EA044901B1 - DEVELOPMENT OF AAV CAPSIDS - Google Patents

Description

Related applications

This application claims priority under 35 U.S. Code § 119(e) as filed on U.S. Provisional Application Serial No. USSN No. 62/486642, filed April 18, 2017, entitled Development of AAV Capsids, No. 62/417756, filed November 4, 2016, entitled Development of AAV Capsids and No. 62/408022, filed October 13, 2016, entitled Development of AAV Capsids, the entire contents of each application are incorporated herein by reference.

Field of invention

The present disclosure, in certain aspects, relates to isolated nucleic acids, compositions and kits for identifying adeno-associated viruses in cells. In accordance with certain aspects, the present disclosure provides new AAVs and methods of using them, as well as related kits.

BACKGROUND OF THE INVENTION

Recombinant adeno-associated AAV viruses (rAAVs) are capable of driving stable and long-lasting transgene expression in target tissues without apparent toxicity or immunogenicity to the host. Thus, rAAVs represent promising delivery systems for long-term therapeutic gene expression. However, the low transduction efficiency and limited tissue tropism of currently available rAAV vectors may limit their use as feasible and effective therapies. In addition, reliable transition to clinical use of major therapeutic AAV serotypes originating from non-human tissues poses a challenge. Accordingly, there remains a need for new AAV-based vectors for gene delivery.

Brief description of the invention

The present disclosure, in certain aspects, relates to novel AAVs for gene therapy applications. In accordance with some embodiments, the AAVs described herein contain amino acid variations in one or more capsid proteins that confer new or enhanced tissue tropism properties. In accordance with certain embodiments, variants of AAV2, AAV2/3 (eg, an AAV2/3 hybrid), and AAV8 that have useful tissue targeting properties have been identified and disclosed herein. For example, AAV8 variants are provided that are useful for transducing cells such as human hepatocytes (eg, those present in liver tissue), central nervous system cells (CNM cells), etc. AAV2, AAV2/3 variants are provided (eg, AAV2/3 hybrid ) and AAV8, which in accordance with some embodiments are suitable for targeting cells of ocular tissue (e.g., eyes), gastrointestinal tract, respiratory system, breast tissue, pancreatic tissue, urinary tract tissue, uterine tissue, tissue, associated with certain types of cancer (for example, breast cancer, prostate cancer, etc.) and other tissues. In some embodiments, the AAV variants described herein target tissue different from the tissue targeted by the corresponding wild-type AAV.

The present disclosure, in accordance with certain aspects, provides an isolated nucleic acid encoding a polypeptide selected from the group consisting of: SEQ ID NO: 1-409, 435-868, and 1726-1988, which encodes an AAV capsid protein. In accordance with some embodiments, an isolated nucleic acid fragment is provided. In certain embodiments, the isolated nucleic acid fragment does not encode a peptide that is identical to the sequence of any of SEQ ID NO: 869, 870, or 871.

In accordance with certain aspects, the present disclosure provides a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs: 410-434, 8761718, and 1989-2251. In some embodiments, the nucleic acid encodes an AAV capsid protein, or a variant thereof, and/or an AAV assembly-activating protein (AAP), or a variant thereof. In accordance with some embodiments, the AAP is in a different nucleic acid open reading frame than the AAV capsid protein. In accordance with some embodiments, the AAP is an AAV2 AAP (AAP-2) or a variant thereof.

The present disclosure, in accordance with certain aspects, provides an isolated AAV capsid protein comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs: 1-409, 435-868, and 1726-1988. In some embodiments, the isolated AAV capsid protein comprises a sequence selected from: SEQ ID NO: 1409, 837-852, or 1726-1814, wherein an amino acid sequence that is not identical to the corresponding amino acid sequence set forth in SEQ ID NO: 869, replaced by a conservative replacement.

In accordance with certain aspects, the present disclosure provides AAV2/3 fusion capsid proteins. In accordance with some embodiments, the isolated capsid

- 1 044901 AAV protein contains a sequence selected from: SEQ ID NO: 435-628 and 1815-1988, wherein an amino acid of the sequence that is not identical to the corresponding amino acid of the sequence set forth as SEQ ID NO: 869 or 870 is replaced by a conservative substitution .

In accordance with some embodiments, the isolated AAV capsid protein comprises a sequence selected from: SEQ ID NO: 629-836 or 853-868, wherein an amino acid sequence that is not identical to the corresponding amino acid sequence set forth as SEQ ID NO: 871, replaced by a conservative substitution.

In accordance with certain aspects of the present disclosure, a composition is provided that contains any of the above AAV capsid proteins. In accordance with some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In accordance with some embodiments, a composition of one or more isolated AAV capsid proteins of the present disclosure and a physiologically compatible carrier is provided.

In accordance with certain aspects of the present disclosure, a recombinant AAV (rAAV) is provided that contains any of the above AAV capsid proteins. In accordance with some embodiments, a composition comprising rAAV is provided. In accordance with certain embodiments, the rAAV-containing composition further comprises a pharmaceutically acceptable carrier. Recombinant AAV is also provided, wherein the recombinant AAV comprises one or more isolated AAV capsid proteins of the present disclosure.

In accordance with some embodiments of the present disclosure, a host cell is provided that contains a nucleic acid encoding a sequence selected from the group consisting of: SEQ ID NO: 410-434, 876-1718 and 1989-2251, which is operably linked to a promoter. In accordance with some embodiments, a composition is provided comprising a host cell and a sterile cell culture medium. In accordance with some embodiments, a composition is provided comprising a host cell and a cryopreservative.

In accordance with certain aspects of the present disclosure, a method of delivering a transgene to a subject is provided. In some embodiments, the method comprises administering any of the foregoing rAAVs to a subject, wherein the rAAV contains at least one transgene and wherein the rAAV infects cells of a target tissue of the subject. In some embodiments, the subject is selected from mouse, rat, rabbit, dog, cat, sheep, pig, and non-human primate. In accordance with one embodiment, the subject is a human.

In accordance with some embodiments, the at least one transgene is a protein encoding gene. In accordance with certain embodiments, the at least one transgene encodes a small interfering nucleic acid. In certain embodiments, the small interfering nucleic acid is a miRNA. In certain embodiments, the small interfering nucleic acid is a miRNA sponge or TuD RNA that inhibits the activity of at least one miRNA in a subject. In accordance with certain embodiments, the miRNA is expressed in a cell of the target tissue. In certain embodiments, the target tissue is tissue from the liver, central nervous system (CNS), eye, gastrointestinal tract, respiratory system, breast, pancreas, urinary tract, or uterus.

In some embodiments, the transgene expresses a transcript that contains at least one miRNA binding site, wherein the miRNA inhibits the activity of the transgene in a tissue other than the target tissue by hybridizing to the binding site.

In certain embodiments, rAAV is administered to a subject intravenously, transdermally, intraocularly, intrathecally, intracerebrally, orally, intramuscularly, subcutaneously, intranasally, or by inhalation.

In accordance with certain aspects of the present disclosure, a method for producing a somatic transgenic animal model is provided. In some embodiments, the method comprises administering any of the foregoing rAAVs to a non-human animal, wherein the rAAV contains at least one transgene and wherein the rAAV infects cells of a target tissue of the non-human animal.

In accordance with some embodiments, the transgene is at least one gene encoding a protein. In certain embodiments, the transgene encodes at least one small interfering nucleic acid. In accordance with some embodiments, the transgene encodes at least one reporter molecule. In certain embodiments, the small interfering nucleic acid is a miRNA. In accordance with certain embodiments, small

- 2 044901 interfering nucleic acid is a miRNA sponge or TuD RNA that inhibits the activity of at least one miRNA in an animal. In accordance with certain embodiments, the miRNA is expressed in a cell of the target tissue. In certain embodiments, the target tissue is tissue from the liver, central nervous system (CNS), eye, gastrointestinal tract, respiratory system, breast, pancreas, urinary tract, or uterus.

In some embodiments, the transgene expresses a transcript that contains at least one miRNA binding site, wherein the miRNA inhibits the activity of the transgene in a tissue other than the target tissue by hybridizing to the binding site.

In accordance with certain aspects of the present disclosure, methods are provided for producing a somatic transgenic animal model that comprise administering any of the foregoing rAAVs to a non-human animal, wherein the rAAV contains at least one transgene, wherein the transgene expresses a transcript that contains at least one site miRNA binding, wherein the miRNA inhibits the activity of the transgene in a tissue other than the target tissue by hybridizing to the transcript binding site.

In accordance with some embodiments, the transgene comprises a tissue-specific promoter or an inducible promoter. In certain embodiments, the tissue-specific promoter is a liver-specific thyroxine-binding globulin gene (TBG) gene promoter, an insulin gene promoter, a glucagon gene promoter, a somatostatin gene promoter, a mucin-2 gene promoter, a pancreatic polypeptide gene (PPY) promoter. , synapsin-1 (Syn) gene promoter, retinoschisin gene promoter, K12 gene promoter, CC10 gene promoter, surfactant protein C (SP-C) gene promoter, PRC1 gene promoter, RRM2 gene promoter, uroplakin 2 (UPII) gene promoter or promoter lactoferrin gene.

In certain embodiments, rAAV is administered to the animal intravenously, transdermally, intraocularly, intrathecally, orally, intramuscularly, subcutaneously, intranasally, or by inhalation. In accordance with certain aspects of the present disclosure, a somatic transgenic animal model is provided that is obtained by any of the foregoing methods.

In accordance with other aspects of the present disclosure, a kit for producing rAAV is provided. In accordance with some embodiments, the kit contains a container containing an isolated nucleic acid having a sequence from any of SEQ ID NO: 410-434, 8761718 and 1989-2251. In accordance with some embodiments, the kit contains a container containing an isolated nucleic acid encoding a polypeptide having the sequence of any of SEQ ID NO: 1-409, 435-868, or 1726-1988. In accordance with some embodiments, the kit further contains instructions for producing rAAV. In accordance with some embodiments, the kit further comprises at least one container containing a recombinant AAV vector, wherein the recombinant AAV vector contains a transgene.

In accordance with other aspects of the present disclosure, a kit is provided comprising a recombinant AAV having any of the above AAV capsid proteins. In accordance with some embodiments, the kit container is a syringe.

In accordance with other aspects, the present disclosure relates to the use of AAV-based vectors in the form of agents, for example, for gene delivery, therapeutic, prophylactic and research purposes, as well as the development of somatic transgenic animal models.

In certain aspects, the present disclosure relates to AAV serotypes that have demonstrated tropism for other tissues/cells, and that can achieve stable smatic gene transfer into animal tissues at levels similar to those of adenoviral vectors (e.g., up to 100% in vivo tissue transduction depending on the target tissue and vector dose) in the absence of vector-related toxicity. In other aspects, the present disclosure relates to AAV serotypes having specific abilities to specifically target tissues of the liver, central nervous system (CNS), eye, gastrointestinal tract, respiratory system, breast, pancreas, urinary tract, or uterus. These tissues are associated with a wide range of human diseases, including neurological, metabolic, diabetic, ocular, respiratory, gastrointestinal, urinary and reproductive diseases, as well as certain types of cancer.

In accordance with some embodiments, rAAV contains at least one transgene. The transgene may be one that causes a pathological condition. In accordance with some embodiments, the transgene encodes a protein that results in treatment of a pathological condition.

In accordance with another aspect, the novel AAVs of the present disclosure can be used to deliver a transgene to a subject. The method is carried out by administering the rAAV of the present disclosure to a subject, wherein the rAAV contains at least one transgene. In accordance with some embodiments, the rAAV specifically targets a predetermined tissue of the subject.

In accordance with another aspect, the AAVs of the present disclosure can be used in a method for producing a somatic transgenic animal model. The method is carried out by administering the rAAV of the present disclosure to an animal, wherein the rAAV contains at least one transgene, wherein the transgene causes a pathological condition, and wherein the rAAV specifically affects a predetermined tissue of the animal.

The transgene can express a number of genes, including genes including cancer-associated genes, pro-apoptotic genes, and apoptosis-related genes. In accordance with some embodiments, the transgene expresses a small interfering nucleic acid capable of inhibiting the expression of a cancer-associated gene. In other embodiments, the transgene expresses a small interfering nucleic acid capable of inhibiting the expression of an apoptosis-related gene. The small interfering nucleic acid in accordance with other embodiments is a miRNA or shRNA. In other embodiments, the transgene expresses a toxin, wherein the toxin is DTA. In other embodiments, the transgene expresses a reporter gene, which is optionally a reporter enzyme such as beta-galactosidase or a fluorescent protein such as GFP or luciferase.

The transgene can express miRNA. In other embodiments, the transgene expresses a miRNA sponge, wherein the miRNA sponge inhibits the activity of one or more miRNAs in an animal. In some embodiments, the miRNA may be an endogenous miRNA or it may be expressed in a cell of tissue from the liver, central nervous system (CNS), eye, gastrointestinal tract, respiratory system, breast, pancreas, urinary tract, or uterus.

rAAV can transduce many different tissue types, such as neurons, squamous epithelial cells, renal proximal or distal convoluted tubule cells, mucosal glandulocytes, blood vessel endothelial cells, endometrial cells, retinal cells, or certain cancer cells (eg, breast cancer cells, prostate cancer cells, etc.).

In some embodiments, rAAV is administered at a dose of 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , or 10 ¹⁵ genomic copies per subject. In some embodiments, rAAV is administered at a dose of 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ or 10 ¹⁴ genomic copies per kg. rAAV can be administered by any route. For example, in accordance with some embodiments, it may be administered intravenously (eg, by injection into the portal vein).

In some embodiments, the transgene includes a tissue-specific promoter, such as a liver-specific thyroxine-binding globulin gene (TBG) gene promoter, an insulin gene promoter, a glucagon gene promoter, a somatostatin gene promoter, a mucin-2 gene promoter, a gene promoter pancreatic polypeptide (PPY), synapsin-1 (Syn) gene promoter, retinoschisin gene promoter, K12 gene promoter, CC10 gene promoter, surfactant protein C (SP-C) gene promoter, PRC1 gene promoter, RRM2 gene promoter, uroplakin 2 gene promoter (UPII) or lactoferrin gene promoter.

The somatic transgenic animal model may be a mammal such as a mouse, rat, rabbit, dog, cat, sheep, pig and non-human primate.

In some embodiments, a putative therapeutic agent may be administered to a somatic transgenic animal model to determine the effect of the putative therapeutic agent on a disease state of the animal.

In accordance with another aspect, the present disclosure is a somatic transgenic model produced using the methods described herein.

In accordance with another aspect of the present disclosure, a kit is provided for producing rAAV that produces a somatic transgenic animal having a pathological condition in a predetermined tissue. The kit contains at least one container containing a recombinant AAV vector, at least one container containing a rAAV packaging component, and instructions for constructing and packaging the recombinant AAV.

The rAAV packaging component may contain a host cell expressing at least one rep gene and/or at least one cap gene. In some embodiments, the host cell is a 293 cell. In other embodiments, the host cell expresses at least one helper virus gene product that influences the production of rAAV comprising a recombinant AAV vector. The at least one cap gene may encode a capsid protein from an AAV serotype that targets a predetermined tissue.

In other embodiments, the rAAV packaging component comprises a helper virus, wherein the helper virus is optionally an adenovirus or a herpes virus.

- 4 044901

The rAAV-based vector and components therein may include any of the elements described herein. For example, in accordance with some embodiments, the rAAV-based vector contains a transgene, such as any of the transgenes described herein. In some embodiments, the transgene expresses a miRNA inhibitor (e.g., miRNA sponge or TuD RNA), wherein the miRNA inhibitor inhibits the activity of one or more miRNAs in the somatic transgenic animal.

Each of the limitations of the present disclosure may include different embodiments of the present disclosure. Thus, it is intended that each of the limitations of the present disclosure, including any element or combination of elements, may be included in every aspect of the present disclosure. The present disclosure is not limited in its application to the details of design and arrangement of components set forth in the following description or illustrated in the drawings. The present disclosure may be implemented in accordance with other embodiments and may be practiced or carried out in various ways.

Brief description of the figures

In fig. 1A, 1B show flow diagrams for identifying AAV variants. In fig. Figure 1A shows high-throughput detection of novel AAV variants in selected human tissues. Proviral capsid sequences are amplified using a high-cycle PNR, then using a low-cycle PNR to barcode amplicon libraries for multiplex single-molecule real-time (SMRT) sequencing. In fig. Figure 1B shows summarized flow results for bioinformatics analysis of sequenced data.

In fig. 2A-2D show data relating to the in vivo detection of FFLuc transgenic activity upon various administrations of certain AAV8 variants. In fig. 2A shows that the luciferase activity of various AAV8 variants was assessed at week 6 after IV (intravenous), IM (intramuscular) or IN (intranasal) injection. In fig. 2B-2D show data related to FFLuc activity scores for each variant, B2 (FIG. 2B), B3 (FIG. 2C), and B61 (FIG. 2D), compared to AAV8 (mean ±SD, n=3, t -criterion).

In fig. 3A, 3B show data relating to the evaluation of FFLuc transgenic activity delivered by the AAV8 variant B61 compared to AAV9 at day 21 after neonatal injection. Luciferase activity and genomic copies of the brain (Fig. 1A) and spinal cord (Fig. 1B) were detected (mean ± SD, n = 5, t test).

In fig. 4A, 4B show data relating to in vivo detection of FFLuc transgenic activity following intramuscular (IM) injection into the right hind limb of the AAV8 variant B44 compared to AAV8. In fig. 4A shows that whole animal luciferase expression of the B44 variant was assessed at week 6 post-IM injection. In fig. Figure 4B shows assessment of muscles (RTA, right tibialis anterior; LTA, right tibialis anterior), liver, and heart. Luciferesis activity (left bar graph) and relative ratios (right bar graph) are presented for B44 versus AAV8 (mean ±SD, n=3).

In fig. Figure 5 shows a phylogenetic comparison of AAV8 variants (B2, B3, B61) with other AAV serotypes.

In fig. 6A shows a schematic flowchart for in vivo characterization of novel AAV variants resulting from high-throughput tropism screening.

In fig. 6B shows a schematic depiction of the NHP characterization workflow of new AAV variants from high-throughput tropism screening.

In fig. 7 is a scatterplot depicting the distribution of different AAV2 capsid variants (409 total) and AAV2/3 variants (194 total) containing one or more variants with a single amino acid difference.

In fig. Figure 8 shows diagrams of vector constructs used in multiplex screening of detected capsid variants. Unique 6 bp barcodes were cloned into transgenes and packaged into candidate capsid variants.

In fig. Figure 9 shows a diagram of the indexed transgene and a diagram of high-throughput sequencing of the library to evaluate the tropism profiling of capsid variants. Indexed and adapter cassette containing 6 bp barcode. (1° barcode) and BstEII restriction site, can be cloned into vector constructs by flanking the BsrGI sites with SacI. Whole raw DNA from rAAV-treated tissues containing both host and vector genomes was sheared using the BstEII enzyme. The resulting 5' overhang was used to specifically ligate an adapter containing a second barcode that allows for additional multiplexed sequencing and optimization; and 5'-biotin modification, which can be used to select adapter-containing fragments using magnetic bead enrichment. The enriched material can then be PCR amplified using primers specific for adapter and transgene sequences to produce libraries for high-throughput sequencing. SEQ ID NO: 1719-1725 are shown from top to bottom.

- 5 044901

Detailed Disclosure of the Invention

Adeno-associated virus (AAV) is a small (~26 nm), replication-defective, non-enveloped virus that typically depends on the presence of a second virus, such as an adenovirus or herpes virus, for its growth in cells. AAV is not known to cause disease and induces a very weak immune response. AAV can infect both dividing and non-dividing cells and can incorporate its genome into the genome of the host cell. These characteristics make AAV a very attractive candidate for the development of viral vectors for gene therapy. Prototypical serotype 2-based AAV vectors provided experimental proof of concept for nontoxic and stable gene transfer in murine and large animal models, but had poor transfer efficiency in many major target tissues. The present disclosure is, in certain aspects, intended to overcome this shortcoming by providing new AAVs having the ability to specifically target various tissues for gene therapy and research applications.

In accordance with certain aspects of the present disclosure, novel AAV capsid proteins are provided that have the ability to target various tissues. In some embodiments, the AAV capsid protein is isolated from tissue that is targeted by the AAV containing the capsid protein. In accordance with some aspects, methods are provided for delivering a transgene to a target tissue in a subject. Transgene delivery methods may be used for gene therapy (eg, to treat a disease) or research (eg, to create a somatic transgenic animal model) applications.

AAV detection methods.

Much of the biology of AAV is due to its capsid. Accordingly, methods for discovering new AAVs have been mainly aimed at isolating DNA sequences for AAV capsids. The main property of the latent adeno-associated virus (AAV) life cycle is persistence in the form of integrated and/or episomal genomes in the host cell. Methods for isolating new AAVs include molecular rescue of latent AAV DNA genomes, rescue of latent proviral genomes of infectious viruses from tissue DNA in vitro in the presence of a functional adenovirus helper virus element, and rescue of circular proviral genomes from tissue DNA using linear rolling circle amplification. mediated by the polymerase of the isothermal phage Phi-29. All of these isolation methods take advantage of the latency of AAV proviral DNA genomes and aim to rescue the genomic DNA of persistent viruses.

In accordance with some aspects, the present disclosure relates to the discovery that novel AAV variants with tropisms for desired tissues can be detected in vivo from tissues of a subject. Without being bound by theory, in vivo tissue applications utilize the natural reservoir of genomic diversity observed among viral genomic sequences isolated from normal and tumor tissues of a subject. Thus, in some embodiments, in vivo tissues act as natural incubators of viral (eg, viral capsid protein) diversity as a result of selective pressure and/or immune evasion.

In some aspects, the present disclosure relates to the discovery that PNR products resulting from amplification of AAV DNA (e.g., AAV DNA isolated or extracted from a host cell or tissue of a subject in vivo) can be subjected to high-throughput single-molecule sequencing in real time. time (SMRT) to identify new capsid protein variants. As used herein, the term single-molecule real-time sequencing (SMRT) refers to a parallelized single-molecule real-time sequencing method, such as that described by Roberts et al. (2013) Genome Biology 14:405, doi:10.1186/gb-2013-14-7-405. Without being bound by a particular theory, the use of SMRT sequencing eliminates the need to reconstruct the viral genome and predict chimeric organisms based on aligned short-read fragments obtained from other standard high-throughput genome sequencing techniques.

Endogenous latent AAV genomes are transcriptionally active in mammalian cells (eg, non-human primate tissue cells such as liver, spleen and lymph nodes). Without being bound by theory, it is hypothesized that to maintain AAV persistence in the host, low levels of AAV gene transcription might be required and the resulting cap RNA could act as more suitable and abundant substrates for retrieving functional cap sequences for vector development. Transcripts of the rep and cap genes are detected at variable frequencies using RNA detection methods (eg, RT-PCR). The presence of a cap gene transcript and the ability to generate cDNA from cap RNA by reverse transcription (RT) in vitro greatly increases the frequency of templates for PNR-based rescue of novel cap sequences from tissues and enhances the sensitivity of detection of novel AAVs.

New cap sequences can also be identified by transfecting cells with total cellular DNA isolated from tissues that contain highly proviral AAV genomes.

- 6 044901 low quantity. Cells can be further transfected with genes that cause a functional element of a helper virus (eg, adenovirus) to trigger and/or enhance transcription of AAV genes in the transfected cells. In some embodiments, novel cap sequences of the present disclosure can be identified by isolating cap mRNA from transfected cells, generating cDNA from the mRNA (eg, using RT-PCR) and sequencing the cDNA.

Isolated capsid proteins and AAV nucleic acids encoding them isolated from mammals, especially non-human primates, are useful in creating gene transfer vectors for clinical research and gene therapy applications in humans. The present disclosure provides, in certain aspects, novel AAVs that have been found in various tissues in vivo (e.g., liver, brain, stomach, respiratory, breast, pancreas, rectum, prostate, genitourinary, and cervical tissues ) using the methods disclosed herein. In accordance with some embodiments, the tissue(s) in which the new AAV variant is found is cancerous tissue (eg, a tumor or cancer cell). In accordance with some embodiments, the nucleic acids encoding the proteins of these new AAVs were found in the genomic DNA of the viruses isolated from human tissues. Examples of tissues in which novel AAV capsid proteins have been discovered are described in Table 1. 1. Nucleic acid and protein sequences, as well as other information regarding AAV, are presented in table. 3-5 and 8, and in the sequence list.

The isolated nucleic acids of the present disclosure that encode AAV capsid proteins include any nucleic acid having the sequence set forth in any of SEQ ID NO: 410-435, 876-1718 or 1989-2251, as well as any nucleic acid having sequence essentially homologous to them. In accordance with some embodiments, isolated nucleic acids of the present disclosure include any nucleic acid having a sequence encoding a polypeptide having the sequence set forth in any of SEQ ID NOs: 1-409, 435-868, and 1726-1988. In accordance with some embodiments, the present disclosure provides an isolated nucleic acid that is substantially homologous to a nucleic acid set forth in any of SEQ ID NOs: 410-435, 876-1718, and 19892251, but which does not encode a protein having the amino acid sequence set forth in SEQ ID NO: 869, 870 or 871.

In accordance with some embodiments, isolated AAV capsid proteins of the present disclosure include any protein having the amino acid sequence set forth in any of SEQ ID NOs: 1-409, 837-852, or 1726-1814, as well as any protein essentially homologous to them. In accordance with some embodiments, the present disclosure provides an isolated capsid protein that is substantially homologous to a protein having the sequence set forth in any of SEQ ID NOs: 1-409, 837-852, or 1726-1814, but which does not have the amino acid sequence set forth in SEQ ID NO: 869.

In accordance with some embodiments, the isolated AAV capsid proteins of the present disclosure include any protein having the amino acid sequence set forth in any of SEQ ID NOs: 435-628 or 1815-1988, as well as any protein substantially homologous thereto. In accordance with some embodiments, the present disclosure provides an isolated capsid protein that is substantially homologous to a protein having the sequence set forth in either SEQ ID NO: 435-628 or 1815-1988, but which does not have the amino acid sequence set forth in SEQ ID NO: 869 or 870.

In accordance with some embodiments, the isolated AAV capsid proteins of the present disclosure include any protein having the amino acid sequence set forth in any of SEQ ID NOs: 629-836 or 853-868, as well as any protein substantially homologous thereto. In accordance with some embodiments, the present disclosure provides an isolated capsid protein that is substantially homologous to a protein having the sequence set forth in either SEQ ID NO: 629-836 or 853-868, but which does not have the amino acid sequence set forth in SEQ ID NO: 871.

Homology refers to the percentage of identity between two polynucleotide or two polypeptide fragments. The term essentially homologous when referring to a nucleic acid or fragment thereof indicates that, when optimally aligned with corresponding nucleotide insertions or deletions with respect to another nucleic acid (or complementary strand thereof), there is approximately 90 to 100% nucleotide sequence identity of the aligned ones. sequences. When referring to a polypeptide or fragment thereof, the term substantially homologous indicates that when optimally aligned with corresponding gaps, insertions or deletions with respect to another polypeptide, there is approximately 90 to 100% nucleotide sequence identity of the aligned sequences. The term highly conserved means at least 80% identity, preferably 90% identity or more

- 7 044901 preferably over 97% identity. In some cases, the term highly conserved may refer to 100% identity. Identity is readily determined by one skilled in the art, for example, through the use of algorithms or computer programs known to those skilled in the art.

The alignments between nucleic acid or polypeptide sequences described herein are performed using any of a number of freely available or commercially available multiple sequence alignment programs, such as Clustal W, available through web servers on the Internet. Alternatively, Vector NTI tools can also be used. There are also several algorithms known in the art that can be used to measure nucleotide sequence identity, including the algorithms contained in the programs described above. As another example, polynucleotide sequences can be compared using the BLASTN program, which provides alignments and percent sequence identity of the regions of greatest overlap between the target sequence and the search sequence. Similar programs are available for comparing amino acid sequences, for example, the Clustal X program, BLASTP. Typically, any of these programs are used with default parameters, although those skilled in the art can change these parameters if necessary. Alternatively, one skilled in the art may use another algorithm or computer program that provides at least the level of identity or alignment that is provided by the above algorithms and programs. Alignments can be used to identify the corresponding amino acids between two proteins or peptides. The term corresponding amino acid may be an amino acid of a protein sequence or peptide sequence that has been aligned to an amino acid of another protein sequence or peptide sequence. The corresponding amino acids may be identical or non-identical. A corresponding amino acid that is a non-identical amino acid may be referred to as a variant amino acid. In table 6 shows examples of variant amino acids.

Alternatively, in the case of nucleic acids, homology can be determined by hybridizing the polynucleotides under conditions that form stable duplexes between homologous regions, followed by digestion with single-strand specific nuclease(s), and determining the size of the digested fragments. DNA sequences that are essentially homologous can be identified by a Southern hybridization experiment, for example, under stringent conditions as defined for that particular system. Determination of suitable hybridization conditions is within the skill of the person skilled in the art.

The term nucleic acid sequence refers to a sequence of DNA or RNA. In some embodiments, the term nucleic acid includes sequences that contain any of the known base analogues of DNA and RNA, such as, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxymethyl) Uracyl, 5-fluoruracyle, 5-bromurasil, 5-carboximethylaminomethyl-2tiouracyl, 5-carboximethylaminomethyluracyl, dihydrouracyl, foreigner, N6-isopentilacenin, 1-methydeenine, 1-methylpseevodouracyl, 1-methylguanin, 1-metilinosi, 2.2-deimetilguaninos 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueuosine, 5'methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio- N6-isopentenyladenine, uracil-5-hydroxyacetic acid methyl ester, uracil-5-hydroxyacetic acid, oxybutoxosine, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil , uracil-5-hydroxyacetic acid methyl ester, uracil-5-hydroxyacetic acid, pseudouracil, queuosine, 2-thiocytosine and 2,6-diaminopurine.

In accordance with some embodiments, the proteins and nucleic acids of the present disclosure are isolated. As used herein, the term isolated means artificially obtained or formed. As used herein in relation to nucleic acids, the term isolated generally means: (i) amplified in vitro, for example, by polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, for example by digestion or gel separation; or (iv) synthesized, for example, by chemical synthesis. An isolated nucleic acid is a nucleic acid that is readily manipulated by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector for which the 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been discovered is considered to be isolated, but a nucleic acid sequence existing in its native state in its natural state owner, is not considered as such. The isolated nucleic acid may be essentially purified, but need not be so. For example, a nucleic acid that is isolated in

- 8 044901 within the cloning or expression vector, is not pure in that it may contain only a small percentage of the material in the cell in which it is located. Such a nucleic acid is isolated, as the term is used herein, because it is readily available for manipulation by standard techniques known to those skilled in the art. As used herein in relation to proteins or peptides, the term isolated generally refers to a protein or peptide that has been artificially produced or generated (eg, chemical synthesis, recombinant DNA technology, etc.).

It should be understood that conservative amino acid substitutions can be made to obtain functionally equivalent variants or homologs of capsid proteins. In accordance with some aspects, the present disclosure provides for sequence changes that result in conservative amino acid substitutions. As used herein, the term conservative amino acid substitution refers to an amino acid substitution that does not change the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants can be prepared according to methods for modifying a polypeptide sequence known to one of ordinary skill in the art, such as those found in the references that underlie such methods, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F.M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Conservative amino acid substitutions include substitutions made among amino acids with the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. Thus, conservative amino acid substitutions can be made with respect to the amino acid sequence of the proteins and polypeptides disclosed herein.

An example of an isolated nucleic acid that encodes an AAV capsid protein polypeptide is a nucleic acid having a sequence selected from the group consisting of SEQ ID NOs: 410-434, 876-1718 and 1989-2251. The isolated nucleic acid fragment encoding the AAV capsid sequence may be useful for constructing a nucleic acid encoding the desired capsid sequence. Fragments can be of any suitable length. In some embodiments, a fragment of an isolated nucleic acid encoding an AAV capsid sequence may be useful for constructing a nucleic acid encoding the desired capsid sequence. The fragments may be of any suitable length (e.g., at least 6, at least 9, at least 18, at least 36, at least 72, at least 144, at least 288, at least 576, etc. at least 1152 or more nucleotides in length). For example, a fragment of a nucleic acid sequence encoding a polypeptide of a first AAV capsid protein can be used to construct or be included in a nucleic acid sequence encoding a second AAV capsid sequence to alter the properties of the AAV capsid. In some embodiments, AAV capsid proteins that contain fragments of capsid sequences from multiple AAV serotypes are referred to as chimeric AAV capsids. The fragment may be a fragment that does not encode a peptide that is identical to the sequence of any of SEQ ID NO: 869, 870 or 871. For example, a nucleic acid sequence fragment encoding a variant amino acid (compared to a known AAV serotype) can be used to designing a nucleic acid sequence encoding the AAV capsid sequence, or may be included therein, to modify the properties of the AAV capsid. In some embodiments, the nucleic acid sequence encoding an AAV variant may be from about 1 to about 100 amino acid variants relative to a known AAV serotype (e.g., serotype AAV2, AAV2/3 (e.g., AAV2/3 hybrid), or AAV8). In some embodiments, the nucleic acid sequence encoding the AAV variant may be from about 5 to about 50 amino acid variants relative to a known AAV serotype (e.g., AAV serotype 2, AAV2/3 (e.g., AAV2/3 hybrid) or AAV8). In some embodiments, the nucleic acid sequence encoding the AAV variant may be from about 10 to about 30 amino acid variants relative to a known AAV serotype (e.g., AAV serotype 2, AAV2/3 (e.g., AAV2/3 hybrid) or AAV8). In some embodiments, the nucleic acid sequence encoding the AAV variant may be from about 1 or 2 or 3 or 4 or 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 amino acid variants compared to a known AAV serotype (eg, AAV serotype 2, AAV2/3 (eg, AAV2/3 hybrid), or AAV8). For example, a nucleic acid sequence encoding an AAV variant (eg, SEQ ID NO: 861) may be 3 amino acid variants compared to a known AAV serotype (eg, AAV8). A recombinant cap sequence can be constructed that has one or more of 3 amino acid variants resulting in inclusion

- 9 044901 fragments of a nucleic acid sequence containing a region encoding a variant amino acid sequence into a nucleic acid sequence encoding a known AAV serotype. Fragments can be included using any suitable method, including site-directed mutagenesis. In this way new variants can be created

AAVs with new properties.

In accordance with some aspects, the present disclosure provides isolated nucleic acids encoding AAV assembly-activating proteins (AAPs) or variants thereof. As used herein, assembly-activating protein or AAP is a chaperone protein whose function is to direct newly synthesized capsid proteins (e.g., VP proteins such as AAV VP1, VP2, and VP3) to the cell nucleolus, thereby promoting the encapsidation of viral genomes . Typically, AAP is encoded in the cap gene of the adeno-associated virus. For example, AAP-2 is encoded in the cap gene of AAV2. Other examples of AAPs include, but are not limited to, AAP-1, AAP-3, AAP-4, AAP-5, AAP-8, AAP-9, AAP-11, and AAP-12, such as those described by Sonntag et al., J. Virol. 2011 Dec. 85(23): 12686-12697. In some embodiments, the AAP is translated from a different open reading frame (ORF) of the cap gene than the capsid protein (eg, VP1, VP2, VP3). For example, in some embodiments, a capsid protein (eg, AAV2 VP1, VP2, VP3) is translated from cap gene ORF 1, and an AAP (eg, AAP-2) is translated from cap gene ORF 2. In accordance with some embodiments, the isolated nucleic acid encoding an AAP contains or consists of a sequence selected from SEQ ID NOs: 410-434 and 876-1718.

Recombinant AAVs.

In accordance with some embodiments, the present disclosure provides dedicated AAVs. As used herein in relation to AAV, the term isolated refers to AAV that has been artificially produced or formed. Isolated AAVs can be generated using recombinant methods. Such AAVs are referred to herein as recombinant AAVs. Recombinant AAVs (rAAVs) preferably have the ability to target tissues in a specific manner such that the rAAV transgene will be delivered specifically to one or more predetermined tissues. The AAV capsid is an important element in determining these tissue-specific targeting abilities. Thus, an rAAV can be selected having a capsid suitable for the tissue being targeted. In some embodiments, rAAV comprises a capsid protein having the amino acid sequence set forth in any of SEQ ID NO: 1-409, 435-852, 859-874, or 1726-1988, or a protein substantially homologous thereto.

Methods for producing recombinant AAVs having the desired capsid protein are well known in the art (see, for example, US Pat. No. 2003/0138772, the contents of which are incorporated herein by reference in their entirety). Typically, the methods involve culturing a host cell that contains a nucleic acid sequence encoding an AAV capsid protein (e.g., a nucleic acid encoding a polypeptide having the sequence set forth in any of SEQ ID NOs: 1-409, 435-868, or 1726- 1988) or a fragment thereof; functional rep gene, a recombinant AAV-based vector consisting of AAV inverted terminal repeats (ITRs) and a transgene; and a sufficient number of functional elements of helper viruses to ensure packaging of the recombinant AAV-based vector into AAV capsid proteins. In accordance with some embodiments, capsid proteins are structural proteins encoded by the AAV cap gene. In some embodiments, AAVs contain three capsid proteins, virion proteins 1-3 (referred to as VP1, VP2, and VP3), all of which can be expressed from a single cap gene. Accordingly, in some embodiments, the VP1, VP2, and VP3 proteins share a common core sequence. In some embodiments, the molecular weights of VP1, VP2, and VP3, respectively, are about 87 kDa, about 72 kDa, and about 62 kDa. In some embodiments, upon translation, the capsid proteins form the capsid proteins into a spherical 60-mer protein shell around the viral genome. In accordance with some embodiments, the protein shell is primarily composed of a VP3 capsid protein. In some embodiments, the functions of the capsid proteins are to protect the viral genome, deliver the genome, and interact with the host. In accordance with some aspects, the capsid proteins deliver the viral genome into the host in a tissue-specific manner. In accordance with some embodiments, the VP1 and/or VP2 capsid proteins may promote tissue tropism of the packaged AAV. In accordance with some embodiments, the tissue tropism of the packaged AAV is determined by the capsid protein VP3. In accordance with some embodiments, the tissue tropism of AAV is enhanced or altered as a result of mutations occurring in the capsid proteins.

In accordance with certain aspects, the present disclosure describes variant wild-type AAV serotypes. In accordance with some embodiments, the variants have altered tissue tropism. In some embodiments, the AAV variants described herein contain amino acid variations (eg, substitution, deletion, insertion) in the cap gene. As described above, all three capsid proteins are transcribed from a single cap gene. Accordingly, in some embodiments, the amino acid variation in the cap gene is present in all three capsid proteins encoded by the cap gene. Alternatively, in some embodiments, the amino acid variation may not be present in all three capsid proteins. In some embodiments, the amino acid variation occurs only in the VP1 capsid protein. In some embodiments, the amino acid variation occurs only in the VP2 capsid protein. In some embodiments, the amino acid variation occurs only in the VP3 capsid protein. In accordance with some embodiments, the AAV variant contains more than one variation in the cap gene. In some embodiments, more than one variation occurs in the same capsid protein (eg, VP3). In some embodiments, more than one variation occurs in different capsid proteins (eg, at least one variation in VP2 and at least one variation in VP3).

In accordance with some embodiments, the AAV variants described herein are AAV2, AAV2/3 (eg, AAV2/3 hybrid), or AAV8 variants. AAV2 is known to effectively transduce central nervous system (CNS) tissue, kidney tissue, eye tissue (eg, photoreceptor cells and retinal pigment epithelium (RPE)), as well as other human tissues. Accordingly, in accordance with some embodiments, the AAV3 variants described herein may be useful for delivering gene therapy to CNS tissue, kidney tissue, or ocular tissue. AAV3 is also known to effectively transduce cancerous human hepatocytes. Accordingly, in accordance with some embodiments, the AAV3 variants described herein may be useful for delivering gene therapy to cancerous and normal human hepatocytes. AAV8 is known to specifically target liver tissue, respiratory tissue, and eyes. Accordingly, in accordance with some embodiments, the AAV8 variants described herein may be useful for delivering gene therapy to liver tissue, respiratory tissue, and the eye.

It should be understood that the AAV2, AAV2/3 (eg, AAV2/3 fusion) and AAV8 variants described herein may contain one or more variations in the cap gene compared to the corresponding wild-type AAV. Thus, in accordance with some embodiments, the AAV2, AAV2/3 (e.g., AAV2/3 fusion), and AAV8 variants described herein may have tissue tropism suitable for delivering gene therapy to additional tissue types not affected by targeting AAV2, AAV2/3 (eg, AAV2/3 fusion), or wild-type AAV8. For example, in accordance with some embodiments, the AAV8 variants described herein (eg, B61; SEQ ID NO: 865) may be useful for delivering gene therapy to the central nervous system (CNS). In some embodiments, the AV2, AAV2/3 (eg, AAV2/3 hybrid), or AAV8 variants described herein may be useful for targeting kidney cells or liver cells. In some embodiments, the AAV2, AAV2/3 (eg, AAV2/3 hybrid), or AAV8 variants described herein may be useful for targeting gene therapy to the liver, spleen, heart, and brain.

In accordance with some aspects, the AAV variants described herein may be useful for treating disorders associated with the CNS. As used herein, the term CNS disorder is a disease or pathological condition of the central nervous system. The CNS disorder may affect the spinal cord (eg, myelopathy), the brain (eg, encephalopathy), or the tissues surrounding the brain and spinal cord. A disorder associated with the central nervous system may be genetic in nature, inherited or acquired as a result of a somatic mutation. The CNS disorder may be a psychological condition or disorder, such as attention deficit hyperactivity disorder, autism spectrum disorder, mood disorder, schizophrenia, Rett syndrome, etc. The CNS disorder may be an autoimmune disorder. The CNS disorder may also be a CNS cancer, such as brain cancer. The CNS disorder that is cancer may be a primary CNS cancer, such as astrocytoma, glioblastoma, etc., or may be a cancer that has metastasized to CNS tissue, such as lung cancer that has metastasized to the brain brain. Additional non-limiting examples of CNS-related disorders include Parkinson's disease, lysosomal storage disease, ischemia, neuropathic pain, amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), and Canavan disease (CD).

In accordance with some embodiments, the AAV variants described herein may be useful for delivering gene therapy to cardiomyocytes (eg, heart tissue). Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating cardiovascular disorders. Used in

- 11 044901 in this document, the term cardiovascular disorder is a disease or pathological condition of the cardiovascular system. Cardiovascular disease can affect the heart, cardiovascular system, arteries, veins, blood vessels and/or capillaries. Cardiovascular disorder may be genetic in nature, inherited or acquired as a result of somatic mutation. Non-limiting examples of cardiovascular disorders include rheumatic heart disease, valvular heart disease, hypertensive heart disease, aneurysm, atherosclerosis, hypertension (eg, high blood pressure), peripheral arterial disease (PAD), coronary artery disease, angina, coronary heart disease , coronary artery disease, myocardial infarction, cerebral vascular disease, transient ischemic attack, inflammatory heart disease, cardiomyopathy, pericardial disease, congenital heart disease, heart failure, stroke and myocarditis due to Chagas disease.

In accordance with some embodiments, the AAV variants described herein can specifically target the lungs and/or tissue of the respiratory system (eg, respiratory system). Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating a pulmonary disease. As used herein, the term pulmonary disease is a disease or pathological condition of the respiratory system. Pulmonary disease can affect the lungs or the muscles involved in breathing. Pulmonary disease may be genetic in nature, inherited or acquired as a result of somatic mutation. The pulmonary disease may be lung cancer, including, but not limited to, non-small cell lung cancer, small cell lung cancer, and lung carcinoid tumor. Additional non-limiting examples include acute bronchitis, acute respiratory distress syndrome (ARDS), asbestosis, asthma, bronchiectasis, bronchiolitis, bronchiolitis obliterans with organizing pneumonia (BOOP), bronchopulmonary dysplasia, byssinosis, chronic bronchitis, coccidioidomycosis (cocci), chronic obstructive pulmonary disease (COPD), cryptogenic organizing pneumonia (COP), cystic fibrosis, emphysema, hantavirus pulmonary syndrome, histoplasmosis, human metapneumovirus infection, hypersensitivity pneumonitis, influenza, lymphangiomatosis, mesothelioma, Middle East respiratory syndrome, nontuberculous mycobacteriosis, whooping cough, pneumoconiosis ( black lung disease), pneumonia, primary ciliary dyskinesia, primary pulmonary hypertension, pulmonary arterial hypertension, pulmonary fibrosis, pulmonary vascular disease, respiratory syncytial virus (RSV) infection, sarcoidosis, severe acute respiratory syndrome (SARS), silicosis, sleep apnea , sudden infant death syndrome (SIDS) and tuberculosis.

In accordance with some embodiments, the AAV variants described herein can specifically target liver tissue. Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating liver disease. As used herein, the term liver disease is a disease or pathological condition of the liver. Liver disease may be genetic in nature, inherited or acquired as a result of a somatic mutation. The liver disease may be liver cancer, including, but not limited to, hepatocellular carcinoma (HCC), fibolamellar carcinoma, cholangiocarcinoma, angiosarcoma, and hepatoblastoma. Additional non-limiting examples of liver disease include Alagille syndrome, alpha-1 antitrypsin deficiency, autoimmune hepatitis, biliary atresia, cirrhosis, polycystic liver disease, fatty liver disease, galactosemia, gallstones, Gilbert's syndrome, hemochromatosis, liver disease of pregnancy, neonatal hepatitis, primary biliary cirrhosis, primary sclerosing cholangitis, porphyria, Reye's syndrome, sarcoidosis, toxic hepatitis, glycogen storage disease type 1, tyrosinemia, viral hepatitis A, B, C, Wilson's disease and schistosomiasis.

In accordance with some embodiments, the AAV variants described herein can specifically target kidney tissue. Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating kidney disease. As used herein, the term kidney disease is a disease or pathological condition of the liver. Kidney disease can be genetic, inherited or acquired as a result of a somatic mutation. The kidney disease may be kidney cancer, including, but not limited to, renal cell carcinoma, clear cell renal carcinoma, papillary type 1 carcinoma, papillary type 2 carcinoma, chromophobe carcinoma, oncocytic renal carcinoma, collecting duct carcinoma, transitional cell carcinoma of the renal pelvis, and Wilms tumor. Additional non-limiting examples of kidney disease include Abderhalden-Kaufman-Lignac syndrome (nephropathic cystinosis), acute kidney failure/acute kidney injury, acute lobar nephronia, acute phosphate nephropathy, acute tubular necrosis, adenine phosphoribosyltransferase deficiency, adenoviral nephritis, Alport syndrome, amyloidosis, angiomyolipoma, analgesic nephropathy, anti-antiotensin antibodies and

- 12 044901 focal segmental glomerulosclerosis, antiphospholipid syndrome, glomerulonephritis associated with anti-TNF-α therapy, APOL1 mutations, apparent mineralocorticoid excess syndrome, aristolochian nephropathy, Balkan endemic nephropathy, Barter syndrome, bituria, kidney disease due to P-thalassemia, tubular new nephropathy, complete VC, C1q nephropathy, cardiorenal syndrome, CFHR5 nephropathy, cholesterol embolism, Churg-Strauss syndrome, chyluria, sclerosing glomerulopathy, sclerosing glomerulopathy associated with CMV, congenital nephrotic syndrome, conorenal syndrome (Mainzer-Saldino syndrome or Saldino-Meizner disease ), contrast nephropathy, copper sulfate toxicity, cortical necrosis, cryoglobulinemia, microcrystalline acute kidney injury, acquired cystic kidney disease, cystinuria, dense sediment disease (MPGN type 2), Dent's syndrome (X-linked recessive nephrolithiasis), dialysis imbalance syndrome, Diabetic disease of the kidneys, non-naichera diabetes, EAST-syndrome, ectopic ureter, Edem, Erdheim-Cheser disease, Factory disease, family hypocalsiuric hypercalcemia, Fanconi syndrome, phrase syndrome, fibrine-fibrilopathy, fibrillar glomerulonephritis and immunotactoid glomuloprotide , Freily syndrome, focal-segmental glomerulosclerosis , focal sclerosis, focal glomerulosclerosis, Galloway-Movat syndrome, Gitelman syndrome, glomerular disease, glomerular tubular reflux, glucosuria, Goodpasture's syndrome, hemolytic uremic syndrome (HUS), atypical hemolytic uremic syndrome (aHUS), hemophagocytic syndrome, hemorrhagic cystitis, hemosiderosis, associated with paroxysmal nocturnal hemoglobinuria and hemolytic anemia, veno-occlusive disease of the hepatic veins, sinusoidal obstruction syndrome, hepatitis C-associated kidney disease, hepatorenal syndrome, HIV-associated nephropathy (HIVAN), horseshoe kidney (renal fusion), Hanner's ulcer, hyperaldosteronism, hypercalcemia, hyperkalemia, hypermagnesemia, hypernatremia, hyperoxaluria, hyperphosphatemia, hypocalcemia, hypokalemia, renal dysfunction caused by hypokalemia, hypomagnesemia, hyponatremia, hypophosphatemia, IgA nephropathy, IgG4 nephropathy, interstitial cystitis, painful bladder syndrome, interstitial nephritis, Ivemark syndrome, urolithiasis, nephrolithiasis, kidney disease due to leptospirosis, light chain deposition disease, monoclonal immunoglobulin deposition disease, Liddle syndrome, Lightwood-Albright syndrome, lipoprotein glomerulopathy, lithium nephrotoxicity, LMX1B mutations causing hereditary FSGS, hematuria combined with low back pain, lupus, systemic lupus erythematosus, lupus renal disease, lupus nephritis, Lyme disease-associated glomerulonephritis, malarial nephropathy, malignant hypertension, malakoplakia, meatal urethral stenosis, medullary cystic kidney disease, spongy kidney, megaureter, melamine-related nephrotoxicity, membranous proliferative glomerulonephritis t, membranous nephropathy, Mesoamerican nephropathy, metabolic acidosis, metabolic alkalosis, microscopic polyangiitis, milk-alkali syndrome, minimal change disease, polycystic kidney disease, multiple myeloma, myeloproliferative neoplasms and glomerulopathy, nail-patella syndrome, nephrocalcinosis, nephrogenic systemic fibrosis, nephroptosis (vagal kidney, kidney prolapse ), nephrotic syndrome, neurogenic bladder, non-cocked nodular glomerulosclerosis, aortomesal tweezers syndrome, opo-di-digital syndrome, orthostatic hypotension, orthostatic proteinuria, osmotic diuja, payge kidney, paying necrosis, papillary syndrome ( renal-false syndrome, isolated kidney hypoplasia ), peritoneal-renal syndrome, with a disorder of the posterior urethral valves, post-infectious glomerulonephritis, post-streptococcal glomerulonephritis, polyarteritis nodosa, polycystic kidney disease, with a disorder of the posterior urethral valves, preeclampsia, proliferative glomerulonephritis with deposits of monoclonal IgG (Nasr disease), proteinuria (protein in the urine ), pseudohyperaldosteronism, pseudohypoaldosteronism, pulmonary-renal syndrome, pyelonephritis (kidney infection), pyonephrosis, radiation nephropathy, refeeding syndrome, reflux nephropathy, rapidly progressive glomerulonephritis, renal abscess, perinephric abscess, renal agenesis, renal artery aneurysm, renal artery stenosis , renal cell carcinoma, renal cyst, renal hypouricemia with exercise-induced acute renal failure, near infarction, nephrogenic osteodystrophy, renal tubular acidosis, osmostat reset syndrome, retrocaval ureter, retroperitoneal fibrosis, rhabdomyolysis, rhabdomyolysis associated with bariatric surgery, kidney disease, associated with rheumatoid arthritis, kidney disease due to sarcoidosis, salt wasting syndrome, renal and cerebral, Schimke immunoosseous dysplasia, scleroderma renal crisis, polycystic kidney syndrome involving the serpentine part of the fibula, Exner syndrome, sickle cell nephropathy, chronic kidney disease due to silica exposure, kidney disease after hematopoietic cell transplantation, kidney disease associated with stem cell transplantation, thin basement membrane disease, benign familial hematuria, trigonitis, tuberous sclerosis, tubular dysgenesis, tumor breakdown syndrome, uremia, uremic optic neuropathy, uretocele, proliferation urethral mucosa, urethral stricture, urinary incontinence, urinary tract infection, urinary tract obstruction, vesico-intestinal fistula, vesiculoureteral reflux, Hippel-Lindau disease, warfarin-associated nephropathy, Wegener's granulomatosis, granulomatosis with polyangiitis and Wunder syndrome dashing.

In accordance with some embodiments, the AAV variants described herein may be useful for delivering gene therapy to ocular tissue (eg, ocular tissue or cells). Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating ocular disorders. As used herein, the term ocular disorder is a disease or pathological condition of the eye. Eye disease can affect the eye, sclera, cornea, anterior chamber, posterior chamber, iris, pupil, lens, vitreous, retina, or optic nerve. Eye disorders may be genetic in nature, inherited or acquired as a result of somatic mutation. Non-limiting examples of eye diseases and disorders include, but are not limited to, age-related macular degeneration, retinopathy, diabetic retinopathy, macular edema, glaucoma, retinitis pigmentosa and eye cancer.

In accordance with some embodiments, the AAV variants described herein may be useful for delivering gene therapy to tissue of the digestive system (eg, gastrointestinal tissue). Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating gastrointestinal disorders. As used herein, the term gastrointestinal disorder is a disease or pathological condition of the gastrointestinal tract. Disease of the digestive system can affect the mucous membrane (eg, epithelium, lamina propria, muscularis lamina mucosa, etc.), submucosa (eg, submucosal plexus, enteric nerve plexus, etc.), muscular layer of the gastrointestinal tract, intestinal tract, serosa and/or tunica adventitia, oral cavity, esophagus, pylorus, stomach, duodenum, small intestine, cecum, appendix, colon, anus or rectum. Gastrointestinal disorders may be of a genetic nature, inherited or acquired as a result of a somatic mutation. Non-limiting examples of gastrointestinal diseases and disorders include, but are not limited to, inflammatory bowel disease (IBD), Crohn's disease, ulcerative colitis, irritable bowel syndrome, celiac disease, reflux esophagitis (GERD), achalasia, diverticulitis, diarrhea, and certain cancers (eg, intestinal cancer, stomach cancer, colon cancer, rectal cancer, etc.).

In accordance with some embodiments, the AAV variants described herein may be useful for delivering gene therapy to mammary tissue (eg, breast tissue). Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating breast disorders. As used herein, the term breast disorder is a disease or pathological condition of the breast. Breast disease can affect fibrous tissue, fatty tissue, lobules, or ducts of the mammary gland. Breast disorders may be genetic in nature, inherited or acquired as a result of somatic mutation. Non-limiting examples of breast diseases and disorders include, but are not limited to, mastitis, mammary calcification, fat necrosis, fibroadenoma, fibrosis and simple cysts, galactorrhea, hyperplasia and breast cancer.

In accordance with some embodiments, the AAV variants described herein may be useful for delivering gene therapy to pancreatic tissue (eg, pancreatic tissue). Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating pancreatic disorders. As used herein, the term pancreatic disorder is a disease or pathological condition of the pancreas. Pancreatic disease may involve the head of the pancreas, neck of the pancreas, body of the pancreas, tail of the pancreas, pancreatic islets (eg, islets of Langerhans), acini, or squamous epithelium. Pancreatic disorders may be genetic in nature, inherited or acquired as a result of a somatic mutation. Non-limiting examples of pancreatic diseases include, but are not limited to, diabetes mellitus (eg, type 1 diabetes mellitus and type 2 diabetes mellitus), pancreatitis (eg, acute pancreatitis, chronic pancreatitis) and pancreatic cancer.

In accordance with some embodiments, the AAV variants described herein may be useful for delivering gene therapy to urinary tract tissue (eg, urinary tract tissue, such as bladder tissue). Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating urinary tract disorders. As used herein, the term urinary tract disorder is a disease or pathological condition of the urinary tract. Urinary tract disease can affect the bladder, ureter, urethra, or prostate gland. Urinary tract disorders may be genetic in nature, inherited or acquired as a result of somatic mutation. Non-limiting examples of urinary tract diseases and disorders include, but are not limited to, urinary tract infections, urolithiasis, bladder control problems (eg, urinary retention, urinary incontinence, etc.), cystitis, and bladder cancer.

In accordance with some embodiments, the AAV variants described herein may be useful for delivering gene therapy to uterine tissue (eg, uterine tissue). Accordingly, in accordance with some embodiments, the AAV variants described herein may be useful for treating uterine disorders. As used herein, the term uterine disorder is a disease or pathological condition of the uterus. Uterine disease can affect the cervix, cervical canal, uterine body (fundus), endometrium, myometrium, or perimeter. Uterine disorder may be genetic in nature, inherited or acquired as a result of somatic mutation. Non-limiting examples of diseases and disorders of the uterus include, but are not limited to, adenomyosis, endometriosis, endometrial hyperplasia, Asherman's syndrome and endometrial cancer.

Components to be cultured in a host cell for the purpose of packaging the rAAV vector into an AAV capsid can be produced in the host cell in trans. Alternatively, any one or more of the required components (eg, recombinant AAV vector, rep sequences, cap sequences, and/or helper virus functional elements) can be produced using a stable host cell that has been engineered such that contains one or more of the required components, using methods known to those skilled in the art. More suitably, such a stable host cell will contain the necessary component(s) under the control of an inducible promoter. At the same time, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the description of regulatory elements suitable for use with a transgene. In yet another alternative, the selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) of one or more inducible promoters. For example, a stable host cell may be derived from 293 cells (which contain functional E1 elements under the control of a constitutive promoter) but which contain rep and/or cap proteins under the control of inducible promoters. Still other stable cells can be obtained by one skilled in the art.

The recombinant AAV vector, rep sequences, cap sequences, and helper viral functional elements required to produce rAAV of the present disclosure can be delivered into a packaging host cell using any suitable genetic element (vector). In some embodiments, a single nucleic acid encoding all three capsid proteins (eg, VP1, VP2, and VP3) is delivered to a packaging host cell in a single vector. In some embodiments, nucleic acids encoding capsid proteins are delivered to the packaging cell using two vectors; wherein the first vector contains a first nucleic acid encoding two capsid proteins (eg, VP1 and VP2), and the second vector contains a second nucleic acid encoding one capsid protein (eg, VP3). In some embodiments, three vectors, each containing a nucleic acid encoding a different capsid protein, are delivered to a packaging host cell. The selected genetic element can be delivered using any suitable method, including the methods described herein. Methods used to construct any embodiment of this disclosure are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering and synthesis techniques, see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Likewise, methods for producing rAAV virions are well known and the selection of a suitable method is not limited by the present disclosure, see, for example, K. Fisher et al., J. Virol., 70:520-532 (1993) and US Pat. No. 5,478,745.

In accordance with some embodiments, recombinant AAVs can be produced using a triple transfection method (described in detail in US Pat. No. 6,001,650). Typically, recombinant AAVs are produced by transfecting a host cell with a recombinant AAV vector (containing a transgene) to be packaged into AAV particles, a vector based on functional elements of AAV helper viruses, and a vector based on accessory functional elements. The AAV helper virus functional element vector encodes AAV helper virus functional element sequences (eg, rep and cap) that function in trans to replicate and encapsulate effective AAVs. Prev

- 15 044901 respectfully, a vector based on functional elements of AAV helper viruses supports the formation of effective AAV vectors without the formation of any detectable wild-type AAV virions (eg, AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use in accordance with the present disclosure include the pHLP19 vector described in US Pat. No. 6,001,650 and the pRep6cap6 vector described in US Pat. No. 6,156,303, the contents of which are incorporated herein by reference. The accessory functional element vector encodes nucleotide sequences for non-AAV-derived viral and/or cellular functional elements on which AAV replication depends (eg, accessory functional elements). Accessory functional elements include those functional elements required for AAV replication, including, but not limited to, fragments involved in activation of AAV gene transcription, developmental stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Virus-based helper functional elements can be derived from any of the known helper viruses, such as adenovirus, herpes virus (other than herpes simplex virus type 1), and vaccinia virus.

In accordance with some aspects, the present disclosure provides transfected host cells. The term transfection is used to refer to the uptake of foreign DNA into a cell, and a cell is transfected when exogenous DNA is introduced into the cell (eg, through the cell membrane). Several transfection techniques are well known in the art, see, for example, Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. Such techniques can be used to introduce one or more exogenous nucleic acids, such as a nucleotide integration vector and other nucleic acid molecules, into suitable host cells.

The term host cell refers to any cell that contains or is capable of containing a substance of interest. Often the host cell is a mammalian cell. The host cell can be used as the recipient of an AAV helper virus construct, an AAV minigene plasmid, a vector based on accessory functional elements, or other transfer DNAs associated with the production of recombinant AAVs. The term includes the progeny of the original cell that has been transfected. Thus, host cell as used herein may refer to a cell that has been transfected with an exogenous DNA sequence. It is clear that the offspring of one original cell may not necessarily be completely identical in morphology or genomic or total DNA content to the original parent, as a result of natural, accidental or intentional mutation.

As used herein, the term cell line refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often cell lines are clone populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes may occur in the karyotype during storage or transfer of such clone populations. Thus, cells derived from a designated cell line may not necessarily be exactly identical to the ancestral cells or cultures, and the designated cell line includes such variants.

As used herein, the term recombinant cell refers to a cell into which a segment of exogenous DNA has been introduced, such as a DNA segment that results in the transcription of a biologically active polypeptide or the production of a biologically active nucleic acid, such as RNA.

Cells can also be transfected with a vector (eg, a helper virus vector) that provides functional elements of the AAV helper viruses. A vector providing helper virus functional elements may provide adenovirus functional elements, including E1a, E1b, E2a and E4ORF6. The adenovirus gene sequences providing these functional elements can be derived from any known adenovirus serotype, such as serotypes 2, 3, 4, 7, 12 and 40, and further include any of the currently identified human types known in the art . Thus, in some embodiments, the methods comprise transfecting a cell with a vector expressing one or more genes required for AAV replication, AAV gene transcription, and/or AAV packaging.

As used herein, the term vector includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., that is capable of replication when associated with appropriate control elements, and that transfers gene sequences between cells. Thus, the term includes cloning and expression means as well as viral vectors. In some embodiments, suitable vectors are contemplated to be vectors in which a segment of a nucleic acid to be transcribed (e.g., a nucleic acid sequence

- 16 044901 acid), located under the transcriptional control of the promoter. The term promoter refers to a DNA sequence recognized by the cell's synthetic machinery, or introduced by the synthetic machinery, that is required to initiate specific transcription of a gene. The phrases operably located, under control, or under transcriptional control mean that the promoter is in the appropriate position relative to the nucleic acid to control RNA polymerase initiation and gene expression. The term expression vector or construct means a type of genetic construct containing a nucleic acid coding sequence, in which part or all of the nucleic acid coding sequence is capable of transcription. In some embodiments, expression involves transcribing a nucleic acid, for example, to produce a biologically active polypeptide product or inhibitory RNA (eg, shRNA, miRNA, miRNA inhibitor) from a transcribed gene.

In some cases, the isolated capsid gene can be used to construct and package recombinant AAVs using methods well known in the art to determine the functional characteristics associated with the capsid protein encoded by the gene. For example, the isolated capsid genes can be used to construct and package recombinant AAV (rAAV) containing a reporter gene (eg, B-galactosidase, GFP, luciferase, etc.). rAAV can then be delivered to an animal (eg, mouse), and the tissue targeting properties of the newly isolated capsid gene can be determined by examining reporter gene expression in various tissues (eg, heart, liver, kidney) of the animal. Other methods for characterizing new isolated capsid genes are disclosed herein, and others are also well known in the art.

The foregoing methods for packaging recombinant vectors into the necessary AAV capsids to produce rAAV of the present disclosure are not intended to be limiting, and other suitable methods will be apparent to one skilled in the art.

Vectors based on recombinant AAVs.

The recombinant AAV (rAAV) vectors of the present disclosure typically consist of at least a transgene and its regulatory sequences, as well as 5' and 3' AAV inverted repeats (ITRs). It is this vector based on recombinant AAV that is packaged into a capsid protein and delivered to the selected target cell. In some embodiments, a transgene is a nucleic acid sequence heterologous to vector sequences that encodes a polypeptide, protein, functional RNA molecule (eg, miRNA, miRNA inhibitor), or other gene product of interest. The nucleic acid coding sequence is operably linked to regulatory components so as to enable transcription, translation and/or expression of the transgene in a cell of the target tissue.

AAV vector sequences typically contain cis-acting 5' and 3' terminal inverted repeats (see, for example, B. J. Carter, in Handbook of Parvoviruses, ed., P. Tijsser, CRC Press, pp. 155, 168 ( 1990)). The ITR sequences are approximately 145 bp. in length. Preferably, substantially entire ITR coding sequences are used in the molecule, although some degree of minor modification of these sequences is acceptable. The ability to modify these ITR sequences is within the skill of the person skilled in the art (see, for example, sources such as Sambrook et al., Molecular Cloning. A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory, New York (1989) ; and K. Fisher et al., J Virol., 70:520 532 (1996)). An example of such a molecule used in the present disclosure is a cis-acting plasmid containing a transgene, in which the selected transgene sequence and associated regulatory elements are flanked by AAV 5' and 3' ITR sequences. AAV ITR sequences can be derived from any known AAV, including currently identified mammalian AAV types.

In accordance with some embodiments, the present disclosure provides a self-complementary AAV vector. As used herein, the term self-complementary AAV vector (scAAV) refers to a vector containing a double-stranded vector genome formed in the absence of a terminal resolution (TR) site from one of the AAV ITRs. The absence of TR prevents initiation of replication at the end of the vector where TR is not present. In general, scAAV vectors produce single-stranded inverted repeat genomes with a wild-type (wt) AAV TR at each end and a mutant TR (mTR) in the middle.

In accordance with some embodiments, the rAAVs of the present disclosure are pseudotyped rAAVs. Pseudotyping is the process of producing viruses or viral vectors in combination with foreign viral envelope proteins. The result is a pseudotyped viral particle. Using this method, foreign viral envelope proteins can be used to alter host tropism or increase/decrease the stability of viral particles. According to some aspects of the pseudo

- 17 044901 typed rAAV contains nucleic acid from two or more different AAVs, in which the nucleic acid from one AAV encodes a capsid protein, and the nucleic acid from at least one other AAV encodes other viral proteins and/or the viral genome. In some embodiments, pseudotyped rAAV refers to an AAV containing an inverted terminal repeat (ITR) of one AAV serotype and a capsid protein of another AAV serotype. For example, a pseudotyped AAV vector containing a serotype X ITR encapsulated with Y proteins would be constructed and designated AAVX/Y (eg, AAV2/1 has an AAV2 ITR and an AAV1 capsid). In some embodiments, pseudotyped rAAVs may be useful for combining the tissue-specific capabilities of capsid protein from one AAV serotype with viral DNA from another AAV serotype, thereby providing targeted delivery of the transgene to the target tissue.

In addition to the essential elements defined above for a recombinant AAV vector, the vector also includes necessary control elements that are operably linked to enable its transcription, translation and/or expression in a cell transfected with the plasmid vector or infected with the virus. obtained in accordance with this disclosure. As used herein, the term operably linked sequences includes expression control sequences that are adjacent to the gene of interest and expression control sequences that function in trans and at a distance from the gene of interest.

Expression control sequences are transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (eg, Kozak consensus sequence); sequences that enhance protein stability; and, if necessary, sequences that enhance secretion of the encoded product. A significant number of expression control sequences, including promoters that are native, constitutive, inducible and tissue specific, are known in the art and can be used.

As used herein, a nucleic acid sequence (eg, a coding sequence) and regulatory sequences are considered operably linked if they are covalently linked in such a way as to subject the expression or transcription of the nucleic acid sequence to the influence or control of the regulatory sequences. If nucleic acid sequences are required to be translated into a functional protein, then two DNA sequences are considered to be functionally related if induction of a promoter at the 5' regulatory sequences results in transcription of the encoded sequence and if the nature of the linkage between the DNA sequences (1) does not introduce a mutation like frameshift, (2) does not impair the ability of the promoter region to direct transcription of the encoded sequences, or (3) does not impair the ability of the corresponding RNA transcript to be translated into protein. Thus, a promoter region would be operably linked to a nucleic acid sequence if the promoter region was capable of acting on the DNA sequence such that the resulting transcript could be translated into the desired protein or polypeptide. Likewise, two or more coding regions are operably linked in this way if their transcription from the same promoter results in the expression of two or more proteins translated in frame. In accordance with some embodiments, operably linked coding sequences result in the formation of a fusion protein. In accordance with some embodiments, operably linked coding sequences result in the formation of functional RNA (eg, shRNA, miRNA, miRNA inhibitor).

In the case of protein-encoding nucleic acids, the polyadenylation sequence is typically inserted after the transgene sequences and before the AAV 3' ITR sequence. The rAAV construct useful in the present disclosure may also contain an intron, preferably located between the promoter/enhancer sequence and the transgene. One possible intronic sequence is derived from SV-40 and is designated SV-40 intronic sequence T. Another vector element that can be used is an internal ribosome entry site (IRES). The IRES sequence is used to produce more than one polypeptide from a single gene transcript. The IRES sequence would be used to produce a protein that contains more than one polypeptide chain. The selection of these and other common vector elements is standard and many such sequences are available [see, for example, Sambrook et al., and the references cited herein, for example, on pages 3.18 to 3.26 and 16.17 to 16.27, and Ausubel et al. , Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989]. In accordance with some embodiments, the foot-and-mouth disease virus 2A sequence is included in the polyprotein; it was shown that such a small peptide

- 18 044901 (approximately 18 amino acids in length) mediates the breakdown of polyproteins (Ryan, M.D. et al., EMBO, 1994; 4: 928-933; Mattion, N.M. et al., J Virology, November 1996; p. 8124-8127; Furler, S. et al., Gene Therapy, 2001; 8: 864-873; and Halpin, S. et al., The Plant Journal, 1999; 4: 453-459). The cleavage activity of the 2A sequence has previously been demonstrated in artificial systems, including plasmids and gene therapy vectors (AAV and retroviruses) (Ryan, M.D. et al., EMBO, 1994; 4: 928-933; Mattion, N.M. et al., J Virology, November 1996;p.8124-8127;Furler, S. et al., Gene Therapy, 2001;8:864-873;and Halpin, S. et al., The Plant Journal, 1999;4:453- 459; de Felipe, P. et al., Gene Therapy, 1999; 6: 198-208; de Felipe, P. et al., Human Gene Therapy, 2000; 11: 1921-1931.; and Klump, H. et al., Gene Therapy, 2001;8:811817).

The exact nature of the regulatory sequences required for gene expression in host cells will vary between species, tissues, and cell types, but will generally include, as appropriate, 5' untranscribed sequences and 5' untranslated sequences involved in the initiation of transcription and translation, respectively. , such as TATAbox, capping sequence, CAAT sequence, enhancer elements, etc. In particular, such 5' non-transcribed regulatory sequences will include a promoter region that includes a promoter sequence to control translation of the operably linked gene. Regulatory sequences may also include enhancer sequences or upstream activating sequences, as appropriate. The vectors of the present disclosure may optionally contain 5' leader or signal sequences. The selection and development of an appropriate vector is within the ability and discretion of one skilled in the art.

Examples of constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer) [see, for example, Boshart et al., Cell, 41: 521-530 (1985)], SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, phosphoglycerol kinase (PGK) promoter and EF1a promoter [Invitrogen].

Inducible promoters provide regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological condition, such as acute phase, a particular state of cell differentiation, or only in replicating cells. Inducible promoters are available from a number of commercial sources, including but not limited to Invitrogen, Clontech and Ariad.

Many other systems have been described and can be easily selected by one skilled in the art. Examples of inducible promoters regulated by exogenously supplied compounds include the zinc inducible ovine metallothionein (MT) promoter, the dexamethasone (Dex) inducible murine mammary tumor virus (MMTV) promoter, the T7 polymerase inducible promoter system (WO 98/10088); insect exidon-inducible promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA , 89:5547-5551 (1992)), tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2 :512-518 (1998)), RU486 inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)) and rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters that may be useful in this context are inducible promoters that are regulated by a specific physiological condition, such as temperature, acute phase, a particular cell differentiation state, or only in replicating cells.

In another embodiment, a native promoter for the trasgene may be used. A native promoter may be preferred when expression of the transgene is desired to mimic the expression of the native gene. A native promoter may be used if transgene expression is to be regulated in a temporal or developmental manner, or in a tissue-specific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, can also be used to mimic native gene expression.

In accordance with some embodiments, the regulatory sequences confer tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (eg, promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific serum thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter,

- 19 044901 pancreatic polypeptide (PPY), synapsin-1 promoter (Syn), creatine kinase (MCK) promoter, mammalian desmin promoter (DES), α-myosin heavy chain (α-MHC) promoter, gastrointestinal tract-specific promoter mucin 2, eye-specific retinoschisin promoter, eye-specific K12 promoter, respiratory-specific CC10 promoter, respiratory-specific surfactant C promoter (SP-C), breast-specific PRC1 promoter, specific for breast tissue, the RRM2 promoter, the urinary tract-specific uroplakin 2 promoter (UPII), the uterine-specific lactoferrin promoter, or the cardiac troponin T (cTnT) promoter. Other exemplary promoters include the betaactin promoter, the hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); alphafetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol., 161:1063-8 (1998)); promoter immunoglobulin heavy chain, T cell receptor α chain promoter, neuronal, such as neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), gene promoter neurofilament light chain (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)) and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995) )), among others, which will be obvious to one skilled in the art.

In accordance with some embodiments, one or more binding sites for one or more miRNAs are included in a transgene of the rAAV vector for the purpose of inhibiting expression of the transgene in one or more tissues of a subject containing the transgene. One skilled in the art will appreciate that binding sites can be selected to control transgene expression in a tissue-specific manner. For example, binding sites for liver-specific miR-122 can be included in a transgene to inhibit expression of that transgene in the liver. Target sites in mRNA can be located in the 5' UTR, 3' UTR or coding region. Typically, the target site is located in the 3' UTR of the mRNA. In addition, a transgene can be designed such that multiple miRNAs regulate the mRNA by recognizing one or more sites. The presence of multiple miRNA binding sites may result in the cooperative action of multiple RISCs and provide highly effective expression inhibition. The target site sequence may contain a total of 5-100, 10-60, or more nucleotides. The target site sequence may comprise at least 5 nucleotides of the target gene binding site sequence.

Recombinant vectors based on AAV sequences encoding transgenes.

The composition of the rAAV vector transgene sequence will depend on the application to which the resulting vector will be applied. For example, one type of transgenic sequence contains a reporter sequence that, when expressed, produces a detectable signal. In another example, the transgene encodes a therapeutic protein or a therapeutic functional RNA. In another example, the transgene encodes a protein or functional RNA that is intended to be used for research purposes, for example, to create a somatic transgenic animal model containing the transgene, for example, to study the function of the transgene product. In another example, the trasgene encodes a protein or functional RNA that is intended to be used to create an animal model of a disease. Suitable sequences encoding the transgene will be apparent to one skilled in the art.

Reporter sequences that may be provided in the transgene include, but are not limited to, DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others , known in the art. When associated with regulatory elements that regulate their expression, reporter sequences provide signals that are detected by standard means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescence cell sorting assays, including enzyme-linked immunosorbent assay (ELISA). ), radioimmunoassay (RIA) and radiohistochemical analysis. For example, in cases where the marker sequence is a LacZ gene, the presence of a vector carrying the signal sequence is detected using β-galactosidase activity assays. If the transgene is green fluorescent protein or luciferase, the vector carrying the signal sequence can be measured visually by the production of color or light in a luminometer. Such reporters may be useful, for example, in confirming tissue targeting and tissue-specific promoter regulatory activity of rAAV.

In accordance with certain aspects, the present disclosure provides rAAV vectors for use in methods of preventing or treating one or more genetic deficiencies or dysfunctions in a mammal, such as, for example, polypeptide deficiency or

- 20 044901 current of a polypeptide in a mammal, and in particular for the treatment or amelioration of the severity or extent of deficiency in a human exhibiting one or more disorders associated with deficiency in such polypeptides in cells and tissues. The method involves administering an rAAV vector that encodes one or more therapeutic peptides, polypeptides, siRNAs, microRNAs, antisense nucleotides, etc., in a pharmaceutically acceptable vehicle to a subject, in an amount and for a period of time sufficient to treat the deficiency or disorder in the subject suffering from such a disorder.

Thus, the present disclosure provides for the delivery of rAAV vectors encoding one or more peptides, polypeptides or proteins that are useful for treating or preventing pathological conditions in a mammalian subject. Exemplary therapeutic proteins include one or more polypeptides selected from the group consisting of growth factors, interleukins, interferons, antiapoptotic factors, cytokines, antidiabetic factors, antiapoptotic agents, coagulation factors, antitumor factors. Other non-limiting examples of therapeutic proteins include BDNF, CNTF, CSF, EGF, FGF, G-SCF, GM-CSF, gonadotropin, IFN, IFG-1, M-CSF, NGF, PDGF, PEDF, TGF, VEGF, TGF- B2, TNF, prolactin, somatotropin, XIAP1, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-10 (187A), viral IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16 IL-17 and IL-18.

rAAV vectors may contain a gene to be transferred into a subject to treat a disease associated with attenuated expression, absence of expression, or dysfunction of the gene. Exemplary genes and associated pathological conditions include, but are not limited to, glucose-6-phosphatase associated with glycogen storage deficiency type 1A; phosphoenolpyruvate carboxykinase associated with Repck deficiency; galactose-1-phosphate uridyl transferase, associated with galactosemia; phenylalanine hydroxylase associated with phenylketonuria; branched chain alpha-keto acid dehydrogenase associated with maple syrup disease; fumarylacetoacetate hydrolase, associated with tyrosinemia type 1; methylmalonyl-CoA mutase associated with methylmalonic acidemia; medium-chain acyl-CoAdehydrogenase, associated with medium-chain acetyl-CoA deficiency; omitine transcarbamylase, associated with omitine transcarbamylase deficiency; arginine succinic acid synthetase associated with citrullinemia; low-density lipoprotein receptor protein associated with familial hypercholesterolemia; UDP-glucuronyl transferase associated with Crigler-Najar disease; adenosine deaminase associated with severe combined immunodeficiency; hypoxanthine-guanine phosphoribosyltransferase, associated with gout and Lesch-Nyhan syndrome; biotinidase associated with biotinidase deficiency; betaglucocerebrosidase associated with Gaucher disease; beta-glucuronidase associated with Sly's syndrome; peroxisomal membrane protein with a molecular weight of 70 kDa, associated with Zellweger syndrome; porphobilinogen deaminase associated with acute intermittent porphyria; alpha-1-antitrypsin to treat alpha-1-atritrypsin deficiency (emphysema); erythropoietin for the treatment of anemia due to thalassemia or renal failure; vascular endothelial growth factor, angiopoietin-1 and fibroblast growth factor for the treatment of ischemic diseases; thrombomodulin and tissue factor inhibitor for the treatment of occluded blood vessels, as observed, for example, in the case of atherosclerosis, thrombosis or embolism; aromatic acid decarboxylase (AADC) and tyrosine hydrolase (TH) for the treatment of Parkinson's disease; beta-adrenergic receptor antisense or mutant form of phospholamban, sarco(endo)plasmic reticulum adenosine triphosphatase-2 (SERCA2) and cardiac adenylate cyclase for the treatment of congestive heart failure; a tumor suppressor gene such as p53 for treating various types of cancer; a cytokine such as one of the various interleukins for the treatment of inflammatory and immune disorders and cancers; dystrophin or minidystrophin and utrophin or miniutrophin for the treatment of muscular dystrophies; and insulin for the treatment of diabetes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a condition, disease, or disorder associated with the central nervous system (CNS). The following is a non-limiting list of genes associated with CNS disease: DRD2, GRIA1, GRIA2, GRIN1, SLC1A1, SYP, SYT1, CHRNA7, 3Rtau/4rTUS, APP, BAX, BCL-2, GRIK1, GFAP, IL-1, AGER, associated with Alzheimer's disease; UCH-L1, SKP1, EGLN1, Nurr-1, BDNF, TrkB, gstm1, S106e, associated with Parkinson's disease; IT15, PRNP, JPH3, TBP, ATXN1, ATXN2, ATXN3, utrophin 1, FTL, TITF-1, associated with Huntington's disease; FXN, associated with Friedreich's ataxia; ASPA associated with Canavan disease; DMD associated with muscular dystrophy; and SMN1, UBE1, DYNC1H1, associated with spinal muscular dystrophy. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to a nucleic acid encoding a protein or functional RNA useful for treating a condition, disease, or disorder associated with the cardiovascular system. The following is a non-limiting list of genes associated with cardiovascular disease: VEGF, FGF, SDF-1, connexin 40, connexin 43, SCN4a, HIF1a, SERCa2a, ADCY1 and ADCY6. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a condition, disease, or disorder associated with the respiratory system. The following is a non-limiting list of genes associated with respiratory disease: TNFa, TGFe 1, SFTPA1, SFTPA2, SFTPB, SFTPC, HPS1, HPS3, HPS4, ADTB3A, Ilia, IL1B, LTA, IL6, CXCR1 and CXCR2. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a liver-associated condition, disease, or disorder. The following is a non-limiting list of genes associated with liver disease: a1-AT, HFE, ATP7B, fumarylacetoacetate hydrolase (FAH), glucose-6-phosphatase, NCAN, GCKR, LYPLAL1 and PNPLA3. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a kidney-related condition, disease, or disorder. The following is a non-limiting list of genes associated with kidney disease: PKD1, PKD2, PKHD1, NPHS1, NPHS2, PLCE1, CD2AP, LAMB2, TRPC6, WT1, LMX1B, SMARCAL1, COQ2, PDSS2, SCARB3, FN1, COL4A5, COL4A6, COL4A3, COL4A4 , FOX1C, RET, UPK3A, BMP4, SIX2, CDC5L, USF2, ROBO2, SLIT2, EYA1, MYOG, SIX1, SIX5, FRAS1, FREM2, GATA3, KAL1, PAX2, TCF2 and SALL1. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a condition, disease, or disorder associated with the eye. The following is a non-limiting list of genes associated with eye disease: CFH, C3, MT-ND2, ARMS2, TIMP3, CAMK4, FMN1, RHO, USH2A, RPGR, RP2, TMCO, SIX1, SIX6, LRP12, ZFPM2, TBK1, GALC, myocyclin , CYP1B1, CAV1, CAV2, optineurin and CDKN2B. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a condition, disease or disorder associated with the mammary gland.

- 22 044901

The following is a non-limiting list of genes associated with breast disease: BRCA1, BRCA2, Tr53, PTEN, HER2, BRAF and PARP1. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a condition, disease, or disorder associated with the gastrointestinal tract. The following is a non-limiting list of genes associated with gastrointestinal disease: CYP2C19, CCL26, APC, IL12, IL10 and IL-18. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a condition, disease, or disorder associated with the pancreas. The following is a non-limiting list of genes associated with pancreatic disease: PRSS1, SPINK1, STK11, MLH1, KRAS2, p16, p53 and BRAF. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a condition, disease, or disorder associated with the urinary tract. The following is a non-limiting list of genes associated with urinary tract disease: HSPA1B, CXCR1 & 2, TLR2, TLR4, TGF-1, FGFR3, RB1, HRAS, TP53, and TSC1. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

In accordance with some embodiments, the present disclosure relates to an AAV comprising a nucleic acid encoding a protein or functional RNA useful for treating a condition, disease, or disorder associated with the uterus. The following is a non-limiting list of genes associated with eye disease: DN-ER, MLH1, MSH2, MSH6, PMS1 and PMS2. In accordance with some embodiments, the present disclosure relates to recombinant AAVs containing nucleic acids that express one or more of the above genes or fragments thereof. In accordance with some embodiments, the present disclosure relates to recombinant AAVs comprising nucleic acids that express one or more functional RNAs that inhibit the expression of one or more of the above genes.

The rAAVs of the present disclosure can be used to restore expression of genes that are attenuated, silenced, or otherwise dysfunctional in a subject (eg, a tumor suppressor that has been silenced in a subject having cancer). The rAAVs of the present disclosure can also be used to knock down the expression of genes that are aberrantly expressed in a subject (eg, an oncogene that is expressed in a subject having cancer). In accordance with some embodiments, an rAAV vector containing a nucleic acid encoding a gene product associated with cancer (eg, tumor suppressors) can be used to treat cancer by administering the rAAV containing the rAAV vector to a subject having cancer. In accordance with some embodiments, an rAAV vector comprising a nucleic acid encoding a small interfering nucleic acid (e.g., shRNA, miRNA) that inhibits the expression of a cancer-associated gene product (e.g., oncogenes) can be used to treat cancer by administration of rAAV,

- 23 044901 containing the rAAV vector, to a subject having cancer. In some embodiments, an rAAV vector comprising a nucleic acid encoding a cancer-associated gene product (or a functional RNA that inhibits expression of a cancer-associated gene) may be used for research purposes, such as for studying cancer or to identify therapeutic agents that treat cancer. The following is a non-limiting list of genes associated with cancer development (for example, oncogenes and tumor suppressors):

AARS, АВСВ1, АВСС4, ABI2, ABL1, ABL2, АСК1,

ACP2, ACY1, ADSL, AKI, AKR1C2, AKT1, ALB, ANPEP, ANXA5, ANXA7, AR2M1, APC, ARHGAP5, ARHGEF5, ARID4A, ASNS, ATF4, ATM, ATP5B, ATP5O, AXL, BARD1, BAX, BCL2, BHLHB2, BLMH, BRAF, BRCA1, BRCA2, VTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBLB, CCL2, CCND1, CCND2, CCND3, CCNE1, CCT5, CCYR61, CD24, CD44, CD59, CDC20, CDC25, CDC25A, CDC25B, CDC2L5, CDK10, CDK4, CDK5, CDK9, CDKL1, CDKN1A, CDKN1B, CDKN1C, CDKN2A, CDKN2B, CDKN2D, CEBPG, CENPC1, CGRRF1, CHAF1A, CIB1, CKMT1, CLK1, CLK2, CLK3, CLNS1A, CLTC, C OL1A1, COL6A3, COX6C, COX7A2, CRAT, CRHR1, CSF1R, CSK, CSNK1G2, CTNNA1, CTNNB1,

- 24 044901

CTPS, CTSC, CTSD, CUL1, CYR61, DCC, DCN, DDX10, DEK, DHCR7, DHRS2, DHX8, DLG3, DVL1, DVL3, E2F1, E2F3, E2F5, EGFR, EGR1, EIF5, EPHA2, ERBB2, ERBB3, ERBB4, ERCC3, ETV1, ETUZ, ETV6, F2R, FASTK, FBN1, FBN2, FES, FGFR1, FGR, FKBP8, FN1, FOS, FOSL1, FOSL2, FOXG1A, FOXO1A, FRAP1, FRZB, FTL, FZD2, FZD5, FZD9, G22P1, GAS6, GCN5L2, GDF15, GNA13, GNAS, GNB2, GNB2L1, GPR39, GRB2, GSK3A, GSPT1, GTF2I, HDAC1, HDGF, HMMR, HPRT1, HRB, HSPA4, HSPA5, HSPA8, HSPB1, HSPH1, HYAL1, HYOU1, ICAM1, ID1, Ш2, IDUA, IER3, IFITM1, IGF1R, IGF2R, IGFBP3, IGFBP4, IGFBP5, IL1B, ILK, ING1, IRF3, ITGA3, ITGA6, ITGB4, JAKI, JARID1A, JUN, JUNB, JUND, K-ALPHA-1, KIT, KITLG, KLK10, KPNA2, KRAS2, KRT18, KRT2A, KRT9, LAMB1, LAMP2, LCK, LCN2, LEP, LITAF, LRPAP1, LTF, LYN, LZTR1, MADH1, MAP2K2, MAP3K8, MAPK12, MAPK13, MAPKAPK3, MAPRE1, MARS, MASI, MCC, MCM2, MCM4, MDM2, MDM4, MET, MGST1, MICB, MLLT3, MME, MMP1, MMP14, MMP17, MMP2, MNDA, MSH2, MSH6, MT3, MYB, MYBL1, MYBL2, MYC, MYCL1, MYCN, MYD88, MYL9, MYLK, ΝΕΟΙ, NF1, NF2, NFKB1, NFKB2, NFSF7, NID, NINJ1, NMBR, NME1, NME2, NME3, NOTCH1, NOTCH2, NOTCH4, NPM1, NQO1, NR1D1, NR2F1, NR2F6, NRAS, NRG1, NSEP1, OSM, PA2G4, PABPC1, PCNA, PCTK1, PCTK2, PCTK3, PDGFA, PDGFB, PDGFRA, PDPK1, PEA15, PFDN4, PFDN5, PGAM1, PHB, RPSZSA, RPSZSV, PIK3CG, PIM1, PKM2, PKMYT1, PLK2, PPARD, PPARG, PPIH, PPP1CA, PPP2R5A, PRDX2, PRDX4, PRKAR1A, PRKCBP1, PRNP, PRSS15, PSMA1, PTCH, PTEN, PTGS1, PTMA, PTN, PTPRN, RAB5A, RAC1, RAD50, RAFI, RALBP1, RAP1A, RARA, RARB, RASGRF1, RBI, RBBP4, RBL2, REA, REL, RELA, RELB, RET, RFC2, RGS19, RHOA, RHOB, RHOC, RHOD, RIPK1, RPN2, RPS6KB1, RRM1, SARS, SELENBP1, SEMA3C, SEMA4D, SEPPI, SERPINH1, SFN, SFPQ, SFRS7, SHB, SHH, SIAH2, SIVA, SIVA TP53, SKI, SKIL, SLC16A1, SLC1A4, SLC20A1, SMO, SMPD1, SNAI2, SND1, SNRPB2, S0CS1, S0CS3, SOD1, SORT1, SPINT2, SPRY2 , SRC, SRPX, STAT1, STAT2, STAT3, STAT5B, STC1, TAF1, TBL3, TBRG4, TCF1, TCF7L2, TFAP2C, TFDP1, TFDP2, TGFA, TGFB1, TGFBI, TGFBR2, TGFBR3, THBS1, TIE, TIMP1, TIMP3, TJP1 , TK1, TLE1, TNF, TNFRSF10A, TNFRSF10B, TNFRSF1A, TNFRSF1B, TNFRSF6, TNFSF7, TNK1, TOBI, TP53, TP53BP2, TP53I3, TP73, TPBG, TPT1, TRADD, TRAM1, TRRAP, TSG101, TUFM, TXNRD1, TYRO3, U.B.C. , UBE2L6, UCHL1, USP7, VDAC1, VEGF, VHL, VIL2, WEE1, WNT1, WNT2, WNT2B, WNT3, WNT5A, WT1, XRCC1, YES1, YWHAB, YWHAZ, ZAP70 and ZNF9.

The rAAV vector may contain as a transgene a nucleic acid encoding a protein or functional RNA that modulates apoptosis. The following is a non-limiting list of genes associated with apoptosis, and nucleic acids encoding the products of these genes, and their homologues, and encoding small interfering nucleic acids (for example, shRNA, miRNA) that inhibit the expression of these genes, and their homologues that are useful in as transgenes in accordance with certain embodiments of the present disclosure:

- 25 044901

RPS27A, ABL1, AKT1, APAF1, BAD, BAG1, BAG3, BAG4, BAKI, BAX, BCL10, BCL2, BCL2A1, BCL2L1, BCL2L10, BCL2L11, BCL2L2L12, BCL2L2, BCLAF1, BF1, BF1, BF Ar, bid, bik, naip, birc2, BIRC3, XIAP, BIRC5, BIRC6, BIRC7, BIRC8, BNIP1, BNIP2, BNIP3, BNIP3L, BOK, BRAF, CARDIO, CARD11, NLRC4, CARD14, NOD2, NODI, CARD6, CARD8, CARD9, CASP1, CASP10, CASP14, CASP2, CASP3, CASP4, CASP5, CASP6, CASP7, CASP8, CASP9, CFLAR, SSHEA, SSHEV, CRADD, DAPK1, DAPK2, DFFA, DFFB, FADD, GADD45A, GDNF, HRK, IGF1R, LTA, LTBR, MCL1, NOL3, PYCARD, RIPK1, RIPK2, TNF, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, TNFRSF11B, TNFRSF12A, TNFRSF14, TNFRSF19, TNFRSF1A, TNFRSF1B, TNFRSF21, TNFRSF25, CD40, FAS, TNFRSF6B, CD27, TNFRSF9, TNFSF10, TNFSF14, TNFSF18, CD40LG, FASLG, CD70, TNFSF8, TNFSF9, TP53, TP53BP2, TP73, TP63, TRADD, TRAF1, TRAF2, TRAF3, TRAF4, TRAF5 DRD2, GRIA1, GRIA2,GRIN1, SLC1A1, SYP, SYT1, CHRNA7, 3Rtau/4rTUS, APP, BAX, BCL -2, GRIK1, GFAP, IL-1, AGER, UCH-L1, SKP1, EGLN1, Nurr-1, BDNF, TrkB, gstml, 8106β, IT15, PRNP, JPH3, TBP, ATXN1, ATXN2, ATXN3, atrophy 1, FTL, TITF-1, FXN, ASP A, DMD and SMN1, UBE1, DYNC1H1.

One skilled in the art will also appreciate that in the case of transgenes encoding proteins or polypeptides, mutations that result in conservative amino acid substitutions can be made in the transgene to provide functionally equivalent variants or homologues of the protein or polypeptide. In accordance with some aspects, the present disclosure provides for sequence changes that result in conservative amino acid changes in the transgene. In accordance with some embodiments, the transgene is a gene containing a dominant negative mutation. For example, a transgene may express a mutant protein that interacts with the same elements as the wild-type protein and thereby blocks some aspect of the function of the wild-type protein.

Suitable transgenic products also include miRNA. miRNA and other small interfering nucleic acids regulate gene expression by cleaving/destructing the target RNA transcript or repressing the translation of the target messenger RNA (mRNA). miRNAs are natively expressed, typically as final 19-25 nucleotide untranslated RNA products. miRNAs exert their activity through sequence-specific interactions with the 3′ untranslated regions (UTRs) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors, which are then processed into a miRNA duplex and then into a mature single-stranded miRNA molecule. Such a mature miRNA directs a multiprotein complex, miRISC, which identifies a target site, for example, in the 3' UTR region of the target mRNAs based on their complementarity with the mature miRNA.

In accordance with certain embodiments of the methods, the following non-limiting list of miRNA genes and homologues thereof useful as transgenes or as targets for small interfering nucleic acids encoded by transgenes (e.g., miRNA sponges, antisense oligonucleotides, TuD RNAs) is provided:

- 26 044901 hsa-let-7a, hsa-let-7a*, hsa-let-7b, hsa-let-7b*, hsa-let-7c, hsa-let-7c*, hsa-let-7d, hsa- let-7d*, hsa-let-7e, hsa-let-7e*, hsa-let-7f, hsa-let-7f-l*, hsa-let-7f-2*, hsa-let-7g, hsa- let-7g*, hsa-let-7i, hsa-let-7i*, hsa-miR-1, hsa-miR-100, hsa-miR100*, hsa-miR-101, hsa-miR-101*, hsa- miR-103, hsa-miR-105, hsa-miR-105*, hsa-miR-106a, hsa-miR-106a*, hsa-miR-106b, hsa-miR-106b*, hsa-miR-107, hsa -miR-lOa, hsa-miR-10a*, hsamiR-lOb, hsa-miR-10b*, hsa-miR-1178, hsa-miR-1179, hsa-miR-1180, hsa-miR-1181, hsa-miR1182 , hsa-miR-1183, hsa-miR-1184, hsa-miR-1185, hsa-miR-1197, hsa-miR-1200, hsa-miR1201, hsa-miR-1202, hsa-miR-1203, hsa-miR -1204, hsa-miR-1205, hsa-miR-1206, hsa-miR1207-3p, hsa-miR-1207-5p, hsa-miR-1208, hsa-miR-122, hsa-miR-122*, hsa- miR-1224-Зр, hsamiR-1224-5p, hsa-miR-1225-Зр, hsa-miR-1225-5p, hsa-miR-1226, hsa-miR-1226*, hsa-miR1227, hsa-miR-1228 , hsa-miR-1228*, hsa-miR-1229, hsa-miR-1231, hsa-miR-1233, hsa-miR1234, hsa-miR-1236, hsa-miR-1237, hsa-miR-1238, hsa- miR-124, hsa-miR-124*, hsa-miR1243, hsa-miR-1244, hsa-miR-1245, hsa-miR-1246, hsa-miR-1247, hsa-miR-1248, hsa-miR1249, hsa -miR-1250, hsa-miR-1251, hsa-miR-1252, hsa-miR-1253, hsa-miR-1254, hsa-miR1255a, hsa-miR-1255b, hsa-miR-1256, hsa-miR-1257 , hsa-miR-1258, hsa-miR-1259, hsa-miR125a-3p, hsa-miR-125a-5p, hsa-miR-125b, hsa-miR-125b-l*, hsa-miR-125b-2* , hsa-miR-126, hsa-miR-126*, hsa-miR-1260, hsa-miR-1261, hsa-miR-1262, hsa-miR-1263, hsa-miR-1264, hsa-miR-1265, hsa-miR-1266, hsa-miR-1267, hsa-miR-1268, hsa-miR-1269, hsa-miR-1270, hsa-miR-1271, hsa-miR-1272, hsa-miR-1273, hsa- miR-127-Зр, hsa-miR-1274a, hsa-miR-1274b, hsa-miR-1275, hsa-miR-127-5p, hsa-miR-1276, hsa-miR-1277, hsa-miR-1278, hsa-miR-1279, hsa-miR-128, hsa-miR-1280, hsa-miR-1281, hsa-miR-1282, hsa-miR-1283, hsa-miR-1284, hsamiR-1285, hsa-miR- 1286, hsa-miR-1287, hsa-miR-1288, hsa-miR-1289, hsa-miR-129*, hsamiR-1290, hsa-miR-1291, hsa-miR-1292, hsa-miR-1293, hsa -miR-129-Зр, hsa-miR-1294, hsamiR-1295, hsa-miR-129-5p, hsa-miR-1296, hsa-miR-1297, hsa-miR-1298, hsa-miR-1299, hsa - 27 044901 miR-1300, hsa-miR-1301, hsa-miR-1302, hsa-miR-1303, hsa-miR-1304, hsa-miR-1305, hsamiR-1306, hsa-miR-1307, hsa-miR -1308, hsa-miR-130a, hsa-miR-130a*, hsa-miR-130b, hsamiR-130b*, hsa-miR-132, hsa-miR-132*, hsa-miR-1321, hsa-miR- 1322, hsa-miR-1323, hsamiR-1324, hsa-miR-133a, hsa-miR-133b, hsa-miR-134, hsa-miR-135a, hsa-miR-135a*, hsamiR-135b, hsa-miR -135b*, hsa-miR-136, hsa-miR-136*, hsa-miR-137, hsa-miR-138, hsa-miR138-1*, hsa-miR-138-2*, hsa-miR-139 -3p, hsa-miR-139-5p, hsa-miR-140-Зр, hsa-miR-140-5p, hsa-miR-141, hsa-miR-141*, hsa-miR-142-Зр, hsa- miR-142-5p, hsa-miR-143, hsa-miR-143*, hsa-miR-144, hsa-miR-144*, hsa-miR-145, hsa-miR-145*, hsa-miR-146a , hsa-miR-146a*, hsamiR-146b-3p, hsa-miR-146b-5p, hsa-miR-147, hsa-miR-147b, hsa-miR-148a, hsa-miR-148a*, hsa-miR -148b, hsa-miR-148b*, hsa-miR-149, hsa-miR-149*, hsa-miR-150, hsa-miR-150*, hsamiR-151-Зр, hsa-miR-151-5p, hsa-miR-152, hsa-miR-153, hsa-miR-154, hsa-miR-154*, hsamiR-155, hsa-miR-155*, hsa-miR-15a, hsa-miR-15a*, hsa -miR-15b, hsa-miR-15b*, hsa-miR16, hsa-miR-16-1*, hsa-miR-16-2*, hsa-miR-17, hsa-miR-17*, hsa-miR -181a, hsa-miR-181a*, hsa-miR-181a-2*, hsa-miR-181b, hsa-miR-181c, hsa-miR-181c*, hsa-miR-181d, hsa-miR-182, hsa-miR-182*, hsa-miR-1825, hsa-miR-1826, hsa-miR-1827, hsa-miR-183, hsa-miR-183*, hsamiR-184, hsa-miR-185, hsa- miR-185*, hsa-miR-186, hsa-miR-186*, hsa-miR-187, hsa-miR187*, hsa-miR-188-Зр, hsa-miR-188-5p, hsa-miR-18a , hsa-miR-18a*, hsa-miR-18b, hsa-miR18b*, hsa-miR-190, hsa-miR-190b, hsa-miR-191, hsa-miR-191*, hsa-miR-192, hsa-miR-192*, hsa-miR-193a-3p, hsa-miR-193a-5p, hsa-miR-193b, hsa-miR-193b*, hsa-miR-194, hsa-miR194*, hsa-miR -195, hsa-miR-195*, hsa-miR-196a, hsa-miR-196a*, hsa-miR-196b, hsa-miR-197, hsa-miR-198, hsa-miR-199a-3p, hsa -miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a, hsa-miR19a*, hsa-miR-19b, hsa-miR-19b-l*, hsa-miR-19b-2*, hsa-miR-200a, hsa-miR-200a*, hsa-miR200b, hsa-miR-200b*, hsa-miR-200c, hsa-miR-200c*, hsa-miR-202, hsa-miR-202*, hsa-miR203, hsa-miR-204, hsa-miR-205, hsa-miR-206, hsa-miR-208a, hsa-miR-208b, hsa-miR-20a, hsamiR-20a*, hsa-miR-20b , hsa-miR-20b*, hsa-miR-21, hsa-miR-21*, hsa-miR-210, hsa-miR-211, hsa-miR-212, hsa-miR-214, hsa-miR-214 *, hsa-miR-215, hsa-miR-216a, hsa-miR-216b, hsamiR-217, hsa-miR-218, hsa-miR-218-1*, hsa-miR-218-2*, hsa- miR-219-l-3p, hsa-miR-219-23p, hsa-miR-219-5p, hsa-miR-22, hsa-miR-22*, hsa-miR-220a, hsa-miR-220b, hsa -miR-220c, hsa-miR-221, hsa-miR-221*, hsa-miR-222, hsa-miR-222*, hsa-miR-223, hsa-miR-223*, hsamiR-224, hsa- miR-23a, hsa-miR-23a*, hsa-miR-23b, hsa-miR-23b*, hsa-miR-24, hsa-miR-241*, hsa-miR-24-2*, hsa-miR- 25, hsa-miR-25*, hsa-miR-26a, hsa-miR-26a-l*, hsa-miR-26a-2*, hsa-miR-26b, hsa-miR-26b*, hsa-miR- 27a, hsa-miR-27a*, hsa-miR-27b, hsa-miR-27b*, hsamiR-28-Зр, hsa-miR-28-5p, hsa-miR-296-Зр, hsa-miR-296- 5p, hsa-miR-297, hsa-miR-298, hsamiR-299-Зр, hsa-miR-299-5p, hsa-miR-29a, hsa-miR-29a*, hsa-miR-29b, hsa-miR -29b-l*, hsamiR-29b-2*, hsa-miR-29c, hsa-miR-29c*, hsa-miR-300, hsa-miR-301a, hsa-miR-301b, hsa

- 28 044901 miR-302a, hsa-miR-302a*, hsa-miR-302b, hsa-miR-302b*, hsa-miR-302c, hsa-miR-302c*, hsamiR-302d, hsa-miR-302d* , hsa-miR-302e, hsa-miR-302f, hsa-miR-30a, hsa-miR-30a*, hsamiR-30b, hsa-miR-30b*, hsa-miR-30c, hsa-miR-30c-l *, hsa-miR-30c-2*, hsa-miR-30d, hsamiR-30d*, hsa-miR-30e, hsa-miR-30e*, hsa-miR-31, hsa-miR-31*, hsa- miR-32, hsa-miR-32*, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-323-3p, hsa-miR-323-5p , hsa-miR-324-3p, hsa-miR-324-5p, hsa-miR-325, hsa-miR-326, hsa-miR-328, hsa-miR-329, hsamiR-330-3p, hsa-miR -330-5p, hsa-miR-331-3p, hsa-miR-331-5p, hsa-miR-335, hsa-miR-335*, hsa-miR-337-3p, hsa-miR-337-5p, hsa-miR-338-3p, hsa-miR-338-5p, hsa-miR-339-3p, hsa-miR339-5p, hsa-miR-33a, hsa-miR-33a*, hsa-miR-33b, hsa -miR-33b*, hsa-miR-340, hsa-miR-340*, hsa-miR-342-3p, hsa-miR-342-5p, hsa-miR-345, hsa-miR-346, hsa-miR -34a, hsa-miR-34a*, hsa-miR-34b, hsa-miR-34b*, hsa-miR-34c-3p, hsa-miR-34c-5p, hsa-miR-361-3p, hsa-miR -3615p, hsa-miR-362-3p, hsa-miR-362-5p, hsa-miR-363, hsa-miR-363*, hsa-miR-365, hsa-miR-367, hsa-miR-367* , hsa-miR-369-3p, hsa-miR-369-5p, hsa-miR-370, hsa-miR-371-3p, hsa-miR-3715p, hsa-miR-372, hsa-miR-373, hsa -miR-373*, hsa-miR-374a, hsa-miR-374a*, hsa-miR-374b, hsa-miR-374b*, hsa-miR-375, hsa-miR-376a, hsa-miR-376a* , hsa-miR-376b, hsa-miR-376c, hsa-miR-377, hsa-miR-377*, hsa-miR-378, hsa-miR-378*, hsa-miR-379, hsa-miR-379 *, hsamiR-380, hsa-miR-380*, hsa-miR-381, hsa-miR-382, hsa-miR-383, hsa-miR-384, hsa-miR-4093p, hsa-miR-409-5p , hsa-miR-410, hsa-miR-411, hsa-miR-411*, hsa-miR-412, hsa-miR-421, hsa-miR-422a, hsa-miR-423-3p, hsa-miR- 423-5p, hsa-miR-424, hsa-miR-424*, hsa-miR-425, hsa-miR-425*, hsa-miR-429, hsa-miR-431, hsa-miR-431*, hsa -miR-432, hsa-miR-432*, hsamiR-433, hsa-miR-448, hsa-miR-449a, hsa-miR-449b, hsa-miR-450a, hsa-miR-450b-3p, hsamiR- 450b-5p, hsa-miR-451, hsa-miR-452, hsa-miR-452*, hsa-miR-453, hsa-miR-454, hsa-miR454*, hsa-miR-455-Зр, hsa- miR-455-5p, hsa-miR-483-3p, hsa-miR-483-5p, hsa-miR-484, hsamiR-485-Zr, hsa-miR-485-5p, hsa-miR-486-Zr, hsa-miR-486-5p, hsa-miR-487a, hsa-miR-487b, hsa-miR-488, hsa-miR-488*, hsa-miR-489, hsa-miR-490-Зр, hsa-miR -490-5p, hsa-miR-491-Зр, hsa-miR-491-5p, hsa-miR-492, hsa-miR-493, hsa-miR-493*, hsa-miR-494, hsa-miR- 495, hsamiR-496, hsa-miR-497, hsa-miR-497*, hsa-miR-498, hsa-miR-499-Зр, hsa-miR-499-5p, hsamiR-500, hsa-miR-500 *, hsa-miR-501-Зр, hsa-miR-501-5p, hsa-miR-5O2-3p, hsa-miR-502-5p, hsa-miR-503, hsa-miR-504, hsa-miR- 505, hsa-miR-505*, hsa-miR-506, hsa-miR-507, hsa-miR508-3p, hsa-miR-508-5p, hsa-miR-509-3-5p, hsa-miR-509 -Zr, hsa-miR-509-5p, hsa-miR-510, hsa-miR-511, hsa-miR-512-Zr, hsa-miR-512-5p, hsa-miR-513a-3p, hsa-miR -513a-5p, hsa-miR513b, hsa-miR-513c, hsa-miR-514, hsa-miR-515-Зр, hsa-miR-515-5p, hsa-miR-516a-3p, hsamiR-516a-5p , hsa-miR-516b, hsa-miR-517*, hsa-miR-517a, hsa-miR-517b, hsa-miR-517c, hsamiR-518a-3p, hsa-miR-518a-5p, hsa-miR- 518b, hsa-miR-518c, hsa-miR-518c*, hsa-miR-518d3p, hsa-miR-518d-5p, hsa-miR-518e, hsa-miR-518e*, hsa-miR-518f, hsa- miR-5 18f*, hsa-miR

- 29 044901

519a, hsa-miR-519b-3p, hsa-miR-519c-3p, hsa-miR-519d, hsa-miR-519e, hsa-miR-519e*, hsamiR-520a-3p, hsa-miR-520a-5p , hsa-miR-520b, hsa-miR-520c-3p, hsa-miR-520d-3p, hsa-miR520d-5p, hsa-miR-520e, hsa-miR-520f, hsa-miR-520g, hsa-miR -520h, hsa-miR-521, hsa-miR522, hsa-miR-523, hsa-miR-524-Zr, hsa-miR-524-5p, hsa-miR-525-Zr, hsa-miR-525-5p , hsamiR-526b, hsa-miR-526b*, hsa-miR-532-3p, hsa-miR-532-5p, hsa-miR-539, hsa-miR-541, hsamiR-541*, hsa-miR-542 -Зр, hsa-miR-542-5p, hsa-miR-543, hsa-miR-544, hsa-miR-545, hsamiR-545*, hsa-miR-548a-3p, hsa-miR-548a-5p, hsa-miR-548b-3p, hsa-miR-548b-5p, hsa-miR548c-3p, hsa-miR-548c-5p, hsa-miR-548d-3p, hsa-miR-548d-5p, hsa-miR- 548e, hsa-miR-548f, hsa-miR-548g, hsa-miR-548h, hsa-miR-548i, hsa-miR-548j, hsa-miR-548k, hsa-miR-5481, hsamiR-548m, hsa- miR-548n, hsa-miR-548o, hsa-miR-548p, hsa-miR-549, hsa-miR-550, hsa-miR550*, hsa-miR-551a, hsa-miR-551b, hsa-miR-551b *, hsa-miR-552, hsa-miR-553, hsa-miR-554, hsa-miR-555, hsa-miR-556-Зр, hsa-miR-556-5p, hsa-miR-557, hsa- miR-558, hsa-miR-559, hsamiR-561, hsa-miR-562, hsa-miR-563, hsa-miR-564, hsa-miR-566, hsa-miR-567, hsa-miR-568, hsa-miR-569, hsa-miR-570, hsa-miR-571, hsa-miR-572, hsa-miR-573, hsa-miR-574-Зр, hsamiR-574-5p, hsa-miR-575, hsa-miR-576-Зр, hsa-miR-576-5p, hsa-miR-577, hsa-miR-578, hsamiR-579, hsa-miR-580, hsa-miR-581, hsa-miR-582- Zr, hsa-miR-582-5p, hsa-miR-583, hsamiR-584, hsa-miR-585, hsa-miR-586, hsa-miR-587, hsa-miR-588, hsa-miR-589, hsa-miR-589*, hsa-miR-590-Зр, hsa-miR-590-5p, hsa-miR-591, hsa-miR-592, hsa-miR-593, hsa-miR-593*, hsa- miR-595, hsa-miR-596, hsa-miR-597, hsa-miR-598, hsa-miR-599, hsa-miR-600, hsa-miR601, hsa-miR-602, hsa-miR-603, hsa-miR-604, hsa-miR-605, hsa-miR-606, hsa-miR-607, hsamiR-608, hsa-miR-609, hsa-miR-610, hsa-miR-611, hsa-miR- 612, hsa-miR-613, hsa-miR-614, hsa-miR-615-Зр, hsa-miR-615-5p, hsa-miR-616, hsa-miR-616*, hsa-miR-617, hsa -miR-618, hsa-miR-619, hsa-miR-620, hsa-miR-621, hsa-miR-622, hsa-miR-623, hsa-miR-624, hsa-miR624*, hsa-miR- 625, hsa-miR-625*, hsa-miR-626, hsa-miR-627, hsa-miR-628-Зр, hsa-miR-6285p, hsa-miR-629, hsa-miR-629*, hsa- miR-630, hsa-miR-631, hsa-miR-632, hsa-miR-633, hsamiR-634, hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa-miR-639, hsa-miR-640, hsa-miR-641, hsa-miR-642, hsa-miR-643, hsa-miR-644, hsa-miR-645, hsa-miR-646, hsa- miR647, hsa-miR-648, hsa-miR-649, hsa-miR-650, hsa-miR-651, hsa-miR-652, hsa-miR-653, hsamiR-654-Зр, hsa-miR-654- 5p, hsa-miR-655, hsa-miR-656, hsa-miR-657, hsa-miR-658, hsamiR-659, hsa-miR-660, hsa-miR-661, hsa-miR-662, hsa- miR-663, hsa-miR-663b, hsa-miR-664, hsa-miR-664*, hsa-miR-665, hsa-miR-668, hsa-miR-671-Зр, hsa-miR-671-5p , hsa-miR-675, hsa-miR-7, hsa-miR-708, hsa-miR-708*, hsa-miR-7-1*, hsa-miR-7-2*, hsa-miR-720, hsa-miR744, hsa-miR-744*, hsa-miR-758, hsa-miR-760, hsa-miR-765, hsa-miR-766, hsa-miR-767-Зр, hsa-miR-767-5p , hsa-miR-768-Зр, hsa-miR-768-5p, hsa-miR-769-Зр, hsa-miR-769-5p, hsa-miR770-5p, hsa-miR-802, hsa-miR-873 , hsa-miR-874, hsa-miR-875-Зр, hsa-miR-875-5p, hsa-miR

- 30 044901

876-3p, hsa-miR-876-5p, hsa-miR-877, hsa-miR-877*, hsa-miR-885-Зр, hsa-miR-885-5p, hsamiR-886-Зр, hsa-miR -886-5p, hsa-miR-887, hsa-miR-888, hsa-miR-888*, hsa-miR-889, hsamiR-890, hsa-miR-891a, hsa-miR-891b, hsa-miR- 892a, hsa-miR-892b, hsa-miR-9, hsa-miR-9*, hsa-miR-920, hsa-miR-921, hsa-miR-922, hsa-miR-923, hsa-miR-924 , hsa-miR-92a, hsa-miR92a-l*, hsa-miR-92a-2*, hsa-miR-92b, hsa-miR-92b*, hsa-miR-93, hsa-miR-93*, hsa -miR-933, hsa-miR-934, hsa-miR-935, hsa-miR-936, hsa-miR-937, hsa-miR-938, hsa-miR-939, hsa-miR940, hsa-miR-941 , hsa-miR-942, hsa-miR-943, hsa-miR-944, hsa-miR-95, hsa-miR-96, hsamiR-96*, hsa-miR-98, hsa-miR-99a, hsa- miR-99a*, hsa-miR-99b and hsa-miR-99b*.

miRNA inhibits the function of the mRNA it specifically targets and, as a result, inhibits the expression of polypeptides encoded by the mRNA. Thus, blocking (partially or completely) the activity of a miRNA (eg, miRNA silencing) can effectively induce or restore the expression of a polypeptide whose expression is inhibited (derepress the polypeptide). In accordance with one embodiment, derepression of polypeptides encoded by mRNA targets from miRNAs is accompanied by inhibition of miRNA activity in cells by any of a variety of methods. For example, blocking the activity of a miRNA may be accompanied by hybridization with a small interfering nucleic acid (eg, antisense oligonucleotide, miRNA sponge, TuD RNA) that is complementary or intrinsically complementary to the miRNA, thereby blocking the interaction of the miRNA with its target mRNA. As used herein, the term small interfering nucleic acid, which is essentially complementary to a miRNA, is a small interfering nucleic acid that is capable of hybridizing with a miRNA and blocking the activity of the miRNA. In some embodiments, the small interfering nucleic acid that is substantially complementary to the miRNA is a small interfering nucleic acid that is complementary to the miRNA in all but 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 16, 17 or 18 bases. In accordance with some embodiments, a small interfering nucleic acid sequence that is substantially complementary to a miRNA is a small interfering nucleic acid sequence that is complementary to the miRNA except for at least one base.

A miRNA inhibitor is an agent that blocks the function, expression and/or processing of miRNA. For example, these molecules include, but are not limited to, miRNA-specific antisense, miRNA sponges, tough decoy RNA (TuD RNA), and miRNA oligonucleotides (double-stranded, hairpin, short oligonucleotides) that inhibit miRNA interaction with the Drosha complex. MicroRNA inhibitors can be expressed in cells from rAAV vector transgenes as described above. MicroRNA sponges specifically inhibit miRNAs through complementary heptameric primer sequences (Ebert, M.S. Nature Methods, Epub August 12, 2007). In some embodiments, an entire miRNA family can be silenced using a single sponge sequence. TuD RNAs provide effective and long-lasting suppression of specific miRNAs in mammalian cells (see, for example, Takeshi Haraguchi, et al., Nucleic Acids Research, 2009, Vol. 37, No. 6 e43, the contents of which in connection with TuD RNA are included in this document by reference). Other methods of silencing miRNA function (derepressing miRNA targets) in cells will be apparent to one skilled in the art.

In some embodiments, the cloning ability of the recombinant RNA vector may limit the required coding sequence and may require complete replacement of the viral 4.8 kb. genome. Thus, in some cases, large genes may not be suitable for use in a standard recombinant AAV vector. One skilled in the art will appreciate that opportunities are available to overcome the limiting encoding capacity. For example, AAV ITRs of two genomes can hybridize to form head-to-tail concatemers, nearly doubling the vector's capacity. Insertion of splice sites promotes the removal of ITR from the transcript. Other possibilities for overcoming the limiting cloning ability will be apparent to one skilled in the art.

Somatic transgenic animal models generated by rAAV-based gene transfer

The present disclosure also relates to the generation of somatic transgenic animal models of disease using recombinant adeno-associated virus (rAAV) methods. The methods are based at least in part on the observation that AAV serotypes and variants thereof

- 31 044901 mediate efficient and stable gene transfer in a tissue-specific manner into the body of adult animals. The rAAV elements (capsid, promoter, transgene products) are combined to generate somatic transgenic animal models that express a stable transgene in a time- and tissue-specific manner.

Somatic transgenic animals produced by the methods of the present disclosure may serve as useful models of a disease, human pathological condition, and/or for characterizing a gene for which function (eg, tissue specificity, role in disease) is unknown or not fully understood. For example, an animal (eg, mouse) can be infected at a particular developmental stage (eg, age) with an rAAV containing a capsid that has the ability to target tissues (eg, liver, heart, pancreas) and a transgene having a tissue-specific promoter , directing the expression of a gene involved in a disease. When infected, rAAV infects specific cells of the target tissue and results in the formation of a transgene product.

In accordance with some embodiments, the sequence of the coding region of the transgene is modified. The modification may change the function of the product encoded by the transgene. The effect of the modification can then be studied in vivo by creating a somatic transgenic animal model using the methods disclosed herein. In some embodiments, the coding region sequence modification is a nonsense mutation that results in the formation of a fragment (eg, a truncated variant). In other cases, the modification is a missense mutation that results in an amino acid substitution. Other modifications are possible and will be apparent to one skilled in the art.

In accordance with some embodiments, the transgene causes a pathological condition. A transgene that causes a pathological condition is a gene whose product plays a role in the disease or disorder (eg, causes the disease or disorder, renders the animal susceptible to the disease or disorder) and/or can induce the disease or disorder in the animal. The animal can then be monitored to assess a number of aspects of the disease (eg, progression, response to treatment, etc.). These examples are not intended to be limiting; other aspects and examples are disclosed herein and are described in more detail below.

The present disclosure, in certain aspects, provides for somatic transgenic animal models by targeted killing of specific cell types. For example, models of type 1 diabetes mellitus can be obtained by targeted destruction of pancreatic beta islets. In other examples, targeted killing of specific cell types can be used to assess the role of specific cell types in human disease. In this regard, transgenes that encode cellular toxins (eg, diphtheria toxin A (DTA)) or proapoptotic genes (NTR, Box, etc.) may be useful as transgenes for functional ablation of specific cell types. Other exemplary transgenes whose products kill cells are provided by the methods disclosed herein and will be apparent to one skilled in the art.

The present disclosure, in certain aspects, provides methods for generating somatic transgenic animal models to study the long-term effects of gene overexpression or knockdown. Long-term overexpression or knockdown (e.g., by shRNA, miRNA, miRNA inhibitor, etc.) of genes in specific target tissues can disrupt the normal metabolic equilibrium and lead to the formation of a pathological condition, thereby leading to the formation of an animal model of a disease such as , for example, cancer. The present disclosure, in certain aspects, provides methods for generating somatic transgenic animal models to study the long-term effects of gene overexpression or knockdown of potential oncogenes or other genes to study tumorigenesis and gene function in target tissues. Suitable transgene products include proteins known to be associated with cancer and small interfering nucleic acids that inhibit the expression of such proteins.

Other suitable transgenes can be readily selected by one skilled in the art, provided they are suitable for creating animal models of a tissue-specific pathological condition and/or disease.

Methods of administration of recombinant AAVs.

rAAV can be delivered to a subject in compositions in accordance with any suitable methods known in the art. The rAAV, preferably suspended in a physiologically compatible vehicle (e.g., a composition), can be administered to a subject, e.g., an animal host such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or non-human primate (such as macaque). In accordance with some embodiments, the host animal does not include a human.

Delivery of rAAV to a mammalian subject may occur, for example, by intramuscular injection or by administration into the bloodstream of the mammalian subject.

- 32 044901

Introduction into the bloodstream can occur by injection into a vein, artery or any other vascular channel. In some embodiments, rAAV is introduced into the bloodstream by isolated limb perfusion, a technique well known in the surgical field, wherein the method allows one skilled in the art to isolate the limb from the systemic circulation prior to administration of rAAV virions. A variant of the isolated limb perfusion technique described in US Pat. No. 6,177,403 can also be used by one skilled in the art to introduce virions into the vasculature of an isolated limb to potentially enhance transduction into muscle cells or tissue. Additionally, in certain examples, it may be desirable to deliver virions to the CNS of a subject. The CNS refers to all the cells and tissue of the brain and spinal cord of a vertebrate. Thus, the term includes, without limitation, neurons, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone tissue, cartilage tissue, and the like. Recombinant AAVs can be delivered directly to the CNS or brain by injection into, for example, the ventricular region, as well as into the striatal region (eg, caudate nucleus or striatal putamen), spinal cord and neuromuscular junction, or cerebellar lobule, using a needle , catheter or related device, using neurosurgical techniques known in the art, such as stereotactic injection (see, for example, Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428 -3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000).

The compositions of the present disclosure may contain rAAV alone or in combination with one or more viruses (eg, a second rAAV encoding one or more other transgenes). In accordance with some embodiments, the composition contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAVs, each of which has one or more different transgenes.

Suitable carriers can be easily selected by one skilled in the art in terms of the indication to which the rAAV is directed. For example, one suitable carrier includes a saline solution, which can be formulated with a number of buffer solutions (eg, phosphate saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil and water. The choice of media is not limited by the present disclosure.

Optionally, the compositions of the present disclosure may contain, in addition to rAAV and carrier(s), other standard pharmaceutical ingredients, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethylvanillin, glycerin, phenol and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

rAAV is administered in sufficient quantities to transfect cells of the desired tissue and to ensure sufficient levels of gene transfer and expression without unnecessary side effects. Standard and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the target organ (eg, intraportal delivery to the liver), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, and other parenteral routes of administration. Routes of administration, if necessary, can be combined.

The dose of rAAV virions required to achieve a given therapeutic effect, e.g., dose units in genomic copies/kg body weight (GC/kg), will vary depending on several factors, including, but not limited to, the route of administration of the rAAV virions, the level of gene expression, or RNA required to achieve a therapeutic effect, the specific disease or disorder being treated, and the stability of the gene product or RNA product. One skilled in the art can readily determine the dose range of rAAV virions for treating a patient having a particular disease or disorder based on the above factors as well as other factors that are well known in the art.

An effective amount of rAAV is an amount sufficient to specifically infect an animal, targeting the desired tissue. In accordance with some embodiments, an effective amount of rAAV is an amount sufficient to produce a stable somatic transgenic animal model. The effective amount will depend primarily on factors such as the species, age, weight, health status of the subject and the tissue being targeted, and thus may vary between animals or tissues. For example, an effective amount of rAAV will typically range from about 1 ml to about 100 ml of solution containing from about 10 ⁹ to 10 ¹⁶ genomic copies. In some embodiments, rAAV is administered at a dose of 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , or 10 ¹⁵ genomic copies per subject. In some embodiments, rAAV is administered at a dose of 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ or 10 ¹⁴ genomic copies per kg. In some cases, a dose of between approximately 10 ¹¹ to 10 ¹² rAAV genomic copies is appropriate. IN

- 33044901 In certain embodiments, a dose of 10 ¹² genomic copies of rAAV is considered effective for targeting heart, liver, and pancreatic tissue. In some cases, stable transgenic animals are obtained by administering multiple doses of rAAV.

In accordance with some embodiments, rAAV compositions are formulated to reduce aggregation of AAV particles in the composition, particularly if high concentrations of rAAV are present (eg, ~10 ¹³ GC/ml or more). Methods for reducing rAAV aggregation are well known in the art and include, for example, adding surfactants, adjusting pH, adjusting salt concentration, etc.; (See, for example, Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the contents of which are incorporated herein by reference).

The composition of pharmaceutically acceptable excipients and carrier solutions is well known to those skilled in the art, and the development of suitable dosage and treatment regimens for the use of certain compositions is described herein in a number of treatment regimens.

Typically, these formulations may contain at least about 0.1% active compound or more, although the percentage of active ingredient(s) may of course vary and may conveniently range from about 1 or 2% to about 70 % or 80% or more of the weight or volume of the entire composition. Naturally, the amount of active compound in each therapeutically useful composition can be prepared so that a suitable dose is obtained in any particular unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, shelf life of the product, as well as other pharmacological aspects will be considered by one skilled in the art of preparing such pharmaceutical formulations, and thus a range of dosages and treatment regimens may be desirable.

In accordance with certain circumstances, it will be desirable to deliver rAAV therapeutic constructs in suitably formulated pharmaceutical compositions disclosed herein subcutaneously, intrapancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally or orally, intraperitoneally or by inhalation. In accordance with some embodiments, methods of administration described in US patents. No. 5543158; 5641515 and 5399363 (each of which is specifically incorporated herein by reference in its entirety) can be used to deliver rAAV. In accordance with some embodiments, the preferred route of administration is portal vein injection.

Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerin, liquid polyethylene glycols and mixtures thereof, and in oils. Under normal conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases the form is sterile and liquid to the extent that there is easy passage through a needle. It must be stable under the conditions of production and storage and must be protected from the contaminating action of microorganisms such as bacteria and fungi. The carrier may also be a solution or dispersion medium containing, for example, water, ethanol, polyol (eg glycerin, propylene glycol and liquid polyethylene glycol, etc.), suitable mixtures thereof and/or vegetable oils. Suitable fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of a dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be carried out using various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents such as sugars or sodium chloride. Prolonged absorption of injectable compositions can be achieved by using agents in the composition that delay absorption, such as aluminum monostearate and gelatin.

In the case of administering aqueous injection solutions, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, the sterile aqueous medium that can be used will be known to those skilled in the art. For example, one dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of hypodermolysis fluid or administered to the intended site by infusion (see, for example, Remington's Pharmaceutical Sciences ^15th Edition, pages 1035-1038 and 1570-1580 ). Some dose variation will occur in some manner depending on the condition of the host. The person responsible for administration will in any case determine the appropriate dose for the individual host.

Sterile injection solutions are prepared by incorporating the active rAAV in the required amount into a suitable diluent with various other ingredients listed in this

- 34 044901 document, if necessary, followed by sterilization by filtration. Typically, dispersions are prepared by incorporating various sterilized active ingredients into a sterile base that contains the basic dispersion medium and other required ingredients listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred preparation methods are vacuum drying and freeze drying techniques, which result in the formation of a powder of the active ingredient together with any additional required ingredient from its pre-sterilized solution by filtration.

The rAAV compositions disclosed herein may also be formulated in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed using the free amino groups of a protein) which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, oxalic, tartaric, mandelic, and the like. . Salts formed by free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or iron hydroxides, and organic bases such as isopropylamine, trimethylamine, histidine, procaine and the like. Once formulated, the solutions will be administered in a manner compatible with the dosage form and in quantities that are therapeutically effective. The compositions are easily administered in several dosage forms, such as injection solutions, drug-releasing capsules, and the like.

As used herein, the term carrier includes any and all solvents, dispersants, bases, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption retarding agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and means for pharmaceutical active substances is well known in the art. Additional active ingredients may also be included in the compositions. The phrase pharmaceutically acceptable refers to molecular structures and compositions that do not cause an allergic or similar adverse reaction when administered to a host.

Delivery vehicles such as liposomes, nanocapsules, microcapsules, microspheres, lipid particles, vesicles, and the like can be used to deliver the compositions of the present disclosure into the cells of a suitable host. In particular, the transgenes delivered by the rAAV vector can be formulated for delivery encapsulated in a lipid particle, liposome, vesicle, nanosphere or nanoparticle, and the like.

Such formulations may be preferred for administering the pharmaceutically acceptable nucleic acid compositions or rAAV constructs disclosed herein. The preparation and use of liposomes is well known to those skilled in the art. Liposomes with increased serum stability and increased blood half-life have recently been developed (US Patent No. 5,741,516). In addition, various methods for preparing liposomes and liposome-like preparations as potential drug carriers have been described (US Patent Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).

Liposomes have been successfully used in a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes do not contain the DNA length restrictions that are typical of viral-based delivery systems. Liposomes have been effectively used to introduce genes, drugs, radiotherapies, viruses, transcription factors, and allosteric effectors into several cultured cell lines and animal organisms. In addition, several successful clinical studies have been completed that examined the effectiveness of liposome-based drug delivery.

Liposomes are formed from phospholipids that are dispersed in an aqueous environment and spontaneously form multilayered concentric bilayer vesicles (also called multilayer vesicles (MLV). MLVs typically have diameters ranging from 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles ( SUV) with diameters ranging from 200 to 500 angstroms containing an aqueous solution in the cortex.

Alternatively, nanocapsular formulations of rAAV may be used. Nanocapsules can generally entrap substances in a stable and reproducible manner. To avoid side effects due to intracellular polymer overload, such ultrafine particles (about 0.1 μm in size) must be engineered with polymers that can degrade in vivo. Biodegradable polyalkyl cyanoacrylate nanoparticles are available for use that meet these requirements.

In addition to the delivery methods described above, the following techniques are provided as alternative methods for delivering rAAV compositions to the host. Sonophoresis (i.e., ultrasound) has been used and described in US Pat. No. 5,656,016 as a device to enhance the rate and efficiency of drug penetration into and through the circulatory system. Other drug delivery alternatives include intraosseous injection (US Patent No. 5779708), microarray devices (US Patent No. 5797898), ophthalmic formulations (Bourlais et

- 35 044901 al., 1998), transdermal matrices (US patent No. 5770219 and 5783208) and feedback controlled delivery (US patent No. 5697899).

Sets and related compositions.

The agents described herein, in accordance with some embodiments, can be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. The kit may include one or more containers containing the components of the present disclosure and instructions for use. In particular, such kits may contain one or more of the products described herein, together with instructions describing the intended use and proper use of these products. In accordance with certain embodiments, the agents in the kit may be in a pharmaceutical composition and dosage suitable for the particular application and route of administration of the agents. Kits for research purposes may contain components in appropriate concentrations or quantities to perform various experiments.

The kit may be designed to facilitate researchers in applying the methods described herein and may take various forms. Each of the compositions in the kit may, if desired, be provided in liquid form (eg, solution) or solid form (eg, dry powder). In certain cases, some of the compositions may be formulated or otherwise processed (eg, to the active form), for example, by adding a suitable solvent or other molecules (eg, water or cell culture medium), which may or may not be provided in the set. As used herein, the term instructions may refer to instructions and/or promotional material, and typically include written instructions on or in connection with the packaging of this disclosure. The instructions may also contain any oral or electronic instructions presented in such a way that the user readily recognizes that the instructions involve communication with the kit, for example, as a result of audiovisual (e.g., videotape, DVD, etc.), Internet and/or web information, etc. .d. Written instructions may be in the form prescribed by government agencies that regulate the manufacture, use, or sale of pharmaceuticals or biologicals, the instructions for which may also reflect government approval of the manufacture, use, or sale for administration to animals.

The kit may contain any one or more of the components described herein in one or more containers. As an example, in accordance with one embodiment, a kit may contain instructions for mixing one or more components of the kit and/or isolating or mixing a sample or administering it to a subject. The kit may include a container containing the tools described herein. The products may be in the form of a liquid, gel or solid (powder). Products can be prepared sterilely, packaged in a syringe and shipped frozen. Alternatively, it may be contained in a vial or other storage container. The second container may contain other products prepared in a sterile manner. Alternatively, the kit may contain the active agents pre-mixed and delivered in a syringe, vial, tube or other container. The kit may contain one or more of all the components required to administer agents to an animal, such as a syringe, topical products, or an intravenous infusion system, especially in the case of kits for the production of specific somatic animal models.

The kit may take several forms, such as a blister pack, cellophane pack, sealed pack, sealed thermoform tray or similar pack or tray form, with the auxiliaries loosely packaged in a pack, one or more tubes, containers, box or bag. The kit can be sterilized after the auxiliaries have been added, thereby ensuring that the individual auxiliaries in the container are otherwise unpacked. The kit can be sterilized using any suitable sterilization techniques, such as irradiation sterilization, heat sterilization, or other sterilization methods known in the art. The kit may also contain other components, depending on the specific application, for example, containers, cell culture media, salts, buffers, reagents, syringes, needles, cloth such as gauze for applying or removing disinfectant, disposable gloves, liner for funds before administration, etc.

Instructions included in the kit may include methods for detecting latent AAV in a cell. In addition, kits of the present disclosure may contain instructions, negative and/or positive controls, containers, sample diluents and buffers, sample preparation tubes, and an AAV reference sequence table in printed or electronic form for sequence comparison.

- 36 044901

Examples

Example 1. Isolation of transcriptionally active new AAV capsid sequences with the necessary tissue tropisms and properties from human tissues.

This example describes novel AAV capsid sequences isolated through the following steps: 1) PCR amplification of wtAAV genomes present in normal and pathological human tissues; 2) high-throughput single-molecule real-time sequencing (SMRT) of PCR amplicon libraries; 3) identifying/profiling variants using bioinformatics analyses; and 4) selecting high-confidence ORFs that can be translated into full-length capsid proteins. Schematic representations of the processes used in this example are shown in FIG. 1A, 1B.

This approach exploited the natural pool of genomic diversity observed among viral genomes isolated from normal and tumor tissues. Conceptually, in vivo tissues act as natural incubators of viral diversity as a result of selective pressure and/or immunosurveillance evasion. Thus, methods that are capable of profiling the full spectrum of AAV variants found among tissues and organs of human origin are useful for detecting inter-, intra-tissue, and inter-patient variability.

PCR amplification of AAV genomes from human tissues.

To isolate different AAV variants with the potential to identify new serotypes with unique tropisms, 844 human surgical specimens from 455 patients were collected from West China Hospital, Sichuan University, Chengdu, China. These tissues included a wide range of tissue/organ types as well as various tumor types (Table 1). Specifically, AAV variants were identified from nine normal liver tissue samples, 7 liver tumor tissue samples, four enlarged prostate tissue samples, two normal lung tissue samples, one pancreatic tumor tissue sample, one breast cancer tissue sample, and one normal tissue sample. breast, one sample of cancerous stomach tissue, one sample of normal stomach tissue, one sample of brain tissue and one sample of glioma.

Total genomic DNA was extracted from human tissues and the AAV capsid sequence was PCR amplified. The primers for PNR used in this example are described in table. 2. Briefly, primers of all AAVs for 4.1 kb amplification. AAV rep-cap sequences (e.g. RepF318, AV2cas) or all AAV primers for 2.3 kb amplification. AAV cap sequences (e.g., CapF, CapR) were used for PCR.

Table 1

Clinical samples for wtAAV genome amplification

Organ Number of fabrics Normal tissue Tumor tissue Liver 100 101 Brain 4 50 Stomach 37 37 Lungs 100 100 Breast 52 57 Pancreas But. 45 Rectum 50 50 Prostate 34 But. B excretory system 3 12 Cervix 2 10 Sum 378 466

PCR primer sequences

table 2

Primer Sequence (5’-3’) SEQ ID NO: RepF318 GCCATGCGGGGTTCTACGAGAT 872 AV2cas ACAGGAGACCAAAGTTCAACTGAAACGA 873 CapF GACTGCATCTTTGAACAATAAATGA 874 CapR GAAACGAATTAACCGGTTTATTGATTAA 875

- 37 044901

High-throughput sequencing of AAV PCR products and bioinformatics analysis.

AAV PCR products were subjected to high-throughput single-molecule real-time (SMRT) sequencing. This approach eliminates the need to reconstruct the viral genome and predict chimeric organisms based on aligned short-read fragments obtained from other standard high-throughput genome sequencing techniques.

Using variant analysis pipelines developed from publicly available bioinformatics tools, more than 600 previously undescribed high-confidence variants in the AAV2, AAV2/3 hybrid, and AAV8 capsid sequences were identified. Specifically, 224 AAV8 variants (containing 1 to 10 variants with single amino acid differences) were identified; 425 AAV2 variants (containing from 1 to 20 variants with one amino acid difference); and 194 AAV2/3 hybrid variants (containing 10 to 50 variants with one amino acid difference). In table 3, 4 and 5 present unique variants of capsid proteins. For comparative purposes, the amino acid sequences of wild-type AAV2, AAV3 and AAV8 capsids are described in SEQ ID NOs: 869, 870 and 871, respectively. In fig. 7 is a scatterplot depicting the distribution of different AAV2 capsid variants and AAV2/3 variants containing one or more variants with a single amino acid difference.

Table 3 Unique AAV2 and AAV2/3 hybrid variants (amino acid sequences) identified by SMRT sequencing and bioinformatics analysis

Unique options AAV2 Sample source Patient no. DNA size (vol.) Unique options (a.k.) SEQ Ш NO: Total unique variants (a.k.) Liver 7927N 2.3 then. (cap) 85 325-409 409 Liver tumor 37NSS 3 322-324 Breast 18V 26 118-143 Mammary cancer 19V 21 211-231 Lungs 18L 55 144-198 Prostate 5 24 1-24 17 12 106-117 18 12 199-210 27 90 232-321 Pancreas cancer 10 81 25-105 Liver 1178N 4.1 then. (ger+sar) 4 410-414; 837840 16 9955N 3 429-434; 850852 Liver tumor 9955С 9 415-428; 841849 Unique AAV2/3 variants Sample source Patient no. DNA size (vol.) Unique options (a.k.) Total unique variants (a.k.) Liver 42 2.3 then. (cap) 6 512-517 194 74 eleven 543-553 Liver tumor 37NSS 6 506-511 65 4 539-542 7449С 15 554-568 Breast 18V 23 435-457 Mammary cancer 19V 44 462-505 Prostate 5 60 569-628 17 18 4 458-461 Stomach cancer 17G But. (420 in DNA) - Stomach 50G 21 518-538

- 38 044901

DNA sequences are presented for 4.1 kb. libraries.

Table 4

Unique AAV8 variants (amino acid sequences) identified using SMRT sequencing and bioinformatics analysis

Sample source Patient no. DNA size (i.e.) Have unique options (a.k.) SEQ GO NO: Total unique variants (a.k.) Liver 0067N 2.3 t.o. (cap) 12 647-658 208 3522N 73 674-746 5110N 3 747-749 7427N 6 750-755 Liver tumor 0067C 9 638-646 7803С 9 756-764 8818С 63 765-827 Brain G5 9 828-836 Glioma 2236 14 659-672 Lungs 24 10 629-637; 673

Table 5

Additional AAV8 variant capsid proteins

Variant name AAV8 SEQ GO NO: IN 1 853 AT 2 854 VZ 855 AT 4 856 AT 12 857 B18 858 B24 859 B41 860 B44 861 B45 862 B46 863 B60 864 B61 865 B62 866 B63 867 B64 868

Example 2: Identification of AAV8 variants with improved in vivo tropism.

A subset of candidate AAV8 variants (eg, B2, B3, B44, and B61) were cloned into AAV packaging vectors using standard molecular cloning techniques and packaged with luciferase reporter genes driven by the CB6 promoter. The resulting vectors were injected into mice and in vivo luciferase trasgene expression levels were analyzed by whole animal imaging and luminescence quantification. It was observed that variants B2 (SEQ ID NO: 854) and B3 (SEQ ID NO: 855) had higher expression in the liver after intramuscular injection (Fig. 2A-2D), while after IV injection in neonatal mice, the variant B61 (SEQ ID NO: 865) had higher transduction efficiencies in the brain and spinal cord compared to AAV9 (FIGS. 3A, 3B). This was notable because wild-type AAV8 was observed to cross the blood-brain barrier less than AAV9. One AAV8 variant, B44 (SEQ ID NO: 861) had a higher ability to be transduced into the liver after IM injection compared to AAV8 (Fig. 4A, 4B).

- 39 044901

Phylogenetic analysis was performed to compare AAV8 capsid variants B2, B3, B44, and B61 compared with other AAV serotypes. Briefly, amino acid sequences of AAV8 variants were aligned with other published AAV sequences using ClustalW and phylogenetic trees were obtained using the minimum evolution method in MEGA6.06. The results of bioinformatics analysis indicated that the sequences B2, B3, B44 and B61 were associated with clade E capsid proteins [AAV8] (Fig. 5). Exemplary amino acid substitutions in AAV8 variants are shown in table. 6.

Table 6

Exemplary amino acid substitutions in AAV8 variants relative to wild-type AAV8 variants

Option AAV Illustrative substitutions (relative to wtAAV8) AT 2 E63G VZ K259R B44 L91Q, Т234А, М374Т B61 М374Т, M561V

Example 3. In vitro assessment of rAAV genome packaging efficiency and initial characterization of candidate capsid variants.

Molecular cloning of packaged plasmid constructs containing selected AAV capsid variants.

AAV2 and AAV2/3 fusion capsid variants identified by SMRT sequencing were cloned into packaging plasmids to replace standard viral capsid genes by standard molecular cloning strategies (e.g., site-directed mutagenesis of the original AAV2 or AAV2/3 capsid expression plasmids, cloning into based on PCR and Gibson assembly, or synthesized with the involvement of third parties). In fig. Figure 8 shows vector constructs to be used in multiplex screening of detected capsid variants. A summary of the proposed transgene cassettes to be used for various diagnostic strategies is shown in Table. 7.

Table 7

Transgene cassettes for various diagnostic strategies

Promoter Transgene Reporter/therapeutic gene analysis Chicken CMV β-Actin enhancer EGFP Efficiency of tissue-specific or cell type-specific transduction Chicken CMV β-Actin enhancer Luciferase Whole animal tropism profiling and individual tissue quantification Serum lobulin, which binds thyroxine Factor IX Liver-specific transduction of secreted factors. Preclinical study

Multiplex assessment of packaging efficiency using high-throughput, small-scale vector production and titration of vector genomes.

Quantification of rAAV vector genomes in crude lysate was used to directly examine the packaging efficiency of rAAV variants in first-generation (single-stranded AAV) and second-generation (self-complementary AAV) vectors immediately after triple transfection

- 40 044901 HEK293 packaging cells. This provides a streamlined alternative to implementing a complete workflow to produce vectors on a small scale, followed by silver staining and titration of vector genomes using standard PCR to assess the quality of viruses for all variants detected. Because this method can be represented in 96-well formats, it is used to quickly identify variants that form saturated vectors.

Serological assessment of new AAV variants.

High packaging efficiency candidates were screened for antibody cross-reactivity to actual AAVs using standard means, such as capsid immunoassays to screen novel rAAVs against sera from AAV-immunized rabbits. In addition, human pooled IgG (IVIG) neutralization assays were performed for each candidate variant to determine the possibility of pre-existing humoral immunity in the human population.

Example 4: In vivo assays of rAAV2 and rAAV2/3 variants to study vector transduction biology, prevalence of pathotoxicity, tissue/organ tropism, and biodistribution profiles.

Mouse studies.

Candidate capsid variants were grouped based on tissue distribution and prioritized based on organs of interest. Groups of candidate variants were cluster-indexed (Fig. 6A), whereby multiple packaging plasmids expressing candidate capsid variants were mixed and expressed to uniquely package DNA barcoded transgenes by triple transfection (e.g., coagulation factor IX F9 (F. IX), to assess liver targeting and efficiency of expression of secreted factors; EGFP, to assess biodistribution and extent of tissue-specific transduction by organ/tissue sectioning and comparative immunofluorescence microscopic analysis; or luciferase (Luc), to assess the quality of transduction in the CNS and liver by visualizing a living animal.

For studies that assessed the ability of rAAV variants to target the liver in relation to transgene expression and secretion, rAAV constructs containing the liver-specific serum thyroxine-binding globulin (TGB) promoter were developed. For studies that profiled vector transduction in the whole animal, constructs containing a regulatory cassette based on the CMV enhancer of the chicken β-actin promoter (CB6) were developed.

Vectors encapsulating the indexed transgenes were injected into adult and neonatal mice via different routes of administration and screened for F.IX expression, EGFP expression, and Luc expression in 1-month longitudinal studies to profile transgene expression mediated by AAV variants. Routes of administration for the CNS/brain included peripheral intravascular (IV, for blood-brain barrier transduction studies), intracerebroventricular (ICV), intraparenchymal, and intrathecal. Introduction into the retina was carried out using a subretinal injection. In some embodiments, the IV injections also specifically target the liver.

Animals that exhibited unique transgene expression compared to control animals (eg, transgenes delivered by AAV2, AAV2/3, or AAV8) were sacrificed and organs were harvested. Individual organs were analyzed for the presence and abundance of barcoded transgenes using standard PCR amplification of crude DNA extracts or cDNA libraries containing the transgene sequence, followed by Illumina sequencing to track barcoded transgenes enriched in each tissue. In fig. Figure 9 presents a general strategy for developing transgene indexing. The prevalence and tissue/organ distribution of barcoded transgenes to be detected reflects the tropism and transduction efficiency of candidate rAAV variants from each group. Highly efficient candidate groups with the required vector properties were selected.

Individual candidate variants from the selected groups were used to package barcoded transgenes for a second round of screening to identify individual high-impact variants. Cluster indexing could be performed iteratively over multiple rounds of hierarchical selection to reduce workload.

Studies in non-human primates (NHP).

Candidate rAAV variants were screened for biodistribution in non-human primates by a modality similar to the cluster-indexing technique outlined in the mouse studies (Fig. 6B). Transduction efficiencies to target organs by different routes of administration were re-evaluated in NHPs to validate rAAV variant profiles observed in mouse precursor event studies.

Immunogenicity, prevalence of neutralizing antibodies in human populations, potential for genotoxicity, and general aspects of pathogenicity were measured in addition to primary assessments, such as histopathological examination of multiple tissues and organs to closely examine T cell or neutrophil infiltrates, monitoring hepatotoxicity through activity ALT/AST and inflammation assays from histological sections with transduction profiles in non-human primates (NHPs).

Example 5: Isolation of new AAV capsid sequences.

Additional AAV capsid sequences were isolated. Using bioinformatics-based variant analysis streams, an additional 263 previously undescribed high-confidence variants of AAV2 and AAV2/3 hybrid capsid sequences were identified. For purposes of comparison, the amino acid sequences of wild-type AAV2 and AAV3 capsids are described in SEQ ID NO: 869 and 870, respectively.

Table 8

Additional unique AAV2 and AAV2/3 hybrid variants (amino acid sequences) identified by SMRT sequencing and bioinformatics analysis

Unique AAV2 variants Sample source DNA size (vol.) Unique options (a.k.) SEQ Ш NO (a.k.): Total unique variants (a.k.) Mammary cancer 2.2 t.o. 8 1726-1733 89 Stomach tumor 15 1734-1748 Glioma 2 1749-1750 Liver 25 1751-1775 Liver tumor 36 1776-1811 Lung tumor 3 1812-1814 Unique AAV2/3 variants Sample source DNA size (vol.) Unique options (a.k.) Total unique variants (a.k.) Mammary cancer 2.2 t.o. 18 1815-1832 174 Stomach 17 1833-1849 Liver 117 1850-1966 Liver tumor 22 1967-1988

Corresponding DNA sequences are provided for all libraries. The nucleic acid sequences for AAV2 capsid variants correspond to SEQ ID NO: 1989-2077. The nucleic acid sequences for AAV2/3 capsid variants correspond to SEQ ID NO: 2078-2251.

The present disclosure is not limited in its application to the details of design and arrangement of components set forth herein or illustrated in the drawings. The present disclosure may be implemented in accordance with other embodiments and may be practiced or carried out in various ways. In addition, phraseology and terminology used herein are provided for descriptive purposes only and should not be construed as limitation. The use of the phrases including, containing or having, containing and including, and variations thereof, in this document is intended to include the clauses listed below and their equivalents, as well as additional clauses.

Thus, while describing several aspects of at least one embodiment of the present disclosure, those skilled in the art will understand that various changes, modifications, and improvements will be readily made. Such changes, modifications and improvements are intended to form part of this disclosure and are within the spirit and scope of this disclosure. Accordingly, the foregoing description and drawings are presented for purposes of example only.

Claims (12)

1. A recombinant expression vector containing a nucleic acid encoding a polypeptide having a sequence selected from the group consisting of SEQ ID NOs: 66, 25-65 and 67-105. 2. The recombinant expression vector according to claim 1, wherein the polypeptide has the sequence SEQ ID NO: 66. 3. An isolated AAV capsid protein comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 66, 25-65 and 67-105. 4. The isolated AAV capsid protein according to claim 3, wherein said protein contains the sequence - 42 044901 item SEQ ID NO: 66. 5. Recombinant AAV (rAAV) containing the isolated AAV capsid protein according to claim 3 or 4. 6. A method of delivering a transgene to a subject, comprising administering the rAAV of claim 5 to the subject, wherein the rAAV contains at least one transgene and wherein the rAAV infects cells of a target tissue of the subject. 7. The method of claim 6, wherein the transgene is a gene encoding a protein or small interfering nucleic acid, wherein optionally the small interfering nucleic acid is a miRNA sponge or TuD RNA that inhibits the activity of at least one miRNA in the subject or animal . 8. The method according to claim 7, wherein the miRNA is expressed in the cell of the target tissue. 9. The method according to any one of claims 6 to 8, wherein the rAAV is administered intravenously, transdermally, intraocularly, intrathecally, orally, intramuscularly, subcutaneously, intranasally or by inhalation. 10. The method according to any one of claims 6 to 9, wherein the subject is selected from mouse, rat, rabbit, dog, cat, sheep, pig, non-human primate and human. 11. A kit for producing rAAV, wherein the kit contains a container containing an isolated nucleic acid encoding a polypeptide having the sequence of any of SEQ ID NO: 66, 25-65 and 67-105; optionally further comprising instructions for producing rAAV and/or at least one container containing a recombinant AAV vector, wherein the recombinant AAV vector contains a transgene. 12. The recombinant expression vector of claim 1 or the isolated AAV capsid protein of claim 3 or 4, wherein the capsid protein is a VP1 capsid protein, a VP2 capsid protein, or a VP3 capsid protein. 1" 2 single-molecule real-time sequencing "Barcoding" Library production using PCR with ' PacBio SMRT sequencing and bioinformatics studies 12330456789 rh8 gMO O rh43 2/3 from a pool of samples with a small number of cycles