aberrant expression of a protein encoded by a gene other than the SCN1A gene, or aberrant expression of RNA encoded by a gene other than the SCNIA gene.

Embodiment 82. The method of Embodiment 81, wherein the symptom of the disease or condition is reduced by approximately 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times or more.

Embodiment 83. The method of Embodiment 81 or 82, wherein the symptom of the disease or condition is reduced by approximately 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% with an increase in SCN1A protein expression.

Embodiment 84. The method of any one of embodiments 81-83, wherein the progression of the disease or condition is reduced by approximately 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, or more with an increase in SCN1A protein expression.

Embodiment 85. The method of any one of embodiments 81-84, wherein progression of the disease or condition is reduced by approximately 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% with increased SCNIA protein expression.

Embodiment 86. The method of any one of Embodiments 81-85, wherein increasing expression of the SCN1A protein or functional SCN1A RNA compensates for a mutation of a gene other than the SCN1A gene, aberrant expression of a protein encoded by a gene other than the SCN1A gene, or aberrant expression of the RNA, encoded by a gene different from the SCN1 A gene.

Embodiment 87. The method of any one of embodiments 81-86, wherein the disease or condition is early childhood epileptic encephalopathy, 13.

Embodiment 88. The method of any one of embodiments 81-87, wherein the subject is characterized by having a mutation in the SCN8A gene.

- 52 045521

Embodiment 89. The method of any one of embodiments 81-86, wherein the disease or condition is sick sinus syndrome 1.

Embodiment 90. The method of any one of embodiments 81-86 or 88, wherein the subject is characterized by having a mutation in the SCN5A gene.

Embodiment 91. The method of any one of embodiments 81-86, wherein the disease or condition is Alzheimer's disease.

Embodiment 92. A method of treating a disease or condition in a subject in need thereof, comprising administering to the subject a composition comprising an antisense oligomer, wherein the antisense oligomer contains a sequence of at least 8 contiguous nucleotides that is at least 80%, 85%, 90% , 95%, 97% or 100% complementary to intron 20 of SCN1A.

Embodiment 93. A method of treating a disease or condition in a subject in need thereof, comprising administering to the subject a composition comprising an antisense oligomer, wherein the antisense oligomer contains a sequence of at least 8 contiguous nucleotides that is at least 80%, 85%, 90% , 95%, 97% or 100% complementary to any of SEQ ID NO: 7-10.

Embodiment 94. The method of any one of embodiments 78-93, wherein the nonsense-mediated RNA decay-inducing exon is spliced from an NMD exon mRNA encoding a target protein or functional RNA.

Embodiment 95. The method of any one of embodiments 78-94, wherein the target protein does not contain an amino acid sequence encoded by a nonsense-mediated RNA decay-inducing exon.

Embodiment 96. The method of any one of embodiments 78-95, wherein the target protein is a full-length target protein.

Embodiment 97. The method of any one of embodiments 78-96, wherein the agent is an antisense oligomer (ASO) complementary to the target portion of the mRNA with the NMD exon.

Embodiment 98. The method of any one of embodiments 78-97, wherein the mRNA is pre-mRNA.

Embodiment 99. The method of any one of embodiments 78-98, wherein the contacting involves contacting the therapeutic agent with the mRNA, the mRNA being located in the nucleus of the cell.

Embodiment 100. The method of any one of embodiments 78-99, wherein the target protein or functional RNA corrects a deficiency of the target protein or functional RNA in a subject.

Embodiment 101. The method of any one of embodiments 78-100, wherein the cells are in or obtained from a subject with a condition caused by insufficient amount or activity of the SCN1 A protein.

Embodiment 102. The method of any one of Embodiments 78-101, wherein the deficiency of the target protein is caused by haploinsufficiency of the target protein, wherein the subject has a first allele encoding a functional target protein and a second allele from which the target protein is not produced or is produced in reduced amount, or a second allele encoding a non-functional or partially functional target protein, and wherein the antisense oligomer binds to the target portion of the NMD exon mRNA transcribed from the first allele.

Embodiment 103. The method of any one of embodiments 78-101, wherein the subject has a condition caused by a disorder that results from a deficiency in the amount or function of the target protein, wherein the subject is characterized by having:

(a) the first mutant allele from which:

(i) the target protein is produced in a reduced amount compared to production of the wild-type allele, (ii) the target protein is produced in a form having reduced function compared to the equivalent wild-type protein, or (iii) the target protein is not produced, and (b) the second mutant allele, from which:

(i) the target protein is produced in a reduced amount compared to the production of the wild-type allele, (ii) the target protein is produced in a form that has reduced function compared to the equivalent wild-type protein, or (iii) the target protein is not produced, and when the subject has the first mutant allele (a)(iii), the second mutant allele is (b)(i) or (b)(ii), and where the subject has the second mutant allele (b)(iii), the first mutant allele is (a)(i) or (a)(ii), and wherein the mRNA with the NMD exon is transcribed from either the first mutant al

- 53 045521 lelya, which is (a)(i) or (a)(ii), and/or from the second allele, which is (b)(i) or (b)(ii).

Embodiment 104. The method of Embodiment 103, wherein the target protein is produced in a form that has reduced function compared to the equivalent wild-type protein.

Embodiment 105. The method of Embodiment 103, wherein the target protein is produced in a form that is fully functional compared to the equivalent wild-type protein.

Embodiment 106. The method of any one of embodiments 78-105, wherein the target portion of the mRNA with the NMD exon is located in the nonsense-mediated RNA decay-inducing exon.

Embodiment 107. The method of any one of embodiments 78-105, wherein the target portion of the mRNA with the NMD exon is either upstream or downstream of the nonsense-mediated RNA decay-inducing exon.

Embodiment 108. The method of any one of embodiments 78-107, wherein the NMD exon mRNA comprises a sequence with at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to to any of SEQ ID NO: 2, 7-10, 12 and 17-20.

Embodiment 109. The method of any one of embodiments 78-107, wherein the NMD exon mRNA is encoded by a genetic sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity. in relation to SEQ ID NO: 1, 3-6, 11 and 13-16.

Embodiment 110. The method of any one of Embodiments 78-107, wherein the target portion of the NMD exon mRNA contains a sequence with at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity. with respect to a region containing at least 8 contiguous nucleic acids SEQ ID NO: 2, 7-10, 12 and 17-20.

Embodiment 111. The method of any one of embodiments 78-110, wherein the agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97% or 100% identical to any of SEQ ID NO: 21-114.

Embodiment 112. The method of any one of embodiments 78-105, wherein the target portion of the mRNA with the NMD exon is located within the nonsense-mediated RNA decay-inducing exon 20x of SCN1A.

Embodiment 113. The method of Embodiment 112, wherein the agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 10% identical. any of SEQ ID NO: 42-50 or 231-239.

Embodiment 114. The method of any one of embodiments 78-105, wherein the target portion of the mRNA with the NMD exon is located upstream or downstream of the nonsense-mediated RNA decay-inducing exon 20x of SCN1A.

Embodiment 115. The method of Embodiment 114, wherein the agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 10θ% identical. any of SEQ ID NO: 21-38, 53-67, 210-227 or 242-256.

Embodiment 116. The method of any one of embodiments 78-105, wherein the target portion of the NMD exon mRNA contains an exon-intron junction of exon 20x SCNIA.

Embodiment 117. The method of Embodiment 116, wherein the agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 10θ% identical. any of SEQ ID NO: 39-41, 51, 52, 228-230, 240 or 241.

Embodiment 118. The method of any one of embodiments 78-105, wherein the target portion of the mRNA with the NMD exon is located within the nonsense-mediated RNA decay-inducing exon 21x of Scn1a.

Embodiment 119. The method of Embodiment 118, wherein the agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 10θ% identical. any of SEQ ID NO: 89-97.

Embodiment 120. The method of any one of embodiments 78-105, wherein the target portion of the mRNA with the NMD exon is either upstream or downstream of the nonsense-mediated RNA decay-inducing exon 21x of Scn1a.

Embodiment 121. The method of Embodiment 120, wherein the agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that

- 54 045521 is at least about 80%, 85%, 90%, 95%, 97% or 100% identical to any of SEQ ID NOs: 68-85 and 100-114.

Embodiment 122. The method of any one of embodiments 78-105, wherein the target portion of the NMD exon mRNA comprises an exon-intron junction of Scn1a exon 21x.

Embodiment 123. The method of Embodiment 122, wherein the agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 10% identical. any of SEQ ID NO: 86-88 and 98-99.

Embodiment 124. The method of any one of embodiments 78-123, wherein the target protein produced is a full-length or wild-type protein.

Embodiment 125. The method of any one of embodiments 78-124, wherein the total amount of processed mRNA encoding the target protein or functional RNA produced in a cell contacting the antisense oligomer is increased by a factor of from about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1 .1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times , about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1, 5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least approximately 5-fold, or at least approximately 10-fold, compared to the total amount of processed mRNA encoding the target protein or functional RNA produced in the control cell.

Embodiment 126. The method of any one of Embodiments 78-124, wherein the total amount of target protein produced by a cell contacting the antisense oligomer is increased by a factor of about 1.1 to about 10 times, from about 1.5 to about 10 times, from about 2 to about 10 times, from about 3 to about 10 times, from about 4 to about 10 times, from about 1.1 to about 5 times, from about 1.1 to about 6 times, from about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times , about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times or at least about 5 times approximately 10 times the total amount of target protein produced by the control cell.

Embodiment 127. The method of any one of embodiments 78-126, wherein the agent is an antisense oligomer (ASO), wherein the antisense oligomer contains a backbone modification containing a phosphorothioate linkage or a phosphorodiamidate linkage.

Embodiment 128. The method of any one of Embodiments 78-127, wherein the agent is an antisense oligomer (ASO), wherein the antisense oligomer comprises a morpholino phosphorodiamidate, a capped nucleic acid, a peptide nucleic acid, 2'-O-methyl, 2'- fluorine or 2-O-methoxyethyl fragment.

Embodiment 129. The method of any one of embodiments 78-128, wherein the agent is an antisense oligomer (ASO), wherein the antisense oligomer contains at least one modified sugar moiety.

Embodiment 130. The method of Embodiment 129, wherein each sugar moiety is a modified sugar moiety.

Embodiment 131. The method of any one of Embodiments 78-130, wherein the agent is an antisense oligomer (ASO), wherein the antisense oligomer consists of 8 to 50 nucleotide bases, 8 to 40 nucleotide bases, 8 to 35 nucleotide bases

- 55 045521 bases, from 8 to 30 nucleotide bases, from 8 to 25 nucleotide bases, from 8 to 20 nucleotide bases, from 8 to 15 nucleotide bases, from 9 to 50 nucleotide bases, from 9 to 40 nucleotide bases, from 9 to 35 nucleotide bases, 9 to 30 nucleotide bases, 9 to 20 nucleotide bases, 9 to 15 nucleotide bases, 10 to 50 nucleotide bases, 10 to 40 nucleotide bases, 10 to 35 nucleotide bases, 10 to 30 nucleotide bases, from 10 to 25 nucleotide bases, from 10 to 20 nucleotide bases, from 10 to 15 nucleotide bases, from 11 to 40 nucleotide bases, from 11 to 35 nucleotide bases, from 11 to 30 nucleotide bases, from 11 to 25 nucleotide bases bases, 11 to 20 nucleotide bases, 11 to 15 nucleotide bases, 12 to 50 nucleotide bases, 12 to 40 nucleotide bases, 12 to 35 nucleotide bases, 12 to 30 nucleotide bases, 12 to 25 nucleotide bases , 12 to 20 nucleotide bases or 12 to 15 nucleotide bases.

Embodiment 132. The method of any one of embodiments 78-131, wherein the agent is an antisense oligomer (ASO), wherein the oligomer is at least 80% antisense, at least 85%, at least 90% antisense oligomer. is at least 95%, at least 98%, at least 99%, or 100% complementary to the target portion of the protein-coding mRNA with the NMD exon.

Embodiment 133. The method of any one of embodiments 78-132, wherein the method further comprises assessing the expression of SCN1A mRNA or protein.

Embodiment 134. The method of any one of embodiments 1-113, wherein Dravet syndrome is treated; epilepsy, generalized with febrile seizures plus, type 2; febrile seizures, familial, 3A; migraine, hereditary hemiplegic, 3; autism; epileptic encephalopathy, early childhood, 13; sick sinus syndrome 1; Alzheimer's disease or sudden unexpected death in epilepsy (SUDEP), and in which the antisense oligomer binds to a target portion of the SCN1A mRNA with the NMD exon, the target being a sequence selected from SEQ ID NOs: 7-10 and 17-20.

Embodiment 135. The method of any one of embodiments 78-134, wherein the subject is a human.

Embodiment 136. The method of any one of embodiments 78-135, wherein the subject is a non-human animal.

Embodiment 137. The method of any one of embodiments 78-136, wherein the subject is a fetus, embryo, or child.

Embodiment 138. The method of any one of embodiments 78-137 wherein the cells are ex vivo.

Embodiment 139. The method as in any one of embodiments 78-138, wherein the therapeutic agent is administered to the subject by intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravitreal injection, or intravenous injection.

Embodiment 140. The method of any one of embodiments 78-139, wherein the method further comprises administering a second therapeutic agent to the subject.

Embodiment 141 The method of embodiment 140, wherein the second therapeutic agent is a small molecule.

Embodiment 142 The method of embodiment 140, wherein the second therapeutic agent is an ASO.

Embodiment 143. The method of Embodiment 142, wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NOs: 115-161.

Embodiment 144. The method of any one of embodiments 140-142, wherein the second therapeutic agent corrects intron retention.

Embodiment 145. An antisense oligomer used in the method of any of embodiments 78-144.

Embodiment 146. An antisense oligomer comprising a sequence with at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any of SEQ ID NO: 21-114.

Embodiment 147. A pharmaceutical composition comprising the antisense oligomer of Embodiment 145 or 146 and an excipient.

Embodiment 148: A method of treating a subject in need thereof, comprising administering the pharmaceutical composition of Embodiment 147 to the subject, wherein the administration is an intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravitreal injection, or intravenous injection.

Embodiment 149. A composition comprising a therapeutic agent for use in a method of increasing the expression of a target protein or functional RNA by cells for the treatment of a disease.

- 56 045521 disease or condition associated with a defective protein or defective functional RNA in a subject in need thereof, wherein the defective protein or defective functional RNA is insufficient in quantity or activity in the subject, wherein the target protein is:

(a) a defective protein or (b) a compensatory protein that functionally augments or replaces a defective protein in a subject;

and wherein the functional RNA is:

(c) a defective RNA or (d) a compensatory functional RNA that functionally augments or replaces a defective functional RNA in a subject; wherein the therapeutic agent enhances exclusion of the nonsense-mediated RNA decay-inducing exon from NMD exon mRNA encoding the target protein or functional RNA, thereby increasing the production or activity of the target protein or functional RNA in the subject.

Embodiment 150. A composition comprising a therapeutic agent for use in a method of treating a disease or condition in a subject in need thereof, the method comprising the step of modulating expression of the SCN1A protein by cells of the subject, wherein the cells have an mRNA that contains an inducing nonsense RNA decay-mediated exon (mRNA with the NMD exon) and encodes the SCN1A protein, and this method involves contacting cells with a therapeutic agent, thereby modulating the exclusion of the nonsense-mediated RNA decay-inducing exon from the NMD exon mRNA encoding the SCN1A protein, thereby modulating the content of processed mRNA encoding the SCN1A protein, and modulating the expression of SCNIA protein in the subject's cells.

Embodiment 151. The composition of Embodiment 150, wherein the disease or condition is selected from the group consisting of: Dravet syndrome (DS); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic spasms; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); sick sinus syndrome 1; autism or migraine, hereditary hemiplegia, 3 and Alzheimer's disease.

Embodiment 152. The composition of any one of embodiments 150-151, wherein the SCN1A protein and the NMD exon mRNA are encoded by the SCN1A gene.

Embodiment 153. The composition of any one of embodiments 149-152, wherein the nonsense-mediated RNA decay-inducing exon is spliced from an NMD exon-encoding mRNA encoding the SCN1A protein.

Embodiment 154. The composition of any one of embodiments 149-153, wherein the SCN1A protein does not contain the amino acid sequence encoded by the nonsense-mediated RNA decay-inducing exon.

Embodiment 155. The composition of any one of embodiments 149-154, wherein the SCN1A protein is a full-length SCN1A protein.

Embodiment 156. The composition of any one of embodiments 149-155, wherein the therapeutic agent is an antisense oligomer (ASO) complementary to the target portion of the mRNA with the NMD exon.

Embodiment 157. The composition of any one of embodiments 149-156, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer targets a portion of the NMD exon mRNA that is located in the nonsense-mediated RNA decay-inducing exon.

Embodiment 158. The composition of any one of embodiments 149-156, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer targets a portion of the NMD exon mRNA that is upstream or downstream of the inducer. nonsense-mediated RNA exon decay.

Embodiment 159. The composition of any one of embodiments 149-158, wherein the target protein is SCN1A.

Embodiment 160. The composition of Embodiment 159, wherein the NMD exon mRNA comprises a sequence with at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any of SEQ ID NO: 2, 7-10, 12 and 17-20.

Embodiment 161. The composition of Embodiment 159, wherein the NMD exon mRNA is encoded by a genetic sequence having sequence identity of at least about 80%, 85%, 90%, 95%, 97%, or 100% to SEQ ID

- 57 045521

NO: 1, 3-6, 11 and 13-16.

Embodiment 162. The composition of Embodiment 159, wherein the target portion of the NMD exon mRNA contains a sequence with at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to the region containing at least 8 contiguous nucleic acids SEQ ID NO: 2, 7-10, 12 and 17-20.

Embodiment 163. The composition of any one of embodiments 159-162, wherein the target portion of the mRNA with the NMD exon (i) is located in the nonsense-mediated RNA decay-inducing exon 20x, (ii) is located upstream of or downstream of inducing nonsense-mediated RNA decay of exon 20x or (iii) contains an exon-intron junction of inducing nonsense-mediated RNA decay of exon 20x.

Embodiment 164. The composition of any one of embodiments 159-163, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97 % or 100% identical to any of SEQ ID NO: 21-114.

Embodiment 165. The composition of any one of embodiments 149-164, wherein the disease or condition is induced by a loss of function mutation in Nav1.1.

Embodiment 166. The composition of any one of embodiments 149-165, wherein the disease or condition is associated with haploinsufficiency of the SCN1A gene, and wherein the subject has a first allele encoding functional SCN1A and a second allele from which no or reduced amount of SCN1A is produced. , or a second allele encoding a nonfunctional SCNIA or a partially functional SCNIA.

Embodiment 167. The composition of any one of embodiments 149-116, wherein the disease or condition is an encephalopathy, optionally induced by a loss-of-function mutation in Nav1.1.

Embodiment 168. The composition of Embodiment 167, wherein the encephalopathy is epileptic encephalopathy.

Embodiment 169. The composition of Embodiment 165 or 166, wherein the disease or condition is Dravet syndrome (DS); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Lennox-Gastaut syndrome; West syndrome; idiopathic seizures; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); sick sinus syndrome 1; autism or malignant migratory partial seizures of infancy.

Embodiment 170. The composition of Embodiment 168, wherein GEFS+ is epilepsy, generalized with febrile seizures plus, type 2.

Embodiment 171. The composition of Embodiment 168, wherein the febrile seizures are febrile seizures, familial, 3A.

Embodiment 172. The composition of Embodiment 168, wherein the SMEB is SMEB without generalized spike wave (SMEB-SW), SMEB without myoclonic seizures (SMEB-M), SMEB without more than one feature of SMEI (SMEB-O), or persistent epilepsy of children with generalized tonic-clonic seizures (ICEGTC).

Embodiment 173. The composition of any one of embodiments 165-172, wherein the therapeutic agent promotes exclusion of the NMD exon from processed mRNA encoding the SCN1A protein and increases the expression of SCN1A in the cell.

Embodiment 174. The composition of any one of embodiments 165-173, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97 % or 100% complementary to any of SEQ ID NO: 22-24, 26, 27, 29-35, 37-62 or 64-67.

Embodiment 175. The composition of any one of embodiments 149-164, wherein the disease or condition is induced by a gain-of-function mutation in Nav1.1.

Embodiment 176. The composition of any one of Embodiments 149-164 or 175, wherein the subject has an allele that produces increased amounts of SCN1A, or an allele encoding a mutant SCN1A that induces increased Nav1.1 activity in the cell.

Embodiment 177. The composition of any one of embodiments 149-164, 175, or 176, wherein the disease or condition is migraine.

Embodiment 178. The composition of Embodiment 177, wherein the migraine is hereditary hemiplegic migraine, 3.

Embodiment 179. The composition of any one of embodiments 149-164, 175, or 176, wherein the disease or condition is Nav1.1 genetic epilepsy.

- 58 045521

Embodiment 180. The composition of any one of embodiments 149 to 164 or 175 to 179, wherein the therapeutic agent inhibits NMD exon exclusion from processed mRNA encoding the SCN1A protein and reduces the expression of SCN1A in the cell.

Embodiment 181. The composition of any one of Embodiments 149-164 or 175180, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97% or 100% complementary to any of SEQ ID NO: 21, 25, 28, 36 or 63.

Embodiment 182. The composition of any one of embodiments 149-181, wherein the processed mRNA encoding the target protein or functional RNA is full-length mature mRNA or wild-type mature mRNA.

Embodiment 183. The composition of any one of embodiments 149-182, wherein the target protein produced is a full-length or wild-type protein.

Embodiment 184. The composition of any one of embodiments 149-183, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer contains a backbone modification including a phosphorothioate linkage or a phosphorodiamidate linkage.

Embodiment 185. The composition of any one of embodiments 149-184, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer is an antisense oligonucleotide.

Embodiment 186. The composition of any one of embodiments 149-185, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer comprises a morpholino phosphorodiamidate, a capped nucleic acid, a peptide nucleic acid, 2'-O-methyl, 2' -fluorine or 2'-O-methoxyethyl fragment.

Embodiment 187. The composition of any one of embodiments 149-186, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer contains at least one modified sugar moiety.

Embodiment 188. The composition of Embodiment 187, wherein each sugar moiety is a modified sugar moiety.

Embodiment 189. The composition of any one of embodiments 149-188, wherein the therapeutic agent is an antisense oligomer (ASO), wherein the antisense oligomer consists of 8 to 50 nucleotide bases, 8 to 40 nucleotide bases, 8 to 35 nucleotide bases bases, 8 to 30 nucleotide bases, 8 to 25 nucleotide bases, 8 to 20 nucleotide bases, 8 to 15 nucleotide bases, 9 to 50 nucleotide bases, 9 to 40 nucleotide bases, 9 to 35 nucleotide bases , from 9 to 30 nucleotide bases, from 9 to 20 nucleotide bases, from 9 to 15 nucleotide bases, from 10 to 50 nucleotide bases, from 10 to 40 nucleotide bases, from 10 to 35 nucleotide bases, from 10 to 30 nucleotide bases, from 10 to 25 nucleotide bases, from 10 to 20 nucleotide bases, from 10 to 15 nucleotide bases, from 11 to 40 nucleotide bases, from 11 to 35 nucleotide bases, from 11 to 30 nucleotide bases, from 11 to 25 nucleotide bases, from 11 to 20 nucleotide bases, 11 to 15 nucleotide bases, 12 to 50 nucleotide bases, 12 to 40 nucleotide bases, 12 to 35 nucleotide bases, 12 to 30 nucleotide bases, 12 to 20 nucleotide bases or 12 up to 15 nucleotide bases.

Embodiment 190. A composition comprising an antisense oligomer, wherein the antisense oligomer comprises a sequence of at least 8 contiguous nucleotides that is at least 80%, 85%, 90%, 95%, 97%, or 100% complementary to intron 20 in SCNIA .

Embodiment 191. A composition comprising an antisense oligomer, wherein the antisense oligomer comprises a sequence of at least 8 contiguous nucleotides that is at least 80%, 85%, 90%, 95%, 97%, or 100% complementary to any of the SEQ IDs NO: 7-10.

Embodiment 192. A pharmaceutical composition comprising a therapeutic agent of any of the compositions of embodiments 149 to 191 and an excipient.

Embodiment 193: A method of treating a subject in need thereof, comprising administering to the subject the pharmaceutical composition of Embodiment 192, wherein the administration is an intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravitreal injection, or intravenous injection.

Embodiment 194. A pharmaceutical composition comprising: an antisense oligomer that hybridizes to a target sequence of an SCN1A mRNA transcript, wherein the SCN1A mRNA transcript contains a nonsense-mediated RNA decay-inducing exon, wherein the antisense oligomer induces exclusion of the nonsense-mediated RNA decay-inducing exon from the SCN1A mRNA transcript ; and a pharmaceutically acceptable excipient.

Embodiment 195. The pharmaceutical composition of Embodiment 194, wherein the SCN1A mRNA transcript is an mRNA transcript with the NMD exon of SCN1A.

- 59 045521

Embodiment 196. The pharmaceutical composition of Embodiment 194 or 195, wherein the target portion of the mRNA transcript with the SCN1A NMD exon (i) is located within the nonsense-mediated RNA decay-inducing exon 20x, (ii) is located upstream or downstream of transcription. from the nonsense-mediated RNA decay-inducing exon 20x or (iii) contains an exon-intron junction of the nonsense-mediated RNA decay-inducing exon 20x.

Embodiment 197. The pharmaceutical composition of Embodiment 194 or 196, wherein the SCNIA mRNA transcript with the NMD exon is encoded by a genetic sequence with sequence identity of at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% relative to any of SEQ ID NO: 1, 3-6, 11 and 13-16.

Embodiment 198. The pharmaceutical composition of Embodiment 194 or 196, wherein the SCN1A mRNA transcript with the NMD exon contains a sequence with a sequence identity of at least about 80%, 85%, 90%, 95%, 96%, 97%, 98 %, 99% or 100% relative to any of SEQ ID NO: 2, 7-10, 12 and 17-20.

Embodiment 199. The pharmaceutical composition of Embodiment 194, wherein the antisense oligomer contains a backbone modification containing a phosphorothioate linkage or a phosphorodiamidate linkage.

Embodiment 200. The pharmaceutical composition of Embodiment 194, wherein the antisense oligomer is an antisense oligonucleotide.

Embodiment 201. The pharmaceutical composition of Embodiment 194, wherein the antisense oligomer comprises a morpholino phosphorodiamidate, a capped nucleic acid, a peptide nucleic acid, a 2'-O-methyl, 2'-fluoro, or a 2'-O-methoxyethyl moiety.

Embodiment 202. The pharmaceutical composition of Embodiment 194, wherein the antisense oligomer contains at least one modified sugar moiety.

Embodiment 203. The pharmaceutical composition of Embodiment 194, wherein the antisense oligomer contains 8 to 50 nucleotide bases, 8 to 40 nucleotide bases, 8 to 35 nucleotide bases, 8 to 30 nucleotide bases, 8 to 25 nucleotide bases , 8 to 15 nucleotide bases, from 9 to 50 nucleotide bases, from 9 to 40 nucleotide bases, from 9 to 35 nucleotide bases, from 9 to 30 nucleotide bases, from 9 to 25 nucleotide bases, from 9 to 20 nucleotide bases, from 10 to 50 nucleotide bases, 10 to 40 nucleotide bases, 10 to 35 nucleotide bases, 10 to 30 nucleotide bases, 10 to 25 nucleotide bases, 10 to 20 nucleotide bases, 10 to 15 nucleotide bases, 11 to 50 nucleotide bases, 11 to 40 nucleotide bases, 11 to 35 nucleotide bases, 11 to 30 nucleotide bases, 11 to 25 nucleotide bases, 11 to 20 nucleotide bases, 11 to 15 nucleotide bases, 12 to 50 nucleotide bases bases, 12 to 40 nucleotide bases, 12 to 35 nucleotide bases, 12 to 30 nucleotide bases, 12 to 25 nucleotide bases, or 12 to 15 nucleotide bases.

Embodiment 204. The pharmaceutical composition of Embodiment 194 or 195, wherein the antisense oligomer is at least 80%, at least 85%, at least 90%, at least 95%, at least 98 % is at least 99% or 100% complementary to the target portion of the SCN1A mRNA transcript with the NMD exon.

Embodiment 205. The pharmaceutical composition of Embodiment 194 or 195, wherein the target portion of the SCN1A mRNA transcript with the NMD exon is in a sequence selected from SEQ ID NOs: 2, 7-10, 12, and 17-20.

Embodiment 206. The pharmaceutical composition of Embodiment 194, wherein the antisense oligomer contains a nucleotide sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98% or 99% identical to the sequence of any of SEQ ID NO: 21-114.

Embodiment 207. The pharmaceutical composition of Embodiment 194, wherein the antisense oligomer comprises a nucleotide sequence selected from SEQ ID NO: 21-114.

Embodiment 208. The pharmaceutical composition of any one of embodiments 194-207, wherein the pharmaceutical composition is formulated for intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravitreal injection, or intravenous injection.

Embodiment 209. A method of inducing processing of a defective SCN1A mRNA transcript to facilitate removal of a nonsense-mediated RNA decay-inducing exon to produce a fully processed SCN1A mRNA transcript that encodes a functional form of the SCN1A protein, the method comprising:

(a) contacting the antisense oligomer with a target cell of the subject; (b) hybridizing the antisense oligomer to a defective SCN1A mRNA transcript, wherein the defective SCN1A mRNA transcript is capable of encoding a functional form of the SCN1A protein and contains at least

- 60 045521 one exon inducing nonsense-mediated RNA decay;

(c) removing at least one nonsense-mediated RNA decay-inducing exon from the defective SCN1A mRNA transcript to produce a fully processed SCN1A mRNA transcript that encodes a functional form of the SCN1 A protein; and (d) translation of the functional form of the SCN1A protein from the fully processed SCNIA mRNA transcript.

Embodiment 210. A method of treating a subject characterized by having a condition caused by insufficient amount or activity of the SCN1A protein, comprising administering to the subject an antisense oligomer comprising a nucleotide sequence having a sequence identity of at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% relative to any of SEQ ID NO: 24-114.

Embodiment 211. A method of screening for an agent that increases expression of a target protein gene or functional RNA by a cell, wherein the cell contains mRNA that contains a nonsense RNA decay-inducing exon (NMD exon mRNA), and wherein the NMD exon mRNA encodes the target protein or functional RNA, the method comprising:

(a) contacting a test agent that targets mRNA to the NMD exon with a first cell;

(b) contacting the control agent with the second cell;

(c) determining a first content in the first cell, the first content being the content of: (i) an RNA transcript encoded by an NMD exon mRNA that does not contain an RNA decay-inducing exon, or (ii) an NMD exon mRNA encoded protein that does not contains an amino acid sequence encoded by an RNA decay-inducing exon;

(d) determining a second content in a second cell, wherein the second content is the content of (i) an RNA transcript encoded by an mRNA with an NMD exon that does not contain an RNA decay-inducing exon, or (ii) an encoded protein of an mRNA with an NMD exon that does not contain the amino acid sequence encoded by the RNA decay-inducing exon;

wherein the first content is higher than the second content; and (e) choice of study agent.

Embodiment 212. A method of screening for an agent that increases expression of a target protein gene or functional RNA by a cell, wherein the cell contains mRNA that contains a nonsense RNA decay-inducing exon (NMD exon mRNA), and wherein the NMD exon mRNA encodes the target protein or functional RNA, the method comprising (a) contacting a test agent that targets mRNA with an NMD exon with a first cell;

(b) contacting the control agent with the second cell;

(c) determining a first content in the first cell, the first content being the content of (i) an RNA transcript encoded by an mRNA with an NMD exon that does not contain an RNA decay-inducing exon, or (ii) an encoded protein of an mRNA with an NMD exon that does not contain the amino acid sequence encoded by the RNA decay-inducing exon;

(d) determining a second content in the second cell, wherein the second content is the content of: (i) an RNA transcript encoded by an NMD exon mRNA that does not contain an RNA decay-inducing exon, or (ii) an encoded protein of an NMD exon mRNA that does not contains an amino acid sequence encoded by an RNA decay-inducing exon;

wherein the first content is higher than the second content; and (e) choice of study agent.

Embodiment 213. The method of embodiment 211 or 212, the method comprising contacting a protein synthesis inhibitor with a first cell and a second cell; wherein the first content is the content of an RNA transcript encoded by an mRNA with an NMD exon that contains an RNA decay-inducing exon; and wherein the second content is the content of an RNA transcript encoded by an mRNA with an NMD exon that contains an RNA decay-inducing exon.

Embodiment 214: A method for treating Dravet syndrome (DS), epilepsy, generalized, with febrile seizures plus, type 2; febrile seizures, familial, 3A; migraine, hereditary hemiplegic, 3; autism; epileptic encephalopathy, early childhood, 13; sick sinus syndrome 1; Alzheimer's disease or SUDEP (sudden unexpected death in epilepsy) in a subject in need thereof by increasing the expression of a target protein or functional RNA by a cell of the subject, wherein the cell contains an mRNA that contains an inducing nonsense-mediated RNA decay exon (NMD exon mRNA), and wherein the mRNA with The NMD exon encodes a target protein or functional RNA, wherein the method involves contacting a cell of the subject with a therapeutic agent that modulates splicing of an NMD exon mRNA encoding the target protein or functional RNA, whereby the nonsense-mediated RNA decay-inducing exon is excluded from the NMD exon mRNA encoding the target protein

- 61 045521 or functional RNA, thereby increasing the content of processed mRNA encoding the target protein or functional RNA, and increasing the expression of the target protein or functional RNA in the cell of the subject.

Embodiment 215. A method of increasing the expression of the SCN1A protein by a cell containing an mRNA that contains a nonsense-mediated RNA decay-inducing exon (mRNA with an NMD exon) and encodes the SCN1A protein, the method comprising contacting the cell with an agent that modulates the splicing of an mRNA with an NMD exon encoding SCN1A protein, whereby the nonsense-mediated RNA decay-inducing exon is eliminated from the NMD exon mRNA encoding the SCN1A protein, thereby increasing the level of processed mRNA encoding the SCN1 A protein and increasing the expression of the SCNIA protein in the cell. Embodiment 216. The method of embodiment 214 or 215, wherein the means:

(a) binds to the target portion of the mRNA with the NMD exon encoding the target protein or functional RNA;

(b) binds to one or more components of the spliceosome, or (c) is a combination of (a) and (b).

Although preferred embodiments of the present invention have been shown and described herein, those skilled in the art will appreciate that such embodiments are presented by way of example only. Those skilled in the art will appreciate that numerous variations, changes and substitutions will occur without departing from the present invention. It should be understood that various alternatives to the embodiments described herein may be used in the practice of the present invention. It is intended that the following claims define the scope of the present invention and that methods and structures within the scope of the claims and their equivalents are thereby covered.

Examples

The present invention will be more specifically illustrated by the following examples. However, it should be understood that the present invention is in no way limited to these examples.

Example 1: Identification of NMD-inducing exon inclusion events in SCN1A transcripts by RNAseq using next-generation sequencing.

Shotgun sequencing of the entire transcriptome was performed using next generation sequencing to reveal a snapshot of transcripts produced by the SCN1A gene to identify NIE inclusion events.

For this purpose, polyA+ RNA was isolated from the nuclear and cytoplasmic fractions of HCN (human cortical neurons) and cDNA libraries were created using Illumina's TruSeq Stranded mRNA library Prep Kit. Libraries were paired-end sequenced, resulting in 100-nucleotide reads that were mapped to the human genome (February 2009, assembly GRCh37/hg19). Sequencing results for SCN1A are shown in FIG. 2. Briefly, in FIG. Figure 2 shows mapped reads visualized using the UCSC Genome Browser (managed by the UCSC Genome Informatics Group (Center for Biomolecular Science and Technology, University of California, Santa Cruz, 1156 High Street, Santa Cruz, CA 95064) and described, for example, by Rosenbloom, et. al., 2015, The UCSC Genome Browser database: 2015 update, Nucleic Acids Research 43, Database Issue, doi: 10.1093/nar/gku1177), and coverage and read counts can be inferred from the peak signals. The height of the peaks indicates the level of expression determined by the density of reads in a particular region. The top panel shows a graphical representation of the SCN1A gene to scale. The level of conservation of 100 vertebrate species is shown as peaks. The highest peaks correspond to exons (black boxes), while no peaks are observed for most introns (lines with arrows). Peaks of conservation were identified in intron 20 (NM_006920), shown in the middle panel. Inspection of conserved sequences identified a 64-bp exon-like sequence. (bottom panel, sequence in grey) flanked by 3' and 5' splice sites (underlined sequence). Inclusion of this exon results in a frameshift and the introduction of a premature termination codon in exon 21, making the transcript a target of NMD.

Exemplary SCN1A gene, pre-mRNA, exon and intron sequences are summarized in Table. 2. The sequence for each exon or intron is summarized in table. 3.

- 62 045521

table 2

List of SCN1A target gene sequences and pre-mRNAs

View SEQ ID NO. Sequence type Human SEQ Ш NO. 1 Gene SCN1A (NC_000002.12) SEQ GO NO. 2 SCN1A pre-mRNA (encoding e.g. SCN1A mRNA NM_006920.5) SEQ ID NO. 3 Exon 20 gene SEQ ID NO. 4 Intron 20 gene SEQ ID NO. 5 Exon 21 gene SEQ ID NO. 6 Exon 20x gene SEQ ID NO. 7 Exon 20 pre-mRNA SEQ ID NO. 8 Pre-mRNA intron 20 SEQ ID NO. 9 Exon 21 pre-mRNA SEQ ID NO. 10 Exon 20x pre-mRNA Mouse SEQ ID NO. eleven Gene SCN1A (NC_000068.7) SEQ ID NO. 12 SCN1A pre-mRNA (encoding, for example, SCNlANM_001313997.1 mRNA) SEQ ID NO. 13 Exon 21 gene SEQ ID NO. 14 Intron 21 gene SEQ ID NO. 15 Exon 22 gene SEQ ID NO. 16 Exon 21x gene SEQ ID NO. 17 Exon 21 pre-mRNA SEQ ID NO. 18 Pre-mRNA intron 21 SEQ ID NO. 19 Exon 22 pre-mRNA SEQ ID NO. 20 Exon 21x pre-mRNA

Table 3

Target exon or intron sequences in SCN1A pre-mRNA transcripts

SEQID NO. Sequence type Subsequence SEQID NO. 7 Exon 20 pre-mRNA GGGAUGAGG SEQID NO. 8 Pre-mRNA intron 20 guaagaaaaaugaaagaaccugaaguauuguauauagccaaaauuaaacuaaauuaaa uuuagaaaaaggaaaaucuaugcaugcaaaaggaauggcaaauucuugcaaaauugcu acuuuauuguuuuaucuguugcauauuuacuucuaggugauaugcaagagaaauag gccucucuugaaaugauaauauaucauuuaucugcugugcuu auuuaaaugacuuua uuuccuaauccaucuugggaguuuccuuacaaaucuauauacaaaaaaaagcugaugc auuauuaaaguacuauguguaaugauauaaugguaaucuaaaguaaauucuauauca gguacuuauucuuugugaugauauacuguacuuaacgaguuuuccugaaaauaaugu gaaucacacaugugccuaaguaugaguguua agaaaaaaaugaaaggaguuguuaaa acuuuugucuguauaaugccaaaguuugcauuauuugaauauauucaagauuagaug guuagauauuaaguguugacugaauuuauaaaacuaguaauacuaacuuaaagauua cauacaaauccacaucauuuuuauaacaauaaaguaaacacuuauaaugaacagaaaa uauaauuuugacuc auuacuauagguaauuuauacauuaaccuuaacuugcaucuua uuggucagagucacacaaaauguuauuuuauccuuuuucaaagaugcaauaaucauuu uccaucaugcauaacagauuagaaauuuugccauuauugacuuauuuuccaugccuu uuuuuacggcaugaagcauuaguuuuauagauauauaauauaaaaauuaguucug cu

- 63 045521

uuuuuuuaaaaaaaaauauuaucaaaacaaaacacugaauugugugauuccaauagaa aaacacugcucuuucaccuccuaagguguaguuacuuuuauggaaacuaagcuguau uguagacuuccauuugcacuuuguagauuguuuuauagccuuauguucucuucucaa gucuuauuauaaaugucacuuuguaagaacguaggacuugu cuucgauuucccuaac auauaugaaaacuuuguccucauuaucgacaacucagaacaauauaauacaaguaguc cucuuuuauuucucacagagagccucaaauuuucaccaaaauguuaacagaaauuauc ucugggguguauaagaauuaagucuguuuuccaauuaaaugucacuuuguuuuguu ucagacuggcaguuucaguucuggagaaaa aaaaugucauuuguguacauucuacuu gaaaacauguugccugaaucaaaauaauauauuuuauauggcuugugaaaucugaac aaugcuaaacauuugaaaauauauauaaccuuuuacauuugaccauuugaaaguuua uuaaauucauuggucaagugcucagauauuuccauacauuacacuucauuucuauaa aaaagcugaucu uaucgguauacuuuuauauuuucucagaaauaaccauaucuauaau uauuaucaauaaugccuuuuauauuaaaagagguuaguuuuuugaaacuuggaguuu uagacauaaaauccuuauaaaugcugauagugauauaacuaauaguuuuaaaugguca gauuuaugaauauggcucuauuccucauaaugacaacauacacagcacuaaa auga cuaaucucuucaauacguguuuggcauuguagagucaaaauaacguuauaauugauu cuauuuuuuauacuucuaguguuuggauauuuuauuuuuguaaaaauauaaucauga augauggugagguuggauauaagaaugaugauuaugauugggaagugagauuugaa caugcucagaaacucucauuuaauucuuugcccuagcagcauaaaauca caauagcug cgucaaagcguaacucaggcacucauuuuauuuuuguuguucuguuauuuuuucaaa gcaugugcuuuuaugcaacauuacugaauaaagcauguuguacagugcuugauaaga aguuagaaaguaacaaauaaauuaucaucacguugcacuuuguguuuugcauguuuu augcacauuucuggcugacagcuuuuuaaacau uuauuguauuucaaauuuccagucc aaauuuuucaacuuguaaaauuaaacugagugaauugaugucgugaauaucuagggu aaaauaaaauuuguguuuaauuuguauuuuuauauuuccuaaccuaggaaaucuuaa auaccuucuuuuucaaaagaacucaagucuuaauggauagggaaacagacggagagca ucaugaa caaaaaguaacaccaaauguucugucauaucagauuucuaacuaauaacaa acuauauauuucuauuuuguauaggauaaucuugcuccaacuuggaugggguggag cgcugguuccuccccugagcccuuuauuauggguacuguauuaccccuuuugcuacc uuuaauccuugcacugugacuuauguguaguggggugagggagggauugggaaggg uacuauuau ugcaccacaguagggaaaauacauuauuuacauccuaauccccucuuuu caauugucuuaaauuucauuuugaaaaaaaaaaaaaccuuuaugaauuuuacccucugug gauuuuaaccccaaugguugauaucuuuauuaaguuucauugaauaugauuuaguua uguguauauggaguuauccaucuuuggggagauuacuggauuggugagggcgg ggg acccugguguagaaugauuaugugaaaaaacaauuuaacuuguuaagcucaugauac uguuugaggcauacagccccugcuguuuaguacauuggucuggguccugaaaauuac caguuagauaccaucaguugauuauugauauguaugagcagauacuagggugcaaua uuucagguuucauaagacugguauugauugugaccacucucauuuuuauugugua a guucauaugggguuauuuucaaaauguuaacaaggcaaaaauauauuaagaaauag uugaauaagcacaugugaauuguguuguaaacaaaaaguuagaauaaaaaaauccacu uauuugaauuaugcagaauagaauacauaccuagaaauaaaacaaaaacgucuuauca ugaguauuaagauaaaauuuaaggcauaaacucacuuc uuagaauaaguaacucccaa cuaacuuucuaggauuuuaaaacauaacacagugaaaacauacauaaacauaacucua cauuuuauuuauucuuaaaguuuaaguguauuauacaagaagaagaguuuauauucg agagacagaaaaagucagaauuuuuuguuuggaucaccaauauaucauagcuuacaaaa aaacugucuuaauuaaaacc cacaacauaauuuuuuuuagauuuuuaagaaagauucua uuauucuucuuuauacuuaaaaauggaugauuccuacuuugcccacuuuuauuuuua uucacauagauuuucuuuuauuucuauuagagaagcacuagaauucaugaauaguguu gauuugaaguucaaaguauuaauucagauaaaaagacauuucugcauguauga aaa uuucuaaugugaauuugcauauuuaauuaucaauccuucauuuaguguagacuuauu uuuaaaaaugcagguaaugaaccagaaauagaauugguugugcuagaguagagaaac uuuauuugauuguuuuugaaaaaaaagcuucugagaagaaacaaccucuaguaca

- 64 045521

guauuauucauuaagauagcuccuuucucagacauuuccuuucauguagccugaaa guucaauuugaaauuuguucuuuccaauuuauucagacuaauucugccuacuuucuu ccccccauaagaaccaauuacugcagcuuuauugagacugaaaaaguuaauacaccu ccuucuuugcugaaccaaggaauggcuuggaacucuugggaa aagacaaucuuuucu augaucuuucauugucuaauuuaauacaucauaaauaugacuauagcuuuguauaau aaacuccccaauacugugccagauguuuucuaagauaaaguuauuuuauguucacaa aaaaaauaaaacuuuucucugggccaaauguaugccaacuuugcaaauucauauccuga agugcacugcugcagaguacaugcuugc gucauaaauuccauagaguucgcuuuaac ucuaaaucaauccccaguuucaaaguaaaccucucaaacauauuaccuaagcacaaacu ucucccugugcucaguuccuuauauuauucucaucccaauauucagaaauaacauuuuaaa aauuaugcuuugaucaauaaauacuaaucuaaacuuugcuucauuaacccauucauu uuugucaaccauu auuuuauuccuauauucaaagcucucgguauguucuuauauuc aagacacucaaggcccuggaagauucacgaacauauguuugcaucuuaaauuuuuag aaaucuuacaaucugucaggauuacacugaacucuaguacagaguaauauggguacc agauaagugggagcaacuuuccacguagacuggaaacagcacuaaugcuauuuaua ggcu acuuucugaacuuaacuuguuuuaaccucauuuuucucauaugccaaaugaga acgcaauacugaauuaucuguacaguucuguucaguacuagaauucugauucuugaa uucaaaggggaaaacauuccucuuuuauuuuggaggcuaaacugggggacaaaguuag gcuccaugaaagaagugcuauuugaacuaaagccuuuaagaggggagaguauuucag a agaggagcuauuagacaaggaauuucaauguaaauggcaucucaaucaccuggcaau uauauuagcacacgguuauuauauauauugaaguggcaugaaguauagaugaccagg gaaguuaaaacuggaaauauagauuguggagugaugugaauaccaagguaagaaaaa uauuuguuaguuaccagagagccaauaauaacuuucaagugggacuuggggaagau uaau ucaucuuacauagauuaaaugaaggagaagguuaggagacagaugacagugca aguaugaaauaacagaggcaguucuagguggugacugugagaauggaaaagaggug gcaaagcugagaaacguuucaaagaaaaaaugagacagguaaugugaaaagaaaau cgagaaauagguauagauaaucaguguucugcucauacucuaaauuggguguugaag gcaa aauacguauuuuaauuaguacucuguguauacacacuagaaacagcauuguaa ucuggauaguggacaaaauauucagaaaagaagggaaauaguaacuugauuucaauu uccaaaucucuaaucugaaagaaaucuaauucuauucauccaauuuuaaaauaaauuaua uaacgagaauuuaugaaguccauuguauuaaugcagacagucagaugagauaa ggca aagugucacgugucagcuuggguaguugcaucggccacaucauuugguucugccugga uaacucaaccaaauuauuuuucauacucauccccuccaccuuugucauuacugguau ucuuauuuucuuuggcccacuuaucacacuguuuuauguuccccagaaggccuagag uucuuuacaggcuuuaaacagggaucagaaguauaagaaauuggcuca uguauuuuu uuuucagacaggcaguuaaaaaaaauuguucuaaaaauacacuggcaucaaauggcaa auagaagauguuuugacgacuacuuccauuggaucagacugacaagaauaauacaagc acauagguggaauuaaacuuagcuauuaauguccaaguuugaggcagcugccccuua uaagcauuuuagggucuguuuuuagcuuc ccucuuagccacuccugugcagcuccag ugggagguauggaggaaaaagcaaggaagccaucccuauguuguuuccaaacaugaa cacucaagauuuuuaacuagugguccagaaguaaagagggggaaaacauccuucuau agaaaaaaaaaaaguagauaauaauugaacacagaacuucaugugaucacaucagau uugagaacuauguauggcaucc cucuuuuucuuauuuuccuaagaaaugauuucuau uauguuucauuugaaauaaguuuuugauuaaacucaguaaaugaaacaacugaca ugacuggagcuugaaauaaacgaugugaugaucuaaugaaauacauaaugcaaauug ucuugcuucuuaugcaaaaauuauuagucauagcaaugcaugaauaauuaaagacaa uu auauuagguauuuaauaauauuuuuuauauuuaucaucugaauuuuuaaguuau uuuaaaaauauauuggucaaaucaacucagguccaaauguuuuaguuuuguucuuua auauauugccuuuuuaaaaugaguuaaacuucuguauaggcuuuuuaacuuuucuu uauucugauaacacaauucugacuucaucuggcag caaguuccucuugauuuuccuuu uccuuuaaccuuuuaaugcuucucccucccuuuuuuuuaaaaacauuuuuguuucau uucuugguuauauugccuauaguuguuuuccuaaguguauugcuuaagaaaaaaaaa

- 65 045521

ugaauuuuaagauuuuuuuugaaccuugcuuuuacauauccuagaauaaauagcauug SEQ ID NO. 9 Exon 21 pre-mRNA gauaaucuugcuccaacuuggaugggguggagcgcugguuccuccccugagcccuuu auuaugg SEQ ID NO. 10 Exon 20x pre-mRNA GUGGUUGUGAAUGCCCUUUUAGGAGCAAUUCCAUCCAU CAUGAAUGUGCUUCUGGUUUGUCUUAUAUUCUGGCUAA UUUUCAGCAUCAUGGGCGUAAAUUUGUUUGCUGGCAAA UUCUACCACUGUAUUAACACCACAACUGGUGACAGGUU UGACAUCGAAGACGUGAAUAAUCAUACUGAUUGCCUAA AACUAAUAGAAAGAAAUGA GACUGCUCGAUGGAAAAAU GUGAAAGUAAACUUUGAUAAUGUAGGAUUUGGGUAUC UCUCUUUGCUUCAAGUU SEQ ID NO. 17 Exon 21 pre-mRNA GGGAUGAGG SEQ ID NO. 18 Pre-mRNA intron 21 guaagaaaaaggaaaacucugcagcguuguauauugucaaagcuaggcugaguucaa cuuaacuaacgaaaaacacgugcaugcaaaaggaauggcaacccuuugcaaacuugcu acuuuacccuuuucucuguugcauauuuacuucuuggugauaugcaagagaaaaucg gccucuuugaaaaugauuuaauauucauuuaucugcuu ugcuaauuaaaaugaccuua guucauaaucgaucuugggaguuuccuuauaauuccuaauacaaagggggaggggca gauacucucuuaaagaacuaaguugagucauguaauaauuaccuagagauaauuuug uuucauaucguucuccucuaugacagcccaucaguacuuaagggauccuauggaaag uaaugugaaucacaauguguaugaauaca aaggaaaaaaugaagaauuguuaaaug uuuugucuuuacaaugccaaaauucucauuuauuugaauauauccaagggcagauauu aaccauugacuggaguaauaauacugccucaacuguaacuaaauuaaugacauuga auaaguaagacacuauuuaauuacuauaaauacauacacaucuuaugacaauacagc ugauaaggaaaaagaacauguauu uuuauucauugccauacauggcucgucaaccuu aacuuaaaccucgguucucaguuacacagaguuuuauguugcucuuuugagcaaagc auuauuccccucuccauauucaacacguaucagauuuuugcauuuauuggcucauu guuaugaugauuauuucaaagcauuauacaaucauuuauagaagaugugccguguga aaauuauuu uuuuauuaagauccaaaauuuacgcucuuuaaaccaaucagaugaaau guauaaggcaaagagugcucauuguccugacacuuacaaaccaaggcuccaacaaaca ggcuccucuugcaccacauagagggcuuucagccuguguccccccauaaaaaccuau uauaaauuuuauuauacuauacuguaagaaaccuguccaauuuuuauuucucu agc acauaugaaaacuucucuucaguagauccaaguaagcacaaaggagcuuugauucuca cacaagaaaucaauuuguauuaaaaauguaucauaaauuuucucccaauuaugcaaa acuuaaaugcuuuuccaauuaaaagagcacuuucguuucagaauagcaauuucaguu gucaaggaaaacauuguuuuuauacauuuuaua uaaaaauacaugagcuaaauuuaa auucacauuuuucaacuuuuuaugguuuuuuauguuucuuuuucuuucgcauuuu uuaacaauccagccauuaccucuccuccugucccccuccuaaguuucucauucucau uccuccuccccccuugccucugagaggaugcucccucccucacuaggccucccucuucc ccagg gcuucaaguuccucaaggauuauacacaucuucucccacugagaccaggccag gcaguccucugcuucugcccagccuguguauguuccugcuugguagcucagucucug gaagcucccuggggucuggguuaguugggacugcuggucuuccuauggaguuaccc uccccuucaacuucuucaauccuuccccuaauucaaccacagguauccagacuucagu ccaa ugguugaguguaaauauuggcaucugucucugucagcuguuguuaggggcuc agaggacagccaugcuaggcuccugccuacaagcagcacaccauaacaucaguaauag ugucaggccuuuaaugaauaaugcuacguauauaagguuguuagauuauacuucaac uuugaucuuuuagaauauuauuaaauccagucguuuauuuuuuauguaauauug acuuuc cauaacaaaugagucuauuuuccuuuuguguagaaauaacuuuaucaauua

- 66 045521

uuguuaauaaugcuuuugucaauuauuguugauaugcuucucuuuuuuaaaacugg agucaucaaaacaaaaauucuggguagauauuacgaagcugacuccuuggucagcuu ggcacauagugagaccacaaauaucucaaggucacggcaauuccucaccaccaguuug gcauugugaagucaaaaccaaccuucuguugauucugguuuuuguauu ucuaguau gagacauuuucuacuuuguaagaguauauaacuguggauggcggcgagguugggca ugaugaugauuguaagcgggaagugagcuagaguaucuucagaaacucucacuuuau ccuccuuggcagcauagaaccgcaaucgcuguguccgagugucaaccaggcagucau uuuguuuuggguuuuugucacucuuucaaagcaugugcuucuacg caacacuacca aacacagcaugcugcauagugcuugagaaggaguuagaaaguaacaaacgaguuauca ucacguugcccuuuguguuuugcaugucuuaugcacacuuuuggcugacagcuuuu gaacauuuauuguauuucaaauuuccaguccaaauuuuuuuuucaacuugugaaauu gaacggaaugaaccgaugucgugaauaccuagg gucaaauaaaacuuguauuuuaaau ucguaguuuuaauuucccaagcugggaaaaucguaaaaaccuuuuccaaagaacucaa gucuuaguugcuagggaaacaggcagugagcaucauauacaaaaaguaacaccaaaug uucugucauaucagcuuucuaacuaauaauaaacuauauauuucuauuuuauagg auaaucuug cuccaacuuggaugggguggagcggugguuccuccccucagcccuuua uuauggguacuguauuaccccuuuugcuaccuuuuaauccuugcacugugacuuaugu guagugggauugagggagggagugggaaggguacaauugcaccacaguagggacaau acaggauuuauuuccaaauccacuacuuuuuaaugagcuuaaacuucuuuugggaaaa aaaaa guuaucucugacuuaccaucuguggauuauaaccccagaaguacauaucuuua uuacguuucacugaauaugauuuagcuauuuauacuucauuguccauuuauggggaa auuacucaauuggugagggugggggacccugguguaggaugcugaugaaaacguuu ucauuugucaagcucaugguagugacagagcauauaguccuuauuuuuucaacacac ugcuc uggucccucaaugggccagucacauuccaucaguugaucguugaugugcg agcaguggcuaaagguacaacaggccagguaucucaggguugccaaugguuaugauc auucucaucuuuauugcauaaaaauguguuauuugcagaaaguagcaaggcaagauc ccugugaaacaagggaauacaaaaaaaaaaaaagaugugcuuuaagu uauaaaaccaa aacaugugaaaagucaacuucauugaaguauaaagaauaggauaugcaugaaaaacaa aaaaaucaugagcacuaagaaauugguguauaagccaacuccuuguaagcuaccccaa uuaacuucccagaaucuuagaaggcaucacagugcaccccaaaauaaaaagccaaacu gacacuucugcuuccucuuaaaauguaggagucuugg auaagaaagauaauuuuuau uguuuggaagaaaaaaaaauuguuuggauaauugaggcauuuaucuaucaaaaauau uuaucuuauauaaaauuucacaacugauuuaguuguuggcuuuucuaaaaauuuuu uauauuucauauuaagaacucaugauuuuuuacuuuccauuuuuuuaaauucuuauuca cauauggu uuuucucuauuucuuagaaaagcuauagaacccaugguuuccggugacu uaaaaaacuaaucuaaaugucuucacuuagaugauacuuucaaaugcacugaaauuuc uaauaucaacaagaauauuugccugguccuaauuuuucacugauuuaauaaaaagua ugaacccuaaagaagaaauagacuugaagaacugguugugugacaauacagaa auucu gcugggagauguccuuuuaaaacauuguuagaagagacaaccucuacaauccacccau uaagcauacuucucucuuagacaucuccuuuuuauguaccuuauaaccucaauguguu cuuuccaauugacuuagaccaacacuucccagcgcaucccacaugggagccaauuacu gacucccuagagacugcaaagaauuaauauuguagaaccaagggaugguugggcu cuugggagaggcaauccguuugugaucuuuugcucuggauguuaaugaaaucgcaac uuuaaguggauuuucaguggcaaauccucugauccuaugccaaauguucucuaagac aaacauccuuguaaaauaaaugucucacugggccaaaucuauggcaaauuugcacguu uuccugaacugcauuccuauauaguauuugccauccugaauucacuaa ugggcauua cuuuuauauucaaaaccagucccuucuucaaaggaaaucucucccauuuauuacauuau gcaaacugcuuucuuaugcagugguuaaauccuuagccaggcaaguaugaggacugg aauuuggauauccagaacccucagaaaugucggaugggcauaguagcuuacauguaa uuccagagcuagaaagaugaaacuagcccuguccuca agcucugaauucaguuggug caauaaauaagaaagaauccccccccccgaccccuacaucucuuuccucuacaucuaua cauguauuucccaauacagcucuaugcuuccacauauaugcucacauaugugcaugcac

- 67 045521

acuugcacacauauguacacuugacacauugaagcaucauaaucuaacaauuggaaua uaagaaaauauuuaacuuucacacagagcagucagagaaaaccauaagagguugaaac ucuugaaaaaacuugcaggauaaacagaaaagaguaugagaugccaauucuggucuac uuucugaaccuaacuuguuuuaccuucauuagucuaauuuuccaaau gaaccccaag caccaaauuguccuuauugcucuuuccaguacuaaauuaauauuccucaauucgaag gcaaacacucucaucuuuguuaaggauguguagaguuagacucaauaaacgacaugu auauuugagcuaaagccuggaggagggagauuauuucaagggcaaguacuuggcagg gaguuucaaagaaagaaggcucucaauucucagacuaacaccuuagcg uggagugac ugucacagaggagggugaaguguaugucaccaguuagggaagcugaaaggggaaaug uaucaggcuugugagaauccuucagcagccaagucuagcaccugagcacaauccccag aacugaccccacaugguggaaaggagaggaauaauuccugcaaauuuuccugugacc uccacccaagugcuauagaaaaugcaugcaugcccacaugcacacacaaaua aacauag uugcaaacuguuuuggaaaaauaaccucacaaacugucgagugauguaaugccaaa gaaagagaaauguuuucuaauggcuagagaaccauuaaggaauuuuucaaaauggga caugggauagauaauuuaguauccauacugaaagaaggcaagcaaauaaaaucugau aagaauguauucuuaguaaccgaggacagagcgaagauaga gaacagggccaauggc caagguggaaagguuugaaggaagcagcaugaaaccuacagacuuguaccaaaaugu ucagugucaugaguguuaaaagugaaaagcuugcauguuaguauggauuucauaucc ucggcagacagagcaccucacugagagugggagaugaaguauucagaaaugagaaac aacuacucaauuucaguguucauaucucaaauccaauaaacaacuu uagggguacaau uuuuuaaaaaauuacauuaaaauguuuuuaaaucucuucuuaauaauuuuaaaauua aauugaaaauaacuuuuaaaaaguaauauauacaggaaagccugugugcuaauuuuuu agggaggccauaaagggagauaguugcucauuaauuucuacacaucagccuaucuuu ggcuucugccuugauagc gcacucugaauuaucuucuucauguucaucccucaucuu uauuguuacugguuucauuucccuuggccacauagcccacuauuuuguauuccccaa uggauauuguuccuuacaaaguucagccagggcucagaaguacaaggaauuggcucu uauacuucugucagacaggcaaaaacuucuaaaauuauacuauaauaaaaaucaaaga gaugauauuc auaauuaaacuaacaaaaguggcaggcccccccucccccaacaugagu agaauuaaucugacguccauguucaagucugaaacacacuugccaauuaagagcacau uagggccagccuuuaucucccucuuaguuacuaaugugcaguucaauggugagcuau agagaaggaagccaagacuaccauaugucaaauauaaaaaaaaaaaucccauuua aa ucuguagucccgaauuaaggacaagagagagggaaauaucuuugacauuagaaaaug gagaaaauauuuuagcacaggacuuuacucagucacaucagaguugauaaguacgua ugacaucccucuuuuuccuguuuuccugagaaaaugaucucucuaguguuucauuua agauaaguuuauugaauuaaacucaguaaaugaaacaacugaca ugacuggagcuug aaauaaacgaugugaugaucuacugaaauacaugaugcuaaauugucuugcuucuua ugcaaaaacuacuauuaguuauagcaaugcauggauaauuaaggccaaaaauauauua gauguuaaaaauaguuuuauauuuauacaucugaauuuuauauuuauuuaaaguau auugguccaaucaaucaugcccaaaugu uuuaguucuauucuuugagauacuguuu uguuuugggauuuuuuuuuaugagcuaaucucuugccuaggaguuccuacuucucu cuccuccuuuuauuuuuucuaauaaacuacacaugugucuucauccaggagcuaacu ucucccauuuugcuuuuccuuuagcaccuuuuuuauauuagauuuuuucuuu ucu ccaucucuuugcauauugccuauauuucuuuuccuaagcauaauauuuuaaaaaagac ugaguuuuauguuaagauuauuucugcuuugcucuuacacagauaggauaaguagu cuugauagaaaauaaaucaaugauuccuagggggaugucuuuuugcuuuuaaucaau aaggauucugacuucucuuucucuccauuuguguau uag SEQ ID NO. 19 Exon 22 pre-mRNA gauaaucuugcuccaacuuggaugggguggagcggugguuccuccccucagcccuuu auuaugg SEQ ID NO. 20 Pre-mRNA exon 2 lx GUGGUUGUGAAUGCCCUGUUAGGAGCAAUUCCAUCCAU CAUGAAUGUGCUUCUGGUUUGCCUUAUAUUCUGGCUAA UUUUCAGCAUCAUGGGCGUAAAUUUGUUUGCUGGCAAA UUCUACCACUGUGUUAACACCACAACUGGUGACAUAUU

UGAGAUCAGCGAAGUCAAUAAUCAUUCUGAUUGCCUAA AACUAAUAGAAAGAAAUGAGACCGCCCGGUGGAAAAAU GUGAAAGUAAACUUUGAUAAUGUAGGAUUUGGGUAUC UUUCUUUGCUUCAAGUU

Example 2 Confirmation of NIE using cycloheximide treatment.

RT-PCR analysis using cytoplasmic RNA from DMSO-treated (CHX-) or cycloheximide-treated (CHX+) mouse Neuro 2A (Fig. 3A) and RenCell VM (human neuroprogenitor cells) (Fig. 3B) cells and primers in exon 20 and exon 23 confirmed the presence of a band corresponding to the NMD-inducing exon (20x). The identity of the product was confirmed by sequencing. Densitometric analysis of bands was performed to calculate the percentage inclusion of exon 20x of the total SCN1A transcript. Treatment of RenCell VM with cycloheximide (CHX+) to inhibit NMD resulted in a 2-fold increase in the product corresponding to the NMD-inducing exon 20x in the cytoplasmic fraction (see light gray bar, CHX−, dark gray bar, CHX+).

Example 3. Bypass of the ASO region of exon 20x of SCN1A.

Graphical representation of an ASO walk performed for targeting sequences to the SCN1A exon 20x region, just upstream of the 3' splice site, through the 3' splice site, exon 20x, through the 5' splice site, and downstream of the 5' site splicing using the 2'-MOE ASO, PS backbone, is shown in FIG. 4. ASO was designed to cover these regions by shifting 5 nucleotides at a time. The list of ASOs targeting SCN1A is summarized in Table. 4. ASO sequences are summarized in Table. 5a and 5b and 6a and 6b.

- 68 045521

List of ASOs targeting SCN1A

Table 4

Gene SEQ ID NO. Pre-mRNA SEQ ID NO. ASO SEQ ID NO. NIE SEQ ID NO. 1 SEQ ID NO. 2 SEQ ID NO: 21-67, 210-256 Exon 20x SEQ ID NO. eleven SEQ ID NO. 12 SEQ ID NO: 68-114, 257-303 Exon 2lx

Table 5 a

ASO sequences targeting human SCN1A

SEQ ID NO. Sequence name ASO sequence 21 SCN1A-IVS19X-81 GATGCTCTCCGTCTGTTT 22 SCN1A-IVS19X-76 TTCATGATGCTCTCCGTC 23 SCN1A-IVS19X-71 TTTTGTTCATGATGCTCT 24 SCN1A-IVS19X-66 TTACTTTTTTGTTCATGAT 25 SCN1A-IVS19X-61 TGGTGTTACTTTTTGTTC 26 SCN1A-IVS19X-56 ACATTTGGTGTTACTTTT 27 SCN1A-IVS19X-51 ACAGAACATTTGGTGTTA 28 SCN1A-IVS19X-46 ATTGACAGAACATTTGG 29 SCN1A-IVS19X-41 ATCTGATATGACAGAACA thirty SCN1A-IVS19X-36 TAGAAATCTGATATGACA 31 SCN1A-IVS19X-31 TTAGTTAGAAATCTGATA 32 SCN1A-IVS19X-26 TGTTATTAGTTAGAAATC 33 SCN1A-IVS19X-21 TAGTTTGTTATTAGTTAG 34 SCN1A-IVS19X-16 ATATATAGTTTGTTATTA 35 SCN1A-IVS19X-11 TAGAAATATATAGTTTGT 36 SCN1A-IVS19X-6 CAAAATAGAAAATATATAG 37 SCN1A-IVS19X-3 ATACAAAATAGAAATATA 38 SCN1A-IVS19X-1 CTATACAAAATAGAAATA 39 SCN1A-I19X/E20X+2 TCCTATACAAAATAGAAA 40 SCN1A-I19X/E20X+4 TATCCTATACAAAATAGA 41 SCN1A-I19X/E20X+6 ATTATCCTATACAAAATA 42 SCNlA-Ex20X+l AGTTGGAGCAAGATTATC 43 SCNlA-Ex20X+6 ATCCAAGTTGGAGGCAAGA 44 SCNlA-Ex20X+l 1 ACCCCATCCAAGTTGGAG 45 SCNlA-Ex20X+16 GCTCCACCCCATCCAAGT 46 SCNlA-Ex20X+21 CCAGCGCTCCACCCCATC 47 SCNlA-Ex20X-24 GAACCAGCGCTCCACCCC 48 SCNlA-Ex20X-19 GGGAGGAACCAGCGCTCC 49 SCNlA-Ex20X-3 ATAATAAAGGGCTCAGGG 50 SCNlA-Ex20X-l CCATAATAAAGGGCTCAG 51 SCN1A-E20X/I20X-6 GTAATACAGTACCCATAA 52 SCN1A-E20X/I20X-4 GGGTAATACAGTACCCAT 53 SCN1A-IVS20X+13 TTAAAGGTAGCAAAAGGG 54 SCN1A-IVS20X+18 AAGGATTAAAGGTAGCAA 55 SCN1A-IVS20X+23 AGTGCAAGGATTAAAGGT 56 SCN1A-IVS20X+28 GTCACAGTGCAAGGATTA 57 SCN1A-IVS20X+33 CATAAGTCACAGTGCAAG 58 SCN1A-IVS20X+38 CTACACATAAGTCACAGT 59 SCN1A-IVS20X+43 CCCCACTACACATAAGTC 60 SCN1A-IVS20X+48 CCTCACCCCACTACACAT 61 SCN1A-IVS20X+53 CCCTCCCTCACCCCACTA 62 SCN1A-IVS20X+58 CCAATCCCTCCCTCACCC 63 SCN1A-IVS20X+63 CCTTCCCAATCCCTCCCT 64 SCN1A-IVS20X+68 AGTACCCTTCCCAATCCC 65 SCN1A-IVS20X+73 ATAATAGTACCCTTCCCCA 66 SCN1A-IVS20X+78 GTGCAATAATAGTACCCT 67 SCN1A-IVS20X+83 CTGTGGTGCAATAATAGT

- 69 045521

Table 5b

ASO sequences targeting human SCN1A

SEQ Ш NO. Sequence name ASO sequence 210 SCN1A-IVS19X-81 GAUGCUCUCCGUCUGUUU 211 SCN1A-IVS19X-76 UUCAUGAUGCUCUCCGUC 212 SCN1A-IVS19X-71 UUUUGUUCAUGAUGCUCU 213 SCN1A-IVS19X-66 UUACUUUUUGUUCAUGAU 214 SCN1A-IVS19X-61 UGGUGUUACUUUUUGUUC 215 SCN1A-IVS19X-56 ACAUUUGGUGUUACUUUU 216 SCN1A-IVS19X-51 ACAGAACAUUUGGUGUUA 217 SCN1A-IVS19X-46 AUAUGACAGAACAUUUGG 218 SCN1A-IVS19X-41 AUCUGAUAUGACAGAACA 219 SCN1A-IVS19X-36 UAGAAAAUCUGAUAUGACA 220 SCN1A-IVS19X-31 UUAGUUAGAAUCUGAUA 221 SCN1A-IVS19X-26 UGUUAUUAGUUAGAAAUC 222 SCN1A-IVS19X-21 UAGUUUGUUAUUAGUUAG 223 SCN1A-IVS19X-16 AUAUAUAGUUUGUUAUUA 224 SCN1A-IVS19X-11 UAGAAAUAUAUAGUUUUGU 225 SCN1A-IVS19X-6 CAAAAUAGAAAAUAUAUAG 226 SCN1A-IVS19X-3 AUACAAAAUAGAAAUAUA 227 SCN1A-IVS19X-1 CUAUACAAAAUAGAAAUA 228 SCN1A-I19X/E20X+2 UCCUAUACAAAAUAGAAA 229 SCN1A-I19X/E20X+4 UAUCCUAUACAAAAUAGA 230 SCN1A-I19X/E20X+6 AUUAUCCUAUACAAAAUA 231 SCNlA-Ex20X+l AGUUGGAGCAAGAUUAUC 232 SCNlA-Ex20X+6 AUCCAAGUUGGGAGCAAGA 233 SCNlA-Ex20X+l 1 ACCCAUCCAAGUUGGAG 234 SCNlA-Ex20X+16 GCUCCACCCCAUCCAAGU 235 SCNlA-Ex20X+21 CCAGCGCUCCACCCCAUC 236 SCNlA-Ex20X-24 GAACCAGCGCUCCACCCC 237 SCNlA-Ex20X-19 GGGAGGAACCAGCGCUCC 238 SCNlA-Ex20X-3 AUAAUAAAGGGCUCAGGG 239 SCNlA-Ex20X-l CCAUAAUAAAGGGCUCAG 240 SCN1A-E20X/I20X-6 GUAAUACAGUACCCAUAA 241 SCN1A-E20X/I20X-4 GGGUAAUACAGUACCCAU 242 SCN1A-IVS20X+13 UUAAAGGUAGCAAAAGGG 243 SCN1A-IVS20X+18 AAGGAUUAAAGGUAGCAA 244 SCN1A-IVS20X+23 AGUGCAAGGAUUAAAGGU 245 SCN1A-IVS20X+28 GUCACAGUGCAAGGAUUA 246 SCN1A-IVS20X+33 CAUAAGUCACAGUGCAAG 247 SCN1A-IVS20X+38 CUACACAUAAGUCACAGU 248 SCN1A-IVS20X+43 CCCCACUACACAUAAGUC 249 SCN1A-IVS20X+48 CCUCACCCCACUACACAU 250 SCN1A-IVS20X+53 CCCUCCCUCACCCCACUA 251 SCN1A-IVS20X+58 CCAAUCCCUCCCUCACCC 252 SCN1A-IVS20X+63 CCUUCCCCAAUCCCUCCCU 253 SCN1A-IVS20X+68 AGUACCCUUCCCAAUCCC 254 SCN1A-IVS20X+73 AUAAUAGUACCCUUCCCA 255 SCN1A-IVS20X+78 GUGCAAUAAUAGUACCCU 256 SCN1A-IVS20X+83 CUGUGGUGCAAUAAUAGU

- 70 045521

Table 6a

ASO sequences targeting mouse SCN1A

SEQ Ш NO. Sequence name ASO sequence 68 mScnla-IVS20X-81 GATGCTCACTGCCTGTTTT 69 mScnla-IVS20X-76 TATATGATGCTCACTGCC 70 mScnla-IVS20X-71 TTTTGTATATGATGCCTCA 71 mScnla-IVS20X-66 TTACTTTTTTGTATATGAT 72 mScnla-IVS20X-61 TGGTGTTACTTTTTGTAT 73 mScnla-IVS20X-56 ACATTTGGTGTTACTTTT 74 mScnla-IVS20X-51 ACAGAACATTTGGTGTTA 75 mScnla-IVS20X-46 ATTGACAGAACATTTGG 76 mScnla-IVS20X-41 AGCTGATATGACAGAACA 77 mScnla-IVS20X-36 TAGAAAGCTGATATGACA 78 mScnla-IVS20X-31 TTAGTTAGAAAGCTGATA 79 mScnla-IVS20X-26 TATTATTAGTTAGAAAGC 80 mScnla-IVS20X-21 TAGTTTATTATTAGTTAG 81 mScnla-IVS20X-16 ATATATAGTTTATTATTA 82 mScnla-IVS20X-l 1 TAGAAATATATAGTTTTAT 83 mScnla-IVS20X-6 TAAAATAGAAAATATATAG 84 mScnla-IVS20X-3 ATATAAAATAGAAATATA 85 mScnla-IVS20X-l CTATATAAAATAGAAATA 86 mScnla-I20X/E21X+2 TCCTATATAAAATAGAAA 87 mScnla-I20X/E21X+4 TATCCTATATAAAATAGA 88 mScnla-I20X/E21X+6 ATTATCCTATATAAAAATA 89 mScnla-Ex21X+l AGTTGGAGCAAGATTATC 90 mScnla-Ex21X+6 ATCCAAGTTGGAGGCAAGA 91 mScnla-Ex21X+ll ACCCCATCCAAGTTGGAG 92 mScnla-Ex21X+16 GCTCCACCCCATCCAAGT 93 mScnla-Ex21X+21 CCACCGCTCCACCCCATC 94 m S cn 1 a-Ex21X-24 GAACCACCGCTCCACCCC 95 mScnla-Ex21X-19 GGGAGGAACCACCGCTCC 96 mScnla-Ex21X-3 ATAATAAAGGGCTGAGGG 97 mScnla-Ex21X-l CCATAATAAAGGGCTGAG 98 mScnla-E21X/I21X-6 GTAATACAGTACCCATAA 99 mScnla-E21X/I21X-4 GGGTAATACAGTACCCAT 100 mScnla-IVS21X+13 TTAAAGGTAGCAAAAGGG 101 mScnla-IVS21X+18 AAGGATTAAAGGTAGCAA 102 mScnla-IVS21X+23 AGTGCAAGGATTAAAGGT 103 mScnla-IVS21X+28 GTCACAGTGCAAGGATTA 104 mScnla-IVS21X+33 CATAAGTCACAGTGCAAG 105 mScnla-IVS21X+38 CTACACATAAGTCACAGT 106 mScnla-IVS21X+43 TCCCACTACACATAAGTC 107 mScnla-IVS21X+48 CTCAATCCCACTACACAT 108 mScnla-IVS21X+53 CCTCCCTCAATCCCACTA 109 mScnla-IVS21X+58 CACTCCCTCCCTCAATCC 110 mScnla-IVS21X+63 CTTCCCACTCCCTCCTC 111 mScnla-IVS21X+68 GTACCCTTCCCACTCCCT 112 mScnla-IVS21X+73 CAATTGTACCCTTCCCAC FROM mScnla-IVS21X+78 TGGTGCAATTGTACCCTT 114 mScnla-IVS21X+83 TACTGTGGTGCAATTGTA

Table 6b

ASO sequences targeting mouse SCN1A

SEQ ID NO. Sequence name ASO sequence 257 mScnla-IVS20X-81 GAUGCUCACUGCCUGUUU 258 mScnla-IVS20X-76 UAUAUGAUGCUCACUGCC 259 mScnla-IVS20X-71 UUUUGUAUAUGAUGCUCA 260 mScnla-IVS20X-66 UUACUUUUUGUAUAUGAU

- 71 045521

261 mScnla-IVS20X-61 UGGUGUUACUUUUUGUAU 262 mScnla-IVS20X-56 ACAUUUGGUGUUACUUUU 263 mScnla-IVS20X-51 ACAGAACAUUUGGUGUUA 264 mScnla-IVS20X-46 AUAUGACAGAACAUUUGG 265 mScnla-IVS20X-41 AGCUGAUAUGACAGAACA 266 mScnla-IVS20X-36 UAGAAAGCUGAUAUGACA 267 mScnla-IVS20X-31 UUAGUUAGAAAGCUGAUA 268 mScnla-IVS20X-26 UAUUAUUAGUUAGAAAGC 269 mScnla-IVS20X-21 UAGUUUAUUAUUAGUUAG 270 mScnla-IVS20X-16 AUAUAUAGUUUAUUAUUA 271 mScnla-IVS20X-l 1 UAGAAAUAUAUAGUUUAU 272 mScnla-IVS20X-6 UAAAAUAGAAAAUAUAUAG 273 mScnla-IVS20X-3 AUAUAAAAUAGAAAUAUA 274 mScnla-IVS20X-l CUAUAUAAAAUAGAAAUA 275 mScnla-I20X/E21X+2 UCCUAUAUAAAAUAGAAA 276 mScnla-I20X/E21X+4 UAUCCUAUAUAAAAUAGA 277 mScnla-I20X/E21X+6 AUUAUCCUAUAUAAAAAAUA 278 mScnla-Ex21X+l AGUUGGAGCAAGAUUAUC 279 mScnla-Ex21X+6 AUCCAAGUUGGGAGCAAGA 280 mScnla-Ex21X+l 1 ACCCAUCCAAGUUGGAG 281 mScnla-Ex21X+16 GCUCCACCCCAUCCAAGU 282 mScnla-Ex21X+21 CCACCGCUCCACCCCAUC 283 mScnla-Ex21X-24 GAACCACCGCUCCACCCC 284 mScnla-Ex21X-19 GGGAGGAACCACCGCUCC 285 mScnla-Ex21X-3 AUAAUAAAGGGCUGAGGG 286 mScnla-Ex21X-l CCAUAAUAAAGGGCUGAG 287 mScnla-E21X/I21X-6 GUAAUACAGUACCCAUAA 288 mScnla-E21X/I21X-4 GGGUAAUACAGUACCCAU 289 mScnla-IVS21X+13 UUAAAGGUAGCAAAAGGG 290 mScnla-IVS21X+18 AAGGAUUAAAGGUAGCAA 291 mScnla-IVS21X+23 AGUGCAAGGAUUAAAGGU 292 mScnla-IVS21X+28 GUCACAGUGCAAGGAUUA 293 mScnla-IVS21X+33 CAUAAGUCACAGUGCAAG 294 mScnla-IVS21X+38 CUACACAUAAGUCACAGU 295 mScnla-IVS21X+43 UCCACUACACAUAAGUC 296 mScnla-IVS21X+48 CUCAAUCCCACUACACAU 297 mScnla-IVS21X+53 CCUCCCUCAAUCCCACUA 298 mScnla-IVS21X+58 CACUCCCUCCCUCAAUCC 299 mScnla-IVS21X+63 CUUCCCACUCCCUCCCUC 300 mScnla-IVS21X+68 GUACCCUUCCCACUCCCU 301 mScnla-IVS21X+73 CAAUUGUACCCUUCCCAC 302 mScnla-IVS21X+78 UGGUGCAAUUGUACCCCUU 303 mScnla-IVS21X+83 UACUGUGGUGCAAUUGUA

Example 4. ASO walk across the SCN1A exon 20x region assessed by RT-PCR.

ASO walking sequences can be assessed, for example, using RT-PCR. In fig. 5A is an exemplary PAGE showing SYBR-safe stained RT-PCR products treated with mock SCN1A (placebo), treated with SMN control ASO (SMN), or treated with 2'-MOE ASO targeting the exon 20x region as described herein in the Example 3 and in the description of FIG. 4, at a concentration of 20 μM in RenCell VM cells via gymnosis. Two products corresponding to exon 20x inclusion (top band) and full length (exon 20x exclusion, bottom band) were quantified, and the percentage of exon 20x inclusion is plotted on a histogram (Fig. 5B). The black line indicates no change relative to placebo. Full size products also

- 72045521 was normalized to the internal control RPL32, and the fold change relative to placebo is depicted in the histogram (Fig. 5C). The black line shows a ratio of 1 and no change relative to placebo.

Example 5. ASO walk across the SCN1A exon 20x region assessed by RT-qPCR.

SCN1A SYBR-green RT-qPCR amplification results normalized to RPL32 obtained using that NIE ASO uptake experiment assessed using SYBRsafe RT-PCR as shown in FIG. 6 are presented as fold change relative to placebo, confirming the results of SYBR-safe RT-PCR. The black line indicates a ratio of 1 (no change relative to placebo).

Example 6: Dose-dependent effect of selected ASO in SCN-treated cells.

In fig. 8A shows a typical PAGE showing SYBR-safe stained RT-PCR products from Sen1a mice treated with mock (placebo, RNAiMAX only) or treated with Ex21x+1 2'-MOE ASO targeting exon 21x (mouse nomenclature, corresponding to human exon 20x) , at concentrations of 30 nM, 80 nM and 200 nM in Neuro 2A (mouse neuroblastoma) cells via RNAiMAX transfection. Ex21x+1 (mouse nomenclature) and Ex20x+1 (human nomenclature) are identical. Two products corresponding to exon 21x inclusion (top bar) and full length (exon 21x exclusion, bottom bar) were quantified, and the percentage of exon 21x inclusion is plotted on a histogram (Fig. 8B). Full-length products were also normalized to the internal HPRT control, and fold changes relative to placebo are plotted in a histogram (Fig. 8C). The black line shows a ratio of 1 and no change relative to placebo.

Example 7 Intravitreal (IVT) administration of selected ASOs.

In fig. 9A shows PAGE of SYBR-safe stained mouse Scn1a RT-PCR products from the left eye (-) injected with PBS (1 μl) or the right eye (+) injected with IVS20x-21, Ex21x+1, IVS21x+18 , IVS21x+33 or Ser290 (negative control ASO; Gerard et al, Mol. Ther. Nuc. Ac, 2015) 2'-MOE ASO (1 μl) at a concentration of 10 mM. Ex21x+1, IVS21x+18 and IVS21x+33 (mouse nomenclature) and Ex20x+1, IVS20x+18 and IVS20x+33 (human nomenclature) are identical. Two products corresponding to exon 21x inclusion (top band) and full length (exon 21x exclusion, bottom band) were quantified, and the percentage of exon 21x inclusion is presented in FIG. 9B. White bars correspond to ASO-injected eyes and gray bars correspond to PBS-injected eyes, n=5 in each group. Full-length products were normalized to the internal control GAPDH, and the fold change of the ASO-injected eye relative to the PBS-injected eye is shown in FIG. 9C. The black line shows the ratio of 1 and no change relative to PBS, n=5 in each group.

Example 8: Intracerebroventricular (ICV) injection of selected ASOs.

In fig. 10A shows PAGE of SYBR-safe stained mouse Scn1a RT-PCR products from brain without injection (-, no ASO control) or with injection of 300 μg Ser290 (negative ASO control; Gerard et al, Mol. Ther. Nuc. Ac, 2015) , Ex21x+1, IVS21x+18, IVS21x+33 2'-MOE ASO. Ex21x+1, IVS21x+18 and IVS21x+33 (mouse nomenclature) and Ex20x+1, IVS20x+18 and IVS20x+33 (human nomenclature) are identical. Two products corresponding to exon 21x inclusion (top bar) and full length (exon 21x exclusion, bottom bar) were quantified, and the percentage of exon 21x inclusion is plotted in the histogram in FIG. 10B, n=6 (each targeted ASO), n=5 (Cep290 ASO), n=1 (no injection, no ASO control). Taqman PCR was performed using two different probes covering junctions of exons 21 and 22, and the products were normalized to the internal control GAPDH, and the fold change of ASO-injected brains relative to Ser290-injected brains was plotted in the histogram in FIG. 10C. Black line indicates ratio 1 and no change relative to Cep290, n=6 (each ASO targeted), n=5 (Cep290 ASO), n=1 (no injection, no ASO control).

In fig. 11 shows an exemplary dose response from ICV injection of selected ASO mice in C57BL6J mice (male, 3 months). In fig. 11A shows PAGE gels of SYBR-safe stained Scn1a RT-PCR products from mouse brains injected with 300 μg of Ser290 (ASO negative control; Gerard et al, Mol. Ther. Nuc. Ac, 2015) or brains injected with 33 μg, 100 µg and 300 µg Ex21x+1 2'-MOE ASO. Ex21x+1 (mouse nomenclature) and Ex20x+1 (human nomenclature) are identical. Two products corresponding to exon 21x inclusion (top band) and full length (exon 21x exclusion, bottom band) were quantified. In fig. 11B is a graph showing the percentage of exon 21x inclusion from the data in FIG. 11A, n=5 (each group). In fig. 11C depicts a graph from the results of a Taqman qPCR assay performed using two different probes covering junctions of exons 21 and 22. Products were normalized to the internal control Gapdh and the fold change of ASO-injected brains was plotted relative to Ser290-injected brains. Black line indicates ratio 1 and no change relative to Ser290, n=5 (each group).

In fig. 12 shows exemplary results of ICV injection of a selected ASO into C57BL6J mice (postnatal day 2). In fig. 12A shows PAGE gels of SYBR-safe stained Scnla RT-PCR products from mouse brains without injection (-, no ASO control) or heads

- 73 045521 brain with injection of 20 μg Ex21x+1 2'-MOE ASO. Two products corresponding to exon 21x inclusion (top band) and full length (exon 21x exclusion, bottom band) were quantified. Ex21x+1 (mouse nomenclature) and Ex20x+1 (human nomenclature) are identical. In fig. 12B is a graph showing the percentage of exon 21x inclusion from the data in FIG. 12A, n=4 (each group). In fig. 12C depicts a graph from the results of a Taqman qPCR assay performed using two different probes covering junctions of exons 21 and 22. Products were normalized to the internal control Gapdh, and the fold change of ASO-injected brains was plotted relative to brains without ASO control. Black line indicates ratio 1 and no change relative to non-ASO control, n=4 (each group).

Example 9: Targeted enhancement of nuclear gene product for the treatment of Dravet syndrome.

Dravet syndrome (DS) is a devastating childhood genetic disorder characterized by severe seizures, cognitive and motor impairment, and death. The main cause of DS is decreased expression of the alpha subunit of voltage-gated sodium channel type 1 (Nav1.1). The nonproductive splicing event of SCN1A is conserved in humans and mice. In fig. 13A is a graph showing the percentage of exon 21x inclusion in the indicated mouse CNS samples. In fig. 13B is a graph showing the percentage of exon 20x inclusion in the indicated human CNS samples. In this study, antisense oligonucleotide (ASO) therapy was used to increase productive Scn1a mRNA and consequently restore Nav1.1 protein content.

In fig. 14A is a graph showing the percentage reduction in exon 21x inclusion at the indicated doses (n=3-6 per group). In fig. 14B is a graph showing the percentage increase in Scn1a mRNA at the indicated doses (n=3-6 per group). In fig. 14C is a graph showing the percentage increase in Nav1.1 protein at the indicated doses (n=2 per group).

In fig. 15A is a graph showing the percentage reduction in exon 21x inclusion at the indicated doses (n=4 per group). In fig. 15B is a graph showing the percentage increase in Scn1a mRNA at the indicated doses (n=4 per group).

In fig. 16 depicts a selected Scn1a-targeting ASO administered at a dose of 10 μg via ICV injection in postnatal day 2 mice assessed on day 5 post-injection by Taqman qPCR SCN1A, SCN2A, SCN3A, SCN4A, SCN5A, SCN7A, SCN8A, SCN9A , SCN10A and SCN11A to evaluate target selectivity. Gapdh-normalized Taqman-qPCR amplification results obtained using Ex20x+1 ASO are presented as fold change relative to PBS-treated mice (n=3-6 per group).

In fig. 17 shows illustrative results of intracerebroventricular (ICV) injection on postnatal day 2 of a selected ASO at the indicated dose in F1 wild-type (WT) or heterozygous Dravet syndrome (NET) mice from 129S-Scn1a ^tm1Kea x C57BL/6J crosses 3 days after injection. (n =9-14 per group). In fig. 17A is a plot of the results of a Taqman qPCR assay performed using probes spanning exons 21 and 22. Products were normalized to the internal control Gapdh, and the fold change of ASO-injected brains was plotted relative to PBS-injected brains. In fig. 17B is a graph from the results of a Western blot performed using an anti-Nav1.1 antibody. Products were normalized to Ponceau-stained bands, and the fold change of ASO-injected brains was plotted relative to PBS-injected brains.

Fig. 19 is a graph showing the increase in Scn1a mRNA in frontal sections of mouse brain over time after ICV injection of the SCN1A-targeting ASO. As depicted, the increase in Scn1a mRNA, quantified by Taqman qPCR, was maintained for at least 80 days after injection (n=3-9 per group). Fig. 20 is an exemplary survival curve demonstrating a 100% survival benefit provided by targeting SCN1A ASO in a mouse model of Dravet syndrome. WT and Dravet syndrome heterozygous (+/-) mice, F1 offspring from 129S-scn1a ^tm1Kea x C57BL/6J crosses, received a single blind injection of ICV 20 μg PBS or ASO (treatment designated A or B) on postnatal day 2 , and their survival was monitored. As depicted, mice in group A +/- (mice with Dravet syndrome treated with PBS) began to die from approximately 16 days after birth, while all mice in the other three groups, including group B +/- (mice with Dravet syndrome treated treatment with ASO) survived for at least 35 days after birth (n=32-39 per group). In fig. 18 shows exemplary results of an ASO microwalk across the SCN1A exon 20x region of RenCells via free uptake. The ASOs were designed to cover the areas around the three previously identified target ASOs in FIG. 6 (marked with asterisks) by shifting 1 nucleotide at a time (6-41) or reducing the length of ASO 17 (1-5). The graph shows the percentage inclusion of exon 20x measured by SYBR-green qPCR. The black line indicates no change relative to no ASO (-). ASO sequences are summarized in Table. 7a and 7b.

- 74 045521

Table 7 a

ASO sequences targeting human SCN1A

ID ASO Sequence 5’-3’ SEQIDNO: 1 TTGGAGCAAGATTATC 304 2 GTGGAGCAAGATTATC 305 3 GTTGGAGCAAGATTAT 306 4 AGTTGGAGGCAAGATTAT 307 5 AGTTGGAGCAAGATTA 308 6 GATTATCCTATACAAAAT 309 7 AGATTATCCTATACAAAA 310 8 AAGATTATCTCTATACAAA 311 9 CAAGATTATCCTATACAA 312 10 GCAAGATTATCCTATACA 313 eleven AGCAAGATTATCCTATAC 314 12 GAGCAAGATTATCCTATA 315 13 GGAGCAAGATTATCCTAT 316 14 TGGAGCAAGATTATCCTA 317 15 GTTGGAGCAAGATTATCC 318 16 TTGGAGCAAGATTATCCT 319 18 AAGTTGGAGCAAGATTTAT 320 19 CAAGTTGGAGCAAGATTA 321 20 CCAAGTTGGAGGCAAGATT 322 21 TCCAAGTTGGAGCAAGAT 323 22 AGTACCCATATAAAAGGG 324 23 AATACAGTACCCATAATA 325 24 ATTAAAGGTAGCAAAAGG 326 25 GATTAAAGGTAGCAAAAG 327 26 GGATTAAAGGTAGCAAAA 328 27 AGGATTAAAGGTAGCAAA 329 29 CAAGGATTAAAGGTAGCA 330 thirty GCAAGGATTAAAGGTAGC 331 31 TGCAAGGATTAAAGGTAG 332 32 GTGCAAGGATTAAAGGTA 333 33 AGTCACAGTGCAAGGATT 334 34 AAGTCACAGTGCAAGGAT 335 35 TAAGTCACAGTGCAAGGA 336 36 ATAAGTCACAGTGCAAGG 337 38 ACATAAGTCACAGTGCAA 338 39 CACATAAGTCACAGTGCA 339 40 ACACATAAGTCACAGTGC 340 41 TACACATAAGTCACAGTG 341

- 75 045521

Table 7b

ASO sequences targeting human SCN1A

ID ASO Sequence 5’ -3’ SEQ ID NO: 1_U UUGGAGCAAGAUUAUC 342 2_U GUUGGAGCAAGAUUAUC 343 3_U GUUGGAGCAAGAUUAU 344 4_U AGUUGGAGCAAGAUUAU 345 5_U AGUUGGAGCAAGAUUA 346 6U GAUUAUCCUAUACAAAAU 347 7_U AGAUUAUCCUAUACAAAAA 348 8U AAGAUUAUCCUAUACAAA 349 9 U CAAGAUUAUCCUAUACAA 350 10U GCAAGAUUAUCCUAUCACA 351 11U AGCAAGAUUAUCCUAUAC 352 12 U GAGCAAGAUUAUCCUAUUA 353 13U GGAGCAAGAUUAUCCUAU 354 14 U UGGAGCAAGAUUAUCCUA 355 15U GUUGGAGCAAGAUUAUCC 356 16U UUGGAGCAAGAUUAUCCU 357 18U AAGUUGGAGCAAGAUUAU 358 19U CAAGUUGGAGCAAGAUUA 359 20U CCAAGUUGGAGCAAGAUU 360 21 U UCCAAGUUGGAGCAAGAU 361 22U AGUACCCAUAAUAAAGGG 362 23U AAUACAGUACCCAUAAUA 363 24U AUUAAAGGUAGCAAAAGG 364 25 U GAUUAAAGGUAGCAAAAG 365 26 U GGAUUAAAAGGUAGCAAAA 366 27_U AGGAUUAAAGGUAGCAAA 367 29U CAAGGAUUAAAAGGUAGCA 368 30 U GCAAGGAUUAAAGGUAGC 369 31 U UGCAAGGAUUAAAGGUAG 370 32 U GUGCAAGGAUUAAAGGUA 371 33_U AGUCACAGUGCAAGGAUU 372 34 U AAGUCACAGUGCAAGGAU 373

35 U UAAGUCACAGUGCAAGGA 374 36 U AUAAGUCACAGUGCAAGG 375 38_U ACAUAAGUCACAGUGCAA 376 39U CACAUAAGUCACAGUGCA 377 40 U ACACAUAAGUCACAGUGC 378 41 U UACACAUAAGUCACAGUG 379

Although preferred embodiments of the present invention have been shown and described herein, those skilled in the art will appreciate that such embodiments are presented by way of example only. Those skilled in the art will appreciate that numerous variations, changes and substitutions will occur without departing from the present invention. It should be understood that various alternatives to the embodiments described herein may be used in the practice of the present invention. It is intended that the following claims define the scope of the present invention and that methods and structures within the scope of the claims are thereby covered

-

Claims (59)

inventions and their equivalents. CLAIM 1. A method of enhancing the expression of the Nav1.1 protein in a cell containing a pre-mRNA that contains a nonsense-mediated RNA decay-inducing exon (NMD exon) and encodes the Nav1.1 protein, providing for contact of a therapeutic agent with the cell, whereby the therapeutic agent promotes exclusion the NMD exon of the Nav1.1 protein-encoding pre-mRNA, thereby increasing the content of the processed Nav1.1 protein-encoding mRNA, wherein the therapeutic agent is an antisense oligomer (ASO) or a vector containing the sequence encoding the ASO; ASO contains a sequence that is complementary to the target portion of the pre-mRNA that contains the NMD exon and that encodes the Nav1.1 protein; The NMD exon is located in the region from GRCh37/hg19: chr2:166,863,740 to GRCh37/hg19: chr2:166,863,803; and where the target part is: (i) is located within the intronic sequence flanking the NMD exon; (ii) at least partially overlaps with the NMD exon or (iii) is within the NMD exon. 2. A method of treating a disease or condition in a subject in need thereof by enhancing the expression of the Nav1.1 protein in a cell of the subject, comprising contacting the cell of the subject with a therapeutic agent that promotes the exclusion of a nonsense-mediated RNA decay exon (NMD exon) from pre-mRNA in a cell that contains the NMD exon and encodes the Nav1.1 protein, thereby increasing the content of processed mRNA encoding the Nav1.1 protein and increasing the expression of the Nav1.1 protein in the cell of the subject; wherein the disease or condition is associated with reduced expression or function of the Nav1.1 protein encoded by the SCN1A gene in the subject; the therapeutic agent is an antisense oligomer (ASO) or vector containing an ASO coding sequence; ASO contains a sequence that is complementary to the target portion of the pre-mRNA that contains the NMD exon and that encodes the Nav1.1 protein; The NMD exon is located in the region from GRCh37/hg19: chr2:166,863,740 to GRCh37/hg19: chr2:166,863,803; and wherein the specified target part is: (i) is located within the intronic sequence flanking the NMD exon; (ii) at least partially overlaps with the NMD exon or (iii) is within the NMD exon. 3. The method according to claim 1 or 2, in which the therapeutic agent: (a) communicates with the specified target part; (b) modulates the binding of a factor involved in the exclusion of the NMD exon from pre-mRNA; or (c) is a combination of (a) and (b). 4. The method of claim 3, wherein the therapeutic agent prevents the binding of a factor involved in NMD exon exclusion from the target region. 5. The method according to claim 3, wherein the target part is proximal to the NMD exon. 6. The method of claim 5, wherein the target portion is at most about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, about 50 nucleotides upstream from the 5' end of the NMD exon. 7. The method of claim 5, wherein the target portion is at least about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, about 50, approximately 40, approximately 30, approximately 20, approximately 10, approximately 5 nucleotides, approximately 4, approximately 2, approximately 1 nucleotide upstream from the 5' end of the NMD exon. 8. The method of claim 5, wherein the target portion is at most about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, about 50 nucleotides downstream of the 3' end of the NMD exon. 9. The method of claim 5, wherein the target portion is at least about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, about 50, approximately 40, approximately 30, approximately 20, approximately 10, approximately 5 nucleoti - 77 045521 nucleotides, approximately 4, approximately 2, approximately 1 nucleotide downstream from the 3' end of the NMD exon. 10. The method of claim 3, wherein the target portion is located in an intronic region between two canonical exonic regions of the Nav1.1 encoding mRNA with an NMD exon, and wherein the intronic region contains an NMD exon. 11. The method of claim 3, wherein the target portion at least partially overlaps with the NMD exon. 12. The method of claim 3, wherein the target portion at least partially overlaps with an intron upstream of the NMD exon. 13. The method according to claim 3, wherein the target portion comprises a 5' NMD exon-intron junction or a 3' NMD exon-intron junction. 14. The method according to claim 3, in which the target part is located within the NMD exon. 15. The method of claim 3, wherein the target portion comprises approximately 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the NMD exon. 16. The method of claim 1 or 2, wherein the Nav1.1 protein-encoding pre-mRNA contains a sequence with a sequence identity of at least about 80%, 85%, 90%, 95%, 97%, or 100% to any of the SEQ IDs NO: 2 or 7-10. 17. The method of claim 1 or 2, wherein the Nav1.1 protein-encoding pre-mRNA is encoded by a genetic sequence with a sequence identity of at least about 80%, 85%, 90%, 95%, 97%, or 100% to SEQ ID NO : 1 or 3-6. 18. The method of claim 5, wherein the target portion is at most about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, about 50 nucleotides upstream of the genomic site GRCh37/hg19: chr2:166863803. 19. The method of claim 5, wherein the target portion is located at approximately 500, approximately 400, approximately 300, approximately 200, approximately 100, approximately 80, approximately 70, approximately 60, approximately 50, approximately 40, approximately 30, approximately 20, approximately 10, approximately 5 nucleotides, approximately 4, approximately 2, approximately 1 nucleotide upstream of the genomic site GRCh37/hg19: chr2:166863803. 20. The method of claim 5, wherein the target portion is at most about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, about 50 nucleotides downstream of the genomic site GRCh37/hg19: chr2:166863740. 21. The method of claim 5, wherein the target portion is located at approximately 500, approximately 400, approximately 300, approximately 200, approximately 100, approximately 80, approximately 70, approximately 60, approximately 50, approximately 40, approximately 30, approximately 20, approximately 10, approximately 5 nucleotides, approximately 4, approximately 2, approximately 1 nucleotide downstream of the genomic site GRCh37/hg19: chr2:166863740. 22. The method of claim 3, wherein the target portion of the Nav1.1 protein-coding pre-mRNA contains a sequence with a sequence identity of at least 80%, 85%, 90%, 95%, 97%, or 100% to a region containing at least at least 8 contiguous nucleic acids with the sequence SEQ ID NO: 2 or 7-10. 23. The method of claim 1 or 2, wherein the ASO contains a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any of SEQ ID NOs: 32-35, 39, 40, 42- 45, 49-51, 54-59, 66, 221-224, 228, 229, 231-234, 238-240, 243-248, 255, 304-308, 312-316, 318-324, 326-335, 337-346, 350-354, 356-362, 364-373 or 375-379. 24. The method according to claim 3, in which the target portion of the Nav1.1 protein-coding pre-mRNA is located in the NMD exon. 25. The method according to claim 3, wherein the target portion of the Nav1.1 protein-coding pre-mRNA with the NMD exon is located upstream or downstream of the NMD exon. 26. The method according to claim 3, wherein the target part of the pre-mRNA contains an exon-intron junction of the NMD exon. 27. The method of claim 1, wherein exclusion of the NMD exon from the processed mRNA encoding the Nav1.1 protein in a cell exposed to the therapeutic agent is increased by a factor of from about 1.1 to about 10 times, from about 1 .5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times , about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about - 78 045521 approximately 5 times, approximately 2 to approximately 6 times, approximately 2 to approximately 7 times, approximately 2 to approximately 8 times, approximately 2 to approximately 9 times, approximately 3 to approximately 6 times, approximately 3 times up to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 to about 7 times, about 4 to about 8 times, about 4 to about 9 times, at least about 1.1, at least about 1.5, at least about 2, at least about 2.5, at least about 3, at least about 3.5, at least about 4, at least about 5-fold or at least about 10-fold compared to the exclusion of the NMD exon from the processed Nav1.1 protein-encoding mRNA in a control cell. 28. The method according to claim 1, wherein the therapeutic agent increases the content of processed mRNA encoding the Nav1.1 protein in the cell. 29. The method of claim 1, wherein the amount of processed mRNA encoding the Nav1.1 protein in the cell contacted with the therapeutic agent is increased by a factor of about 1.1 to about 10 times, from about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about 6 times, about 2 to about 7 times times, about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, from about 4 to about 7 times, from about 4 to about 8 times, from about 4 to about 9 times, at least about 1.1, at least about 1.5, at least about 2, according to at least about 2.5, at least about 3, at least about 3.5, at least about 4, at least about 5, or at least about 10 times the total the amount of processed mRNA encoding the Nav1.1 protein in the control cell. 30. The method according to claim 1, wherein the therapeutic agent increases the expression of the Nav1.1 protein in the cell. 31. The method of claim 1, wherein the amount of Nav1.1 protein produced in a cell contacted with the therapeutic agent is increased by a factor of about 1.1 to about 10 times, about 1.5 to about 10 times , about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, from about 1.1 to about 8 times, from about 1.1 to about 9 times, from about 2 to about 5 times, from about 2 to about 6 times, from about 2 to about 7 times, from about 2 to about 8 times, about 2 to about 9 times, about 3 to about 6 times, about 3 to about 7 times, about 3 to about 8 times, about 3 to about 9 times, about 4 times to about 7 times, from about 4 to about 8 times, from about 4 to about 9 times, at least about 1.1, at least about 1.5, at least about 2, at least about 2.5, at least about 3, at least about 3.5, at least about 4, at least about 5, or at least about 10 times the total amount of Nav1 protein .1 produced in the control cage. 32. The method of claim 2, wherein the disease or condition is induced by a loss of function mutation in Nav1.1. 33. The method of claim 32, wherein the disease or condition is associated with haploinsufficiency of the SCN1A gene, wherein the subject has a first allele encoding functional SCN1A and a second allele from which SCN1A is not produced or is produced in reduced amounts, or a second allele encoding non-functional SCNIA or partially functional SCNIA. 34. The method of claim 32, wherein the disease or condition is encephalopathy. 35. The method of claim 34, wherein the encephalopathy is epileptic encephalopathy. 36. The method of claim 32, wherein the disease or condition is Dravet syndrome (DS); severe myoclonic epilepsy of infancy (SMEI) - borderline form (SMEB); febrile seizures (FS); epilepsy, generalized, with febrile seizures plus (GEFS+); epileptic encephalopathy, early childhood, 13; cryptogenic generalized epilepsy; cryptogenic focal epilepsy; epilepsy with myoclonic-astatic seizures; Len syndrome - 79 045521 Knox-Gastaut; West syndrome; idiopathic seizures; early myoclonic encephalopathy; progressive myoclonic epilepsy; alternating hemiplegia of childhood; unclassified epileptic encephalopathy; sudden unexpected death in epilepsy (SUDEP); sick sinus syndrome 1; autism or malignant migratory partial seizures of infancy. 37. The method of claim 36, wherein GEFS+ is generalized epilepsy with febrile seizures plus type 2. 38. The method of claim 36, wherein the febrile seizures are febrile seizures, familial, 3A. 39. The method of claim 36, wherein the SMEB is SMEB without generalized spikewave (SMEB-SW), SMEB without myoclonic seizures (SMEB-M), SMEB without more than one feature of SMEI (SMEB-O), or persistent childhood epilepsy with generalized tonic-clonic seizures (ICEGTC). 40. The method according to claim 32, wherein the therapeutic agent promotes the exclusion of the NMD exon from the processed mRNA encoding the Nav1.1 protein and increases the expression of SCN1A in the cell. 41. The method according to claim 1 or 2, wherein the ASO contains a backbone modification containing a phosphorothioate linkage or a phosphorodiamidate linkage. 42. The method according to claim 1 or 2, wherein the ASO contains a morpholino phosphorodiamidate, a blocked nucleic acid, a peptide nucleic acid, a 2'-O-methyl, 2'-fluoro or a 2'-O-methoxyethyl moiety. 43. The method according to claim 1 or 2, wherein the ASO contains at least one modified sugar moiety. 44. The method according to claim 1 or 2, in which the ASO consists of from 8 to 50, from 8 to 40, from 8 to 35, from 8 to 30, from 8 to 25, from 8 to 20, from 8 to 15, from 9 to 50, from 9 to 40, from 9 to 35, from 9 to 30, from 9 to 25, from 9 to 20, from 10 to 50, from 10 to 40, from 10 to 35, from 10 to 30, from 10 to 25, from 10 to 20, from 10 to 15, from 11 to 50, from 11 to 40, from 11 to 35, from 11 to 30, from 11 to 25, from 11 to 20, from 11 to 15, 12 to 50, 12 to 40, 12 to 35, 12 to 30, 12 to 25, or 12 to 15 nucleotide bases. 45. The method according to claim 3, wherein the ASO is at least 80, at least 85, at least 90, at least 95, at least 98, at least 99 or 100% complementary to the target part of the Nav1.1 protein-coding pre-mRNA. 46. The method of claim 1, wherein the method further comprises assessing the expression of SCNIA mRNA or protein. 47. The method according to claim 2, wherein the subject is a human. 48. The method of claim 2, wherein the subject is a non-human animal. 49. The method of claim 2, wherein the subject is a fetus, embryo or child. 50. The method according to claim 1 or 2, in which the cells are ex vivo. 51. The method of claim 2, wherein the therapeutic agent is administered to the subject by intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravitreal or intravenous injection. 52. The method of claim 2, wherein the method further comprises administering a second therapeutic agent to the subject. 53. The method of claim 52, wherein the second therapeutic agent is a small molecule. 54. The method of claim 52, wherein the second therapeutic agent is an ASO. 55. The method of claim 54, wherein the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to any of SEQ ID NO: 115-161. 56. The method of claim 52, wherein the second therapeutic agent eliminates intron retention. 57. The method of claim 2, wherein the disease or condition is Alzheimer's disease, SCN2A encephalopathy, SCN8A encephalopathy, or SCN5A arrhythmia. 58. The method of claim 28 or 30, wherein the disease or condition is Alzheimer's disease, SCN2A encephalopathy, SCN8A encephalopathy, or SCN5A arrhythmia. 59. The method of claim 1 or 2, wherein the ASO is linked to a moiety that includes a denucleotide nucleotide, a polyether, a polyamine, a polyamide, a peptide, a carbohydrate, a lipid or a polycarbon compound or an anti-transferrin receptor antibody. -