EA045050B1 - OPTIMIZED VECTOR-HOST SYSTEM FOR OBTAINING PROTECTIVE MONO- AND POLYVALENT SUBUNIT VACCINE BASED ON YEAST KLUYVEROMYCES LACTIS - Google Patents

Description

Field of technology

The present invention relates to recombinant yeast Kluyveromyces lactis (K. lactis), which is characterized by highly efficient expression of one or more foreign proteins and which is suitable for use as a vaccine intended to generate a protective immune response to pathogens. In particular, the present invention provides K. lactis strains for the targeted cloning of nucleic acids encoding a foreign antigen into the genome of the yeast strain K. lactis, characterized in that the K. lactis strain, as an alternative or complement to the KlLAC4 locus, in the KlURA3- locus 20 (KLLA0E2277lg) and/or the KlMET5-1 locus (KLLA0B03938g) contain integrated expression cassettes for foreign antigens. The present invention further relates to integrable expression vectors and a method for producing K. lactis strains of the present invention, as well as their use as a vaccine.

Prerequisites for creating the invention

Vaccines are used to prevent diseases (prophylactic vaccines) or to treat established diseases (immunotherapeutic vaccines). Over the past 100 years or so, preventive vaccination programs have contributed to significant reductions in the incidence of infectious diseases. The development of vaccine-based immunotherapies dates back only about 20 years and has been used, for example, against chronic infections caused by viruses, bacteria or parasites, or against cancer. The purpose of vaccination is to induce a cellular (i.e. essentially T cell and NK cell driven) and/or humoral (i.e. essentially B cell/antibody driven) immune response and immune memory (memory) against antigenic components pathogens or malignant (tumor) cells.

Classic vaccines contain the entire pathogen in an attenuated (inactivated) or killed form, including its genetic material, i.e. nucleic acids in the form of DNA or RNA. In most cases, the production of these classical inoculation agents requires special safety precautions and/or the use of infectious organisms and/or cell cultures; In addition, often these grafting agents must be stored and transported in an expensive manner and using cold chains. In addition, when using classical means for vaccination, there is a risk that the means obtained (for example, using a laboratory animal or cell culture) will cause side effects in the vaccinated individual or that undesirable reactivation of the pathogen will occur. There are also problems with diagnosis. For example, if farm animals are vaccinated with whole pathogens, the vaccinated animals will not differ from naturally infected animals, so early warning systems based on the detection of new infections cannot be used. For this reason, so-called subunit vaccines have been developed, in which only certain components of the pathogen are vaccinated. A prerequisite for their use is that the main antigens of the corresponding pathogen are known. Most often, the main antigens are surface components of the pathogen that can be recognized by the immune system, for example, viral envelope proteins or viral capsid proteins. These core antigens can induce a humoral and/or cellular immune response and immune memory against the virus in the host, even in the absence of an intact viral particle. Since other components of the pathogen are absent during vaccination with a subunit vaccine, differential diagnosis can distinguish between vaccinated and naturally infected individuals (differentiation of infected and vaccinated animals (DIVA)); accordingly, the term subunit marker vaccine is used. Disadvantages of many subunit vaccines are that they are often difficult to obtain and often lack immunogenicity. Although the pathogens themselves can be efficiently cultured (subject to the limitations noted above), their essential antigens must be obtained through expensive and largely ineffective genetic engineering and complex purification processes. The subunit vaccines thus obtained are therefore biological material which has a short shelf life and often must be stored and transported refrigerated. For these reasons, most mass vaccination of farm animals is still based on the classical principle of using the whole pathogen.

Widespread avian infectious bursitis (IBD) is caused, for example, by infectious bursitis virus (IBDV), a non-enveloped virus with a double-stranded, segmented RNA genome from the family Birnaviridae. Most vaccines against IBD are based on attenuated (weakened) or inactivated viruses. However, a problem arises here in that highly attenuated non-inactivated live viruses, as well as inactivated viruses, although they provide protection against IBD viruses with intermediate pathogenicity, this does not happen in the case of highly virulent strains of IBD viruses (vvIBDV). Until recently, highly virulent attenuated viruses (intermediate hot strains) were used to protect

- 1 045050 from vvIBDV, but these graft strains are characterized by side effects in the form of immunosuppression due to temporary damage to B cells in the bursa of Fabricius, a lymphatic organ (Rautenschlein et al. (2005)). However, even these intermediate hot vaccines do not provide complete protection against the newly discovered vvIBDV strains (Negash et al. (2012); Kasanga et al. (2007)). Additionally, one problem with vaccination with strong attenuated live viruses is that maternal antibodies interfere with viral replication and therefore the induction of an immune response. Thus, effective grafting with these grafting agents is only possible three weeks after hatching (Kumar et al. (2000); Rautenschlein et al. (2005)).

For example, influenza A viruses are among the most important viral pathogens in the world (Short et al. (2015); Silva et al. (2012)). Influenza viruses belong to the Orthomyxoviridae family; they are enveloped viruses with single-stranded, segmented RNA as their genome. Like most RNA viruses, influenza viruses also undergo a high mutation rate. In particular, reassortment of viral RNA segments results in the formation of viral progeny with new genetic and biological properties (Short et al. (2015)). Because of this rapid evolution, a problem with vaccination against influenza viruses arises in part because the existing vaccine does not work against new variants of the virus that have emerged. Accordingly, efforts have been made for a long time to develop vaccines that would provide cross- and therefore long-term protection against different influenza variants (Steel et al. (2010); Krammer and Palese (2013); Kirchenbaum and Ross (2014); Berthoud et al. (2010); al (2011)).

Bovine viral diarrhea virus (BVDV) is a widespread pathogen of artiodactyls. BVDV is a member of the genus Pestivirus of the Flaviviridae family. The single-stranded RNA genome of these viruses is also subject to a high mutation rate. In addition, pregnant animals can also transmit the infection to the fetus, and due to immunological tolerance, animals with persistent infection (PI) are born. Such PI animals further spread this virus further, and mutations of the virus can lead to 100% mortality as a result of the so-called viral diarrhea. Here too, there have been long-term attempts to develop vaccines that provide cross- and long-lasting protection against different variants of the BVD virus (Ridpath (2015)).

An effective subunit vaccine can eliminate or overcome these problems. In most cases, the subunits are protein components of pathogens; they can be produced through genetic engineering in a variety of host cells. In addition to the intestinal bacterium Escherihia coli, mammalian cells or insect cells, plant cells and various fungi, which can be propagated in cell culture, have become widely used as host systems for the expression of heterologous proteins. Systems based on microorganisms such as bacteria and fungi can be cultivated on a large scale at particularly low cost.

Yeast cells from the yeast genera Saccharomyces, Pichia and Kluyveromyces have been routinely used for decades to express foreign proteins. The advantage of yeast cells over bacteria is that they are eukaryotes, i.e. they resemble in many aspects animal cells and eukaryotic proteins, i.e. proteins that are produced and/or need to be functionalized in animal cells can be produced inexpensively in yeast in native or near-native form (Bathurst (1994); Gellissen & Hollenberg (1997)). Initially, yeast was used only for the production of foreign proteins; in this case, after expression, the proteins were purified from yeast cells and used as a subunit vaccine. Only recently have attempts been made to introduce yeast itself or a cellular fraction of yeast as a vaccine. A yeast vaccine is accordingly a particle of yeast that contains immunologically effective components of the pathogen (antigens) and which, when administered (eg, subcutaneously, intramuscularly or orally/mucosally) into the host, induces a specific immune response against these antigens and, therefore also against the pathogen from which these antigens are derived. Desirably, an immunological memory is induced in the vaccinated organisms, which, in the event of a subsequent infection (contamination), prevents the reproduction and/or spread of the corresponding pathogens and/or mitigates the pathological consequences of the infection. As stated above, antigens are generally structural proteins of pathogens wherein coding nucleic acid sequences (antigen-encoding genes) are genetically engineered into yeast cells and cause the expression of one or more such structural proteins. The recombinant yeast thus obtained in live form (yeast cells), after inactivation and drying in powder form (yeast particles) or after destruction of the cell structure and homogenization (yeast lysate) constitutes a yeast-based vaccine. After the vaccine is administered, the antigens are recognized by the immune system and induce humoral and/or cellular immune protection.

Vaccination with a yeast-based vaccine is known to one skilled in the art. A number of patent applications and US patents, such as US 20090304741 A1, US 5830463 A, US 7465454 B2 and US 20070166323 A1, describe the use of Saccharomyces cerevisiae (S.

- 2 045050 cerevisiae), which contain at least one recombinant antigen. This yeast has been shown to be effective in stimulating an immune response, particularly a cell-mediated immune response.

WO 2006044923 discloses yeast (S. cerevisiae) which recombinantly express various hepatitis C virus (HCV) proteins and which can induce an immune response, mainly a T cell response, against these HCV proteins and can be used as vaccines against chronic hepatitis C.

WO 2007092792 describes the potential use of recombinant yeast S. cerevisiae against influenza virus infection, using a combination of different yeast strains, the use of which leads to the induction of T cells, thereby leading to a cellular immune response.

WO 20101054649 and WO 2013107436 describe the use of Kluyveromyces lactis strains containing specific antigens to provide a protective humoral immune response following oral/mucosal or subcutaneous administration of whole killed yeast cells. Recent patents contain application examples in which recombinant K. lactis strains that were derived from the parent strain VAK367-D4 were successfully used for vaccination.

The possibility of using recombinant yeast Kluyveromyces lactis for vaccination is known to one skilled in the art. (Arnold et al. (2012)); WO 20101054649 and WO 2013107436). In application examples, it can be seen that subcutaneous administration of K. lactis yeast, which expresses the capsid protein VP2 of infectious bursitis virus (IBDV) intracellularly through an expression cassette under the control of the LAC4 promoter, induces a humoral immune response that provides effective protection against viral infection. This may be shown for the moderately pathogenic IBD virus, but has not yet been found for the highly virulent IBDV (vvIBDV). Previous data have shown that the efficacy of a yeast vaccine can be increased by increasing the intracellular concentration of viral antigen (Arnold et al. (2012)). One technical option to provide increased antigen concentration is to introduce an additional copy of the transcription activator gene KlGAL4-1 (alternative name LAC9-1) by integrating plasmid pLI-1 (Krijger et al. (2012) and WO 2013107436) into the IBDV-expressing strain. VP2 (deposited strains DSM 25406 and DSM 25407). Consequently, until now, the creation of such K. lactis vaccine strains has been based on two genetic interventions: the first was the integration of a foreign antigen-encoding gene, the second was the integration of the KlGAL4-1 gene. However, in the form that is used in practice today, the latter also regularly leads to the integration of tandem plasmid repeats, which leads not only to a cytotoxic effect as a result of strong overexpression of the activator (Breunig 1989), but also to different copy numbers of the KlGAL41 and ScURA3 genes in vaccine strains created in this way.

The strategy described in the above application examples (Arnold et al. (2012); WO 20101054649 and WO 2013107436), which consists of expressing a foreign gene using an unmodified LAC4 promoter, has the disadvantage that even under non-inducing conditions minimal expression of the foreign gene occurs, those. the promoter is to a certain extent prone to spontaneous activation. This effect is even more pronounced with increasing dose of the KlGAL4-1 gene. Accordingly, in the case of proteins that, when heterologously expressed, have a cytotoxic effect (cytopathic effect, CPE) on yeast cells, biomass production during cultivation, for example during a fed-batch fermentation process, can be greatly limited. In particular, for such cases it is necessary to find alternative pathways that ensure the lowest possible gene expression under non-inducing conditions.

Various subunit vaccines are effective only when not one, but several subunits of the pathogen are used for vaccination. By using multiple antigen subunits for vaccination, cross-protection against different variants of the pathogen can be further significantly increased. Co-expression of the same or different antigens can also be used to further increase the concentration of antigen in the yeast cell or to produce a vaccine that protects against different pathogens.

The above strains are generally auxotrophic strains, which often grow less well in complete media than prototrophic strains. Accordingly, the rapid conversion of auxotrophic yeast strains into a prototrophic form can lead to improved growth properties.

Description of the invention

The purpose of the present invention was to provide new vaccine strains of K. lactis that can overcome the shortcomings of the current state of the art. In particular, provision is made for recombinant K. lactis strains that contain a limited number of copies of the KlGAL4-1 gene integrated at a specific site in the genome. In addition, provision is made for strains in which, under non-inducing conditions, no or only slight expression of a foreign protein is allowed, while expression of several copies of the antigen is allowed

- 3 045050 or the expression of several antigens in a yeast cell, which are better suited for cultivation and can be effectively used in protective vaccination against pathogens. It is assumed that heterologous genes that encode active immunomodulatory proteins (antigens) are integrated into certain sites in the K. lactis genome. When selecting a desired clone with an integrated foreign gene, resistance genes should not be used as a selectable marker. In addition, provision is made for the formation of prototrophic strains from auxotrophic strains in the simplest possible way. This should also facilitate simplified fermentation of vaccine yeast strains obtained in a synthetic medium without additives.

These goals were achieved by providing a modular system containing new vectors and new genetically modified variants of the yeast K. lactis and allowing the creation of graft strains optimized for specific properties of protein antigens. By modularly replacing DNA elements between vectors, efficient regular cloning of regions encoding foreign antigen into the yeast genome was achieved, regardless of the foreign gene to be expressed. Thanks to the targeted integration of relevant foreign genes into the genome, yeast strains are stable and genetically defined for many generations. Due to these properties, the fermentation method is reproducibly carried out under non-selective conditions and can be standardized. The optimization of the yeast K. lactis according to the present invention was to control the level of protein production so that it was as high as possible, but at the same time that it did not exceed the limit at which the cytopathic effect of the antigens significantly interferes with the fermentation method . This was achieved using genetic intervention or using a combination of several genetic interventions:

i) increasing the concentration of lactose-inducible transcriptional activator, ii) targeted modification of the LAC4 promoter and/or iii) gradually increasing gene dosage for the foreign gene encoding the antigen.

The optimization of the yeast K. lactis according to the present invention also involved the introduction of iv) several new integration sites for foreign gene encoding cassettes into the yeast genome to be able to express multiple antigens simultaneously.

In a preferred embodiment, the object of the present invention is achieved by providing a K. lactis strain for the targeted cloning of nucleic acids encoding a foreign antigen into the genome of a yeast strain of K. lactis, characterized in that the K. lactis strain has an alternative or complementary KH locus. AC4 locus KlURA3-20 (KLLA0E2277lg) and/or locus KlMET5-1 (KLLA0B03938g) contain integrated expression cassettes for foreign antigens. It is particularly advantageous when the K. lactis strain contains integrated expression cassettes for foreign antigens in the KlURA3-20 locus (KLLA0E2277lg) and/or the KlMET5-1 locus (KLLA0B03938g) in addition to the KlLAC4 locus. Even more preferably, the K. lactis strain contains integrated expression cassettes for foreign antigens in the KlURA3-20 locus (KLLA0E2277 lg) and the KlMET5-1 locus (KLLA0B03938g) in addition to the KlLAC4 locus. The advantage of K. lactis strains modified in this way is that the genes for expression of foreign genes are integrated into established, defined loci in the K. lactis genome and the copy number of foreign genes is controlled. In addition, these K. lactis strains provide the ability to integrate various genes for the expression of various foreign antigens at specific loci in the K. lactis genome.

In the context of the present invention, by foreign antigens or foreign proteins are meant all peptides, polypeptides and proteins that are suitable to induce an immune response, preferably a protective immune response, against a pathogen or carcinogenic abnormal cells in humans or animals. Foreign proteins can be derived from various types of disease or tumor pathogens for which antigens have been identified that are independently capable of inducing a protective immune response, preferably a protective immune response.

In a preferred embodiment, the foreign proteins are derived from pathogens (viruses, bacteria, parasites) for which antigens have been characterized that are independently capable of inducing a protective immune response, preferably a protective humoral immune response.

For example, these include the following: foreign proteins derived from parasites

Necator americanus; Ancylostoma duodenale: ASP protein, hemoglobin-degrading proteases;

Leishmania: gp63, 46 kDa promastigote antigen, LACK;

Plasmodium: protein CSP, CSA-1, CSA-3, EXP1, SSP2, STARP, SALSA, MSP1, MSP2, MSP3, AMA-1, GLURP, Pfs25, Pfs 28, Pvs25, Pvs 28, Pfs 48/45, Pfs 230 ;

Schistosoma: TP1, Sm23, ShGSTs 26 and 28, paramyosin, parasite myosin, Sm14;

foreign proteins obtained from the bacteria Mycobakterium tuberculosis: Ag85A, Hsp65, R8307, 19 kDa, 45 kDa, 10.4;

- 4 045050

Heliobacter pylori: VacA, LagA, NAP, hsp, urease, catalase;

Group A Strepptococcus: M, peptidase SCPA, exotoxin SPEA and SPEC, fibronectin binding protein;

Streptococcus pneumonia: PspA, PsaA, BHV 3, BHV 4;

Salmonella typhimurium: Vi antigen;

Shigella: LPS;

Vibrio cholera: CTB;

Escherichia coli ETEC: LT, LT-ST, CTB;

Yersinia pestis: F1, V;

foreign proteins derived from tumor cells/tumors (tumor associated antigens, TAA)

CEA;

5T4; MUC1; MART1; HER-2;

Particularly preferred are foreign proteins derived from Caliciviridae viruses (Norwalk virus, HEV): NV 60 kDa; ORF2 HEV; Reoviridae (rotavirus): VP7, VP4; Retroviridae (HIV): Gag, Pol, Nef, Env, gp160, gp120, gp140, gp41;

Flaviviridae (genus Flavivirus: WNV, dengue virus, YF, TBE, JEV): preM-Env, NS3, NS4, NS5;

Flaviviridae (genus Pestivirus BVDV, CSFV, BDV. genus Hepacivirus HCV): E1, E2, E ^RNS (plague), C, NS3, NS4, NS5;

Hepadnaviridae (HBV): HBS antigen;

Paramyxoviridae (Paramyxovirinae.PIV-1, PIV-2, mumps virus, Sendai virus, PIV2, PIV-4, measles virus): M, HN, N, F;

Paramyxoviridae (Pneumovirinae: RSV): F, G, SH, M;

Rhabdoviridae (rabies virus): G;

Herpesviridae (EBV, HSV2): gp350/220 (EBV), gB2, gD2 (HSV);

Coronaviridae (SARS): CoV, N, M, S;

Orthomyxoviridae (influenza virus A, B): HA, NA, M1, M2, NP;

Papillomaviridae: L2, E6, E7.

In yet another embodiment of the present invention, the modified K. lactis strains are characterized in that the K. lactis expression cassettes contain the LAC4-12 (Pl _AC 4 _-12 ) promoter or variants of this promoter, the ORF of the expressed antigen, and the AgTEF1 terminator. The advantage of this embodiment is that the expression of foreign genes under the control of the P _L ac _4-12 promoter after integration of LAC4 into the locus of both KlURA3 and/or KIMET5 is approximately equally induced by lactose.

As described above, there is a positive correlation between the concentration of antigen in vaccine strains and the immunological effect of the yeast vaccine in the target organisms. Alternatively, to prevent CPE resulting from strong overexpression, for example by integrating an additional KlGAL4 gene, the vector system described above can be modified to quickly and efficiently replace multiple copies of the gene one after another and introduce a given expression cassette in one step into one of the three gene loci (see example 5 and Fig. 7A).

In a preferred improved embodiment of the present invention, the K. lactis strains thus modified contain multiple copies of nucleic acid sequences encoding a foreign antigen, which are inserted by means of a tandem expression cassette or several expression cassettes. These expression cassettes contain multiple copies of the antigen-coding region (gene) flanked by the LAC4-12 promoter (P _{LaC4_12} ) or variants _of this promoter and the AgTEF1 terminator, respectively. Thus, by increasing the copy number of an antigen gene, its expression at one of the corresponding gene loci can be significantly increased.

In a preferred embodiment of the present invention, the KlLAC4 locus of the K. lactis strain contains the foreign antigen IBDV-VP2 gene in the form of a tandem expression cassette. The advantage of this K. lactis strain over strains with one copy of the gene that encodes the foreign antigen IBDV-VP2 is that the foreign antigen IBDV-VP2 is expressed in increased quantities. Particularly preferred according to this embodiment of the present invention is strain VAK1118 (DSM 32701), which contains the foreign antigen IBDV-VP2 gene in the form of a tandem expression cassette at the KlLAC4 locus.

Even more preferably, the KlLAC4 locus and/or the KlURA3-20 locus and/or the KlMET5-1 locus of the K. lactis strains of the present invention contain one or more copies of different nucleic acids encoding a foreign antigen, which are inserted through one an expression cassette, a tandem expression cassette, or multiple expression cassettes. As a result, on the one hand, various foreign antigens can be expressed in the yeast cell, and on the other hand, these different foreign antigens can be expressed in different concentrations. Particularly preferred according to this embodiment is a K. lactis strain in which

- 5 045050 into the K1LAC4 and K1URA3-20 loci of the K. lactis strain, nucleic acid sequences encoding foreign antigens HA of the influenza A virus (A/Puerto Rico/8/1934(H1N1)) and M1 of the influenza A virus (A/Puerto Rico/8/1934(H1N1)). Particularly preferred according to this embodiment of the present invention is strain VAK1283 (DSM 32697), in which nucleic acid sequences encoding foreign influenza A virus HA antigens are inserted into the KlLAC4 and KlURA3-20 loci of the K. lactis strain (A/Puerto Rico/8/1934 (H1N1)) and M1 influenza A virus (A/Puerto Rico/8/1934(H1N1)).

As already mentioned, it is known that increasing the dose of the KlGAL4 gene can lead to increased antigen production (Krijger et al. 2012 and WO 2013107436). The disadvantages of achieving this by integrating the KlGAL4 expressing plasmid pLI-1 in a two-step method are listed above. According to the present invention, these disadvantages are overcome by providing a stable parent strain for foreign gene integration that contains a second copy of the KlGAL4 gene. This ensures that all resulting strains have the same genetic background and that these strains contain exactly one extra copy of the KlGAL4 gene. This reduces the cytotoxicity observed when multiple copies are expressed and reduces the number of steps to produce vaccine strains to just one step. In addition, genetic stability is increased since reversible plasmid integration/excision is avoided. Such a strain can be obtained, for example, as described in example 1.

In yet another preferred embodiment of the present invention, a K. lactis strain is provided which, in addition to the genomic KlGAL4 gene, contains a second ectopic copy of the KlGAL4 gene. In this strain, the expression of the transcriptional activator KlGAL4 can be increased by a maximum of twofold, and the expression of foreign genes inserted into the KlLAC4 locus and/or the KlURA3-20 locus and/or the KlMET5-1 locus can be increased in a specific manner by the LAC4-12 promoter or through variants of this promoter described below. In the traditional practice, plasmids encoding KlGAL4 were introduced into the cell transiently and at multiple, uncontrolled copy numbers. As a result, the foreign antigen was often expressed at such a high concentration that it resulted in cytotoxic effects. In the case of K. lactis strains according to this embodiment of the present invention, the cytotoxic effects can be more effectively reduced or avoided. Additional gene loci that will be used in the future for the same purpose (LAC4-driven expression cassette insertion) can also be controlled in the same way. It has been shown that it is advantageous when an ectopic copy of the KlGAL4 gene, flanked by the KlGAL4 promoter and the KlGAL4 terminator, is integrated in the K. lactis strain into the KLLA0E13795g gene locus (Klavt3::KlGAL4-l, SEQ ID NO: 1). Particularly preferred according to this embodiment of the present invention is strain VAK1111 (DSM 32696), which has these properties.

In a further preferred embodiment of the present invention, there is provided a K. lactis strain in which a nucleic acid sequence encoding the foreign antigen IBDV-VP2 is present at the KlLAC4 locus. Particularly preferred according to this embodiment of the present invention is strain VAK1171 (DSM 32699). This strain additionally contains a second ectopic copy of the KlGAL4 gene, which also contains a nucleic acid sequence encoding the foreign antigen IBDV-VP2. This strain demonstrates increased expression of the foreign antigen IBDV-VP2 compared to strains without an additional ectopic copy of the KlGAL4 gene.

The production of heterologous protein in microorganisms is problematic when it results in a cytopathic effect (CPE). Thus, the present invention provides an approach to separating the antigen production phase from the biomass accumulation phase. By using an inducible LAC4 promoter this becomes partially possible, for example in a fed-batch fermentation process, but is difficult because under non-inducing conditions the P _LaC4 _ ₁₂ promoter is not completely inactive (i.e., to some extent prone to spontaneous activation). In the case of antigens with very strong CPE, this leads to a decrease in growth rate and to the induction of a stress response in the cell with negative effects on antigen production. This problem is exacerbated by doubling the dosage of the KlGAL4 gene and/or increasing the number of antigen coding sequences (see below).

Thus, a preferred improved embodiment of the K. lactis strains of the present invention is that the K. lactis strains are characterized by a modified promoter structure at the LAC4-12 promoter which, under non-inducing conditions, allows no or only little expression of the foreign protein. The modified structure of the LAC4-12 promoter, in particular, is characterized by the fact that the basic control region ( _BCR ) of the P _{LaC4_12} promoter between positions 1065 and 1540 is deleted ₍ LR2 deletion; P _LAC4 - _12.LR2 '; SEQ ID NO: 2) ( see also example 2). As already described above, an advantage of this embodiment of the present invention over conventional practice is that the cytotoxic effects that would normally be caused by strong expression of a foreign gene are reduced or eliminated more effectively. Preferred in this embodiment are K. lactis strains that have a nucleic acid sequence encoding the foreign influenza A virus HA antigen (A/Puerto Rico/8/1934(H1N1)) at the KlLAC4 locus. Particularly preferred according to this embodiment of the present invention is strain VAK1243 (DSM 32702).

This strain is characterized by the presence of an LR2 deletion in the LAC4-12 promoter.

The K. lactis strain may also be characterized by a modified LAC412 promoter structure that provides the ability to modulate foreign protein expression, where the number of binding sites for the KlGal4 promoter activator (upstream activating sequences 1, 2 and 4, 5) varies, and 1, 2, 3 or 4 KlGal4 binding sites. In this way, various foreign proteins can be expressed in a yeast cell at different concentrations (target quality). Truncated promoter variants are, among other things, important for ensuring modularity of the system, for example for the expression of proteins in the same strain at an optimal stoichiometric ratio, for example for the production of highly immunogenic virus-like particles (VLPs). According to this embodiment of the present invention, it is preferred that a nucleic acid sequence encoding the foreign antigen IBDV-VP2 is inserted into the KlLAC4 locus of the K. lactis strain. Particularly preferred according to this embodiment of the present invention is strain VAK1131 (DSM 32700). This strain is characterized by the presence of a deletion of LR2 and a deletion of upstream activating sequences 4 and 5 in the LAC4-12 promoter.

The purpose of the present invention was, in part, to provide strains of K. lactis that are more suitable for cultivation. This problem is solved due to the fact that in the K. lactis strains of the present invention the gene function of the Kllac4, Klura3-20 and Klmet51 alleles is restored. Thus, the resulting K. lactis strains are prototrophic (example 6, Fig. 8). Thus, the fermentation of vaccine strains is simplified, the implementation of production processes becomes simpler and more economical. Preferred according to this embodiment of the present invention are K. lactis strains in which nucleic acid sequences encoding foreign antigens, BVDV E2 ectodomain (type 1, CP7), ectodomain are inserted into the KlLAC4, KlURA3-20 and KlMet5-l loci of the K. lactis strain E2 BVDV (type 2, New York 93) and Npro-NS3 BVDV (type 1, CP7). Particularly preferred according to this embodiment of the present invention is strain VAK1400 (DSM 32698). This strain is prototrophic.

In a particularly preferred embodiment, the present invention relates to a K. lactis strain selected from the following strains:

VAK952 DSM 32705; VAK1111 DSM 32696; VAK1118 DSM 32701; VAK1131 DSM 32700; VAK 1171 DSM 32699; VAK1243 DSM 32702; VAK1283 DSM 32697; VAK1395 DSM 32706; VAK1400 DSM 32698.

These strains were deposited on 11/24/2017 or 12/01/2017 (DSM 32705, DSM 32706) in the German Collection of Microorganisms and Cell Cultures GmbH, DSMZ, DSMZ, Inhoffenstrasse 7B, 38124, Braunschweig, Germany, in accordance with the Treaty of Budapest according to the above numbers.

In one additional aspect of the present invention, integrated expression vectors are provided that produce the K. lactis strains of the present invention.

In a preferred embodiment of the present invention, integrated expression vectors KIpURA3 (SEQ ID NO: 3) and KIpMET5 (SEQ ID NO: 4) are provided. These vectors contain the LAC4-12 promoter ( _PLAC4.12 ) or variants of this promoter (described above for K. lactis strains), including the ORF for _the antigen to be expressed, in addition the AgTEF 1 terminator sequence, as well as targeting sequences that provide targeted restoration of functionality of the Klura3-20 or Klmet5-1 allele after integration. The antigen coding sequence is cloned using specific restriction sites between the promoter and terminator sequences in the expression cassette. These vectors enable stable integration of cassettes expressing a foreign gene into the K. lactis genome without the use of markers and without the use of antibiotic resistance. Accordingly, the advantages of this vector system are that foreign genes are easily exchanged between different vectors, and promoters and terminators in expression cassettes can also be replaced with others. The expression cassette consists of the _Plac4-12 promoter and the AgTEF1 terminator, as well as a foreign gene located between them. A foreign gene can be replaced using AscI and NotI restriction sites. The P _lAC4-12 promoter can be replaced in both vectors due to the restriction sites SmaI and AscI, the terminator in KIpURA3 due to NotI and BoxI (or MluI) and in KIpMET5 due to NotI and Ecl136II (or SacI). Alternative expression cassettes are cloned into KIpURA3 between the SmaI and BoxI (or Mlul) restriction sites, and into KIpMET5 between SmaI and Ecl136II (or SacI). Using known restriction enzymes, the expression cassettes between the KIpMET5 and KIpURA3 vectors are also replaced or additional expression cassettes are inserted. An improvement over the KIp3 and KIp3-MCS vectors (WO 20101054649) is that selection occurs under non-inducing conditions (without lactose), which in the case of CPE proteins leads to higher levels of transformation and prevents the possible enrichment of transformants with reduced foreign expression gene. See also examples 3.1 and 3.2.

In a particularly preferred embodiment of the present invention, an integrated expression vector is provided which is selected from KIpMET5-P _{LAC4_12} - _Et , KIpMET5-P _LAC4 . ₁₂ . _LR2 -Et, KIpMET5-PLAC4-Et, KIpMET5-Plac4-lr2, as well as from KIpURA3-PLAC4-12—Et, KIpURA3-PLAC4-12-LR2—Et, KIpURA3P _LAC4 -Et and KIpURA3-P _{LAC4_LR2} ( _SEQ ID NO: 3 or SEQ ID NO: 4 in combination with SEQ ID NO: 5, 6, 7 or 8).

Vectors KIpURA3-PLAC4-12—Et, KIpURA3-PLAC4-12-LR2—Et, KIpURA3-PLAC4—Et, and KIpURA3-Plac4-lr2 are variants of the KIpURA3-Et vector, each of which contains a nucleic acid sequence encoding the Etx protein .B-HA. The KIpURA3-P _LAC4-12 -Et, KIpURA3-P _LAC4-12-LR2 Et, KIpURA3-P _LAC4 -Et, and KIpURA3-P _LAC4-LR2 vectors differ from the KIpURA3-Et vector in their promoter.

Vectors KIpMET5-PLAC4-12—Et, KIpMET5-PLAC4-12-LR2—Et, KIpMET5-PLAC4—Et, KIpMET5-Plac4-lr2 are variants of the KIpMET5 vector, each of which contains a nucleic acid sequence encoding the Etx.B protein -HA. Vectors KIpMET5-P _LAC4-12 -Et, KIpMET5-P _LAC4-12-LR2 -Et, KIpMET5-P _LAC4 -Et, KIpMET5-P _LAC4-LR2 differ from the KIpMET5 vector in their promoter.

In a further aspect, the present invention relates to a method for producing the K. lactis strain of the present invention, comprising the steps of:

(i) inserting a nucleic acid sequence encoding an antigen into a KIpURA5 or KIpMET5 vector, (ii) transforming a culture of K. lactis using a modified and pre-enzymatically digested vector construct, (iii) selecting transformed K. lactis cells using a solid medium, which does not contain uracil and/or methionine, and (iv) optionally restoring prototrophy.

According to one embodiment of the method of the present invention, it is possible to simultaneously provide ectopic insertion and regulated expression of gene sequences of several antigens. Preferably, different gene sequences that encode antigens of different variants of the pathogen are provided for ectopic insertion and regulated expression. It is further advantageous to provide ectopic insertion and regulated expression of various gene sequences that encode antigens of various pathogens.

In one further aspect of the present invention, pharmaceutical or veterinary compositions for parenteral, enteral, intramuscular, transmucosal or oral administration are provided that contain the K. lactis strain of the present invention, optionally in combination with typical carriers and/or excipients. In particular, the present invention relates to pharmaceutical or veterinary compositions that are suitable for vaccination.

The pharmaceutical or veterinary composition preferably contains at least one physiologically acceptable carrier, diluent, excipient and/or excipient. The K. lactis strains of the present invention may be present in a pharmaceutically acceptable carrier, for example, a conventional vehicle such as an aqueous saline solution or a buffer solution, as a pharmaceutical composition for administration by injection. Such a medium may also contain conventional pharmaceutical composition agents, such as, for example, pharmaceutically acceptable salts for osmotic adjustment, buffer, preservatives, and the like. Preferred media include saline and human serum. A particularly preferred medium is PBS buffered saline.

Other suitable pharmaceutically acceptable carriers are known to one skilled in the art, for example, from Remington's Practice of Pharmacy, 13th edition and J. of Pharmaceutical Science & Technology, Vol. 52, Nr. 5, Sept-Okt, S 238-311.

A further aspect of the present invention relates to the use of the recombinant yeast K. lactis of the present invention for vaccination, such as to provide protective immunization, in particular protective immunization that is directed against a pathogen.

A suitable method for providing protective immunization includes, for example, the following steps:

a) cultivating and propagating the recombinant yeast according to the present invention,

b) collecting and inactivating the yeast,

c) administering recombinant yeast according to a predetermined immunization schedule,

d) determining the titer of antibodies formed and/or

e) obtaining evidence of immunization.

Cultivation and propagation of the recombinant yeast of the present invention can be carried out using any available conventional method. Particularly preferred are methods that provide high cell yields at low cost. These include fermentation methods, in particular high cell density fermentation methods. It has been shown that it is particularly advantageous to carry out the fermentation using a fed-batch fermentation protocol.

In a preferred embodiment, such protective immunization is provided by oral/mucosal, intramuscular or subcutaneous administration of the recombinant yeast.

In the method of the present invention, recombinant yeast cells must be used in an inactivated/killed state. For this purpose, after cultivation and expression of foreign genes, the yeast is dried and then inactivated. Inactivation can be carried out using any available traditional method. Particularly suitable for use in the method of the present invention is heat inactivation (for example, heat inactivation for 2 hours at 90°C) or -irradiation (for example, at 25 or 50 kGy).

The present invention also provides a method of vaccination comprising administering a K. lactis strain of the present invention to a subject, for example an animal or a human, preferably an animal, in an amount sufficient to provide in the subject an immune response, preferably a protective immune response, to one or more foreign antigens .

A particular advantage is that a protective immune response to the pathogen develops after a single application/immunization (single injection) or after a double application/immunization (prime boost) of the K. lactis strains of the present invention. An additional advantage is that a cross-protective immune response to different pathogen variants develops after a single application/immunization (single injection) or after a double application/immunization (prime boost) of the K. lactis strains of the present invention. When the K. lactis strains of the present invention carry and express various foreign antigen genes of various pathogens, a protective immune response to various pathogens can develop after a single application/immunization (single injection) or two applications/immunization (prime boost).

Brief description of the advantages of the invention

The described improvements to the K. lactis platform result in numerous benefits.

a) Allows for high simplification (ready-to-use kit) and high reproducibility of the basic design of yeast-based subunit vaccines. Now they can be obtained within a certain short period of time.

b) Yeast-based vaccines may contain one or more antigens; they can be easily adapted and produced in various quantities.

c) In addition, the possibility of efficient fermentation of prototrophic yeast is ensured.

d. The possibility of strictly inducible production of the recombinant protein is ensured. The latter is especially important for proteins that can cause CPE.

e) The targeted, stable integration of foreign genes into the genome and thus the concomitant stability of the strains provides the advantage that the production process is reproducible. This is especially important for production in accordance with GMP.

f) With increased production of recombinant antigen, provided by increasing the copy number of the foreign gene and/or the concentration of KlGAL4, the protective ability of the yeast vaccine improves.

g) With the increased production of recombinant antigen achieved by increasing the copy number of the foreign gene and/or the concentration of KlGAL4, it is also possible to reduce the dose of the inoculant to be administered. This makes the production of yeast more economical and improves the tolerability of the vaccine in the recipient of the vaccine.

h) Multivalent yeast-based vaccines can be used for cross-protection or multivalent protection for prevention against different variants of the same pathogen or different pathogens. Other than inactivation and the addition of an appropriate adjuvant or appropriate volume of liquid, no further processing of the yeast for use as a grafting agent is carried out.

- 9 045050

The present invention is explained in more detail with the help of drawings and examples of the invention.

In fig. Figure 1 shows the characterization of a newly derived K. lactis core strain with two copies of KlGAL4. The presence of a second ectopic copy of KlGAL4 at the identified integration site was tested and the effect of integration on yeast growth was analyzed. A. Schematic of the integration site of the ectopic copy of KlGAL4. The integration site is indicated and gene names are given. B. Agarose gel with PCR-amplified primers

VK183 (5'-GAGCCCACCACCTGCTCCTG-3') (SEQ ID NO: 9) and

VK184 (5'-CTGATGTATTGCGCTCCTTACTAAC-3') (SEQ ID NO: 10) by fragments of the KlAVT3 locus of a yeast strain with an additional integrated ectopic gene KlGAL4 (VAK1110) and without it (VAK367). For each case, the expected fragment size is shown in the diagram to the right. C: Drop test with serial tenfold dilutions (Start-OD 1) in a medium containing glucose (YPD) or lactose (YPLac). Incubation was carried out at 30 and 37°C, respectively. The growth of yeast strains with a copy of KlGAL4 in the native gene locus (VAK1139), in an ectopic gene locus and a deletion of KlGAL4 in the native gene locus (VAK1110), without a copy of KlGAL4 (AKlgal4; VAK964) or with two copies of KlGAL4 (VAK1168) was compared. It has been shown that specific integration of the additional KlGAL4 gene leads to only minor growth disturbances: these are observed only at 37°C and under inducing conditions. The growth impairment is more pronounced with complete deletion of KlGAL4.

In fig. Figure 2 shows the result of Western blot analysis of proteins from a K. lactis strain with an additional ectopic copy of KlGAL4 that produces IBDV-VP2. The effect of an additional copy of KlGAL4 on LAC4-12 promoter-dependent production of the recombinant protein was analyzed by Western blotting. A yeast strain with an IBDV-VP2 expression cassette was used as the test strain and compared with other yeast strains expressing IBDV-VP2. The presence (+) or absence (-) of the ectopic copy of KlGAL4 and the tandem expression cassette IBDVVP2 (see below) is indicated at the top. In strain VAK911, an ectopic copy was introduced by linearizing plasmid pLI-1 with BstEII (Krijger et al. 2012 and WO 2013107436), in strain VAK1130, an ectopic copy of KlGAL4 was located at the KIAVT3 locus (see Fig. 1). Yeast strain VAK367 was used as a wild-type control strain without the foreign gene. After pre-culture in YPD, yeast strains were grown for 15 h in YPLac. 20 μg of protein extract from each yeast strain was analyzed by SDS-PAGE. Immunoblotting was performed using rabbit anti-IBDV serum (1:8000) and goat anti-rabbit antibody conjugated to HRP (1:10000). Multimers (ag) and monomers (mon) of IBDV-VP2 are indicated on the right with arrows, nonspecific bands with asterisks. It has been shown that ectopic expression of the additional KlGAL4 gene, as well as the presence of a tandem expression cassette (see also below), leads to a significant increase in the concentration of foreign antigen.

In fig. Figure 3 illustrates the effect of deletion of LR2 in the LAC4-12 promoter on recombinant protein production without induction and yeast growth on glucose. The unmodified LAC4-12 promoter exhibits basal levels of GOI (gene of interest) expression even under non-inducing conditions. This is a particular problem in the case of foreign antigens that are cytotoxic. Using these experiments, we tested whether a deletion in the BC region (LR2 deletion) of the LAC4-12 promoter could reduce or even completely suppress the production of the recombinant protein under non-inducing conditions. A. Diagram of the LAC4-12 promoter (P _LAC4- i ₂ ). The major control region (BCR), the LR2 deletion, and the four KlGal4 binding sites (upstream activating sequence: U1, U2, U4, U5), as well as the nucleic acid sequence encoding the foreign gene (GOI), are shown. B. Western blot analysis of yeast strains with and without LR2 deletion (VAK1131) expressing IBDV-VP2 after cultivation under non-inducing conditions (YP with 3% EtOH). VAK1111 served as a wild-type control strain without the foreign gene. 50 μg of protein extract from each yeast strain was loaded onto a 12% SDS gel. Immunoblotting was performed using rabbit anti-IBDV serum (1:5000) and goat anti-rabbit antibody conjugated to HRP (1:10000). KlNop1 loading controls were detected using mouse anti-Nop1 antibody (1:5000) and goat anti-mouse antibody conjugated to HRP (1:10000). C. Drop test with serial tenfold dilutions (Start-OD 1) in YPD, YPD with 0.5% glucose and YPLac. Incubation was carried out at 30 and 37°C, respectively. The growth of yeast strains carrying the foreign influenza A virus HA gene in the LAC4 locus with and without LR2 deletion (VAK1243) and without it (VAK952) was compared. Yeast strain VAK367 served as a control wild-type strain without a foreign gene. Deletion of LR2 has been shown to suppress unwanted basal expression of a foreign protein. Deletion of LR2 has also been shown to improve the growth of a yeast strain that expresses a cytotoxic protein (influenza virus hemagglutinin, HA) under both non-inducing and inducing conditions. This is especially noticeable at 37°C.

In fig. Figure 4 shows KIp vectors that can be used to integrate protein expression cassettes into various loci of the K. lactis genome. While the use of the LAC4 locus (vector system

- 10 045050

KIp3) has already been described (WO 20101054649 and WO 2013107436), the use of the K1URA3 and KIMET5 loci is new. A. Schematic of different KIp vectors with their corresponding genome integration sites. B and C. Expression cassettes and flanking ends of the new KIpUKA3 (B) and KIpMET5 vectors described herein (C). Various regions of the DNA sequence and corresponding restriction sites are marked. GOI: foreign gene (gene of interest). D. Western blot analysis of foreign protein expression in yeast strains constructed using KIp vectors (A, B, and C). The foreign gene is Etx.B-HA. Yeast expressing the housekeeping protein KlNop1 (KLLA0C04389g) was used as a loading control. After pre-cultivation in YPD (+U), yeast strains were grown for 4 h in YPLac (+U). 30 μg of protein extract from each yeast strain was loaded onto 12% SDS-PAGE. Immunoblotting was performed using mouse monoclonal anti-HA antibodies (1:5000) and anti-KlNop1 antibodies (1:5000; Santa Cruz, TX, USA), and goat anti-mouse antibody conjugated to HRP (1:10000; Jackson ImmunoResearch , Pennsylvania, USA). Similar to the LAC4 locus (WO 20101054649 and WO 2013107436), both the KlURA3 and KIMET5 loci have been shown to be useful for heterologous gene expression.

In fig. Figure 5 shows the production of different recombinant proteins in the same yeast strain. This yeast strain (VAK1234) was constructed using the KIpURA3 and KIp3-MCS vectors. Western blot analysis of proteins was performed from a yeast strain expressing tandem IBDV-VP2 (see below), into which an additional expression cassette with Etx.B-HA (VAK1234) was inserted as a foreign gene using the KIpURA3 vector. Yeast strains that carried only the Etx.B-HA expression cassette at the LAC4 locus (VAK899) or the KlURA3 locus (VAK1235) or only the tandem IBDV-VP2 expression cassette at the LAC4 locus (VAK1171) in the genome were used as controls. After pre-cultivation in YPD, yeast strains were grown for 6 h in YPLac. 30 μg of protein extract from each yeast strain was loaded onto 12% SDSPAGE. Detection of proteins in immunoblotting was carried out in the case of Etx.B-HA using mouse anti-HA antibody (1:5000; Santa Cruz, TX, USA) and goat anti-mouse antibody conjugated to HRP (1:10000), and in the case of IBDV-VP2 using rabbit anti-IBDV serum (1:5000; Granzow et al. (1997)) and goat anti-rabbit antibody conjugated to HRP (1:10000; Jackson ImmunoResearch, PA, USA). Both foreign proteins were shown to be expressed in the same yeast cell. Surprisingly, the expression level of an antigen is not limited when co-expressed with another antigen. This becomes noticeable when comparing the expression level of mono- and bivalent strains (see also Fig. 12).

In fig. 6 shows variously inducible variants of the LAC4-12 promoter for expression cassettes in KIp vectors. Expression cassettes of KIp vectors with various variants of the LAC4-12 promoter were obtained. The effect of promoter variants on the intensity of protein synthesis induction was tested based on the analysis of yeast strains that contained the corresponding expression cassettes with Etx.B-HA as a foreign gene. A. Schematic representation of promoter variants, corresponding KIpURA3 vectors with Etx.B-HA as a foreign gene and yeast strains obtained with their help. BCR: binding site for transcriptional activators KlCat8 and KlSip4, transcriptional activators under non-inducing conditions; U1, U2, U4, U5: binding sites for the transcription activator KlGal4 (upstream activating sequence). B. Results of Western blot analysis to characterize LAC4-12 promoter variants in yeast strains generated using the KIpURA3 vector (A). After preculture in YPD, yeast strains were grown for 4 h in YPLac. 30 μg of protein extract from each yeast strain was loaded onto 12% SDS-PAGE. Immunoblotting was performed using mouse monoclonal anti-HA antibody (1:5000) and anti-Nop1 antibody (1:5000), as well as goat anti-mouse antibody conjugated to HRP (1:10000). The level of foreign gene expression has been shown to vary depending on the type of promoter used.

In fig. 7 shows the effect of doubling the copy number of a foreign gene using a tandem expression cassette on the production of a recombinant protein. The effect on the production of recombinant protein (IBDV-VP2) by increasing the copy number of a foreign gene using a tandem expression cassette was tested. A. Schematic representation of a tandem expression cassette. DNA regions and corresponding restriction sites are marked. GOI: foreign gene (gene of interest). B. Shown is a tandem random integration construct derived from (A) using the ScURA3 selectable marker. C. Results of Western blot analysis performed to compare IBDV-VP2 protein production in a yeast strain (VAK1118) with a tandem expression cassette (A) and a yeast strain (VAK910) with an expression cassette having only one copy of the foreign gene. After precultivation in YPD, yeast strains were grown for 3 h or 6 h in YPLac. 60 μg of protein extract from each yeast strain was loaded onto 12% SDSPAGE. Immunoblotting was performed using rabbit anti-IBDV serum (1:10,000) and goat anti-rabbit antibody (1:10,000) conjugated to HRP. Aggregated (ag.) and monomeric (mon.) IBDV-VP2 are indicated on the right with arrows, nonspecific bands with stars

- 11 045050 daughters. D. Result of Western blot analysis of yeast strains with a randomly integrated tandem IBDV-VP2 expression cassette (B) in comparison with a yeast strain formed using a KIp3-MCS expression cassette (VAK910), as well as a strain derived from it with additional copies of KlGAL4-1 (pLI-1). After pre-culture in YPD, yeast strains were grown for 8 h in YPLac. Immunoblotting was performed as described in (b). It was shown that the use of a tandem expression cassette significantly increased the expression level of the foreign protein.

In fig. Figure 8 shows a gene fragment for restoring the gene function of the Klura3-20 and Klmet5-1 alleles (A). Gene loci and gene fragments amplified using the indicated primers for KlURA3 (A) and KIMET5 (B) are schematically shown. Mutations of the Klura3-20 (A) and Klmet5-1 (B) alleles, restored by homologous recombination with these gene fragments, are shown with asterisks under the genes. The restriction sites used to cut the subcloned fragments are shown. This diagram shows a strategy for obtaining prototrophic yeast strains expressing a foreign gene at the URA3 or MET5 locus.

In fig. 9 in combination with table. 1 and table. Figure 2 illustrates the protective immunization of chickens against vvIBDV in the classical prime-boost vaccination regimen. In two experiments (A and B), groups of at least 16 SPF chickens were inoculated subcutaneously with lyophilized and heat-inactivated yeast cells of a genetically optimized yeast strain K. lactis VAK1127 expressing tandem IBDV-VP2 using the prime-boost method. The first grafting was carried out two weeks after hatching (prime), the second (boost) was carried out two weeks after that. Two weeks after the boost, virus infection was carried out using a highly virulent (vv) strain of IBDV (very virulent 89163/7.3). A group of animals that served as infection controls were subjected to a mock (sham) treatment in which PBS or adjuvant alone was used. In experiment 1 (A), the wild-type strain (VAK367) was also used as a control. At least seven chickens per group were used as controls without virus challenge; in Experiment 2 (B) - at least five. Serum samples were collected shortly before the first challenge, before and after challenge, otherwise at ten days intervals. The rate of seroconversion was determined using ELISA (ProFLOK IBD Plus, Synbiotics). Shown are titer values recalculated according to the instructions in the kit. A. Experiment 2 was carried out similar to experiment 1 (A). The mean ELISA titer value for 12 animals with standard deviation is shown. Both experiments showed the appearance of high titers of antibodies to IBDV-VP2 in animals vaccinated with VAK1127. The corresponding tables summarize the results of protection of vaccinated animals against infection with vvIBDV: in both vaccination experiments, complete protection against viral infection was achieved.

In fig. 10 shows the effect of genetic modifications to restore prototrophy on the amount of recombinant protein produced and the immunogenicity of a yeast strain expressing tandem IBDV-VP2. The auxotrophic yeast strain VAK1127, expressing tandem IBDV-VP2, and the prototrophic yeast strain VAK1171 derived from it were compared in terms of the efficiency of production of recombinant proteins and immunogenicity. A. Results of Western blot analysis to determine the content of IBDV-VP2 in freshly collected yeast material. After pre-culture in YPD, yeast strains were grown for 8 h in YPLac. 40 μg of protein extract from each yeast strain was loaded onto 12% SDS-PAGE. Immunoblotting was performed using rabbit anti-IBDV serum (1:10,000) and goat anti-rabbit HRP-conjugated antibody (1:10,000). Aggregated (ag.) and monomeric (mon.) IBDV-VP2 are indicated on the right with arrows, nonspecific bands with asterisks. B. Results of Western blot analysis to determine the content of IBDV-VP2 in lyophilized heat-inactivated yeast material, which was then used in an immunization study in BALB/c mice (C). After pre-cultivation in YPD, the yeast strains were grown for 15 h in YPLac. 10 μg of protein extract from each yeast strain was loaded onto 12% SDS-PAGE, and immunoblotting was also performed as shown above (A), and lanes are indicated accordingly. C. Immunogenicity test of both yeast strains VAK1127 and VAK1171 in an immunization experiment on BALB/c mice. Groups of five mice each were inoculated three times subcutaneously with 0.1 mg (dry weight) of the yeast material analyzed above (B). A wild-type strain (VAK367) without antigen was used as a control. The first administration was carried out with CFA (Freund's complete adjuvant) as an adjuvant, the remaining two administrations were carried out at two-week intervals with IFA (Incomplete Freund's adjuvant) as an adjuvant. One week after the third administration, mice were sacrificed and bled. Serum samples were analyzed by ELISA using IBDV-VP2 (IDEXX). Absorbance at 650 nm, which correlates with IBDV-VP2 antibody titer, is shown with standard deviation. A monoclonal antibody to IBDV-VP2 (mab64 positive) was used as a positive control for the ELISA, and either a test buffer (negative 1) or a nonspecific antibody (negative 2) was used as a negative control. It was shown that both strains are characterized by similar levels of expression of foreign protein

- 12 045050 ka and the ability to induce an immune response.

In fig. 11 in combination with table. Figure 3 shows protective immunization of SPF chickens against vvIBDV by a single subcutaneous injection of grafting yeast genetically optimized for IBDV-VP2. Groups of at least 18 SPF hens received a single subcutaneous inoculation of 10 mg of heat-inactivated cells of the genetically optimized yeast strain K. lactis VAK1171 expressing tandem IBDV-VP2 two weeks after hatching. Animals inoculated with PBS or 10 mg VAK367 were used as controls. They were inoculated twice, two or four weeks after hatching. Six weeks after hatching, all animals were challenged with vvIBDV. Serum samples were analyzed as described above using ELISA (ProFLOK IBD Plus, Synbiotics). Specific antibody titer values are shown. Individual dots show individual antibody titer values for the twelve chickens analyzed per group, bars represent the mean with standard deviation. In the case of controls, only the antibody titer was determined for chickens that survived infection. Single-dose vaccination with the yeast-based subunit vaccine VAK1171 has already been shown to provide complete protection against subsequent exposure to vvIBDV.

In fig. 12 shows the characterization of strains VAK952 and VAK1283. (A) Yeast strains VAK952 (monovalent with HA) and VAK1283 (bivalent with HA, M1) were preincubated in YPD in shake flasks and then induced in YPL for 6 h. Optical density was measured at 600 nm and the culture was harvested. 30 OD units, the pellet was broken up using glass beads, and the soluble (LF) as well as insoluble (P, pellet) protein fraction was assessed by immunoblotting. Anti-HA1 antibody or anti-M1 antibody was used as the primary antibody, and mouse antibody IR-Dye800CW was used as the secondary antibody. The signal was generated using an infrared imaging system (LI-COR Biosciences). (B, C) Yeast strains were preincubated in YPD in shake flasks and then induced in YPL for a period of 24 hours. At the indicated time points, the optical density of the yeast culture was determined and the culture was harvested at 30 OD units. (B) VAK1283 pellets were broken up using glass beads and analyzed by immunoblotting. (C) Measured absorbance values for VAK952 and VAK1283 are summarized as a growth curve as a function of time and represent the average of at least two independent tests. (D) For the drop dilution test, yeast strains were grown on nutrient agar plates containing YPD for 48 h at 30°C. Serial dilutions of yeast were prepared starting with 1 OD unit and then dropped onto nutrient agar plates containing YPD or YPL. The contents of the dishes were cultured for 48 hours at 30°C and then photographed. Ponceau S: staining of total yeast protein of the corresponding fraction, loading control. VAK952 (monovalent with HA) and VAK1283 (bivalent (HA, M1)) were shown to express HA protein in comparable amounts. It has also been shown that VAK1283 and VAK952 have comparable growth properties, with a slight advantage for VAK1283.

In fig. 13 illustrates the antibody titer in serum obtained from BALB/c mice after immunization with VAK952 (monovalent with HA) as well as VAK1283 (bivalent with HA, M1) before and after challenge. Both yeast strains were preincubated in shake flasks with YPD and then induced for 12 h (VAK952) or 6 h (VAK1283) in YPL. The cultures were then harvested, dried, and the yeast material was inactivated for 2 h at 90°C. For immunization, 9-week-old female BALB/c mice were immunized twice (prime boost) three weeks apart or once (one injection) by subcutaneous injection of 2 mg of yeast (VAK952, VAK1283) or 1 mg of VAK1283 or two injections of PBS (without adjuvant). ). AddaVax was used as an adjuvant. Three or six weeks after the last administration, animals were infected with 5x MLD ₅₀ influenza A/PR/8/34 (H1N1) virus by intranasal administration. Sham-infected animals that were intranasally administered only PBS without virus served as infection controls. Three to six weeks after the last administration and at the time of infection, serum samples were collected from the animals and assessed for neutralizing antibody (nAb) in the VNT. ₅₀ nAb titer: a serum dilution that produces a 50% reduction in plaque counts compared to a virus-free control. The corresponding serum dilution is given as log2. Due to the logarithmic presentation of the results, serum samples without a detectable amount of antibody were assigned the value: Iog ₂ (2)=1. mAb: test system control (anti-H1 antibody (H37-66)). It was shown that both immunization schedules resulted in significant induction of neutralizing antibody. It is also clear that the obtained titers of neutralizing antibodies to HA do not differ significantly between the prime-boost and single-injection vaccination experiments with VAK952 and VAK1283.

In fig. 14 shows infection with influenza A/PR/8/34 (H1N1) virus after immunization with VAK952 (monovalent with HA) as well as VAK1283 (bivalent with HA, M1). Three or six weeks after the last challenge (see FIG. 13 for immunization schedule), BALB/c mice were infected with 5x MLD50 of influenza A/PR/8/34 (H1N1) virus by intranasal administration. As

- 13 045050 sham-infected animals (sham) that were administered intranasally only PBS without virus served as infection controls. Survival (A), body weight (B), and clinical signs (C) of the animals were then assessed several times daily over a period of 14 days. For clinical symptoms, a 0-4 score was established and averaged for each group (0: no abnormality; 1: slightly ruffled coat; 2: ruffled coat, decreased activity; 3: ruffled coat, 15% weight loss; 4: ruffled fur, body weight loss >20%). The prime-boost immunization route with VAK952 has been shown to not provide optimal protection against viral exposure as does VAK1283. For both vaccines, a single injection regimen of 2 mg of vaccine administered provides optimal protection. Administration of 1 mg VAK1283 provides a degree of protection similar to administration of 2 mg VAK952 in the prime-boost method.

Examples of implementation of the invention

Example 1. Obtaining a host strain with two copies of the KlGAL4 gene stably integrated into unrelated gene loci.

The second copy of the KlGAL4 gene was inserted without a selectable marker into another gene locus (ectopically). The insertion can be localized by sequencing the KIAVT3 gene (KLLA0E13795g) (Klavt3::KlGAL4-l, SEQ ID NO: 1) (Fig. 1). The resulting strain is called VAK1111. Independent meiotic segregation of both copies of KlGAL4 located on chromosome E (ectopic copy) and D (genomic copy) was confirmed by a crossing experiment. In addition, in the same experiment it was determined that the number of copies of the KlGAL4-1 gene in the genome is exactly two.

To use VAK1111 for targeted integration of an expression cassette into the LAC4 locus, similar to VAK367-D4, a disruption fragment of the lac4::ScURA3 gene was introduced, which allows marker-free integration of the desired foreign gene between the LAC4 promoter and the LAC4 reading frame in a single step using technology based on KIp vectors under selection conditions when grown on lactose (Krijger et al. (2012)). The resulting strain VAK1123 differs from VAK367-D4 only in the second ectopic copy of the KlGAL4 gene.

Example 1.1. Improved production of a vaccine yeast strain with an additional integrated KlGAL4 gene.

In one application, the IBDV-oVP2 _T2S gene (Arnold et al. (2012)) was inserted into the LAC4 locus of strain VAK1123 (resulting in strain VAK1130). Increased production of IBDV-VP2 was found compared to a strain with only one copy of KlGAL4, which was otherwise isogenic to this strain (VAK910). For comparison, strain VAK1118, which carries only one KlGAL4 gene but two copies of the VP2IBDY CDS (see below) is also shown (Fig. 2).

Example 2. P _L A _C 4-12 _LR 2' promoter with reduced basal activity to optimize antigen expression with a cytopathic effect.

The production of heterologous protein in microorganisms is problematic when it results in a cytopathic effect (CPE). Thus, the goal was to provide an approach to separate the antigen production phase from the biomass accumulation phase. By using an inducible LAC4 promoter, this is partially possible through the fed-batch fermentation process, but is difficult because the PLAC4-12 promoter is not completely inactive under non-inducing conditions. In the case of antigens with very strong CPE, this leads to a decrease in growth rate and to the induction of a stress response in the cell with negative effects on antigen production. This problem is exacerbated by doubling the dosage of the KlGAL4 gene and/or increasing the number of genes encoding the antigen (see below). To solve this problem, the main control region (BCR) of the P _L a _C4 - ₁₂ promoter was deleted (Fig. 3A) (Mehlgarten et al. (2015)) from -1065 to -1540 (LR2 deletion; P _L A _C4 - ₁ 2- _L R2', SEQ ID NO: 2). This deletion was introduced into the original strains VAK367 (one copy of KlGAL4) and VAK1111 (two copies of KlGAL4) into the genomic LAC4 locus along with a fragment of disruption of the lac4::ScURA3 gene function. The resulting strains VAK1109 and VAK1124 are suitable for the expression of antigens with CPE. Promoter P _LAC4 . _12LR2 ' was also used in the KIpURA3-Et and KIpMET5-Et integration vectors (see below).

Example 2.1. Suppression of basal (non-inducible) antigen expression due to a modified promoter.

After integration of the tandem expression cassette IBDV-VP2 into VAK1124 (resulting yeast strain: VAK1131; for an explanation of the term tandem expression cassette see below and Fig. 7), it could be seen that deletion of LR2 in the LAC4-12 promoter resulted in the production of VP2 protein in non-inducing conditions decreased significantly (Fig. 3B). It can be seen that in strains that express the influenza A virus antigen, hemagglutinin (VAK952 without deletion, VAK1243 with LR2 deletion in the promoter), the cytopathic effect of the influenza A virus HA antigen is suppressed, and due to the deletion of LR2, growth under non-inducing conditions is improved (Fig. 3C).

Example 3. Universal vector system for targeted integration of several expression cassettes into the K. lactis genome.

Yeast strain VAK367, like previously VAK367-D4 (Krijger et al. (2012)), WO 20101054649, provided the genetic background for all K. lactis strains described herein. This strain is characterized by mutations in two genes K1URA3 (KLLA0E2277lg) and K1MET5 (KLLA0B03938g), which are designated as alleles Klura3-20 (missing base pair at position +345) and Klmet5-1 (G2555A and A3682T), it requires in uracil and methionine (auxotrophy); thus, these alleles are nonfunctional variants of the gene.

These mutant alleles were used in addition to the LAC4 integration site already developed by KIp3/KIp3-MCS (Krijger et al. (2012)) as additional loci for targeted integration and thus for the production of multivalent vaccine strains (Fig. 4A). Selection was carried out by restoring the gene function of these mutant genes without additional insertion of a selectable marker. For this purpose, new vectors for integration were created. In these vectors, expression cassettes (in each case under the control of the LAC4-12 promoter or its variants) are flanked by gene fragments, which allows integration upstream of the KlURA3 gene or downstream of the KIMET5 gene due to homologous recombination, and thereby restores the wild-type sequences of these genes .

Through mutagenesis and auxotrophic selection for alternative growth promoters, similar additional loci may be discovered as sites of integration.

Example 3.1. Vectors KIpURA3 and KIpMET5 for targeted integration of expression cassettes (with the inducible LAC4-12 promoter) into the KlURA3 (KLLA0E2277lg) and/or KIMET5 (KLLA0B03938g) loci of K. lactis strains with the Klura3-20 or Klmet5-1 alleles.

Using appropriate gene fragments (targeting sequences KIMET5/KlURA3) that provide targeted restoration of functionality of the Klura3-20 or Klmet5-1 alleles, integrated expression vectors KIpURA3 (SEQ ID NO: 3) and KIpMET5 (SEQ ID NO: 4) are constructed.

The KIpMET5 expression vector contains an expression cassette consisting of a LAC4-12 promoter (P _LAC4 - ₁₂ or variants thereof), a nucleic acid sequence encoding the antigen to be expressed, and an AgTEF1 terminator; upstream of the KlMET5 genomic fragment it is flanked by the inserted ScCYC1 terminator, and downstream of the KlAIM18 promoter it is flanked by the downstream KlAIM18 gene.

The KlpURA3 expression vector contains an expression cassette consisting of a LAC4-12 promoter (P _LAC4 - ₁₂ or variants thereof), a nucleic acid sequence encoding the antigen to be expressed, and an AgYEF1 terminator; upstream of KLLAOE22749g it is flanked by the corresponding promoter, and downstream of the KlURA3 promoter it is flanked by the downstream KlURA3 fragment (Fig. 4B, C).

In each case, the antigen coding sequence is cloned using AscI and NotI restriction sites between the promoter and terminator. By restriction of the resulting plasmid with Eco911 or KpnI, the entire expression cassette is separated from the KIpURA5 vector backbone, with HindIII or BoxI from KIpMET5, and the restriction mixture is transformed into K. lactis host strains with the Klura3-30 and/or Klmet5-1 allele. Therefore, the foreign gene expression cassette thus integrated into KlURA3-20 or KlMET5-1 exactly corresponds to the cassette that can be integrated into LAC4 in VAK367-D4 using the KIp3-MCS vector (WO 20101054649). Verification of uracil or methionine prototrophic transformants is carried out in a standard manner using colony PCR with primers MAB6 and VK211 in the case of transformants with KIpMET5 or primers MAB6 and VK71 in the case of transformants with KIpURA3. When the expression cassette is integrated into the correct location between KlURA3 or KIMET5 and the corresponding adjacent gene, 1652 bp products are generated. in the case of transformants with KIpMET5 or 1307 bp. in the case of transformants with KIpURA3. There was no evidence that the insertion disrupted the function of adjacent genes.

Primer.

MAB6: 5'-CCCAGATGCGAAGTTAAGTG-3' (SEQ ID NO: AND)

VK71: 5'-TACAACAGATCACGTGATCTTTTTGTAAG-3' (SEQ ID NO: 12)

VK211: 5'-GATTTCGTAACCCTATTGTTCATGAATG-3' (SEQ ID NO: 13)

Example 3.2. Expression of a foreign antigen following integration of a gene coding cassette into the KlURA3 or KlMET5 locus.

A foreign gene under the control of the P _LAC4 promoter. ₁₂ is approximately equally strongly induced by lactose after integration into the LAC4, KlURA3, and KlMET5 locus. The thermolabile nontoxic enterotoxin B subunit (Etx.B) from E. co1i and the C-terminal (HA) ₃ epitope (Etx.B-HA) served as test proteins to evaluate the vector system. The coding sequence was cloned into the KIpMET5, KIpURA3, and KIp3-MCS vectors and integrated into the KlMET5 (VAK1251), KlURA3 (VAK1235), and LAC4 (VAK899) gene loci (Fig. 4D). As shown by Western blotting, the concentration of Etx.B-HA protein is very similar in all three strains (Fig. 4D). Accordingly, it was impossible to determine the position effect, the dependence of the amount of recombinant protein produced on the site of integration of the expression cassette into the genome.

Example 3.3. Coexpression of two foreign antigens in the same yeast cell.

The ability to produce different heterologous proteins under the control of the Plac4 _-12 promoter in the same yeast strain using a new vector system could be achieved by constructing a yeast strain with an Etx.B-HA expression cassette at the KlURA3 locus and an expression cassette at the LAC4 locus with two copies VP2 _ibdv , which are present in tandem (VAK1234; FIG. 5; see below and FIG. 7 for an explanation regarding the tandem cassette). When compared with yeast strains each containing only one expression cassette (VAK1235 or VAK1171), VAK1234 did not show any reduction in Etx.B-HA or ^vp2 ibdv protein concentrations.

Example 4. Variants of the LAC4 promoter to modulate recombinant protein synthesis under similar inducing conditions.

The immunogenic action of antigens is often based on the assembly of several proteins in a non-stoichiometric ratio. To provide it in yeast-based vaccines, variants of the P _L a _C4 promoter - _12lr2 ' (Fig. 6A) were created that can be induced to varying degrees by lactose or galactose. They differ in the number of binding sites for the KlGal4 activator (U1, U2, U4, U5; Godecke et al. (1991)) and the presence or absence of a major BCR control region. In addition to the structures shown in FIGS. 3A, which were used in the KIpURA3 vector, by inserting additional binding sites, promoter variants with higher promoter efficiency can be obtained. The result is synthetic, lactose-inducible promoters designed to improve the vector system, and under the same inducing conditions, different levels of protein or gene expression can be achieved.

Example 4.1. Expression of foreign antigen under the control of various variants of the LAC4 promoter.

Expression of Etx.B-HA under the control of four LAC4-12 promoter variants. Four variants of the LAC4 promoter were tested, which differ in the number of binding sites for the transcriptional activator KlGal4, as well as the presence/absence of a control region for basal level of expression under non-inducing conditions (basic control region, BCR; Fig. 6A; SEQ ID NO: 14). Using these variants, the KIpURA3-Et KIpURA3-PL412-Et, KIpURA3-PL412LR2-Et, KIpURA3-PL4-Et, and KIpURA3-PL4LR2 vectors were created, and in each case, the Etx.B-HA protein was inserted as a test GOI. As described above, insertion of an alternative GOI is possible through the AscI and NotI restriction sites. Expression cassettes were integrated into the K1URA3 locus, and Etx.B-HA protein concentration was quantified by Western blotting (Fig. 6B). It was shown that under the same inducing conditions (4 hours in complete medium with lactose), the longest variant of the promoter is P _laC4 _ ₁₂ , which contains the complete intergenic region from the LAC4 gene to LAC12 and contains four binding sites for KlGal4 (U1, U2, U4, U5) (Godecke et al. (1991)), provides the highest protein concentration. When only two proximal binding sites U1 and U2 (−1064 to −10) are present in LAC4, additional deletion of the BCR (−1540 to −1065) results in decreased protein abundance even under inducing conditions.

Example 5. Increased antigen production by increasing the number of copies of the gene encoding the antigen.

Thus, the vector system described above was modified to quickly and efficiently replace multiple copies of a gene one by one and introduce a given expression cassette in one step at one of three gene loci (Fig. 7A).

To obtain a tandem expression cassette integrated into the LAC4 locus, three PCR-amplified fragments are fused (In-Fusion cloning) in one step from any KIp3(-MCS)-GOI matrix: (1 and 2) expression cassettes with P _LAC4 . _LR2 and TTEF (primer: VK30 and VK31 or VK32 and VK33) and (3) targeting sequence for LAC4 (VK34 and VK35)). After restriction, for example with HpaI, the tandem expression cassette can be integrated into the lac4::URA3 locus as described (Fig. 7). After successful integration of the expression cassette, depending on the parent strain, the first copy of the foreign gene is regulated by either _PLAC4.12 or _PlaC4 . ₁₂ . _lr2 , and the second - through P _LAC4 . _LR 2. Alternatively, by inserting a selectable marker between two expression cassettes at the SmiI, MluI or PmeI restriction sites and separating the targeting sequence for LAC4 by KpnI, a tandem cassette is obtained that can be integrated into the genome in an untargeted manner by NHEJ. If an expression cassette is cut with MreI and AvaI, it is possible to ligate compatible ends and thus create long expression cassettes from multiple cassettes. By repeated restriction with MreI and AvaI, the ligation mixture is enriched for fragments in which the expression cassettes are arranged in tandem (head to tail). They are subjected to transformation and non-directional integration through marker-assisted selection.

- 16 045050

Primer.

VK30: 5'-TATAGGGCGAATTGGAGCTCCGCCGGCGGAAGAGGTAACGCCTTTTGTT

AAS-3'(SEQ ID NO: 15)

VK31: 5'-CTAAACGGAACTCGCATTTAAATCTCGTTTTCGACACTGGATGG-3' (SEQ ID NO: 16)

VK32: 5'-GCGAGTTCCGTTTAGACGCGTTTAAACTTGTTTAATTATTATGGGGCAG GCGAGA-3' (SEQ ID NO: 17)

VK33: 5'-CGGGGAATGCGCTGCTTTTCGACACTGGATGGGCGGCGTTA-3' (SEQ ID NO: 18)

VK34: 5'-GCAGCGCATTCCCCGGGTACCGCTTCGACTAGGTGATTAGCG-3' (SEQ ID NO: 19)

VK35: 5'-AAAAGCTGGGTACCGGGCCCACTAGTCGAGAGTTAACCGTGACTACAGC

TA-3' (SEQ ID NO: 20)

Example 5.1. Successful implementation of the multiple copy strategy.

The strategy was validated using IBDV-VP2 as the antigen and a KIp3-derived expression cassette that contained two IBDV-VP2 coding sequences (CDS-VP2IBDY) in tandem. The IBDV-VP2 tandem expression cassette (Fig. 7A) in the KIp3 vector (plasmid KIp3-tndemoVP2T2S, SEQ ID NO: 21) consists of two LAC4 promoter-regulated coding sequences for VP2 _ibdv (CDS-VP2 _ibdv ) from KIp3-MCS-oVP2T2S ( Arnold et al, (2012)). The promoter sequences consist of the LAC4 promoter region -1123 to -10 for the first copy and -1099 to -10 for the second copy. Both CDS-VP2 _ibdvs are flanked at the 3' end by the AgTEF1 terminator. Plasmid KIp3tandem-oVP2T2S was cut with HpaI and the restriction mixture was transformed into strain VAK367-D4. The yeast strain VAK1118 thus obtained contains a tandem expression cassette integrated into the LAC4 locus. As shown by Western blotting, the concentration of IBDV-VP2 protein in this strain is higher compared to the isogenic strain with only one copy (Fig. 7B). The tandem expression cassette is genetically very stable: after growing for 78 generations in induction medium (YNB + lactose), 100 colonies tested by PCR showed no genetic modification of the expression cassette (data not shown).

Example 6: Tools to promote prototrophy in K. lactis strains for simplified fermentation in synthetic medium and complete medium.

Studies have shown that in complete medium, uracil auxotrophic yeast strains grow worse than uracil prototrophic strains, and this effect can only be partially eliminated by adding uracil. Therefore, to simplify the fermentation of vaccine strains, make production processes easier to implement and cost-effective, and to avoid growth impacts due to insufficient methionine and/or uracil uptake, it is necessary to find ways to quickly and reproducibly eliminate the auxotrophy required during strain construction. To recover KlURA3 from Klura3-20, a DNA fragment was prepared by PCR using primers VK67 and VK69 and the wild-type KlURA3 gene as a template (Fig. 8A). Similarly, to correct the Klmet5-1 allele, a PCR fragment was generated using primers VK74 and VK75 and the wild-type KlMET5 allele as a template (Fig. 8B). Transformation of PCR fragments into the corresponding mutant strains (separately or together) and selection on a medium without methionine and/or uracil led to highly efficient restoration of wild-type alleles. In particular, this process was carried out to generate strains VAK1171 and VAK1400 (see above).

Primer.

VK67: 5‘-GACATCACTGTCTCTTTCCCCTTAATGATC-3‘ (SEQ Ш NO: 22)

VK69: 5‘-TCAGCAAGCATCAATAATCCCCTTGGTTC-3‘ (SEQ Ш NO: 23)

VK74: 5‘-GAAAGAAAGACGTTGGTCTCTACGCTTG-3‘ (SEQ ID NO: 24)

VK75: 5‘-AGATTATAAGTTCCTGGGGCTTTACCCAC-3‘ (SEQ ID NO: 25)

Example 7: Protective immunization using optimized inactivated yeast for vaccines.

Modifications and optimizations of the K. lactis vaccine platform carried out according to Examples 1-5 were validated in various vaccination studies.

Example 7.1. Immunogenicity of an optimized K. lactis platform using a yeast strain expressing IBDV-VP2 (VAK1127) as an example.

Strain VAK1127 contains a tandem IBDV-VP2 expression cassette (SEQ ID NO: 21), two copies of KlGAL4 and a deletion of LR2 in the LAC4 promoter. To determine the immunogenicity characteristics of the yeast strain, immunization tests were carried out on target organisms, which were chickens. IN

- 17 045050 challenge experiments achieved complete protection of SPF chickens against the highly virulent (vv) strain IBDV89163/7.3 (AFSSA, Ploufragan, France), well characterized by Eterradossi and colleagues (1997) (Tables 1 and 2). In two independently conducted trials for this purpose, 1 mg of lyophilized, heat-inactivated (2 h, 90°C) yeast (VAK1127) with incomplete Freund's adjuvant (IFA) (prime boost) was administered twice (Fig. 9A and B). The introduction was carried out two weeks and four weeks after hatching, exposure to the virus (infection) was carried out six weeks after hatching. After 19 days, high titers of antibodies to IBDV-VP2 can be measured in animals vaccinated with VAK1127. In controls, antibody titers to IBDV-VP2 appeared only after infection with vvIBDV (Fig. 9). In both experiments, complete protection (0% morbidity, 0% mortality) of animals vaccinated with VAK1127 against challenge with vvIBDV was observed (Tables 1 and 2). Using these experiments, it is possible to observe protection against vvIBDV using a subunit vaccine using the classical prime-boost vaccination method.

The immunogenicity of grafting yeast is not affected by genetic reverse mutation of prototrophic yeast strains carrying the antigen. This can be shown by using the corresponding auxotrophic or prototrophic forms of the yeast strain expressing IBDV-VP2 in a mouse vaccination experiment (Fig. 10C).

Yeast strain VAK1127 (auxotrophic) was converted to prototrophic as described above (Example 6; Fig. 8) in two steps using PCR fragments to obtain VAK1171. In both forms of the strain there is no significant difference in the level of expression of the recombinant protein (Fig. 10A and B). Mice were inoculated subcutaneously three times at two-week intervals with a subcutaneous injection of 0.1 mg heat-inactivated yeast with IFA. No differences in the rate of seroconversion were found between the auxotrophic strain expressing IBDV-VP2 (VAK1127) and its prototrophic derivative (VAK1171) (Fig. 10C).

Example 7.2. Complete protection through vaccination using a single injection regimen.

Vaccination is one injection type, i.e. vaccination through a single dose of vaccine is usually ineffective in the case of subunit vaccines due to insufficient immunogenicity. However, the antibody titer data (Fig. 9) obtained for the optimized strain VAK1127 in the prime/boost method indicate that protection can also be achieved in a single injection approach. To test this, one-injection vaccination was performed using the prototrophic yeast strain VAK1171 (Fig. 11; Table 3). In this case, yeast was introduced only once at a higher dose (10 mg) and infection was carried out with an interval of 4 weeks. It has been shown that with VAK1171, a single injection regimen can in fact achieve complete protection against vvIBDV (0% incidence, 0% mortality) (Table 3). This result is associated with the achievement of a higher titer of protective antibodies approximately 20 days after vaccination (Fig. 11). The fact that the single-injection vaccination regimen provides a high degree of protection against vvIBDV demonstrates the strong immunogenic potential of the vaccine used and provides impressive evidence for the applicability of the optimized platform for vaccine development.

Example 7.3. Improved protection provided by a bivalent yeast vaccine compared to a monovalent yeast vaccine when used against influenza A virus infections.

For vaccination against influenza A virus, three different vaccine strains were obtained. The first to create was VAK952 (DSM 32705), which expresses the main antigen of the influenza A virus strain (Puerto Rico/8/1934; PR8/34), the HA (hemagglutinin) gene. The gene was integrated into VAK952 using the method described in Krijger et al. (2012) and Arnold et al. (2012), to the LAC4 locus in the genome. The second to be created was VAK1283 (DSM 32697). In this case, in addition to the HA gene from PR8/34 at the LAC4 locus, the M1 gene was also integrated into the URA3 locus. The M1 gene encodes another important antigen of the influenza A virus, which is conserved to a much greater extent than NA. Already published reports have shown that by combining both antigens it is possible to increase the immunogenicity of the influenza A virus vaccine and also provide cross-protection against different influenza viruses. To validate this aspect using a bivalent yeast vaccine, another strain was obtained (VAK1395; DSM 32706), which also contained the M1 gene in the URA3 locus and the HA gene from PR8/34 was replaced by the HA gene of the California/4/2009 influenza virus . Comparable levels of HA expression or additional M1 expression in the respective strains were confirmed; the strains were also shown to have comparable growth, with a slight advantage for VAK1283 over VAK952 (Fig. 12). In vaccination studies in which a prime-boost or single-injection regimen, respectively, was administered to a mouse model at varying yeast concentrations, VAK952 and VAK1283 were each shown to induce similar virus-neutralizing antibody titers (FIG. 13). However, in the challenge experiment, it became apparent that the bivalent VAK1283 vaccine provided maximum protection in both the prime-boost and single-injection regimens, while this did not occur with the monovalent VAK952 vaccine. Additionally, for the VAK1283 vaccine in a single injection experiment, half of the yeast material used provided an effect similar to that of VAK952 in the prime-boost approach (Figure 14 and Table 3). In experiments using the VAK1395 vaccine, protection against influenza PR8/34 could also be observed. Thus, using a bivalent yeast-based vaccine, cross-protection was provided against different variants of the influenza virus.

Table 1

Reasons for infection - protective response in vaccinated chickens SPF D istopathological assessment of damage

Grafting (a)____________ bursa of Fabricius Index bu/bod (c)

Strain Quantity Having fallen ill- yeast VP2 per dose with infection - without infection - bridge (%) Mortality (VAK) vaccinations Adjuvant 0 1 2 3 4 (d) (%) (e) 367 Absent IFA - - - 1 7 2.80±1.32 5.36±0.65 6/10 (60) 4/10 (40) 1127 4.1+0.25 mcg IFA 8 - - 1 - 4.40+0.76 4.89+0.63 0/10 0/10 PBS IFA - - - - 10 4.08+1.91 4.92+0.94 10/10 (100) 8/10 (80%) table 2 Reasons for infection - protective response in vaccinated chickens SPF G istopathological damage assessment Vaccination(s) Bursa of Fabricius Index bu/bod (c) Strain Quantity Having fallen ill- yeast VP2 per dose with infection - without bridge (%) Mortality (VAK) vaccinations Adjuvant 0 1 2 3 4 infection prevention (d) (%) (e) 1127 4.1 ±0.71 µg IFA 6 - - - - 5.10±0.78 4.81±1.20 0/9 (0) 0/9 (0) - PBS IF A - - - - 8 4.09+1.87 5.32±0.85 9/9 (100) 7/9 (78) Table 3 Reasons for infection - protective response in vaccinated chickens SPF G istopathological damage assessment Vaccination(s) Bursa of Fabricius Index bu/bod (с) Strain Quantity Having fallen ill- yeast VP2 per dose with infection - without bridge (%) Mortality (VAK) vaccinations Adjuvant 0 1 2 3 4 infection prevention (d) (%) (e) PBS Absent MF59 - - - - 9 3.73+1.92 4.77+1.02 9/9 (100) 6/9 (66) VAK367 Absent MF59 - - - - 10 4.09+1.58 3.60+0.89 10/10 (100) 9/10 (90) VAK1171 35±4.2 µg IFA 10 - - - - 4.48±0.37 3.96±1.02 0/10 (0) 0/10 (0)

Explanations for the table. 1.

(a) Two weeks after hatching, chickens were inoculated subcutaneously with 1 mg of yeast (or PBS) and IFA as an adjuvant. Two weeks after the vaccine was administered, they were given a boost in the same way. After another two weeks, a test was carried out with infection with a virus introduced through the oculo-nasal route at the rate of 10 EID vvIBDV (very virulent 89163/7.3). The inoculum yeast used was inactivated whole yeast strain VAK1127, and the group inoculated with PBS and IFA alone served as an infection control. The antigen-free wild-type yeast group (VAK367) served as a control to determine the effect of the yeast itself.

(b) Histopathological assessment of damage to the bursa of Fabricius was performed using a scale from 0 to 4: 0: no damage; 1: 5-25% of affected follicles; 2: 26-50% of affected follicles; 3: 51-75% of affected follicles; 76-100% damage to the bursa of Fabricius (loss of structure).

(c) The mean bursa of Fabricius to body weight index (bu/bod) was calculated using the formula: (bursa of Fabricius mass/body weight)x1000. The control group without loading consisted of at least seven hens, the group with loading consisted of ten. Standard deviation is given.

(d) Morbidity is given as the number of sick chickens divided by the total number of chickens in the group. The percentage of sick chickens is shown in parentheses.

(e) Mortality is given as the number of dead chickens per total number of chickens in the group. The percentage of dead chickens is shown in parentheses.

Explanations for the table. 2.

(a) Two weeks after hatching, chickens were inoculated subcutaneously with 1 mg of yeast (or PBS) and IFA as an adjuvant. Two weeks after the vaccine was administered, they were given a boost in the same way. After another two weeks, a virus challenge test was performed via the oculo-nasal route using 10 ⁴ EID vvIBDV (very virulent 89163/7.3). The inoculum yeast used was inactivated whole yeast strain VAK1127, and the group inoculated with PBS and IFA alone served as an infection control.

(b) Histopathological assessment of damage to the bursa of Fabricius was performed using a scale from 0 to 4: 0: no damage; 1: 5-25% of affected follicles; 2: 26-50% of affected follicles; 3: 51-75% of affected follicles; 76-100% damage to the bursa of Fabricius (loss of structure).

(c) The mean bursa of Fabricius to body weight index (bu/bod) was calculated using the formula: (bursa of Fabricius mass/body weight)x1000. The unloaded control group consisted of at least five hens, and the loaded group consisted of nine. Standard deviation is given.

- 19 045050 (d) Morbidity is given as the number of sick chickens to the total number of chickens in the group.

The percentage of sick chickens is shown in parentheses.

(f) Mortality is given as the number of dead chickens per total number of chickens in the group. The percentage of dead chickens is shown in parentheses.

Explanations for the table. 3.

(a) Two weeks after hatching, chickens were inoculated subcutaneously with 10 mg of yeast (or PBS) and IFA as an adjuvant. Four weeks later, a test was carried out with infection with a virus introduced through the oculo-nasal route at the rate of 10 ⁴ EID vvIBDV (very virulent 89163/7.3). Inactivated whole yeast strain VAK1171 was used as yeast for a single inoculation. The group inoculated with PBS and MF59 alone and the group inoculated with wild-type yeast and MF59 served as infection controls; two weeks after the first inoculation, both groups were boosted with the same amount of yeast or PBS.

(b) Histopathological assessment of damage to the bursa of Fabricius was performed using a scale from 0 to 4: 0: no damage; 1: 5-25% of affected follicles; 2: 26-50% of affected follicles; 3: 51-75% of affected follicles; 76-100% damage to the bursa of Fabricius (loss of structure).

(c) The average value of the bursa of Fabricius to body weight ratio index (bu/bod) was calculated using the formula: (weight of bursa of Fabricius/body weight) x 1000. Each group consisted of at least nine chickens. Standard deviation is given.

(d) Morbidity is given as the number of sick chickens divided by the total number of chickens in the group. The percentage of sick chickens is shown in parentheses.

(e) Mortality is given as the number of dead chickens divided by the total number of chickens in the group. The percentage of dead chickens is shown in parentheses.

Sequences.

The present invention contains as part of the description the following sequences.

SEQ ID NO Name 1 K. lactis avt3::LAC9 2 LAC4-12-LR2 3 Vector X7pURA3 4 Vector A7rMET5 5 Variant ¥1^4-12 of the LAC4-12 promoter 6 Variant of P^cr/g-thrust promoter LAC4-12 7 Option R/propmotor LAC4-12 8 Variant P^C4-LR2 of the LAC4-12 promoter 9 Primer sequence VK183 10 Primer sequence VK184 AND MAB6 primer sequence

-20045050

12 VK71 primer sequence 13 Primer sequence VK211 14 BCR PLAC4-12 15 VK30 primer sequence 16 VK31 primer sequence 17 VK32 primer sequence 18 VK33 primer sequence 19 VK34 primer sequence 20 VK35 primer sequence 21 L7rZ-tandem-oUR2T28 22 VK67 primer sequence 23 VK69 primer sequence 24 VK74 primer sequence 25 VK75 primer sequence

-21 045050

List of references.

Arnold, M.; Durairaj, V.; Mundt, E.; Schulze, K.; Breunig, K. D. & Behrens, S.-E. Protective Vaccination against Infectious Bursal Disease Virus with Whole Recombinant Kluyveromyces lactis Yeast Expressing the Viral VP2 Subunit, PLoS ONE, Public Library of Science, 2012, 7, e42870

Berthoud, T. K.; Hamill, M.; Lillie, P. J.; Hwenda, L.; Collins, K. A.; Ewer, K. J.; Milicic, A.;

Poyntz, H. C.; Lambe, T. & Fletcher, H. A. Potent CD8+ T-cell immunogenicity in humans of a novel heterosubtypic influenza A vaccine, MV A- NP+ Ml, Clinical infectious diseases, Oxford University Press, 2011, 52, 1-7

Bathurst, I. C. Protein expression in yeast as an approach to production of recombinant malaria antigens, The American journal of tropical medicine and hygiene, ASTMH, 1994, 50, 20-26

Breunig, K. D. Multicopy plasmids containing the gene for the transcriptional activator LAC9 are not tolerated by K. lactis cells, Current genetics, Springer, 1989, 15, 143-148 de Silva; Chandimal, U.; Tanaka, H.; Nakamura, S.; Goto, N. & Yasunaga, T. A comprehensive analysis of reassortment in influenza A virus, Biology open, The Company of Biologists Ltd, 2012, 1, 385-390

Eterradossi, N.; Toquin, D.; Abbassi, H.; Rivallan, G.; Cotte, J. & Guittet, M. Passive Protection of Specific Pathogen Free Chicks Against Infectious Bursal Disease by In - Ovo Injection of Semi - Purified Egg - Yolk Antiviral Immunoglobulins, Zoonoses and Public Health, Wiley Online Library, 1997, 44, 371- 383

Gellissen, G. & Hollenberg, S. P. Application of yeasts in gene expression studies: a comparison of Saccharomyces cerevisiae, Hansenula polymorpha and Kluyveromyces lactis-a review, Gene, Elsevier, 1997, 190, 87-97

Godecke, A.; Zachariae, W.; Arvanitidis, A. & Breunig, K. D. Coregulation of the Kluyveromyces lactis lactose permease and β-galactoidase genes is achieved by interaction of multiple LAC9 binding sites in a 2.6 kbp divergnent promoter, Nucleic acids research, Oxford University Press, 1991, 19, 5351- 5358

- 22 045050

Granzow, H.; Birghan, C.; Mettenleiter, T. C.; Beyer, J.; Kollner, W. & Mundt, E. A second form of infectious bursal disease virus-associated tubule contains VP4., Journal of virology, Am Soc Microbiol, 1997, 71, 8879-8885

Kasanga, C. J.; Yamaguchi, T.; Wambura, P. N.; Maeda-Machang'u, A. D.; Ohya, K. & Fukushi, H. Molecular characterization of infectious bursal disease virus (IBDV): diversity of very virulent IBDV in Tanzania, Archives of virology, Springer, 2007, 152, 783-790

Kirchenbaum, G. A. & Ross, T. M. Eliciting broadly protective antibody responses against influenza, Current opinion in immunology, Elsevier, 2014, 28, 71-76

Kirunda, E.L.; Erima, B.; Tumushabe, A.; Kiconco, J.; Tugume, T.; Mulei, S.; Mimbe, D.; Mworozi, E.; Bwogi, J. & Luswa, L. Prevalence of influenza A viruses in livestock and freeliving waterfowl in Uganda, BMC veterinary research, BioMed Central, 2014, 10, 50

Krammer, F. & Palese, P. Influenza virus hemagglutinin stalk-based antibodies and vaccines, Current opinion in virology, Elsevier, 2013, 3, 521-530

Krijger, J.-J.; Baumann, J.; Wagner, M.; Schulze, K.; Reinsch, C.; Klose, T.; Onuma, O. F.; Simon, C.; Behrens, S.-E. & Breunig, K. D. A novel, lactase-based selection and strain improvement strategy for recombinant protein expression in Kluyveromyces lactis, Microbial Cell Factories, 2012, 11, 112

Kumar, K.; Singh, K. S. P. & Prasad, S. B. Immune responses to intermediate strain IBD vaccine at different levels of maternal antibody in broiler chickens, Tropical animal health and production, Springer, 2000, 32, 357-360

Negash, T.; Gelaye, E.; Petersen, E.L.; Grummer, B. & Rautenschlein, S. Molecular evidence of very virulent infectious bursal disease viruses in chickens in Ethiopia, Avian diseases, BioOne, 2012, 56, 605-610

Rautenschlein, S.; Kraemer, S. H.; Vanmarcke, J. & Montiel, E. Protective efficacy of intermediate and intermediate plus infectious bursal disease virus (IBDV) vaccines against very virulent IBDV in commercial broilers, Avian diseases, BioOne, 2005, 49, 231-237

Remington's Practice of Pharmacy, 13. Ausgabe und J. of. Pharmaceutical Science & Technology, Vol. 52, Nr. 5, Sept-Oct., S. 238-311

-

Claims (36)

Ridpath, J. F. Emerging pestiviruses infecting domestic and wildlife hosts, Animal Health Research Reviews, Cambridge University Press, 2015, 16, 55-59 RKI, Influenza (Teil 2): Erkrankungen durch zoonotische Influenzaviren, 2016 Schrauwen, E. J. A. & Fouchier, R. A. M. Host adaptation and transmission of influenza A viruses in mammals, Emerging microbes & infections, Nature Publishing Group, 2014, 3, e9 Short, K. R.; Richard, M.; Verhagen, J. H.; van Riel, D.; Schrauwen, E. J. A.; van den Brand, J. M. A.; Manz, B.; Bodewes, R. & Herfst, S. One health, multiple challenges: The interspecies transmission of influenza A virus, One health, Elsevier, 2015, 1, 1-13 Steel, J.; Lowen, A. C.; Wang, T. T.; Yondola, M.; Gao, Q.; Haye, K.; Garcia-Sastre, A. & Palese, P. Influenza virus vaccine based on the conserved hemagglutinin stalk domain, MBio, Am Soc Microbiol, 2010, 1, e00018-10 WHO, Influenza (Seasonal), 2016 WHO, Biologicals, Influenza, 2017 CLAIM 1. Kluyveromyces lactis (K. lactis) strain for targeted cloning of nucleic acids encoding a foreign antigen into the genome of the yeast strain K. lactis, characterized by the fact that the K. lactis strain has an addition to the KlLAC4 locus in the KlURA3-20 locus and/ or the KlMET51 locus contains integrated expression cassettes for foreign antigens, wherein the K. lactis expression cassettes contain the LAC4-12 promoter ( _PLAC4-12 ) or a variant of this promoter, including the intergenic region from LAC12 to _LAC4 , the foreign antigen-encoding region and terminator AgTEF1, and wherein said variant of said LAC4-12 promoter (P _LAC4-12 ) is selected from at least one of the LAC4-12 promoter with a modified promoter structure that, under non-inducing conditions, does not allow or only allows little expression of a foreign protein, when This removes the basic control region (BCR) of the P _LAC4 promoter. ₁₂ -1065 to -1540 (LR2 deletion; P _LAC4 . ₁₂ . _LR2 ; SEQ ID NO: 2); and the LAC4-12 promoter with a modified promoter structure that provides the ability to modulate the expression of a foreign protein, while the number of binding sites for the KlGal4 promoter activator (upstream activating sequences 1, 2 and 4, 5) varies, and 1, 2, 3 or 4 are present KlGal4 binding site. 2. The K. lactis strain according to claim 1, characterized in that the KlLAC4 locus, or the KlURA3-20 locus, or the KlMET5-1 locus of the resulting K. lactis strains contains several copies of nucleic acids encoding a foreign antigen, which are inserted by tandem expression cassette or multiple expression cassettes. 3. The K. lactis strain according to claim 1 or 2, characterized in that the KlLAC4 locus of the K. lactis strain contains the foreign IBDV VP2 antigen gene in the form of a tandem expression cassette. 4. The K. lactis strain according to claim 1 or 2, characterized in that the KlLAC4 locus, and/or the KlURA3-20 locus, and/or the KlMET5-1 locus contains one or more copies of various nucleic acids encoding a foreign antigen , which are inserted via a single expression cassette, a tandem expression cassette, or multiple expression cassettes. 5. The K. lactis strain according to any one of claims 1, 2 and 4, characterized in that in the KlLAC4 and KlURA3-20 loci of the K. lactis strain, genes encoding foreign antigens HA of the influenza A virus are inserted and expressed ((A/Puerto Rico /8/1934(H1N1)) and M1 influenza A virus ((A/Puerto Rico/8/1934(H1N1)). 6. The K. lactis strain according to any of the previous paragraphs, characterized in that the K. lactis strain, in addition to the genomic KIGAL4 gene, contains a second ectopic copy of the KIGAL4 gene. 7. The K. lactis strain according to claim 6, characterized in that the ectopic copy of the KIGAL4 gene, which is flanked by the KIGAL4 promoter and the KIGAL4 terminator, is integrated in the K. lactis strain into the KLLA0E13795g gene locus (KlavtS::KlGAL4-1, SEQ ID NO: 1). 8. The K. lactis strain according to any of the previous paragraphs, characterized in that the KlLAC4 locus of the K. lactis strain contains the gene for the foreign antigen VP2 of IBDV. 9. The K. lactis strain according to claim 1, characterized in that the KlLAC4 locus of the K. lactis strain contains the gene for the foreign antigen HA of the influenza A virus ((A/Puerto Rico/8/1934(H1N1)). 10. The K. lactis strain according to any of the previous paragraphs, characterized in that in the locus - 24 045050 K1LAC4 strain K. lactis inserted the gene for the foreign antigen VP2 of IBDV. 11. The K. lactis strain according to any of the previous paragraphs, characterized in that the gene function of the Kllac4, Klura3-20 and Klmet5-I alleles is restored, and the K. lactis strain is prototrophic. 12. The K. lactis strain according to any of the previous paragraphs, characterized by the fact that the genes of foreign antigens of the BVDV E2 ectodomain (type 1, CP7), BVDV E2 ectodomain (type 2, New York 93) and Npro-NS3 BVDV (Typ1, CP7). 13. K. lactis strain which is VAK1283 DSM 32697. 14. K. lactis strain which is VAK1395 DSM 32706. 15. K. lactis strain which is VAK1400 DSM 32698. 16. A method for obtaining a K. lactis strain according to any one of claims 1-15, including the stages: (i) insertion of the gene sequence of the desired antigen into the KIpURA3 and/or KIpMET5 vector and into the KIp3-MCS vector, (ii) transformation of the K. lactis culture using modified and pre-enzymatically digested vector constructs and/or vector constructs, (iii) selection transformed K. lactis cells using solid medium that does not contain uracil and/or methionine. 17. The method according to claim 16, further comprising step (iv) restoring prototrophy. 18. The method according to claim 16 or 17, characterized in that ectopic insertion and regulated expression of gene sequences of several antigens are simultaneously provided. 19. The method according to claim 18, characterized in that they provide ectopic insertion and regulated expression of various gene sequences that encode antigens of various variants of the pathogen. 20. The method according to claim 18, characterized in that they provide ectopic insertion and regulated expression of various gene sequences that encode antigens of various pathogens. 21. Pharmaceutical composition containing the K. lactis strain according to any one of claims 1-15. 22. Use of the K. lactis strain according to any one of claims 1-15 in vaccination. 23. Use according to claim 22, characterized in that the K. lactis strain is administered subcutaneously, intramuscularly, orally or through mucous membranes. 24. Use according to claim 22, characterized in that the K. lactis strain, after a single application or immunization or a double application or immunization, provides a protective immune response against the pathogen. 25. Use according to claim 22, characterized in that the K. lactis strain, after a single application or immunization or double application or immunization, provides a cross-protective immune response against different variants of the pathogen. 26. Use according to claim 22, characterized in that the K. lactis strain, after a single application or immunization or double application or immunization, provides a protective immune response against various pathogens. 27. Use of the K. lactis strain according to any one of claims 1-15 in protective humoral vaccination. 28. Use according to claim 27, characterized in that the K. lactis strain is administered subcutaneously, intramuscularly, orally or through mucous membranes. 29. Use according to claim 27, characterized in that the K. lactis strain, after a single application or immunization or a double application or immunization, provides a protective immune response against the pathogen. 30. Use according to claim 27, characterized in that the K. lactis strain, after a single application or immunization or double application or immunization, provides a cross-protective immune response against different variants of the pathogen. 31. Use according to claim 27, characterized in that the K. lactis strain, after a single application or immunization or double application or immunization, provides a protective immune response against various pathogens. 32. A method of vaccination comprising administering the K. lactis strain of any one of claims 1 to 15 to a subject in an amount sufficient to provide the subject with a protective immune response against one or more foreign antigens. 33. The method according to claim 32, characterized in that the K. lactis strain is administered subcutaneously, intramuscularly, orally or through mucous membranes. 34. The method according to claim 32 or 33, characterized in that the K. lactis strain, after a single application or immunization or double application or immunization, provides a protective immune response against the pathogen. 35. The method according to claim 32 or 33, characterized in that the K. lactis strain, after a single application or immunization or double application or immunization, provides a cross-protective immune response against different variants of the pathogen. 36. The method according to claim 32 or 33, characterized in that the K. lactis strain after a single application or immunization or double application or immunization provides protective immunity -