EA044826B1 - MODULATION OF CILIOGENESIS - Google Patents

Description

Field of technology to which the invention relates

The invention relates to the formation of cilia (ciliogenesis) in cells. Compounds, compositions, uses, medicaments and methods are provided for modulating ciliogenesis, preventing and/or treating diseases associated with it.

State of the art

The protein, designated R2R1 and belonging to the FAM25 family of proteins, is essential for the maintenance and regeneration of the lung epithelium, in particular the basal cell program. This function was discovered in experiments with primary bronchial epithelial cells (PBECs) cultured by submerged culture. Under deep culture conditions, rapid cellular growth of undifferentiated PBECs is characteristic. Therefore, such conditions for cell culture are excellent for studying basal cells - stem cells of the epithelium of the human airways (bronchi and lungs).

Loss of cilia-bearing cells leads to insufficient clearance of mucus and airways, particularly in patients with chronic obstructive pulmonary disease (COPD). Actually, this symptom is characteristic of COPD: pathologically altered epithelium (lack of ciliated cells, squamous differentiation and basal cell hyperplasia) is not able to clear the airways of mucus, bacteria, viruses and dirt. Ineffectiveness of the cleansing mechanism leads to serious symptoms such as cough, bronchial and lung infections and insufficient gas exchange in the lungs, resulting in increased mortality rates.

The purpose of this invention is to provide compounds, compositions, drugs and methods for exploiting the role of the R2R1 protein in ciliogenesis to provide treatment for related disorders and diseases.

Disclosure of the Invention

This invention stems from the discovery of compounds capable of binding to (or interacting with) and/or modulating complexes involved in chromatin binding/remodeling (e.g., Polycomb group PRC1 and Trithorax group MLL), which can be used to modulate ciliogenesis (e.g. turning on/off its mechanism), which can occur, for example, in the epithelium of the lungs and bronchi in humans.

Specifically, the gene designated R2R1 (respiratory cell regenerative gene 1) encodes a protein identified as binding to components of Polycomb repressor complex 1 (PRC1) and a Trithorax group MLL (TrxG-MLL). The PRC1 complex consists of a number of convoluted Polycomb group (PcG) proteins. The TrxG-MLL complex (also called COMPASS-like complex) consists of a number of specific Trithorax group (TrxG) proteins. The interaction of the R2R1 protein and the PRC1/trxG-MLL complexes or PcG or TrxG proteins leads to the modulation of ciliogenesis in human bronchial epithelial cells.

A first aspect of the present invention provides compounds that bind, associate or interact with complexes involved in chromatin binding/remodeling for use in the treatment and/or prevention of diseases and/or conditions involving abnormal or defective ciliogenesis.

Also proposed is the use of compounds that bind, associate or interact with complexes involved in chromatin binding/remodeling in the manufacture of medicaments for the treatment and/or prevention of diseases and/or conditions associated with abnormal or defective ciliogenesis.

Also provided is a method of treating and/or preventing diseases and/or conditions accompanied by abnormal or defective ciliogenesis, comprising the step of administering to the individual in need a therapeutically effective amount of a compound that binds, associates or interacts with complexes involved in chromatin binding/remodeling. PRC1-type complexes compact chromatin and suppress its remodeling. Likewise, the MLL complex of the Trithorax group (TrxG-MLL) is involved in chromatin binding/remodeling.

Thus, in another aspect of the present invention there are provided compounds that bind, associate or interact with PRC1 and/or TrxG-MLL for use in the treatment and/or prevention of diseases and/or conditions involving abnormal or defective ciliogenesis.

Another aspect of the present invention provides the use of compounds that bind, associate or interact with PRC1 and/or TrxG-MLL in the manufacture of medicaments for the treatment and/or prevention of diseases and/or conditions associated with abnormal or defective ciliogenesis.

The present invention also provides a method of treating and/or preventing diseases and/or conditions involving abnormal or defective ciliogenesis, comprising the step of administering to that individual in need a therapeutically effective amount of a compound that binds, associates or interacts with PRC1 and/or TrxG-MLL.

Without going into theoretical considerations and taking into account what is explained in more detail below, we can say that the authors of this invention have discovered the ability of the R2R1 protein to bind or associate/interact with components (for example, with proteins or peptide components) of complexes involved in binding/ chromatin remodeling, including, for example, with the PRC1 and TrxG-MLL complexes; in this case, the R2R1 protein can act as an on/off switch for ciliogenesis in the bronchial epithelium in humans. Accordingly, compounds that modulate or mimic the expression, function and/or activity of R2R1 can be used as a means of modulating (e.g., restoring, enhancing or suppressing - in other words, turning on/off) ciliogenesis in cells and/or as a basis for treatment diseases, conditions and/or syndromes caused or caused by abnormal or defective ciliogenesis. It is possible that compounds that modulate or mimic R2R1 expression, function and/or activity bind or otherwise associate with R2R1 protein binding sites that are present in complexes involved in chromatin binding/remodeling, including PRC1 complexes /TrxG-MLL or in some (or certain) components thereof. The consequence of binding or association with R2R1 binding sites in PRC1/TrxG-MLL complexes or their components may be the modulation of ciliogenesis in cells. Thus, compounds that bind and/or associate with the R2R1 binding sites in these complexes (for example, the R2R1 binding sites in the RC1/TrxG-MLL complexes) can be used to modulate ciliogenesis and/or in the treatment and/or prevention of diseases. conditions and/or syndromes caused by, or conditioned by, or accompanied by abnormal or defective ciliogenesis.

In light of the above, this invention relates to compounds for use (capable of binding, associating or interacting with complexes involved in chromatin binding/remodeling, PRC1, TrxG-MLL, and/or R2R1 binding sites therein), compositions for use ( containing one or more compounds capable of binding, associating or interacting with complexes involved in chromatin binding/remodeling, PRC1, TrxG-MLL, and/or R2R1 binding sites present therein), the use of compositions/medicines containing compounds capable of binding , associate or interact with complexes involved in chromatin binding/remodeling, PRC1, TrxG-MLL, and/or with R2R1 binding sites present therein, and methods of using these compounds/compositions/medicines. In addition, this compound relates to compounds (for use), compositions (for use), medicaments (for use) and methods of use of compounds that mimic or modulate the expression, function and/or activity of R2R1. Compounds that mimic the functions of R2R1 may exhibit one or more of the properties and/or functions of the wild-type R2R1 protein. For example, a compound that mimics R2R1 may bind or associate with PRC1, TrxG-MLL, or a component or subunit thereof. R2R1 mimic compounds may, for example, bind or associate with complexes involved in chromatin binding/remodeling, PRC1, TrxG-Mll, or their components through R2R1 binding sites - in other words, R2R1 mimic compounds may bind or associate/interact with binding sites for R2R1 complexes involved in chromatin binding/remodeling, PRC1 and/or TrxG-Mll. Compounds that modulate the expression, function and/or activity of R2R1 can enhance or inhibit its expression, function and/or activity. Compounds for use in this invention may interfere with the binding of, prevent the binding of, or inhibit the binding of native R2R1 or wild-type R2R1 to PRC1TrxG-MLL and/or components or subunits thereof.

As used herein, the terms compounds, compositions, uses, drugs/drugs, and methods are used in connection with these aspects and embodiments of the invention. Further in this description, the designations PRC1 and TrxG-Mll are used - they refer to non-limiting examples of complexes involved in chromatin binding/remodeling.

It will be appreciated that in this specification, the word containing is used to refer to those aspects and embodiments of the present invention that contain a particular feature or features. However, it should be noted that the word comprising also refers to aspects and/or embodiments of the present invention consisting of or consisting primarily of the feature or features in question.

Polycomb repressor complex 1 (PRC1) is a multiprotein complex, and compounds used in various aspects and embodiments of this invention (namely, applications, compositions, drugs and methods) include those compounds that bind or associate with one or more subunits of PRC1 or with any R2R1 binding site within the complex. It is known that in the PRC1 complex there is an exchange of its components, so that there are canonical and non-canonical PRC1 complexes. The effects of PRC1 on chromatin (histone H2A ubiquitinylation, PRC2 recruitment, and promotion of PRC2 in its repressor form) are determined by its various protein components. Note, however, that the RNF2 (RING finger protein 2/RING domain-containing protein 2) subunit of the PRC1 complex is always present. In the context of the present invention, a compound capable of binding to the RNF2 subunit of the PRC1 complex may be used in various compositions, applications, formulations and methods. The target of a compound capable of binding or associating with RNF2 may be the R2R1 binding site.

Compounds used in various aspects and embodiments of this invention (namely, applications, compositions, drugs and methods) include those compounds that bind or associate with the chromatin modifying component TrxG-MLL (from Trithorax group - Mixed lineage leukemia)) . Unlike PRC1, TrxG-MLL mediates active gene expression through H3K4 methylation. In fact, the functions of TrxG-MLL and PRC1 are complementary: PRC1 mediates repressor chromatin modifications and, accordingly, is in mutual opposition with the TrxG-MLL complex, which regulates chromatin modifications necessary for transcriptional activation. The TrxG-MLL complex has a core structure, which in turn contains a number of protein subunits, including, for example, proteins designated DPY-30 and ASH2L. These two proteins are always present in various TrxG-MLL complexes and are important for the (tri)methylation activity of TrxGMLL on histone H3 Lys-4. The compounds of this invention can bind or associate with the TrxG-MLL complex through the DPY-30 and/or ASH2L components. In other words, the compounds used in this invention bind or associate with DPY-30 and/or ASH2L. Compounds capable of binding or associating with the DPY-30 and/or ASH2L components may target R2R1 binding sites on one or the other (or both) of these components.

Compounds useful in various aspects and embodiments of this invention (namely, applications, compositions, drugs and methods) also include compounds that are bound by the SF3B2 protein, a component of non-canonical PRC1 complexes. In the context of this invention, a compound capable of binding to the SF3B2 subunit of the PRC1 complex may be used in various compositions, applications, formulations and methods. The target of a compound that specifically binds to the R2R1 binding site of the SF3B2 subunit of the PRC1 complex may be the R2R1 binding site present in it.

The compounds used in various aspects of the present invention (compounds that bind or associate with the PRC1 and TrxG-MLL complexes, including their components, subunits and/or R2R1 binding sites, may be nucleic acids (nucleic acid molecules - RNA, DNA and/or or synthetic/artificial forms), antisense oligonucleotides, carbohydrates, proteins, peptides, low molecular weight compounds, antibodies (including their fragments that bind an antigen or target).

Nucleic acid molecules (polynucleotides) used in this invention as expression agents or encoding R2R1 protein/peptides that (i) bind to any of the complexes described above, (ii) bind to any R2R1 binding site present therein, or ( iii) themselves modulate the function, expression and/or activity of R2R1), may be derived from or contain the nucleotide sequence designated herein by SEQ ID NO: 1 and below.

SEQIDNQ:W acactgacacggaccgaaggagtggaaaaagctttacctgtcactgtctgctgccatacgATGCTGGGAGGCCTGGGGA

AGCTGGCGGCCGAGGGCCTGGCCCACCGCACAGAGAAAGCCACTGGGGGAGCAGTT

CACGCAGTGGAAGAGGTGGTGAGCGAGGTGGTGGGCCACGCCAAGGAGGTTGGAG

AGAAGACCATTAATGACGCCCTAAAGAAAGCCCAAGAATCAGGAGACAGGGTGGT

GAAGGAGGTCACTGAGAAGGTCACCCACACCATCACTGATGCTGTTACCCATGCGG

CAGAAGGCCTGGGAAGACTGGGACAGtgagcctgcctaccagcatggctggcccttcctgaaggtcaataaaga gtgtgaaacgtgaaaaaaaaaaaaaaataacaaaaaaaaaaaaaaaaa^

SEQ ID NO: 1 is an example of a mouse R2R1 gene transcript. The coding or translated portion of this sequence (underlined) contains approximately 267 nucleotides. This portion of SEQ ID NO: 1 is specifically designated as SEQ ID NO: 2. The nucleic acid molecules (polynucleotides) used in this invention may be derived from or contain the nucleotide sequence designated by SEQ ID NO: 3 below .

- 3 044826

SEQ ID-NO:

actgtctgctgccacacgATGCTGGGAGGCCTGGGGAAGCTGGCTGCCGAAGGCCTGGCCCAC

CGCACCGAGAAGGCCACCGAGGGAGCCATTCATGCCGTGGAAGAAGTGGTGAAGG

AGGTGGTGGGACACGCCAAGGAGACTGGAGAGAAAGCCATTGCTGAAGCCATAAA

GAAAGCCCAAGAGTCAGGGGACAAAAAGATGAAGGAAATCACTGAGACAGTGACC

AACACAGTCACAAATGCCATCACCCATGCAGCAGAGAGTCTGGACAAACTTGGACA

Gtgagtgcacctgctaccacggcccttccccagtctcaataaaaagccatgacatgtg^

The sequence SEQ ID NO: 3 is an example of a human R2R1 gene transcript. The coding or translated portion of this sequence (underlined) contains approximately 267 nucleotides. This portion of SEQ ID NO: 1 is specifically designated as SEQ ID NO: 4.

The 267 nucleotides of SEQ ID NO: 2 encode a protein/polypeptide containing 89 amino acid residues and having the sequence designated SEQ ID NO: 5 below.

SEQ ID NO: 5

MLGGLGKLAAEGLAHRTEKATGGAVHAVEEVVSEVVGHAKEVGEKTINDALKKAQES

GDRVVKEVTEKVTHTITDAVTHAAEGLGRLGQ

The 267 nucleotides of SEQ ID NO: 4 encode a protein/polypeptide containing 89 amino acid residues and having the sequence designated SEQ ID NO: 6 below.

SEQ ID NO: 6

MLGGLGKLAAEGLAHRTEKATEGAIHAVEEVVKEVVGHAKETGEKAIAEAIKKAQESG

DKKMKEITETVTNTVTNAITHAAESLDKLGQ

Thus, this invention relates to nucleotide sequences containing in whole or in part (section or fragment) the sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, to the amino acid sequences SEQ encoded by them ID NO: 5 or SEQ ID NO: 6, as well as amino acid sequences containing in whole or in part (section or fragment) the sequences of SEQ ID NO: 5 or SEQ ID NO: 6. This invention also relates to nucleotide and/or amino acid sequences having a certain degree of identity and/or homology with the entire sequences of SEQ ID NO: 1, SEQ ID NO 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6, or parts thereof (in fragments).

For convenience, the sequences of SEQ ID NOS: 1-6 (each encoding or mediating the expression of R2R ¹ proteins) are referred to hereinafter as reference sequences.

A reference sequence fragment as described herein may contain any number of nucleotides/amino acid residues. For example, a fragment used in this invention may contain from about 1-5 nucleotides/amino acid residues to about n-1, where n is the total number of nucleotides/amino acid residues in the reference sequence. For example, a fragment or portion of a reference sequence of this invention may contain at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 80, 85, 88, 90, 95, 100, 150, 200, 250, 265, 266, 267, 300, 341, 350, 400 or 424 nucleotides/amino acid residues; the upper limit (n-1) depends on the size (n) of the nucleotide sequence encoding the full-length protein or on the number (n) of amino acid residues constituting the complete primary sequence of the protein.

Homologous or identical sequences may be naturally occurring in mammals, such as rodents and/or humans. Using the nucleotide and/or amino acid sequences described herein, one skilled in the art can readily identify related (e.g., homologous or identical) sequences within longer genomic sequences and in other species of living organisms, such as other mammals and etc. For example, a nucleotide sequence derived from any of the nucleotide sequences described herein can be used as a probe to detect homologous/identical or closely related sequences in the genomes of other species of living organisms (other than mice and humans).

- 4 044826

It is possible to obtain homologous or identical sequences using, for example, molecular biological methods, including sequencing, polymerase chain reaction (PCR) and/or cloning. It will be appreciated by those skilled in the art that sequences homologous or identical to any of the sequences described herein (referred to herein as reference sequences), including functional fragments of such sequences, may have at least about 20-30% homology or identity with complete or a partial corresponding sequence or fragment thereof. In other cases, homologous or identical sequences may exhibit at least 40, 50, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homology or identity any of the sequences described herein. For example, SEQ ID NOS: 2 and 4, both of which are nucleotide sequences used in this invention (either as drugs themselves or as sequences encoding proteins or peptides used in this invention) are 81.3% identical in throughout its entire length (267 amino acid residues). Thus, in the case of, for example, the sequence SEQ ID NO: 2, sequences that are about 80% identical/homologous can be used. When aligning the sequences of SEQ ID NOS: 1 and 3, the degree of identity is about 64%, so that in the case of, for example, the sequence SEQ ID NO: 1, sequences that are about 64% identical/homologous can be used.

The degree of homology (or percentage) between two or more amino acid or nucleotide sequences is assessed by aligning the sequences being compared; in this case, the number of nucleotides/amino acid residues in aligned positions is determined, which in these sequences are identical or not identical, but the difference is a synonymous nucleotide substitution (that is, not affecting which amino acid will be in this position) or leading to conservative amino acid substitutions. Homology can be assessed using BLAST programs (Basic Local Alignment Search Tool; see Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol 215:403–410).

The degree (or percentage) of identity of two or more amino acid or nucleotide sequences is also assessed by aligning the compared sequences, where the ratio of the number of exactly matching nucleotides/amino acid residues in these aligned sequences to the total number of nucleotides/amino acid residues in the compared sequences is determined and, multiplying the resulting value by 100, thereby obtaining the percentage of identity of these sequences.

Each of the reference sequences encodes a protein or peptide that binds, interacts with, or is otherwise associated with a component (one or more) or R2R1 binding site of the PRC1 complex and/or the TrxG-MLL complex; fragments of any of the reference sequences described herein used in this invention, or sequences used in this invention having the required degree of homology or identity with any of the sequences of SEQ ID NOS: 1-6 (or fragments thereof) encode or provide expression of a functional protein or a peptide - that is, a protein or peptide exhibiting the ability to bind to (or having an affinity for) the PRC1 complex and/or the TRXG-MLL complex, and/or components or subunits of either. A protein or peptide that exhibits the ability to bind/associate with (or has an affinity for) the PRC1 complex and/or the TRXG-MLL complex can bind/associate with (or has an affinity for) R2R1 binding sites therein.

In light of the foregoing, the compounds used in various aspects of the present invention contain (or consist of, or substantially consist of) the nucleic acids described herein (for example, the nucleic acids represented by the sequences SEQ ID NO: 1, 2, 3 or 4); peptides/proteins encoded by these nucleic acids, as well as any proteins or peptides described herein (for example, proteins or peptides represented by the sequences SEQ ID NO: 5 or 6); nucleotide or amino acid sequences, including parts or fragments of the nucleotide/amino acid sequences described herein; nucleotide or amino acid sequences having a certain degree of homology or identity with the nucleotide or amino acid sequences described herein.

In addition, variants of nucleotide or amino acid sequences can be used in accordance with this invention. For example, a variant nucleotide or amino acid sequence may be naturally occurring, containing, or comprising, or including one or more polymorphisms or insertions, substitutions, inversions, or deletions of nucleotide/amino acid residues relative to the reference sequence of the present invention. It is well known in the art that due to the degeneracy of the genetic code, substitutions of one or more nitrogenous bases in a codon are possible that are not reflected in the corresponding amino acid sequence. And you can use the degeneracy of the genetic code to obtain a variant of the nucleotide sequence

- 5 044826 sequence encoding a peptide or protein whose amino acid sequence is substantially identical to the reference sequence described herein. Sequence variants used in this invention can also be obtained by introducing one or more conservative substitutions into the sequence. Those skilled in the art will appreciate that the term conservative substitution encompasses the replacement of, for example, one or more amino acid residues in the reference amino acid sequence of a protein or peptide of the present invention with residue(s) of a different but similar amino acid such that the substitution is substantially does not affect the physicochemical properties and/or structure or function of the native or wild-type protein.

As a matter of fact, it must be taken into account that all such variants, especially those that are functional, or exhibit the desired activity, or encode functional peptides/proteins (that is, proteins/peptides that exhibit the ability to bind or associate with the PRC1 and/or TrxGMLL complexes, and/ or components or subunits of any of them) can be used in this invention.

Compounds (eg, inhibitors) that modulate in cells the expression of R2R1 genes (exemplary sequences of which are represented by SEQ ID NOS: 1-4 above) and/or the activity, function and/or expression of R2R1 proteins/peptides ( example sequences of which are represented by SEQ ID NOS: 5 and 6 above). For example, the compounds used in this invention may be antisense oligonucleotides or RNA interfering inhibitors. Such compounds are designed to interfere with transcription/translation processes by targeting specific DNA or RNA sequences. Antisense oligonucleotides/compounds contain DNA and/or RNA and are used to significantly reduce or completely eliminate the level of expression of the R2R1 gene or its protein product. For example, an antisense DNA sequence may contain a short sequence complementary to a portion of any of the reference nucleotide sequences described herein. For example, the antisense nucleotide sequence may comprise from about 5 to about 50 contiguous nucleotides of any of the sequences set forth herein as SEQ ID NOS: 1-4. The antisense RNA sequence used in this invention may be complementary to a specific portion of the messenger RNA for R2R1. Other antisense or inhibitory RNA/DNA molecules useful in this invention include microRNAs, small/short interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs). Such oligoribonucleotides can be represented by native double-stranded RNA or double-stranded RNA modified in one way or another (for example, chemically) to acquire resistance to the action of nucleases. Oligoribonculeotides may also be short hairpin RNAs (shRNAs) contained in expression or plasmid constructs that correspond to or contain small interfering RNAs described herein. Preferably, interfering PECs that are potentially useful in the present invention are double-stranded RNA molecules. In all cases, the antisense DNA or RNA contains sequences complementary to the nucleotide sequences corresponding to the R2R1 sequences described herein. Note that for all applications of methods using antisense molecules described herein, methods and protocols for achieving regulation of gene expression using antisense molecules are known, and algorithms that allow computer-assisted prediction of antisense molecules can be used to create antisense molecules/oligomers useful herein. sequences with an optimal inhibitory effect on a given gene.

Recombinant compounds, in particular recombinant proteins/peptides and/or nucleotide sequences, can be used in the present invention. For example, one skilled in the art, using the reference sequences described herein, can obtain recombinant sequences corresponding to R2R1 and/or peptides/proteins for use herein using molecular biological techniques, including cloning and polymerase chain reaction (PCR). invention. Additional information regarding the use of cloning and polymerase chain reaction methods to obtain recombinant sequences can be found, for example, in PCR Primer: A Laboratory Manual, Second Edition Edited by Carl W. Dieffenbach & Gabriela S. Dveksler: Cold Spring Harbor Laboratory Press and Molecular Cloning: A Laboratory Manual by Joseph Sambrook & David Russell: Cold Spring Harbor Laboratory Press.

The compounds used in this invention may contain antibodies (including antigen-binding and target-binding moieties). These are antibodies that bind to R2R1 proteins/peptides or epitopes thereof, or to epitopes corresponding to the binding site occupied by R2R1 in the binding sites of the PRC1 and/or TrxG-MLL complexes (or located there). Antibody term

- 6 044826 includes polyclonal and/or monoclonal antibodies and, for example, IgG, IgM, IgD, IgE and/or IgA isotypes. The term antibody fragments/antibody fragments should be understood to include fragments of antibody molecules containing one or both light chains and/or one or both heavy chains, and also includes fragments designated Fab, Fab2 and scFv. Antibodies and fragments thereof useful in this invention are functional and include antibody molecules and fragments thereof capable of interfering with, blocking, or neutralizing the binding of R2R1 to the PRC1 complex and/or the TrxG-MLL complex. Alternatively, the antibodies and fragments thereof used in this invention bind to the R2R1 binding site in the PRC1 complex and/or the TrxG-MLL complex. Antibodies or functional fragments thereof that bind to the R2R1 binding site in the PRC1 complex and/or the TrxG-MLL complex can be used to influence function similar to that of R2R1. In other words, such antibodies or functional fragments thereof can be used instead of R2R1 as a substitute for this protein in performing its function.

As stated above, the term antibodies as used herein includes polyclonal and/or monoclonal antibodies. Polyclonal antibodies are heterogeneous populations of antibody molecules, the source of which is the blood serum of animals immunized with any antigen or functional derivative of an antigen. Thus, in order to obtain polyclonal antibodies specific for, or having affinity for, R2R1, one must immunize a host animal, such as a rabbit, sheep, pig, etc., with the R2R1 protein/peptide (e.g., inject it), such as a protein or peptide, encoded or represented by the sequence described herein, or a suitable (encoding antigenic protein/peptide) fragment thereof. After immunization, antibodies that are specific and/or have affinity for R2R1 are formed in the animal's body, and they can be isolated from blood serum. Monoclonal antibodies are a homogeneous population of antibodies that have specificity/affinity for a specific antigen or its epitope. They can be obtained by any method that ensures the formation of antibody molecules by cells of continuous lines in culture. These methods include, but are not limited to those listed here, the Kohler-Milystein hybridoma method (Kohler and Milstein (1975), Nature 256:495-497; and US Pat. No. 4,376,110), the use of human B cell hybridomas (Kosbor et al. , 1983, Immunology Today 4:72; Cole et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030), and (EBV) (Cole et al., 1985, Monoclonal Anti-bodies and Cancer Therapy hybridomas from cells transformed with Epstein-Barr virus, Alan R. Liss, Inc., pp. 77-96). Monoclonal antibodies used in this invention can be obtained using methods using the nucleotide or amino acid sequences of proteins or peptides described herein, for example, proteins or peptides encoded by the nucleotide sequences set forth in SEQ ID NO: 1-4 or SEQ ID NOS: 5 or 6).

The compounds used in this invention also include low molecular weight substances (eg, low molecular weight organic compounds) capable of replacing R2R1 or inhibiting its effects. For example, small molecules that (i) interfere with or interfere with the binding of R2R1 to RNF2, DPY-30/ASH2L or SF3B2 can be used in this invention; (ii) inhibit the binding of R2R1 to RNF2, DPY-30/ASH2L or SF3B2; (iii) promote the binding of r2r1 to RNF2, DPY30/ASH2L or SF3B2 or (iv) modulate the binding of R2R1 to RNF2, DPY-30/ASH2L or SF3B2.

Compounds that are suitable for use in this invention (namely, compounds that modulate ciliogenesis and/or are useful in restoring ciliogenesis and/or treating or preventing diseases associated with disorders of ciliogenesis) can be identified using methods involving the preparation of probe compounds , contacting these compounds with cells and determining the effect (or lack thereof) of such contact on ciliogenesis in a given cell. Modulation of ciliogenesis can be identified by any observed increase or decrease in ciliogenesis and/or cilia formation, or by the development of activity associated with the intensity of ciliogenesis or cilia formation, in comparison with cells not in contact with the test agents. Any cells capable of undergoing or carrying out ciliogenesis are suitable for the use of such methods. Such cells may be undifferentiated, differentiated or differentiated primary bronchial epithelial cells (PBCs) taken from humans (donated). Or they may be undifferentiated, differentiated or differentiated induced pluripotent stem (iPS) cells with or without genetic modifications. For example, In iPS Cells, the gene(s) encoding R2R1 can be modified and cultured under specific conditions, such as monolayer, suspension, or air-liquid interface.

The term abnormal or defective ciliogenesis includes excessive or inadequate ciliogenesis or conditions in which the process or processes related to ciliogenesis are (or become) aborted, suppressed, or ineffective. The term abnormal or defective ciliogenesis includes diseases or conditions called ciliopathies in the broad sense. Losses in ciliogenesis lead to pathological changes in the bronchial epithelium.

Those skilled in the art will appreciate that ciliogenesis is an important process leading to the formation of ciliated cells, which play a key role in the removal of

- 7 044826 research on mucus from the airways. When ciliated cells are lost (for example, due to some form of abnormal or defective ciliogenesis), the clearance of mucus from the airways becomes ineffective, which occurs in patients, for example, with chronic obstructive pulmonary disease (COPD). In such cases, the pathologically altered bronchial epithelium (characterized by the loss of ciliated cells, squamous differentiation and hyperplasia of basal cells) is not able to cleanse the airways of mucus, bacteria, viruses and dirt. Ineffective cleansing mechanisms lead to serious symptoms such as cough, bronchial and lung infections, and insufficient gas exchange in the lungs. Increased mortality rates are often associated with such complications.

Various compounds described herein, namely those capable of binding or interacting or associating with the PRC1 complex and/or the TrxG-MLL complex and represented by nucleotide sequences (sense/antisense DNA/RNA), proteins/peptides, small molecules and/ or antibodies, can be used in restoring or correcting ciliogenesis in cells with abnormal or deficient (eg, weakened, suppressed, impaired, deficient or absent) ciliogenesis, as described above. Other compounds, such as nucleotide sequences (sense/antisense DNA/RNA), proteins/peptides, small molecules and/or antibodies, can serve to suppress or reduce the level of ciliogenesis in cells.

Those skilled in the art will understand that any variant of ciliogenesis in which its level is increased or decreased compared to the normal level found in healthy cells will be abnormal. Abnormal ciliogenesis - whether high or low - is associated with a number of diseases, including diseases classified as ciliopathies, such as primary ciliary dyskinesia, hydrocephalus, polycystic liver and kidney disease, some forms of retinal degeneration, as well as nephronophthisis, Bardet syndrome -Biedl, Alström syndrome and Meckel-Gruber syndrome. Abnormal or defective ciliogenesis may be a cause or factor in diseases of the respiratory tract, including the lungs, such as chronic obstructive pulmonary disease and similar conditions. Various compounds described herein, namely those capable of binding or interacting or associated with the PRC1 complex and/or the TrxG-MLL complex, can be used in the treatment and/or prevention of ciliopathies and/or chronic obstructive pulmonary diseases. For example, the compounds of this invention can be used to restore ciliogenesis in patients with or predisposed and/or susceptible to chronic obstructive pulmonary diseases.

The compounds used in this invention may be formulated for administration to individuals in need thereof. These compounds are offered in the form of pharmaceutical compositions. The composition used in this invention contains suitable (eg, pharmaceutically acceptable) excipients, diluents and/or buffer solutions. The compounds of this invention may be formulated in a pharmaceutical composition together with one or more other compounds intended for administration to patients - for example, together with one or more other drugs needed to prevent and/or treat other diseases and/or diseases and/or conditions associated with ciliogenesis. Preferably, the pharmaceutical compositions of this invention are sterile.

Excipients, carriers or diluents useful in this invention include, for example, water, saline, phosphate buffered saline (PBS), dextrose, glycerin, ethyl alcohol, ion exchange agents, alumina, aluminum stearate, lecithin, whey proteins (e.g. serum albumin), buffering agents (e.g. phosphates), glycine, sorbic acid, potassium sorbate, mixtures of partial glycerides of saturated fatty acids of vegetable origin, salts or electrolytes (e.g. protamine sulfate, disodium phosphate, dipotassium phosphate, sodium chloride, zinc salts, colloidal silicon dioxide, magnesium trisilicate), polyvinylpyrrolidone, cellulose derivatives, polyethylene glycone, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polypropylene block polymers, polyethylene glycol, lanolin, etc., or combinations thereof.

The pharmaceutical preparation used in the present invention may be, for example, a dosage form suitable for oral administration, or for parenteral administration, or for transmucosal administration, or for topical administration. The composition of this invention can be formulated in such a way that it can be inhaled. Compositions intended for inhalation may be in dosage forms such as powders or solutions that can be aerosolized and inhaled as droplets. Those skilled in the art will be familiar with devices used to deliver the compositions of this invention directly to the lungs, for example by inhalation. The particle or droplet sizes of the composition can be varied so that the drug reaches different areas of the lungs. For example, inhaled small particles or droplets can penetrate deep into the lung tissue and, in some cases, reach the alveoli.

- 8 044826

Compositions of this invention suitable for oral administration, in which the carrier is a solid substance, are most preferably presented in unit dosage forms, for example in the form of large pills, capsules or tablets, each of which contains a predetermined amount of one or more compounds according to this invention. the invention, binding to the PRC1 complex and/or the TrxG-MLL complex. Tablets are prepared by compression or molding, optionally using one or more auxiliary ingredients. Compressed tablets are prepared using a suitable tableting machine from the free-flowing substance (eg, powder or granules) of the active compounds (one or more) bound to the PRC1 and/or TrxG-MLL complexes; if necessary, the active compound in free-flowing form is mixed with a binder, glidant, inert diluent, lubricant, surfactant or dispersant. Molded tablets are prepared by forming them from active compounds (one or more) bound to PRC1 and/or TrxG-MLL complexes together with an inert liquid diluent. If necessary, the tablets are coated, and if they are uncoated, then, if necessary, a mark is applied to them - a break line. Capsule formulations are prepared by filling empty capsule shells with the active compound, alone or in admixture with one or more excipients, and then sealing them in the usual manner. The active agent (eg, the compounds of this invention that bind to the PRC1 and/or TrxG-MLL complexes) may be formulated in granular dispersible forms, which may, for example, be suspended in water or spread over the surface of a food product before administration to the body. Granules can be packaged in bags. Formulations suitable for oral administration using a liquid carrier may be a solution or suspension in water or a non-aqueous liquid, or an oil-in-water liquid emulsion.

Compositions suitable for oral administration include modified release dosage forms, for example tablets, in which the active compounds binding to the PRC1 and/or TRXG-MLL complexes are included in a suitable matrix to provide the desired release pattern of the active ingredients, or are coated with a film, ensuring the desired release pattern of active ingredients. Such compositions are particularly suitable for prophylactic use.

Compositions intended for parenteral administration include sterile solutions or suspensions of the active compounds of this invention binding to PRC1 and/or TrxG-MLL complexes in an aqueous or oily vehicle. The compositions of this invention may contain or also contain cryoprotective agents or compositions, preservatives, antibiotics, excipients, etc.

Compositions and vaccines administered by injection may be intended for bolus administration or for continuous infusion. Such drugs are usually packaged in single-dose or multi-dose containers, which, after adding the drug to them, are hermetically sealed and not opened until the moment of administration. Another option for preparations of the above active compounds of this invention are powders, which are diluted with a suitable carrier medium, such as sterile pyrogen-free water or phosphate buffered saline (PBS), before use.

Compositions containing one or more compounds of this invention binding to PRC1 and/or TrxG-MLL complexes may be long-acting depot formulations administered by intramuscular injection or by implantation, eg subcutaneous or intramuscular. The composition of depot preparations includes, for example, polymeric or hydrophobic materials or ion exchange resins suitable for such dosage forms. These preparations may also include agents or excipients that increase the affinity of the active ingredients for their targets and/or the duration of the immune response in the animal (eg, cattle, sheep or goats); These excipients include single or double oil-in-water emulsions. Such long-acting compositions are particularly suitable for prophylactic use.

Compositions of the present invention suitable or intended for mucosal administration include compositions containing particulates for aerosol spraying or dispersed in drinking water. In the latter case, it is desirable that the diameter of the particles in such a composition be in the range of 10-200 μm so that these particles are retained, for example, in the nasal cavity, which is achieved by using a powder with particles of the desired size or selecting the valve of the inhalation device. Other suitable compositions for this invention include coarse powders with particles with a diameter of 2-0500 microns for administration by rapid inhalation through the nasal passages from a container of the drug, which is held close to the nose; nasal drops containing 0.2-5 w/v% of the active compound in an aqueous or oily solution or suspension.

It should be appreciated that in addition to the carriers and carrier media mentioned above, the various compositions described herein may contain one or more additional suitable (pharmaceutically acceptable) carriers, for example diluents, buffer solutions, aromatizing agents

- 9 044826 binding agents, binding agents, surfactants, thickeners, glidants, preservatives (including antioxidants), etc., as well as substances serving to ensure isotonicity between the composition and the blood of the intended patient. Pharmaceutically acceptable carriers are well known to those skilled in the art; these include (but are not limited to) 0.1 M phosphate buffer solution and preferably 0.05 M or 0.8% saline. Note also that pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions or emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (eg olive oil) and injectable organic esters such as ethyl oleate. Aqueous carriers include water, aqueous-alcoholic solutions, emulsions or suspensions, including saline and buffer media. Carriers suitable for parenteral administration include sodium chloride solution, dextrose Ringer's solution, lactated dextrose Ringer's solution, or fixed oils. Preservatives and other additives may also be used, such as antimicrobial agents, antioxidants, chelating agents, inert gases, etc.

Compositions of the present invention for topical use may be presented, for example, in the form of a gel, cream or ointment.

The compositions of this invention for veterinary use are typically in powder or liquid concentrated forms. In accordance with veterinary drug standards, water-soluble excipients commonly used in pharmaceuticals, such as lactose or sucrose, can be added to these powders to improve their physical properties. Thus, particularly preferred powders of this invention contain 50-100% w/w, preferably 6080% w/w, of active ingredients (e.g., one or more compounds of this invention binding to PRC1 and/or TrxG-MLL complexes , and 0-50 w/w%, preferably 20-40 w/w% of excipients commonly used in veterinary medicine.Such powders are added, for example, to animal feed, for example using a pre-prepared mixture, or diluted in drinking water .

The liquid concentrates of the present invention preferably contain one or more of the compounds of the present invention binding to the PRC1 and/or TrxG-MLL complexes and, if desired, also water-miscible solvents suitable for veterinary use, for example polyethylene glycol, polypropylene glycol, glycerin, formal glycerol ( mixture of isomers) or the specified solvents mixed with ethyl alcohol in an amount of up to 30 vol./vol.%. Liquid concentrated preparations can be mixed into the water that the animal drinks.

Carrying out the invention

Next, this invention is described in more detail, including with the help of the following illustrations.

Fig. 1 illustrates the functions of the R2R1 protein in ciliogenesis.

Fig. 2 depicts the results of Western blotting of R2R1 in an immunoprecipitation experiment.

Fig. 3 - comparison of LogRatios representing differential expression due to transcriptional effect of R2R1 (FAM25KD) knockdown and the presence of chronic obstructive pulmonary disease.

Fig. 4 - Log ₂ (intensity) plots illustrating the increase in the expression level of a number of genes related to cilia.

Fig. 5 are boxplots illustrating the significance of differentially expressed cilia-related genes upon short hairpin RNA-mediated blocking of FAM25 (R2R1) gene expression.

Fig. 6 is a Log2Ratio diagram illustrating the up-regulation of ciliary gene expression related to ciliary movement due to short hairpin RNA (shRNA)-mediated downregulation of the FAM25(R2Rl) gene.

Fig. 7 is a Log ₂ Ratio diagram illustrating the up-regulation of ciliary gene expression related to ciliary morphogenesis due to short hairpin RNA (shRNA)-mediated downregulation of the FAM25(R2R1) gene.

Fig. 8 - analysis of the spectral map with the first principal component (PC1 on the X-axis) and the second principal component (PC2 on the Y-axis).

Fig. 9 - expression profile of the DYNLRB2 gene in PBEC cells under MS conditions (without lentiviral transduction, that is, control) from a donor without obstructive pulmonary disease (Br331) compared to cells from a donor with chronic obstructive pulmonary disease (Br370).

Fig. 10 - analysis of R2R1 gene expression by RTqPCR: experiment ABI Hs04194072_mH and experiment ABI Hs04194073_mH) with constitutive expression of shRNA_R2R1 in PBEC cells from a donor without obstructive pulmonary disease (Br331) compared to cells from a donor with chronic obstructive pulmonary disease (Br370).

Fig. 11 - analysis of R2R1 gene expression by RTqPCR: experiment ABI Hs04194072_mH and experiment ABI Hs04194073_mH) with constitutive expression of FHR2R1 in PBEC cells from a donor without obstructive pulmonary disease (Br331) compared with cells from a donor with chronic obstructive pulmonary disease (Br3 70 ).

Fig. 12 - fluorescence pattern in PBEC cells from a donor with chronic obstructive pulmonary disease (Br370) on the 1st week of exposure to air.

Fig. 13 - corrected total cell fluorescence (CTCF), as a measure of R2R1 protein expression, in PBEC cells from a donor without obstructive pulmonary lesions (Br331) at weeks 1, 2 and 3 of air exposure.

Fig. 14 - corrected total cell fluorescence (CTCF), as a measure of R2R1 protein expression, in PBEC cells from a donor without obstructive pulmonary lesions (Br331) at weeks 1, 2 and 3 of air exposure; all data is collected on one graph.

Fig. 15 - SPM analysis of gene expression levels for all samples used in the experiment.

Fig. 16 - SPM analysis of gene expression levels under conditions of decreased R2R1 expression.

Fig. 17 - SPM analysis of gene expression levels under conditions of increased R2R1 expression.

Fig. 18 - SPM analysis of gene expression levels for all samples used in the experiment.

Fig. 19 is a Log ₂ (intensity) plot illustrating an increase in the expression level of ROPN1L with a decrease in the expression level of R2R1.

Fig. 20 is a Log ₂ (intensity) plot illustrating a decrease in the expression level of ROPN1L with an increase in the expression level of R2R1.

Fig. 21 is a Log ₂ plot illustrating an increase in the expression level of ROPN1L with a decrease in the expression level of R2R1.

Fig. 22 - number of cells with cilia in the absence of obstructive pulmonary lesions (Br331).

Fig. 23 - number of cells with cilia in chronic obstructive pulmonary disease (Br370).

Fig. 24 - number of mucus-producing cells in the absence of obstructive pulmonary lesions (Br331).

Fig. 25 - the number of mucus-producing cells in chronic obstructive pulmonary disease (Br370).

Fig. 26 - staining of PBEC cells from a donor without obstructive pulmonary lesions (Br331) on the 2nd week of exposure to air under the indicated conditions (MS, shRNA_OK, shRNA_R2R1).

Fig. 27 - staining of PBEC cells from a donor from a donor with chronic obstructive pulmonary disease (Br370 on the 2nd week of exposure to air under the indicated conditions (MS, shRNA_OK, shRNA_R2R1).

Fig. 28 - staining of PBEC cells from a donor without obstructive pulmonary lesions (Br331) on the 2nd week of exposure to air under the indicated conditions (MS, FH, FHR2R1).

Fig. 29 - staining of PBEC cells from a donor with chronic obstructive pulmonary disease (Br370) on the 2nd week of exposure to air under the indicated conditions (MS, FH, FHR2R1).

Fig. 30 - staining of PBEC cells from a donor without obstructive pulmonary lesions (Br331) on the 3rd week of exposure to air under the indicated conditions (MS, shRNA_OK, shRNA_R2R1).

Fig. 31 - staining of PBEC cells from a donor with chronic obstructive pulmonary disease (Br370) on the 3rd week of exposure to air under the indicated conditions (MS, shRNA_OK, shRNA_R2R1).

Fig. 32 - staining of PBEC cells from a donor without obstructive pulmonary lesions (Br331) on the 3rd week of exposure to air under the indicated conditions (MS, FH, FHR2R1).

Fig. 33 - staining of PBEC cells from a donor with chronic obstructive pulmonary disease (Br370) on the 3rd week of exposure to air under the indicated conditions (MS, FH, FHR2R1).

Example 1.

1.1. The binding of R2R1 proteins (FAM25 family of proteins) to complexes involved in chromatin binding/remodeling, PRC1 of the Polycomb group (via the RNF2 subunit) and TrxG-MLL of the Trithorax group (via the DPY-30 and ASH2L subunits) serves as a mechanism for turning on/off ciliogenesis in cells of the pulmonary and bronchial epithelium in humans.

R2R1 proteins play an essential role in the maintenance and regeneration of the pulmonary epithelium, in particular in the basal cell program. Their functions were discovered through experiments with primary bronchial epithelial cells (PBECs) cultured by submerged culture. Under the conditions of this cultivation method, rapid proliferation of undifferentiated PBEC cells is characteristic. Therefore, deep cultivation conditions are ideal for studying basal cells - stem cells of the epithelium of the airways (lungs and bronchi) in humans.

To study the function of R2R1 proteins in the differentiation and activity of differentiated PBEC cells, further experiments were carried out. PBEC cells were grown in an air-liquid phase separation (ALI conditions). shRNA-mediated knockdown of R2R1 gene expression in PBEC cells growing under ALI conditions in two independent experiments revealed a complementary function of R2R1 in the differentiation of human bronchial epithelial cells. The effect of constitutive and inducible

- 11 044826 expression of shRNA 'FAM25 147' (=TRCN0000284147, also referred to as shRNA_R2R1), counteracting the expression of R2R1, is illustrated in FIG. 4-7.

1.2. Knockdown of R2R1 expression results in significant upregulation of ciliogenesis or the ciliary gene expression program.

The cilia gene expression program involves structural and motor proteins of motile cilia. It follows that R2R1 regulates the transition between basal cells and ciliated cells. The function of R2R1 is, so to speak, symmetrical: namely, in the presence of R2R1, the basal cell program is implemented, and in the absence of R2R1, the ciliated cell program is initiated. This symmetry (basal cells-->/<-ciliated cells) is depicted in Fig. 1. It should be noted that there is no evidence of basal cells-->/<--mucus-producing cells symmetry; this fact has important therapeutic implications.

Loss of cilia-bearing cells leads to insufficient clearance of mucus from the airways in patients with chronic obstructive pulmonary disease (COPD). This symptom is characteristic of COPD: pathologically altered bronchial epithelium (lack of ciliated cells, squamous differentiation and basal cell hyperplasia) is not able to clear the airways of mucus, bacteria, viruses and dirt. Ineffectiveness of the cleansing mechanism leads to serious symptoms such as cough, bronchial and lung infections, insufficient gas exchange in the lungs, and as a result, the mortality rate increases.

It was found that in PBEC cells grown under ALI conditions, the level of gene expression in the cilia gene program is persistently reduced. This was observed in two independent experiments with PBEC cells from multiple donors.

A comparison of the transcriptional effects of chronic obstructive pulmonary disease and blocking R2R1 expression in PBEC cells growing under ALI conditions using short hairpin RNAs (shRNAs) is illustrated in FIG. 3. In the upper left quadrant, the data represent the effect of R2R1 on ciliogenesis and obstructive lung disease. Genes whose expression is altered due to shRNA knockdown of R2R1 in PBEC cells grown under ALI conditions are located along the Y axis. Genes whose expression level is increased due to R2R1 knockdown are located above the zero of the Y axis. Genes whose expression is altered due to obstructive Lung lesions (compared to those without) are located along the X-axis. Genes that are downregulated due to obstructive lung disease are located to the left of the X-axis zero. The upper left quadrant thus represents the overlap between genes that are upregulated due to for blocking R2R1, and genes whose expression level is reduced due to obstructive pulmonary damage. Most of these genes are involved in ciliogenesis.

1.3. Study of the mechanism by which R2R1 proteins regulate the transition between basal cells and ciliated cells.

For normal ciliogenesis, the cell must produce enough different cilia proteins. The simultaneous expression of such many genes must be strictly regulated. Consequently, this regulation is carried out according to the on/off type.

We were able to identify the RNF2 protein, a core component of the PRC1 complex, as a binding partner of R2R1, which was established in two independent experiments with a yeast two-hybrid (Y2H) system (first experiment: 7 hits, of which 4 were RNF2; second experiment: 4 hits, of which 1 is RNF2). A second binding partner was also identified, the DPY-30 protein, which is a component of the TrxG-MLL complex (1/7 matches in the first Y2H experiment). Finally, the set of proteins involved in chromatin binding was completed by the protein SF3B2 (1/4 matches in the second Y2H experiment).

The interaction between R2R1 proteins and PRC1/TrxG complexes was confirmed in an in vitro translation experiment (1-Step CHO High-Yield IVT Kit, Thermo Scientific). The R2R1 construct with an N-terminal hemagglutinin tag (HA-tag) in the pT7CFE1 vector was expressed along with various permutations of the Polycomb (PcG) and TrxG constructs carrying an N-terminal FLAG tag in the pT7CFE1 vector. Co-immunoprecipitation was performed using EZview™ Red Anti-HA Affinity Gel (Sigma Aldrich) to bind R2R1 and any associated proteins in the reaction mixture. Bound proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting with anti-FLAG® monoclonal antibody M2 (Sigma Aldrich).

The various permutations are described in the table below.

- 12 044826

1__________________________________________________________

Protein marker Magic Mark

N-terminus of DPY-30

N-terminus of R2R1

N-terminus of DPY-30

N-terminus of ASII2L

N-terminus of KMT2D

N-terminus of R2R1

N-terminus of RNF2

N-terminus of RYBP

N-terminus of KMT2D

N-terminus of R2R1

N-terminus of RNF2

N-terminus of PCGF4 (BMI1)

N-terminus of RYBP

N-terminus of R2R1

Fig. Figure 2 illustrates the co-immunoprecipitation of R2R1 and various PRC1/TrxG proteins using different permutations. The strength of the binding of RNF2 to R2R1 during non-canonical permutation of the PRC1 complex (in the presence of KMT2D (MLL4) and RYBP, 4th lane) is greater than in the canonical form of the PRC1 complex (5th lane). ASH2L clearly binds to R2R1 (lane 3) when permuted to include the KMT2D (MLL4), DPY-30, and ASH2L proteins of the TrxG-MLL complex. ASH2L and DPY-30 are known to be reciprocal binding members and important subunits of the TrxGMLL complexes. Finally, when a protein mixture containing only R2R1 and DPY-30 is permuted, heterodimerization between R2R1 and DPY-30 appears to occur.

From the above it follows that the effect on transcription (many genes are simultaneously regulated by R2R1) is due to changes in the binding properties of proteins that carry out chromatin remodeling, and the PRC1 complex in this sense is the most obvious example. It is known that an exchange of components occurs in PRC1, which leads to the appearance of canonical and non-canonical complexes. The effects of PRC1 on chromatin (histone H2A ubiquitinylation, PRC2 recruitment, and promotion of PRC2 in its repressor form) are determined by its various protein components. However, the RNF2 subunit is always present in the PRC1 complex.

Thus, we have discovered a completely clear non-canonical function of PRC1. This function is determined by the binding of R2R1 to the PRC1 complex. The binding of R2R1 to PRC1 creates a transition point in ciliogenesis. R2R1 also interacts with the TrxG-MLL complex (Trithorax group, or TrxG), which modifies chromatin, with the participation of DPY-30 and ASH2L. Unlike PRC1, the TrxG complex maintains active gene expression by methylating H3K4. The interaction of proteins of the Polycomb group and the Trithorax group maintains a certain set of genes in an active or repressed state. Thus, R2R1 has a significant effect on chromatin domains and gene expression by binding to Polycomb group (PcG) proteins PRC1 and TrxG group proteins. It is likely that a peptide that is part of the R2R1 protein, a protein partially similar to R2R1, or a small molecule compound that interacts with the R2R1-RNF2 and/or R2R1-DPY-30/ASH2L binding sites can restore ciliogenesis in patients with chronic obstructive pulmonary diseases.

It is necessary to show that the R2R1 protein regulates a specific set of genes that ensure ciliogenesis in human PBEC cells. In other words, we need to obtain evidence that R2R1 binds to specific nucleotide sequences (promoters or enhancers) in genes that regulate or mediate ciliogenesis.

R2R binding sites in the genome of human PBEC cells were identified by CHIP-Seq (chromatin immunoprecipitation and next-generation sequencing of enriched DNA fragments). In human PBEC cells grown under ALI conditions, a protein containing an N-terminal FLAG tandem tag was constitutively expressed (using lentiviral transduction).

- 13 044826 epitope protein R2R1, and a protein that had only an N-terminal FLAG-HA tag and a tandem epitope. Genomic DNA in chromatin and proteins were combined with a cross-linking agent - disuccinimidyl glutarate (DSG) and formaldehyde. Chromatin was sonicated to the desired size (~200 bp) and immunoprecipitated using the EZview™ Red Anti-HA Affinity Gel System (Sigma Aldrich) to bind genomic DNA fragments corresponding to the N-terminal FLAG tag tandem epitope - R2R1 protein and an N-terminal FLAG-HA tag tandem epitope. A next-generation sequencing (NGS) library was then prepared from these DNA fragments (after de-crosslinking and digestion) and sequenced to a depth of at least 40 x 10 ⁶ reads. As a result of comparison (EaSeq, http://easeq.net/) of enrichment of binding sites in the library corresponding to the protein, FLAG-HA tandem epitope-R2R1, and FLAG-HA tandem epitope (control library), a set of ~3000 sites was obtained , binding R2R1. At the same time, reproducibility of the results was achieved, which was demonstrated in technical and biological repetitions of the experiment (donors Br331 and Br363).

So, firstly, analysis of the set of R2R1 binding sites revealed that R2R1 binds to the promoter sites of the TP73 and FOXJ genes, the protein products of which are the main transcription factors that initiate the formation of motile cilia. R2R1 also binds to the promoter sites of genes encoding components of the centrosome apparatus and the basal body of the cilium (CROCC, CCDC41, CEP131, CEP164, CEP170, CEP170B, CEP192 etc.). Finally, other key regulators of ciliogenesis and epithelial differentiation (transcription factors, small non-coding RNAs, chromatin modifiers, etc.) were identified: FUZ, FGFR1, MIR34AHG, ARID1B, JARID2, YY1, KDM2A, KDM2B, KDM4B, KDM6B, KMT2A, KMT5B ,SETD1A. Thus, this invention provides compounds (e.g., the R2R1-based compounds described herein) capable of modulating the activity of genes encoding components of the centrosome/basal body of the cilium and/or regulators of ciliogenesis and epithelial differentiation (or binding to, or associated with) with these genes).

Below are example DNA sequences for R2R1 binding sites.

- 14 044826

TP73 >hgl9_dna range=chr 1:3607302-3607501 5'pad=0 3'pad=0 strand=+ repeatMasking=none

GTTCCCCAGCATCCTCGGCTCCTGCCTCACTAGCTGCGGAGCCTCTCCCGCTCGGTCC ACGCTGCCGGGCGGCCACGACCGTGACCCTTCCCCTCGGGCCGCCCAGATCCATGCC TCGTCCCACGGGACACCAGTTCCCTGGCGTGTGCAGACCCCCCGGCGCCTACCATGC TGTACGTCGGTGACCCCGCACGGCACCT FOXJ1 >hgl9_dna range=chr17:7 4118677-74118876 5'pad=0 3'pad=0 strand=+ repeatMasking=none GCGGAGGCAGAGCGGCCCTGGGGCCCCGGCGTCAGCTGAGGTTGCACTGTGTTTGG AGAGGAGCCTCGGAGGGGTGGGCTGCCTGGCAGCAGTGGCCTGGGGGGCCGCAAATG AGGAGGGTGCAGTGCCTTGGGCAGTAAATTAGAAGACACAGGCTGCTGGC TGGGGG CGGGAGGGCACAGGGAAGCCCTGCCCGGGAGC FUZ >hgl9_dna range=chrl9:50308793-50308992 5'pad=0 3 'pad=0 strand=+ repeatMasking=none

CGGGACTTCCTGACGCCCCCGCTGCTGTCCGTGCGCTTCCGGTGAGTCAGGTA CGGCGCGGCCGGTGGGCGGAGCCTCCGGGGTGAGGGGCGGGGCCTAATGGAGCCTC CCTTTCACCTCATCAGGTACGGTGGCGCCCCCCAGGCCCTCACCCTGAAGCTCCCAG TGACCATCAACAAGTTCTTCCAGCCCACCGAT FUZ >hgl9_dna range=chrl9: 50304563-50304762 5'pad=0 3'pad=0 strand=+ repeatMasking=none

ATCCTAGGGAGGGGCACCTCTCGAGGGGGTTTCTGGGAGAGGGCAGTGGAA CCTGGCCCCGCTGACACCCACTCCTGCACACAGCCCCCCAGTGCAGTTCTCCCTGCT CCACTCCAAGTTCCATCTGTGCAGCGTGGCCACGCGGGCGCTGCTGCTGTCCACCTA CATCAAGTTCATCAACCTCTTCCCCGAGACCAAGG CROCC >hgl9_dna range=chrl :17266175-17266468 5'pad=0 3'pad=0 strand=+ repeatMasking=none

CCCAGGGAGGTGAGGGCTCAGAGGGTGGCGAGGGCACATAGGAGGGGAGCG GAAGCCTGGCTCTCAGGCCTAGGCCCCTATCCTGCCCCAGGCCAGGTCCAGGCCCTG GACCCCGCCTAGCGTAGGCTAGTGTGTATCCCTGGAACCAGAAGAGAGTAGGTGGC TCTGGAGGCCTCAGGCCCCCCCAGACTCTGTGACCCCCCACACCCCAGGACATGC GTGGGCGCTATGAGGC AAGCCAGGACCTACTGGGCACCCTGCGGAAGCAGCTTAGC GACAGCGAGAGCGAGCG

- 15 044826

CROCC >hgl9_dna range=chrl :17239197-17239454 5'pad=0 3'pad=0 strand=+ repeatMasking=none

TCCAGGGACTGGCTGTGCATACTGGCAGATGTCAGTCAGCCCTCCTGCAGTT GGGCCAGGGACACCTCAGGGAAACTGTGACCTTCCTTCCAATCTTGGTAACATCACC CTTCCACCCCAAATCCCAGGGAATGGCCCGAATCTCTCCTGACAAACAGCTCTCAGC CCTGGTCCAGGCCACAGTCTTGCTTGCACCGGGCCGGGTTTCAGAGCCCGAAGGGC ACACTGGCAGCCTTTAG TGCAGTGTTTCAGATGTCA

CROCC >hgl9_dna range=chrl :17249731-17249930 5'pad=0 3'pad=0 strand=+ repeatMasking=none

GTGGCGCACACGGTGTAGTTATGTGGCTTGAGGATCTGGGAAAGGCACACTC AGTTGCAGCTGGTGTGCTGGCGTGTGGCGTTTTGGTGCTCTAACCATTGTCTGTGTTC AACTCCCAAGCTACAGACGGGCCCCCTCCTTGGGAGCGCCAGGGATGTTGGCGCCC TGGAGCCCCAGACAGGGAGAGACTCAGAGGGCCC

CROCCP2 (CROCC area) >hgl9_dna range=chrl :16949769-16950030 5'pad=0 3'pad=0 strand=+ repeatMasking=none

CGACTACAGGGAATGGAAATGGTATAGCCATCATCTAAAACCATCTCCCGG GTTGGAAACCCACCAGCATTTCCCTTCCTGGTTCTGTCTGGCTCAGGTGTACATGGA CAGGAAAATTAATTTCCATGACCCAAGTAGGTGCTTAGTTAATGTTAGATGAGCAGA AAGAAGCCCTGAGTTCAGAGATTCGATGGGGAACGGTGCAGGGAAGTGGGGCTCGG ATTCTGGGGCCAAGAGAG TCATCTGAAAACCCACAGAGAAC

CROCCP3 (CROCC area) >hgl9_dna range=chrl :16825373-16825572 5'pad=0 3'pad=0 strand=+ repeatMasking=none

AGGGGACCCCGACCGGCGGAGGGACGGCTGCGCCCTGCAGGCCGCTGCGCC CAGGCAGGCCTCTGCGCCCGGGCAGGCCTCGGCCTCCTGTCGCGCCCCCGGCCCGCG ACAATCCGGGCAGGATGGGCGGCAGGACGCGGAGGGGCATCTGCGGAGCCCGTCG GGAACGCCCTCTTGGCTTCCGGTGCCGGGCAGCGGCG

CEP131 >hgl9_dna range=chrl7:79196529-79196728 5'pad=0 3'pad=0 strand=+ repeatMasking=none

TGCGCCCTGCAACCCCCTCCCTTGCCCGGGCCCCCCTCACCTGCGCGGGCCGG GGGCGCAGCCGCGAAGCCTGCCTGGCGCGCGGGGCCTGCAGATTCGGCCGGCGGGG

- 16 044826

AGGGGATGCGGAACCAGTCGCGCCCAAACCTCGGGTCGGCGACCTGGCGCCCCGCC

ACCCCCAACACTGCCCCGAGGCCCGGTGACAATGA

CEP 164 >hgl9_dna range=chrl 1:117198627-117198826 5'pad=0 3'pad=0 strand=+ repeatMasking=none

GTTGGGTGGCGTTGGGGGAGCTGCGCCTCGCCCAGAGCCTCGCCCGGAGCCT CGCCCGGAGCCTTCCGGGGTGGGGGATAGTTGAGGACCTCATCGAGGGAGGGGTTG GGCGGCGGGGAAGGGAGCGAGCGTGGCGGGGGACCCGAGGCACGCTCTCGAGCCA ACGAGCTGATGCGCTCGAGTGTGGGCGGGGACTGAG

CEP 170 >hgl9_dna range=chrl :243418128-243418414 5'pad=0 3'pad=0 strand=+ repeatMasking=none

AAGCCCCGGGTCCCAGGCGGGCAGAGGGTGGGGGTGGCGGCGCCGCGCGGA GCACCCGGGAAGCGCCCCCTTCGCGGTCCAGCCCCGCACCCCCGCCCCGCGGCGGG CGGCGCCCGAGTCCTCGCCGCAAACCCGAGGAGCAGGATGTGGAAAGCAGCCGCGG CGGTGGCTGCGGCTGCGGCGCCTACACCGAGCAGCCGATCGCATCACTTACCCCTTA CCGTGGAGAGAGGGACC GGACGGGGGAGGCGGGGCGCGTCGCGTCCCGTGAGTCTCTCGCACGCCGT

SERPOV >hgl9_dna range=chrl4:105331641-105331930 5'pad=0 3'pad=0 strand=+ repeatMasking=none

CGCTCTGCCGTGGGCTCGGCCCGGGCTGCCACGAGCGTGCGGGCCTCGCCGG GCATGTCCTAGGCGGCGGCCCCGCCCAGCGCTCGGCCGGGCGGGCGGGCGGGCGCG AGGGCAGGGACCGAGCCGGGCCGAGCTGGGGAACAAGCCGGGGACCAAGCCGGGG ACCAAGCCGGGGACTAAGGCGAGCCGGAGACCGAGCCCGAACAGCAGGTAGGACG CGCCGGCCCAGCGCTG GCCGCGGCCCCGGGCCTCCCATCGCCCCGCACCTGCACGGCT GTGGGGTCTCACGGGG

SERPOV >hgl9_dna range=chrl4:105333102-105333301 5'pad=0 3'pad=0 strand=+ repeatMasking=none

AGACCTTGGGCGTGGGCACTGGGCAAAGTAGGGACAAGGAGCCACTCACTC CTCTGCCTGGCACCCTCATGTGGTGTGGCCCTGCCCTCAGGATGCACTCAGCCCGGC AGCCTCCCCTTCTCCTCTGCTCCACTGGGCCTCAGCTGCTGTCATCCCTGTCCTGGGT TATTGTCCTCACTTCTTGACTGGCCTCCTGAGTC

SICKLES

- 17 044826 >hgl9_dna range=chrl4:105332644-105332843 5'pad=0 3'pad=0 strand=+ repeatMasking=none

GGGCCGCGGCAGGTGATGGCAGAGGGTGAGGCCTAGGAGGGCTGGCTGGGG

GCCGGAGGTGCAATGGTGGGGTAGGCCCTGCCCGATAGAGCACCCTGTGGTCTCCC

CCAGCAGCCCTAGGGAGGGTGGGGCTGTAGAGGCCTCCTGGAGGCTTTGCTGTCTG

GGGCTGCAGGGTCATCGAAGTGCCAGCCCCTTGGCCT

SERPOV >hgl9_dna range=chrl4:105341395-105341594 5'pad=0 3'pad=0 strand=+ repeatMasking=none

TGGTGTTTCATGACGGTGCCCTGTGGTGGGGCAGTGATGGCCAGCTGCCAGG

GTGGCCTGCACGTGGCAGGCTAAGAGTGACCAGCCTGAGGGGCCCAGGCTCTCACC TGGGAGACTGAGAAGCCGTGCTGGCACTCAGGAGGGACTTCCAGCTCCTAGTCGTG

TGGGTTGCAGGCCGTCCTGTCCCAGGGCTGGGGGAC

CEP 192 >hgl9_dna range=chrl 8:12991416-12991615 5'pad=0 3'pad=0 strand=+ repeatMasking=none

GAAGTCGGGGACGCGGGCTCGGTGAGGGGGGACGCTGGTGCCTCGGCCTGC

GCCTAGGCGGGAGGCAGACGCATGCACCTTTGGCCTACGTTTCGGCTGCCGGACCG

ACGGGACAGTGACGGTTGGGCCGGGTGGGGGCGCAGGCTGTGGGGCGGCCTCAGG

GCGCGAGCAAGGGGACTGCCGCGCTTCCCGCGCCTCTG

CCDC41 >hgl9_dna range=chrl2:94853729-94853928 5'pad=0 3'pad=0 strand=+ repeatMasking=none

TTGGCCCAGCGGCACGCGAAGCAGGAAGTCCCACCCCCCACGCCGACGTCAC

CCACGCCACCGACGCCGGTTGCTGCCGGAGCCGTTAGAGGGAGGAGACAAAACGAAC

CGAGGCGGGAGCGGCCACGGGTGACAGCGGCAGCGGCGGGGCCGGGCTGCGCTCC

CGAAGGCGTTCCTGGAGGGCCCTGGGATGGACTCAGA

MIR34AHG >hgl9_dna range=chrl :9242327-9242526 5'pad=0 3'pad=0 strand=+ repeatMasking=none

ACCGACGGGACAGCGGCATCTCCTCCACCTGAAAAGGAAAGAGGACCAGGT

GGGGGCCAGGCAGGGCGCATGAAGGCGGCGCCAGCACCGCGCGATCGATCACG

TCGGTGCGGGGGGAGGGGTCGGAGCCTGGCCTCGGCCTAGGGCGCAGATGCGGTGCG

CACCGCAGGGGGGCGGCGTGGGGTGCGGGGCCAGTCC

The nucleotide sequences of example R2R1 binding sites are characterized by a high content of GC bases. Thus, analysis of the base content in the entire set of R2R1 binding sites (~3000 sites) shows that the GC content exceeds the AT content: G and C bases together account for >66% of the bases in the genomic R2R1 binding sites. A search for motifs in R2R1 binding sites using the RSAT (Regulatory Sequence Analysis Tools; http://rsat.sb-roscoff.fr/) software package revealed highly specific GC motifs. These motifs are repeated regardless of the RSAT motif search technique (counting the occurrence of oligonucleotides in a set of sequences, as a result of which overrepresented oligonucleotides are identified, the positional distribution of oligonucleotides in a set of sequences is calculated and those that deviate significantly from a uniform distribution are identified, and overrepresented pairs of oligonucleotides of approximately the same size , separated by a fixed number of nucleotides, in a set of DNA sequences; see definitions of terms at

- 18 044826 RSAT server http://rsat.sb-roscoff.fr/). The detected motifs clearly repeat GCC (CGG) triads. Typically, high GC content and repeated sequences of GC nucleotides are characteristic of CpG islands. (CGI). Recently, these CGIs are thought to contain genomic binding sites for PcG (Polycomb response elements, abbreviated PRE) and TrxG (Trithorax response elements, abbreviated TRE) complexes, collectively referred to as PREs. Consequently, another link to Polycomb function was established: R2R1 represents a failed PRE recognition element. This is of particular importance for PcG complexes, in which—unlike TrxG complexes—no universal PRE recognition elements have been identified.

Example 2.

2.1. Restoration of ciliogenesis in PBEC cells grown under ALI conditions from donors with chronic obstructive pulmonary disease.

First of all, we emphasize that ciliogenesis in the absence of R2R1 is not limited to PBEC cells from donors without obstructive lung lesions. Therefore it should be noted that:

(a) in PBEC cells from donors with and without chronic obstructive pulmonary disease, the expression of R2R1 is easily upregulated and downregulated;

(b) R2R1 protein expression is associated with R2R1 transcript expression;

(c) in PBEC cells from donors with and without chronic obstructive pulmonary disease, knockdown of R2R1 expression initiates a program of expression of cilia-related genes. Conversely, an increase in the expression level of R2R1 leads to suppression of the transcription of genes related to cilia;

(d) changes in the repertoire of transcripts are reflected in the phenotype of the cell. The transcriptome related to ciliogenesis determines the increase in the number of ciliated cells in PBEC cells grown under ALI conditions from donors with chronic obstructive pulmonary disease.

The results of the experiments described below illustrate statements 2.1(a), 2.1(b), 2.1(c), and 2.1(d).

PBEC cells from a donor without obstructive pulmonary lesions (Br331) and from a donor with chronic obstructive pulmonary lesions (Br370) were grown under ALL conditions. At the 1st, 2nd and 3rd weeks of exposure to air (AE), transcriptome and cell cell analysis was performed phenotype. In each variant of the conditions, the experiment was repeated three times.

The following conditions were taken.

(i) MC (medium control) - the population of cells grew without any intervention.

(ii) Reduced expression of R2R1 in PBEC cells was achieved by constitutive expression (using lentiviral transduction) of FAM25 147= TRCN0000284147 (designated shRNA_R2R1). PBEC cells that constitutively expressed random small hairpin RNAs (designated shRNA_OK) served as a negative control under these conditions.

(ii i) Increased expression levels of R2R1 were achieved by constitutive expression of an N-terminal FLAG-HA tandem epitope tag-R2R1 construct (designated FHR2R1) (using lentiviral transduction). Under these conditions, PBEC cells, which constitutively expressed a similar N-terminal FLAG-HA tandem epitope tag construct (designated FH), served as a negative control.

iv) Donors: without obstructive pulmonary disease (Br331) and with chronic obstructive pulmonary disease (Br370) (v) Time: PBEC cells were collected at 1st, 2nd and 3rd weeks of air exposure (AE).

2.2. In PBEC cells from donor Br370 (with chronic obstructive pulmonary disease), a persistent decrease in the level of expression of genes responsible for the formation of cilia was observed over time.

It could be expected that (1) in the gene expression profile of PBEC cells grown under ALI conditions, ciliogenesis would become more and more noticeable over time. We also hypothesized that (2) in PBEC cells from a donor with chronic obstructive pulmonary disease (Br370), the appearance of ciliogenesis-related transcripts would be delayed compared with PBEC cells from a donor without obstructive pulmonary disease (Br331).

The analysis of the gene expression program in MS PBEC cells (PBEC cells that were not subjected to lentiviral transduction) had to prove or disprove these assumptions.

Application of spectral map analysis (SPM) confirmed our assumptions. This method (see Fig. 8) provides unambiguous identification of the predominant gene clusters and other objects in the data set. This method of analyzing gene expression data showed that the expression of genes related to ciliogenesis changed over time (week of air exposure), which explained the most variation (56%) in the data. This variability is graphically represented in the first principal component (X-axis, or PC1) of the spectral map. The second largest variation (17%) can be explained by donor status, that is, whether there is obstructive pulmonary disease or not. This variability is represented in the second principal component (Y-axis, or _PC2 ) of the spectral map). Genes for which the greatest changes in expression were noted are located in the areas of extreme values along the X and Y axes.

- 19 044826

The subgroup of genes causing the largest changes in differential expression consists entirely of genes related to ciliogenesis (see Fig. 8).

The DYNLRB2 and ROPNL1 genes are examples of genes related to ciliogenesis. As expected, these genes are located at the extremes of the X axis (PC1 - variation associated with time).

Thus, the first (1) part of our assumption is confirmed.

Overlaying data from various MS PBECs samples onto a spectral map shows their distribution along the first two principal components. It can be seen that the groups corresponding to the presence of chronic obstructive pulmonary disease (Br370) and its absence (Br331) are clearly separated by the expression of cilia-related genes along PC1 and _PC2 . PBEC cells from a donor (Br331) without obstructive lung disease cluster closest to a subset of cilia-related genes. PBEC cells from a donor with chronic obstructive pulmonary disease (Br370) cluster at the opposite end. This proves the second part (2) of our assumption. As an example, the gene expression profile of DYNLRB2 is shown (see Fig. 9). This independent univariate gene-by-gene hypothesis testing analysis confirms the effect of PBEC cell origin (from a donor with or without chronic obstructive pulmonary disease—Br370 versus Br331). PBEC cells from a donor without pulmonary obstruction (Br331) collected at the first time point indicated (first week of air exposure: AE week=1) showed the lowest level of DYNLRB2 expression. And in PBEC cells from a donor without obstructive pulmonary lesions (Br331), collected at the third of the indicated time points (third week of air exposure: AE week=3), a very high level of DYNLRB2 expression was observed. In PBEC cells from a donor with chronic obstructive pulmonary disease (Br370), this gene was weakly expressed.

2.3. The expression level of R2R1 in PBEC cells from a donor without obstructive pulmonary disease and from a donor with chronic obstructive pulmonary disease significantly decreases and increases.

The expression of R2R1 genes was studied using real-time quantitative polymerase chain reaction - RTqPCR; (experiment ABI Hs04194072_mH and experiment ABI Hs04194073_mH); the results obtained demonstrated its complete absence of knockout) with constitutive expression of shRNA_R2R1 in PBEC cells from a donor without obstructive pulmonary disease (Br331) and from a donor with chronic obstructive pulmonary disease (Br370); see fig. 10. On the contrary, the same (RTqPCR) determination of the expression of R2R1 genes with constitutive expression of FHR2R1 showed an increase in the expression level of >10 ⁴ in PBEC cells from a donor without obstructive pulmonary disease (Br331) and from a donor with chronic obstructive pulmonary disease (Br370) (ABI experiment Hs04194072_mH and experience ABI Hs04194073_mH); see fig. eleven). These data are presented as scatter plots (dash means). RTqPCR results prove that the expression of R2R ¹ genes is regulated both downward and upward, and this regulation is very pronounced, significant and reliable.

2.4. The expression of the R2R1 protein is associated with the expression of the R2R1 transcript. The total content of the R2R1 protein in the nucleus was determined as follows.

PBEC cells were immunohistochemically stained using antibodies (1/500) against FAM25A family proteins (Abcam ab 177969). Secondary antibodies were goat anti-rabbit IgG (H+L) conjugated to Alexa Fluor® 594 fluorescent dye (Thermo-Fisher Scientific A-11037). Using the Image J program (http://rsbweb.nih.gov/ij/index.html), the corrected total cell fluorescence (CTCF) was determined from 10 fields at a magnification of x20. The CTCF value is used to estimate the total content of the R2R1 protein in the nucleus. Fig. 12 gives an idea of the characteristic fluorescence pattern under different conditions (MS, FH, FHR2R1, shRNA_OK and shRNA_R2R1) at a given time point AE (exposure to air). The dot plot (bars are mean values with standard deviation SD) shows the fluorescence pattern in PBEC cells from a donor with chronic obstructive pulmonary disease (Br370) in the first week of air exposure. In fig. 13 shows the time sequence of fluorescence patterns in PBEC cells from a donor without obstructive pulmonary lesions (Br331). In fig. 14 summarizes in one chart the data obtained at three different points in time in FIG. 13.

The CTCF results prove that following the regulation (increase or decrease in expression level) of R2R1 gene expression, the amount (expression level is regulated) of R2R1 protein in the nucleus changes accordingly. In addition, the nuclear localization of the R2R1 protein is consistent with the interaction of R2R1-PcG and R2R1-TrxG.

2.5. Knockdown of R2R1 expression initiates a program of ciliogenesis-related gene expression in PBEC cells from a donor with chronic obstructive pulmonary disease and from a donor without such a lesion. An increase in the expression level of R2R1 leads to suppression of the transcription of genes related to ciliogenesis.

To demonstrate what was said in paragraph 2.5, we performed independent analysis (SPM) of gene expression levels for all samples used in the experiment. This set included samples that met the conditions of MS, FH, FHR2R1, shRNA_OK and shRNA_R2R1, which were taken on

- 20 044826

1st, 2nd and 3rd weeks of exposure to air from PBEC cells from a donor with chronic obstructive pulmonary disease (Br370) and from a donor without obstructive pulmonary disease (Br331). The results indicate that the subset of genes responsible for the largest changes in differential expression consists entirely of genes related to cilia (see Fig. 15). The same is true for conditions in which the level of R2R1 expression decreases (samples that meet MS conditions, shRNA_OK, shRNA_R2R1) and increases (samples that meet MS conditions, FH, FHR2R1); see fig. 16 and 17 respectively. On each of the cartograms, the ROPN1L gene is highlighted, taken as an example.

A closer look at the data revealed that samples with reduced levels of R2R1 expression clustered near a cluster of genes related to cilia (see Figs. 15 and 16). For example, samples from a donor without obstructive pulmonary disease (Br331) under shRNA_R2R1 conditions, taken at week 3 of air exposure (3AE), are located very close to a cluster of genes related to cilia. For samples with an increased level of R2R1 expression, the opposite situation occurs: samples with an increased level of R2R1 expression under FHR2R1 conditions are located at a greater distance from the cluster of genes related to cilia along the XY axes. For example, samples from a donor with chronic obstructive pulmonary disease (Br370) under FHR2R1 conditions taken at week 1 of air exposure (1AE) are located at the opposite end of the ciliogenesis-related gene cluster. On the cartograms presented in Fig. 15, 16 and 17, the effect of switching off the R2R1 genes on ciliogenesis in RVSE cells from a donor with chronic obstructive pulmonary disease (Br370) is not entirely clear. However, further analysis revealed that knocking down R2R1 gene expression in PBCE cells from a chronic obstructive pulmonary disease donor (Br370) resulted in a shift closer to the ciliogenesis-related gene cluster along the XY axes (see FIG. 18). The results of this independent analysis indicate restoration of ciliogenesis in PBEC cells in chronic obstructive pulmonary disease.

Finally, analysis using the LIMMA (gene-by-gene) software package confirms the effect of R2R1 gene knockdown on ciliogenesis in PBCE cells from a donor with chronic obstructive pulmonary disease (Br370). Log ₂ intensity plots for expression of the exemplified gene ROPN1L (FIGS. 19, 20 and 21) illustrate the restoration of ciliogenesis in PBEC cells from a chronic obstructive pulmonary disease donor (Br370).

2.6. Changes in the transcriptome should be reflected in the phenotype of the cell. The presence of gene transcripts related to ciliogenesis should lead to an increase in the number of ciliated cells in PBEC cultures grown under ALI conditions from individuals with chronic obstructive pulmonary diseases.

In order for the cellular phenotype characteristic of chronic obstructive pulmonary diseases to change towards the norm, an increase in the number of ciliated cells is necessary. Therefore, it was necessary to prove that an increase in the level of expression of genes related to ciliogenesis is accompanied by an increase in the number of ciliated cells.

PBEC cells (cultured in parallel in the experiments described above) were stained by immunohistochemical methods, namely:

nuclear staining: fluorescent dye 4,6-diamidino-2-phenylindole dihydrochloride (DAPI);

staining of mucus-producing cells: antibodies (45M1) against MUC5AC + secondary antibodies (chicken anti-mouse IgG (H+L), conjugated with fluorescent dye Alexa Fluor® 488);

staining of ciliated cells: monoclonal antibodies against acetylated tubulin (clone 6-11B-1) + secondary antibodies (goat antibodies against mouse IgG (H+L), conjugated with fluorescent dye Alexa Fluor® 594);

Stained cells were counted from 10 fields (magnification x20). In fig. 22 dot plot (bars are mean values with standard deviation SD) illustrates that a decrease in the expression level of R2R1 (under shRNA_R2R1 conditions) leads to an increase in the number of ciliated cells among PBEC in the absence of obstructive pulmonary lesions (Br331) and in chronic obstructive pulmonary disease (Br370) . The opposite is also true: increasing the level of R2R1 expression leads to the disappearance of ciliated cells (see Fig. 23). Negative control for shRNA_R2R1-mediated knockdown of R2R1 expression - expression of negative control shRNA_OK Negative control for FHR2R1 expression - expression of the construct, FH-tag.

Changes in R2R1 expression do not lead to changes in the number of mucus-producing cells (see Figs. 24, 25). This is extremely important because an increase in the number of mucus-producing cells aggravates the symptoms of the disease. In fact, both in chronic obstructive pulmonary disease (Br370) and in the absence of obstructive pulmonary disease (Br331), PBEC cells produce the same number of mucus-producing cells at week 3 of air exposure (regardless of conditions). This once again emphasizes the fact that the main driving factor in the phenotype characteristic of chronic obstructive pulmonary diseases is defective ciliogenesis.

-

Claims (13)

For illustrative purposes, FIGS. 26-29. In each of them, the top row represents triple staining of PBSE cells (blue - nuclei; green - mucus-producing cells; red - ciliated cells). The bottom row represents only the ciliated cells (red) in the same fields as the top row. CLAIM 1. The use of a compound that binds, associates or interacts with Polycomb repressor complex 1 (PRC1) and/or Trithorax group - mixed lineage leukemia (TrxGMLL), for the treatment and/or prevention of diseases and/or conditions associated with abnormal or deficient ciliogenesis, where the compound interferes with, prevents or inhibits the binding between native respiratory cell regenerative gene 1 (R2R1) or wild-type R2R1 with PRC1 and/or TrxG-MLL and/or any of their components or subunits. 2. Use according to claim 1, wherein the compound binds or associates with R2R1 binding sites in the PRC1 complex and/or in the TrxG-MLL complex. 3. Use as in any of the preceding claims, wherein the compound binds or associates with RING domain-containing protein 2 (RNF2), a subunit of PRC1. 4. Use according to any of the preceding claims, wherein the compound binds or associates with the DPY-30 and/or ASH2L protein subunits of the TrxG-MLL complex. 5. Use according to any of the previous paragraphs, wherein the compound is selected from the group consisting of nucleic acids; antisense oligonucleotides; carbohydrates; proteins/peptides; low molecular weight compounds and antibodies or their antigen-binding or target-binding fragments. 6. Use as claimed in any of the preceding claims, wherein the compound interferes with, prevents or inhibits binding between native R2R1 or wild-type R2R1 to PRC1 and/or TrxG-MLL, and the compound contains a sequence corresponding to SEQ ID NO: 1, 2, 3 or 4, a sequence at least 70% identical to it or a fragment thereof that binds PRC1 and/or TrxG-MLL. 7. Use as claimed in any of the preceding claims, wherein the compound interferes with, prevents or inhibits binding between native R2R1 or wild-type R2R1 to PRC1 and/or to TrxG-MLL, the protein or peptide contains a sequence corresponding to SEQ ID NO: 5 or 6 , or a sequence at least 95% identical to them, or a fragment thereof, binding PRC1 and/or TrxG-MLL. 8. Use according to any of the preceding claims, wherein the compound is an antisense oligonucleotide that attenuates, suppresses and/or terminates the expression, function and/or activity of the R2R1 gene. 9. Use as claimed in any of the preceding claims, wherein the compound is an antibody capable of binding to R2R1 or to R2R1 binding sites in the PRC1 complex and/or the TrxG-MLL complex. 10. Use as claimed in any of the preceding claims, wherein the compound is for use in the treatment or prevention of abnormal ciliogenesis. 11. Use according to any of the previous paragraphs, where the compound is intended for use in the treatment or prevention of ciliopathies. 12. Use as claimed in any of the preceding claims, wherein the compound is for use in the treatment or prevention of chronic obstructive pulmonary disease (COPD). 13. Use according to claim 1 or 11, where the disease or condition caused by abnormal or defective ciliogenesis or ciliopathy is selected from primary ciliary dyskinesia, hydrocephalus, polycystic liver and kidney lesions, retinal degeneration, nephronophthisis, Bardet-Biedl syndrome, Alström syndrome and Meckel-Gruber syndrome. -