EA044295B1 - MODULATORS OF APOL1 EXPRESSION - Google Patents

Description

List of sequences

This application is submitted together with a sequence listing in electronic form. The sequence listing is presented as a file called 200779-WO-PCT-SeqListingUpdated.txt, created on May 20, 2019, which is 465 kb in size. Electronic sequence listing information is incorporated herein by reference in its entirety.

Field of technology

Embodiments of the present invention provide methods, compounds, and compositions useful for inhibiting the expression of APOL1 (apolipoprotein L, 1), and in some cases, reducing the amount of APOL1 protein in a cell or animal, which may be useful for treating, preventing, or reducing the intensity of manifestations of APOL1-associated disease.

BACKGROUND OF THE INVENTION

End-stage kidney disease (ESKD) affects more than half a million people in the United States. In the United States, individuals of African descent are approximately twice as likely to develop ESKD as those of other ethnic origins (McClellan W. et al. Am. J. Kidney Dis. 1988. 12: 285-290; Cowie CC et al N Engl J Med 1989 321: 1074-1079). There are no specific treatments for the vast majority of kidney diseases. Antihypertensive and anti-inflammatory treatments have been found to slow progression and reduce symptoms in some patients in some types of chronic kidney disease (CKD), but they do not lead to either resolution of the disease or a complete cessation of disease progression.

New data suggest an association between the existence of two common variants (G1 and G2) in the last exon of APOL1 among patients of African descent and an increased risk of developing CKD (Kao WH et al. Nat. Genet. 2008. 40: 1185-1192; Lipkowitz MS et al. Kidney Int. 2013. 83: 114-120; Genovese G. et al. Science. 2010. 329: 841-845; Tzur et al. Hum Genet. 2010; Kopp et al. J Am Soc Nephrol. 2011). In a 2013 study, G1 and G2 risk variants in APOL1 were associated with higher rates of ESKD and CKD progression observed in patients of African ancestry compared with groups of other ethnic origins, regardless of diabetes status (Parsa A et al. N. Engl J Med 2013 369: 2183-2196). Approximately 50% of subjects of African descent carry one risk allele in APOL1, while approximately 13% of subjects of African descent (~five million people) carry two risk alleles in APOL1, a significant proportion of whom will develop APOL1-associated CKD. Studies of subjects of African descent with two APOL1 risk alleles have demonstrated increased odds ratios for developing many forms of kidney disease, including but not limited to focal segmental glomerulosclerosis (FSGS) (OR=10.5), hypertension-related ESKD (OR=7.3), HIV-associated nephropathy (HIVAN) (OR=29), sickle cell nephropathy (OR=3.4) and lupus membranous nephropathy (OR=5.4) (Genovese et al. Science. 2010; Tzur et al. Hum Genet. 2010; Kopp et al. Science. 2010; al. J Am Soc Nephrol. 2011).

- 1 044295

Brief description of the invention

In one aspect, the present invention provides a compound according to the following formula (SEQ ID NO: 1164):

or a pharmaceutically acceptable salt thereof.

In yet another aspect, the present invention provides a compound or a pharmaceutically acceptable salt thereof comprising a modified oligonucleotide, wherein the modified oligonucleotide is 16 linked nucleosides in length and has a nucleic base sequence consisting of SEQ ID NO: 1164, wherein the modified oligonucleotide comprises:

a gap segment consisting of nine linked deoxynucleosides;

5'-terminal flanking segment consisting of three linked nucleosides; And

3'-terminal flanking segment consisting of four linked nucleosides;

wherein the gap segment is located between the 5'-terminal flanking segment and the 3'-terminal flanking segment; where the 5'-terminal flanking segment contains cEt-nucleosides; where the 3'-terminal flanking segment contains cEt-nucleoside, cEt-nucleoside, cEt-nucleoside and 2'-O-methoxyethylnucleoside in the 5'-3' direction; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine.

In one embodiment of a compound of the invention, the pharmaceutically acceptable salt of such a compound is a sodium salt.

In yet another embodiment of the compound of the invention, the pharmaceutically acceptable salt is a potassium salt.

In another aspect of the present invention there is provided a pharmaceutical composition comprising a compound of the invention and a pharmaceutically acceptable carrier.

In another aspect of the present invention, there is provided a method of inhibiting the expression of APOL1 in a cell, comprising contacting the cell with a compound of the invention, thereby inhibiting the expression of APOL1 in the cell.

In one embodiment of the method of the invention, the cell is located in the kidney of an individual.

In another aspect of the present invention, the use of a compound of the invention is provided for the treatment, prevention or amelioration of a disease associated with APOL1.

Detailed description

It should be understood that both the foregoing general description and the following detailed description are illustrative and explanatory only and are not limiting of the claimed embodiments. As used herein, the use of the singular form includes the plural form unless specifically stated otherwise. In this document, the use of or means and/or unless otherwise indicated. Moreover, the use of the term including, as well as other forms such as includes and included, is not limiting.

Section headings used in this document are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including, without limitation, patents, patent applications, articles, books, scientific proceedings, and reference sequence records in GenBank and NCBI, are hereby expressly incorporated by reference to the portions of the document discussed herein, and in their entirety.

It is understood that the sequence set forth under each SEQ ID NO in the examples contained herein is not dependent on any modification of the sugar moiety, internucleoside linkage, or nucleic base. As such, compounds defined by SEQ ID NO may independently contain one or more modifications of a sugar moiety, internucleoside linkage, or nucleic base. Compounds described by an ION/ISIS number indicate a combination of nucleobase sequence, chemical modification, and motif.

Definitions.

Unless otherwise specified, the following terms have the following meanings.

2'-deoxynucleoside means a nucleoside containing a 2'-H(H)-furanosyl sugar moiety found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, the 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA (uracil) nucleobase.

2'-O-methoxyethyl (also 2'-MOE) refers to a 2'-O(CH ₂ ) ₂ -OCH ₃ instead of the 2'-OH group of the ribosyl ring. 2'-O-methoxyethyl modified sugar is a modified sugar.

2'-MOE nucleoside (also 2'-O-methoxyethyl nucleoside) means a nucleoside containing a 2'-MOE modified sugar moiety.

A 2'-substituted nucleoside or 2-modified nucleoside means a nucleoside containing a 2'-substituted or 2'-modified sugar moiety. As used herein, 2'-substituted or 2-modified in relation to a sugar component means that the sugar component contains at least one 2'-substituent group other than H or OH.

The 3'-terminal target site refers to the nucleotide of the target nucleic acid that is complementary to the nucleotide of the particular compound closest to the 3'-end.

The 5'-terminal target site refers to the nucleotide of the target nucleic acid that is complementary to the nucleotide of the particular compound closest to the 5'-end.

5'-methylcytosine means cytosine with a methyl group attached at the 5' position.

Approximate means within ±10% of the value. For example, if compounds are stated to suppress APOL1 by at least about 70%, it is intended that APOL1 levels are suppressed by an amount in the range of 60 to 80%.

Administration or administration refers to the routes by which a compound or composition provided herein is administered to an individual to perform its intended function. An example route of administration that can be used includes, but is not limited to, parenteral administration such as subcutaneous, intravenous or intramuscular injection or infusion.

Administered simultaneously or co-administered means the administration of two or more compounds by any route in which the patient exhibits the pharmacological effects of both. Coadministration does not require that both compounds be administered in the same pharmaceutical composition, in the same dosage form, through the same route of administration, or at the same time. The effects of both compounds do not necessarily occur at the same time. The effects should only overlap for a certain period of time and do not have to be of the same duration. Simultaneous administration or co-administration covers parallel or sequential administration.

- 3 044295

Amelioration refers to an improvement or reduction in at least one manifestation, sign or symptom of an associated disease, disorder or condition. In certain embodiments, amelioration includes delaying or slowing the progression or reducing the severity of one or more manifestations of a condition or disease. The progression or severity of manifestations can be determined using subjective or objective indicators that are known to those skilled in the art.

Animal refers to a human or non-human animal, including without limitation mice, rats, rabbits, dogs, cats, pigs and non-human primates, including without limitation non-human apes and chimpanzees.

Antisense activity means any detectable and/or measurable activity associated with hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or the protein encoded by such target nucleic acid compared to levels of the target nucleic acid or levels of the target protein in the absence of the target antisense compound.

An antisense compound means a compound containing an oligonucleotide and optionally one or more additional components, such as a conjugate group or a terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds such as oligonucleotides, ribozymes, siRNA, shRNA, ssRNA and compounds whose activity depends on the degree of occupancy of the active sites.

Antisense inhibition means a decrease in the levels of a target nucleic acid in the presence of an antisense compound complementary to the target nucleic acid compared to the levels of the target nucleic acid in the absence of the antisense compound.

Antisense mechanisms are all such mechanisms that involve hybridization of a compound to a target nucleic acid, where the result or effect of hybridization is either destruction of the target or occupancy of the target with concomitant blocking of cellular machinery involving, for example, transcription or splicing.

Antisense oligonucleotide means an oligonucleotide having a nucleic base sequence complementary to the target nucleic acid or a region or segment thereof. In certain embodiments, the antisense oligonucleotide is capable of specifically hybridizing to a target nucleic acid or region or segment thereof.

APOL1 means any APOL1 nucleic acid or protein. APOL1 nucleic acid means any nucleic acid encoding APOL1. For example, in certain embodiments, the APOL1 nucleic acid includes a DNA sequence encoding APOL1, an RNA sequence transcribed from DNA encoding APOL1 (including genomic DNA containing introns and exons), and an mRNA sequence encoding APOL1. APOL1 mRNA means mRNA encoding APOL1 protein. The target can be specified in upper or lower case.

A specific APOL1 inhibitor refers to any agent capable of specifically inhibiting the expression or activity of APOL1 RNA and/or APOL1 protein at the molecular level. For example, specific APOL1 inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules and other agents capable of suppressing the expression of APOL1 RNA and/or APOL1 protein.

Bicyclic nucleoside or BNA means a nucleoside containing a bicyclic sugar moiety. Bicyclic sugar or bicyclic sugar component means a modified sugar component containing two rings, where the second ring is formed by a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar component does not contain a furanosyl component.

A branching group means a group of atoms with at least 3 positions that can form covalent bonds with at least 3 groups. In certain embodiments, the branching moiety provides multiple reactive sites for the attachment of bound ligands to the oligonucleotide via a conjugating linker and/or a cleavable moiety.

Cell-targeting moiety means a conjugated group or fragment of a conjugated group that is capable of binding to a particular cell type or cell types.

cEt or conformationally restricted by ethyl means a bicyclic ribosyl sugar moiety wherein the second ring of the bicyclic sugar is formed by a bridge connecting a 4' carbon atom and a 2' carbon atom, the bridge having the formula: 4'-CH(CH ₃ )-O- 2' and the methyl group of the bridge is in the S configuration.

- 4 044295 cEt-nucleoside means a nucleoside containing a cEt-modified sugar moiety.

Chemical modification in a compound describes the substitution or change by chemical reaction of any of the structural units in the compound compared to the original state of such structural unit. Modified nucleoside means a nucleoside independently having a modified sugar moiety and/or a modified nucleic acid base. Modified oligonucleotide means an oligonucleotide containing at least one modified internucleoside linkage, modified sugar and/or modified nucleic base.

A chemically distinct region refers to a region of a compound that is chemically different in some way from another region of the same compound. For example, a region with 2'-O-methoxyethyl nucleotides is chemically different from a region with nucleotides without 2'-O-methoxyethyl modifications.

Chimeric antisense compounds mean antisense compounds that have at least 2 chemically distinct regions, with multiple subunits per position.

A cleavable bond means any chemical bond that can be broken. In certain embodiments, the cleavable bond is selected from an amide, a polyamide, an ester, an ester, one or both of the esters in a phosphodiester bond, a phosphoester, a carbamate, a disulfide, or a peptide.

A fissionable moiety means a bond or group of atoms that is broken down under physiological conditions, such as within a cell, animal, or human.

Complementary, in relation to an oligonucleotide, means that the nucleic base sequence of that oligonucleotide or one or more regions thereof corresponds to the nucleic base sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleic base sequences are aligned in opposite directions. The nucleobase matches or complementary nucleobases described herein are limited to the following pairs: adenine (A and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine ( ^mC ) and guanine (G), unless otherwise noted. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may contain one or more nucleic base mismatches. In contrast, fully complementary or 100% complementary in relation to oligonucleotides, means that such oligonucleotides are characterized by nucleobase matches on each nucleoside without any nucleobase mismatches.

Conjugated group means a group of atoms that is attached to an oligonucleotide. Conjugated moieties contain a conjugated moiety and a conjugating linker that attaches the conjugated moiety to the oligonucleotide.

Conjugating linker means a group of atoms containing at least one bond that connects the conjugated moiety to the oligonucleotide.

A conjugate moiety refers to a group of atoms that is attached to an oligonucleotide via a conjugating linker.

Contiguous, when referring to an oligonucleotide, refers to nucleosides, nucleic acid bases, sugar moieties, or internucleoside linkages that are directly adjacent to each other. For example, contiguous nucleic acid bases mean nucleic acid bases that are immediately adjacent to each other in a sequence.

Designing or engineered to refers to a method of constructing a compound that specifically hybridizes to a selected nucleic acid molecule.

Diluent means an ingredient in a composition that has no pharmacological activity but is pharmaceutically necessary or desirable. For example, the diluent in the injection composition may be a liquid, such as saline.

Modified in various ways means chemical modifications or chemical substituents that are different from each other, including no modification. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are modified in different ways, even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are modified in different ways, even though they are both naturally occurring, unmodified nucleosides. Nucleosides that are the same but contain different nucleobases are not modified in different ways. For example, a nucleoside containing a 2'-OMe-modified sugar and an unmodified adenine nucleobase and a nucleoside containing a 2'-OMe-modified sugar and an unmodified thymine nucleic base are not modified in different ways.

Dose means a specified amount of a compound or pharmaceutical agent given in one administration or over a specified period of time. In certain embodiments, the dose may be administered in the form of two or more boluses, tablets, or injections. For example, in certain embodiments, if subcutaneous administration is necessary, the required dose may require a volume that is difficult to accommodate in a single injection. In such embodiments, two or more injections may be used to achieve the required dose. In certain embodiments, the dosage may be administered in two or more injections to reduce an injection site reaction in an individual. In other embodiments, the compound or pharmaceutical is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.

A dosage schedule is a combination of doses designed to achieve one or more desired effects.

Double-stranded antisense compound means an antisense compound containing two oligomeric compounds that are complementary to each other and form a duplex, and where one of the two oligomeric compounds contains an oligonucleotide.

An effective amount means an amount of a compound sufficient to achieve the desired physiological effect in an individual requiring the compound. The effective amount may vary among individuals depending on the health and physical condition of the individual being treated, the taxonomic group of the individuals being treated, the composition of the composition, an assessment of the individual's medical condition, as well as other factors considered.

Effectiveness means the ability to produce the desired effect.

Expression includes all functions by which the information encoded in a gene is converted into structures present and functioning in the cell. Such structures include, but are not limited to, transcription and translation products.

Gapmer means an oligonucleotide containing an internal region having several nucleosides that promote cleavage by RNase H, located between external regions having one or more nucleosides, where the nucleosides forming the internal region are chemically different from the nucleoside or nucleosides forming the external regions. The inner area may be called a gap, and the outer areas may be called flanks.

Hybridization means the annealing of oligonucleotides and/or nucleic acids. Without limitation to a specific mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a target nucleic acid.

Immediately adjacent means that there are no intermediate elements between immediately adjacent elements of the same type (eg, there are no intermediate nucleobases between immediately adjacent nucleobases).

Individual means a human or non-human animal selected for treatment or therapy.

Inhibition of expression or activity means a reduction or blocking of expression or activity relative to expression or activity in an untreated or control sample and does not necessarily indicate complete elimination of expression or activity.

Internucleoside linkage means a group or bond that forms a covalent bond between adjacent nucleosides in an oligonucleotide. Modified internucleoside linkage means any internucleoside linkage other than a naturally occurring phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.

Extended oligonucleotides are oligonucleotides that contain one or more additional nucleosides compared to the oligonucleotide disclosed herein, for example, the original oligonucleotide.

Linked nucleosides mean adjacent nucleosides linked to each other by an internucleoside bond.

Linker nucleoside means a nucleoside that links the oligonucleotide to the conjugated moiety. The linker nucleosides are located in the conjugating linker of the compound. Linker nucleosides are not considered part of the oligonucleotide moiety of the compound, even if they are adjacent to the oligonucleotide.

Mismatched or non-complementary means a nucleic base of the first oligonucleotide that is not complementary to the corresponding nucleotide base of the second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned

- 6,044,295 Tids. For example, nucleic acid bases, including but not limited to the universal nucleic acid bases inosine and hypoxanthine, are capable of hybridizing with at least one nucleic acid base but are nonetheless mismatched or non-complementary with respect to the nucleic acid base with which they hybridize. As another example, a nucleic acid base of a first oligonucleotide that is unable to hybridize with a corresponding nucleic acid base of a second oligonucleotide or a target nucleic acid is a mismatched or non-complementary nucleic acid base when the first and second oligonucleotides are aligned.

Modulation refers to the change or adjustment of a characteristic in a cell, tissue, organ or organism. For example, modulation of APOL1 RNA may mean an increase or decrease in the level of APOL1 RNA and/or APOL1 protein in a cell, tissue, organ or organism. A modulator produces a change in a cell, tissue, organ or organism. For example, an APOL1 compound may be a modulator that causes a decrease in the amount of APOL1 RNA and/or APOL1 protein in a cell, tissue, organ or organism.

MOE stands for methoxyethyl.

Monomer refers to one structural unit of the oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

Motif means a characteristic region of unmodified and/or modified sugar components, nucleobases and/or internucleoside linkages in an oligonucleotide.

Natural or naturally occurring remedies are found in nature.

Non-bicyclic modified sugar or non-bicyclic modified sugar component means a modified sugar component that contains a modification, such as a substituent, that does not bridge two sugar atoms to form a second ring.

Nucleic acid refers to molecules made up of monomeric nucleotides. Nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids and double-stranded nucleic acids.

Nucleic base means a heterocyclic moiety capable of pairing with the base of another nucleic acid. As used herein, the naturally occurring nucleobase is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A modified nucleic acid base is a naturally occurring nucleic acid base that is chemically modified. A universal base or universal nucleic base is a nucleic base different from a naturally occurring nucleic base and a modified nucleic base and capable of pairing with any nucleic base.

Nucleic base sequence means the order of contiguous nucleic bases in a nucleic acid or oligonucleotide, regardless of any sugar or internucleoside linkage.

Nucleoside means a compound containing a nucleic acid base and a sugar component. The nucleic base and the sugar component are independently either unmodified or modified. Modified nucleoside means a nucleoside containing a modified nucleic acid base and/or a modified sugar moiety. Modified nucleosides include nucleosides with the nitrogenous bases removed and lacking a nucleobase.

An oligomeric compound means a compound containing one oligonucleotide and optionally one or more additional components, such as a conjugate group or an end group.

Oligonucleotide means a polymer of linked nucleosides, each of which may or may not be modified independently of each other. Unless otherwise stated, oligonucleotides consist of 8-80 linked nucleosides. Modified oligonucleotide means an oligonucleotide where at least one sugar, nucleobase or internucleoside linkage is modified. Unmodified oligonucleotide means an oligonucleotide that does not contain any modification of the sugar, nucleobase or internucleoside linkage.

Parent oligonucleotide means an oligonucleotide whose sequence is used as a basis for the design of more oligonucleotides with similar sequence but different lengths, motifs and/or chemical structures. Newly designed oligonucleotides may have the same or overlapping sequence compared to the original oligonucleotide.

Parenteral administration means administration by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal

- 7 044295 or intracerebroventricular injection.

A pharmaceutically acceptable carrier or diluent means any substance suitable for use when administered to an individual. For example, the pharmaceutically acceptable carrier may be a sterile aqueous solution such as PBS or water for injection.

Pharmaceutically acceptable salts mean physiologically and pharmaceutically acceptable salts of compounds such as oligomeric compounds or oligonucleotides, i.e. salts that retain the necessary biological activity of the original compound and do not impart undesirable toxicological properties to it.

Pharmaceutical means a compound that has a therapeutically beneficial effect when administered to an individual.

Pharmaceutical composition means a mixture of substances suitable for administration to an individual. For example, the pharmaceutical composition may contain one or more compounds or a salt thereof and a sterile aqueous solution.

Phosphothioate bond means a modified phosphate bond in which one of the non-bridging oxygen atoms is replaced by a sulfur atom, phosphorothioate internucleoside bond is a modified internucleoside bond.

Phosphorus component means a group of atoms containing a phosphorus atom. In certain embodiments, the phosphorus component includes a mono-, di-, or triphosphate or phosphorothioate.

A fragment means a certain number of contiguous (ie linked) nucleic acid bases. In certain embodiments, a fragment is a specified number of contiguous nucleic bases of a target nucleic acid. In certain embodiments, a fragment represents a certain number of contiguous nucleic bases of an oligomeric compound.

Prevention refers to delaying or preventing the onset, development, or progression of a disease, disorder, or condition for a period of time ranging from a few minutes to an indefinite period.

A prodrug means a compound in a form outside the body that, when administered to an individual, is metabolized to another form inside the person's body or cells. In certain embodiments, the metabolized form is an active or more active form of a compound (eg, a drug). Typically, conversion of a prodrug within the body is facilitated by the action of enzyme(s) (eg, endogenous or viral enzyme) or chemical(s) present in cells or tissues and/or physiological conditions.

To reduce means to reduce to a lesser degree, size, quantity or number.

A RefSeq number is a unique combination of letters and numbers assigned to a sequence that indicates that the sequence corresponds to a specific transcript target (e.g., target gene). Such sequence and target gene information (collectively, a gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence Database, GenBank, the European Nucleotide Archive, and the Japanese DNA Data Bank (the latter three form the International Nucleotide Sequence Database Collaboration, or INSDC).

A region is defined as a fragment of a target nucleic acid having at least one identifiable structure, function or characteristic.

An RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs, including miRNA mimics.

Segments are defined as smaller fragments or subfragments of regions within a nucleic acid.

Side effects mean physiological disease and/or treatment-related conditions that differ from the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal abnormalities, hepatotoxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, elevated serum aminotransferase levels may indicate hepatotoxicity or abnormal liver function. For example, elevated bilirubin levels may indicate hepatotoxicity or abnormal liver function.

Single-stranded, when applied to a compound, means that the compound has only one oligonucleotide. Self-complementary means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of a single oligonucleotide, where the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex.

Sites are defined as unique nucleic base positions within the target nucleic acid.

Specifically hybridizing refers to an oligonucleotide that has a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce the desired effect while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, the specific hybridization occurs under physiological conditions.

Specific inhibition in relation to a target nucleic acid means reducing or blocking the expression of a target nucleic acid while exhibiting smaller, minimal or no effects on non-target nucleic acids. The reduction does not necessarily indicate complete elimination of expression of the target nucleic acid.

Standard cell assay means the assay(s) described in the examples and acceptable variations thereof.

Standard in vivo experiment means the procedure(s) described in the example(s) and acceptable variations thereof.

A stereorandom chiral center, in the context of a collection of molecules with an identical molecular formula, means a chiral center having a random stereochemical configuration. For example, in a population of molecules containing a stereorandom chiral center, the number of molecules having the ^ configuration of the stereorandom chiral center may not necessarily be the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random if it is the result of a synthesis method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

Sugar component means an unmodified sugar component or a modified sugar component. Unmodified sugar moiety or unmodified sugar means the 2'-OH(H)-ribosyl moiety found in RNA (unmodified RNA sugar moiety) or the 2'-H(H) moiety found in DNA (unmodified DNA sugar moiety). Modified sugar component or modified sugar means a modified furanosyl sugar component or sugar simulant. Modified furanosyl sugar component means a furanosyl sugar containing a non-hydrogen substituent in place of at least one hydrogen or hydroxyl atom of the unmodified sugar component. In certain embodiments, the modified furanosyl sugar moiety is a 2'-substituted sugar moiety. Such modified furanosyl sugar components include bicyclic sugars and non-bicyclic sugars.

Sugar mimic means a modified sugar moiety, other than a furanosyl moiety, that can link a nucleic acid base to another group, such as an internucleoside bond, a conjugate group, or a terminal group, in an oligonucleotide. Modified nucleosides containing sugar mimics may be included in the oligonucleotide at one or more positions, and such oligonucleotides are capable of hybridizing with complementary compounds or nucleic acids.

Synergism or act synergistically refers to the effect of a combination that is greater than the combined effect of each component separately at the same doses.

A target gene refers to a gene encoding a target.

Targeting means the specific hybridization of a compound with a target nucleic acid to induce the desired effect.

Target nucleic acid, target RNA, target RNA transcript, and target nucleic acid each mean a nucleic acid that the compounds described herein are capable of targeting.

Target region means a fragment of a target nucleic acid that is targeted by one or more compounds.

Target segment means the nucleotide sequence of a target nucleic acid that is targeted by a compound. The 5'-terminal target site refers to the nucleotide of the target segment closest to the 5'-end. The 3'-terminal target site refers to the nucleotide of the target segment closest to the 3'-end.

Terminal group means a chemical group or group of atoms that is covalently linked to the end of the oligonucleotide.

A therapeutically effective amount means an amount of a compound, pharmaceutical agent or composition that produces a therapeutically beneficial effect in an individual.

Treatment refers to the administration of a compound or pharmaceutical composition to an animal for the purpose of effecting a change or improvement in a disease, disorder or condition in the animal.

Certain embodiments.

In certain embodiments, methods, compounds, and compositions are provided for inhibiting the expression of APOL1 (APOL1).

In certain embodiments, compounds that target APOL1 nucleic acid are provided. In certain embodiments, the APOL1 nucleic acid has the sequence listed in RefSeq or GENBANK under accession no. NM_003661.3 (incorporated by reference, disclosed herein as SEQ ID NO: 1), NT_011520.9 with truncated nucleotides 15986452-16001905 (SEQ ID NO: 2), NM_001136541.1 (SEQIDNO: 3), NM_001136540.1 (SEQ ID NO: 4), NM145343.2 (SEQ ID NO: 5), DC339680.1 (SEQ ID NO: 6), AK309143.1 (SEQ ID NO: 7), NT_011520.13 with cut-off nucleotides 17543446-17543655 (SEQ ID NO: 8) or NC_000022.11 with cut-off nucleotides 36250001-36271000 (SEQ ID NO: 9). In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the connection is single-stranded. In certain embodiments, the connection is double-stranded.

In certain embodiments, a compound is provided comprising a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic acid base sequence comprising at least 8 contiguous nucleic acid bases from the nucleic acid base sequence of SEQ ID NO: 1164. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the connection is single-stranded. In certain embodiments, the connection is double-stranded.

In certain embodiments, a compound is provided comprising a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic acid base sequence comprising at least 12 contiguous nucleic acid bases from the nucleic acid base sequence of SEQ ID NO: 1164. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the connection is single-stranded. In certain embodiments, the connection is double-stranded.

In certain embodiments, a compound is provided that contains a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 1164. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the connection is single-stranded. In certain embodiments, the connection is double-stranded.

In certain embodiments, a compound is provided comprising a modified oligonucleotide consisting of the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the connection is single-stranded. In certain embodiments, the connection is double-stranded.

In certain embodiments, the compounds target nucleotides 5849-5907, 58535869, 5855-5873, 8145-8180, 8168-8216, 8306-8321, 8320-8338, 8723-8847, 8743-8760, 8829-8847, 87558840, 14342- 14390 and 14342-14370 of APOL1 nucleic acid. In certain embodiments, the compounds target a sequence within nucleotides 5849-5907, 5853-5869, 58555873, 8145-8180, 8168-8216, 8306-8321, 8320-8338, 8723-8847, 8743-8760, 8829-88 47, 8755 -8840, 1434214390 and 14342-14370 of APOL1 nucleic acid having the nucleic base sequence of SEQ ID NO: 2. In certain embodiments, the compounds contain a fragment of at least 8, 9, 10, 11, 12, 13, 14, 15 or 16 contiguous nucleobases, complementary to a fragment of equal length within nucleotides 5849-5907, 5853-5869, 5855-5873, 8145-8180, 81688216, 8306-8321, 8320-8338, 8723-8847, 8743-8 760, 8829-8847, 8755-8840, 14342-14390, and 14342-14370 of an APOL1 nucleic acid having the nucleic base sequence of SEQ ID NO: 2. In certain embodiments, such compounds are antisense compounds, oligomeric compounds, or oligonucleotides.

In certain embodiments, the compounds target a region of the APOL1 nucleic acid having the nucleic acid sequence of SEQ ID NO: 2 located within nucleotide bases 5849-5907, 5853-5869, 5855-5873, 8145-8180, 8168-8216, 8306- 8321, 8320-8338, 8723-8847, 8743-8760, 8829-8847, 8755-8840, 14342-14390 and 14342-14370. In certain embodiments, the compounds target at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleic acid bases located within the aforementioned nucleic acid base regions.

- 10 044295 bases. In certain embodiments, such compounds are antisense compounds, oligomeric compounds, or oligonucleotides. In certain embodiments, the modified oligonucleotide is 10-30 linked nucleosides in length.

In certain embodiments, the compound contains a modified oligonucleotide having a length of 16 linked nucleosides and being complementary to the sequence within nucleotides 5854-5869, 5855-5870, 8164-8179, 8306-8321, 8321-8336, 8744-8759, 8829-8844, or 14 342 -14357 from SEQ ID NO: 2.

In certain embodiments, the compound comprises a modified oligonucleotide having a length of 16 linked nucleosides, and which has a nucleobase sequence comprising a fragment of at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobases from SEQ ID NO: 1164.

In certain embodiments, the compound comprises a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleobase sequence comprising SEQ ID NO: 1164.

In certain embodiments, the compound comprises a modified oligonucleotide that has the nucleic base sequence consisting of SEQ ID NO: 1164.

In certain embodiments, any of the above modified oligonucleotides comprises at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleic acid base.

In certain embodiments, any of the above modified oligonucleotides contains at least one modified sugar. In certain embodiments, the at least one modified sugar contains a 2'-O-methoxyethyl group. In certain embodiments, the at least one modified sugar is a bicyclic sugar, such as containing a 4'-CH(CH ₃ )-O-2' group, a 4'-CH ₂ -O-2' group, or a 4'-( CH ₂ ) ₂ -O-2'.

In certain embodiments, the modified oligonucleotide contains at least one modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.

In certain embodiments, any of the above modified oligonucleotides contains at least one modified nucleic acid base, such as 5-methylcytosine.

In certain embodiments, any of the above modified oligonucleotides contains:

a gap segment consisting of linked deoxynucleosides;

5'-terminal flanking segment consisting of linked nucleosides; And

3'-terminal flanking segment consisting of linked nucleosides;

wherein the gap segment is located between the 5'-terminal flanking segment and the 3'-terminal flanking segment, and where each nucleoside of each flanking segment contains a modified sugar. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length and has a nucleobase sequence comprising the sequence set forth in SEQ ID NO: 1164. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length and has a nucleobase sequence comprising from the sequence mentioned under SEQ ID NO: 1164.

In certain embodiments, the compound comprises or consists of a modified oligonucleotide having a length of 16 linked nucleobases, having a nucleobase sequence comprising or consisting of the sequence set forth in SEQ ID NO: 1164, wherein the modified oligonucleotide comprises:

a gap segment consisting of nine linked deoxynucleosides;

5'-terminal flanking segment consisting of three linked nucleosides; And

3'-terminal flanking segment consisting of four linked nucleosides;

where the gap segment is located between the 5'-terminal flanking segment and the 3'-terminal flanking segment; where the 5'-terminal flanking segment contains cEt-nucleosides; where the 3'-terminal flanking segment contains cEt-nucleoside, cEt-nucleoside, cEt-nucleoside and 2'-O-methoxyethylnucleoside in the 5'-3' direction; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine.

In certain embodiments, the compound contains or consists of the following formula: Tks Tks Tks Tds Gds Tds Ads Ads Gds Tds Gds mCds Aks Aks mCks mCe where A=adenine, mC=5methylcytosine, G=guanine, T=thymine, e=2' -O-methoxyethyl-modified nucleoside, k=cEtmodified nucleoside, d=2'-deoxynucleoside and s=phosphothioate internucleoside linkage.

In certain embodiments, the compound contains or consists of ION 972190 or a salt thereof, wherein they have the following chemical structure:

- 11 044295

In any of the above embodiments, the compound or oligonucleotide may be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the nucleic acid encoding APOL1 .

In any of the above embodiments, the connection may be single-stranded. In certain embodiments, the compound contains deoxyribonucleotides. In certain embodiments, the connection is double-stranded. In certain embodiments, the compound is double-stranded and contains ribonucleotides. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

In certain embodiments, the compounds or compositions provided herein contain a pharmaceutically acceptable salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

In certain embodiments, the compounds or compositions described herein are well tolerated, as demonstrated by the presence of at least one of an increase in alanine transaminase (ALT) or aspartate transaminase (AST) levels of no more than 4-fold, 3-fold, or 2 times, compared with animals treated with saline, or an increase in the weight of the liver, spleen or kidney of no more than 30, 20, 15, 12, 10, 5 or 2%, compared with animals treated with control. In certain embodiments, the compounds or compositions described herein are well tolerated, as demonstrated by the lack of increase in ALT or AST levels compared to animals treated with

- 12 044295 control. In certain embodiments, the compounds or compositions described herein are well tolerated, as demonstrated by the absence of an increase in liver, spleen, or kidney weights compared to control-treated animals.

In certain embodiments, a composition is provided comprising a compound according to any of the above embodiments or any pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity of less than about 40 centipoise (cP), less than about 30 centipoise (cP), less than about 20 centipoise (cP), less than about 15 centipoise (cP), or less than about 10 cp (sp). In certain embodiments, a composition having any of the above viscosities contains a compound provided herein at a concentration of about 100 mg/ml, about 125 mg/ml, about 150 mg/ml, about 175 mg/ml, about 200 mg /ml, approximately 225 mg/ml, approximately 250 mg/ml, approximately 275 mg/ml, or approximately 300 mg/ml. In certain embodiments, the composition having any of the above viscosities and/or compound concentrations has a temperature at or about room temperature of about 20°C, about 21°C, about 22°C, about 23°C, about 24°C , about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.

Some indications.

Certain embodiments provided herein relate to methods of inhibiting the expression of APOL1, which may be useful for treating, preventing, or ameliorating an APOL1-associated disease in an individual by administering a compound that targets APOL1. In certain embodiments, the compound may be a specific inhibitor of APOL1. In certain embodiments, the compound may be an antisense compound, an oligomeric compound, or an oligonucleotide that targets APOL1.

Examples of APOL1-associated diseases amenable to treatment, prevention, and/or amelioration using the methods provided herein include APOL1-associated nephropathy, focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertensive nephropathy, HIV-associated nephropathy, sickle cell nephropathy, ESKD, glomerular disease, ESRD, arterioneprosclerosis, lupus nephritis and other forms of APOL1-associated proteinuric disease.

In certain embodiments, a method of treating, preventing, or ameliorating an APOL1-associated disease in an individual comprises administering to the individual a compound containing a specific APOL1 inhibitor, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the individual is identified as having, or at risk of developing, an APOL1-associated disease. In certain embodiments, the disease is an APOL1-associated nephropathy. In certain embodiments, the APOL1-associated nephropathy is focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertension nephropathy, HIV-associated nephropathy, sickle cell nephropathy, arteronephrosclerosis, lupus nephritis, and other forms of APOL1-associated proteinuric diseases . In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound contains a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic base sequence containing at least 8 contiguous nucleic bases from the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide having length of 16 linked nucleosides and which has a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the connection may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administration of the compound provides improvement in edema, proteinuria, albuminuria, drop in GFR, high lipid levels, high

- 13 044295 cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage and renal failure, prevention or prevention thereof.

In certain embodiments, a method of treating, preventing, or reducing symptoms of edema, proteinuria, albuminuria, drop in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, and renal failure comprises administering to an individual a compound , containing a specific APOL1 inhibitor, thereby treating, preventing or reducing the severity of edema, proteinuria, albuminuria, drop in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage and renal insufficiency. In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound contains a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic base sequence containing at least 8 contiguous nucleic bases from the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide consisting from the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound comprises a modified oligonucleotide having a length of 16 linked nucleosides that has the nucleic base sequence comprising SEQ ID NO: 1164. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the connection may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administration of the compound provides improvement, prevention or prevention of edema, proteinuria, albuminuria, fall in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage and renal failure. In certain embodiments, the individual is identified as having, or at risk of developing, an APOL1-associated disease.

In certain embodiments, a method of inhibiting APOL1 expression in an individual who has or is at risk of developing an APOL1-associated disease comprises administering to the individual a compound containing a specific APOL1 inhibitor, thereby suppressing APOL1 expression in the individual. In certain embodiments, administration of the compound suppresses APOL1 expression in the kidney. In certain embodiments, the disease is an APOL1-associated nephropathy. In certain options for the implementation of APOL1-Associated nephropathy, it is one of the focal-sized glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy, due to hypertension, HIV-anti-accelerated nephropathy, sickle cell nephropathy, artinerionatricoplerosis, and volcanic nephritic nephritic nephritis. , ESKD and other forms of APOL1-composed proteinuric disease. In certain embodiments, the individual has, or is at risk for, edema, proteinuria, albuminuria, drop in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular disease or kidney failure, or a combination of such symptoms. development of such. In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound contains a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic base sequence containing at least 8 contiguous nucleic bases from the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide having length of 16 linked nucleosides and which has a nucleobase sequence comprising the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide consisting of the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified an oligonucleotide having a length of 16 linked nucleosides that has a nucleobase sequence comprising SEQ ID NO: 1164. In certain embodiments, the compound comprises a modified oligonucleotide that has a nucleobase sequence consisting of SEQ ID NO: 1164. In certain embodiments

- 14 044295 connection is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the connection may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administration of the compound provides improvement, prevention or prevention of edema, proteinuria, albuminuria, fall in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage and kidney failure.

In certain embodiments, a method of inhibiting APOL1 expression in a cell includes contacting the cell with a compound containing a specific APOL1 inhibitor, thereby suppressing APOL1 expression in the cell. In certain embodiments, the cell is glomerular. In certain embodiments, the cell is located in a kidney. In certain embodiments, the cell is located in the kidney of an individual who has, or is at risk for developing, APOL1-associated nephropathy. In certain options for the implementation of APOL1-Associated nephropathy, it is one of the focal-sized glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy, due to hypertension, HIV-anti-accelerated nephropathy, sickle cell nephropathy, artinerionatricoplerosis, and volcanic nephritic nephritic nephritis. , ESKD and other forms of APOL1-composed proteinuric disease. In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound contains a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic base sequence containing at least 8 contiguous nucleic bases from the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide having length of 16 linked nucleosides and which has a nucleobase sequence comprising the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide consisting of the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified an oligonucleotide having a length of 16 linked nucleosides that has a nucleobase sequence comprising SEQ ID NO: 1164. In certain embodiments, the compound comprises a modified oligonucleotide that has a nucleobase sequence consisting of SEQ ID NO: 1164. In certain embodiments, the compound is are ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the connection may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

In certain embodiments, a method of reducing or suppressing the severity of edema, proteinuria, albuminuria, drop in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, or renal failure in the kidney of an individual who has a disease associated with or at risk of developing APOL1 involves administering to an individual a compound containing a specific inhibitor of APOL1, thereby reducing or suppressing the severity of edema, proteinuria, fall in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular disease or renal failure in the individual. In certain embodiments, the individual has or is at risk of developing an APOL1-associated disease. In certain embodiments, the APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertension nephropathy, HIV-associated nephropathy, sickle cell nephropathy, arterioneprosclerosis, lupus nephritis, ESKD, and other forms of APOL1-associated nephropathy proteinuric disease . In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound contains a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic base sequence containing at least 8 contiguous nucleic bases from the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide having length 16 knitted nuk

- 15 044295 leosides and which has a nucleobase sequence comprising the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide consisting of the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified an oligonucleotide having a length of 16 linked nucleosides that has a nucleobase sequence comprising SEQ ID NO: 1164. In certain embodiments, the compound comprises a modified oligonucleotide that has a nucleobase sequence consisting of SEQ ID NO: 1164. In certain embodiments, the compound is are ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the connection may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having, or at risk of developing, an APOL1-associated disease.

Certain embodiments include a compound comprising a specific APOL1 inhibitor for use in treating an APOL1-associated disease. In certain embodiments, the disease is focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertensive nephropathy, HIV-associated nephropathy, sickle cell nephropathy, arterioneprosclerosis, lupus nephritis, ESKD, or other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound contains a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic base sequence containing at least 8 contiguous nucleic bases from the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide having length of 16 linked nucleosides and which has a nucleobase sequence comprising the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide consisting of the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified an oligonucleotide having a length of 16 linked nucleosides that has a nucleobase sequence comprising SEQ ID NO: 1164. In certain embodiments, the compound comprises a modified oligonucleotide that has a nucleobase sequence consisting of SEQ ID NO: 1164. In certain embodiments, the compound is are ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the connection may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally.

Certain embodiments include a compound containing a specific APOL1 inhibitor for use in reducing or suppressing the severity of edema, proteinuria, albuminuria, drop in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney disease, glomerular disease, or renal disease. deficiency in an individual who has or is at risk of developing APOL1-associated nephropathy. In certain embodiments, the APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertension nephropathy, HIV-associated nephropathy, sickle cell nephropathy, arterioneprosclerosis, lupus nephritis, ESKD, and other forms of APOL1-associated nephropathy proteinuric disease . In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound contains a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic base sequence containing at least 8 contiguous nucleic bases from the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide having length of 16 linked nucleosides and which has a nucleobase sequence comprising the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide consisting of the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligo

- 16 044295 nucleotide having a length of 16 linked nucleosides, which has a nucleobase sequence consisting of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide that has a nucleobase sequence consisting of SEQ ID NO: 1164. In certain embodiments embodiment, the connection is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the connection may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

Certain embodiments involve the use of a compound containing a specific APOL1 inhibitor for the manufacture or preparation of a medicament for the treatment of an APOL1-associated disease. Certain embodiments involve the use of a compound containing a specific APOL1 inhibitor for the preparation of a medicament for the treatment of an APOL1-associated disease. In certain embodiments, the disease is an APOL1-associated nephropathy. In certain embodiments, the disease is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertension nephropathy, HIV-associated nephropathy, sickle cell nephropathy, arterionephropathy, lupus nephritis, ESKD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound contains a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic base sequence containing at least 8 contiguous nucleic bases from the nucleic base sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide having length of 16 linked nucleosides and which has a nucleobase sequence comprising the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide consisting of the nucleic acid sequence of SEQ ID NO: 1164. In certain embodiments, the compound contains a modified an oligonucleotide having a length of 16 linked nucleosides that has a nucleobase sequence comprising SEQ ID NO: 1164. In certain embodiments, the compound comprises a modified oligonucleotide that has a nucleobase sequence consisting of SEQ ID NO: 1164. In certain embodiments, the compound is are ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163. In any of the above embodiments, the connection may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

Certain embodiments include the use of a compound containing a specific APOL1 inhibitor for the manufacture or preparation of a medicament for reducing or suppressing the severity of edema, proteinuria, albuminuria, fall in GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, lesions kidney, glomerular lesion or renal failure in an individual who has, or is at risk of developing, APOL1-associated nephropathy associated with APOL1. In certain embodiments, the APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertension nephropathy, HIV-associated nephropathy, sickle cell nephropathy, arteronephrosclerosis, lupus nephritis, ESKD, and other forms of APOL1 - associated proteinuric disease. Certain embodiments involve the use of a compound containing a specific APOL1 inhibitor for the preparation of a medicament for the treatment of an APOL1-associated disease. In certain embodiments, the disease is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, hypertension nephropathy, HIV-associated nephropathy, sickle cell nephropathy, arterionephropathy, lupus nephritis, ESKD, and other forms of APOL1-associated proteinuric diseases. In certain embodiments, the compound comprises an antisense compound that targets APOL1. In certain embodiments, the compound comprises an oligonucleotide that targets APOL1. In certain embodiments, the compound comprises a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic acid base sequence comprising at least 8 contiguous nucleic acid bases from the nucleic acid base sequence of SEQ ID NO: 1164. In certain embodiments, with

- 17 044295 the compound comprises a modified oligonucleotide having a length of 16 linked nucleosides and which has a nucleic acid base sequence comprising the nucleic acid base sequence of SEQ ID NO: 1164. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleic acid base sequence of SEQ ID NO: 1164. 1164. In certain embodiments, the compound comprises a modified oligonucleotide having a length of 16 linked nucleosides that has a nucleobase sequence comprising SEQ ID NO: 1164. In certain embodiments, the compound contains a modified oligonucleotide that has a nucleobase sequence consisting of SEQ ID NO: : 1164. In certain embodiments, the compound is ION No. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

In any of the above methods or routes of application, the compound may target APOL1. In certain embodiments, the compound contains or consists of a modified oligonucleotide, for example a modified oligonucleotide of 16 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleic acid base sequences set forth in SEQ ID NOs: 1-9. In certain embodiments, the modified oligonucleotide contains at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleic acid base. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2'-O-methoxyethyl modified sugar, and the modified nucleobase is 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; 5'-terminal flanking segment consisting of linked nucleosides; and a 3' flanker segment consisting of linked nucleosides, wherein the gap segment is located between and immediately adjacent to the 5' flanker segment and the 3' flanker segment, and wherein each nucleoside of each flanker segment contains a modified sugar.

In any of the above embodiments, the modified oligonucleotide is 16 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleic acid base sequences set forth in SEQ ID NOs: 1-9. In certain embodiments, the modified oligonucleotide contains at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleic acid base. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2'-O-methoxyethyl modified sugar, and the modified nucleobase is 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked 2'-deoxynucleosides; 5'-terminal flanking segment consisting of linked nucleosides; and a 3' flanker segment consisting of linked nucleosides, wherein the gap segment is located between and immediately adjacent to the 5' flanker segment and the 3' flanker segment, and wherein each nucleoside of each flanker segment contains a modified sugar.

In any of the above methods or routes of application, the compound contains or consists of a modified oligonucleotide having a length of 16 linked nucleosides and having a nucleic base sequence containing SEQ ID NO: 1164, where the modified oligonucleotide contains: a gap segment consisting of linked 2'-deoxynucleosides ; 5'-terminal flanking segment consisting of linked nucleosides; and a 3'-terminal flanking segment consisting of linked nucleosides; wherein the gap segment is located between the 5' flanker segment and the 3' flanker segment, and wherein each nucleoside of each flanker segment contains a modified sugar.

In any of the above methods or routes of application, the compound contains or consists of a modified oligonucleotide having a length of 16 linked nucleic bases, having a sequence of nucleic bases containing or consisting of the sequence mentioned under SEQ ID NO: 1164, where the modified oligonucleotide contains:

a gap segment consisting of nine linked deoxynucleosides;

5'-terminal flanking segment consisting of three linked nucleosides; And

3'-terminal flanking segment consisting of four linked nucleosides; where the gap segment is located between the 5'-terminal flanking segment and the 3'-terminal flanking segment; where the 5'- 18 044295 terminal flanking segment contains cEt nucleosides; wherein the 3'-terminal flanking segment contains cEt-nucleoside, cEt-nucleoside, cEt-nucleoside and 2'-O-methoxyethylnucleoside in the 5'-3' direction; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine.

In any of the above methods or routes of application, the compound contains or consists of ION 972190 or a salt thereof, having the following chemical structure:

In any of the above methods or routes of application, the compound contains or consists of ION 972190 or a sodium salt thereof, having the following chemical structure:

- 19 044295

In any of the above methods or routes of administration, the compound can be administered parenterally. For example, in certain embodiments, the compound may be administered by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal or intracerebroventricular administration.

Some connections.

In certain embodiments, the compounds described herein may be antisense compounds. In certain embodiments, the antisense compound contains or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleic base sequence complementary to the target nucleic acid sequence.

In certain embodiments, a compound described herein contains or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleic base sequence complementary to the target nucleic acid sequence.

In certain embodiments, the compound or antisense compound is single-stranded. Such a single-stranded compound or antisense compound contains an oligomeric co

- 20 044295 unity or consists of it. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugated group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the single-stranded antisense compound or oligomeric compound oligonucleotide contains a self-complementary sequence of nucleic bases.

In certain embodiments, the connections are double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to the target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleic acid base in the modified oligonucleotide is replaced with a uracil nucleic acid base. In certain embodiments, the compound contains a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide is 16 linked nucleosides long, and the second modified oligonucleotide is 16 linked nucleosides long. In certain embodiments, one of the modified oligonucleotides has a nucleic acid base sequence comprising at least 8 contiguous nucleic acid bases from SEQ ID NO: 1164.

In certain embodiments, the antisense compounds are double-stranded. Such double-stranded antisense compounds comprise a first oligomeric compound having a region complementary to the target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double-stranded antisense compounds typically contains or consists of a modified oligonucleotide and optionally a conjugated group. The oligonucleotide of the second oligomeric compound of such a double-stranded antisense compound may be modified or unmodified. Either or both of the oligomeric compounds of the double-stranded antisense compound may contain a conjugated group. Oligomeric compounds of double-stranded antisense compounds may contain non-complementary nucleoside overhangs.

Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, siRNAs, miRNA-targeting oligonucleotides, and single-stranded RNAi compounds such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and miRNA mimics.

In certain embodiments, a compound described herein has a nucleic base sequence that, when written in the 5'-3' direction, contains a sequence that is inversely complementary to the target segment of the target nucleic acid to which it targets.

In certain embodiments, a compound described herein contains an oligonucleotide having a length of 16 linked subunits.

In certain embodiments, the compound may further comprise additional components or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments in which the conjugated group contains a nucleoside (ie, a nucleoside that binds the conjugated group to the oligonucleotide), the nucleoside of the conjugated group is not counted in the length of the oligonucleotide.

In certain embodiments, the connections may be shortened or truncated. For example, one subunit may be removed from the 5' end (5' truncation) or, alternatively, from the 3' end (3' truncation). In a shortened or truncated junction targeting the APOL1 nucleic acid, two subunits at the 5' end may be deleted, or alternatively, two subunits at the 3' end of the junction may be deleted. Alternatively, the removed nucleosides may be distributed throughout the compound.

If there is one additional subunit in an elongated junction, the additional subunit may be located at the 5' or 3' end of the junction. When there are two or more additional subunits, the added subunits may be adjacent to each other, for example in a compound having two subunits added at the 5' end (5' end addition) or, alternatively, at the 3' end (3 '-terminal addition) of the compound. Alternatively, the added subunits may be distributed throughout the junction.

It is possible to increase or decrease the length of a junction such as an oligonucleotide

- 21 044295 tide, and/or introduction of mismatched bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305-7309; Gautschi et al. J. Natl. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in the sequence, chemical structures, and motifs of an oligonucleotide can greatly affect one or more of the many properties required for clinical testing (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).

In certain embodiments, the compounds described herein are interfering RNA (for RNAi) compounds, which include double-stranded RNA (also called short interfering RNA or siRNA) compounds and single-stranded RNAi (or ssRNA) compounds. ). Such compounds exert their function at least in part through the RISC signaling pathway to disrupt and/or sequester the target nucleic acid (hence include miRNA/miRNA mimetic compounds). The term siRNA, as used herein, is intended to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence-specific RNAi, e.g., short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, modified short interfering oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. Additionally, the term RNAi as used herein is intended to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, translational repression, or epigenetic mechanisms.

In certain embodiments, a compound described herein may comprise any of the APOL1-targeting oligonucleotide sequences described herein. In certain embodiments, the connection may be double-stranded. In certain embodiments, the compound comprises a first strand comprising a fragment of at least 16 contiguous nucleic acid bases from SEQ ID NO: 1164, and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleic acid base sequence of SEQ ID NO: 1164 and a second strand. In certain embodiments, the compound comprises ribonucleotides, wherein the first strand contains uracil (U) instead of thymine (T) in SEQ ID NO: 1164. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to a site in APOL1 , which is the target of SEQ ID NO: 1164, and (ii) the second strand. In certain embodiments, the compound contains one or more modified nucleotides that have a halogen (such as a fluorine group; 2'-F) or an alkoxy group (such as a methoxy group; 2'-OMe) at the 2' position of the sugar. In certain embodiments, the compound contains at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and the at least one 2'-OM sugar modification are arranged in an alternating characteristic region along at least 2, 3, 4, 5, 6, 7, 8. 9, 10, 11, 12, 13, 14, 15, 16 contiguous nucleobases along the strand of the junction, which is a dsRNA. In certain embodiments, the compound contains between adjacent nucleotides one or more bonds other than a naturally occurring phosphodiester bond. Examples of such linkages include phosphoramide, phosphorothioate and diphosphothioate linkages. The compounds may also be chemically modified nucleic acid molecules, as disclosed in US Pat. No. 6,673,661. In other embodiments, the compound comprises one or two capped strands, as disclosed, for example, in WO 00/63364, filed April 19, 2000.

In certain embodiments, the first splice strand is an siRNA guide strand and the second splice strand is an siRNA follower strand. In certain embodiments, the second strand of the connection is complementary to the first strand. In certain embodiments, each strand of the compound is 16 linked nucleosides in length. In certain embodiments, the first or second strand of the compound may contain a conjugated group.

In certain embodiments, a compound described herein may comprise any of the APOL1-targeting oligonucleotide sequences described herein. In certain embodiments, the connection is single-stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound contains a fragment of at least 16 contiguous nucleic acid bases from SEQ ID NO: 1164. In certain embodiments, the compound contains the sequence of nucleic acid bases of SEQ ID NO: 1164. In certain embodiments, the compound contains ribonucleotides, wherein uracil ( U) location

- 22044295 is placed at the thymine (T) site in SEQ ID NO: 1164. In certain embodiments, the compound contains a nucleic base sequence complementary to the site in APOL1 targeted by SEQ ID NO: 1164. In certain embodiments, the compound contains one or more modified nucleotides that have a halogen (such as a fluorine group; 2'-F) or an alkoxy group (such as a methoxy group; 2'-OMe) at the 2' position of the sugar. In certain embodiments, the compound contains at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and the at least one 2'-OMe sugar modification are arranged in an alternating characteristic region along at least 2, 3, 4, 5, 6, 7. 8, 9, 10, 11, 12, 13, 14, 15, 16 adjacent nucleobases along the connecting strand. In certain embodiments, the compound contains between adjacent nucleotides one or more bonds other than a naturally occurring phosphodiester bond. Examples of such linkages include phosphoramide, phosphorothioate and diphosphothioate linkages. The compounds may also be chemically modified nucleic acid molecules, as disclosed in US Pat. No. 6,673,661. In other embodiments, the compound comprises a capped strand, as disclosed, for example, in WO 00/63364, filed April 19, 2000. In certain embodiments, the compound consists of 16 linked nucleosides. In certain embodiments, the compound may contain a conjugate group.

Some mechanisms.

In certain embodiments, the compounds described herein contain or are composed of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. In certain embodiments, the compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one form of antisense activity. In certain embodiments, the compounds described herein selectively act on one or more target nucleic acids. Such compounds contain a sequence of nucleic bases that hybridizes with one or more target nucleic acids, resulting in one or more forms of desired antisense activity, and does not hybridize with one or more non-target nucleic acids, or does not hybridize with one or more non-target nucleic acids in a manner that results in significant undesired antisense activity.

In certain forms of antisense activity, hybridization of a compound described herein with a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H-mediated cleavage of a target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand in the RNA DNA duplex. The DNA in such an RNA DNA duplex need not be unmodified DNA. In certain embodiments, the compounds described herein are sufficiently DNA-like to induce RNase H activity. In addition, in certain embodiments, one or more non-DNA-like nucleosides are permitted in the gap segment of the gapmer.

In certain forms of antisense activity, the compounds described herein, or a fragment of the compound, are incorporated into the RNA-inducible silencing complex (RISC), which ultimately leads to cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of a target nucleic acid by the Argonaute protein. The compounds that are included in RISC are RNAi compounds. RNAi junctions can be double-stranded (siRNA) or single-stranded (ssRNA).

In certain embodiments, hybridization of the compounds described herein with a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain such embodiments, hybridization of a compound to a target nucleic acid results in a change in splicing of the target nucleic acid. In certain embodiments, hybridization of a compound to a target nucleic acid results in inhibition of the binding interaction between the target nucleic acid and the protein or other nucleic acid. In certain such embodiments, hybridization of a compound to a target nucleic acid results in a change in translation of the target nucleic acid.

Forms of antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of nucleic acid splice variants

- 23 044295 acid or protein and/or phenotypic change in a cell or animal.

Target nucleic acids, target regions and nucleotide sequences.

In certain embodiments, the compounds described herein contain or consist of an oligonucleotide containing a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mRNA and pre-mRNA containing intronic, exonic and untranslated regions. In certain embodiments, the target RNA is mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an exon-intron junction. In certain embodiments, at least 50% of the target region is within an intron.

Nucleotide sequences that encode APOL1 include, but are not limited to, the following: RefSeq accession no. NM_003661.3 (incorporated by reference, disclosed herein as SEQ ID NO: 1), NT_011520.9 with truncated nucleotides 15986452-16001905 (SEQ ID NO : 2), NM_001136541.1 (SEQ ID NO: 3), NM_001136540.1 (SEQ ID NO: 4), NM145343.2 (SEQ ID NO: 5), DC339680.1 (SEQ ID NO: 6), AK309143. 1 (SEQ ID NO: 7), NT_011520.13 with cut-off nucleotides 17543446-17543655 (SEQ ID NO: 8) or NC_000022.11 with cut-off nucleotides 36250001-36271000 (SEQ ID NO: 9).

Hybridization.

In some embodiments, hybridization occurs between a compound disclosed herein and an APOL1 nucleic acid. The most common mechanism of hybridization involves the formation of hydrogen bonds (e.g., Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds) between complementary nucleic acid bases of nucleic acid molecules.

Hybridization can occur under various conditions. Hybridization conditions are sequence dependent and determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, compounds provided herein may specifically hybridize to APOL1 nucleic acid.

Complementarity.

An oligonucleotide is said to be complementary to another nucleic acid if the nucleic base sequence of that oligonucleotide or one or more regions thereof matches the nucleic base sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleic base sequences are aligned in opposite directions. The nucleic base matches or complementary nucleobases described herein are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine ( ^m C) and guanine (G), unless otherwise noted. Complementary oligonucleotides and/or nucleic acids do not need to have nucleic base complementarity at each nucleoside and may contain one or more nucleic base mismatches. An oligonucleotide is fully complementary or 100% complementary if such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

In certain embodiments, the compounds described herein contain or are composed of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. Non-complementary nucleic bases between the compound and the APOL1 nucleic acid may be tolerated as long as the compound retains the ability to specifically hybridize to the target nucleic acid. Moreover, the compound may hybridize to one or more APOL1 nucleic acid segments such that intervening or adjacent segments do not participate in the hybridization event (eg, forming a loop, mismatch, or hairpin structure).

In certain embodiments, the compounds provided herein, or a specific fragment thereof, are complementary to an APOL1 nucleic acid, target region, target segment, or specific fragment at 70, 80, 85, 86, 87, 88, 89, 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99 or 100%, or by at least that amount, or by a value not exceeding that amount. In certain embodiments, the compounds provided herein, or a specified fragment thereof, are 70-75%, 75-80%, 80-85 complementary to the APOL1 nucleic acid, target region, target segment, or specified fragment thereof. %, 85-90%,

90-95%, 95-100% or any value within these ranges. The percentage of complementarity of a compound with respect to the target nucleic acid can be determined using standard methods.

For example, a compound in which 18 of the 20 nucleobases of the compound are complementary to the target region and will therefore hybridize specifically would be 90 percent complementary. In this example, the remaining non-complementary nucleic acid bases may cluster or alternate with the complementary nucleic acid bases and do not need to be adjacent to each other or to the complementary nucleic acid bases. Accordingly, a compound that is 18 nucleic bases in length, having four non-complementary nucleic bases that are flanked by two regions that are fully complementary to the target nucleic acid, will have an overall complementarity with the target nucleic acid of 77.8%. The percentage of complementarity of a compound to a target nucleic acid region can be determined in the usual manner using the BLAST (Base Local Alignment Search Tool) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 -410; Zhang and Madden, Genome Res., 1997, 7, 649-656). The percentage of sequence homology, identity, or complementarity can be determined, for example, using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison, Wis.) using default settings, which uses the Smith algorithm -Waterman (Adv. Appl. Math., 1981, 2, 482-489).

In certain embodiments, the compounds described herein, or specific fragments thereof, are fully complementary (ie, 100% complementary) to the target nucleic acid or specific fragment thereof. For example, the compound may be fully complementary to the APOL1 nucleic acid or its target region, or target segment, or target sequence. As used herein, fully complementary means that each nucleic base of a compound is complementary to the corresponding nucleic base of the target nucleic acid. For example, a compound of 20 nucleic bases is completely complementary to a target nucleic acid of 400 nucleobases in length, provided that the target nucleic acid has a corresponding fragment of 20 nucleic bases that is completely complementary to the compound. Fully complementary can also be used in relation to a specific fragment of the first and/or second nucleic acid. For example, a fragment of 20 nucleic bases in a compound of 30 nucleic bases may be completely complementary to a target nucleic acid of 400 nucleobases in length. A 20 nucleobase fragment in a 30 nucleobase fragment is completely complementary to a target sequence if there is a corresponding 20 nucleobase fragment in the target sequence in which each nucleic base is complementary to a nucleic base in the 20 nucleobase fragment in the junction. At the same time, the entire 30 nucleic base compound may or may not be completely complementary to the target sequence depending on whether the remaining 10 nucleobases in the compound are also complementary to the target sequence.

In certain embodiments, the compounds described herein contain one or more mismatched nucleic bases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such a mismatch, but activity against the non-target molecule is reduced by an even greater amount. Thus, in certain such embodiments, the selectivity of the compound is improved. In certain embodiments, the mismatch has a specific location within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain such embodiments, the mismatch is at positions 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3' end of the gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5' end of the flanking region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3' end of the flanking region. In certain embodiments, the mismatch has a specific location within an oligonucleotide that does not have a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

The location of the non-complementary nucleic base may be at the 5' end or at the 3' end of the compound. Alternatively, the non-complementary nucleic acid base or nucleic acid bases may be in the internal junction position. If there are two or

- 25 044295 more non-complementary nucleic bases they can be contiguous (i.e. linked) or non-contiguous. In one embodiment, the non-complementary nucleic acid base is located in the flanking segment of the gapmer oligonucleotide.

In certain embodiments, compounds described herein that are 16 nucleobases in length contain no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleic base(s) relative to a target nucleic acid, such as an APOL1 nucleic acid or a specific fragment thereof.

In certain embodiments, compounds described herein that are 16 nucleic bases in length contain no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleic acid(s). s) base(s) relative to a target nucleic acid, such as an APOL1 nucleic acid or a specific fragment thereof.

In certain embodiments, the compounds described herein also include those compounds that are complementary to a target nucleic acid fragment. As used herein, a fragment refers to a specific number of contiguous (ie, linked) nucleic acid bases within a region or segment of a target nucleic acid. A fragment can also refer to a specific number of contiguous nucleobases in a compound. In certain embodiments, the compounds are complementary to a fragment of at least 8 nucleic bases in the target segment. In certain embodiments, the compounds are complementary to a fragment of at least 9 nucleic bases in the target segment. In certain embodiments, the compounds are complementary to a fragment of at least 10 nucleic bases in the target segment. In certain embodiments, the compounds are complementary to a fragment of at least 11 nucleic bases in the target segment. In certain embodiments, the compounds are complementary to a fragment of at least 12 nucleic bases in the target segment. In certain embodiments, the compounds are complementary to a fragment of at least 13 nucleic bases in the target segment. In certain embodiments, the compounds are complementary to a fragment of at least 14 nucleic bases in the target segment. In certain embodiments, the compounds are complementary to a fragment of at least 15 nucleic bases in the target segment. In certain embodiments, the compounds are complementary to a fragment of at least 16 nucleic bases in the target segment. Also provided are compounds that are complementary to a fragment of at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleic bases in the target segment or fragment within a range limited by any two of these values.

Identity.

The compounds provided herein may also be characterized by a certain percentage of identity to a particular nucleotide sequence, SEQ ID NO or compound represented by a particular ION number, or fragment thereof. In certain embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, the compounds described herein are modified oligonucleotides. As used herein, a compound is identical to a sequence disclosed herein if it has the same ability to form nucleic base pairs. For example, RNA that contains uracil instead of thymidine in the revealed DNA sequence would be considered identical to the DNA sequence because both uracil and thymidine pair with adenine. Also provided are shortened and extended versions of the connections described in this document, as well as connections having non-identical bases relative to the connections provided in this document. Non-identical bases may be adjacent to each other or distributed throughout the compound. The percentage identity of a compound is calculated by the number of bases that have identical base-pairing properties to the sequence to which it is compared.

In certain embodiments, the compounds described herein, or fragments thereof, are identical to one or more compounds, or SEQ ID NO, or fragment thereof, disclosed herein at 70, 75, 80, 85, 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99 or 100% or at least such values. In certain embodiments, the compounds described herein are approximately 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical, or any percentage between such values. a specific nucleotide sequence, SEQ ID NO, or a compound represented by a specific ION number, or a fragment thereof, wherein the compounds contain an oligonucleotide having one or more mismatched nucleic acid bases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain similar embodiments, the mismatch is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or

- 26 044295 from the 3'-end of the oligonucleotide.

In certain embodiments, the compounds described herein contain or consist of antisense compounds. In certain embodiments, a fragment of an antisense compound is compared to a fragment of equal length in a target nucleic acid. In certain embodiments, a fragment of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases is compared to a fragment of equal length in the nucleic acid acid targets.

In certain embodiments, the compounds described herein contain or consist of oligonucleotides. In certain embodiments, the oligonucleotide fragment is compared to a fragment of equal length in the target nucleic acid. In certain embodiments, a fragment of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases is compared to a fragment of equal length in the nucleic acid target acid.

Some modified compounds.

In certain embodiments, the compounds described herein contain or are composed of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides contain at least one modification compared to unmodified RNA or DNA (i.e., contain at least one modified nucleoside (containing a modified sugar component and/or a modified nucleic base) and/or at least one modified internucleoside linkage) .

A. Modified nucleosides.

Modified nucleosides contain a modified sugar moiety or a modified nucleic acid base, or both a modified sugar moiety and a modified nucleic acid base.

1. Modified sugar components.

In certain embodiments, the sugar components are non-bicyclic modified sugar components. In certain embodiments, the modified sugar components are bicyclic or tricyclic sugar components. In certain embodiments, the modified sugar components are sugar simulants. Such sugar simulants may contain one or more substitutions corresponding to substitutions in other types of modified sugar components. In certain embodiments, the modified sugar moieties are nonbicyclic modified furanosyl sugar moieties containing one or more acyclic substituents, including, but not limited to, substituents at the 2', 4', and/or 5' positions. In certain embodiments, the furanosyl sugar component is a ribosyl sugar component. In certain embodiments, one or more acyclic substituents on the non-bicyclic modified sugar moieties are branched. Examples of 2'-substituent groups suitable for non-bicyclic modified sugar moieties include, but are not limited to: 2'-F, 2'-OCH3 (OMe or O-methyl) and 2'O(CH ₂ ) ₂ OCH ₃ (MOE). In certain embodiments, the 2'-substituting groups are selected from halogen, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, OC ₁ -C ₁₀ -alkoxy, substituted OC ₁ -C ₁₀ -alkoxy, OC ₁ -C ₁₀ -alkyl, substituted OC ₁ -C ₁₀ -alkyl, S-alkyl, N(R _m )-alkyl, O-alkenyl, Salkenyl, N(R _m )-alkenyl, O-alkynyl, S-alkynyl, N(R _m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH ₂ ) ₂ SCH ₃ , O(CH ₂ ) ₂ ON(R _m )(R _n ) or OCH ₂ C(=O)-N(R _m )(R _n ), where each Rm and R _n independently represents H, an amino protecting group, or a substituted or unsubstituted C ₁ -C ₁₀ -alkyl, and 2' -substituent groups described in Cook et al., US 6531584; Cook et al., US 5859221; and Cook et al., US 6,005,087. In certain embodiments, such 2' substituent groups may be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO ₂ ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4'-substituent groups suitable for linear non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (eg, methoxy), alkyl, and the groups described in Manoharan et al., WO 2015/106128. Examples of 5'-substituent groups suitable for non-bicyclic modified sugar moieties include, but are not limited to: 5'-methyl (R or S), 5'vinyl and 5'-methoxy. In certain embodiments, non-bicyclic modified sugars contain more than one non-bridging substituent on the sugar, such as in the case of 2'-F-5'-methyl modified sugar moieties, as well as modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 /101157 and Rajeev et al., US2013/0203836.

In certain embodiments, the 2'-substituted nucleoside or non-bicyclic 2'-modified nucleoside contains a sugar moiety containing a linear 2'-substituent

- 27 044295 group selected from: F, NH2, N ₃ , OCF3, OCH3, O(CH2) ₃ NH2, CH2CH=CH2, OCH2CH=CH2,

OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R _m )(Rn), O(CH2)2O(CH2^(CH3)2 and N-substituted acetamide (OCH2C(=O)-N(R _m ) (R _n )), wherein each R _m and R _n independently represents H, an amino protecting group, or a substituted or unsubstituted C ₁ -C ₁₀ alkyl.

In certain embodiments, the 2'-substituted nucleoside or non-bicyclic 2'modified nucleoside contains a sugar moiety containing a linear 2'-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON( CH3)2, O(CH ₂ ) ₂ O(CH ₂ ) ₂ N(CH ₃ ) ₂ and OCH ₂ C(=O)-N(H)CH ₃ (NMA).

In certain embodiments, the 2'-substituted nucleoside or nonbicyclic 2'modified nucleoside contains a sugar moiety containing a linear 2'-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

Nucleosides containing modified sugar moieties, such as non-bicyclic modified sugar moieties, are designated by the position(s) of substitution(s) in the sugar moiety of the nucleoside. For example, nucleosides containing 2'-substituted or 2-modified sugar moieties are called 2'-substituted nucleosides or 2-modified nucleosides.

Certain modified sugar components contain a bridging substituent in the sugar that forms a second ring, resulting in a bicyclic sugar component. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and 2' atoms of the furanose ring. In some such embodiments, the furanose ring is a ribose ring. Examples of such 4'-2'-bridged sugar substituents include, but are not limited to: 4'-CH2-2', 4'-( _CH2 ) _2-2 ', 4'-(CH2) _3-2 ', 4-CH2 -O-2' (LNA), 4'-CH2-S-2', 4'-(CH ₂ ) ₂ -O-2' (ENA), 4'-CH(CH ₃ )-O-2' ( called conformation-limiting ethyl or cEt in the S configuration), 4'-CH ₂ -O-CH ₂ -2', 4'-CH ₂ -N(R)-2', 4'-CH(CH ₂ OCH ₃ ) -O-2' (conformationally constrained MOE or cMOE) and analogs thereof (see, for example, Seth et al., US 7399845, Bhat et al., US 7569686, Swayze et al., US 7741457, and Swayze et al. , US 8022193), 4'-C(CH3)(CH3)-O-2' and its analogs (see, for example, Seth et al., US 8278283), 4'-CH ₂ -N(OCH ₃ )- 2' and its analogs (see, for example, Prakash et al., US 8278425), 4'-CH ₂ -ON(CH3)-2' (see, for example, Allerson et al., US 7696345 and Allerson et al ., US 8124745), 4'-CH ₂ -C(H)(CH3)-2' (see, for example, Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH ₂ -C(=CH ₂ )-2' and its analogs (see, for example, Seth et al., US 8278426), 4'-C(R _a R _b )-N(R)-O -2', 4'-C(R _a R _b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2' wherein R, Ra and Rb each independently represent H, a protecting group or C ₁ -C ₁₂ -alkyl (see, for example, Imanishi et al., US 7427672).

In certain embodiments, such 4'-2' bridges independently contain from 1 to 4 linked groups independently selected from: -[C(R _a )(R _b )] _n -, -[C(R _a )(R _b )] _n -O-, -C(R _a )=C(R _b )-, -C(R _a )=N-, -C(=NRa)-, -C(=O)-, -C( =S)-, -O-, -Si(Ra)2-, -S(=O)x- and -N(Ra)-; Where:

x is 0, 1 or 2;

n is 1, 2, 3 or 4;

R _a and R _b are each independently H, protecting group, hydroxyl, C1- _C12 -alkyl, substituted _C1 - _C12 -alkyl, _C2 - _C12- alkenyl, substituted _C2 - _C12 -alkenyl, C ₂ -C ₁₂ -alkynyl, substituted C ₂ -C ₁₂ -alkynyl, C ₅ -C ₂₀ -aryl, substituted C ₅ -C ₂₀ -aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, alicyclic C ₅ -C _7- radical, substituted alicyclic C ₅ -C ₇ -radical, halogen, OJ1, NJ1J2, SJ1, N ₃ , COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O) ₂ -J1) or sulfoxyl (S(=O)-J1); and each J1 and J2 independently represents H, C ₁ -C ₁₂ -alkyl, substituted C ₁ -C ₁₂ -alkyl, C ₂ -C ₁₂ -alkenyl, substituted C ₂ -C ₁₂ -alkenyl, C ₂ -C ₁₂ - alkynyl, substituted C ₂ -C ₁₂ -alkynyl, C ₅ -C ₂₀ -aryl, substituted C ₅ -C ₂₀ -aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C ₁ -C ₁₂ -aminoalkyl, substituted with C ₁ -C ₁₂ -aminoalkyl or protecting group.

Additional bicyclic sugar components are known in the art, see for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J.

Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al.

Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97,

- 28 044295

5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org.

Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379;

Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S. 7053207, Imanishi et al., U.S. 6268490, Imanishi et al. U.S. 6770748, Imanishi et al., U.S. RE44779; Wengel et al., U.S. 6794499, Wengel et al., U.S. 6670461; Wengel et al., U.S. 7034133, Wengel et al., U.S. 8080644; Wengel et al., U.S. 8034909; Wengel et al., U.S. 8153365; Wengel et al., U.S.

7572582; and Ramasamy et al., U.S. 6525191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. 7547684; Seth et al., U.S. 7666854;

Seth et al., U.S. 8088746; Seth et al., U.S. 7750131; Seth et al., U.S. 8030467; Seth et al., U.S. 8268980; Seth et al., U.S. 8546556; Seth et al., U.S. 8530640; Migawa et al., U.S. 9012421; Seth et al., U.S. 8501805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides into which such bicyclic sugar moieties are included are further defined by isomeric configuration. For example, the LNA nucleoside (described herein) may be in the α-L configuration or the β-D configuration.

LNA (p-B configuration) aL-LNA (aL-configuration) bridge = 4'-CH2-O-2' bridge = 4-CH2-O-2' aL-methyleneoxy-modified (4'-CH ₂ -O -2') or α-L-LNA bicyclic nucleosides were included in oligonucleotides that exhibited antisense activity (Frieden et al., Nucleic Acids Research, 2003, 27, 6365-6372). As used herein, the general description of bicyclic nucleosides includes both isomeric configurations. When specific bicyclic nucleoside positions (eg, LNA or cEt) are identified in the exemplified embodiments herein, they are in the β-D configuration unless otherwise noted.

In certain embodiments, the modified sugar components contain one or more non-bridged sugar substituents and one or more bridged sugar substituents (eg, in the case of 5'-substituted and 4'-2'-bridged sugars).

In certain embodiments, the modified sugar components are sugar simulants. In certain such embodiments, the oxygen atom in the sugar component is replaced, for example, by a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar components also contain bridged and/or non-bridged substituents as described herein. For example, certain sugar mimics contain a 4' sulfur atom and a substitution at the 2' position (see, for example, Bhat et al., U.S. 7875733, and Bhat et al., U.S. 7939677) and/or at the 5' position.

In certain embodiments, the sugar simulants contain rings with a number of atoms other than 5. For example, in certain embodiments, the sugar simulant contains a six-membered tetrahydropyran (THP). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), annitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see, for example, Leumann, C.J. Bioorg. & Med. Chem. 2002, 10, 841854), fluorine HNA:

U O' V^Bx F

F-HNA (F-HNA, see, for example, Swayze et al., U.S. 8088904; Swayze et al., U.S. 8440803; and Swayze et al., U.S. 9005906, F-HNA may also be called F-THP or 3' -fluorotetrahydropyran) and nucleosides containing additional modified THP compounds of the following formula:

- 29 044295

where, independently for each specified modified THP nucleoside:

Bx is a nucleic base component;

each of T ₃ and T ₄ independently represents an internucleoside linking group linking the modified THP nucleoside to the rest of the oligonucleotide, or one of T ₃ and T ₄ is an internucleoside linking group linking the modified THP nucleoside to the rest of the oligonucleotide, and the other of T ₃ and T ₄ represents H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3' end group; each of q ₁ , q ₂ , q ₃ , q ₄ , q ₅ , q ₆ and q ₇ independently represents H, C 1 -C ₆ alkyl substituted with C 1 -C ₆ alkyl, C ₂ -C ₆ alkenyl substituted with C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl or substituted C ₂ -C ₆ alkynyl; and each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N ₃ , OC(=X)J1, OC(=X)NJ1J2, NJ ₃ C(=X)NJ ₁ J ₂ , and CN, where X represents O, S or NJ _b and each of J1, J2, and J ₃ independently represents H or C1-C ₆ alkyl.

In certain embodiments, modified THP nucleosides are provided, wherein each of q ₁ , q ₂ , q ₃ , q ₄ , q ₅ , q ₆ and q ₇ is H. In certain embodiments, at least one of q ₁ , q ₂ , _q3 , _q4 , _q5 , _q6 , and _q7 is other than H. In certain embodiments, at least one of _q1 , _q2 , _q3 , _q4 , _q5 , _q6 , and _q7 represents methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R ₁ and R ₂ is F. In certain embodiments, R 1 is F and R 2 is H, in certain embodiments R ₁ is methoxy and R ₂ is H, and in certain embodiments, R1 is methoxyethoxy and _R2 is H.

In certain embodiments, sugar mimics contain rings containing more than 5 atoms and more than one heteroatom. For example, nucleosides containing morpholine sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5698685; Summerton et al. , U.S. 5166315; Summerton et al., U.S. 5185444; and Summerton et al., U.S. 5034506). As used herein, the term morpholine component means a sugar simulant with the following structure:

In certain embodiments, the morpholine components can be modified, for example, by adding or changing various substituent groups in the above structure of the morpholine component. Such sugar mimics are referred to herein as modified morpholine components.

In certain embodiments, sugar simulants contain acyclic components. Examples of nucleosides and oligonucleotides containing such acyclic sugar mimics include, but are not limited to, peptide nucleic acid (PNA), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 77, 5853- 5865), as well as nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.

Many other bicyclic and tricyclic ring systems of sugars and sugar mimics are known in the art and can be used in modified nucleosides.

2. Modified nucleic bases.

Nucleic acid bases (or bases) with modifications or substitutions are structurally different from, but are functionally interchangeable with, naturally occurring or synthetic unmodified nucleic acid bases. Both natural and modified nucleic bases can take part in the formation of hydrogen bonds. Such modifications of nucleic acid bases may impart nuclease stability, binding affinity, or some other advantageous biological property to the antisense compounds.

In certain embodiments, the compounds described herein contain modified oligonucleotides. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides containing an unmodified nucleic acid base. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides containing a modified nucleic acid base. In certain embodiments, the modified oligonucleotides contain one or more nucleosides that do not contain a nucleobase, referred to as base-deleted nucleosides.

In certain embodiments, the modified nucleic acid bases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2-, N-6-, and 0-6-substituted purines. In certain embodiments, the modified nucleic acid bases are selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-propynyl(C=CCH ₃ )-uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothimine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halogen, 8 -amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halogen, in particular 5-bromo, 5-trifluoromethyl, 5-halogenuracil and 5halocytosine, 7-methylguanine, 7- methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-Nbenzoylcytosine, 4-N-benzoyluracil, 5- methyl 4-N-benzoylcytosine, 5-methyl-4-N-benzoyluracil, universal bases, hydrophobic bases, non-specific pairing bases, extended bases and fluorinated bases. Additional modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin2-one (G- shaped clamp). Modified nucleic acid bases may also include nucleic acid bases in which the purine or pyrimidine base is replaced by other heterocycles, for example, 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleic acid bases include those disclosed in Merigan et al., US 3687808, nucleic acid bases disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859 ; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Section 15, Antisense Research and Applications, Crooke, ST and Lebleu, V., Eds., CRC Press, 1993, 273-288; and nucleic acid bases disclosed in chapters 6 and 15 of Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, pages 163-166 and 442-443.

Publications describing the preparation of some of the above modified nucleic acid bases, as well as other modified nucleic acid bases, include, but are not limited to:

Manoharan et al., US2003/0158403,

Manoharan et al., US2003/0175906; Dinh et al., U.S. 4845205; Spielvogel et al., U.S. 5130302;

Rogers et al., U.S. 5134066; Bischofberger et al., U.S. 5175273; Urdea et al., U.S. 5367066;

Benner et al., U.S. 5432272; Matteucci et al., U.S. 5434257; Gmeiner et al., U.S. 5457187; Cook et al., U.S. 5459255; Froehler et al., U.S. 5484908; Matteucci et al., U.S. 5502177; Hawkins et al., U.S. 5525711; Haralambidis et al., U.S. 5552540; Cook et al., U.S. 5587469; Froehler et al., U.S. 5594121; Switzer et al., U.S. 5596091; Cook et al., U.S. 5614617; Froehler et al., U.S. 5645985;

Cook et al., U.S. 5681941; Cook et al., U.S. 5811534; Cook et al., U.S. 5750692; Cook et al., U.S. 5948903; Cook et al., U.S. 5587470; Cook et al., U.S. 5457191; Matteucci et al., U.S. 5763588;

Froehler et al., U.S. 5830653; Cook et al., U.S. 5808027; Cook et al., U.S. 6166199; and Matteucci et al., U.S. 6005096.

In certain embodiments, compounds targeting the APOL1 nucleic acid contain one or more modified nucleic acid bases. In certain embodiments, the modified nucleic base is 5'methylcytosine. In certain embodiments, each cytosine is 5-methylcytosine.

Modified internucleoside bonds.

The naturally occurring internucleoside bond in RNA and DNA is a 3'-5' phosphodiester bond. In certain embodiments, the compounds described herein having one or more modified, i.e. non-naturally occurring internucleoside linkages are often preferred over antisense compounds with naturally occurring internucleoside linkages due to their desirable properties, such as, for example, increased cellular uptake, increased affinity for target nucleic acids, and increased stability in the presence of nucleases.

Exemplary internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonate and phosphorothioate linkages. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as arrays of modified oligonucleotides containing stereorandom internucleoside linkages or as arrays of modified oligonucleotides containing phosphorothioate linkages in specific stereochemical configurations. In certain embodiments, assemblies of modified oligonucleotides contain phosphorothioate internucleoside linkages, wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be prepared using synthetic methods that result in a random selection of the stereochemical configuration of each phosphorothioate bond. However, as is well understood by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule is characterized by a specific stereoconfiguration. In certain embodiments, the populations of modified oligonucleotides are enriched with modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, a particular configuration of a particular phosphorothioate bond is present in at least 65% of the molecules in the aggregate. In certain embodiments, a particular configuration of a particular phosphorothioate bond is present in at least 70% of the molecules in the aggregate. In certain embodiments, a particular configuration of a particular phosphorothioate bond is present in at least 80% of the molecules in the aggregate. In certain embodiments, a particular configuration of a particular phosphorothioate bond is present in at least 90% of the molecules in the aggregate. In certain embodiments, a particular configuration of a particular phosphorothioate bond is present in at least 99% of the molecules in the aggregate. Such chirally enriched arrays of modified oligonucleotides can be prepared using synthetic methods known in the art, for example those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014) and WO 2017/015555. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one specified phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides containing (Rp)- and/or (Sp)phosphothioates provide one or more of the following formulas, respectively, where B indicates a nucleic base:

Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein may be stereorandom or in a specific stereochemical configuration.

In certain embodiments, compounds targeting the APOL1 nucleic acid contain one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage.

In certain embodiments, the compounds described herein contain oligonucleotides. Oligonucleotides with modified internucleoside bonds contain internucleoside bonds that retain a phosphorus atom, as well as internucleoside bonds that do not have a phosphorus atom. Exemplary phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate linkages. Methods for producing phosphorus-containing and phosphorus-free bonds are well known.

In certain embodiments, the nucleosides of the modified oligonucleotides may be linked to each other via any internucleoside linkage. The two main classes of internucleoside linking groups are determined by the presence or absence of a phosphorus atom. Exemplary phosphorus-containing internucleoside linkages include, but are not limited to, phosphate linkages, which include phosphodiester (P=O) linkages (also referred to as unmodified or naturally occurring linkages), phosphotriester, methylphosphonate, phosphoramidate, as well as phosphorothioate (P=S) and diphosphothioate (HS) -P=S) connections. Illustrative phosphorus-free

- 32 044295 internucleoside linking groups include, but are not limited to, methylene-methylimino (-CH2N(CH ₃ )-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-); siloxane (-O-SiH ₂ -O-) and N,N'-dimethylhydrazine (-CH2-N(CH ₃ )-N(CH ₃ )-) groups. Modified internucleoside bonds, as opposed to naturally occurring phosphate bonds, can be used to modify, typically increasing, the resistance of an oligonucleotide to nucleases. In certain embodiments, internucleoside linkages having a chiral atom can be obtained as a racemic mixture or as individual enantiomers. Exemplary chiral internucleoside linkages include, but are not limited to, alkylphosphonate and phosphorothioate linkages. Methods for preparing phosphorus-containing and phosphorus-free internucleoside linkages are well known to those skilled in the art.

Neutral internucleoside linkages include, but are not limited to, phosphotriester linkages, methylphosphonate linkages, MMI (3'-CH2-N(CH ₃ )-O-5'), 3-amide (3'-CH ₂ -C(=O)-N(H) -5'), 4-amide (3'-CH ₂ -N(H)C(=O)-5'), formoacetal (3'-O-CH2-O-5'), methoxypropyl and thioformacetal bonds (3 '-S-CH ₂ O-5'). Additional neutral internucleoside bonds include nonionic bonds including siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfonate ester, and amide bonds (see, for example, Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; sections 3 and 4, 40-65). Additional neutral internucleoside bonds include nonionic bonds containing a combination of N, O, S and CH ₂ moieties.

In certain embodiments, oligonucleotides contain modified internucleoside linkages located along the oligonucleotide or region thereof as a defined characteristic region or motif of modified internucleoside linkages. In certain embodiments, the internucleoside linkages are arranged in a gap-containing motif. In such embodiments, the internucleoside linkages in each of the two flanking regions are different from the internucleoside linkages in the gap region. In certain embodiments, the internucleoside linkages in the flanks are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so that such oligonucleotides having a gap-containing internucleoside motif may or may not have a gap-containing nucleoside motif, and if they do have a gap-containing nucleoside motif, the length of the flanks and the gap may or may not be be the same.

In certain embodiments, the oligonucleotides comprise a region having an alternating motif of internucleoside linkages. In certain embodiments, the oligonucleotides contain a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide contains a region having homogeneous bonds that are phosphorothioate internucleoside bonds. In certain embodiments, the oligonucleotide has uniform phosphorothioate bonds. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate, and at least one internucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide contains at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide contains at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide contains at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide contains at least one block consisting of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide contains at least one block consisting of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide contains at least one block consisting of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide contains at least one block consisting of at least 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides at the 3' end of the oligonucleotide.

In certain embodiments, the oligonucleotides contain one or more methylphosphonate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif include a linkage motif containing linkages that are all phosphorothioate linkages except one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate bond is located in the central gap of an oligonucleotide having a gapmer nucleoside motif.

In certain embodiments, it is desirable to order the amount of phosphorothioate

- 33 044295 internucleoside bonds and phosphodiester internucleoside bonds to maintain resistance to nucleases. In certain embodiments, it is desirable to regularize the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages can be reduced and the number of phosphodiester internucleoside linkages can be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages can be reduced and the number of phosphodiester internucleoside linkages can be increased while still maintaining nuclease resistance. In certain embodiments, it is desirable to reduce the number of phosphorothioate internucleoside linkages while still maintaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester internucleoside linkages while still maintaining nuclease resistance.

3. Some motives.

In certain embodiments, the compounds described herein contain oligonucleotides. Oligonucleotides may have a motif, for example, a characteristic region of unmodified and/or modified sugar moieties, nucleic acid bases and/or internucleoside linkages. In certain embodiments, the modified oligonucleotides contain one or more modified nucleosides containing a modified sugar. In certain embodiments, the modified oligonucleotides comprise one or more modified nucleosides containing a modified nucleic acid base. In certain embodiments, the modified oligonucleotides contain one or more modified internucleoside linkages. In such embodiments, the characteristic region or motif defines the modified, unmodified, and variously modified sugar moieties, nucleic acid bases, and/or internucleoside linkages of the modified oligonucleotide. In certain embodiments, each characteristic region of sugar components, nucleobases, and internucleoside linkages is independent of the others. Thus, a modified oligonucleotide can be described by its sugar motif, nucleobase motif, and/or internucleoside linkage motif (as used herein, nucleobase motif describes modifications of the nucleobases regardless of the sequence of the nucleobases).

A. Some motifs from sugars.

In certain embodiments, the compounds described herein contain oligonucleotides. In certain embodiments, oligonucleotides contain one or more types of modified sugar and/or unmodified sugar moieties arranged along the oligonucleotide or region thereof in a defined characteristic sugar region or motif. In some cases, such sugar motifs include, without limitation, any sugar modifications discussed herein.

In certain embodiments, the modified oligonucleotides contain or consist of a region having a gapmer motif that contains or consists of two outer regions, or flanks, and a central or inner region, or gap. The three regions of the gapmer motif (5' flank, gap and 3' flank) form a contiguous sequence of nucleosides in which at least some of the sugar components of the nucleosides of each flank are different from at least some of the sugar components of the gap nucleosides. In particular, at least the sugar components of the nucleosides of each flank that are closest to the gap (the 5' flank nucleoside closest to the 3' end and the 3' flank nucleoside closest to the 5' end) differ from the sugar components of neighboring gap nucleosides, which thus defines the boundary between the flanks and the gap (i.e., the point of junction of the flank and the gap). In certain embodiments, all of the sugar components in the gap are the same. In certain embodiments, the gap contains one or more nucleosides having a sugar component that is different from the sugar component of one or more other gap nucleosides. In certain embodiments, all sugar motifs of the two flanks are the same (symmetrical gapmer). In certain embodiments, the 5' flank sugar motif is different from the 3' flank sugar motif (asymmetric gapmer).

In certain embodiments, gapmer flanks contain 1-5 nucleosides. In certain embodiments, gapmer flanks contain 2-5 nucleosides. In certain embodiments, gapmer flanks contain 3-5 nucleosides. In certain embodiments, all gapmer nucleosides are modified nucleosides.

In certain embodiments, the gapmer gap contains 7-12 nucleosides. In certain embodiments, the gapmer gap contains 7-10 nucleosides. In certain embodiments, the gapmer gap contains 8-10 nucleosides. In certain embodiments, the gapmer gap contains 10 nucleosides. In a certain embodiment, each gapmer gap nucleoside is an unmodified 2'-deoxynucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In such options

- 34 044295 implementation, the nucleosides on the gap side of each flank-gap junction are unmodified 2'-deoxynucleosides, and the flank-side nucleosides from each flank-gap junction are modified nucleosides. In certain such embodiments, each gap nucleoside is an unmodified 2'-deoxynucleoside. In certain such embodiments, each nucleoside of each flank is a modified nucleoside.

In certain embodiments, the modified oligonucleotide has a completely modified sugar motif, wherein each nucleoside of the modified oligonucleotide contains a modified sugar moiety. In certain embodiments, the modified oligonucleotides contain or consist of a region having a completely modified sugar motif, wherein each nucleoside of the region contains a modified sugar moiety. In certain embodiments, the modified oligonucleotides contain or consist of a region having a fully modified sugar motif, wherein each nucleoside in the fully modified region contains the same modified sugar moiety, and such region is referred to herein as a uniformly modified sugar motif. In certain embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide contains the same 2' modification.

b. Some motifs from nucleic bases.

In certain embodiments, the compounds described herein contain oligonucleotides. In certain embodiments, oligonucleotides contain modified and/or unmodified nucleic acid bases arranged along the oligonucleotide or region thereof in a defined characteristic region or motif. In certain embodiments, each nucleic base is modified. In certain embodiments, none of the nucleic bases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine.

In certain embodiments, the modified oligonucleotides comprise a block of modified nucleic acid bases. In certain such embodiments, the block is located at the 3' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleosides at the 3' end of the oligonucleotide. In certain embodiments, the block is located at the 5' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleosides at the 5' end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside containing a modified nucleic base. In certain such embodiments, one nucleoside containing a modified nucleic base is located in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleic acid base is selected from 2-thiopyrimidine and 5-propine pyrimidine.

With. Some motifs from internucleoside bonds.

In certain embodiments, the compounds described herein contain oligonucleotides. In certain embodiments, oligonucleotides contain modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined characteristic region or motif. In certain embodiments, virtually each internucleoside linking group is a phosphate internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is independently selected from phosphorothioate and phosphate internucleoside linkages. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside bonds in the gap are modified. In certain such embodiments, some or all of the flanking internucleoside linkages are unmodified phosphate bonds. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer and the internuclear motif

- 35 044295 leoside linkage contains at least one phosphodiester internucleoside linkage in at least one flank, where at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In some such embodiments, all of the phosphorothioate bonds are stereorandom. In certain embodiments, all of the flanking phosphorothioate bonds are (Sp)-phosphothioates, and the gap contains at least one Sp, Sp, Rp motif. In certain embodiments, the modified oligonucleotide assemblies are enriched with modified oligonucleotides containing such internucleoside linkage motifs.

4. Some modified oligonucleotides.

In certain embodiments, the compounds described herein contain modified oligonucleotides. In certain embodiments, the above modifications (sugars, nucleobases, internucleoside linkages) are included in the modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification, motifs, and overall length values. In certain embodiments, each of such parameters is independent of the others. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer motif of sugars may or may not be modified and may or may not correspond to the gapmer nature of the sugar modifications. For example, the internucleoside linkages in the flanking regions of the sugar gapmer may be the same or different from each other, and may be the same as or different from the internucleoside linkages in the gap region of the sugar gap motif. Likewise, such gapmer oligonucleotides may contain one or more modified nucleic acid bases regardless of the gapmer nature of the sugar modifications. In addition, in some cases, the oligonucleotide is described by a total length or range of lengths, or lengths or ranges of lengths of two or more regions (for example, regions of nucleosides having the specified sugar modifications), in such circumstances it may be possible to select for each range such amounts that the result is an oligonucleotide having a total length outside the specified range. In such circumstances, the requirements for both elements must be satisfied. For example, in certain embodiments, the modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having said sugar motif, region B consists of 6-10 linked nucleosides having the specified sugar motif, and region C consists of 2-6 linked nucleosides having the specified sugar motif. Such embodiments do not include modified oligonucleotides in which A and C each consist of 6 linked nucleosides and B each consists of 10 linked nucleosides (even though these amounts of nucleosides are permissible under the requirements for A, B and C), since the total length of such an oligonucleotide is 22, which exceeds the upper limit of the total length of the modified oligonucleotide (20). As used herein, if the oligonucleotide description is silent regarding one or more parameters, then such parameter is not limited. Thus, a modified oligonucleotide, described only as having a gapmer motif of sugars without further description, can have any length, any motif of internucleoside bonds, and any motif of nucleic bases. Unless otherwise stated, all modifications are nucleobase sequence independent.

Some conjugated compounds.

In certain embodiments, the compounds described herein contain or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or end groups. Conjugated moieties consist of one or more conjugated moieties and a conjugating linker that links the conjugated moiety to an oligonucleotide. Conjugated groups can be attached to either one or both ends of the oligonucleotide and/or at any internal position. In certain embodiments, the conjugated groups are attached to the nucleoside of the modified oligonucleotide at the 2' position. In certain embodiments, conjugate groups attached to either one or both ends of the oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or end groups are attached at the 3' and/or 5' end of the oligonucleotides. In certain such embodiments, conjugated groups (or end groups) are attached at the 3' end of the oligonucleotides. In certain embodiments, the conjugated groups are attached near the 3' end of the oligonucleotides. In certain embodiments, conjugated groups (or end groups) are attached at the 5' end of the oligonucleotides. In certain embodiments, the conjugated groups are attached near the 5' end of the oligonucleotides.

In certain embodiments, the oligonucleotide is modified. In certain embodiments, the compound oligonucleotide has a nucleic base sequence that is complementary to the target nucleic acid. In certain embodiments, the oligonucleotides are complementary to messenger RNA (mRNA). In certain embodiments, the oligonucleotides are complementary to the sense transcript.

Examples of end groups include, but are not limited to, conjugate groups, cap groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Some conjugated groups.

In certain embodiments, one or more conjugated groups are covalently attached to the oligonucleotides. In certain embodiments, conjugated moieties modify one or more properties of the oligonucleotide to which they are attached, including, without limitation, pharmacodynamic characteristics, pharmacokinetic characteristics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, conjugated groups impart a new property to the oligonucleotide to which they are attached, for example, fluorophores or reporter groups provide detection of the oligonucleotide.

Some conjugated groups and conjugated components have been described previously, for example: cholesterol component (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med . Chem. Lett., 1994, 4, 1053-1060), a thioether, for example, hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chain, for example dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49 -54), a phospholipid such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973) or adamantaneacetic acid, palmityl component (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylaminocarbonyloxycholesterol component (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or the GalNAc cluster (e.g. WO2014/179620).

1. Conjugated components.

Conjugated moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioesters, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin , phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores and dyes.

In certain embodiments, the conjugate component comprises an active drug substance, e.g., aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod , flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethicin, barbiturate, cephalosporin, sulfa drug, antidiabetic drug, antibacterial agent or antibiotic.

2. Conjugating linkers.

Conjugated components are attached to oligonucleotides using conjugating linkers. In some compounds, the conjugate moiety comprises a single chemical bond (ie, the conjugate moiety is attached to the oligonucleotide by a conjugating linker through a single bond). In certain embodiments, the conjugating linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units.

In certain embodiments, the conjugating linker contains one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamine. In certain such embodiments, the conjugating linker contains groups selected from alkyl, amino, oxo, amide and ester groups. In certain embodiments, the conjugating linker contains groups selected from alkyl and amide groups. In certain embodiments, the conjugating linker contains groups selected from alkyl and ether groups. In certain embodiments, the conjugating linker contains at least one phosphorus-containing component. In certain embodiments, the conjugating linker contains at least one phosphate group. In certain embodiments, the conjugating linker contains at least one neutral linking group.

In certain embodiments, conjugating linkers, including the conjugating linkers described above, are bifunctional linking moieties, such as those known in the art to be useful for attaching conjugated moieties to parent compounds, such as the oligonucleotides provided herein. Typically, the bifunctional linker contains at least two functional groups. One of the functional groups is selected to bind to a specific site in the compound, and the other is selected to bind to a conjugated group. Examples of functional groups used in the bifunctional coupling component include, but are not limited to, electrophiles to react with nucleophilic groups and nucleophiles to react with electrophilic groups. In certain embodiments, the bifunctional linking components contain one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugating linkers include, but are not limited to, pyrrolidine, 8-amino-3,6dioxaoctanoic acid (ADO), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugating linkers include, but are not limited to, substituted or unsubstituted C ₁ -C ₁ o-alkyl, substituted or unsubstituted C ₂ -C ₁₀ alkenyl, or substituted or unsubstituted C ₂ -C ₁₀ -alkynyl, wherein a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, the conjugating linkers contain 1-10 linker nucleosides. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides contain a modified sugar moiety. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides contain an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavage moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-Nbenzoyladenine, guanine, and 2-N- isobutyrylguanine. In general, it is desirable that the linker nucleosides are cleaved from the compound after it reaches the target tissue. Accordingly, linker nucleosides are typically linked to each other and to the rest of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

In this document, linker nucleosides are not considered part of the oligonucleotide. Accordingly, in embodiments in which the compound contains an oligonucleotide consisting of linked nucleosides in a specified amount or range of quantities and/or characterized by a specified percentage of complementarity with respect to a reference nucleic acid, and the compound also contains a conjugated group containing a conjugating linker containing the linker nucleosides , these linker nucleosides are not taken into account when determining the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide with respect to the reference nucleic acid. For example, the compound may contain (1) a modified oligonucleotide consisting of 8-30 nucleosides, and (2) a conjugated group containing 1-10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is greater than 30. Alternatively, the compound may contain a modified oligonucleotide consisting of 8-30 nucleosides and not contain a conjugated group. The total number of contiguous linked nucleosides in such a compound does not exceed 30. Unless otherwise specified, conjugating linkers contain no more than 10 linker nucleosides. In certain embodiments, the conjugating linkers contain no more than 5 linker nucleosides. In certain embodiments, the conjugating linkers contain no more than 3 linker nucleosides. In certain embodiments, the conjugating linkers contain no more than 2 linker nucleosides. In certain embodiments, the conjugating linkers contain no more than 1 linker nucleoside.

In certain embodiments, it is desirable for the conjugated group to be cleaved from the oligonucleotide. For example, under certain circumstances, compounds containing a particular conjugated moiety are better taken up by a particular cell type, but after uptake of the compound, it is desirable for the conjugated moiety to be cleaved to release the unconjugated or parent oligonucleotide. Thus, some conjugates may contain one or more cleavable components, typically as part of a conjugating linker. In certain embodiments, the cleavable component is a cleavable bond. In certain embodiments, the cleavable component is a group of atoms containing at least one cleavable bond. In certain embodiments, the cleavable component comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleaved component is selectively cleaved within a cellular or subcellular compartment, such as a lysosome. IN

- 38 044295 in certain embodiments, the cleaved component is selectively cleaved by endogenous enzymes such as nucleases.

In certain embodiments, the cleavable bond is selected from an amide, an ester, an ester, one or both of the esters in a phosphodiester bond, a phosphoester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both of the esters in the phosphodiester bond. In certain embodiments, the cleavable component comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugated moiety or conjugated moiety.

In certain embodiments, the cleavable component contains or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and/or to the rest of the compound via cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is attached to either the 3' or 5' terminal nucleoside of the oligonucleotide via a phosphate internucleoside bond and is covalently attached to the remainder of the conjugating linker or conjugating moiety via a phosphate or phosphorothioate bond. In certain such embodiments, the cleavage moiety is 2'-deoxyadenosine.

Compositions and methods for preparing pharmaceutical compositions.

The compounds described herein can be mixed with pharmaceutically acceptable active or inert substances to obtain pharmaceutical compositions or formulations. Compositions and methods for formulating pharmaceutical compositions depend on a number of criteria, including, without limitation, the route of administration, the extent of the disease, or the dose to be administered.

In certain embodiments, pharmaceutical compositions are provided containing one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds contain or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition contains a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition contains a sterile saline solution and one or more compounds. In certain embodiments, such a pharmaceutical composition consists of a sterile saline solution and one or more compounds. In certain embodiments, the sterile saline solution is pharmaceutical grade saline solution. In certain embodiments, the pharmaceutical composition contains one or more compounds and sterile water. In certain embodiments, the pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition contains one or more compounds and a phosphate buffered saline (PBS). In certain embodiments, the pharmaceutical composition consists of one compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for formulating pharmaceutical compositions depend on a number of criteria, including, without limitation, the route of administration, the extent of the disease, or the dose to be administered.

The compound described herein, which targets the APOL1 nucleic acid, can be used in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, the methods described herein use a pharmaceutical composition containing a compound that targets an APOL1 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound contains or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions containing the compounds provided herein include any pharmaceutically acceptable salts, esters or salts of such esters or any other oligonucleotide which, when administered to an animal, including a human, is capable of providing it (directly or indirectly) with its biologically active metabolite or residue. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound contains or consists of a modified oligonucleotide. Accordingly, for example, the present invention also covers pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically

- 39 044295 acceptable salts of such prodrugs and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

The prodrug may involve the inclusion of additional nucleosides at one or both ends of the compound, which are cleaved by endogenous nucleases in the body to form the active compound.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

Some selected compounds.

Approximately 1,930 newly designed compounds and several previously disclosed compounds with varying lengths, chemical structures, and motifs were tested for their effect on human APOL1 mRNA in vitro in several cell types (Example 1). Of the 1930 compounds tested for single-dose efficacy in vitro, 373 selected compounds were tested for dose-dependent inhibition in A431 cells (Example 2). Of the 373 compounds tested in dose response assays, 86 oligonucleotides were selected for in vivo efficacy and tolerability studies in rodents.

In in vivo rodent tolerance models, body weight and organ weights, liver function markers (such as alanine transaminase, aspartate transaminase, and bilirubin), hematologic markers (such as HCT, leukocyte count, platelet count, RBC count, MCH, and MCHC) and kidney functions (such as BUN and creatinine). In an hAPOL1 transgenic mouse model, the reduction in hAPOL1 mRNA in vivo was measured.

ION Nos. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163 were tested for activity, pharmacokinetic profile, and tolerability in cynomolgus monkeys (Example 9). Treatment with certain compounds caused a decrease in APOL1 mRNA expression in liver tissue. In particular, treatment with ION 904763 and ION 972190, which are cross-reactive with the cynomolgus APOL1 gene sequence, caused a significant reduction in APOL1 mRNA expression in liver tissue compared to PBS control. It was observed that ION 972190 caused the greatest reduction in APOL1 mRNA expression compared to PBS control. Monkeys tolerated treatment with compounds, particularly treatment with ION 972190, well.

Accordingly, compounds with any one or more improved properties are provided herein. In certain embodiments, the compounds described herein are effective and tolerable.

Examples

The following examples describe a screening method for identifying lead compounds targeting APOL1. For example, ION 793406, 904763, 905469, 905505, 905634, 905665, 972190 and 972163 resulted in high activity and tolerability. ION 972190 demonstrated high activity and tolerability.

Non-limiting disclosure and incorporation by reference.

Although the sequence listing accompanying this application specifically identifies each sequence as either RNA or DNA, in reality these sequences may be modified by any combination of chemical modifications. One skilled in the art will readily appreciate that the designation RNA or DNA to describe modified oligonucleotides is, in some cases, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'OH sugar moiety and a thymine base may be described as DNA having a modified sugar (2'-OH instead of the natural 2'-H in DNA) or as RNA having a modified base ( thymine (methylated uracil) instead of natural uracil in RNA).

Accordingly, the nucleic acid sequences provided herein, including without limitation those listed in the sequence listing, include nucleic acids containing any combination of natural or modified RNA and/or DNA, including without limitation such nucleic acids with modified nucleic bases. By further example and without limitation, an oligonucleotide having the nucleobase sequence ATCGATCG includes any oligonucleotides having such a nucleobase sequence, whether modified or unmodified, including, without limitation, those compounds that contain RNA bases, such as compounds having the sequence AUCGAUCG, and compounds having multiple DNA bases and multiple RNA bases, such as AUCGATCG, as well as compounds having other modified nucleic acid bases, such as ATmCGAUCG, where ^m C indicates a cytosine base containing a methyl group in 5-position.

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and may thus form enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S ), as α or β, for example in the case of sugar anomers

- 40 044295 ditch, or as (D) or (L), for example in the case of amino acids, etc. Compounds provided herein that are depicted or described as having specific stereoisomeric configurations include only those compounds. Compounds presented herein that are depicted or described as having undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Likewise, all tautomeric forms of the compounds presented herein are included unless otherwise noted. Unless otherwise indicated, the oligomeric compounds and modified oligonucleotides described herein are intended to include the corresponding salt forms.

The compounds described herein include variations in which one or more atoms are replaced by a non-radioactive isotope or a radioactive isotope of the specified element. For example, compounds herein that contain hydrogen atoms cover all possible substitutions of deuterium for each of the 1H hydrogen atoms. Isotopic substitutions covered by compounds herein include, but are not limited to: ² H or ³ H instead of 1H, ¹³ C or ¹⁴ C instead of ¹² C, ¹⁵ N instead of ¹⁴ N, ¹⁷ O or ¹⁸ O instead of ¹⁶ O, and ³³ S, ³⁴ S, ³⁵ S or ³⁶ S instead of ³² S.

Although certain compounds, compositions and methods described herein have been specifically described in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to be limiting. Each of the references mentioned in this application is incorporated herein by reference in its entirety.

Example 1 Antisense silencing of human APOL1 in A431 cells.

Antisense oligonucleotides with different chemical motifs targeting APOL1 nucleic acid were developed and their effects on APOL1 mRNA were studied in vitro.

cEt gapmers 3-10-3.

Newly developed chimeric antisense oligonucleotides are designated cEt gapmers 3-10-3 in the tables below. Gapmers are 16 nucleosides long, with a central gap segment containing ten 2'-deoxynucleosides and flanked by flanking segments in the 5' direction and in the 3' direction, each containing three nucleosides. Each nucleoside in the 5' flanking segment and each nucleoside in the 3' flanking segment has a cEt modification. All internucleoside bonds in each gapmer are phosphorothioate (P=S) bonds. All cytosine residues in each gapmer are 5-methylcytosine.

The start site indicates the nucleoside closest to the 5' end in the human gene sequence targeted by the gapmer. The stop site indicates the nucleoside closest to the 3' end in the human gene sequence targeted by the gapmer. Each of the gapmers listed in the tables below targets either the human APOL1 mRNA, designated herein as SEQ ID NO: 1 (Accession No. θΕΝΒΑΝΚΝΜ_003661.3), or the human APOL1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANKNT accession no. 011520.9 with cut-off nucleotides 15986452-16001905). n/a indicates that the antisense oligonucleotide does not target that specific gene sequence with 100% complementarity.

Antisense oligonucleotides were tested in a series of experiments using similar culture conditions. The results of each experiment are presented in the individual tables shown below. Cultured A431 cells at a density of 10,000 cells per well were transfected by free uptake with 4,000 nM antisense oligonucleotide. After a treatment period of approximately 24 h, RNA was isolated from cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer and probe set RTS35962 (forward sequence GCTACTCCTGCTGACTGATAATG, designated herein as SEQ ID NO: 10; reverse sequence AAGGTTGTCCAGAGCTTTACG, designated herein as SEQ ID NO: 11; probe sequence TGCCCAGGAATGAGGCAGATGAG, designated herein as SEQ ID NO : 12) was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured using RIBOGREEN®. Results are presented as the percentage of APOL1 suppression relative to untreated control cells. Oligonucleotides listed in table. 28 were screened in further experiments.

- 41 044295

Table 1

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

Connection number SEQ ID: 1, starting site SEQ ID: 1, stopsite SEQ ID: 2, starting site SEQ ID: 2, stopsite Subsequence % suppression of scientific research SEQ ID NO 793406 N/A N/A 8306 8321 GTTCAAAAG CAGCATT 83 13 903425 23 38 516 531 AAGATATAC CGAGGAA 24 14 903457 124 139 617 632 TCCCCTGGCA GAGACT 54 15 903489 250 265 4543 4558 TCGCTCCAGC TTSSTS 55 16 903521 302 317 4777 4792 TTACTTTGAG GATCTC 48 17 903617 559 574 12650 12665 ACTGCTGGCC TTTATS 76 18 903649 628 643 12719 12734 GGAGCCTTCT TATGTT 8 19 903681 669 684 12760 12775 GGTGCCTTTG TGGACC 0 20 903713 740 755 12831 12846 AGACCCATG CCGACGA thirty 21 903745 810 825 12901 12916 AGCGGCTGT GATTCCC 46 22 903777 849 864 12940 12955 CTTTCCGTAG TCCATG 17 23 903809 930 945 13021 13036 ACCAAAAAA STSSSTS 82 24 903841 1007 1022 13098 13113 GCACGGATG TSSTTSS 57 25 903873 1083 1098 13174 13189 GATTGGCTCA GTGACC 59 26

- 42 044295

903905 1126 1141 13217 13232 TGGGTTCATT AACCCT 3 27 903937 1211 1226 13302 13317 ACGAGGTAG ACTACAT 76 28 903969 1344 1359 13435 13450 TTCTTGGTCC GCCTGC 84 29 904001 1719 1734 13810 13825 AATGTTTGCA TTTGGG 98 thirty 904033 1798 1813 13889 13904 GTGCTCAGCT ATGGAA 90 31 904065 1925 1940 14016 14031 TAGTCTAAAAG TAAACT 26 32 904097 2283 2298 14374 14389 GCTGGTTCCT TCAAGC 25 33 904129 2412 2427 14503 14518 CATTCTTCGG AGGACA 78 34 904161 2510 2525 14601 14616 TCAGGAAGC CGCTGCC 58 35 904193 2599 2614 14690 14705 ACCTGCCCTT CAGTGT 52 36 904225 2723 2738 14814 14829 CTGTTTACT ACCGGG 83 37 904257 2804 2819 14895 14910 TCAATCCTGG GCGGCG 85 38 904321 N/A N/A 1373 1388 CATGATTGCA AAGCTG 89 39 904353 N/A N/A 836 851 GCTTTGTGAA CCCATC 58 40 904385 N/A N/A 2479 2494 CAAGCCCAG TCCAATT 23 41 904417 N/A N/A 2988 3003 GATGTTTGTC TTCTGG 88 42

- 43 044295

904449 N/A N/A 4339 4354 GCCAGTGTGT ATTGCA 40 43 904481 N/A N/A 4711 4726 ACAAATTGTG GGATCA 0 44 904513 N/A N/A 5057 5072 CTAGGTGCCA GGGTAG 47 45 904545 N/A N/A 5114 5129 CCCCCCCCCC GCTGAT 9 46 904577 N/A N/A 5292 5307 GGGCCACTC AGAGCAA 0 47 904609 N/A N/A 5357 5372 GTGGCAAAG GACAGAC 72 48 904641 N/A N/A 5489 5504 CCCTATTGTG TGGCAG 66 49 904673 N/A N/A 5681 5696 TTTTTCTTTG ACCGGG 74 50 904705 N/A N/A 5765 5780 CGAAGCCTCC TCCAGT 65 51 904737 N/A N/A 5806 5821 CACCCGATA AACCTTG 67 52 904769 N/A N/A 5861 5876 AGGCAGTTTT GTAAGT 76 53 904801 N/A N/A 5932 5947 ATTCGGAGA CCTCCCT 5 54 904833 N/A N/A 5964 5979 CCTGGGCAA GGCTAAG 35 55 904865 N/A N/A 6137 6152 TTACTCCACA CCTTAA 39 56 904897 N/A N/A 6205 6220 TTTGGTACAA AACTGC 71 57 904929 N/A N/A 6260 6275 TGTCTCACTA AACCCC 69 58

- 44 044295

904961 N/A N/A 6328 6343 GACCAGTGA GATCCAA 85 59 904993 N/A N/A 6401 6416 ACCACCTGTA GGGACA 50 60 905025 N/A N/A 6541 6556 GGGTACTTCT GTTAGA 82 61 905057 N/A N/A 6599 6614 CAGCTGTAAC CCCCTG 44 62 905089 N/A N/A 6647 6662 CAGCCCTGA AACATTC 13 63 905121 N/A N/A 6793 6808 GCGATTGTCT TGTTTT 93 64 905153 N/A N/A 6878 6893 GCCGTGGCA ACTCTGT 0 65 905185 N/A N/A 6994 7009 GGGTCGGCT GAGTGCT 61 66 905217 N/A N/A 7156 7171 ACCTCCATGT TGCCTC 42 67 905249 N/A N/A 7243 7258 GCTGGTCTTG GGCACT 34 68 905281 N/A N/A 7338 7353 CTTATAGCTT ACCTGT 27 69 905313 N/A N/A 7474 7489 GAGTCACCG CCCAAAA 59 70 905345 N/A N/A 7842 7857 TTGCCGTGCA CACACA 19 71 905377 N/A N/A 7937 7952 GTTTGCAGGG ATCTGG 86 72 905409 N/A N/A 8000 8015 CAAAGAACT CAAGTCA 85 73 905441 N/A N/A 8087 8102 ACTGCTCCCT GTAATC 38 74

-45 044295

905473 N/A N/A 8174 8189 TGTGTTTAGG CATTCA 87 75 905505 N/A N/A 8321 8336 GTTATGAAAT TATTGG 96 76 905537 N/A N/A 8385 8400 ATGCCTGTTG GGTCAA 64 77 905569 N/A N/A 8455 8470 GCACCAACA TGAAGTG 71 78 905601 N/A N/A 8625 8640 ACCCTTTTGG CACCTT 94 79 905633 N/A N/A 8743 8758 TTCTATTAGA GGGCTA 94 80 905665 N/A N/A 8829 8844 GCTTTAAACT CAGGTG 93 81 905697 N/A N/A 8890 8905 GTTTTATGGA GTCAT 95 82 905729 N/A N/A 8959 8974 GTGCATAAC AGCCATTT 19 83

table 2

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

Research Institute connection number SEQ ID: 1, starting site SEQ ID: 1, stopsite SEQ ID: 2, start site SEQ ID: 2, stopsite Subsequence % depressed nya SEQ ID NO 793406 N/A N/A 8306 8321 GTTCAAAAG CAGCATT 85 13 903424 22 37 515 530 AGATATACC GAGGAAT 3 84 903456 79 94 572 587 GGATCCCAC CTCCAGT 9 85

- 46 044295

903488 227 242 4520 4535 ASTSSSASA CCAAGGA 27 86 903520 301 316 4776 4791 TACTTTGAGG ATTSSS 65 87 903616 558 573 12649 12664 CTGCTGGCCT TTATCG 0 88 903648 627 642 12718 12733 GAGCCTTCTT ATGTTA 27 89 903680 668 683 12759 12774 GTGCCTTTGT GGACCT 24 90 903712 739 754 12830 12845 GACCCATGC CGACGAG 46 91 903744 809 824 12900 12915 GCGGCTGTG ATTCCCA 0 92 903776 848 863 12939 12954 TTTCCGTAGT CCATGG 20 93 903808 914 929 13005 13020 ACCTCCTCA ATTTGT 61 94 903840 1006 1021 13097 13112 CACGGATGT CCTTCCC 69 95 903872 1082 1097 13173 13188 ATTGGCTCA GTGACCC 88 96 903904 1125 1140 13216 13231 GGGTTCATTA ACCCTC 22 97 903936 1210 1225 13301 13316 CGAGGTAGA CTACATC 63 98 903968 1343 1358 13434 13449 TCTTGGTCCG CCTGCA 66 99 904000 1717 1732 13808 13823 TGTTTGCATT TGGGTC 99 100 904032 1797 1812 13888 13903 TGCTCAGCTA TGGAAA 77 101

- 47 044295

904064 1924 1939 14015 14030 AGTCTAAAAG TAAACTG 18 102 904096 2282 2297 14373 14388 CTGGTTCCTT CAAGCC 77 103 904128 2411 2426 14502 14517 ATTCTTCGGA GGACAT 71 104 904160 2508 2523 14599 14614 AGGAAGCCG CTGCCTG 0 105 904192 2596 2611 14687 14702 TGCCCTTCAG TGTTCA 47 106 904224 2722 2737 14813 14828 TGTTTACTTA CCGGGT 91 107 904256 2803 2818 14894 14909 CAATCCTGG GCGGCGA 79 108 904320 N/A N/A 1372 1387 ATGATTGCA AAGCTGG 75 109 904352 N/A N/A 828 843 AACCCATCT GAGCTGT 34 110 904384 N/A N/A 2476 2491 GCCCAGTCC AATTGTG 14 111 904416 N/A N/A 2970 2985 ACTCCATGC AGCAAGG 71 112 904448 N/A N/A 4322 4337 GTCTGCGAT GTGCAGA 21 113 904480 N/A N/A 4705 4720 TGTGGGATTC AAATGTG 0 114 904512 N/A N/A 5056 5071 TAGGTGCCA GGGTAGG 68 115 904544 N/A N/A 5113 5128 CCCCCCCCCG CTGATT 16 116 904576 N/A N/A 5291 5306 GGCCACTCA GAGCAAA 0 117

- 48 044295

904608 N/A N/A 5355 5370 GGCAAAGGGA CAGACCG 9 118 904640 N/A N/A 5466 5481 CCAGGCCAG GTAGCCG 21 119 904672 N/A N/A 5666 5681 GGGTATTTTTA GATGAC 76 120 904704 N/A N/A 5764 5779 GAAGCCTCC TCCAGTT 68 121 904736 N/A N/A 5805 5820 ACCCGATAA ACCTTGT 73 122 904768 N/A N/A 5860 5875 GGCAGTTTTG TAAGTG 81 123 904800 N/A N/A 5931 5946 TTCGGAGAC CTCCCTA 33 124 904832 N/A N/A 5963 5978 CTGGGCAAG GCTAAGT 1 125 904864 N/A N/A 6136 6151 TACTCCACAC CTTAAT 18 126 904896 N/A N/A 6204 6219 TTGGTACAA AACTGCA 68 127 904928 N/A N/A 6259 6274 GTCTCACTAA ACCCA 71 128 904960 N/A N/A 6327 6342 ACCAGTGAG ATCCAAC 87 129 904992 N/A N/A 6377 6392 GGATGGGCC CACAGGA 39 130 905024 N/A N/A 6540 6555 GGTACTTCTG TTAGAT 37 131 905056 N/A N/A 6598 6613 AGCTGTAAC CCCCTGA 54 132 905088 N/A N/A 6646 6661 AGCCCTGAA ACATTCC 39 133

-49044295

905120 N/A N/A 6792 6807 CGATTGTCTT GTTTTT 96 134 905152 N/A N/A 6877 6892 CCGTGGCAA CTCTGTA 22 135 905184 N/A N/A 6992 7007 GTCGGCTGA GTGCCT 35 136 905216 N/A N/A 7152 7167 CCATGTTGCC TCTGTC 62 137 905248 N/A N/A 7242 7257 CTGGTCTTGG GCACTC 25 138 905280 N/A N/A 7336 7351 TATAGCTTAC CTGTGG 59 139 905312 N/A N/A 7472 7487 GTCACCGCC CAAAACC 51 140 905344 N/A N/A 7840 7855 GCCGTGCAC ACACAAG 29 141 905376 N/A N/A 7929 7944 GGATCTGGG AATTATG 65 142 905408 N/A N/A 7999 8014 AAAGAACTC AAGTCAG 91 143 905440 N/A N/A 8085 8100 TGCTCCTGT AATCAC 55 144 905472 N/A N/A 8173 8188 GTGTTTAGGC ATTCAG 72 145 905504 N/A N/A 8318 8333 ATGAATTA TTGGTTC 82 146 905536 N/A N/A 8384 8399 TGCCTGTTGG GTCAAA 43 147 905568 N/A N/A 8454 8469 CACCAACAT GAAGTGA 0 148 905600 N/A N/A 8624 8639 CCCTTTTGGC ACCTTC 95 149 905632 N/A N/A 8742 8757 TCTATTAGAG GGCTAG 57 150 905664 N/A N/A 8828 8843 CTTTAAAACTC AGGTGA 62 151 905696 N/A N/A 8887 8902 TTATGGAGTC ATTAGT 79 152 905728 N/A N/A 8958 8973 TGCATAACA GCCATTG 0 153

-50044295

Table 3

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, start site SEQ ID: 1, stopsite SEQ ID: 2, home site SEQ ID: 2, stopsite Subsequence % depressed nya SEQ ID NO 793406 N/A N/A 8306 8321 GTTCAAAA GCAGCATT 81 13 903428 26 41 519 534 CCCAAGAT ATACCGAG 24 154 903460 130 145 623 638 GAATCTTCC CCTGGCA 55 155 903492 255 270 N/A N/A CACCCTCGC TCCAGCT 44 156 903524 322 337 4797 4812 CAGCCAGT CACCGAG 14 157 903620 562 577 12653 12668 TGTACTGCT GGCCTTT 68 158 903652 631 646 12722 12737 CACGGAGC STTSTTAT 31 159 903684 672 687 12763 12778 GGTGGTGCC TTTGTGG 0 160

- 51 044295

903716 743 758 12834 12849 GCCAGACC CATGCCGA 39 161 903748 813 828 12904 12919 CAAAGCGG CTGTGATTT 21 162 903780 852 867 12943 12958 CTTCTTTCC GTAGTCC 32 163 903812 936 951 13027 13042 GTTCCACC CAAAAAC 20 164 903844 1011 1026 13102 13117 GAGGGCAC GGATGTCC 39 165 903876 1086 1101 13177 13192 TGAGATTGG CTCAGTG 64 166 903908 1129 1144 13220 13235 TGCTGGGTT CATTAAC 6 167 903940 1231 1246 13322 13337 GTAAGTGCT TTGATTC 93 168 903972 1347 1362 13438 13453 CAGTTCTTG GTCCGCC 79 169 904004 1743 1758 13834 13849 TCACCCTCT TTATCCC 76 170 904036 1801 1816 13892 13907 GCTGTGCTC AGCTATG 35 171 904068 1929 1944 14020 14035 TCTTTAGTC TAAAGTA 0 172 904100 2336 2351 14427 14442 TAACTCTTG GGCTTTC 73 173 904132 2415 2430 14506 14521 CTTCATTCT TCGGAGG 34 174 904164 2513 2528 14604 14619 TCATCAGGA AGCCGCT 73 175 904196 2613 2628 14704 14719 GGCCATGG CCCACCAC 0 176

-52044295

904228 2766 2781 14857 14872 AGCTTCCTC CCAATGC 24 177 904260 2807 2822 14898 14913 AGGTCAATC CTGGGCG 58 178 904324 N/A N/A 1376 1391 TCTCATGAT TGCAAAG 69 179 904356 N/A N/A 871 886 GTCTCAGCA GTCAAAA 62 180 904388 N/A N/A 2518 2533 TTGGTTCCT AGAAGAA 36 181 904420 N/A N/A 3414 3429 ACTGAGGG TATATGAA 82 182 904452 N/A N/A 4361 4376 GTGTGATAA CTAGCTG 86 183 904484 N/A N/A 4738 4753 TTTTGTTGC ACCCTTG 83 184 904516 N/A N/A 5065 5080 GTCATTTGC TAGGTGC 90 185 904548 N/A N/A 5173 5188 TGGTCAACC TCCTCTC 0 186 904580 N/A N/A 5305 5320 ATACATTCC CACAGGG 22 187 904612 N/A N/A 5393 5408 AGGGAGGT AAGGAGCG 26 188 904644 N/A N/A 5492 5507 AGGCCTAT TGTGTGG 0 189 904676 N/A N/A 5694 5709 ATTGGGCCT CAGATTT 57 190 904708 N/A N/A 5768 5783 GCACGAAG CCTCCTCC 60 191 904740 N/A N/A 5809 5824 ATTCACCCG ATAAACC 47 192

-53 044295

904772 N/A N/A 5870 5885 AACCCAAA CAGGCAGT 69 193 904804 N/A N/A 5935 5950 TGTATTCGG AGACCTC 47 194 904836 N/A N/A 5967 5982 AAACCTGG GCAAGGCT 23 195 904868 N/A N/A 6141 6156 ATGCTTACT CCACACC 75 196 904900 N/A N/A 6211 6226 CCCATGTTT GGTACAA 54 197 904932 N/A N/A 6263 6278 CCTTGTCTC ACTAAAC 73 198 904964 N/A N/A 6332 6347 CTAAGACC AGTGAGAT 58 199 904996 N/A N/A 6404 6419 GAAACCAC CTGTAGGG 53 200 905028 N/A N/A 6544 6559 GATGGGTA CTTCTGTT 88 201 905060 N/A N/A 6605 6620 TTAGAACA GCTGTAAC 50 202 905092 N/A N/A 6684 6699 GGGCTGGT GGATATAA 0 203 905124 N/A N/A 6796 6811 CGAGCGATT GTCTTGT 76 204 905156 N/A N/A 6881 6896 GTTGCCGTG GCAACTC 21 205 905188 N/A N/A 7039 7054 GAGTTTTTC CTCAGTC 49 206 905220 N/A N/A 7161 7176 GAGGCACC TCCATGTT 41 207 905252 N/A N/A 7260 7275 CAAAGGAG ATTCCTCC 35 208

-54044295

905284 N/A N/A 7342 7357 CTCCCTTAT AGCTTAC 62 209 905316 N/A N/A 7477 7492 CGAGAGTC ACCGCCCA 72 210 905348 N/A N/A 7845 7860 TTCTTGCCG TGCACAC 10 211 905380 N/A N/A 7943 7958 CGTGTGGTT TGCAGGG 72 212 905412 N/A N/A 8008 8023 TAGGTCTAC AAAGAAC 71 213 905444 N/A N/A 8090 8105 TGGACTGCT CCCTGTA 13 214 905476 N/A N/A 8177 8192 AGATGTGTT TAGGCAT 96 215 905508 N/A N/A 8330 8345 CATCATTGG GTTATGA 37 216 905540 N/A N/A 8388 8403 CACATGCCT GTTGGGT 48 217 905572 N/A N/A 8466 8481 TTTTCAGCT CAGCACC 49 218 905604 N/A N/A 8633 8648 AGACTCCA ACCCTTT 53 219 905636 N/A N/A 8746 8761 TAATTCTAT TAGAGGG 83 220 905668 N/A N/A 8833 8848 TGAAGCTTT AAACTCA 18 221 905700 N/A N/A 8895 8910 GACTTGTTT TATGGAG 87 222 905732 N/A N/A 8962 8977 GGAGTGCA TAACAGCC 0 223

- 55 044295

Table 4

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

Connection number SEQ ID: 1, starting site SE Q ID: 1, hundred IIsay t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 85 13 903429 27 42 520 535 CCCCAAGATATAC C.G.A. 0 224 903461 131 146 624 639 GGAATCTTCCCCTG G.C. 51 225 903493 256 271 N/A N/A GCACCCTCGCTCC A.G.C. 24 226 903525 323 338 4798 4813 GCAGCCCAGTCAC C.G.A. 0 227 903621 563 578 12654 1266 9 CTGTACTGCTGGCC TT 87 228 903653 632 647 12723 1273 8 GCACGGAGCCTTC TTA 33 229 903685 673 688 12764 1277 9 TGGTGGTGCCTTTG TG 0 230 903717 744 759 12835 1285 0 TGCCAGACCCATG CCG 48 231 903749 817 832 12908 1292 3 CGGTCAAAGCGGC TGT 71 232 903781 853 868 12944 1295 9 ACTTCTTTCCGTAG TS 6 233

- 56 044295

903813 940 955 13031 1304 6 ATATGTTTCTCACCC A.A. 77 234 903845 1012 102 7 13103 1311 8 TGAGGGCACGGAT GTC 67 235 903877 1090 110 5 13181 1319 6 CAGCTGAGATTGG CTC 19 236 903909 ISO 114 5 13221 1323 6 ATGCTGGGTTCATT A.A. 28 237 903941 1233 124 8 13324 1333 9 ATGTAAGTGCTTTG AT 74 238 903973 1348 136 3 13439 1345 4 ACAGTTCTTGGTCC G.C. 92 239 904005 1744 175 9 13835 1385 0 CTCACCCTCTTTAT CC 50 240 904037 1827 184 2 13918 1393 3 CTGCCATCTGCATT A.A. 54 241 904069 1942 195 7 14033 1404 8 CCCCCCAATATATT C.T. 67 242 904101 2340 235 5 14431 1444 6 GTTCTAACTCTTGG G.C. 90 243 904133 2416 243 1 14507 1452 2 ACTTCATTCTTCGG A.G. 27 244 904165 2514 252 9 14605 1462 0 ATCATCAGGAAGC C.G.C. 92 245 904197 2614 262 9 14705 1472 0 TGGCCATGGCCCA CCA 10 246 904229 2767 278 2 14858 1487 3 GAGCTTCCTCCCA ATG 0 247 904261 2839 285 4 14930 1494 5 ATGAGTAGGTGAG TTT 84 248 904325 N/A N/A 1378 1393 AATCTCATGATTGC A.A. 70 249

- 57 044295

904357 N/A N/A 872 887 TGTCTCAGCAGTC AAA 69 250 904389 N/A N/A 2519 2534 TTTGGTTCCTAGAA GA 25 251 904421 N/A N/A 3417 3432 ACAACTGAGGGTA TAT 80 252 904453 N/A N/A 4366 4381 AGCATGTGTGATA ACT 88 253 904485 N/A N/A 4818 4833 TACCTGGGTCCAT GGT 6 254 904517 N/A N/A 5067 5082 GAGTCATTTGCTA GGT 90 255 904549 N/A N/A 5175 5190 GCTGGTCAACCTC CTC 40 256 904581 N/A N/A 5306 5321 GATACATTCCCAC AGG 60 257 904613 N/A N/A 5394 5409 AAGGGAGGTAAGG A.G.C. 15 258 904645 N/A N/A 5493 5508 GAGGCCCTATTGT GTG 13 259 904677 N/A N/A 5695 5710 TATTGGGCCTCAG A.T.T. 17 260 904709 N/A N/A 5769 5784 AGCACGAAGCCTC CTC 60 261 904741 N/A N/A 5813 5828 TCATATTCACCCGA T.A. 76 262 904773 N/A N/A 5872 5887 TAAACCCAAAACAG G.C.A. 76 263 904805 N/A N/A 5936 5951 CTGTATTCGGAGA CCT 54 264 904837 N/A N/A 5970 5985 CAAAAACCTGGGC AAG 56 265

- 58 044295

904869 N/A N/A 6142 6157 TATGCTTACTCCAC A.C. 57 266 904901 N/A N/A 6213 6228 TGCCCATGTTTGGT A.C. 7 267 904933 N/A N/A 6265 6280 CTCCTTGTCTCACT A.A. 50 268 904965 N/A N/A 6333 6348 GCTAAGACCAGTG A.G.A. 67 269 904997 N/A N/A 6405 6420 TGAAACCACCTGT AGG 38 270 905029 N/A N/A 6545 6560 AGATGGGTACTTC TGT 89 271 905061 N/A N/A 6607 6622 CTTTAGAACAGCT GTA 57 272 905093 N/A N/A 6698 6713 TTCTTGATGTGGTG GG 92 273 905125 N/A N/A 6797 6812 GCGAGCGATTGTC TTG 59 274 905157 N/A N/A 6882 6897 GGTTGCCGTGGCA ACT 0 275 905189 N/A N/A 7043 7058 GGGAGAGTTTTTC CTC 14 276 905221 N/A N/A 7162 7177 TGAGGCACCTCCA TGT 0 277 905253 N/A N/A 7261 7276 GCAAAGGAGATTC CTC 61 278 905285 N/A N/A 7343 7358 TCTCCCTTATAGCT T.A. 71 279 905317 N/A N/A 7478 7493 GCGAGAGTCACCG CCC 0 280 905349 N/A N/A 7846 7861 TTTCTTGCCGTGCA C.A. 17 281

- 59 044295

905381 N/A N/A 7957 7972 AGCTGCCACCAAA A.C.G. 25 282 905413 N/A N/A 8009 8024 GTAGGTCTACAAA GAA 79 283 905445 N/A N/A 8091 8106 CTGGACTGCTCCCT GT 20 284 905477 N/A N/A 8178 8193 CAGATGTGTTTAG G.C.A. 97 285 905509 N/A N/A 8331 8346 ACATCATTGGGTT ATG 82 286 905541 N/A N/A 8389 8404 CCACATGCCTTGTTG GG 1 287 905573 N/A N/A 8472 8487 GAATCCTTTTCAGC TC 63 288 905605 N/A N/A 8634 8649 CAGACTCCAACCC TTT 49 289 905637 N/A N/A 8747 8762 CTAATTCTATTAGA GG 35 290 905669 N/A N/A 8835 8850 GCTGAAGCTTTAA ACT 7 291 905701 N/A N/A 8899 8914 GTGGGACTTGTTTT AT 72 292 905733 N/A N/A 8963 8978 GGGAGTGCATAAC A.G.C. thirty 293

Table 5

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site S.E. Q ID: 1, CTO SEQ ID: 2, starting site SEQ ID: 2, stop Subsequence % depressed AND I S.E. QID NO

-60044295

πsay t website 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC A.T.T. 85 13 903430 28 43 521 536 TCCCCAAGATATA CCG 0 294 903462 132 147 625 640 AGGAATCTTCCCC TGG 0 295 903494 257 272 N/A N/A TGCACCCTCGCTC CAG 6 296 903526 324 339 4799 4814 AGCAGCCAGTCA CCG 0 297 903622 564 579 12655 1267 0 TCTGTACTGCTGG CCT 46 298 903654 633 648 12724 1273 9 GGCACGGAGCCTT CTT 13 299 903686 674 689 12765 1278 0 ATGGTGGTGCCTT TGT 0 300 903718 745 760 12836 1285 1 GTGCCAGACCCAT GCC 32 301 903750 818 833 12909 1292 4 CCGGTCAAAGCGG CTG 0 302 903782 854 869 12945 1296 0 CACTTCTTTCCGTA GT 0 303 903814 941 956 13032 1304 7 GATATGTTCTCAC CCA 94 304 903846 1013 102 8 13104 1311 9 CTGAGGGCACGGA TGT 65 305 903878 1091 110 6 13182 1319 7 TCAGCTGAGATTG GCT 0 306 903910 1131 114 6 13222 1323 7 GATGCTGGGTTCA TTA 0 307

-61 044295

903942 1235 125 0 13326 1334 1 TCATGTAAGTGCT TTG 85 308 903974 1349 136 4 13440 1345 5 CACAGTTCTTGGT CCG 89 309 904006 1747 176 2 13838 1385 3 TACCTCACCCTCTT T.A. 66 310 904038 1828 184 3 13919 1393 4 ACTGCCATCTGCA TTA 0 311 904070 1943 195 8 14034 1404 9 GCCCCCAATATA TTC 29 312 904102 2341 235 6 14432 1444 7 TGTTCTAACTCTTG GG 90 313 904134 2417 243 2 14508 1452 3 GACTTCATTCTTCG GA 85 314 904166 2515 253 0 14606 1462 1 CATCATCAGGAAG CCG 88 315 904198 2615 263 0 14706 1472 1 ATGGCCATGGCCCC ACC 0 316 904230 2768 278 3 14859 1487 4 TGAGCTTCCTCCC AAT 35 317 904262 2840 285 5 14931 1494 6 GATGAGTAGGTGA GTT 82 318 904326 N/A N/A 1379 1394 GAATCTCATGATT G.C.A. 68 319 904358 N/A N/A 919 934 AGATGGGCACCCC CAA 3 320 904390 N/A N/A 2533 2548 TTCCGGGAAGTGA CTT 27 321 904422 N/A N/A 3539 3554 AACACCAATTAGT ASA 64 322 904454 N/A N/A 4384 4399 CAATGACCAGGC CTG thirty 323

- 62 044295

904486 N/A N/A 4822 4837 AGCCTACCTGGGT CCA 0 324 904518 N/A N/A 5068 5083 TGAGTCATTTGCT AGG 48 325 904550 N/A N/A 5194 5209 GAGGTGACAGTC GGG 33 326 904582 N/A N/A 5307 5322 CGATACATTCCCA CAG 29 327 904614 N/A N/A 5406 5421 ATGGTACAGGAGA AGG 89 328 904646 N/A N/A 5494 5509 GGAGGCCCTATTG TGT 10 329 904678 N/A N/A 5696 5711 CTATTGGGCCTCA GAT 49 330 904710 N/A N/A 5771 5786 ATAGCACGAAGCC TCC 72 331 904742 N/A N/A 5814 5829 TTCATATTCACCCG AT 66 332 904774 N/A N/A 5873 5888 GTAAACCCCAAACA GGC 71 333 904806 N/A N/A 5937 5952 CCTGTATTCGGAG ACC 66 334 904838 N/A N/A 5972 5987 ATCAAAAACCTGG G.C.A. 75 335 904870 N/A N/A 6143 6158 TTATGCTTACTCCA C.A. 71 336 904902 N/A N/A 6214 6229 ATGCCCATGTTTG GTA 0 337 904934 N/A N/A 6266 6281 CCTCCTTGTCTCAC T.A. 0 338 904966 N/A N/A 6334 6349 AGCTAAGACCAGT GAG 21 339

- 63 044295

904998 N/A N/A 6406 6421 CTGAAACCACCTG TAG 47 340 905030 N/A N/A 6546 6561 CAGATGGGTACTT CTG 41 341 905062 N/A N/A 6609 6624 GCCTTTAGAACAG CTG 23 342 905094 N/A N/A 6700 6715 ATTTTCTTGATGTGG TG 98 343 905126 N/A N/A 6798 6813 GGCGAGCGATTGT CTT 84 344 905158 N/A N/A 6883 6898 TGGTTGCCGTGGC A.A.C. 0 345 905190 N/A N/A 7059 7074 ATCATCTTGTTTTG GG 80 346 905222 N/A N/A 7163 7178 TTGAGGCACCTCC ATG 0 347 905254 N/A N/A 7263 7278 ATGCAAAGGAGAT TCC 28 348 905286 N/A N/A 7344 7359 TTCTCCCTTATAGC TT 33 349 905318 N/A N/A 7479 7494 AGCGAGAGTCACC GCC 4 350 905350 N/A N/A 7847 7862 GTTTCTTGCCGTGC A.C. 22 351 905382 N/A N/A 7960 7975 GTCAGCTGCCACC AAA 76 352 905414 N/A N/A 8010 8025 GGTAGGTCTACAA A.G.A. 78 353 905446 N/A N/A 8095 8110 GAGGCTGGACTGC TCC 0 354 905478 N/A N/A 8179 8194 CCAGATGTGTTTA GGC 87 355

-64044295

905510 N/A N/A 8332 8347 CACATCATTGGGT TAT 92 356 905542 N/A N/A 8390 8405 GCCACATGCCTGT TGG 0 357 905574 N/A N/A 8481 8496 GAGAGGAATGAAT CCT 37 358 905606 N/A N/A 8644 8659 GAGTCCTCCCCAG ACT 0 359 905638 N/A N/A 8750 8765 GCTCTAATTCTATT A.G. 0 360 905670 N/A N/A 8836 8851 TGCTGAAGCTTTA A.A.C. 13 361 905702 N/A N/A 8900 8915 TGTGGGACTTGTTT T.A. 64 362 905734 N/A N/A 8965 8980 GTGGGAGTGCATA ASA 0 363

Table 6

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site SE Q ID: 1, CTO Psy T SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC A.T.T. 80 13 903431 29 44 522 537 GTCCCCAAGATAT ACC 2 364

- 65 044295

903463 135 150 628 643 CCAAGGAATCTTC CCC 53 365 903495 258 273 N/A N/A TTGCACCCTCGCTC C.A. 25 366 903527 329 344 4804 4819 GTGCCAGCAGCCC AGT 0 367 903623 565 580 12656 1267 1 TTCTGTACTGCTGG CC 15 368 903655 634 649 12725 1274 0 GGGCACGGAGCCT TCT 0 369 903687 675 690 12766 1278 1 GATGGTGGTGCCT TTG 0 370 903719 746 761 12837 1285 2 GGTGCCAGCCCA TGC 0 371 903751 819 834 12910 1292 5 CCCGGTCAAAGCG GCT 0 372 903783 855 870 12946 1296 1 CCACTTCTTTCCGT A.G. 51 373 903815 946 961 13037 1305 2 AGTTGGATATGTT CTC 81 374 903847 1014 102 9 13105 1312 0 TCTGAGGGCACGG ATG 24 375 903879 1092 110 7 13183 1319 8 TTCAGCTGAGATT GGC 49 376 903911 1132 114 7 13223 1323 8 GGATGCTGGGTTC A.T.T. 41 377 903943 1236 125 1 13327 1334 2 CTCATGTAAGTGC TTT 81 378 903975 1351 136 6 13442 1345 7 GTCACAGTTCTTG GTC 54 379 904007 1748 176 3 13839 1385 4 TTACCTCACCCTCT TT 64 380

- 66 044295

904039 1829 184 4 13920 1393 5 CACTGCCATCTGC A.T.T. 57 381 904071 1944 195 9 14035 1405 0 GGCCCCCAATAT A.T.T. 0 382 904103 2342 235 7 14433 1444 8 CTGTTCTAACTCTT GG 93 383 904135 2418 243 3 14509 1452 4 AGACTTCATTCTTC GG 69 384 904167 2516 253 1 14607 1462 2 CCATCATCAGGAA GCC 87 385 904199 2620 263 5 14711 1472 6 GGACCATGGCCAT GGC 0 386 904231 2772 278 7 14863 1487 8 GATCTGAGCTTCC TCC 44 387 904263 2841 285 6 14932 1494 7 TGATGAGTAGGTG AGT 81 388 904327 N/A N/A 1380 1395 TGAATCTCATGAT TGC 75 389 904359 N/A N/A 1002 1017 GTGTGGCCTGGCC ATA 0 390 904391 N/A N/A 2544 2559 CGGTTGGTCAATT CCG 0 391 904423 N/A N/A 3741 3756 CAGAGGCTATCAA CAA 90 392 904455 N/A N/A 4391 4406 GTTCTGACAATGA CCA 50 393 904487 N/A N/A 4830 4845 AGGAGGTGAGCCCT ACC 0 394 904519 N/A N/A 5069 5084 TTGAGTCATTTGCT A.G. 47 395 904551 N/A N/A 5196 5211 GGGAGGTGACAGG TCG 36 396

- 67 044295

904583 N/A N/A 5309 5324 CCCGATACATTCC CAC 50 397 904615 N/A N/A 5407 5422 CATGGTACAGGAG AAG 32 398 904647 N/A N/A 5495 5510 GGGAGGCCCTATT GTG 14 399 904679 N/A N/A 5697 5712 TCTATTGGGCCTC A.G.A. 15 400 904711 N/A N/A 5772 5787 CATAGCACGAAGC CTC 70 401 904743 N/A N/A 5815 5830 TTTCATATTCACCC GA 87 402 904775 N/A N/A 5874 5889 GGTAAAACCAAAC AGG 54 403 904807 N/A N/A 5938 5953 ACCTGTATTCGGA GAC 58 404 904839 N/A N/A 5974 5989 GCATCAAAAACCT GGG 52 405 904871 N/A N/A 6144 6159 CTTATGCTTACTCC A.C. 85 406 904903 N/A N/A 6215 6230 TATGCCCCATGTTTG GT 51 407 904935 N/A N/A 6268 6283 ACCCTCCTTGTCTC A.C. 37 408 904967 N/A N/A 6335 6350 CAGCTAAGACCAG TGA 65 409 904999 N/A N/A 6407 6422 GCTGAAACCACCT GTA 66 410 905031 N/A N/A 6547 6562 TCAGATGGGTACT TCT 89 411 905063 N/A N/A 6610 6625 GGCCTTTAGAACA GCT 0 412

- 68 044295

905095 N/A N/A 6702 6717 GTATTTCTTGATGT GG 98 413 905127 N/A N/A 6799 6814 GGGCGAGCGATTG TCT 16 414 905159 N/A N/A 6884 6899 TTGGTTGCCGTGG CAA 6 415 905191 N/A N/A 7060 7075 GATCATCTTGTTTT GG 51 416 905223 N/A N/A 7164 7179 CTTGAGGCACCTC CAT 35 417 905255 N/A N/A 7264 7279 CATGCAAAGGGAGA TTC 0 418 905287 N/A N/A 7345 7360 ATTCTCCCTTATAG C.T. 15 419 905319 N/A N/A 7480 7495 CAGCGAGAGTCAC C.G.C. 0 420 905351 N/A N/A 7848 7863 TGTTTCTTGCCGTG C.A. 34 421 905383 N/A N/A 7963 7978 GAAGTCAGCTGCC ACC 87 422 905415 N/A N/A 8011 8026 TGGTAGGTCTACA AAG 76 423 905447 N/A N/A 8109 8124 GACCATTCCCAGC A.G.A. 65 424 905479 N/A N/A 8180 8195 TCCAGATGTGTTT AGG 83 425 905511 N/A N/A 8333 8348 ACACATCATTGGG TTA 85 426 905543 N/A N/A 8404 8419 GATCACTTCCATCT G.C. 0 427 905575 N/A N/A 8492 8507 ATGGTGCTTTGGGA GAG 5 428 905607 N/A N/A 8649 8664 CAAGAGAGTCCTC CCC 57 429 905639 N/A N/A 8751 8766 GGCTCTAATTCTAT T.A. 0 430 905671 N/A N/A 8862 8877 GGAATTGTGTGCC CCC 43 431 905703 N/A N/A 8902 8917 GATGTGGGACTTG TTT 82 432 905735 N/A N/A 8966 8981 TGTGGGAGTGCAT A.A.C. 0 433

- 69 044295

Table 7

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site SE Q ID: 1, hundred IIsay t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 86 13 903432 thirty 45 523 538 AGTCCCCAAGATA TAS 0 434 903464 142 157 N/A N/A GCCTCCTCCAAGG AAT 9 435 903496 259 274 N/A N/A GTTGCACCCTCGC TSS 13 436 903528 331 346 4806 4821 TGGTGCCAGCAGC SSA 0 437

- 70 044295

903624 566 581 12657 1267 2 TTTCTGTACTGCTG G.C. 64 438 903656 635 650 12726 1274 1 AGGGCACGGAGCC TTC 0 439 903688 676 691 12767 1278 2 CGATGGTGGTGCC TTT 0 440 903720 747 762 12838 1285 3 GGGTGCCAGACCC ATG 5 441 903752 820 835 12911 1292 6 TCCCGGTCAAAGC GGC 0 442 903784 856 871 12947 1296 2 ACCACTTCTTTCCG T.A. 23 443 903816 947 962 13038 1305 3 AAGTTGGATATGT TCT 74 444 903848 1015 103 0 13106 1312 1 GTCTGAGGGCACG GAT 37 445 903880 1093 110 8 13184 1319 9 TTTCAGCTGAGAT TGG 56 446 903912 1133 114 8 13224 1323 9 AGGATGCTGGGTT CAT 66 447 903944 1237 125 2 13328 1334 3 CCTCATGTAAGTG CTT 70 448 903976 1353 136 8 13444 1345 9 TGGTCACAGTTCTT GG 89 449 904008 1751 176 6 13842 1385 7 ACTTTACCTCACCC TC 80 450 904040 1830 184 5 13921 1393 6 GCACTGCCATCTG CAT 23 451 904072 1945 196 0 14036 1405 1 CGGCCCCCCAATA TAT 0 452 904104 2343 235 8 14434 1444 9 ACTGTTCTAACTCT TG 90 453

- 71 044295

904136 2419 243 4 14510 1452 5 AAGACTTCATTCTT C.G. 23 454 904168 2517 253 2 14608 1462 3 ACCATCATCAGGA A.G.C. 82 455 904200 2621 263 6 14712 1472 7 GGGACCATGGCCA TGG 74 456 904232 2773 278 8 14864 1487 9 AGATCTGAGCTTC CTC 9 457 904264 2842 285 7 14933 1494 8 TTGATGAGTAGGT GAG 93 458 904328 N/A N/A 1381 1396 TTGAATCTCATGA TTG 48 459 904360 N/A N/A 1049 1064 TGTTGCCCCCATTG GG 3 460 904392 N/A N/A 2549 2564 TCTGCCGGTTGGT CAA 18 461 904424 N/A N/A 3753 3768 GAATGAGCAGGTC A.G.A. 95 462 904456 N/A N/A 4392 4407 GGTTCTGACAATG ACC 37 463 904488 N/A N/A 4831 4846 GAGGAGGTGAGCC TAC 35 464 904520 N/A N/A 5070 5085 CTTGAGTCATTTGC T.A. 63 465 904552 N/A N/A 5197 5212 CGGGAGGTGACAG GTC 41 466 904584 N/A N/A 5310 5325 GCCCGATACATTC CCA 16 467 904616 N/A N/A 5409 5424 CTCATGGTACAGG A.G.A. 56 468 904648 N/A N/A 5496 5511 AGGGAGGCCCTAT TGT 14 469

- 72 044295

904680 N/A N/A 5698 5713 TTCTATTGGGCCTC A.G. 90 470 904712 N/A N/A 5773 5788 CCATAGCACGAAG CCT 72 471 904744 N/A N/A 5816 5831 GTTTCATATTCACC C.G. 95 472 904776 N/A N/A 5875 5890 AGGTAAAACCCCAAA CAG 59 473 904808 N/A N/A 5939 5954 CACCTGTATTCGG A.G.A. 16 474 904840 N/A N/A 5975 5990 AGCATCAAAAAAACC TGG 88 475 904872 N/A N/A 6145 6160 CCTTATGCTTACTC C.A. 92 476 904904 N/A N/A 6216 6231 GTATGCCCATGTTT GG 34 477 904936 N/A N/A 6269 6284 TACCCTCCTTGTCT C.A. 54 478 904968 N/A N/A 6336 6351 TCAGCTAAGACCA GTG 89 479 905000 N/A N/A 6409 6424 TTGCTGAAACCAC CTG 74 480 905032 N/A N/A 6548 6563 ATCAGATGGGTAC TTC 94 481 905064 N/A N/A 6611 6626 AGGCCTTTAGAAC A.G.C. 26 482 905096 N/A N/A 6714 6729 CACTAAATCTGTG TAT 8 483 905128 N/A N/A 6800 6815 TGGGCGAGCGATT GTC 87 484 905160 N/A N/A 6885 6900 CTTGGTTGCCGTG G.C.A. 27 485

- 73 044295

905192 N/A N/A 7076 7091 CTGTTATTAAAACC ASA 67 486 905224 N/A N/A 7165 7180 CCTTGAGGCACCT CCA 35 487 905256 N/A N/A 7265 7280 CCATGCAAAGGAG A.T.T. 68 488 905288 N/A N/A 7346 7361 CATTCTCCCTTATA G.C. 42 489 905320 N/A N/A 7481 7496 ACAGCGAGAGTCA CCG 78 490 905352 N/A N/A 7849 7864 TTGTTTCTTGCCGT G.C. 57 491 905384 N/A N/A 7964 7979 TGAAGTCAGCTGC CAC 79 492 905416 N/A N/A 8012 8027 ATGGTAGGTCTAC AAA 64 493 905448 N/A N/A 8115 8130 ATTCCTGACCATTC CC 75 494 905480 N/A N/A 8181 8196 ATCCAGATGTGTT TAG 86 495 905512 N/A N/A 8334 8349 AACACATCATTGG GTT 27 496 905544 N/A N/A 8405 8420 TGATCACTTCCATC TG 0 497 905576 N/A N/A 8493 8508 CATGGTGCTTTGG A.G.A. 40 498 905608 N/A N/A 8659 8674 CATAGCCAGCAA GAG 40 499 905640 N/A N/A 8752 8767 GGGCTCTAATTCT A.T.T. 0 500 905672 N/A N/A 8863 8878 GGGAATTGTGTGC CCC 24 501 905704 N/A N/A 8903 8918 TGATGTGGGACTT GTT 92 502 905736 N/A N/A 8967 8982 GTGTGGGAGTGCA TAA 0 503

- 74 044295

Table 8

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site SE Q ID: 1, hundred IIsay t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 80 13 903433 31 46 524 539 CAGTCCCCAAGAT ATA 24 504 903465 144 159 N/A N/A GGGCCTCCTCCAA GGA 0 505 903497 260 275 N/A N/A TGTTGCACCCTCG STS 42 506 903529 332 347 4807 4822 ATGGTGCCAGCAG SSS 0 507 903625 567 582 12658 1267 3 GTTTCTGTACTGCT GG 72 508 903657 636 651 12727 1274 2 AAGGGCACGGAGC STT 61 509 903689 677 692 12768 1278 3 GCGATGGTGGTGC STT 32 510

- 75 044295

903721 748 763 12839 1285 4 AGGGTGCCAGCC CAT 0 511 903753 821 836 12912 1292 7 ATCCCGGTCAAAG CGG 0 512 903785 857 872 12948 1296 3 CACCACTTCTTTCC GT 22 513 903817 949 964 13040 1305 5 GAAAGTTGGATAT GTT 83 514 903849 1016 103 1 13107 1312 2 CGTCTGAGGGCAC GGA 15 515 903881 1094 110 9 13185 1320 0 CTTTCAGCTGAGA TTG 57 516 903913 1134 114 9 13225 1324 0 CAGGATGCTGGGT TCA 76 517 903945 1238 125 3 13329 1334 4 CCCTCATGTAAGT GCT 67 518 903977 1354 136 9 13445 1346 0 GTGGTCACAGTTC TTG 0 519 904009 1752 176 7 13843 1385 8 AACTTTACCTCAC CCT 87 520 904041 1838 185 3 13929 1394 4 TCCTTGCTGCACTG CC 94 521 904073 1946 196 1 14037 1405 2 CCGGCCCCCCAAT ATA 3 522 904105 2345 236 0 14436 1445 1 CAACTGTTCTAAC TCT 74 523 904137 2482 249 7 14573 1458 8 GCCCCCAGGAGGA CAA 5 524 904169 2518 253 3 14609 1462 4 GACCATCATCAGG AAG 79 525 904201 2672 268 7 14763 1477 8 CACATACTCTCTG GGA 47 526

- 76 044295

904233 2774 278 9 14865 1488 0 GAGATCTGAGCTT CCT 88 527 904265 2843 285 8 14934 1494 9 CTTGATGAGTAGG TGA 78 528 904361 N/A N/A 1052 1067 TTCTGTTGCCCCCA TT 68 529 904393 N/A N/A 2558 2573 CTGGGCGAGTCTG CCG 0 530 904425 N/A N/A 3756 3771 GTAGAATGAGCAG GTC 97 531 904457 N/A N/A 4426 4441 AGAGTCTATACAC A.G.A. 75 532 904489 N/A N/A 4851 4866 GAGTAGGAACCAG CAG 84 533 904521 N/A N/A 5071 5086 ACTTGAGTCATTT GCT 85 534 904553 N/A N/A 5198 5213 GCGGGAGGTGACA GGT 33 535 904585 N/A N/A 5311 5326 GGCCCGATACATT CCC 0 536 904617 N/A N/A 5410 5425 TCTCATGGTACAG GAG 75 537 904649 N/A N/A 5497 5512 TAGGGAGGCCCTA TTG 14 538 904681 N/A N/A 5699 5714 ATTCTATTGGGCCT C.A. 89 539 904713 N/A N/A 5775 5790 CACCATAGCACGA A.G.C. 90 540 904745 N/A N/A 5817 5832 AGTTTCATATTCAC CC 95 541 904777 N/A N/A 5877 5892 CAAGGTAAACCCA A.A.C. thirty 542

- 77 044295

904809 N/A N/A 5940 5955 TCACCTGTATTCG GAG 32 543 904841 N/A N/A 6017 6032 CTAAAAGCTGATT TGC 52 544 904873 N/A N/A 6146 6161 TCCTTATGCTTACT CC 93 545 904905 N/A N/A 6219 6234 CATGTATGCCCAT GTT 61 546 904937 N/A N/A 6270 6285 ATACCCTCCTTGTC TC 39 547 904969 N/A N/A 6337 6352 TTCAGCTAAGACC AGT 89 548 905001 N/A N/A 6410 6425 GTTGCTGAAAACCA CCT 64 549 905033 N/A N/A 6549 6564 TATCAGATGGGTA CTT 66 550 905065 N/A N/A 6612 6627 GAGGCCTTTAGAA CAG 0 551 905097 N/A N/A 6715 6730 GCACTAAATCTGT GTA 24 552 905129 N/A N/A 6801 6816 CTGGGCGAGCGAT TGT 61 553 905161 N/A N/A 6886 6901 ACTTGGTTGCCGT GGC 27 554 905193 N/A N/A 7077 7092 CCTGTTATTAAAAAC CAC 81 555 905225 N/A N/A 7166 7181 TCCTTGAGGCACC TCC 32 556 905257 N/A N/A 7266 7281 ACCATGCAAAGGA GAT thirty 557 905289 N/A N/A 7347 7362 GCATTCTCCCTTAT A.G. 75 558

- 78 044295

905321 N/A N/A 7482 7497 GACAGCGAGAGTC ACC 29 559 905353 N/A N/A 7850 7865 ATTGTTTCTTGCCG TG 55 560 905385 N/A N/A 7967 7982 TCCTGAAGTCAGC TGC 56 561 905417 N/A N/A 8013 8028 AATGGTAGGTCTA CAA 85 562 905449 N/A N/A 8116 8131 TATTCCTGACCATT CC 77 563 905481 N/A N/A 8182 8197 AATCCAGATGTGT TTA 81 564 905513 N/A N/A 8336 8351 TCAACACATCATT GGG 88 565 905545 N/A N/A 8406 8421 GTGATCACTTCCA TCT 84 566 905577 N/A N/A 8494 8509 CCATGGTGCTTTG GAG 4 567 905609 N/A N/A 8660 8675 CCATAAGCCAGCA A.G.A. 53 568 905641 N/A N/A 8753 8768 AGGGCTCTTAATTC TAT 0 569 905673 N/A N/A 8864 8879 AGGGAATTGTGTG CCC eleven 570 905705 N/A N/A 8904 8919 GTGATGTGGGACT TGT 80 571 905737 N/A N/A 8968 8983 AGTGTGGGAGTGC ATA 0 572

-79044295

Table 9

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site SE Q ID: 1, hundred IIsay t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 83 13 903434 32 47 525 540 CCAGTCCCCAGA TAT 31 573 903466 152 167 2362 2377 TCGCTGCAGGGCC TSS 26 574 903498 261 276 N/A N/A TTGTTGCACCCTCG ST 61 575 903530 343 358 N/A N/A TCTCTGGGTCCATG GT 0 576 903626 568 583 12659 1267 4 AGTTTCTGTACTGC TG 58 577 903658 637 652 12728 1274 3 CAAGGGCACGGAG SST 1 578 903690 678 693 12769 1278 4 GGCGATGGTGGTG SST 17 579 903722 756 771 12847 1286 2 CTCTGTGAAGGGT GCC 39 580 903754 822 837 12913 1292 8 AATCCCGGTCAAA GCG 21 581 903786 858 873 12949 1296 4 SASSASSTTSTTTTS C.G. 48 582

- 80 044295

903818 966 981 13057 1307 2 ATTGCCAGCTAAG GAA 51 583 903850 1030 104 5 13121 1313 6 GATTGGCTCTGGC TCG 56 584 903882 1095 111 0 13186 1320 1 GCTTTCAGCTGAG A.T.T. 6 585 903914 1152 116 7 13243 1325 8 GACTCCTCTGCTCA TT 84 586 903946 1239 125 4 13330 1334 5 CCCCTCATGTAAG TGC 43 587 903978 1359 137 4 13450 1346 5 GCCTGTGGTCAC AGT 31 588 904010 1753 176 8 13844 1385 9 AAACTTTACCTCA CCC 71 589 904042 1840 185 5 13931 1394 6 TCTCCTTGCTGCAC TG 92 590 904074 1947 196 2 14038 1405 3 CCCGGCCCCCCAA TAT 0 591 904106 2346 236 1 14437 1445 2 CCAACTGTTCTAA CTC 89 592 904138 2484 249 9 14575 1459 0 ATGCCCCCAGGAG GAC 29 593 904170 2522 253 7 14613 1462 8 CAATGACCATCAT CAG 45 594 904202 2673 268 8 14764 1477 9 TCACATACTCTCTG GG 79 595 904234 2775 279 0 14866 1488 1 AGAGATCTGAGCT TCC 74 596 904266 2844 285 9 14935 1495 0 GCTTGATGAGTAG GTG 54 597 904298 N/A N/A 2349 2364 TCCTCCTTGAGCA GGA 29 598

- 81 044295

904362 N/A N/A 1077 1092 TGAACTCCTTGTAC C.T. 51 599 904394 N/A N/A 2565 2580 GTCCTCCCTGGGC GAG 33 600 904426 N/A N/A 3793 3808 CCACATTTGAGAT TAT 88 601 904458 N/A N/A 4457 4472 CGGGCAGCCATCT GAT 0 602 904490 N/A N/A 4870 4885 CACCCTCCATTCTA A.G. 0 603 904522 N/A N/A 5072 5087 CACTTGAGTCATTT G.C. 84 604 904554 N/A N/A 5199 5214 AGCGGGAGGTGAC AGG 34 605 904586 N/A N/A 5312 5327 AGGCCCGATACAT TCC 26 606 904618 N/A N/A 5411 5426 TTCTCATGGTACA GGA 65 607 904650 N/A N/A 5498 5513 TTAGGGAGGCCCT A.T.T. 6 608 904682 N/A N/A 5700 5715 AATTCTATTGGGC CTC 64 609 904714 N/A N/A 5776 5791 TCACCATAGCACG AAG 86 610 904746 N/A N/A 5819 5834 GCAGTTTCATATTC A.C. 96 611 904778 N/A N/A 5887 5902 GATTTTCCAACAA GGT 84 612 904810 N/A N/A 5941 5956 CTCACCTGTATTCG GA 27 613 904842 N/A N/A 6020 6035 GCACTAAAAGCTG A.T.T. 70 614

- 82 044295

904874 N/A N/A 6150 6165 GAAATCCTTATGC TTA 69 615 904906 N/A N/A 6220 6235 CCATGTATGCCCA TGT 79 616 904938 N/A N/A 6271 6286 CATACCCTCCTTGT C.T. 21 617 904970 N/A N/A 6339 6354 AATTCAGCTAAGA CCA 77 618 905002 N/A N/A 6411 6426 AGTTGCTGAAACC ACC 68 619 905034 N/A N/A 6550 6565 ATATCAGATGGGT ACT 74 620 905066 N/A N/A 6613 6628 CGAGGCCTTTAGA ASA 19 621 905098 N/A N/A 6716 6731 GGCACTAAATCTG TGT 0 622 905130 N/A N/A 6802 6817 GCTGGGCGAGCGA TTG 39 623 905162 N/A N/A 6887 6902 GACTTGGTTGCCG TGG 79 624 905194 N/A N/A 7078 7093 GCCTGTTATTTAAA CCA 52 625 905226 N/A N/A 7167 7182 ATCCTTGAGGCAC CTC 64 626 905258 N/A N/A 7268 7283 CTACCATGCAAAG GAG 38 627 905290 N/A N/A 7348 7363 TGCATTCTCCTTA T.A. 19 628 905322 N/A N/A 7483 7498 AGACAGCGAGAGT CAC 1 629 905354 N/A N/A 7851 7866 AATTGTTTCTTGCC GT 41 630

- 83 044295

905386 N/A N/A 7973 7988 GATTACTCCTGAA GTC 53 631 905418 N/A N/A 8015 8030 ATAATGGTAGGTC TAC 87 632 905450 N/A N/A 8117 8132 ATATTCTGACCAT TC 72 633 905482 N/A N/A 8183 8198 GAATCCAGATGTG TTT 80 634 905514 N/A N/A 8337 8352 ATCAACACATCAT TGG 62 635 905546 N/A N/A 8407 8422 AGTGATCACTTCC ATS 0 636 905578 N/A N/A 8495 8510 GCCATGGTGCTTT GGA 0 637 905610 N/A N/A 8663 8678 CTTCCATAAGCCA G.C.A. 48 638 905642 N/A N/A 8754 8769 TAGGGCTCTAATT STA 32 639 905674 N/A N/A 8865 8880 GAGGGAATTGTGT GCC 58 640 905706 N/A N/A 8905 8920 TGTGATTGTGGGAC TTG 82 641 905738 N/A N/A 8969 8984 AAGTGTGGGAGTG CAT 0 642

- 84 044295

Table 10

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site S.E. Q ID: 1, one hundred SEQ ID: 2, starting site SEQ ID: 2, stop Subsequence % depressed nya SE Q ID NO II- website website 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 84 13 903435 39 54 532 547 AGGTCCTCCAGTC SSS 0 643 903467 153 168 2363 2378 GTCGCTGCAGGGC STS 4 644 903499 262 277 N/A N/A TTTGTTGCACCCTC G.C. 91 645 903531 345 360 N/A N/A GCTTCTCTGGGTCC ATG 8 646 903627 569 584 12660 1267 5 CAGTTTCTGTACTG ST 14 647 903659 638 653 12729 1274 4 GCAAGGGCACGGA GCC 0 648 903691 679 694 12770 1278 5 TGGCGATGGTGGT GCC 0 649 903723 757 772 12848 1286 3 CCTCTGTGAAGGG TGC 24 650 903755 823 838 12914 1292 9 TAATCCCGGTCAA A.G.C. 18 651 903787 861 876 12952 1296 7 TGTCCACCACTTCT TT 49 652 903819 967 982 13058 1307 3 TATTGCCAGCTAA GGA 33 653 903851 1031 104 6 13122 1313 7 AGATTGGCTCTGG STS 87 654 903883 1096 111 1 13187 1320 2 CGCTTTCAGCTGA GAT 0 655 903915 1156 117 1 13247 1326 2 GCTTGACTCCTCTG ST 6 656

- 85 044295

903947 1240 125 5 13331 1334 6 CCCCCTCATGTAA GTG 25 657 903979 1380 139 5 13471 1348 6 ATCTCTCCTGGTGG C.T. 82 658 904011 1754 176 9 13845 1386 0 TAAACTTTACCTCA CC 65 659 904043 1841 185 6 13932 1394 7 TTCTCCTTGCTGCA C.T. 89 660 904075 1948 196 3 14039 1405 4 ACCCGGCCCCCCA ATA 13 661 904107 2347 236 2 14438 1445 3 TCCAACTGTTCTAA C.T. 66 662 904139 2485 250 0 14576 1459 1 TATGCCCCCAGGA GGA 24 663 904171 2525 254 0 14616 1463 1 CCCCAATGACCAT CAT 27 664 904203 2678 269 3 14769 1478 4 GGTTCTCACATACT C.T. 96 665 904235 2776 279 1 14867 1488 2 TAGAGATCTGAGC TTC 43 666 904267 2845 286 0 14936 1495 1 AGCTTGATGAGTA GGT 0 667 904299 N/A N/A 2352 2367 GCCTCCTCCTTGAG C.A. 0 668 904363 N/A N/A 1086 1101 GATGACCTCTGAA CTC 65 669 904395 N/A N/A 2566 2581 GGTCCTCCCTGGG C.G.A. 7 670 904427 N/A N/A 3795 3810 GCCCACATTTGAG A.T.T. 23 671 904459 N/A N/A 4461 4476 AGGACGGGCAGCC ATS 9 672

- 86 044295

904491 N/A N/A 4871 4886 CCACCCTCCATTCT A.A. eleven 673 904523 N/A N/A 5073 5088 CCACTTGAGTCATT TG 89 674 904555 N/A N/A 5200 5215 GAGCGGGAGGTGA CAG 16 675 904587 N/A N/A 5313 5328 CAGGCCCGATACA TTC 8 676 904619 N/A N/A 5412 5427 ATTCTCATGGTAC AGG 92 677 904651 N/A N/A 5499 5514 CTTAGGGAGGCCC TAT 3 678 904683 N/A N/A 5701 5716 AAATTCTATTGGG CCT 19 679 904715 N/A N/A 5777 5792 TTCACCATAGCAC GAA 24 680 904747 N/A N/A 5826 5841 CCTTACTGCAGTTT C.A. 91 681 904779 N/A N/A 5889 5904 GGGATTTTCCAAC AAG 42 682 904811 N/A N/A 5942 5957 TCTCACCTGTATTC GG 28 683 904843 N/A N/A 6021 6036 TGCACTAAAAGCT GAT 21 684 904875 N/A N/A 6152 6167 CAGAAATCCTTAT GCT 25 685 904907 N/A N/A 6221 6236 TCCATGTATGCC ATG 77 686 904939 N/A N/A 6279 6294 CACTCAATCATAC CCT 43 687 904971 N/A N/A 6340 6355 CAATTCAGCTAG ACC 54 688

- 87 044295

905003 N/A N/A 6413 6428 GGAGTTGCTGAAA CCA 35 689 905035 N/A N/A 6551 6566 CATATCAGATGGG TAC 65 690 905067 N/A N/A 6614 6629 ACGAGGCCTTTAG A.A.C. 49 691 905099 N/A N/A 6720 6735 CTCTGGCACTAAA TCT 38 692 905131 N/A N/A 6803 6818 GGCTGGGCGAGCG A.T.T. 44 693 905163 N/A N/A 6888 6903 TGACTTGGTTGCC GTG 67 694 905195 N/A N/A 7079 7094 GGCCTGTTATTAA ACC 2 695 905227 N/A N/A 7168 7183 GATCCTTGAGGCA CCT 4 696 905259 N/A N/A 7269 7284 ACTACCATGCAAA GGA 38 697 905291 N/A N/A 7379 7394 CTCCTTATGTTTTG A.A. 81 698 905323 N/A N/A 7484 7499 CAGACAGCGAGAG TCA 22 699 905355 N/A N/A 7852 7867 AAATTGTTTCTTGC C.G. 46 700 905387 N/A N/A 7974 7989 GGATTACTCCTGA AGT 33 701 905419 N/A N/A 8016 8031 AATAATGGTAGGT STA 82 702 905451 N/A N/A 8118 8133 TATATTCCTGACCA TT 63 703 905483 N/A N/A 8184 8199 GGAATCCAGATGT GTT 86 704

- 88 044295

905515 N/A N/A 8338 8353 TATCAACACATCA TTG 37 705 905547 N/A N/A 8408 8423 CAGTGATCACTTC CAT 38 706 905579 N/A N/A 8516 8531 ACATTGAAACACC AGG 92 707 905611 N/A N/A 8664 8679 GCTTCCATAAGCC A.G.C. 35 708 905643 N/A N/A 8755 8770 GTAGGGCTCTAAT TCT 56 709 905675 N/A N/A 8866 8881 AGAGGGAATTGTG TGC 78 710 905707 N/A N/A 8906 8921 CTGTGATTGTGGGA CTT 91 711 905739 N/A N/A 8970 8985 AAAGTGTGGGAGT G.C.A. 0 712

Table 11

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site S.E. Q ID: 1, CTO IIsai T SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC A.T.T. 93 13 903414 12 27 505 520 AGGAATTCGAAAG GGA 0 713

- 89 044295

903446 52 67 545 560 ATAATAACCAGAC AGG 48 714 903478 206 221 N/A N/A GCACTCATCCAGA TGC 29 715 903510 288 303 4763 4778 TCCAGTATCTGTCC C.A. 57 716 903542 397 412 9060 9075 GTGTGCTCACTTTT TC 91 717 903638 615 630 12706 1272 1 GTTATCCTCAAGC TCA 81 718 903670 656 671 12747 1276 2 ACCTTCTGAACCC CAT 85 719 903702 729 744 12820 1283 5 GACGAGGTCAGG ATG 51 720 903734 789 804 12880 1289 5 CATCCCAGGTTCC AAG 63 721 903766 836 851 12927 1294 2 ATGGTACTGCTGG TAA 76 722 903798 873 888 12964 1297 9 GGCTTGGGCTTGT GTC 57 723 903830 982 997 13073 1308 8 GTGTGAGTTGGTA AGT 98 724 903862 1047 106 2 13138 1315 3 ATGCGGTACTGAC TGA 92 725 903894 1107 112 2 13198 1321 3 CACCTGTTCACCG CTT 94 726 903926 1169 118 4 13260 1327 5 GCCACATCCGTGA GCT 25 727 903958 1333 134 8 13424 1343 9 CCTGCAGAATCTT ATA 0 728 903990 1393 140 8 13484 1349 9 CCCTGCCAGGCAT ATS 20 729

- 90 044295

904022 1779 179 4 13870 1388 5 CCAAAGTCCCTAA CAC 74 730 904054 1866 188 1 13957 1397 2 TATTGCAGGCTCC AAT 18 731 904086 2256 227 1 14347 1436 2 TCTTCCGTCAATAT AT 79 732 904118 2383 239 8 14474 1448 9 TGGGTCTGTAGTG GAG 76 733 904150 2498 251 3 14589 1460 4 TGCCTGACTGAGA TAT 64 734 904182 2542 255 7 14633 1464 8 CCATCACATGACA ACC 83 735 904214 2712 272 7 14803 1481 8 CCGGGTAAGAGCG ATG 29 736 904246 2793 280 8 14884 1489 9 CGGCGACAAGACA GCT 53 737 904278 N/A N/A 448 463 AGCAAACACGCTC CCC 32 738 904310 N/A N/A 1333 1348 GCAACGCACCCTT CTC 67 739 904374 N/A N/A 1715 1730 ACAGGCTTCATCA TCT 72 740 904406 N/A N/A 2624 2639 AGCCTCTGCTGAA TAT 25 741 904438 N/A N/A 3956 3971 GATCTTGCCAGAT GCC 38 742 904470 N/A N/A 4584 4599 ATCACTGAGCCCC CAT 55 743 904502 N/A N/A 5016 5031 TCACCCTAAGGAG AGG 68 744 904534 N/A N/A 5095 5110 ACTTCCCCAAGGA TGT 25 745

- 91 044295

904566 N/A N/A 5217 5232 AGGGTCAGCTTGG A.G.C. 73 746 904598 N/A N/A 5332 5347 GTTAAGCTGGAAG CTG 41 747 904630 N/A N/A 5455 5470 AGCCGTGTTATAT TTG 88 748 904662 N/A N/A 5580 5595 TGCCCTAACACAG CTG 8 749 904694 N/A N/A 5742 5757 TTCCCAATTCAG AAT 54 750 904726 N/A N/A 5793 5808 TTGTCTCCGACACT TT 43 751 904758 N/A N/A 5849 5864 AAGTGCAACCAAT CAA 94 752 904790 N/A N/A 5918 5933 CTAAACTCACACT GGC 67 753 904822 N/A N/A 5953 5968 CTAAGTTCCGGTC TCA 87 754 904854 N/A N/A 6090 6105 ACTCCACTGGGGCC C.G.A. 16 755 904886 N/A N/A 6191 6206 GCATTGCCCCTCCC AAT 57 756 904918 N/A N/A 6233 6248 CACCACAGCCGTT CCA 26 757 904950 N/A N/A 6305 6320 CTGGGTCTGACCC A.C.G. 0 758 904982 N/A N/A 6366 6381 CAGGATCCTGACA A.A.C. 0 759 905014 N/A N/A 6437 6452 CAGGTTCACATGA CAG 77 760 905046 N/A N/A 6582 6597 AACTGCAAGCTAT GGG 91 761

- 92 044295

905078 N/A N/A 6628 6643 GACAGGCAATACC TAC 6 762 905110 N/A N/A 6733 6748 GGATGGAAGGAAC CTC 91 763 905142 N/A N/A 6821 6836 TGAACGCAATGCT GAC 97 764 905174 N/A N/A 6981 6996 GCTCTCGGCTTCTA AT 21 765 905206 N/A N/A 7111 7126 CGGCTCTCCACTG TCA 46 766 905238 N/A N/A 7232 7247 GCACTCTCAGATG GGC 20 767 905270 N/A N/A 7284 7299 ACAGCATTGAGTA CAA 96 768 905302 N/A N/A 7456 7471 ATCAAGCAGGAAG CTC 70 769 905334 N/A N/A 7527 7542 CCGGCCACCTCAT TCT 16 770 905366 N/A N/A 7889 7904 CCAGTATGTATTT GTG 52 771 905398 N/A N/A 7986 8001 CAGTACAGAGCAG GAT 96 772 905430 N/A N/A 8064 8079 CACATGTTTCAAAC AGT 78 773 905462 N/A N/A 8145 8160 TTTAGAAAGGACA CGG 94 774 905494 N/A N/A 8268 8283 AATATCAGAGTGT ACC 94 775 905526 N/A N/A 8373 8388 TCAAACACTTTAT ACC 63 776 905558 N/A N/A 8424 8439 GGAAGTGGAAACA TCC 50 777 905590 N/A N/A 8561 8576 GTTGAAGTCACCC A.G.C. 48 778 905622 N/A N/A 8692 8707 GACTGTGTGAGCA CAC 25 779 905654 N/A N/A 8809 8824 CATTTGGAGATCT GGC 90 780 905686 N/A N/A 8877 8892 ATTAGTGCTATAG AGG 87 781 905718 N/A N/A 8945 8960 TTGCATAAGAGAT GAC 84 782

- 93 044295

Table 12

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site SE Q ID: 1, hundred IIsay t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 89 13 903415 13 28 506 521 GAGGAATTCGAAA GGG 47 783 903447 54 69 547 562 GTATAATAACCAG ASA thirty 784 903479 207 222 N/A N/A TGCACTCATCCAG ATG 15 785 903511 289 304 4764 4779 CTCCAGTATCTGTC SS 70 786

- 94 044295

903671 658 673 12749 1276 4 GGACCTTCTGAAC CCC 20 787 903703 730 745 12821 1283 6 CGACGAGGGTCAG GAT 53 788 903735 790 805 12881 1289 6 CCATCCCAGGTTC CAA 51 789 903767 837 852 12928 1294 3 CATGGTACTGCTG GTA 83 790 903799 891 906 12982 1299 7 TTTGATGACCAGG TCG 74 791 903831 983 998 13074 1308 9 CGTGTGAGTTGGT AAG 86 792 903863 1048 106 3 13139 1315 4 CATGCGGTACTGA CTG 44 793 903895 1108 112 3 13199 1321 4 CCACCTGTTCACC GCT 92 794 903927 1171 118 6 13262 1327 7 GGGCCACATCCGT GAG 0 795 904023 1780 179 5 13871 1388 6 GCCAAAGTCCCTA ASA 87 796 904087 2257 227 2 14348 1436 3 TTTCTTCCGTCAATA T.A. 91 797 904119 2385 240 0 14476 1449 1 GCTGGGTCTGTAG TGG 88 798 904151 2499 251 4 14590 1460 5 CTGCCTGACTGAG ATA 86 799 904183 2543 255 8 14634 1464 9 CCCATCACATGAC A.A.C. 85 800 904215 2713 272 8 14804 1481 9 ACCGGGTAAGAGC GAT 76 801 904247 2794 280 9 14885 1490 0 GCGGCGACAAGAC A.G.C. 24 802

- 95 044295

904311 N/A N/A 1336 1351 TCTGCAACGCACC CTT 54 803 904343 N/A N/A 631 646 TTACCAAGGAATC TTC 42 804 904375 N/A N/A 1885 1900 CGCCTCCTTCAAC CTT 68 805 904407 N/A N/A 2637 2652 GACCCTGACCTGG A.G.C. 48 806 904439 N/A N/A 4015 4030 GCACTGGACAGCC TGT 41 807 904471 N/A N/A 4590 4605 TTGTCTATCACTGA G.C. 66 808 904503 N/A N/A 5017 5032 GTCACCCTAAGGA GAG 40 809 904535 N/A N/A 5104 5119 GCTGATTCCACTTC CC 66 810 904567 N/A N/A 5221 5236 CCCCAGGGTCAGC TTG 48 811 904599 N/A N/A 5333 5348 AGTTAAAGCTGGAA GCT 18 812 904631 N/A N/A 5456 5471 TAGCCGTGTTATA TTT 73 813 904663 N/A N/A 5650 5665 TGAACTCAGCCCC TGC 43 814 904695 N/A N/A 5743 5758 TTTCCCAATTCAGC A.A. 63 815 904727 N/A N/A 5794 5809 CTTGTCTCGCACA CTT 81 816 904759 N/A N/A 5850 5865 TAAGTGCAACCAA TCA 92 817 904791 N/A N/A 5919 5934 CCTAAACTCACAC TGG 47 818

- 96 044295

904823 N/A N/A 5954 5969 GCTAAGTTCCGGT CTC 87 819 904855 N/A N/A 6091 6106 AACTCCACTGGGC CCG 0 820 904887 N/A N/A 6194 6209 ACTGCATTGCCCT CCC 80 821 904919 N/A N/A 6234 6249 GCACCACAGCCGT TCC 37 822 904983 N/A N/A 6367 6382 ACAGGATCCTGAC AAA 8 823 905047 N/A N/A 6583 6598 AAACTGCAAGCTA TGG 71 824 905079 N/A N/A 6630 6645 TGGACAGGCAATA CCT 1 825 905143 N/A N/A 6822 6837 ATGAACGCAATGC TGA 96 826 905175 N/A N/A 6982 6997 TGCTCTCGGCTTCT A.A. 65 827 905207 N/A N/A 7112 7127 ACGGCTCTCCACT GTC 58 828 905239 N/A N/A 7233 7248 GGCACTCTCAGAT GGG 13 829 905271 N/A N/A 7285 7300 CACAGCATTGAGT ASA 88 830 905303 N/A N/A 7459 7474 ACCATCAAGCAGG AAG 90 831 905335 N/A N/A 7528 7543 CCCGGCCACCTCA TTC 0 832 905367 N/A N/A 7890 7905 ACCAGTATGTATT TGT 75 833 905399 N/A N/A 7987 8002 TCAGTACAGAGCA GGA 96 834

- 97 044295

905431 N/A N/A 8065 8080 ACACATGTTTCAA CAG 70 835 905463 N/A N/A 8146 8161 TTTTAGAAAGGAC A.C.G. 93 836 905495 N/A N/A 8269 8284 AAATATCAGAGTG TAC 75 837 905527 N/A N/A 8374 8389 GTCAAACACTTTA TAC 52 838 905559 N/A N/A 8442 8457 GTGAGCCTTCCAG GCC 0 839 905591 N/A N/A 8564 8579 GATGTTGAAGTCA CCC 60 840 905623 N/A N/A 8694 8709 AAGACTGTGTGAG CAC 54 841 905655 N/A N/A 8811 8826 TACATTTGGAGAT CTG 95 842 905687 N/A N/A 8878 8893 CATTAGTGCTATA GAG 76 843 905719 N/A N/A 8946 8961 ATTGCATAAGAGA TGA 83 844

Table 13

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site S.E. Q ID: 1, CTO IIsai T SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO

- 98 044295

793406 N/A N/A 8306 8321 GTTCAAAAGCAGC A.T.T. 79 13 903416 14 29 507 522 CGAGGAATTCGAA AGG 22 845 903448 55 70 548 563 TGTATAATAACCA GAC 27 846 903480 208 223 N/A N/A GTGCACTCATCCA GAT 0 847 903512 291 306 4766 4781 ATCTCCAGTATCTG TC 20 848 903544 403 418 9066 9081 GATTCTGTGTGCTC A.C. 90 849 903640 617 632 12708 1272 3 ATGTTATCCTCAA GCT 47 850 903672 659 674 12750 1276 5 TGGACCTTCTGAA CCC 6 851 903704 731 746 12822 1283 7 CCGACGAGGGTCA GGA 25 852 903736 793 808 12884 1289 9 ACTCCATCCCAGG TTC 20 853 903768 838 853 12929 1294 4 CCATGGTACTGCT GGT 0 854 903800 892 907 12983 1299 8 TTTTGATGACCAG GTC 57 855 903832 997 101 2 13088 1310 3 CCTTCCCAATGCCT C.G. 78 856 903864 1049 106 4 13140 1315 5 GCATGCGGTACTG ACT 4 857 903896 1109 112 4 13200 1321 5 TCCACCTGTTCACC G.C. 78 858 903928 1200 121 5 13291 1330 6 TACATCCAGCACA A.G.A. 72 859

- 99 044295

903960 1335 135 0 13426 1344 1 CGCCTGCAGAATC TTA 63 860 903992 1395 141 0 13486 1350 1 GCCCCTGCCAGGC ATA 20 861 904024 1781 179 6 13872 1388 7 TGCCAAAGTCCCT A.A.C. 83 862 904056 1872 188 7 13963 1397 8 TTCCCTTATTGCAG G.C. 77 863 904088 2258 227 3 14349 1436 4 ATTTCTTCCGTCAAT AT 77 864 904120 2386 240 1 14477 1449 2 GGCTGGGTCTGTA GTG 66 865 904152 2500 251 5 14591 1460 6 GCTGCCTGACTGA GAT 33 866 904184 2544 255 9 14635 1465 0 ACCCATCACATGA CAA 80 867 904216 2714 272 9 14805 1482 0 TACCGGGTAAGAG C.G.A. 84 868 904248 2795 281 0 14886 1490 1 GGCGGCGACAAGA CAG 58 869 904280 N/A N/A 450 465 ACAGCAAACACGC TCC 18 870 904312 N/A N/A 1338 1353 ATTCTGCAACGCA CCC 61 871 904344 N/A N/A 642 657 CTGTCCCCAACTTA CC 7 872 904376 N/A N/A 1887 1902 TCCGCCTCCTTCAA CC 45 873 904408 N/A N/A 2680 2695 CACCCTGGATCCC ATS 26 874 904440 N/A N/A 4044 4059 CTCTTCATCTTGGT GA 69 875

- 100 044295

904472 N/A N/A 4599 4614 CCAGATTGTTTGTC T.A. 62 876 904504 N/A N/A 5018 5033 TGTCACCCTAAGG A.G.A. 36 877 904536 N/A N/A 5105 5120 CGCTGATTCCACTT CC 17 878 904568 N/A N/A 5222 5237 ACCCCAGGGTCAG CTT 25 879 904600 N/A N/A 5334 5349 CAGTTAAGCTGGA A.G.C. 18 880 904632 N/A N/A 5457 5472 GTAGCCGTGTTAT A.T.T. 73 881 904664 N/A N/A 5652 5667 ACTGAACTCAGCC CCT 50 882 904696 N/A N/A 5744 5759 GTTTCCCAATTCAG C.A. 64 883 904728 N/A N/A 5795 5810 CCTTGTCTCGCACA C.T. 88 884 904760 N/A N/A 5851 5866 GTAAGTGCAACCA ATS 98 885 904792 N/A N/A 5920 5935 CCCTAAACTCACA CTG 28 886 904824 N/A N/A 5955 5970 GGCTAAGTTCCGG TCT 48 887 904856 N/A N/A 6092 6107 AAACTCCACTGGG CCC 9 888 904888 N/A N/A 6195 6210 AACTGCATTGCC TCC 72 889 904920 N/A N/A 6236 6251 CCGCACCACAGCC GTT 26 890 904952 N/A N/A 6307 6322 CGCTGGGTCTGAC CCA 22 891

- 101 044295

904984 N/A N/A 6368 6383 CACAGGATCTGA CAA 0 892 905016 N/A N/A 6439 6454 AGCAGGTTCACAT GAC 78 893 905048 N/A N/A 6587 6602 CCTGAAACTGCAA GCT 41 894 905080 N/A N/A 6631 6646 CTGGACAGGCAAT ACC 24 895 905112 N/A N/A 6735 6750 TTGGATGGAAGGA ACC 75 896 905144 N/A N/A 6823 6838 AATGAACGCAATG CTG 83 897 905176 N/A N/A 6983 6998 GTGCTCTCGGCTTC T.A. 59 898 905208 N/A N/A 7113 7128 CACGGCTCTCCAC TGT thirty 899 905240 N/A N/A 7234 7249 GGGCACTCTCAGA TGG 44 900 905272 N/A N/A 7286 7301 CCACAGCATTGAG TAC 58 901 905304 N/A N/A 7460 7475 AACCATCAAGCAG GAA 70 902 905336 N/A N/A 7532 7547 AGTGCCCGGCCAC CTC 37 903 905368 N/A N/A 7892 7907 GGACCAGTATGTA TTT 34 904 905400 N/A N/A 7988 8003 GTCAGTACAGAGC AGG 96 905 905432 N/A N/A 8066 8081 CACACATGTTTCA ASA 48 906 905464 N/A N/A 8156 8171 ATTTCCACTATTTTT A.G. 59 907

- 102 044295

905496 N/A N/A 8271 8286 GAAAATATCAGAG TGT 94 908 905528 N/A N/A 8375 8390 GGTCAAACACTTT ATA 58 909 905560 N/A N/A 8443 8458 AGTGAGCCTCCA GGC eleven 910 905592 N/A N/A 8565 8580 AGATGTTGAAGTC ACC 67 911 905624 N/A N/A 8704 8719 GGGACAAAGAAG ACT 23 912 905656 N/A N/A 8812 8827 CTACATTTGGGAGA TCT 62 913 905688 N/A N/A 8879 8894 TCATTAGTGCTATA GA 91 914 905720 N/A N/A 8947 8962 CATTGCATAAGAG ATG 19 915

Table 14

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site SE Q ID: 1, CTO Psy T SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC A.T.T. 82 13 903417 15 thirty 508 523 CCGAGGAATTCGA AAG 12 916

- 103 044295

903449 56 71 549 564 CTGTATAATAACC A.G.A. 47 917 903481 209 224 N/A N/A AGTGCACTCATCC A.G.A. 0 918 903513 292 307 4767 4782 GATCCCAGTATCT GT 28 919 903641 618 633 12709 1272 4 TATGTTATCCTCAA G.C. 52 920 903673 660 675 12751 1276 6 GTGGACCTCTGA ACC 0 921 903705 732 747 12823 1283 8 GCCGACGAGGGTC AGG eleven 922 903737 794 809 12885 1290 0 AACTCCATCCCAG GTT 0 923 903769 839 854 12930 1294 5 TCCATGGTACTGCT GG 0 924 903801 893 908 12984 1299 9 CTTTTGATGACCA GGT 60 925 903833 999 101 4 13090 1310 5 GTCCTTCCAATGC C.T. 28 926 903865 1050 106 5 13141 1315 6 GGCATGCGGTACT GAC 37 927 903897 1110 112 5 13201 1321 6 CTCCACCTGTTCAC C.G. 57 928 903929 1201 121 6 13292 1330 7 CTACATCCAGGCAC AAG 72 929 903961 1336 135 1 13427 1344 2 CCGCTGCAGAAT CTT 91 930 903993 1405 142 0 13496 1351 1 TTTTGTCCTGGCCC C.T. 83 931 904025 1782 179 7 13873 1388 8 ATGCCAAAGTCCC TAA 96 932

- 104 044295

904057 1873 188 8 13964 1397 9 TTTCCCTTATTGCA GG 77 933 904089 2259 227 4 14350 1436 5 TATTCTTCCGTCAA T.A. 50 934 904121 2401 241 6 14492 1450 7 GGACATTGAACCT GGG 86 935 904153 2501 251 6 14592 1460 7 CGCTGCCTGACTG A.G.A. 58 936 904185 2545 256 0 14636 1465 1 GACCCATCACATG ASA 59 937 904217 2715 273 0 14806 1482 1 TTACCGGGTAAGA GCG 76 938 904249 2796 281 1 14887 1490 2 GGGCGGCGACAAG ASA 82 939 904281 N/A N/A 451 466 CACAGCAAACACG CTC thirty 940 904313 N/A N/A 1339 1354 CATTCTGCAACGC ACC 54 941 904345 N/A N/A 651 666 GCAGGTCAACTGT CCC 0 942 904377 N/A N/A 1888 1903 ATCCGCCTCCTTCA A.C. 17 943 904409 N/A N/A 2706 2721 ATTCCCCGACAC TTG 62 944 904441 N/A N/A 4045 4060 ACTCTTCATCTTGG TG 73 945 904473 N/A N/A 4607 4622 AACCTAACCAGA TTG 0 946 904505 N/A N/A 5019 5034 GTGTCACCCTAAG GAG 29 947 904537 N/A N/A 5106 5121 CCGCTGATTCCACT TC 35 948

- 105 044295

904569 N/A N/A 5233 5248 CAGGTGGAAAACAC CCC 1 949 904601 N/A N/A 5335 5350 CCAGTTTAAGCTGG AAG 4 950 904633 N/A N/A 5458 5473 GGTAGCCGTGTTA TAT 74 951 904665 N/A N/A 5653 5668 GACTGAACTCAGC CCC 57 952 904697 N/A N/A 5745 5760 TGTTTCCCAATTCA G.C. 67 953 904729 N/A N/A 5796 5811 ACCTTGTCTCCGAC A.C. 71 954 904761 N/A N/A 5852 5867 TGTAAGTGCAACC AAT 85 955 904793 N/A N/A 5921 5936 TCCCTAAAACTCAC ACT 18 956 904825 N/A N/A 5956 5971 AGGCTAAGTTCCG GTC 35 957 904857 N/A N/A 6093 6108 CAAACTCCACTGG GCC 16 958 904889 N/A N/A 6196 6211 AAACTGCATTGCC CTC 64 959 904921 N/A N/A 6237 6252 CCCGCACCACAGC CGT 44 960 904953 N/A N/A 6308 6323 GCGCTGGGTCTGA CCC 0 961 904985 N/A N/A 6369 6384 CCACAGGATCCTG ASA 14 962 905017 N/A N/A 6512 6527 TAAAGCCAGCTGA CAG 47 963 905049 N/A N/A 6588 6603 CCCTGAAACTGCA A.G.C. 32 964

- 106 044295

905081 N/A N/A 6632 6647 CCTGGACAGGCAA TAC 0 965 905113 N/A N/A 6736 6751 TTTGGATGGAAGG A.A.C. 71 966 905145 N/A N/A 6824 6839 AAATGAACGCAAT GCT 65 967 905177 N/A N/A 6984 6999 AGTGCTCTCGGCTT C.T. 39 968 905209 N/A N/A 7114 7129 ACACGGCTCTCCA CTG 55 969 905241 N/A N/A 7235 7250 TGGGCACTCTCAG ATG 25 970 905273 N/A N/A 7289 7304 ACTCCACAGCATT GAG 4 971 905305 N/A N/A 7461 7476 AAACCATCAAGCA GGA 63 972 905337 N/A N/A 7829 7844 ACAAGAGACCCTCA TTC 48 973 905369 N/A N/A 7893 7908 GGGACCAGTATGT A.T.T. 21 974 905401 N/A N/A 7990 8005 AAGTCAGTACAGA G.C.A. 94 975 905433 N/A N/A 8067 8082 CCACACATGTTTC A.A.C. 62 976 905465 N/A N/A 8158 8173 GAATTTCCACTATT TT 74 977 905497 N/A N/A 8307 8322 GGTTCAAAAGCAG CAT 96 978 905529 N/A N/A 8376 8391 GGGTCAAACACTT TAT 78 979 905561 N/A N/A 8444 8459 AAGTGAGCCTTCC AGG thirty 980 905593 N/A N/A 8566 8581 CAGATGTTGAAGT CAC 56 981 905625 N/A N/A 8723 8738 CCTATTGTAAGAA CAG 58 982 905657 N/A N/A 8820 8835 TCAGGTGACTACA TTT 89 983 905689 N/A N/A 8880 8895 GTCATTAGTGCTAT A.G. 95 984 905721 N/A N/A 8948 8963 CCATTGCATAAGA GAT 84 985

- 107 044295

Table 15

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site SE Q ID: 1, hundred IIsay t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 86 13 903418 16 31 509 524 ACCGAGGAATTCG AAA 22 986 903450 59 74 552 567 CGTCTGTATAATA ACC 37 987 903482 210 225 N/A N/A AAGTGCACTCATC CAG 50 988 903514 293 308 4768 4783 GGATCCCAGTAT CTG 15 989

- 108 044295

903642 619 634 12710 1272 5 TTATGTTATCTCA A.G. 67 990 903674 661 676 12752 1276 7 TGTGGACCTTCTG A.A.C. 16 991 903706 733 748 12824 1283 9 TGCCGACGAGGGT CAG 42 992 903738 795 810 12886 1290 1 CAACTCCATCCCA GGT 37 993 903770 841 856 12932 1294 7 AGTCCATGGTACT GCT 21 994 903802 894 909 12985 1300 0 GCTTTTGATGACC AGG 87 995 903834 1000 101 5 13091 1310 6 TGTCCTTCCCAATG CC 38 996 903866 1052 106 7 13143 1315 8 GAGGCATGCGGTA CTG 53 997 903898 1111 112 6 13202 1321 7 TCTCCACCTGTTCA CC 63 998 903930 1204 121 9 13295 1331 0 AGACTACATCCAG CAC 81 999 903962 1337 135 2 13428 1344 3 TCCGCCTGCAGAA TCT 76 100 0 903994 1406 142 1 13497 1351 2 ATTTTGTCCTGGCC CC 64 100 1 904026 1787 180 2 13878 1389 3 TGGAAATGCCAAA GTC 97 100 2 904058 1884 189 9 13975 1399 0 CAGTTCCCATTTTT CC 93 100 3 904090 2260 227 5 14351 1436 6 CTATTCTTCCGTCA AT 67 100 4 904122 2402 241 7 14493 1450 8 AGGACATTGAACC TGG 65 100 5

- 109 044295

904154 2502 251 7 14593 1460 8 CCGCTGCCTGACT GAG 81 100 6 904186 2546 256 1 14637 1465 2 GGACCCATCACAT GAC 55 100 7 904218 2716 273 1 14807 1482 2 CTTACCGGGTAAG A.G.C. 49 100 8 904250 2797 281 2 14888 1490 3 TGGGCGGCGACAA GAC 74 100 9 904282 N/A N/A 457 472 ACCAAGCACAGCA A.A.C. 0 101 0 904314 N/A N/A 1341 1356 ACCATTCTGCAAC G.C.A. 68 101 1 904346 N/A N/A 655 670 GGAGGCAGGTCAA CTG 5 101 2 904378 N/A N/A 2051 2066 TGACCACCTGTCTT GG 0 101 3 904410 N/A N/A 2716 2731 GGTGCCTCGGATT CCC 9 101 4 904442 N/A N/A 4052 4067 GTGCTCAACTCTTC AT 76 101 5 904474 N/A N/A 4615 4630 CCAAGACCAACCT AAA 29 101 6 904506 N/A N/A 5020 5035 CGTGTCACCCTAA GGA 51 101 7 904538 N/A N/A 5107 5122 CCGCTGATTCCA CTT 36 101 8 904570 N/A N/A 5234 5249 TCAGGTGGAAACA CCC eleven 101 9 904602 N/A N/A 5336 5351 TCCAGTTAAGCTG GAA 0 102 0 904634 N/A N/A 5460 5475 CAGGTAGCCGTGT TAT 41 102 1

- 110 044295

904666 N/A N/A 5654 5669 TGACTGAACTCAG CCC 43 102 2 904698 N/A N/A 5747 5762 GCTGTTTCCCAATT C.A. 57 102 3 904730 N/A N/A 5797 5812 AACCTTGTCTCCG ASA 46 102 4 904762 N/A N/A 5853 5868 TTGTAAGTGCAAC CAA 76 102 5 904794 N/A N/A 5925 5940 GACCTCCCTAAAAC TCA 13 102 6 904826 N/A N/A 5957 5972 AAGGCTAAGTTCC GGT 47 102 7 904858 N/A N/A 6104 6119 GACAAGAACCCCA A.A.C. 0 102 8 904890 N/A N/A 6197 6212 AAAACTGCATTGC CCT 72 102 9 904922 N/A N/A 6238 6253 ACCCGCACCACAG CCG 12 103 0 904954 N/A N/A 6320 6335 AGATCCAACTCGG C.G.C. 7 103 1 904986 N/A N/A 6370 6385 CCCACAGGATCT GAC 25 103 2 905018 N/A N/A 6514 6529 CTTAAAGCCAGCT GAC 25 103 3 905050 N/A N/A 6590 6605 CCCCTGAAACTG CAA 34 103 4 905082 N/A N/A 6633 6648 TCCTGGACAGGCA ATA 32 103 5 905114 N/A N/A 6739 6754 AGGTTTGGATGGA AGG 90 103 6 905146 N/A N/A 6825 6840 GAAATGAACGCAA TGC 87 103 7

- 111 044295

905178 N/A N/A 6985 7000 GAGTGCTCTCGGC TTC 47 103 8 905210 N/A N/A 7115 7130 TACACGGCTCTCC ACT 73 103 9 905242 N/A N/A 7236 7251 TTGGGCACTCTCA GAT 8 104 0 905274 N/A N/A 7290 7305 AACTCCACAGCAT TGA 53 104 1 905306 N/A N/A 7466 7481 GCCCAAAACCATC AAG 3 104 2 905338 N/A N/A 7830 7845 CACAAGAGACCTC A.T.T. 15 104 3 905370 N/A N/A 7917 7932 TATGGAATTGCAG ATA 85 104 4 905402 N/A N/A 7991 8006 CAAGTCAGTACAG A.G.C. 93 104 5 905434 N/A N/A 8068 8083 CCCACACATGTTTT CAA 58 104 6 905466 N/A N/A 8159 8174 AGAATTTCCACTA TTT 82 104 7 905498 N/A N/A 8308 8323 TGGTTCAAAAGCA G.C.A. 90 104 8 905530 N/A N/A 8377 8392 TGGGTCAAACACT TTA 63 104 9 905562 N/A N/A 8445 8460 GAAGTGAGCCCTTC CAG 60 105 0 905594 N/A N/A 8567 8582 CCAGATGTTGAAG TCA 76 105 1 905626 N/A N/A 8724 8739 TCCTATTGTAAGA ASA 54 105 2 905658 N/A N/A 8821 8836 CTCAGGTGACTAC A.T.T. 87 105 3 905690 N/A N/A 8881 8896 AGTCATTAGTGCT ATA 90 105 4 905722 N/A N/A 8949 8964 GCCATTGCTATAAG A.G.A. 29 105 5

- 112 044295

Table 16

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

Connection number SEQ ID: 1, starting site SE Q ID: 1, hundred IIsay t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed SE Q ID NO 903419 17 32 510 525 TACCGAGGAATTC GAA 13 105 6 903451 73 88 566 581 CACCTCCAGTTAT GCG 51 105 7 903483 211 226 N/A N/A AAAGTGCACTCAT SSA 71 105 8 903515 294 309 4769 4784 AGGATCCCAGTA TST 24 105 9 903643 620 635 12711 1272 6 CTTATGTTATCCTC AA 81 106 0 903675 662 677 12753 1276 8 TTGTGGACCTTCTG AA 58 106 1 903707 734 749 12825 1284 0 ATGCCGACGAGGG TCA 49 106 2 903739 801 816 12892 1290 7 GATTCCCAACTCC ATS 10 106 3

- 113 044295

903771 842 857 12933 1294 8 TAGTCCATGGTAC TGC 4 106 4 903803 896 911 12987 1300 2 AGGCTTTTGATGA CCA 24 106 5 903835 1001 101 6 13092 1310 7 ATGTCCTTCCCAAAT G.C. 32 106 6 903867 1053 106 8 13144 1315 9 TGAGGCATGCGGT ACT 88 106 7 903899 1115 FROM 0 13206 1322 1 ACCCTCTCCACCT GTT 41 106 8 903931 1205 122 0 13296 1331 1 TAGACTACATCCA G.C.A. 72 106 9 903963 1338 135 3 13429 1344 4 GTCGCCTGCCAGA ATS 82 107 0 903995 1701 171 6 13792 1380 7 AAAAGCGATGGCT CAC 57 107 1 904027 1791 180 6 13882 1389 7 GCTATGGAAATGC CAA 90 107 2 904059 1886 190 1 13977 1399 2 TCCAGTTCCCATTT TT 90 107 3 904091 2264 227 9 14355 1437 0 CTCTCTATTCTTCC GT 92 107 4 904123 2404 241 9 14495 1451 0 GGAGGACATTGAA CCT 62 107 5 904155 2503 251 8 14594 1460 9 GCCGCTGCCTGAC TGA 48 107 6 904187 2589 260 4 14680 1469 5 CAGTGTTCAAGCA GGG 83 107 7 904219 2717 273 2 14808 1482 3 ACTTACCGGGTAA GAG 49 107 8 904251 2798 281 3 14889 1490 4 CTGGGCGGCGACA A.G.A. 39 107 9

- 114 044295

904283 N/A N/A 458 473 GACCAAGCACAGC AAA 0 108 0 904315 N/A N/A 1342 1357 CACCATTCTGCAA C.G.C. 74 108 1 904347 N/A N/A 767 782 CAATCAGACTCAA GCC 19 108 2 904379 N/A N/A 2053 2068 CGTGACCACCTGT CTT 16 108 3 904411 N/A N/A 2721 2736 GAGCTGGTGCCTC GGA thirty 108 4 904443 N/A N/A 4081 4096 CCTCATTGCAAT CCT 96 108 5 904475 N/A N/A 4648 4663 GCTCTGCAAATCT CTC 15 108 6 904507 N/A N/A 5021 5036 CCGTGTCACCCTA AGG 54 108 7 904539 N/A N/A 5108 5123 CCCCCGCTGATTCC ACT 16 108 8 904571 N/A N/A 5235 5250 CTCAGGTGGAAAC ACC 34 108 9 904603 N/A N/A 5337 5352 GTCCAGTTAAGCT GGA 9 109 0 904635 N/A N/A 5461 5476 CCAGGTAGCCGTG TTA 74 109 1 904667 N/A N/A 5655 5670 ATGACTGAACTCA GCC 32 109 2 904699 N/A N/A 5757 5772 CCTCCAGTTTGCTG TT 48 109 3 904731 N/A N/A 5798 5813 AAACCTTGTCTCC GAC 66 109 4 904763 N/A N/A 5854 5869 TTTGTAAGTGCAA CCA 96 109 5

- 115 044295

904795 N/A N/A 5926 5941 AGACCTCCCTAAA CTC 8 109 6 904827 N/A N/A 5958 5973 CAAGGCTAAGTTC CGG 64 109 7 904859 N/A N/A 6106 6121 AAGACAGAACCC CAA 68 109 8 904891 N/A N/A 6198 6213 CAAAACTGCATTG CCC 50 109 9 904923 N/A N/A 6242 6257 ACCCACCCGCACC ASA 16 110 0 904955 N/A N/A 6321 6336 GAGATCCAACTCG GCG eleven 110 1 904987 N/A N/A 6371 6386 GCCCACAGGATCC TGA 0 110 2 905051 N/A N/A 6592 6607 AAACCCCTGAAAC TGC 65 110 3 905083 N/A N/A 6634 6649 TTCCTGGACAGGC AAT 31 110 4 905115 N/A N/A 6740 6755 CAGGTTTGGATGG AAG 74 110 5 905147 N/A N/A 6826 6841 GGAAATGAACGCA ATG 91 110 6 905179 N/A N/A 6986 7001 TGAGTGCTCTTCGG CTT 62 110 7 905211 N/A N/A 7116 7131 GTACACGGCTCTC CAC 7 110 8 905243 N/A N/A 7237 7252 CTTGGGCACTCTC A.G.A. 44 110 9 905275 N/A N/A 7291 7306 AAACTCCACAGCA TTG thirty 111 0 905307 N/A N/A 7467 7482 CGCCCAAAACCAT CAA 44 111 1

- 116 044295

905339 N/A N/A 7833 7848 ACACACAAGAGAC CTC 0 111 2 905371 N/A N/A 7918 7933 TTATGGAATTGCA GAT 93 111 3 905403 N/A N/A 7992 8007 TCAAGTCAGTACA GAG 92 111 4 905435 N/A N/A 8070 8085 CACCCACACATGT TTC 49 111 5 905467 N/A N/A 8160 8175 CAGAATTTCCACT A.T.T. 85 111 6 905499 N/A N/A 8309 8324 TTGGTTCAAAAGC A.G.C. 92 111 7 905531 N/A N/A 8378 8393 TTGGGTCAAACAC TTT 69 111 8 905563 N/A N/A 8448 8463 CATGAAGTGAGCC TTC 56 111 9 905595 N/A N/A 8568 8583 GCCAGATTGTTGAA GTC 34 112 0 905627 N/A N/A 8725 8740 GTCCTATTGTAAG A.A.C. 24 112 1 905659 N/A N/A 8822 8837 ACTCAGGTGACTA CAT 71 112 2 905691 N/A N/A 8882 8897 GAGTCATTAGTGC TAT 92 112 3 905723 N/A N/A 8951 8966 CAGCCATTGCATATA A.G.A. 46 112 4

- 117 044295

Table 17

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, S.E. Q ID: SEQ ID: 2, SEQ ID: 2, Subsequence % depressed nya S.E. Q starts 1, starts stop ID th site one hundred th site - NO And- website sai T 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 84 13 903420 18 33 511 526 ATACCGAGGAATT C.G.A. 5 112 5 903452 74 89 567 582 CCACCCCAGTTA TGC 70 112 6 903484 212 227 4505 4520 AAAAGTGCACTCA TSS 65 112 7 903516 295 310 4770 4785 GAGGATCCCAGT ATS 60 112 8 903644 623 638 12714 1272 9 CTTCTTATGTTATC ST 90 112 9 903676 663 678 12754 1276 9 TTTGTGGACCTTCT GA 76 FROM 0 903708 735 750 12826 1284 1 CATGCCGACGAGG GTC 25 FROM 1 903740 805 820 12896 1291 1 CTGTGATTCCCAA STS 66 FROM 2 903772 843 858 12934 1294 9 GTAGTCCATGGTA CTG 15 FROM 3 903804 897 912 12988 1300 3 AAGGCTTTTGATG ACC 64 from 4 903836 1002 101 7 13093 1310 8 GATGTCCTTCCA ATG 29 FROM 5 903868 1054 106 9 13145 1316 0 CTGAGGCATGCGG TAS 78 FROM 6 903900 1116 FROM 1 13207 1322 2 AASSSTTSSSASS TGT 48 FROM 7

- 118 044295

903932 1206 122 1 13297 1331 2 GTAGACTACATCC A.G.C. 63 113 8 903964 1339 135 4 13430 1344 5 GGTCCGCCTGCAG AAT 70 113 9 903996 1706 172 1 13797 1381 2 GGGTCAAAAGCGA TGG 94 114 0 904028 1792 180 7 13883 1389 8 AGCTATGGAAATG CCA 62 114 1 904060 1888 190 3 13979 1399 4 TCTCCAGTTCCCAT TT 73 114 2 904092 2270 228 5 14361 1437 6 AGCCTCCTCTCTAT TC 49 114 3 904124 2405 242 0 14496 1451 1 CGGAGGACATTGA ACC 89 114 4 904156 2504 251 9 14595 1461 0 AGCCGCTGCCTGA CTG 54 114 5 904188 2590 260 5 14681 1469 6 TCAGTGTTCAAGC AGG 92 114 6 904220 2718 273 3 14809 1482 4 TACTTACCGGGTA A.G.A. 47 114 7 904252 2799 281 4 14890 1490 5 CCTGGGCGGCGAC AAG 53 114 8 904284 N/A N/A 459 474 TGACCAAGCACAG CAA 10 114 9 904316 N/A N/A 1343 1358 GCACCATTCTGCA A.C.G. 29 115 0 904348 N/A N/A 801 816 TCTATAGTTTAAG A.G.C. 6 115 1 904380 N/A N/A 2437 2452 TCCCGCCTCAGGG CTC 22 115 2 904412 N/A N/A 2788 2803 ACACCATCTCATG A.G.C. 59 115 3

- 119 044295

904444 N/A N/A 4200 4215 _{GTTTTTACAATAGT} GC 97 115 4 904476 N/A N/A 4667 4682 GCTTGCTTGAGCA GCC 16 115 5 904508 N/A N/A 5022 5037 GCCGTGTCACCCCT AAG 65 115 6 904540 N/A N/A 5109 5124 CCCCGCTGATTC CAC 43 115 7 904572 N/A N/A 5236 5251 CCTCAGGTGGAAA CAC 0 115 8 904604 N/A N/A 5338 5353 GGTCCAGTTAAGC TGG 12 115 9 904636 N/A N/A 5462 5477 GCCAGGTAGCCGT GTT 61 116 0 904668 N/A N/A 5656 5671 GATGACTGAACTC A.G.C. 63 116 1 904700 N/A N/A 5760 5775 CCTCCTCCAGTTTG C.T. 50 116 2 904732 N/A N/A 5799 5814 TAAACCTTGTCTCC GA 87 116 3 904764 N/A N/A 5855 5870 TTTTGTAAGTGCA ACC 94 116 4 904796 N/A N/A 5927 5942 GAGACCCTCCCTAA ACT 26 116 5 904828 N/A N/A 5959 5974 GCAAGGCTAAGTT CCG 97 116 6 904860 N/A N/A 6108 6123 CAAAGACAAGAAC CCC 68 116 7 904892 N/A N/A 6199 6214 ACAAAACTGCATT GCC 50 116 8 904924 N/A N/A 6254 6269 ACTAAACCCACA CCC 6 116 9

- 120 044295

904956 N/A N/A 6322 6337 TGAGATCCAACTC GGC 65 117 0 904988 N/A N/A 6372 6387 GGCCCACAGGATC CTG 0 117 1 905020 N/A N/A 6536 6551 CTTCTGTTAGATAC A.A. 93 117 2 905052 N/A N/A 6593 6608 TAACCCCCTGAAA CTG 61 117 3 905084 N/A N/A 6635 6650 ATTCCTGGACAGG CAA 62 117 4 905116 N/A N/A 6741 6756 CCAGGTTTGGATG GAA 73 117 5 905148 N/A N/A 6827 6842 GGGAAATGAACGC AAT 89 117 6 905180 N/A N/A 6987 7002 CTGAGTGCTCTCG GCT 77 117 7 905212 N/A N/A 7117 7132 GGTACACGCTCT CCA 29 117 8 905244 N/A N/A 7238 7253 TCTTGGGCACTCTC A.G. 80 117 9 905276 N/A N/A 7298 7313 ATGTCTCAAACTC CAC 90 118 0 905308 N/A N/A 7468 7483 CCGCCCAAAACCA TCA 58 118 1 905340 N/A N/A 7835 7850 GCACACACAAGAG ACC 13 118 2 905372 N/A N/A 7921 7936 GAATTATGGAATT G.C.A. 90 118 3 905404 N/A N/A 7994 8009 ACTCAAGTCAGTA CAG 87 118 4 905436 N/A N/A 8077 8092 GTAATCACACCCA CAC 50 118 5

- 121 044295

905468 N/A N/A 8162 8177 TTCAGAATTTCCA STA 92 118 6 905500 N/A N/A 8310 8325 ATTGGTTCAAAAG CAG 85 118 7 905532 N/A N/A 8379 8394 GTTGGGTCAAACA CTT 71 118 8 905564 N/A N/A 8449 8464 ACATGAAGTGAGC CTT 88 118 9 905596 N/A N/A 8620 8635 TTTGGCACCTTCAC C.T. 53 119 0 905628 N/A N/A 8738 8753 TTAGAGGGCTAGT GTC 82 119 1 905660 N/A N/A 8823 8838 AACTCAGGTGACT ASA 68 119 2 905692 N/A N/A 8883 8898 GGAGTCATTAGTG STA 82 119 3 905724 N/A N/A 8952 8967 ACAGCCATTGCAT AAG 50 119 4

Table 18

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site S.E. Q ID: 1, CTO IIsai T SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC A.T.T. 87 13

- 122 044295

903421 19 34 512 527 TATACCGAGGAAT TCG 23 119 5 903453 75 90 568 583 CCCACCCTCCAGTT ATG 45 119 6 903485 217 232 4510 4525 CAAGGAAAAGTGC ACT 33 119 7 903517 296 311 4771 4786 TGAGGATCTCCAG TAT 69 119 8 903613 527 542 12618 1263 3 TTCATGATCATTTG TC 88 119 9 903645 624 639 12715 1273 0 CCTTCTTATGTTAT CC 82 120 0 903677 664 679 12755 1277 0 CTTTGTGGACCTTC TG 74 120 1 903709 736 751 12827 1284 2 CCATGCGCGACGAG GGT 25 120 2 903741 806 821 12897 1291 2 GCTGTGATTCCCCA ACT 59 120 3 903773 844 859 12935 1295 0 CGTAGTCCATGGT ACT 25 120 4 903805 898 913 12989 1300 4 CAAGGCTTTTGAT GAC 88 120 5 903837 1003 101 8 13094 1310 9 GGATGTCCTTCCC AAT 46 120 6 903869 1079 109 4 13170 1318 5 GGCTCAGTGACCC GGG 17 120 7 903901 1119 FROM 4 13210 1322 5 ATTAACCCTCTCCA CC 27 120 8 903933 1207 122 2 13298 1331 3 GGTAGACTACATC CAG 59 120 9 903965 1340 135 5 13431 1344 6 TGGTCCGCCTGCA GAA 83 121 0

- 123 044295

904029 1793 180 8 13884 1389 9 CAGCTATGGAAAT GCC 86 121 1 904061 1890 190 5 13981 1399 6 ACCTCCAGTTCCCC AT 88 121 2 904093 2272 228 7 14363 1437 8 CAAGCCTCCTCTCT AT 81 121 3 904125 2407 242 2 14498 1451 3 TTCGGAGGACATT GAA 19 121 4 904157 2505 252 0 14596 1461 1 AAGCCGCTGCCTG ACT 48 121 5 904189 2591 260 6 14682 1469 7 TTCAGTGTTCAAG CAG 92 121 6 904253 2800 281 5 14891 1490 6 TCCTGGGCGGCGA CAA 92 121 7 904317 N/A N/A 1344 1359 GGCACCATTCTGC A.A.C. 28 121 8 904349 N/A N/A 807 822 CAACCCTCTATAG TTT 12 121 9 904381 N/A N/A 2448 2463 GGAGCCCTCCCTC CCG 0 122 0 904413 N/A N/A 2821 2836 TGTGTGATCCCCTA GG 22 122 1 904445 N/A N/A 4206 4221 GCCAGTGTTTTTAC A.A. 72 122 2 904477 N/A N/A 4691 4706 TGAGCCACCAGTG GAC 0 122 3 904541 N/A N/A 5110 5125 CCCCCCGCTGATTC C.A. 31 122 4 904573 N/A N/A 5238 5253 AGCCTCAGGTGGA A.A.C. 53 122 5 904605 N/A N/A 5339 5354 GGGTCCAGTTAAG CTG 14 122 6

- 124 044295

904669 N/A N/A 5658 5673 TAGATGACTGAAC TCA 79 122 7 904701 N/A N/A 5761 5776 GCCTCCTCCAGTTTT G.C. 34 122 8 904733 N/A N/A 5801 5816 GATAAACCTTGTC TCC 65 122 9 904765 N/A N/A 5856 5871 GTTTTGTAAGTGC A.A.C. 73 123 0 904797 N/A N/A 5928 5943 GGAGACCTCCCTA A.A.C. 33 123 1 904829 N/A N/A 5960 5975 GGCAAGGCTAAGT TCC 91 123 2 904861 N/A N/A 6111 6126 CAGCAAAGACAAG A.A.C. 53 123 3 904893 N/A N/A 6201 6216 GTACAAAACTGCA TTG 31 123 4 904925 N/A N/A 6255 6270 CACTAAACCCCAC ACC 26 123 5 904957 N/A N/A 6323 6338 GTGAGATCCAACT CGG 77 123 6 904989 N/A N/A 6374 6389 TGGGCCCACAGGA TCC 4 123 7 905021 N/A N/A 6537 6552 ACTTCTGTTAGATA C.A. 95 123 8 905053 N/A N/A 6594 6609 GTAACCCCCTGAA ACT 45 123 9 905085 N/A N/A 6638 6653 AACATTCCTGGAC AGG 31 124 0 905117 N/A N/A 6742 6757 CCCAGGTTTGGAT GGA 49 124 1 905149 N/A N/A 6828 6843 AGGGAAATGAACG CAA 86 124 2

- 125 044295

905181 N/A N/A 6988 7003 GCTGAGTGCTCTC GGC 57 124 3 905213 N/A N/A 7118 7133 GGGTACACGGCTC TCC 38 124 4 905245 N/A N/A 7239 7254 GTCTTGGGCACTCT C.A. 89 124 5 905277 N/A N/A 7300 7315 TAATGTCTCAAAC TCC 90 124 6 905309 N/A N/A 7469 7484 ACCGCCCAAAACC ATS 57 124 7 905341 N/A N/A 7836 7851 TGCACACAAAGA GAC 0 124 8 905373 N/A N/A 7922 7937 GGAATTATGGAAT TGC 98 124 9 905405 N/A N/A 7995 8010 AACTCAAGTCAGT ASA 81 125 0 905437 N/A N/A 8081 8096 CCCTGTAATCACA CCC 71 125 1 905501 N/A N/A 8311 8326 TATTGGTTCAAAA G.C.A. 87 125 2 905533 N/A N/A 8381 8396 CTGTTGGGTCAAA CAC 41 125 3 905565 N/A N/A 8450 8465 AACATGAAGTGAG CCT 88 125 4 905597 N/A N/A 8621 8636 TTTTGGCACCTTCA CC 76 125 5 905629 N/A N/A 8739 8754 ATTAGAGGGGCTAG TGT 73 125 6 905661 N/A N/A 8824 8839 AAACTCAGGTGAC TAC 75 125 7 905693 N/A N/A 8884 8899 TGGAGTCATTAGT GCT 91 125 8 905725 N/A N/A 8953 8968 AACAGCCATTGCA TAA 10 125 9

- 126 044295

Table 19

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

Connection number SEQ ID: 1, starting site S.E. Q ID: 1, one hundred IIsay t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 74 13 903426 24 39 517 532 CAAGATATACCGA GGA 0 126 0 903458 125 140 618 633 TTCCCCTGGCAGA GAC 3 126 1 903490 253 268 N/A N/A CCCTCGCTCCAGC TTS 61 126 2 903522 303 318 4778 4793 CTTACTTTGAGGA TST 68 126 3 903618 560 575 12651 1266 6 TACTGCTGGCCTTT AT 59 126 4 903650 629 644 12720 1273 5 CGGAGCCTTCTTA TGT thirty 126 5 903682 670 685 12761 1277 6 TGGTGCCTTTGTG GAC 0 126 6 903714 741 756 12832 1284 7 CAGACCCATGCCG A.C.G. 37 126 7

- 127 044295

903746 811 826 12902 1291 7 AAGCGGCTGTGAT TSS 60 126 8 903778 850 865 12941 1295 6 TCTTTCCGTAGTCC AT 14 126 9 903810 931 946 13022 1303 7 CACCCAAAAACTC CCT 59 127 0 903842 1008 102 3 13099 1311 4 GGCACGGATGTCC TTC 48 127 1 903874 1084 109 9 13175 1319 0 AGATTGGCTCAGT GAC 91 127 2 903906 1127 114 2 13218 1323 3 CTGGGTTCATTAA CCC 0 127 3 903938 1212 122 7 13303 1331 8 CACGAGTAGACT ASA 56 127 4 903970 1345 136 0 13436 1345 1 GTTCTTGGTCCGCC TG 62 127 5 904002 1741 175 6 13832 1384 7 ACCCTCTTATCCC CC 91 127 6 904034 1799 181 4 13890 1390 5 TGTGCTCAGCTAT GGA 84 127 7 904066 1926 194 1 14017 1403 2 TTAGTCTAAAAGTA A.A.C. 44 127 8 904098 2284 229 9 14375 1439 0 TGCTGGTTCCTTCA A.G. 76 127 9 904130 2413 242 8 14504 1451 9 TCATTCTTCGGAG GAC 73 128 0 904162 2511 252 6 14602 1461 7 ATCAGGAAGCCGC TGC 52 128 1 904194 2609 262 4 14700 1471 5 ATGGCCCACCACC TGC 0 128 2 904226 2736 275 1 14827 1484 2 GCTAATTTTCTGAC TG 96 128 3

- 128 044295

904258 2805 282 0 14896 1491 1 GTCAATCCTGGGC GGC 63 128 4 904322 N/A N/A 1374 1389 TCATGATTGCAAA GCT 20 128 5 904354 N/A N/A 837 852 AGCTTTGTGAACC CAT 10 128 6 904386 N/A N/A 2482 2497 GCCCAAGCCCAGT CCA 0 128 7 904418 N/A N/A 3410 3425 AGGGTATATGAAA GTT 77 128 8 904450 N/A N/A 4340 4355 AGCCAGTGTGTAT TGC 83 128 9 904482 N/A N/A 4733 4748 TTGCACCCTTGAG GAG 0 129 0 904514 N/A N/A 5058 5073 GCTAGGTGCCAGG GTA 78 129 1 904546 N/A N/A 5115 5130 CCCCCCCCCCCGC TGA 16 129 2 904578 N/A N/A 5303 5318 ACATTCCCACAGG GCC 0 129 3 904610 N/A N/A 5361 5376 GGATGTGGCAAAG GAC 54 129 4 904642 N/A N/A 5490 5505 GCCCTATTGTGTG G.C.A. 0 129 5 904674 N/A N/A 5682 5697 ATTTTTCTTTGACC GG 64 129 6 904706 N/A N/A 5766 5781 ACGAAGCCCTCCTC CAG 55 129 7 904738 N/A N/A 5807 5822 TCACCCGATAAAC CTT 82 129 8 904770 N/A N/A 5868 5883 CCCAAACAGGCAG TTT 57 129 9

- 129 044295

904802 N/A N/A 5933 5948 TATTCGGAGACCT CCC 5 130 0 904834 N/A N/A 5965 5980 ACCTGGGCAAGGC TAA 52 130 1 904866 N/A N/A 6138 6153 CTTACTCCACACCT T.A. 72 130 2 904898 N/A N/A 6206 6221 GTTTGGTACAAAA CTG 0 130 3 904930 N/A N/A 6261 6276 TTGTCTCACTAAA CCC 21 130 4 904962 N/A N/A 6330 6345 AAGACCAGTGAGA TCC 50 130 5 904994 N/A N/A 6402 6417 AACCACCTGTAGG GAC 69 130 6 905026 N/A N/A 6542 6557 TGGGTACTTCTGTT A.G. 62 130 7 905058 N/A N/A 6600 6615 ACAGCTGTAACCC CCT 13 130 8 905090 N/A N/A 6680 6695 TGGTGGATATAAAA A.G.C. 39 130 9 905122 N/A N/A 6794 6809 AGCGATTTGTCTTG TTT 72 131 0 905154 N/A N/A 6879 6894 TGCCGTGGCAACT CTG 6 131 1 905186 N/A N/A 7037 7052 GTTTTTCCTCAGTC CC 69 131 2 905218 N/A N/A 7159 7174 GGCACCTCCATGT TGC 0 131 3 905250 N/A N/A 7244 7259 TGCTGGTCTTGGG CAC 17 131 4 905282 N/A N/A 7339 7354 CCTTATAGCTTACC TG 64 131 5

- 130 044295

905314 N/A N/A 7475 7490 AGAGTCACCCGCCC AAA 58 131 6 905346 N/A N/A 7843 7858 CTTGCCGTGCACA CAC 10 131 7 905378 N/A N/A 7939 7954 TGGTTTGCAGGGA TCT 56 131 8 905410 N/A N/A 8001 8016 ACAAAGAACTCAA GTC 55 131 9 905442 N/A N/A 8088 8103 GACTGCTCCCTGT AAT 0 132 0 905474 N/A N/A 8175 8190 ATGTGTTTAGGCA TTC 81 132 1 905506 N/A N/A 8327 8342 CATTGGGTTATGA AAT 48 132 2 905538 N/A N/A 8386 8401 CATGCCTTGTTGGG TCA 46 132 3 905570 N/A N/A 8460 8475 GCTCAGCACCAAC ATG 0 132 4 905602 N/A N/A 8631 8646 ACTCCAACCCTTTT GG 10 132 5 905634 N/A N/A 8744 8759 ATTCTATTAGAGG GCT 85 132 6 905666 N/A N/A 8831 8846 AAGCTTTAAAACTC AGG 62 132 7 905698 N/A N/A 8893 8908 CTTGTTTTATGGAG TC 97 132 8 905730 N/A N/A 8960 8975 AGTGCATAACAGC CAT 9 132 9

- 131 044295

Table 20

Suppression of APOL1 mRNA by cEt gapmers. 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site SE Q ID: 1, one hundred psy t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 74 13 903427 25 40 518 533 CCAAGATATACCG AGG 12 133 0 903459 129 144 622 637 AATCTTCCCCTGG CAG 13 133 1 903491 254 269 N/A N/A ACCCTCGCTCCAG STT 50 133 2 903523 306 321 4781 4796 GGGCTTACTTTGA GGA 0 133 3 903619 561 576 12652 1266 7 GTACTGCTGGCCT TTA 47 133 4 903651 630 645 12721 1273 6 ACCGAGCCTTCTT ATG 34 133 5 903683 671 686 12762 1277 7 GTGGTGCCTTTGT GGA 0 133 6 903715 742 757 12833 1284 8 CCAGACCCATGCC GAC 49 133 7 903747 812 827 12903 1291 8 AAAGCGGCTGTGA TTS 29 133 8 903779 851 866 12942 1295 7 TTCTTTTCCGTAGTC SA 38 133 9 903811 932 947 13023 1303 8 TSASSSAAAAAST SSS 72 134 0

- 132 044295

903843 1010 102 5 13101 1311 6 AGGGCACGGATGT CCT 3 134 1 903875 1085 110 0 13176 1319 1 GAGATTGGCTCAG TGA 69 134 2 903907 1128 114 3 13219 1323 4 GCTGGGTTCATTA ACC 6 134 3 903939 1230 124 5 13321 1333 6 TAAGTGCTTTTGAT TCG 89 134 4 903971 1346 136 1 13437 1345 2 AGTTCTTGGGTCCG CCT 52 134 5 904003 1742 175 7 13833 1384 8 CACCCTCTTTATCC CC 85 134 6 904035 1800 181 5 13891 1390 6 CTGTGCTCAGCTA TGG 73 134 7 904067 1928 194 3 14019 1403 4 CTTTAGTCTAAAAG TAA 16 134 8 904099 2334 234 9 14425 1444 0 ACTCTTGGGCTTTC TC 91 134 9 904131 2414 242 9 14505 1452 0 TTCATTCTTCGGA GGA 63 135 0 904163 2512 252 7 14603 1461 8 CATCAGGAAGCCG CTG 23 135 1 904195 2612 262 7 14703 1471 8 GCCATGGCCCACC ACC 0 135 2 904227 2744 275 9 14835 1485 0 GCTTTCATGCTAA TTT 40 135 3 904259 2806 282 1 14897 1491 2 GGTCAATCCTGGG CGG 58 135 4 904323 N/A N/A 1375 1390 CTCATGATTGCAA A.G.C. 69 135 5 904355 N/A N/A 869 884 CTCAGCAGTCAAA ACC 24 135 6

- 133 044295

904387 N/A N/A 2515 2530 GTTCCTAGAAGAA GCC 25 135 7 904419 N/A N/A 3411 3426 GAGGGTATATGAA AGT 59 135 8 904451 N/A N/A 4351 4366 TAGCTGGTGATAG CCA 27 135 9 904483 N/A N/A 4735 4750 TGTTGCACCCCTTG AGG 23 136 0 904515 N/A N/A 5064 5079 TCATTTGCTAGGT GCC 84 136 1 904547 N/A N/A 5172 5187 GGTCAACCTCTC TCC 3 136 2 904579 N/A N/A 5304 5319 TACATTCCCACAG GGC 23 136 3 904611 N/A N/A 5379 5394 CGCCAGGTCACAC A.G.A. 69 136 4 904643 N/A N/A 5491 5506 GGGCCCTATTGTGT GGC 0 136 5 904675 N/A N/A 5683 5698 GATTTTTTCTTTGAC C.G. 95 136 6 904707 N/A N/A 5767 5782 CACGAAGCCTCCT CCA 38 136 7 904739 N/A N/A 5808 5823 TTCACCCGATAAA CCT 69 136 8 904771 N/A N/A 5869 5884 ACCCAAACAGGCA GTT 2 136 9 904803 N/A N/A 5934 5949 GTATTCGGAGACC TCC 25 137 0 904835 N/A N/A 5966 5981 AACCTGGGCAAGG STA 21 137 1 904867 N/A N/A 6140 6155 TGCTTACTCCACA CCT 65 137 2

- 134 044295

904899 N/A N/A 6210 6225 CCATGTTTGGTAC AAA 61 137 3 904931 N/A N/A 6262 6277 CTTGTCTCACTAA ACC thirty 137 4 904963 N/A N/A 6331 6346 TAAGACCAGTGAG ATS 41 137 5 904995 N/A N/A 6403 6418 AAACCACCTGTAG GGA 42 137 6 905027 N/A N/A 6543 6558 ATGGGTACTTCTG TTA 79 137 7 905059 N/A N/A 6604 6619 TAGAACAGCTGTA ACC 48 137 8 905091 N/A N/A 6682 6697 GCTGGTGGATATA AAA 0 137 9 905123 N/A N/A 6795 6810 GAGCGATTGTCTT GTT 89 138 0 905155 N/A N/A 6880 6895 TTGCCGTGGCAAC TCT 0 138 1 905187 N/A N/A 7038 7053 AGTTTTTCCTCAGT CC 56 138 2 905219 N/A N/A 7160 7175 AGGCACCTCCATG TTG eleven 138 3 905251 N/A N/A 7256 7271 GGAGATTCCTCCT GCT 0 138 4 905283 N/A N/A 7340 7355 CCCTTATAGCTTA CCT 64 138 5 905315 N/A N/A 7476 7491 GAGAGTCACCGCC CAA 65 138 6 905347 N/A N/A 7844 7859 TCTTGCCGTGCAC ASA 26 138 7 905379 N/A N/A 7940 7955 GTGGTTTGCAGGG ATS 82 138 8

- 135 044295

905411 N/A N/A 8006 8021 GGTCTACAAAAGAA CTC 42 138 9 905443 N/A N/A 8089 8104 GGACTGCTCCCTG TAA 17 139 0 905475 N/A N/A 8176 8191 GATGTGTTTAGGC A.T.T. 84 139 1 905507 N/A N/A 8329 8344 ATCATTGGGTTAT GAA 15 139 2 905539 N/A N/A 8387 8402 ACATGCCTTGTTGG GTC 48 139 3 905571 N/A N/A 8461 8476 AGCTCAGCACCAA CAT 22 139 4 905603 N/A N/A 8632 8647 GACTCCAACCCTT TTG 19 139 5 905635 N/A N/A 8745 8760 AATTCTATTAGAG GGC 80 139 6 905667 N/A N/A 8832 8847 GAAGCTTTAAACT CAG 83 139 7 905699 N/A N/A 8894 8909 ACTTGTTTTATGG AGT thirty 139 8 905731 N/A N/A 8961 8976 GAGTGCATAACAG CCA 9 139 9

- 136 044295

Table 21

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

Connection number SEQ ID: 1, starting site SE Q ID: 1, hundred and - SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed SE Q ID NO sai T 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 84 13 903436 41 56 534 549 ACAGGTCCTCCAG TSS 37 140 0 903468 154 169 2364 2379 TGTCGCCTGCAGGG SST 35 140 1 903500 263 278 12661 1267 6 TTTTGTTGCACCCT C.G. 84 140 2 903532 346 361 N/A N/A TGCTCTCTGGGTCC AT 8 140 3 903628 570 585 N/A N/A CCAGTTTCTGTACT G.C. 23 140 4 903660 642 657 12733 1274 8 ATCTGCAAGGGCA CGG 39 140 5 903692 680 695 12771 1278 6 TTGGCGATGGTGG TGC 0 140 6 903724 758 773 12849 1286 4 CCCTCTGTGAAGG GTG 0 140 7 903756 824 839 12915 1293 0 GTAATCCCGGTCA AAG 41 140 8 903788 862 877 12953 1296 8 GTGTCCACCACTTC TT 18 140 9 903820 968 983 13059 1307 4 GTATTGCCAGCTA AGG 94 141 0 903852 1032 104 7 13123 1313 8 AAGATTGGCTCTG GCT 74 141 1 903884 1097 111 2 13188 1320 3 CCGCTTTCAGCTG A.G.A. 39 141 2 903916 1158 117 3 13249 1326 4 GAGCTTGACTCCT CTG 5 141 3

- 137 044295

903948 1241 125 6 13332 1334 7 GCCCCCTCATGTA AGT eleven 141 4 903980 1382 139 7 13473 1348 8 ATATCTCTCCTGGT GG 69 141 5 904012 1755 177 0 13846 1386 1 ATAAAACTTTACCTC A.C. 62 141 6 904044 1842 185 7 13933 1394 8 CTTCTCCTTGCTGC A.C. 84 141 7 904076 1949 196 4 14040 1405 5 CACCCGGCCCCCC AAT 36 141 8 904108 2348 236 3 14439 1445 4 ATCCAACTGTTCTA A.C. 64 141 9 904140 2486 250 1 14577 1459 2 ATTGCCCCCAGG AGG 40 142 0 904172 2527 254 2 14618 1463 3 CACCCCAATGACC ATS 63 142 1 904204 2679 269 4 14770 1478 5 TGGTTCTCACATAC TC 91 142 2 904236 2777 279 2 14868 1488 3 CTAGAGATCTGAG CTT 14 142 3 904268 2846 286 1 14937 1495 2 CAGCTTGATGAGT AGG 21 142 4 904300 N/A N/A 2354 2369 GGGCCTCCTCCTTG A.G. 2 142 5 904364 N/A N/A 1115 ISO AAGTTGGTGCTCA GAC 8 142 6 904396 N/A N/A 2572 2587 ACAGCGGGTCCTC CCT 60 142 7 904428 N/A N/A 3809 3824 TCGCATAAAACTT TGC 43 142 8 904460 N/A N/A 4464 4479 CAGAGGACGGGCA GCC 0 142 9

- 138 044295

904492 N/A N/A 4914 4929 AGTCCATCCGGGT TCT 27 143 0 904524 N/A N/A 5074 5089 CCCACTTGAGTCA TTT 67 143 1 904556 N/A N/A 5201 5216 AGAGCGGGAGGTG ASA 25 143 2 904588 N/A N/A 5314 5329 TCAGGCCCGATAC A.T.T. 0 143 3 904620 N/A N/A 5415 5430 ATTATTCTCATGGT A.C. 73 143 4 904652 N/A N/A 5500 5515 CCTTAGGGAGGCC STA 16 143 5 904684 N/A N/A 5702 5717 AAAATTCTATTGG GCC 0 143 6 904716 N/A N/A 5779 5794 TTTTCACCATAGCA C.G. 87 143 7 904748 N/A N/A 5828 5843 GTCCTTACTGCAGT TT 95 143 8 904780 N/A N/A 5891 5906 CAGGGATTTTCCA ASA 77 143 9 904812 N/A N/A 5943 5958 GTCTCACCTGTATT C.G. 34 144 0 904844 N/A N/A 6022 6037 TTGCACTAAAAGC TGA 62 144 1 904876 N/A N/A 6153 6168 CCAGAAATCCTTA TGC 35 144 2 904908 N/A N/A 6223 6238 GTTCCATGTATGCC C.A. 85 144 3 904940 N/A N/A 6280 6295 ACACTCAATCATA CCC 64 144 4 904972 N/A N/A 6341 6356 CCAATTCAGCTAA GAC 73 144 5

- 139 044295

905004 N/A N/A 6414 6429 AGGAGTTGCTGAA ACC 69 144 6 905036 N/A N/A 6553 6568 GTCATATCAGATG GGT 92 144 7 905068 N/A N/A 6616 6631 CTACGAGGCCTTT A.G.A. 23 144 8 905100 N/A N/A 6721 6736 CCTCTGGCACTAA ATS 40 144 9 905132 N/A N/A 6804 6819 TGGCTGGGCGAGC GAT 38 145 0 905164 N/A N/A 6889 6904 CTGACTTGGTTGCC GT 60 145 1 905196 N/A N/A 7080 7095 GGGCCTGTTATTA A.A.C. 0 145 2 905228 N/A N/A 7169 7184 TGATCCTTGAGGC ACC 28 145 3 905260 N/A N/A 7270 7285 AACTACCATGCAA AGG 38 145 4 905292 N/A N/A 7380 7395 ACTCCTTATGTTTT GA 94 145 5 905324 N/A N/A 7485 7500 CCAGACAGCGAGA GTC 78 145 6 905356 N/A N/A 7862 7877 GCATGATGTAAAA TTG 6 145 7 905388 N/A N/A 7975 7990 AGGATTACTCCTG AAG 0 145 8 905420 N/A N/A 8017 8032 AAATAATGGTAGG TCT 77 145 9 905452 N/A N/A 8120 8135 GGTATATTCCCTGA CCA 25 146 0 905484 N/A N/A 8185 8200 TGGAATCCAGATG TGT 65 146 1

- 140 044295

905516 N/A N/A 8340 8355 AATATCAACACAT CAT 82 146 2 905548 N/A N/A 8409 8424 CCAGTGATCACTT CCA 78 146 3 905580 N/A N/A 8517 8532 AACATTGAAACAC CAG 94 146 4 905612 N/A N/A 8665 8680 AGCTTCCATAAGC CAG 12 146 5 905644 N/A N/A 8756 8771 GGTAGGGCTCTAA TTC 60 146 6 905676 N/A N/A 8867 8882 TAGAGGGAATTGT GTG 61 146 7 905708 N/A N/A 8907 8922 GCTGTGATTGTGGG ACT 89 146 8 905740 N/A N/A 8971 8986 GAAAGTGTGGGAG TGC 8 146 9

Table 22

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site S.E. Q ID: 1, CTO IIsai T SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC A.T.T. 82 13 903437 42 57 535 550 GACAGGTCCTCA GTC 14 147 0

- 141 044295

903469 155 170 2365 2380 ATGTCGCTGCAGG GCC 18 147 1 903533 349 364 N/A N/A TACTGCTCTCTGG GTC 33 147 2 903629 571 586 12662 1267 7 ACCAGTTTCTGTA CTG 4 147 3 903661 643 658 12734 1274 9 CATCTGCAAGGGC A.C.G. 43 147 4 903693 681 696 12772 1278 7 ATTGGCGATGGTG GTG 27 147 5 903725 759 774 12850 1286 5 TCCCTCTGTGAAG GGT 0 147 6 903757 827 842 12918 1293 3 CTGGTAATCCCGG TCA 63 147 7 903789 863 878 12954 1296 9 TGTGTCCACCACTT C.T. 39 147 8 903821 969 984 13060 1307 5 AGTATTGCCAGCT AAG 98 147 9 903853 1033 104 8 13124 1313 9 GAAGATTGGCTCT GGC 91 148 0 903885 1098 111 3 13189 1320 4 ACCGCTTTCAGCT GAG 10 148 1 903917 1159 117 4 13250 1326 5 TGAGCTTGACTCC TCT 6 148 2 903949 1242 125 7 13333 1334 8 TGCCCCCTCATGT AAG 46 148 3 903981 1384 139 9 13475 1349 0 GCATATCTCTCCTG GT 81 148 4 904013 1764 177 9 13855 1387 0 CTCAGTTCCATAA ACT 87 148 5 904045 1844 185 9 13935 1395 0 GCCTTCTCCTTGCT G.C. 57 148 6

- 142 044295

904077 1950 196 5 14041 1405 6 ACCACCGGCCCCC CAA 49 148 7 904109 2349 236 4 14440 1445 5 TATCCAACTGTTCT A.A. 68 148 8 904141 2487 250 2 14578 1459 3 GATATGCCCCCAG GAG 84 148 9 904173 2528 254 3 14619 1463 4 CCACCCAATGAC CAT 67 149 0 904205 2680 269 5 14771 1478 6 TTGGTTCTCACATA C.T. 84 149 1 904237 2778 279 3 14869 1488 4 TCTAGAGATCTGA GCT 20 149 2 904269 2847 286 2 14938 1495 3 CCAGCTTGATGAG TAG thirty 149 3 904365 N/A N/A 1116 1131 CAAGTTGGTGCTC A.G.A. 0 149 4 904397 N/A N/A 2583 2598 TCAACTAGGATAC A.G.C. 82 149 5 904429 N/A N/A 3817 3832 ATCCTTCTTCGCAT A.A. 80 149 6 904461 N/A N/A 4467 4482 AATCAGAGGACGG G.C.A. 5 149 7 904493 N/A N/A 4916 4931 CTAGTCCATCCGG GTT 49 149 8 904525 N/A N/A 5075 5090 CCCCACTTGAGTC A.T.T. 57 149 9 904557 N/A N/A 5202 5217 CAGAGCGGGAGGT GAC 24 150 0 904589 N/A N/A 5315 5330 ATCAGGCCCGATA CAT 0 150 1 904621 N/A N/A 5436 5451 CTCAAGACAACAT GGG 43 150 2

- 143 044295

904653 N/A N/A 5501 5516 CCCTTAGGGAGGC CCT 13 150 3 904685 N/A N/A 5721 5736 CTTACTCAATTAA CTC 77 150 4 904717 N/A N/A 5782 5797 ACTTTTTCACCATA G.C. 94 150 5 904749 N/A N/A 5829 5844 TGTCCTTTACTGCA GTT 82 150 6 904781 N/A N/A 5892 5907 CCAGGGATTTTCC A.A.C. 69 150 7 904813 N/A N/A 5944 5959 GGTCTCACCTGTA TTC 32 150 8 904845 N/A N/A 6023 6038 TTTGCACTAAAAG CTG 67 150 9 904877 N/A N/A 6154 6169 CCCAGAAATCCTT ATG 37 151 0 904909 N/A N/A 6224 6239 CGTTTCCATGTATG CCC 93 151 1 904941 N/A N/A 6281 6296 CACACTCAATCAT ACC 22 151 2 904973 N/A N/A 6343 6358 GGCCAATTCAGCT AAG 7 151 3 905069 N/A N/A 6617 6632 CCTACGAGGCCTT TAG 59 151 4 905101 N/A N/A 6722 6737 ACCTCTGGCACTA AAT 59 151 5 905133 N/A N/A 6805 6820 TTGGCTGGGCGAG C.G.A. 61 151 6 905165 N/A N/A 6890 6905 GCTGACTTGGTTG CCG 10 151 7 905197 N/A N/A 7081 7096 TGGGCCTGTTATT AAA 14 151 8

- 144 044295

905229 N/A N/A 7170 7185 CTGATCCTTGAGG CAC 72 151 9 905261 N/A N/A 7271 7286 CAACTACCATGCA AAG 53 152 0 905293 N/A N/A 7381 7396 AACTCCTTATGTTTT TG 89 152 1 905325 N/A N/A 7486 7501 TCCAGACAGCGAG AGT 83 152 2 905357 N/A N/A 7863 7878 GGCATGATGTAAA A.T.T. 33 152 3 905389 N/A N/A 7977 7992 GCAGGATTACTCC TGA 10 152 4 905421 N/A N/A 8053 8068 ACAGTGAAACAAG CAA 93 152 5 905453 N/A N/A 8121 8136 TGGTATATTCCTG ACC 35 152 6 905485 N/A N/A 8201 8216 CCTTAATGTAAAAT TCC 90 152 7 905517 N/A N/A 8345 8360 ATGTGAATATCAA CAC 74 152 8 905549 N/A N/A 8410 8425 CCCAGTGATCACT TCC 78 152 9 905581 N/A N/A 8518 8533 GAACATTGAAACA CCA 93 153 0 905613 N/A N/A 8666 8681 CAGCTTCCATAAG CCA thirty 153 1 905645 N/A N/A 8767 8782 GAGATCACAAGGG TAG 98 153 2 905677 N/A N/A 8868 8883 ATAGAGGGAATTG TGT 45 153 3 905709 N/A N/A 8908 8923 AGCTGTGATTGTGG GAC 63 153 4 905741 N/A N/A 8978 8993 GTTGGAGGAAAGT GTG 19 153 5 905773 N/A N/A 9795 9810 TCTGACATAAGCC CAG 0 153 6 905805 N/A N/A 10425 1044 0 AGAACCACCTATA TAA 60 153 7

- 145 044295

Table 23

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site S.E. Q ID: 1, one hundred IIsay t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 88 13 903422 20 35 513 528 ATATACCGAGGAA TTS 7 153 8 903454 77 92 570 585 ATCCCACCTCCAG TTA 49 153 9 903486 218 233 4511 4526 CCAAGGAAAAGTG CAC 47 154 0 903518 297 312 4772 4787 TTGAGGATCTCCA GTA 55 154 1 903614 543 558 12634 1264 9 GTGCCAGTTTTTGT ST 0 154 2 903646 625 640 12716 1273 1 GCCTTCTTATGTTA TS thirty 154 3

- 146 044295

903678 665 680 12756 1277 1 CCTTTGTGGACCTT ST 71 154 4 903710 737 752 12828 1284 3 CCCATGCCGACGA GGG eleven 154 5 903742 807 822 12898 1291 3 GGCTGTGATTCCC A.A.C. 28 154 6 903774 845 860 12936 1295 1 CCGTAGTCCATGG TAC eleven 154 7 903806 902 917 12993 1300 8 TTGTCAAGGCTTT GA 69 154 8 903838 1004 101 9 13095 1311 0 CGGATGTCCTTCCC A.A. 23 154 9 903870 1080 109 5 13171 1318 6 TGGCTCAGTGACC CGG 31 155 0 903902 1122 FROM 7 13213 1322 8 TTCATTAACCCCTCT CC 74 155 1 903934 1208 122 3 13299 1331 4 AGGTAGACTACAT CCA 40 155 2 903966 1341 135 6 13432 1344 7 TTGGTCGGCCTGC A.G.A. 64 155 3 903998 1708 172 3 13799 1381 4 TTGGGTCAAAAGC GAT 92 155 4 904030 1794 180 9 13885 1390 0 TCAGCTATGGAAA TGC 93 155 5 904062 1921 193 6 14012 1402 7 CTAAAGTAAACTG CTT 63 155 6 904094 2279 229 4 14370 1438 5 GTTCCTTCAAGCCT CC 92 155 7 904126 2408 242 3 14499 1451 4 CTTCGGAGGACAT TGA 70 155 8 904158 2506 252 1 14597 1461 2 GAAGCCGCTGCCT GAC 78 155 9

- 147 044295

904190 2594 260 9 14685 1470 0 CCCTTCAGTGTTCA A.G. 89 156 0 904222 2720 273 5 14811 1482 6 TTTACTTACCGGGT A.A. 22 156 1 904254 2801 281 6 14892 1490 7 ATCCTGGGCGGCG ASA 84 156 2 904318 N/A N/A 1345 1360 AGGCACCATTCTG CAA 29 156 3 904350 N/A N/A 820 835 TGAGCTGTTTCCC A.A. 39 156 4 904382 N/A N/A 2474 2489 CCAGTCCAATTGT G.C.A. 43 156 5 904414 N/A N/A 2828 2843 TGTTCACTGTGTGA TC 74 156 6 904446 N/A N/A 4306 4321 GCCCTCTTACATGTG TC 52 156 7 904478 N/A N/A 4693 4708 TGTGAGCCACCAG TGG 0 156 8 904510 N/A N/A 5024 5039 GGGCCGTGTCACC STA 8 156 9 904542 N/A N/A 5111 5126 CCCCCCCGCTGATT CC 19 157 0 904574 N/A N/A 5241 5256 ACCAGCCTCAGGT GGA 12 157 1 904606 N/A N/A 5353 5368 CAAAGGACAGACC GGG 64 157 2 904638 N/A N/A 5464 5479 AGGCCAGGTAGCC GTG 9 157 3 904670 N/A N/A 5659 5674 TTAGATGACTGAA CTC 75 157 4 904702 N/A N/A 5762 5777 AGCCTCCTCCAGTT TG 32 157 5

- 148 044295

904734 N/A N/A 5802 5817 CGATAAACCTTGT CTC 44 157 6 904766 N/A N/A 5858 5873 CAGTTTTTGTAAGT G.C.A. 97 157 7 904798 N/A N/A 5929 5944 CGGAGACCTCCCT AAA 12 157 8 904830 N/A N/A 5961 5976 GGGCAAGGCTAAG TTC 56 157 9 904862 N/A N/A 6112 6127 CCAGCAAAGACAA GAA 87 158 0 904894 N/A N/A 6202 6217 GGTACAAAACTGC A.T.T. 78 158 1 904926 N/A N/A 6256 6271 TCACTAAACCCCCA CAC 0 158 2 904958 N/A N/A 6325 6340 CAGTGAGATCCAA CTC 40 158 3 904990 N/A N/A 6375 6390 ATGGGCCCACAGG ATS 0 158 4 905022 N/A N/A 6538 6553 TACTTCTGTTAGAT A.C. 92 158 5 905054 N/A N/A 6595 6610 TGTAACCCCCTGA A.A.C. 17 158 6 905086 N/A N/A 6641 6656 TGAAACATTCCTG GAC 85 158 7 905118 N/A N/A 6743 6758 ACCCAGGTTTGGA TGG 33 158 8 905150 N/A N/A 6875 6890 GTGGCAACTCTGT AAG 10 158 9 905182 N/A N/A 6989 7004 GGCTGAGTGCTCT CGG 60 159 0 905214 N/A N/A 7119 7134 AGGGTACACGCT CTC 45 159 1

- 149 044295

905246 N/A N/A 7240 7255 GGTCTTGGGCACT CTC 79 159 2 905278 N/A N/A 7301 7316 ATAATGTCTCAAA CTC 77 159 3 905310 N/A N/A 7470 7485 CACCGCCCAAAAC CAT 25 159 4 905342 N/A N/A 7838 7853 CGTGCACACACAA GAG 0 159 5 905374 N/A N/A 7923 7938 GGGAATTATGGAA TTG 83 159 6 905406 N/A N/A 7996 8011 GAACTCAAGTCAG TAC 73 159 7 905438 N/A N/A 8083 8098 CTCCCTGTAATCAC A.C. 40 159 8 905470 N/A N/A 8168 8183 TAGGCATTCAGAA TTT 71 159 9 905502 N/A N/A 8313 8328 ATTATTGGTTCAA AAG 35 160 0 905534 N/A N/A 8382 8397 CCTGTTGGGTCAA ASA 45 160 1 905566 N/A N/A 8452 8467 CCAACATGAAGTG A.G.C. 79 160 2 905598 N/A N/A 8622 8637 CTTTTGGCACCTTC A.C. 83 160 3 905630 N/A N/A 8740 8755 TATTAGAGGGCTA GTG 55 160 4 905662 N/A N/A 8825 8840 TAAACTCAGGTGA STA 60 160 5 905694 N/A N/A 8885 8900 ATGGAGTCATTAG TGC 85 160 6 905726 N/A N/A 8954 8969 TAACAGCCATTGC ATA 6 160 7

- 150 044295

Table 24

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site SE Q ID: 1, one hundred psy t SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % depressed nya SE Q ID NO 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 87 13 903423 21 36 514 529 GATATACCGAGGA ATT 17 160 8 903455 78 93 571 586 GATCCCACCTCCA GTT 29 160 9 903487 220 235 4513 4528 CACCAAGGAAAAG TGC 3 161 0 903519 300 315 4775 4790 ACTTTGAGGATCT SSA 66 161 1 903615 544 559 12635 1265 0 CGTGCCAGTTTTTG TS 0 161 2 903647 626 641 12717 1273 2 AGCCTTCTTATGTT AT 44 161 3 903679 666 681 12757 1277 2 GCCTTTGTGGACCT TS 77 161 4 903711 738 753 12829 1284 4 ACCCATGCCGACG AGG 19 161 5 903743 808 823 12899 1291 4 CGGCTGTGATTTCC SAA 19 161 6 903775 846 861 12937 1295 2 TCCGTAGTCCATG GTA 5 161 7

- 151 044295

903807 907 922 12998 1301 3 TCAATTTTGTCAAG GCT 94 161 8 903839 1005 102 0 13096 1311 1 ACGGATGTCCTTC CCA 40 161 9 903871 1081 109 6 13172 1318 7 TTGGCTCAGTGAC CCG 44 162 0 903903 1124 FROM 9 13215 1323 0 GGTTCATTAACCCT C.T. 39 162 1 903935 1209 122 4 13300 1331 5 GAGGTAGACTACA TCC 29 162 2 903967 1342 135 7 13433 1344 8 CTTGGTCGGCCTGC A.G. 42 162 3 903999 1709 172 4 13800 1381 5 TTTGGGTCAAAAG C.G.A. 89 162 4 904031 1796 181 1 13887 1390 2 GCTCAGCTATGGA AAT 77 162 5 904063 1923 193 8 14014 1402 9 GTCTAAAGTAAAAC TGC 88 162 6 904095 2281 229 6 14372 1438 7 TGGTTCCTTCAAGC C.T. 35 162 7 904127 2409 242 4 14500 1451 5 TCTTCGGAGGACA TTG 64 162 8 904159 2507 252 2 14598 1461 3 GGAAGCCGCTGCC TGA 80 162 9 904191 2595 261 0 14686 1470 1 GCCCTTCAGTGTTC A.A. 47 163 0 904223 2721 273 6 14812 1482 7 GTTTACTTACCGG GTA 83 163 1 904255 2802 281 7 14893 1490 8 AATCCTGGGCGGC GAC 79 163 2 904319 N/A N/A 1347 1362 ACAGGCACCATTC TGC 38 163 3

- 152 044295

904351 N/A N/A 825 840 CCATCTGAGCTGTT TC thirty 163 4 904383 N/A N/A 2475 2490 CCCAGTCCAATTG TGC 34 163 5 904415 N/A N/A 2885 2900 TTGCTGTAAGGGA CAA 53 163 6 904447 N/A N/A 4310 4325 CAGAGCCTCTTAC ATG 47 163 7 904479 N/A N/A 4694 4709 ATGTGAGCCACCA GTG 46 163 8 904511 N/A N/A 5025 5040 TGGGCCGTGTCAC CCT 9 163 9 904543 N/A N/A 5112 5127 CCCCCCCGCTGA TTC 43 164 0 904575 N/A N/A 5243 5258 GGACCAGCCTCAG GTG 0 164 1 904607 N/A N/A 5354 5369 GCAAAGGACAGAC CGG 32 164 2 904639 N/A N/A 5465 5480 CAGGCCAGGTAGC CGT 22 164 3 904671 N/A N/A 5660 5675 TTTAGATGACTGA ACT 69 164 4 904703 N/A N/A 5763 5778 AAGCCTCCTCCAG TTT 23 164 5 904735 N/A N/A 5803 5818 CCGATAAACCTTG TCT 67 164 6 904767 N/A N/A 5859 5874 GCAGTTTTTGTAAG TGC 43 164 7 904799 N/A N/A 5930 5945 TCGGAGACCTCCC TAA 25 164 8 904831 N/A N/A 5962 5977 TGGGCAAGGCTAA GTT 49 164 9

- 153 044295

904863 N/A N/A 6135 6150 ACTCCACACCTTA A.T.T. 36 165 0 904895 N/A N/A 6203 6218 TGGTACAAAACTG CAT 66 165 1 904927 N/A N/A 6257 6272 CTCACTAAACCCC ASA 29 165 2 904959 N/A N/A 6326 6341 CCAGTGAGATCA ACT 70 165 3 904991 N/A N/A 6376 6391 GATGGGCCCACAG GAT 2 165 4 905023 N/A N/A 6539 6554 GTACTTCTGTTAGA T.A. 66 165 5 905055 N/A N/A 6597 6612 GCTGTAACCCCCCT GAA 85 165 6 905087 N/A N/A 6645 6660 GCCTGAAACATT CCT 20 165 7 905119 N/A N/A 6744 6759 AACCCAGGTTTGG ATG 40 165 8 905151 N/A N/A 6876 6891 CGTGGCAACTCTG TAA 41 165 9 905183 N/A N/A 6991 7006 TCGGCTGAGTGCT CTC 63 166 0 905215 N/A N/A 7120 7135 CAGGGTACACGGC TCT 40 166 1 905247 N/A N/A 7241 7256 TGGTCTTGGGCAC TCT 76 166 2 905279 N/A N/A 7335 7350 ATAGCTTACCTGT GGG 38 166 3 905311 N/A N/A 7471 7486 TCACCGCCCAAAA CCA 29 166 4 905343 N/A N/A 7839 7854 CCGTGCACACACA A.G.A. 0 166 5

- 154 044295

905375 N/A N/A 7928 7943 GATCTGGGAATTA TGG 62 166 6 905407 N/A N/A 7997 8012 AGAACTCAAGTCA GTA 92 166 7 905439 N/A N/A 8084 8099 GCTCCTGTAATC ASA 35 166 8 905471 N/A N/A 8172 8187 TGTTTAGGCATTCA GA 86 166 9 905503 N/A N/A 8317 8332 TGAAATTATTGGTT C.A. 6 167 0 905535 N/A N/A 8383 8398 GCCTGTTGGGTCA A.A.C. 60 167 1 905567 N/A N/A 8453 8468 ACCAACATGAAGT GAG 72 167 2 905599 N/A N/A 8623 8638 CCTTTTGGCACCTT C.A. 93 167 3 905631 N/A N/A 8741 8756 CTATTAGAGGGCT AGT 78 167 4 905663 N/A N/A 8827 8842 TTTAAACTCAGGT GAC 64 167 5 905695 N/A N/A 8886 8901 TATGGAGTCATTA GTG 81 167 6 905727 N/A N/A 8955 8970 ATAACAGCCATTG CAT 14 167 7

- 155 044295

Table 25

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected SEQ ID: 1, starting site S.E. Q ID: 1, one hundred SEQ ID: 2, starting site SEQ ID: 2, stop Subsequence % depressed nya S.E. QID NO II- website website 793406 N/A N/A 8306 8321 GTTCAAAAGCAGC ATT 95 13 903501 264 279 N/A N/A GTTTTGTTGCACCC TS 98 167 8 903543 402 417 9065 9080 ATTCTGTGTGCTC ACT 98 167 9 903545 405 420 9068 9083 CAGATTCTGTGTG STS 98 168 0 903556 419 434 9082 9097 GTCAGCAGGAGTA G.C.A. 65 168 1 903557 421 436 9084 9099 CAGTCAGCAGGAG TAG 84 168 2 903558 422 437 9085 9100 TCAGTCAGCAGGA GTA 92 168 3 903564 429 444 9092 9107 CTCATTATCAGTC A.G.C. 94 168 4 903567 434 449 9097 9112 CAGGCCTCATTAT CAG 40 168 5 903568 435 450 9098 9113 CCAGGCCTCATTA TCA 52 168 6 903569 436 451 9099 9114 TCCAGGCCTCATT ATS 69 168 7 903570 437 452 9100 9115 TTCCAGGCCTCAT TAT 55 168 8 903571 438 453 9101 9116 GTTCCAGGCCTCA TTA 74 168 9 903572 439 454 9102 9117 CGTTCCAGCCTC ATT 97 169 0 903573 440 455 9103 9118 CCGTTCCAGGCCT CAT 81 169 1

- 156 044295

903574 441 456 9104 9119 TCCGTTCCAGCC TCA 85 169 2 903575 443 458 9106 9121 AATCCGTTCCAGG CCT 52 169 3 903576 444 459 9107 9122 GAATCCGTTCCAG GCC 55 169 4 903577 445 460 9108 9123 CGAATCCGTTCCA GGC 45 169 5 903578 446 461 9109 9124 ACGAATCCGTTCC AGG 43 169 6 903579 447 462 9110 9125 CACGAATCCGTTC CAG 61 169 7 903581 449 464 9112 9127 GCCACGAATCCGT TCC 35 169 8 903582 450 465 9113 9128 AGCCACGAATCCG TTC 53 169 9 903583 451 466 9114 9129 CAGCCACGAATCC GTT 47 170 0 903584 452 467 9115 9130 GCAGCCACGAATC CGT 40 170 1 903585 453 468 9116 9131 AGCAGCCACGAAT CCG 82 170 2 903586 469 484 N/A N/A TCCTGGGCAGTTC A.G.C. 53 170 3 903587 471 486 N/A N/A ATTCCTGGGCAGT TCA 89 170 4 903589 473 488 N/A N/A TCATTCCTGGGGCA GTT 74 170 5 903592 501 516 12592 1260 7 GTCCAGAGCTTTA CGG 65 170 6 903595 504 519 12595 1261 0 GTTGTCCAGAGCT TTA 94 170 7

- 157 044295

903596 505 520 12596 1261 1 GGTTGTCCAGAGC TTT 98 170 8 903597 506 521 12597 1261 2 AGGTTGTCCAGAG CTT 83 170 9 903598 507 522 12598 1261 3 AAGGTTGTCCAGA GCT 80 171 0 903599 508 523 12599 1261 4 CAAGGTTGTCCAG A.G.C. 91 171 1 903600 509 524 12600 1261 5 GCAAGGTTGTCCA GAG 90 171 2 903606 515 530 12606 1262 1 TGTCTTGCAAGGT TGT 98 171 3 903607 516 531 12607 1262 2 TTGTCTTGCAAGG TTG 96 171 4 903639 616 631 12707 1272 2 TGTTATCTCAAG CTC 76 171 5 903959 1334 134 9 13425 1344 0 GCCTGCAGAATCT TAT 65 171 6 903991 1394 140 9 13485 1350 0 CCCCTGCCAGGCA TAT 71 171 7 903997 1707 172 2 13798 1381 3 TGGGTCAAAAGCG ATG 96 171 8 904055 1867 188 2 13958 1397 3 TTATTGCAGGCTC CAA 96 171 9 904221 2719 273 4 14810 1482 5 TTACTTACCGGGT AAG 57 172 0 904279 N/A N/A 449 464 CAGCAAACACGCT CCC 23 172 1 904509 N/A N/A 5023 5038 GGCCGTGTCACCC TAA 46 172 2 904637 N/A N/A 5463 5478 GGCCAGGTAGCCG TGT 46 172 3

- 158 044295

904951 N/A N/A 6306 6321 GCTGGGTCTGACC CAC 0 172 4 905005 N/A N/A 6415 6430 AAGGAGTTGCTGA A.A.C. 75 172 5 905015 N/A N/A 6438 6453 GCAGGTTCACATG ASA 88 172 6 905019 N/A N/A 6534 6549 TCTGTTAGATACA A.A.C. 92 172 7 905037 N/A N/A 6570 6585 TGGGAAACTCAAC TGG 77 172 8 905111 N/A N/A 6734 6749 TGGATGGAAGGAA CCT 73 172 9 905469 N/A N/A 8164 8179 CATTCAGAATTTC CAC 98 173 0 905837 N/A N/A 11345 1136 0 CCCACCATTGATG GGT thirty 173 1 905869 N/A N/A 12150 1216 5 TCACTATCGATCA AAT 53 173 2

Table 26

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

The number is connected by a foreigner SEQ ID: 1, starting site S.E. Q ID: 1, CTO IIsai T SEQ ID: 2, starting site SEQ ID: 2, stop website Subsequence % suppressed FL S.E. QID NO 905758 N/A N/A 9461 9476 CACTTTACATGCA C.G.A. 90 173 3

- 159 044295

905867 N/A N/A 12079 1209 4 TCATCATAGATAC TCC 87 173 4 972204 N/A N/A 9219 9234 GGAGGTGTGCCTG TCA 49 173 5 972206 N/A N/A 9311 9326 GCTACTCACTGCC A.G.C. 0 173 6 972208 N/A N/A 9356 9371 AGAAATGACCCTG TTC 31 173 7 972210 N/A N/A 9450 9465 CACGATCTCATTTT TC 79 173 8 972212 N/A N/A 9453 9468 ATGCACGATCTCA TTT 5 173 9 972214 N/A N/A 9455 9470 ACATGCACGATCT CAT 48 174 0 972216 N/A N/A 9458 9473 TTTACATGCACGA TCT 66 174 1 972218 N/A N/A 9460 9475 ACTTTACATGCAC GAT 89 174 2 972220 N/A N/A 9481 9496 GTGTCAGTCATTA TGC 79 174 3 972222 N/A N/A 9501 9516 GTTAACTGTGCAC STA 25 174 4 972224 N/A N/A 9519 9534 AGCTTGTAAGATG TTA 44 174 5 972226 N/A N/A 9551 9566 GAAGATCCTTAAC CCT 46 174 6 972228 N/A N/A 9622 9637 ACATTGGTTAGGT CAG 82 174 7 972230 N/A N/A 9624 9639 ACACATTGGTTAG GTC 55 174 8 972232 N/A N/A 9672 9687 GGAATTCCTCAGA TGA 15 174 9

- 160 044295

972234 N/A N/A 9678 9693 GTTTATGGAATTC CTC 95 175 0 972236 N/A N/A 9689 9704 GGTCCTGCCGTGT TTA 29 175 1 972238 N/A N/A 9846 9861 TCCTATCACATTG AGT 37 175 2 972240 N/A N/A 9869 9884 TGCCTCTAAGGCC TTC 10 175 3 972242 N/A N/A 9904 9919 ATCTTGGTGTTGG TTC 68 175 4 972244 N/A N/A 10059 1007 4 TTAAGTTTCAAGC CCT 77 175 5 972246 N/A N/A 10072 1008 7 GTTCATGACCTCC TTA 76 175 6 972248 N/A N/A 10083 1009 8 GTCCTCTGCAAGT TCA 65 175 7 972250 N/A N/A 10125 1014 0 GATCATCCAGCA GGG 27 175 8 972252 N/A N/A 10196 1021 1 GAACTTGCCAGTT CCA 32 175 9 972254 N/A N/A 10257 1027 2 TGCTTGTCAATGT CAG 72 176 0 972256 N/A N/A 10265 1028 0 AGACATACTGCTT GTC 0 176 1 972258 N/A N/A 10285 1030 0 TACTATGAAAATG GTC eleven 176 2 972260 N/A N/A 10297 1031 2 AGCAACTAATTCT ACT 47 176 3 972262 N/A N/A 10307 1032 2 ACAAATTGGCAGC A.A.C. 81 176 4 972264 N/A N/A 10309 1032 4 ACACAAATTGGCA G.C.A. 72 176 5

- 161 044295

972266 N/A N/A 10420 1043 5 CACCTATAAAAAT TGC 39 176 6 972268 N/A N/A 10464 1047 9 GCAATTTTATGGA ACC 94 176 7 972270 N/A N/A 10507 1052 2 CTTAGTAGTGACA GCT 40 176 8 972272 N/A N/A 10521 1053 6 AGCCTAACTGATG CCT 14 176 9 972274 N/A N/A 10543 1055 8 GGTCTCACTCGCA GGT 52 177 0 972276 N/A N/A 10623 1063 8 GGCTATTCATTCT GGC 0 177 1 972278 N/A N/A 10631 1064 6 GGAGATCTGGCTA TTC 71 177 2 972280 N/A N/A 10669 1068 4 GCTACTGGTTCTG GCC 0 177 3 972282 N/A N/A 10774 1078 9 GAGTACTTTGAAT TCA 0 177 4 972284 N/A N/A 10788 1080 3 GTCTGGCTATCTCT GA 49 177 5 972286 N/A N/A 10798 1081 3 AGACATTGCAGTC TGG 22 177 6 972288 N/A N/A 10835 1085 0 TAAATTTGCAGGT GGT 96 177 7 972290 N/A N/A 10837 1085 2 CTTAAATTTGCAG GTG 89 177 8 972292 N/A N/A 10852 1086 7 GGATTTAGAAATC CCC 7 177 9 972294 N/A N/A 10944 1095 9 TGTGTTCTTTCCGT GT 48 178 0 972296 N/A N/A 11017 1103 2 GACAATGAAGCTT CAC 60 178 1

- 162 044295

972298 N/A N/A 11097 1111 2 TTAACTGGGTGAG CTT 27 178 2 972300 N/A N/A 11122 1113 7 TAATGTGATTCAC AGG 98 178 3 972302 N/A N/A 11126 1114 1 GGTTTAATGTGAT TCA 90 178 4 972304 N/A N/A 11148 1116 3 CCTGAAAAAAGGC TTC 55 178 5 972306 N/A N/A 11160 1117 5 TGTAACAACAATC CTG 61 178 6 972308 N/A N/A 11196 1121 1 TTACTATATTTGG A.G.C. 33 178 7 972310 N/A N/A 11264 1127 9 TGTCTCCTATCAGT CC 36 178 8 972312 N/A N/A 11291 ISO 6 CAATTTAGCAGGA ACC 36 178 9 972314 N/A N/A 11361 1137 6 GATTATGCTCTTC ACC 59 179 0 972316 N/A N/A 11366 1138 1 TATTCTGATTATGCT C.T. 78 179 1 972318 N/A N/A 11380 1139 5 TGATTACGCTTTG STA 15 179 2 972320 N/A N/A 11382 1139 7 TTCTGATTACGCTTT G.C. 79 179 3 972322 N/A N/A 11582 1159 7 AGATACTCTGGAC ACT 50 179 4 972324 N/A N/A 11606 1162 1 GGCAGCTTGTGAT CCA 0 179 5 972326 N/A N/A 11731 1174 6 CCGTATAGGAATC TGA 37 179 6 972328 N/A N/A 11749 1176 4 GGTGATTTGGGCCA CGG 56 179 7

- 163 044295

972330 N/A N/A 11804 1181 9 AGTGATTCTCCAGG CCC 25 179 8 972332 N/A N/A 11956 1197 1 GTGACTGCCAAAG TGT 22 179 9 972334 N/A N/A 11996 1201 1 TTGATAAAGATGC CTC 76 180 0 972336 N/A N/A 12011 1202 6 TTTCATGGTAGGT GTT 76 180 1 972338 N/A N/A 12070 1208 5 ATACTCCCTCAATA TTT 41 180 2 972340 N/A N/A 12073 1208 8 TAGATACTCCCTCA ATA 56 180 3 972342 N/A N/A 12078 1209 3 CATCATAGATACT CCT 88 180 4 972344 N/A N/A 12081 1209 6 GTTCATCATAGAT ACT 26 180 5 972346 N/A N/A 12180 1219 5 GATCTCTATCCTGT GT 36 180 6 972348 N/A N/A 14951 1496 6 GACTCGAACAAGT CCA 1 180 7 972350 N/A N/A 15111 1512 6 CTTCATCGGTCCA TCG thirty 180 8 972352 N/A N/A 15298 1531 3 TCCAGGTACCCTT STA 2 180 9 972354 N/A N/A 15311 1532 6 AGACATCACCTTG TCC 1 181 0

- 164 044295

Table 27

Suppression of APOL1 mRNA by cEt gapmers 3-10-3 targeting SEQ ID NO: 1 and 2

Connection number SEQ ID: 1, S.E. Q ID: SEQ ID: 2, SEQ ID: 2, Subsequence % suppression S.E. Q start site 1, one hundred IIsay t start site stop website ID NO 905758 N/A N/A 9461 9476 CACTTTACATGCA C.G.A. 88 173 3 905867 N/A N/A 12079 1209 4 TCATCATAGATAC TSS 85 173 4 972205 N/A N/A 9277 9292 ATTCTTCCTGGAG TGC 50 181 1 972207 N/A N/A 9315 9330 TGAGGCTACTCAC TGC 0 181 2 972209 N/A N/A 9390 9405 GTAACTGGCAAAG TTS 3 181 3 972211 N/A N/A 9452 9467 TGCACGATCTCAT TTT 29 181 4 972213 N/A N/A 9454 9469 CATGCACGATCTC ATT 23 181 5 972215 N/A N/A 9456 9471 TACATGCACGATC TCA 83 181 6 972217 N/A N/A 9459 9474 CTTTACATGCACG ATS 55 181 7 972219 N/A N/A 9462 9477 GCACTTTACATGC A.C.G. 63 181 8 972221 N/A N/A 9483 9498 GTGTGTCAGTCAT TAT 94 181 9 972223 N/A N/A 9502 9517 CGTTAACTGTGCA SST 50 182 0 972225 N/A N/A 9546 9561 TCCTTAACCTGG TTS 21 182 1

- 165 044295

972227 N/A N/A 9558 9573 TCAAGAAGAAGAT CCT 48 182 2 972229 N/A N/A 9623 9638 CACATTGGTTAGG TCA 82 182 3 972231 N/A N/A 9626 9641 ACACACATTGGTT AGG 75 182 4 972233 N/A N/A 9675 9690 TATGGAATTCCTC A.G.A. 40 182 5 972235 N/A N/A 9681 9696 CGTGTTTATGGAA TTC 71 182 6 972237 N/A N/A 9841 9856 TCACATTGAGTTG STA 85 182 7 972239 N/A N/A 9868 9883 GCCTCTAAGGCCT TCA 7 182 8 972241 N/A N/A 9899 9914 GGTGTTGGTTCCC CAC 31 182 9 972243 N/A N/A 9937 9952 GCTGATCCCGGTC TCT 42 183 0 972245 N/A N/A 10062 1007 7 TCCTTAAGTTTCA A.G.C. 31 183 1 972247 N/A N/A 10077 1009 2 TGCAAGTTCATGA CCT 41 183 2 972249 N/A N/A 10107 1012 2 GAAATATCCCCTCT CCC 23 183 3 972251 N/A N/A 10148 1016 3 CCCTATATGCCCA TGA 75 183 4 972253 N/A N/A 10197 1021 2 AGAACTTGCCAGT TCC 0 183 5 972255 N/A N/A 10264 1027 9 GACATACTGCTTG TCA 0 183 6 972257 N/A N/A 10272 1028 7 GTCACTAAGACAT ACT 8 183 7

- 166044295

972259 N/A N/A 10296 1031 1 GCAACTAATTCTA STA 80 183 8 972261 N/A N/A 10306 1032 1 CAAATTGGCAGCA ACT 61 183 9 972263 N/A N/A 10308 1032 3 CACAAATTGGCAG CAA 91 184 0 972265 N/A N/A 10419 1043 4 ACCTATATAAAATT GCT 22 184 1 972267 N/A N/A 10461 1047 6 ATTTTATGGAACC TCT 72 184 2 972269 N/A N/A 10495 1051 0 AGCTTCACCTGTG TGC 10 184 3 972271 N/A N/A 10510 1052 5 TGCCTTAGTAGTG ASA 34 184 4 972273 N/A N/A 10539 1055 4 TCACTCGCAGGTG TCA thirty 184 5 972275 N/A N/A 10622 1063 7 GCTATTCATTCTG GCT 0 184 6 972277 N/A N/A 10624 1063 9 TGGCTATTCATTCT GG 22 184 7 972279 N/A N/A 10664 1067 9 TGGTTCTGGCCAC TGC 37 184 8 972281 N/A N/A 10732 1074 7 GGAGTTCACTTTG CCT 0 184 9 972283 N/A N/A 10783 1079 8 GCTATCTCTGAGT ACT 13 185 0 972285 N/A N/A 10797 1081 2 GACATTGCAGTCT GGC 46 185 1 972287 N/A N/A 10800 1081 5 TCAGACATTGCAG TCT 0 185 2 972289 N/A N/A 10836 1085 1 TTAAATTTGCAGG TGG 92 185 3

- 167 044295

972291 N/A N/A 10839 1085 4 CCCTTAAATTTGC AGG 19 185 4 972293 N/A N/A 10853 1086 8 TGGATTTAGAAAAT CCC 13 185 5 972295 N/A N/A 11012 1102 7 TGAAGCTTCACAC TTA 29 185 6 972297 N/A N/A 11019 1103 4 AGGACAATGAGC TTC 50 185 7 972299 N/A N/A 11100 1111 5 TCCTTAACTGGGT GAG 25 185 8 972301 N/A N/A 11125 1114 0 GTTTAATGTGATTT CAC 88 185 9 972303 N/A N/A 11127 1114 2 TGGTTTAATGTGA TTC 90 186 0 972305 N/A N/A 11159 1117 4 GTAACACAATCC TGA 69 186 1 972307 N/A N/A 11195 1121 0 TACTATATTTGGA GCT 40 186 2 972309 N/A N/A 11200 1121 5 GTCTTTACTATATT TG 77 186 3 972311 N/A N/A 11290 ISO 5 AATTTAGCAGGAA CCC 53 186 4 972313 N/A N/A 11307 1132 2 GAGAATCCTGTTA GGC 51 186 5 972315 N/A N/A 11362 1137 7 TGATTATGCTCTTC A.C. 36 186 6 972317 N/A N/A 11368 1138 3 GCTATCTGATTAT GCT 18 186 7 972319 N/A N/A 11381 1139 6 CTGATTACGCTTT GCT 33 186 8 972321 N/A N/A 11572 1158 7 GACACTAAGGCAT GGG 77 186 9

- 168 044295

972323 N/A N/A 11584 1159 9 GCAGATACTCTGG ASA 46 187 0 972325 N/A N/A 11699 1171 4 GGGCTATTTGGTG TCT 22 187 1 972327 N/A N/A 11747 1176 2 TGATTTGGCCACG GGA 58 187 2 972329 N/A N/A 11767 1178 2 GAACATCTGTCTT TGC 42 187 3 972331 N/A N/A 11856 1187 1 AGCATGAACTTTA CCC 53 187 4 972333 N/A N/A 11968 1198 3 CAGGTCAACACCG TGA 0 187 5 972335 N/A N/A 11998 1201 3 GTTTGATAAAGAT GCC 77 187 6 972337 N/A N/A 12069 1208 4 TACTCCCTCAATAT TTA 66 187 7 972339 N/A N/A 12071 1208 6 GATACTCCTCAAT A.T.T. 37 187 8 972341 N/A N/A 12077 1209 2 ATCATAGATACTC CTC 93 187 9 972343 N/A N/A 12080 1209 5 TTCATCATAGATA CTC 87 188 0 972345 N/A N/A 12168 1218 3 GTGTAAATTGCAG A.G.C. 82 188 1 972347 N/A N/A 12199 1221 4 TGTGAAATGAGCT CCA 78 188 2 972349 N/A N/A 14953 1496 8 ATGACTCGAACAA GTC 38 188 3 972351 N/A N/A 15116 1513 1 TGGAACTTCATCG GTC 5 188 4 972353 N/A N/A 15310 1532 5 GACATCACCTTTGT CCA 16 188 5 972355 N/A N/A 15432 1544 7 GGAAGTCAGGCAC CCA 16 188 6

- 169 044295

Table 28

Gapmers targeting SEQ ID NO: 1 and 2

Connection number SEQ ID: 1, starting site S.E. Q ID: 1, one hundred IIsay t SEQ ID: 2, starting site S.E. Q ID: 2, one hundred IIsay t Subsequence Chemical characteristics SE Q ID NO 904628 N/A N/A 5450 546 5 TGTTATATTTGAT SST kkk-dlO-kkk 188 7 905141 N/A N/A 6820 683 5 GAACGCAATGCT GACT kkk-dlO-kkk 188 8 905269 N/A N/A 7283 729 8 CAGCATTGAGTA SAAS kkk-dlO-kkk 188 9 905521 N/A N/A 8366 838 1 CTTTATACCAGTG TST kkk-dlO-kkk 189 0 905582 N/A N/A 8520 853 5 GAGAACATTGAA ACAS kkk-dlO-kkk 189 1 905684 N/A N/A 8875 889 0 TAGTGCTATAGA GGGA kkk-dlO-kkk 189 2 905757 N/A N/A 9457 947 2 TTACATGCACGAT STS kkk-dlO-kkk 189 3 969419 N/A N/A 9460 947 5 ACTTTACATGCAC GAT kk-d9-ekeke 174 2 905758 N/A N/A 9461 947 6 CACTTTACATGCA C.G.A. kkk-dlO-kkk 173 3 969219 N/A N/A 9461 947 6 CACTTTACATGCA C.G.A. kk-dlO-keke 173 3

- 170 044295

971984 N/A N/A 9461 947 6 CACTTTACATGCA C.G.A. kk-d9-kekek 173 3 905808 N/A N/A 10462 104 77 AATTTTATGGAAC STS kkk-dlO-kkk 189 4 971987 N/A N/A 12076 120 91 TCATAGATACTCC TCA kkk-dlO-kkk 189 5 905867 N/A N/A 12079 120 94 TCATCATAGATAC TSS kkk-dlO-kkk 173 4 904016 1772 178 7 13863 138 78 CCCTAACACTCAG TTS kkk-dlO-kkk 189 6 904084 2253 226 8 14344 143 59 TCCGTCAAATATAT TST kkk-dlO-kkk 189 7 904212 2709 272 4 14800 148 15 GGTAAGAGCGAT GGGA kkk-dlO-kkk 189 8

Deoxy-, MOE- and cEt-gapmers.

Newly developed chimeric antisense oligonucleotides are designated deoxy, MOE, and cEt gapmers in the tables below. Deoxy, MOE and cEt oligonucleotides have nucleosides that have either a MOE sugar modification, a (S)-cEt sugar modification, or a deoxy modification. The Chemical Characteristics column describes the sugar modifications in each oligonucleotide. 'k' denotes the (S)-cEt sugar modification; 'd' denotes deoxyribose; and 'e' denotes MOE modification. All internucleoside bonds in each gapmer are phosphorothioate (P=S) bonds. All cytosine residues in each gapmer are 5-methylcytosine. The sugar motifs of the gapmers are shown in the Chemical Characteristics columns of the tables below, where 'k' stands for cEtcaxap; 'e' means 2'-MOE-sugar; 'd' stands for deoxysugar, and the number after 'd' indicates the amount of deoxynucleosides.

The start site indicates the nucleoside closest to the 5' end in the human gene sequence targeted by the gapmer. The stop site indicates the nucleoside closest to the 3' end in the human gene sequence targeted by the gapmer. Each of the gapmers listed in the tables below targets either the human APOL1 mRNA, designated herein as SEQ ID NO: 1 (Accession No. θΕΝΒΑΝΚ ΝΜ_003661.3), or the human APOL1 genomic sequence, designated herein as SEQ ID NO: 2 (Accession No. GENBANKNT_011520.9 with cut-off nucleotides 15986452-16001905). 'n/a' indicates that the antisense oligonucleotide does not target that specific gene sequence with 100% complementarity.

Antisense oligonucleotides were tested in a series of experiments using similar culture conditions. The results of each experiment are presented in the individual tables shown below. Cultured A431 cells at a density of 5000 cells per well were transfected by free uptake with 2000 nM antisense oligonucleotide. After a treatment period of approximately 24 h, RNA was isolated from cells and APOL1 mRNA levels were measured by quantitative real-time PCR. The human primer and probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured using RIBOGREEN®. Results are presented as the percentage of APOL1 suppression relative to untreated control cells.

- 171 044295

Table 29

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Research Institute connection number SEQ ID: 1, home site S.E. Q ID: 1, one hundred IIsay t SEQ ID: 2, home site SE Q ID: 2, one hundred IIsay t Subsequence Chemical characteristics % suppression SEQ ID NO 793406 N/A N/ A 8306 832 1 GTTCAAAA GCAGCATT kkk-dlOkkk 90 13 905095 N/A N/ A 6702 671 7 GTATTTCTT GATGTGG kkk-dlOkkk 99 413 905491 N/A N/ A 8237 825 2 GAGTATTG TTTTTGTG kkk-dlOkkk 93 1899 905634 N/A N/ A 8744 875 9 ATTSTATT GAGGGCT kkk-dlOkkk 95 1326 969064 N/A N/ A 6700 671 5 ATTTTCTTGA TGTGGTG k-dlO- kekek 96 343 969084 N/A N/ A 5449 546 4 GTTATTTT GATCCTC k-dlO- kekek 95 1900 969094 N/A N/ A 8321 833 6 GTTATGAA ATTATTGG k-dlO- kekek 73 76 969104 1031 104 6 13122 131 37 AGATTGGC TCTGGCTC k-d9- kekeke 23 654 969114 N/A N/ A 8162 817 7 TTCAGAAT TTSSASTA k-d9- kekeke 62 1186 969124 N/A N/ A 8306 832 1 GTTCAAAA GCAGCATT k-d9- kekeke 33 13 969134 N/A N/ A 5858 587 3 CAGTTTTTGT AAGTGCA k-d9- kekeke 48 1577 969144 N/A N/ A 8743 875 8 TTCTATTAG AGGGCTA k-d9- kekeke 34 80 969154 2340 235 5 14431 144 46 GTTCTAACT CTTGGGC kek-d9eekk 86 243 969164 N/A N/ A 7922 793 7 GGAATTAT GGAATTGC kek-d9eekk 98 1249 969184 N/A N/ A 6547 656 2 TCAGATGG GTACTTCT kk-dlOkeke 89 411 969194 N/A N/ A 8743 875 8 TTCTATTAG AGGGCTA kk-dlOkeke 94 80 969204 2736 275 1 14827 148 42 GCTAATTTT CTGACTG kk-dlOkeke 99 1283 969214 N/A N/ A 8237 825 2 GAGTATTG TTTTTGTG kk-dlOkeke 96 1899

- 172 044295

969224 2735 275 0 14826 148 41 CTAATTTTC TGACTGT kk-d8- eeekk 88 1901 969234 N/A N/ A 8163 817 8 ATTCAGAA TTTCCACT kk-d8- eeekk 64 1902 969244 N/A N/ A 8828 884 3 CTTTAAACT CAGGTGA kk-d8- kekekk 70 151 969254 N/A N/ A 6816 683 1 GCAATGCT GACTTGGC kk-d8- kekekk 91 1903 969274 N/A N/ A 6701 671 6 TATTTCTTG ATGTGGT kk-d8- kekekk 71 1904 969294 N/A N/ A 5854 586 9 TTTGTAAGT GCAACCA kk-d8- kekekk 87 1095 969304 N/A N/ A 8366 838 1 CTTTATACC AGTGTCT kk-d8- kekekk 87 1890 969314 N/A N/ A 5449 546 4 GTTATTTT GATCCTC kk-d9eeekk 93 1900 969324 N/A N/ A 8332 834 7 CACATCAT TGGGTTAT kk-d9eeekk 86 356 969334 1033 104 8 13124 131 39 GAAGATTG GCTCTGGC kk-d9eeekk 81 1480 969344 N/A N/ A 6818 683 ACGCAATG CTGACTTG kk-d9eeekk 87 1905 969354 N/A N/ A 8831 884 6 AAGCTTTA AACTCAGG kk-d9eeekk 95 1327 969364 N/A N/ A 6549 656 4 TATCAGAT GGGTACTT kk-d9eeekk 70 550 969384 N/A N/ A 5452 546 7 CGTGTTAT ATTTGATC kk-d9eeekk 74 1906 969394 N/A N/ A 8335 835 0 CAACACAT CATTGGGT kk-d9eeekk 80 1907 969404 N/A N/ A 5449 546 4 GTTATTTT GATCCTC kk-d9ekeke 96 1900

- 173 044295

969414 N/A N/ A 8332 834 7 CACATCAT TGGGTTAT kk-d9ekeke 81 356 969424 1033 104 8 13124 131 39 GAAGATTG GCTCTGGC kk-d9ekeke 64 1480 969434 N/A N/ A 6818 683 3 ACGCAATG CTGACTTG kk-d9ekeke 92 1919 969444 N/A N/ A 8832 884 7 GAAGCTTT AAACTCAG kk-d9ekeke 62 1397 969454 N/A N/ A 5856 587 1 GTTTTGTAA GTGCAAC kk-d9ekeke 86 1230 969464 N/A N/ A 8368 838 3 CACTTTATA CCAGTGT kk-d9ekeke 0 1908 969474 N/A N/ A 5448 546 3 TTATATTTG ATCCTCA kk-d9kdkdk 96 1909 969484 N/A N/ A 8320 833 5 TTATGAAA TTATTGGT kk-d9kdkdk 47 1910 969494 970 985 13061 130 76 AAGTATTG CCAGCTAA kk-d9kdkdk 70 1911 969504 N/A N/ A 6702 671 7 GTATTTCTT GATGTGG kk-d9kdkdk 87 413 971924 N/A N/ A 6547 656 2 TCAGATGG GTACTTCT kk-d9kekek 82 411 971934 N/A N/ A 8743 875 8 TTCTATTAG AGGGCTA kk-d9kekek 53 80 971944 2738 275 3 14829 148 44 ATGCTAAT TTTCTGAC kk-d9kekek 97 1912 971954 N/A N/ A 8166 818 1 GGCATTCA GAATTTCC kk-d9kekek 46 1913 971964 N/A N/ A 8306 832 1 GTTCAAAA GCAGCATT kk-d9kekek 60 13 971974 N/A N/ A 6548 656 3 ATCAGATG GGTACTTC kk-d9kekek 66 481

- 174 044295

971994 1033 104 8 13124 131 39 GAAGATTG GCTCTGGC kkk-d8kdkdk 51 1480 972004 N/A N/ A 6702 671 7 GTATTTCTT GATGTGG kkk-d8kdkdk 92 413 972014 N/A N/ A 8829 884 4 GCTTTAAA CTCAGGTG kkk-d8kdkdk 93 81 972024 N/A N/ A 5853 586 8 TTGTAAGT GCAACCAA kkk-d8kekek 35 1025 972034 N/A N/ A 8365 838 0 TTTATACCA GTGTCTT kkk-d8kekek 76 1914 972044 2253 226 8 14344 143 59 TCCGTCAA TATATTCT kkk-d8kekek 95 1897 972054 N/A N/ A 6820 683 5 GAACGCAA TGCTGACT kkk-d8kekek 48 1888 972074 N/A N/ A 5854 586 9 TTTGTAAGT GCAACCA kkk-d8kekek 63 1095 972084 N/A N/ A 8366 838 1 CTTTATACC AGTGTCT kkk-d8kekek 76 1890 972094 N/A N/ A 5413 542 8 TATTCTCAT GGTACAG kkk-d9keke 68 1915 972104 N/A N/ A 8238 825 3 TGAGTATT θ _τττττ θ _τ kkk-d9keke 92 1916 972114 970 985 13061 130 76 AAGTATTG CCAGCTAA kkk-d9keke 63 1911 972124 N/A N/ A 6702 671 7 GTATTTCTT GATGTGG kkk-d9keke 98 413 972144 N/A N/ A 5857 587 2 AGTTTTTGTA AGTGCAA kkk-d9kkke 96 1917 972154 N/A N/ A 8742 875 7 TCTATTAG AGGGCTAG kkk-d9kkke 51 150 972164 2340 235 5 14431 144 46 GTTCTAACT CTTGGGC kkk-d9kkke 58 243 972174 N/A N/ A 8164 817 9 CATTCAGA ATTTCCAC kkk-d9kkke 92 1730 972184 971 986 13062 130 77 TAAGTATT GCCAGCTA kkk-d9kkke 65 1918 972194 N/A N/ A 6819 683 4 AACGCAAT GCTGACTT kkk-d9kkke 91 1919

- 175 044295

Table 30

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Connection number SEQ ID: 1, home site S.E. Q ID: 1, one hundred IIsay t SEQ ID: 2, home site S.E. Q ID: 2, one hundred IIsay t Subsequence Chemical characteristics % suppression S.E. QID N ABOUT 793444 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kkk-dlOkkk 68 19 20 905095 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-dlOkkk 99 41 3 905491 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-dlOkkk 94 18 99 969055 N/A N/ A 8828 884 3 STTTAAAASTSA GGTGA k-dlO- kekek 77 15 1 969065 N/A N/ A 6816 683 1 GCAATGCTGA CTTGGC k-dlO- kekek 85 19 03 969085 N/A N/ A 5450 546 5 TGTTATATTTG ATSST k-dlO- kekek 79 18 87 969095 N/A N/ A 8333 834 8 ACACATCATTG GGTTA k-dlO- kekek 47 42 6

- 176 044295

969105 N/A N/ A 5410 542 5 TCTCATGGTAC AGGAG k-d9- kekeke 55 53 7 969115 N/A N/ A 8235 825 0 GTATTGTTTTTT GTGGG k-d9- kekeke 70 19 21 969125 970 985 13061 130 76 AAGTATTGCC AGCTAA k-d9- kekeke 25 19 eleven 969135 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC k-d9- kekeke 43 48 1 969145 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT k-d9- kekeke 34 13 26 969155 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kek-d9eekk 94 12 83 969165 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kek-d9eekk 89 17 thirty 969175 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kk-dlOkeke 91 81 969185 N/A N/ A 6701 671 6 TATTTCTTGAT GTGGT kk-dlOkeke 99 19 04 969195 N/A N/ A 8828 884 3 CTTTAAACTCA GGTGA kk-dlOkeke 87 15 1 969205 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kk-dlOkeke 95 67 7 969215 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kk-dlOkeke 68 76 969225 N/A N/ A 5411 542 6 TTCTCATGGTA CAGGA kk-d8- eeekk 80 60 7 969235 N/A N/ A 8236 825 1 AGTATTGTTTT TGTGG kk-d8- eeekk 85 19 22 969245 968 983 13059 130 74 GTATTGCCAGC TAAGG kk-d8- kekekk 74 14 10 969255 N/A N/ A 7920 793 5 AATTATGGAA TTGCAG kk-d8- kekekk 35 19 23

- 177 044295

969265 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kk-d8- kekekk 50 81 969275 N/A N/ A 6817 683 2 CGCAATGCTG ACTTGG kk-d8- kekekk 60 19 24 969285 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kk-d8- kekekk 16 19 20 969295 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kk-d8- kekekk 18 15 77 969305 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kk-d8- kekekk 34 13 26 969315 N/A N/ A 5853 586 8 TTGTAAGTGCA ACCAA kk-d9eeekk 83 10 25 969325 N/A N/ A 8365 838 0 TTTATACCAGT GTCTT kk-d9eeekk 88 19 14 969335 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kk-d9eeekk 81 19 25 969345 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kk-d9eeekk 99 12 49 969355 N/A N/ A 8307 832 2 GGTTCAAAAG CAGCAT kk-d9eeekk 95 97 8 969365 N/A N/ A 6703 671 8 TGTATTTCTTG ATGTG kk-d9eeekk 87 19 26 969385 N/A N/ A 5856 587 1 GTTTTGTAAGT GCAAC kk-d9eeekk 83 12 thirty 969395 N/A N/ A 8368 838 3 CACTTTATACC AGTGT kk-d9eeekk 0 19 08 969405 N/A N/ A 5853 586 8 TTGTAAGTGCA ACCAA kk-d9ekeke 87 10 25 969415 N/A N/ A 8365 838 0 TTTATACCAGT GTCTT kk-d9ekeke 90 19 14 969425 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kk-d9ekeke 90 19 25

- 178 044295

969435 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kk-d9ekeke 97 12 49 969445 N/A N/ A 8308 832 3 TGGTTCAAAA GCAGCA kk-d9ekeke 82 10 48 969455 N/A N/ A 5860 587 5 GGCAGTTTTGT AAGTG kk-d9ekeke 75 12 3 969465 N/A N/ A 8745 876 0 AATTCTATTAG AGGGC kk-d9ekeke 79 13 96 969475 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kk-d9kdkdk 93 19 00 969485 N/A N/ A 8332 834 7 CACATCATTGG GTTAT kk-d9kdkdk 79 35 6 969495 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC kk-d9kdkdk 79 14 80 969505 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kk-d9kdkdk 85 19 05 971915 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kk-d9kekek 86 81 971925 N/A N/ A 6701 671 6 TATTTCTTGAT GTGGT kk-d9kekek 97 19 04 971935 N/A N/ A 8828 884 3 CTTTAAACTCA GGTGA kk-d9kekek 82 15 1 971945 N/A N/ A 5414 542 9 TTATTCTCATG GTACA kk-d9kekek 47 19 27 971955 N/A N/ A 8239 825 4 GTGAGTATTGT TTTTG kk-d9kekek 88 19 28 971965 970 985 13061 130 76 AAGTATTGCC AGCTAA kk-d9kekek 62 19 eleven 971975 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kk-d9kekek 75 41 3 971995 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kkk-d8kdkdk 95 19 25

- 179 044295

972005 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kkk-d8kdkdk 70 19 05 972025 N/A N/ A 5857 587 2 AGTTTTTGTAAG TGCAA kkk-d8kekek 77 19 17 972035 N/A N/ A 8742 875 7 TCTATTAGAGG GCTAG kkk-d8kekek 23 15 0 972045 2342 235 7 14433 144 48 CTGTTCTAACT CTTGG kkk-d8kekek 88 38 3 972055 N/A N/ A 7924 793 9 TGGGAATTAT GGAATT kkk-d8kekek 56 19 29 972065 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kkk-d8kekek 64 19 20 972075 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kkk-d8kekek 87 15 77 972085 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kkk-d8kekek 37 13 26 972095 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT kkk-d9keke 71 18 87 972105 N/A N/ A 8322 833 7 GGTTATTGAAA TTATTG kkk-d9keke 88 19 thirty 972115 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC kkk-d9keke 75 14 80 972125 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kkk-d9keke 87 19 05 972145 N/A N/ A 6547 656 2 TCAGATGGGT ACTTCT kkk-d9kkke 82 41 1 972155 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kkk-d9kkke 85 80 972165 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kkk-d9kkke 92 12 83 972175 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-d9kkke 88 18 99 972185 1034 104 9 13125 131 40 TGAAGATTGG CTCTGG kkk-d9kkke 61 19 31 972195 N/A N/ A 7923 793 8 GGGAATTATG GAATTG kkk-d9kkke 77 15 96

- 180 044295

Table 31

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Research Institute connection number SEQ ID: 1, home site SE Q ID: 1, hundred IIsay t SEQ ID: 2, home site S.E. Q ID: 2, one hundred IIsay t Consistently awn Chemical characteristics % suppression S.E. QID N ABOUT 903822 970 985 13061 130 76 AAGTATTGCC AGCTAA kkk-dlOkkk 90 19 eleven 905095 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-dlOkkk 100 41 3 905491 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-dlOkkk 94 18 99 969056 968 983 13059 130 74 GTATTGCCAG CTAAGG k-dlO- kekek 93 14 10 969066 N/A N/ A 7920 793 5 AATTATGGAA TTGCAG k-dlO- kekek 52 19 23 969076 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT k-dlO- kekek 95 19 20 969086 N/A N/ A 5854 586 9 TTTGTAAGTGC AASSA k-dlO- kekek 99 10 95 969096 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT k-dlO- kekek 89 18 90

- 181 044295

969106 N/A N/ A 5447 546 2 TATATTTTGATC CTCAA k-d9-kekeke 75 19 32 969116 N/A N/ A 8331 834 6 ACATCATTGG GTTATG k-d9-kekeke 76 28 6 969126 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC k-d9-kekeke 21 14 80 969136 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG k-d9-kekeke 87 41 3 969146 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG k-d9-kekeke 67 81 969156 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kek-d9-eekk 96 67 7 969166 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kek-d9-eekk 90 18 99 969176 969 984 13060 130 75 AGTATTGCCA GCTAAG kk-dlOkeke 86 14 79 969186 N/A N/ A 6817 683 2 CGCAATGCTG ACTTGG kk-dlOkeke 96 19 24 969206 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT kk-dlOkeke 92 18 87 969216 N/A N/ A 8333 834 8 ACACATCATT GGGTTA kk-dlOkeke 72 42 6 969226 N/A N/ A 5448 546 3 TTATATTTGAT CCTCA kk-d8- eeekk 91 19 09 969236 N/A N/ A 8320 833 5 TTATGAAATTA TTGGT kk-d8- eeekk 35 19 10 969246 1031 104 6 13122 131 37 AGATTGGCTCT GGCTC kk-d8- kekekk 18 65 4 969256 N/A N/ A 8162 817 7 TTCAGAATTTTC CACTA kk-d8- kekekk 58 eleven 86 969266 969 984 13060 130 75 AGTATTGCCA GCTAAG kk-d8- kekekk 34 14 79

- 182 044295

969276 N/A N/ A 7921 793 6 GAATTATGGA ATTGCA kk-d8- kekekk 61 eleven 83 969286 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kk-d8- kekekk 34 13 969296 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC kk-d8- kekekk 45 48 1 969316 N/A N/ A 5857 587 2 AGTTTTTGTAAG TGCAA kk-d9-eeekk 94 19 17 969326 N/A N/ A 8742 875 7 TCTATTAGAG GGCTAG kk-d9-eeekk 67 15 0 969336 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC kk-d9-eeekk 91 24 3 969346 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kk-d9-eeekk 78 17 thirty 969356 971 986 13062 130 77 TAAGTATTGCC AGCTA kk-d9-eeekk 79 19 18 969366 N/A N/ A 6819 683 4 AACGCAATGC TGACTT kk-d9-eeekk 82 19 19 969376 N/A N/ A 8832 884 7 GAAGCTTTAA ACTCAG kk-d9-eeekk 72 13 97 969386 N/A N/ A 5860 587 5 GGCAGTTTTGT AAGTG kk-d9-eeekk 80 12 3 969396 N/A N/ A 8746 876 1 TAATTCTATTA GAGGG kk-d9-eeekk 59 22 0 969406 N/A N/ A 5857 587 2 AGTTTTTGTAAG TGCAA kk-d9-ekeke 91 19 17 969416 N/A N/ A 8742 875 7 TCTATTAGAG GGCTAG kk-d9-ekeke 67 15 0 969426 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC kk-d9-ekeke 78 24 3 969436 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kk-d9-ekeke 87 17 thirty

- 183 044295

969446 972 987 13063 130 78 GTAAGTATTG CCAGCT kk-d9-ekeke 69 19 33 969456 N/A N/ A 6550 656 5 ATATCAGATG GGTACT kk-d9-ekeke 27 62 0 969466 N/A N/ A 8746 876 1 TAATTCTATTA GAGGG kk-d9-ekeke 46 22 0 969476 N/A N/ A 5853 586 8 TTGTAAGTGC AACCAA kk-d9kdkdk 74 10 25 969486 N/A N/ A 8365 838 0 TTTATACCAGT GTCTT kk-d9kdkdk 81 19 14 969496 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kk-d9kdkdk 91 19 25 969506 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kk-d9kdkdk 89 12 49 971916 969 984 13060 130 75 AGTATTGCCA GCTAAG kk-d9kekek 65 14 79 971926 N/A N/ A 6817 683 2 CGCAATGCTG ACTTGG kk-d9kekek 83 19 24 971946 N/A N/ A 5451 546 6 GTGTTATATTTT GATCC kk-d9kekek 78 19 34 971956 N/A N/ A 8323 833 8 GGGTTATGAA ATTATT kk-d9kekek 84 19 35 971966 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC kk-d9kekek 48 14 80 971976 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kk-d9kekek 79 19 05 971996 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC kkk-d8kdkdk 73 24 3 972006 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kkk-d8kdkdk 76 12 49 972026 N/A N/ A 6547 656 2 TCAGATGGGT ACTTCT kkk-d8kekek 50 41 1

- 184 044295

972036 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kkk-d8kekek 42 80 972046 2738 275 3 14829 148 44 ATGCTAATTTT CTGAC kkk-d8kekek 95 19 12 972056 N/A N/ A 8166 818 1 GGCATTCAGA ATTTCC kkk-d8kekek 20 19 13 972066 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kkk-d8kekek 24 13 972076 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC kkk-d8kekek 54 48 1 972096 N/A N/ A 5451 546 6 GTGTTATATTTT GATCC kkk-d9keke 96 19 81 972106 N/A N/ A 8334 834 9 AACACATCAT TGGGTT kkk-d9keke 21 49 6 972116 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kkk-d9keke 94 19 25 972126 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kkk-d9keke 55 12 49 972136 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kkk-d9kkke 74 81 972146 N/A N/ A 6701 671 6 TATTTCTTGAT GTGGT kkk-d9kkke 99 19 04 972156 N/A N/ A 8828 884 3 CTTTAAACTCA GGTGA kkk-d9kkke 59 15 1 972166 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kkk-d9kkke 93 67 7 972176 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kkk-d9kkke 96 76 972186 2252 226 7 14343 143 58 CCGTCAATAT ATTCTT kkk-d9kkke 98 19 36 972196 N/A N/ A 8165 818 0 GCATTCAGAA TTTCCA kkk-d9kkke 95 19 37

- 185 044295

Table 32

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Connection number SEQ ID: 1, home site SE Q ID: 1, hundred IIsay t SEQ ID: 2, home site S.E. Q ID: 2, one hundred IIsay t Consistently awn Chemical characteristics % suppression S.E. QID N ABOUT 904082 2251 226 6 14342 143 57 CGTCAATATATA TSTTT kkk-dlOkkk 94 19 25 905095 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-dlOkkk 100 41 3 905491 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-dlOkkk 94 18 99 969057 1031 104 6 13122 131 37 AGATTGGCTCT GGCTC k-dlO- kekek 40 65 4 969067 N/A N/ A 8162 817 7 TTCAGAATTTTC SASTA k-dlO- kekek 87 eleven 86 969077 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT k-dlO- kekek 79 13 969087 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA k-dlO- kekek 92 15 77 969097 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA k-dlO- kekek 45 80 969107 N/A N/ A 5448 546 3 TTATATTTGAT SSTSA k-d9kekeke 39 19 09 969117 N/A N/ A 8364 837 9 TTATACCAGTG TSTTS k-d9kekeke 82 19 38 969127 2251 226 6 14342 143 57 CGTCAATATATA TSTTT k-d9kekeke 96 19 25

- 186 044295

969137 N/A N/ A 6818 683 3 ACGCATGCT GACTTG k-d9- kekeke 72 19 05 969157 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kek-d9eekk 99 19 00 969167 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kek-d9eekk 90 76 969177 1032 104 7 13123 131 38 AAGATTGGCT CTGGCT kk-dlOkeke 65 14 eleven 969187 N/A N/ A 7921 793 6 GAATTATGGA ATTGCA kk-dlOkeke 92 eleven 83 969207 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kk-dlOkeke 92 10 95 969217 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT kk-dlOkeke 97 18 90 969227 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kk-d8- eeekk 69 19 00 969237 N/A N/ A 8332 834 7 CACATCATTGG GTTAT kk-d8- eeekk 54 35 6 969247 N/A N/ A 5410 542 5 TCTCATGGTAC AGGAG kk-d8- kekekk 26 53 7 969257 N/A N/ A 8235 825 0 GTATTGTTTTTT GTGGG kk-d8- kekekk 39 19 21 969267 1032 104 7 13123 131 38 AAGATTGGCT CTGGCT kk-d8- kekekk 2 14 eleven 969277 N/A N/ A 8163 817 8 ATTCAGAATTT CCACT kk-d8- kekekk 57 19 02 969287 970 985 13061 130 76 AAGTATTGCC AGCTAA kk-d8- kekekk 27 19 eleven 969297 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kk-d8- kekekk 52 41 3 969317 N/A N/ A 6547 656 2 TCAGATGGGT ACTTCT kk-d9eeekk 88 41 1

- 187 044295

969327 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kk-d9eeekk 87 80 969337 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kk-d9eeekk 94 12 83 969347 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kk-d9eeekk 97 18 99 969357 1034 104 9 13125 131 40 TGAAGATTGG CTCTGG kk-d9eeekk 82 19 31 969367 N/A N/ A 7923 793 8 GGGAATTATG GAATTG kk-d9eeekk 86 15 96 969377 N/A N/ A 8308 832 3 TGGTTCAAAA GCAGCA kk-d9eeekk 93 10 48 969387 N/A N/ A 6550 656 5 ATATCAGATG GGTACT kk-d9eeekk 52 62 0 969407 N/A N/ A 6547 656 2 TCAGATGGGT ACTTCT kk-d9ekeke 91 41 1 969417 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kk-d9ekeke 85 80 969427 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kk-d9ekeke 88 12 83 969437 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kk-d9ekeke 98 18 99 969447 1035 105 0 13126 131 41 CTGAAGATTG GCTCTG kk-d9ekeke 53 19 39 969457 N/A N/ A 6704 671 9 GTGTATTTCTT GATGT kk-d9ekeke 94 19 40 969467 N/A N/ A 8831 884 6 AAGCTTTAAA CTCAGG kk-d9ekeke 95 13 27 969477 N/A N/ A 5857 587 2 AGTTTTTGTAAG TGCAA kk-d9kdkdk 91 19 17 969487 N/A N/ A 8742 875 7 TCTATTAGAGG GCTAG kk-d9kdkdk 68 15 0

- 188 044295

969497 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC kk-d9kdkdk 90 24 3 969507 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kk-d9kdkdk 84 17 thirty 971917 1032 104 7 13123 131 38 AAGATTGGCT CTGGCT kk-d9kekek 37 14 eleven 971927 N/A N/ A 7921 793 6 GAATTATGGA ATTGCA kk-d9kekek 51 eleven 83 971947 N/A N/ A 5452 546 7 CGTGTTATATT TGATC kk-d9kekek 88 19 06 971957 N/A N/ A 8335 835 0 CAACACATCA TTGGGT kk-d9kekek 43 19 07 971967 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kk-d9kekek 94 19 25 971977 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kk-d9kekek 82 12 49 971997 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kkk-d8kdkdk 93 12 83 972007 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kkk-d8kdkdk 88 17 thirty 972017 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kkk-d8kekek 68 81 972027 N/A N/ A 6701 671 6 TATTTCTTGAT GTGGT kkk-d8kekek 95 19 04 972037 N/A N/ A 8828 884 3 CTTTAAACTCA GGTGA kkk-d8kekek 40 15 1 972047 N/A N/ A 5414 542 9 TTATTCTCATG GTACA kkk-d8kekek 53 19 27 972057 N/A N/ A 8239 825 4 GTGAGTATTGT TTTTG kkk-d8kekek 85 19 28 972067 970 985 13061 130 76 AAGTATTGCC AGCTAA kkk-d8kekek 47 19 eleven

- 189 044295

972077 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-d8kekek 73 41 3 972097 N/A N/ A 5855 587 0 TTTTGTAAGTG CAACC kkk-d9keke 98 eleven 64 972107 N/A N/ A 8367 838 2 ACTTATACCA GTGTC kkk-d9keke 65 19 41 972117 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC kkk-d9keke 66 24 3 972127 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kkk-d9keke 86 17 thirty 972137 969 984 13060 130 75 AGTATTGCCA GCTAAG kkk-d9kkke 89 14 79 972147 N/A N/ A 6817 683 2 CGCAATGCTG ACTTGG kkk-d9kkke 94 19 24 972167 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT kkk-d9kkke 89 18 87 972177 N/A N/ A 8333 834 8 ACACATCATTG GGTTA kkk-d9kkke 59 42 6 972187 2341 235 6 14432 144 47 TGTTCTAACTC TTGGG kkk-d9kkke 89 31 3 972197 N/A N/ A 8238 825 3 TGAGTATTGTT TTTGT kkk-d9kkke 95 19 16

- 190 044295

Table 33

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Connection number SEQ ID: 1, home site SE Q ID: 1, one hundred p- SEQ ID: 2, home site S.E. QID: 2, hundred and- Subsequence Chemical characteristics % suppression S.E. QID N ABOUT website website 904619 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kkk-dlOkkk 97 67 7 905095 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-dlOkkk 100 41 3 905491 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-dlOkkk 94 18 99 969058 N/A N/ A 5410 542 5 TCTCATGGTAC AGGAG k-dlO- kekek 61 53 7 969068 N/A N/ A 8235 825 0 GTATTGTTTTTT GTGGG k-dlO- kekek 77 19 21 969078 970 985 13061 130 76 AAGTATTGCC AGCTAA k-dlO- kekek 54 19 eleven 969088 N/A N/ A 6548 656 3 ATCAGATGGG TASTTS k-dlO- kekek 73 48 1 969098 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT k-dlO- kekek 45 13 26 969108 N/A N/ A 5852 586 7 TGTAAGTGCA ACCAAT k-d9kekeke 67 95 5 969118 N/A N/ A 8741 875 6 CTATTAGAGG GCTAGT k-d9- kekeke 34 16 74 969128 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC k-d9kekeke 77 24 3 969138 N/A N/ A 7922 793 7 GGAATTATGG AATTGC k-d9kekeke 88 12 49 969158 N/A N/ A 5450 546 5 TGTTATATTTG ATSST kek-d9eekk 94 18 87 969168 N/A N/ A 8333 834 8 ACACATCATTG GGTTA kek-d9eekk 87 42 6 969178 2735 275 0 14826 148 41 CTAATTTTCTG ACTGT kk-dlOkeke 98 19 01

- 191 044295

969188 N/A N/ A 8163 817 8 ATTCAGAATTT CCACT kk-dlOkeke 88 19 02 969198 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kk-dlOkeke 94 19 20 969208 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kk-dlOkeke 94 15 77 969218 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kk-dlOkeke 78 13 26 969228 N/A N/ A 5853 586 8 TTGTAAGTGCA ACCAA kk-d8- eeekk 70 10 25 969238 N/A N/ A 8365 838 0 TTTATACCAGT GTCTT kk-d8- eeekk 89 19 14 969248 N/A N/ A 5447 546 2 TATATTTTGATC CTCAA kk-d8- kekekk 77 19 32 969258 N/A N/ A 8331 834 6 ACATCATTGG GTTATG kk-d8- kekekk 70 28 6 969268 2735 275 0 14826 148 41 CTAATTTTCTG ACTGT kk-d8- kekekk 71 19 01 969278 N/A N/ A 8236 825 1 AGTATTGTTTT TGTGG kk-d8- kekekk 66 19 22 969288 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC kk-d8- kekekk 10 14 80 969298 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kk-d8- kekekk 72 19 05 969308 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kk-d9eeekk 91 81 969318 N/A N/ A 6701 671 6 TATTTCTTGAT GTGGT kk-d9eeekk 99 19 04 969328 N/A N/ A 8828 884 3 CTTTAAACTCA GGTGA kk-d9eeekk 92 15 1 969338 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kk-d9eeekk 92 67 7

- 192 044295

969348 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kk-d9eeekk 54 76 969358 2252 226 7 14343 143 58 CCGTCAATATA TTCTT kk-d9eeekk 98 19 36 969368 N/A N/ A 8165 818 0 GCATTCAGAA TTTCCA kk-d9eeekk 98 19 37 969378 972 987 13063 130 78 GTAAGTATTGC CAGCT kk-d9eeekk 89 19 33 969388 N/A N/ A 6704 671 9 GTGTATTTCTT GATGT kk-d9eeekk 96 19 40 969398 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kk-d9ekeke 92 81 969408 N/A N/ A 6701 671 6 TATTTCTTGAT GTGGT kk-d9ekeke 99 19 04 969418 N/A N/ A 8828 884 3 CTTTAAACTCA GGTGA kk-d9ekeke 91 15 1 969428 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kk-d9ekeke 95 67 7 969438 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kk-d9ekeke 68 76 969448 2253 226 8 14344 143 59 TCCGTCAATAT ATTCT kk-d9ekeke 97 18 97 969458 N/A N/ A 6820 683 5 GAACGCAATG CTGACT kk-d9ekeke 95 18 88 969478 N/A N/ A 6547 656 2 TCAGATGGGT ACTTCT kk-d9kdkdk 88 41 1 969488 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kk-d9kdkdk 87 80 969498 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kk-d9kdkdk 93 12 83 969508 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kk-d9kdkdk 92 18 99

- 193 044295

971918 2735 275 0 14826 148 41 CTAATTTTCTG ACTGT kk-d9kekek 83 19 01 971928 N/A N/ A 8163 817 8 ATTCAGAATTT CCACT kk-d9kekek 76 19 02 971938 N/A N/ A 8832 884 7 GAAGCTTTAA ACTCAG kk-d9kekek 84 13 97 971948 N/A N/ A 5856 587 1 GTTTTGTAAGT GCAAC kk-d9kekek 88 12 thirty 971958 N/A N/ A 8368 838 3 CACTTTATACC AGTGT kk-d9kekek 14 19 08 971968 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC kk-d9kekek 61 24 3 971978 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kk-d9kekek 76 17 thirty 971998 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kkk-d8kdkdk 81 67 7 972008 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-d8kdkdk 54 18 99 972018 969 984 13060 130 75 AGTATTGCCA GCTAAG kkk-d8kekek 66 14 79 972028 N/A N/ A 6817 683 2 CGCAATGCTG ACTTGG kkk-d8kekek 68 19 24 972048 N/A N/ A 5451 546 6 GTGTTATATTTT GATCC kkk-d8kekek 75 19 34 972058 N/A N/ A 8323 833 8 GGGTTATGAA ATTATT kkk-d8kekek 73 19 35 972068 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC kkk-d8kekek 16 14 80 972078 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kkk-d8kekek 71 19 05 972088 N/A N/ A 8831 884 6 AAGCTTTAAA CTCAGG kkk-d9keke 84 13 27

- 194 044295

972098 N/A N/ A 5859 587 4 GCAGTTTTTGTA AGTGC kkk-d9keke 60 16 47 972108 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kkk-d9keke 73 13 26 972118 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kkk-d9keke 93 12 83 972128 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-d9keke 81 18 99 972138 1032 104 7 13123 131 38 AAGATTGGCT CTGGCT kkk-d9kkke 35 14 eleven 972148 N/A N/ A 7921 793 6 GAATTATGGA ATTGCA kkk-d9kkke 90 eleven 83 972168 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kkk-d9kkke 56 10 95 972178 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT kkk-d9kkke 95 18 90 972188 N/A N/ A 5413 542 8 TATTCTCATGG TACAG kkk-d9kkke 79 19 15 972198 N/A N/ A 8322 833 7 GGTTATTGAAA TTATTG kkk-d9kkke 91 19 thirty

- 195 044295

Table 34

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Research Institute connection number SEQ ID: 1, home site SE Q ID: 1, hundred IIsay t SEQ ID: 2, home site S.E. Q ID: 2, one hundred IIsay t Subsequence Chemical characteristics % suppression S.E. QID N ABOUT 904627 N/A N/ A 5449 546 4 GTTATATTTTGA TSSTS kkk-dlOkkk 100 19 00 905095 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-dlOkkk 100 41 3 905491 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-dlOkkk 94 18 99 969059 N/A N/ A 5447 546 2 TATATTTTGATC STCAA k-dlO- kekek 89 19 32 969069 N/A N/ A 8331 834 6 ACATCATTGG GTTATG k-dlO- kekek 89 28 6 969079 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC k-dlO- kekek 44 14 80 969089 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG k-dlO- kekek 92 41 3 969099 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG k-dlO- kekek 92 81 969109 N/A N/ A 5856 587 1 GTTTTGTAAGT GCAAC k-d9kekeke 73 12 thirty 969119 N/A N/ A 8742 875 7 TCTATTAGAGG GCTAG k-d9kekeke 37 15 0 969129 2736 275 1 14827 148 42 GCTAATTTTCT GACTG k-d9kekeke 88 12 83 969139 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC k-d9kekeke 58 17 thirty 969149 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kek-d9eekk 82 19 20 969159 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kek-d9eekk 99 10 95 969169 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT kek-d9eekk 95 18 90 969179 N/A N/ A 5411 542 6 TTCTCATGGTA CAGGA kk-dlOkeke 78 60 7

- 196 044295

969189 N/A N/ A 8236 825 1 AGTATTGTTTT TGTGG kk-dlOkeke 91 19 22 969199 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kk-dlOkeke 89 13 969209 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC kk-dlOkeke 83 48 1 969229 N/A N/ A 5857 587 2 AGTTTTTGTAAG TGCAA kk-d8- eeekk 94 19 17 969239 N/A N/ A 8742 875 7 TCTATTAGAGG GCTAG kk-d8- eeekk 44 15 0 969249 N/A N/ A 5448 546 3 TTATATTTGAT CCTCA kk-d8- kekekk 69 19 09 969259 N/A N/ A 8364 837 9 TTATACCAGTG TCTTC kk-d8- kekekk 68 19 38 969269 N/A N/ A 5411 542 6 TTCTCATGGTA CAGGA kk-d8- kekekk 20 60 7 969279 N/A N/ A 8320 833 5 TTATGAAATTA TTGGT kk-d8- kekekk 63 19 10 969289 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kk-d8- kekekk 95 19 25 969299 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kk-d8- kekekk 74 12 49 969309 969 984 13060 130 75 AGTATTGCCA GCTAAG kk-d9eeekk 86 14 79 969319 N/A N/ A 6817 683 2 CGCAATGCTG ACTTGG kk-d9eeekk 88 19 24 969339 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT kk-d9eeekk 87 18 87 969349 N/A N/ A 8333 834 8 ACACATCATTG GGTTA kk-d9eeekk 51 42 6 969359 2341 235 6 14432 144 47 TGTTCTAACTC TTGGG kk-d9eeekk 97 31 3

- 197 044295

969369 N/A N/ A 8238 825 3 TGAGTATTGTT TTTGT kk-d9eeekk 87 19 16 969379 1035 105 0 13126 131 41 CTGAAGATTG GCTCTG kk-d9eeekk 54 19 39 969389 N/A N/ A 6820 683 5 GAACGCAATG CTGACT kk-d9eeekk 95 18 88 969399 969 984 13060 130 75 AGTATTGCCA GCTAAG kk-d9ekeke 78 14 79 969409 N/A N/ A 6817 683 2 CGCAATGCTG ACTTGG kk-d9ekeke 94 19 24 969429 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT kk-d9ekeke 94 18 87 969439 N/A N/ A 8333 834 8 ACACATCATTG GGTTA kk-d9ekeke 64 42 6 969449 2342 235 7 14433 144 48 CTGTTCTAACT CTTGG kk-d9ekeke 97 38 3 969459 N/A N/ A 7924 793 9 TGGGAATTAT GGAATT kk-d9ekeke 78 19 29 969469 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kk-d9kdkdk 96 81 969479 N/A N/ A 6701 671 6 TATTTCTTGAT GTGGT kk-d9kdkdk 97 19 04 969489 N/A N/ A 8828 884 3 CTTTAAACTCA GGTGA kk-d9kdkdk 89 15 1 969499 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kk-d9kdkdk 84 67 7 969509 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kk-d9kdkdk 71 76 971919 N/A N/ A 5411 542 6 TTCTCATGGTA CAGGA kk-d9kekek 76 60 7 971929 N/A N/ A 8236 825 1 AGTATTGTTTT TGTGG kk-d9kekek 75 19 22

- 198 044295

971939 N/A N/ A 8308 832 3 TGGTTCAAAA GCAGCA kk-d9kekek 68 10 48 971949 N/A N/ A 5860 587 5 GGCAGTTTTGT AAGTG kk-d9kekek 65 12 3 971959 N/A N/ A 8745 876 0 AATTCTATTAG AGGGC kk-d9kekek 56 13 96 971969 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kk-d9kekek 96 12 83 971979 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kk-d9kekek 90 18 99 971999 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kkk-d8kdkdk 92 19 00 972009 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kkk-d8kdkdk 91 76 972019 1032 104 7 13123 131 38 AAGATTGGCT CTGGCT kkk-d8kekek 23 14 eleven 972029 N/A N/ A 7921 793 6 GAATTATGGA ATTGCA kkk-d8kekek 61 eleven 83 972049 N/A N/ A 5452 546 7 CGTGTTATATT TGATC kkk-d8kekek 82 19 06 972059 N/A N/ A 8335 835 0 CAACACATCA TTGGGT kkk-d8kekek thirty 19 07 972069 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kkk-d8kekek 94 19 25 972079 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kkk-d8kekek 66 12 49 972089 N/A N/ A 8307 832 2 GGTTCAAAAG CAGCAT kkk-d9keke 70 97 8 972099 N/A N/ A 6549 656 4 TATCAGATGG GTACTT kkk-d9keke 37 55 0 972109 N/A N/ A 8745 876 0 AATTCTATTAG AGGGC kkk-d9keke 82 13 96

- 199 044295

972119 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kkk-d9keke 94 67 7 972129 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kkk-d9keke 93 76 972139 2735 275 0 14826 148 41 CTAATTTTCTG ACTGT kkk-d9kkke 99 19 01 972149 N/A N/ A 8163 817 8 ATTCAGAATTT CCACT kkk-d9kkke 89 19 02 972159 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kkk-d9kkke 82 19 20 972169 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kkk-d9kkke 92 15 77 972179 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kkk-d9kkke 85 13 26 972189 N/A N/ A 5451 546 6 GTGTTATATTTT GATCC kkk-d9kkke 94 19 34 972199 N/A N/ A 8334 834 9 AACACATCATT GGGTT kkk-d9kkke 58 49 6

Table 35

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Research Institute connection number SEQ ID: 1, home site S.E. Q ID: 1, CTO IIsai T SEQ ID: 2, home site S.E. QID: 2, CTO IIsai T Subsequence Chemical characteristics % suppression S.E. QID N ABOUT 904763 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kkk-dlOkkk 98 10 95

- 200 044295

905095 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-dlOkkk 100 41 3 905491 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-dlOkkk 94 18 99 969060 N/A N/ A 5448 546 3 TTATATTTGAT CCTCA k-dlO- kekek 82 19 09 969070 N/A N/ A 8364 837 9 TTATACCAGTG TCTTC k-dlO- kekek 82 19 38 969080 2251 226 6 14342 143 57 CGTCAATATATA TCTTT k-dlO- kekek 90 19 25 969090 N/A N/ A 6818 683 3 ACGCATGCT GACTTG k-dlO- kekek 71 19 05 969110 N/A N/ A 6546 656 1 CAGATGGGTA CTTCTG k-d9-kekeke 23 34 1 969120 N/A N/ A 8827 884 2 TTTAAACTCAG GTGAC k-d9-kekeke 43 16 75 969130 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG k-d9-kekeke 51 67 7 969140 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG k-d9-kekeke 94 18 99 969150 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kek-d9-eekk 89 13 969160 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kek-d9-eekk 96 15 77 969170 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kek-d9-eekk 94 80 969180 N/A N/ A 5448 546 3 TTATATTTGAT CCTCA kk-dlOkeke 96 19 09 969190 N/A N/ A 8320 833 5 TTATGAAATTA TTGGT kk-dlOkeke 63 19 10 969200 970 985 13061 130 76 AAGTATTGCC AGCTAA kk-dlOkeke 73 19 eleven

- 201 044295

969210 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kk-dlOkeke 98 41 3 969230 N/A N/ A 6547 656 2 TCAGATGGGT ACTTCT kk-d8- eeekk 78 41 1 969240 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kk-d8- eeekk 76 80 969250 N/A N/ A 5852 586 7 TGTAAGTGCA ACCAAT kk-d8- kekekk 43 95 5 969260 N/A N/ A 8741 875 6 CTATTAGAGG GCTAGT kk-d8- kekekk 25 16 74 969270 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kk-d8- kekekk 43 19 00 969280 N/A N/ A 8332 834 7 CACATCATTG GGTTAT kk-d8- kekekk 34 35 6 969290 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC kk-d8- kekekk 52 24 3 969300 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kk-d8- kekekk 57 17 thirty 969310 1032 104 7 13123 131 38 AAGATTGGCT CTGGCT kk-d9-eeekk 63 14 eleven 969320 N/A N/ A 7921 793 6 GAATTATGGA ATTGCA kk-d9-eeekk 94 eleven 83 969340 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kk-d9-eeekk 99 10 95 969350 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT kk-d9-eeekk 96 18 90 969360 N/A N/ A 5413 542 8 TATTCTCATGG TACAG kk-d9-eeekk 71 19 15 969370 N/A N/ A 8322 833 7 GGTTATTGAAA TTATTG kk-d9-eeekk 61 19 thirty 969380 2253 226 8 14344 143 59 TCCGTCAATAT ATTCT kk-d9-eeekk 96 18 97

- 202 044295

969390 N/A N/ A 7924 793 9 TGGGAATTAT GGAATT kk-d9-eeekk 63 19 29 969400 1032 104 7 13123 131 38 AAGATTGGCT CTGGCT kk-d9-ekeke 66 14 eleven 969410 N/A N/ A 7921 793 6 GAATTATGGA ATTGCA kk-d9-ekeke 95 eleven 83 969430 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kk-d9-ekeke 97 10 95 969440 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT kk-d9-ekeke 98 18 90 969450 2738 275 3 14829 148 44 ATGCTAATTTT CTGAC kk-d9-ekeke 95 19 12 969460 N/A N/ A 8166 818 1 GGCATTCAGA ATTTCC kk-d9-ekeke 93 19 13 969470 969 984 13060 130 75 AGTATTGCCA GCTAAG kk-d9kdkdk 69 14 79 969480 N/A N/ A 6817 683 2 CGCAATGCTG ACTTGG kk-d9kdkdk 94 19 24 969500 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT kk-d9kdkdk 86 18 87 969510 N/A N/ A 8333 834 8 ACACATCATT GGGTTA kk-d9kdkdk 57 42 6 971920 N/A N/ A 5448 546 3 TTATATTTGAT CCTCA kk-d9kekek 91 19 09 971930 N/A N/ A 8320 833 5 TTATGAAATTA TTGGT kk-d9kekek 82 19 10 971940 972 987 13063 130 78 GTAAGTATTG CCAGCT kk-d9kekek 53 19 33 971950 N/A N/ A 6550 656 5 ATATCAGATG GGTACT kk-d9kekek 21 62 0 971960 N/A N/ A 8746 876 1 TAATTCTATTA GAGGG kk-d9kekek 34 22 0

- 203 044295

971970 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kk-d9kekek 76 67 7 971980 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kk-d9kekek 83 76 972000 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT kkk-d8kdkdk 66 18 87 972010 N/A N/ A 8333 834 8 ACACATCATT GGGTTA kkk-d8kdkdk 48 42 6 972020 2735 275 0 14826 148 41 CTAATTTTCTG ACTGT kkk-d8kekek 90 19 01 972030 N/A N/ A 8163 817 8 ATTCAGAATTT CCACT kkk-d8kekek 56 19 02 972040 N/A N/ A 8832 884 7 GAAGCTTTAA ACTCAG kkk-d8kekek 47 13 97 972050 N/A N/ A 5856 587 1 GTTTTGTAAGT GCAAC kkk-d8kekek 59 12 thirty 972060 N/A N/ A 8368 838 3 CACTTTATACC AGTGT kkk-d8kekek eleven 19 08 972070 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC kkk-d8kekek 37 24 3 972080 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kkk-d8kekek 65 17 thirty 972090 971 986 13062 130 77 TAAGTATTGCC AGCTA kkk-d9keke 78 19 18 972100 N/A N/ A 6703 671 8 TGTATTTCTTG ATGTG kkk-d9keke 71 19 26 972110 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kkk-d9keke 85 19 20 972120 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kkk-d9keke 98 19 00 972130 N/A N/ A 8333 834 8 ACACATCATT GGGTTA kkk-d9keke 58 42 6

- 204 044295

972140 N/A N/ A 5411 542 6 TTCTCATGGTA CAGGA kkk-d9kkke 44 60 7 972150 N/A N/ A 8236 825 1 AGTATTGTTTT TGTGG kkk-d9kkke 89 19 22 972160 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kkk-d9kkke 80 13 972170 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC kkk-d9kkke 88 48 1 972190 N/A N/ A 5855 587 0 TTTTGTAAGTG CAACC kkk-d9kkke 98 eleven 64 972200 N/A N/ A 8367 838 2 ACTTATACCA GTGTC kkk-d9kkke 58 19 41

Table 36

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Number SEQ ID: 1, S.E. Q ID: 1, SEQ ID: 2, S.E. Q ID: 2, Consistently Chemical % S.E. Q connect Research Institute home site CTO IIsay home site CTO IIsay awn characteristics suppressed leniya ID N ABOUT T T 904766 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kkk-dlOkkk 97 15 77 905095 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-dlOkkk 99 41 3 905491 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-dlOkkk 93 18 99 969061 N/A N/ A 5852 586 7 TGTAAGTGCA ACCAAT k-dlO- kekek 81 95 5

- 205 044295

969071 N/A N/ A 8741 875 6 CTATTAGAGG GCTAGT k-dlO- kekek 28 16 74 969081 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC k-dlO- kekek 28 24 3 969091 N/A N/ A 7922 793 7 GGAATTATGG AATTGC k-dlO- kekek 92 12 49 969111 N/A N/ A 6700 671 5 ATTTCTTGATG TGGTG k-d9- kekeke 81 34 3 969131 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC k-d9- kekeke 60 19 00 969141 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG k-d9- kekeke 77 76 969151 970 985 13061 130 76 AAGTATTGCC AGCTAA kek-d9eekk 88 19 eleven 969161 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC kek-d9eekk 91 48 1 969171 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kek-d9eekk 77 13 26 969181 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kk-dlOkeke 97 19 00 969191 N/A N/ A 8332 834 7 CACATCATTGG GTTAT kk-dlOkeke 77 35 6 969201 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC kk-dlOkeke 70 14 80 969211 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kk-dlOkeke 89 19 05 969221 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kk-d8- eeekk 95 81 969231 N/A N/ A 6701 671 6 TATTTCTTGAT GTGGT kk-d8- eeekk 96 19 04 969241 N/A N/ A 8828 884 3 CTTTAAACTCA GGTGA kk-d8- eeekk 88 15 1

- 206 044295

969251 N/A N/ A 5856 587 1 GTTTTGTAAGT GCAAC kk-d8- kekekk 62 12 thirty 969261 N/A N/ A 8742 875 7 TCTATTAGAGG GCTAG kk-d8- kekekk 25 15 0 969271 N/A N/ A 5853 586 8 TTGTAAGTGCA ACCAA kk-d8- kekekk 54 10 25 969281 N/A N/ A 8365 838 0 TTTATACCAGT GTCTT kk-d8- kekekk 51 19 14 969291 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kk-d8- kekekk 71 12 83 969301 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kk-d8- kekekk 85 18 99 969311 2735 275 0 14826 148 41 CTAATTTTCTG ACTGT kk-d9eeekk 83 19 01 969321 N/A N/ A 8163 817 8 ATTCAGAATTT CCACT kk-d9eeekk 77 19 02 969331 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kk-d9eeekk 93 19 20 969341 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kk-d9eeekk 92 15 77 969351 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kk-d9eeekk 70 13 26 969361 N/A N/ A 5451 546 6 GTGTTATATTTT GATCC kk-d9eeekk 98 19 34 969371 N/A N/ A 8334 834 9 AACACATCATT GGGTT kk-d9eeekk 43 49 6 969381 2342 235 7 14433 144 48 CTGTTCTAACT CTTGG kk-d9eeekk 93 38 3 969391 N/A N/ A 8166 818 1 GGCATTCAGA ATTTCC kk-d9eeekk 97 19 13 969401 2735 275 0 14826 148 41 CTAATTTTCTG ACTGT kk-d9ekeke 90 19 01

- 207 044295

969411 N/A N/ A 8163 817 8 ATTCAGAATTT CCACT kk-d9ekeke 87 19 02 969421 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kk-d9ekeke 92 19 20 969431 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kk-d9ekeke 91 15 77 969441 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kk-d9ekeke 25 13 26 969451 N/A N/ A 5414 542 9 TTATTCTCATG GTACA kk-d9ekeke 51 19 27 969461 N/A N/ A 8239 825 4 GTGAGTATTGT TTTTG kk-d9ekeke 93 19 28 969471 1032 104 7 13123 131 38 AAGATTGGCT CTGGCT kk-d9kdkdk 65 14 eleven 969481 N/A N/ A 7921 793 6 GAATTATGGA ATTGCA kk-d9kdkdk 82 eleven 83 969501 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kk-d9kdkdk 99 10 95 969511 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT kk-d9kdkdk 92 18 90 971921 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kk-d9kekek 80 19 00 971931 N/A N/ A 8332 834 7 CACATCATTGG GTTAT kk-d9kekek 74 35 6 971941 1035 105 0 13126 131 41 CTGAAGATTG GCTCTG kk-d9kekek 45 19 39 971951 N/A N/ A 6704 671 9 GTGTATTTCTT GATGT kk-d9kekek 95 19 40 971961 N/A N/ A 8831 884 6 AAGCTTTAAA CTCAGG kk-d9kekek 48 13 27 971971 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT kk-d9kekek 81 18 87

- 208 044295

971981 N/A N/ A 8333 834 8 ACACATCATTG GGTTA kk-d9kekek 50 42 6 971991 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kkk-d8kdkdk 74 19 20 972001 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kkk-d8kdkdk 71 10 95 972011 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT kkk-d8kdkdk 87 18 90 972021 N/A N/ A 5411 542 6 TTCTCATGGTA CAGGA kkk-d8kekek 54 60 7 972031 N/A N/ A 8236 825 1 AGTATTGTTTT TGTGG kkk-d8kekek 55 19 22 972041 N/A N/ A 8308 832 3 TGGTTCAAAA GCAGCA kkk-d8kekek 57 10 48 972051 N/A N/ A 5860 587 5 GGCAGTTTTGT AAGTG kkk-d8kekek 32 12 3 972061 N/A N/ A 8745 876 0 AATTCTATTAG AGGGC kkk-d8kekek 41 13 96 972071 2736 275 1 14827 148 42 GCTAATTTTCT GACTG kkk-d8kekek 88 12 83 972081 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-d8kekek 56 18 99 972091 1034 104 9 13125 131 40 TGAAGATTGG CTCTGG kkk-d9keke 54 19 31 972101 N/A N/ A 6819 683 4 AACGCAATGC TGACTT kkk-d9keke 83 19 19 972121 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kkk-d9keke 49 10 95 972131 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT kkk-d9keke 94 18 90 972141 N/A N/ A 5448 546 3 TTATATTTGAT CCTCA kkk-d9kkke 96 19 09 972151 N/A N/ A 8320 833 5 TTATGAAATTA TTGGT kkk-d9kkke 85 19 10 972161 970 985 13061 130 76 AAGTATTGCC AGCTAA kkk-d9kkke 49 19 eleven 972171 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-d9kkke 98 41 3 972191 N/A N/ A 5859 587 4 GCAGTTTTTGTA AGTGC kkk-d9kkke 76 16 47 972201 N/A N/ A 8745 876 0 AATTCTATTAG AGGGC kkk-d9kkke 70 13 96

- 209 044295

Table 37

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Research Institute connection number SEQ ID: 1, home site SE Q ID: 1, hundred IIsay t SEQ ID: 2, home site S.E. QID: 2, one hundred IIsay t Consistently awn Chemical characteristics % suppressed leniya S.E. QID N ABOUT 905095 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-dlOkkk 100 41 3 905139 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kkk-dlOkkk 94 19 05 905491 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-dlOkkk 94 18 99 969062 N/A N/ A 5856 587 1 GTTTTGTAAGT GCAAC k-dlO- kekek 92 12 thirty 969072 N/A N/ A 8742 875 7 TCTATTAGAGG GCTAG k-dlO- kekek 42 15 0

- 210 044295

969082 2736 275 1 14827 148 42 GCTAATTTTCT GACTG k-dlO- kekek 98 12 83 969092 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC k-dlO- kekek 67 17 thirty 969102 N/A N/ A 8828 884 3 CTTTAAACTCA GGTGA k-d9- kekeke 70 15 1 969112 N/A N/ A 6816 683 1 GCAATGCTGA CTTGGC k-d9- kekeke 45 19 03 969132 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT k-d9kekeke 51 18 87 969142 N/A N/ A 8333 834 8 ACACATCATTG GGTTA k-d9- kekeke 36 42 6 969152 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC kek-d9eekk 87 14 80 969162 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kek-d9eekk 99 41 3 969172 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kek-d9eekk 93 81 969182 N/A N/ A 5853 586 8 TTGTAAGTGCA ACCAA kk-dlOkeke 81 10 25 969192 N/A N/ A 8365 838 0 TTTATACCAGT GTCTT kk-dlOkeke 84 19 14 969202 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kk-dlOkeke 87 19 25 969212 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kk-dlOkeke 40 12 49 969222 969 984 13060 130 75 AGTATTGCCA GCTAAG kk-d8- eeekk 59 14 79 969232 N/A N/ A 6817 683 2 CGCAATGCTG ACTTGG kk-d8- eeekk 68 19 24 969252 N/A N/ A 6546 656 1 CAGATGGGTA CTTCTG kk-d8- kekekk 10 34 1

- 211 044295

969262 N/A N/ A 8827 884 2 TTTAAACTCAG GTGAC kk-d8- kekekk 16 16 75 969272 N/A N/ A 5857 587 2 AGTTTTTGTAAG TGCAA kk-d8- kekekk 84 19 17 969282 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kk-d8- kekekk 26 80 969292 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kk-d8- kekekk 34 67 7 969302 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kk-d8- kekekk 86 76 969312 N/A N/ A 5411 542 6 TTCTCATGGTA CAGGA kk-d9eeekk 86 60 7 969322 N/A N/ A 8236 825 1 AGTATTGTTTT TGTGG kk-d9eeekk 90 19 22 969332 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kk-d9eeekk 86 13 969342 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC kk-d9eeekk 67 48 1 969362 N/A N/ A 5855 587 0 TTTTGTAAGTG CAACC kk-d9eeekk 99 eleven 64 969372 N/A N/ A 8367 838 2 ACTTATACCA GTGTC kk-d9eeekk 91 19 41 969382 2738 275 3 14829 148 44 ATGCTAATTTT CTGAC kk-d9eeekk 88 19 12 969392 N/A N/ A 8239 825 4 GTGAGTATTGT TTTTG kk-d9eeekk 92 19 28 969402 N/A N/ A 5411 542 6 TTCTCATGGTA CAGGA kk-d9ekeke 79 60 7 969412 N/A N/ A 8236 825 1 AGTATTGTTTT TGTGG kk-d9ekeke 89 19 22 969422 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kk-d9ekeke 82 13

- 212 044295

969432 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC kk-d9ekeke 73 48 1 969452 N/A N/ A 5451 546 6 GTGTTATATTTT GATCC kk-d9ekeke 96 19 34 969462 N/A N/ A 8323 833 8 GGGTTATGAA ATTATT kk-d9ekeke 88 19 35 969472 2735 275 0 14826 148 41 CTAATTTTCTG ACTGT kk-d9kdkdk 84 19 01 969482 N/A N/ A 8163 817 8 ATTCAGAATTT CCACT kk-d9kdkdk 79 19 02 969492 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kk-d9kdkdk 86 19 20 969502 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kk-d9kdkdk 95 15 77 969512 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kk-d9kdkdk 74 13 26 971922 N/A N/ A 5853 586 8 TTGTAAGTGCA ACCAA kk-d9kekek 69 10 25 971932 N/A N/ A 8365 838 0 TTTATACCAGT GTCTT kk-d9kekek 89 19 14 971942 2253 226 8 14344 143 59 TCCGTCAATAT ATTCT kk-d9kekek 94 18 97 971952 N/A N/ A 6820 683 5 GAACGCAATG CTGACT kk-d9kekek 78 18 88 971972 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA kk-d9kekek 98 10 95 971982 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT kk-d9kekek 86 18 90 971992 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kkk-d8kdkdk 23 13 972002 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kkk-d8kdkdk 93 15 77

- 213 044295

972012 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kkk-d8kdkdk 78 80 972022 N/A N/ A 5448 546 3 TTATATTTGAT CCTCA kkk-d8kekek 92 19 09 972032 N/A N/ A 8320 833 5 TTATGAAATTA TTGGT kkk-d8kekek 86 19 10 972042 972 987 13063 130 78 GTAAGTATTGC CAGCT kkk-d8kekek 73 19 33 972052 N/A N/ A 6550 656 5 ATATCAGATG GGTACT kkk-d8kekek 28 62 0 972062 N/A N/ A 8746 876 1 TAATTCTATTA GAGGG kkk-d8kekek 41 22 0 972072 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG kkk-d8kekek 70 67 7 972082 N/A N/ A 8321 833 6 GTTATGAAATT ATTGG kkk-d8kekek 79 76 972092 2252 226 7 14343 143 58 CCGTCAATATA TTCTT kkk-d9keke 97 19 36 972102 N/A N/ A 7923 793 8 GGGAATTATG GAATTG kkk-d9keke 63 15 96 972122 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kkk-d9keke 92 15 77 972132 N/A N/ A 8743 875 8 TTCTATTAGAG GGCTA kkk-d9keke 91 80 972142 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kkk-d9kkke 98 19 00 972152 N/A N/ A 8332 834 7 CACATCATTGG GTTAT kkk-d9kkke 78 35 6 972162 1033 104 8 13124 131 39 GAAGATTGGC TCTGGC kkk-d9kkke 70 14 80 972172 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kkk-d9kkke 88 19 05 972182 N/A N/ A 8831 884 6 AAGCTTTAAA CTCAGG kkk-d9kkke 72 13 27 972192 N/A N/ A 6549 656 4 TATCAGATGG GTACTT kkk-d9kkke 69 55 0

- 214 044295

Table 38

Suppression of APOL1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NOs: 1 and 2

Connection number SEQ ID: 1, home site SE Q ID: 1, hundred IIsay t SEQ ID: 2, home site S.E. Q ID: 2, one hundred IIsay t Consistently awn Chemical characteristics % suppression S.E. QID N ABOUT 905095 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kkk-dlOkkk 99 41 3 905469 N/A N/ A 8164 817 9 CATTCAGAATT TSSAS kkk-dlOkkk 94 17 thirty 905491 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG kkk-dlOkkk 93 18 99 969063 N/A N/ A 6546 656 1 CAGATGGGTA CTTCTG k-dlO- kekek 44 34 1 969073 N/A N/ A 8827 884 2 TTTAAACTCAG GTGAC k-dlO- kekek 45 16 75 969083 N/A N/ A 5412 542 7 ATTCTCATGGT ACAGG k-dlO- kekek 83 67 7 969093 N/A N/ A 8237 825 2 GAGTATTGTTTT TTGTG k-dlO- kekek 90 18 99 969103 968 983 13059 130 74 GTATTGCCAGC TAAGG k-d9kekeke 70 14 10

- 215 044295

969113 N/A N/ A 7920 793 5 AATTATGGAA TTGCAG k-d9- kekeke 55 19 23 969123 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT k-d9- kekeke 52 19 20 969133 N/A N/ A 5854 586 9 TTTGTAAGTGC AACCA k-d9- kekeke 95 10 95 969143 N/A N/ A 8366 838 1 CTTTATACCAG TGTCT k-d9- kekeke 92 18 90 969153 2251 226 6 14342 143 57 CGTCAATATATA TCTTT kek-d9eekk 93 19 25 969163 N/A N/ A 6818 683 3 ACGCATGCT GACTTG kek-d9eekk 91 19 05 969183 N/A N/ A 5857 587 2 AGTTTTTGTAAG TGCAA kk-dlOkeke 92 19 17 969193 N/A N/ A 8742 875 7 TCTATTAGAGG GCTAG kk-dlOkeke 72 15 0 969203 2340 235 5 14431 144 46 GTTCTAACTCT TGGGC kk-dlOkeke 84 24 3 969213 N/A N/ A 8164 817 9 CATTCAGAATT TCCAC kk-dlOkeke 84 17 thirty 969223 1032 104 7 13123 131 38 AAGATTGGCT CTGGCT kk-d8- eeekk 55 14 eleven 969233 N/A N/ A 7921 793 6 GAATTATGGA ATTGCA kk-d8- eeekk 95 eleven 83 969253 N/A N/ A 6700 671 5 ATTTCTTGATG TGGTG kk-d8- kekekk 69 34 3 969273 N/A N/ A 6547 656 2 TCAGATGGGT ACTTCT kk-d8- kekekk 62 41 1 969293 N/A N/ A 5450 546 5 TGTTATATTTG ATCCT kk-d8- kekekk 46 18 87 969303 N/A N/ A 8333 834 8 ACACATCATTG GGTTA kk-d8- kekekk 20 42 6

- 216 044295

969313 N/A N/ A 5448 546 3 TTATATTTGAT CCTCA kk-d9eeekk 96 19 09 969323 N/A N/ A 8320 833 5 TTATGAAATTA TTGGT kk-d9eeekk 39 19 10 969333 970 985 13061 130 76 AAGTATTGCC AGCTAA kk-d9eeekk 63 19 eleven 969343 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kk-d9eeekk 97 41 3 969363 N/A N/ A 5859 587 4 GCAGTTTTTGTA AGTGC kk-d9eeekk 79 16 47 969373 N/A N/ A 8745 876 0 AATTCTATTAG AGGGC kk-d9eeekk 73 13 96 969383 N/A N/ A 5414 542 9 TTATTCTCATG GTACA kk-d9eeekk 48 19 27 969393 N/A N/ A 8323 833 8 GGGTTATGAA ATTATT kk-d9eeekk 77 19 35 969403 N/A N/ A 5448 546 3 TTATATTTGAT CCTCA kk-d9ekeke 96 19 09 969413 N/A N/ A 8320 833 5 TTATGAAATTA TTGGT kk-d9ekeke 74 19 10 969423 970 985 13061 130 76 AAGTATTGCC AGCTAA kk-d9ekeke 49 19 eleven 969433 N/A N/ A 6702 671 7 GTATTTCTTGA TGTGG kk-d9ekeke 96 41 3 969453 N/A N/ A 5452 546 7 CGTGTTATATT TGATC kk-d9ekeke 76 19 06 969463 N/A N/ A 8335 835 0 CAACACATCA TTGGGT kk-d9ekeke 80 19 07 969473 N/A N/ A 5411 542 6 TTCTCATGGTA CAGGA kk-d9kdkdk 89 60 7 969483 N/A N/ A 8236 825 1 AGTATTGTTTT TGTGG kk-d9kdkdk 72 19 22

- 217 044295

969493 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kk-d9kdkdk 73 13 969503 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC kk-d9kdkdk 78 48 1 971923 N/A N/ A 5857 587 2 AGTTTTTGTAAG TGCAA kk-d9kekek 81 19 17 971933 N/A N/ A 8742 875 7 TCTATTAGAGG GCTAG kk-d9kekek 52 15 0 971943 2342 235 7 14433 144 48 CTGTTCTAACT CTTGG kk-d9kekek 88 38 3 971953 N/A N/ A 7924 793 9 TGGGAATTAT GGAATT kk-d9kekek 87 19 29 971963 N/A N/ A 8830 884 5 AGCTTTAAACT CAGGT kk-d9kekek 87 19 20 971973 N/A N/ A 5858 587 3 CAGTTTTTGTAA GTGCA kk-d9kekek 91 15 77 971983 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kk-d9kekek 46 13 26 971993 970 985 13061 130 76 AAGTATTGCC AGCTAA kkk-d8kdkdk 54 19 eleven 972003 N/A N/ A 6548 656 3 ATCAGATGGG TACTTC kkk-d8kdkdk 79 48 1 972013 N/A N/ A 8744 875 9 ATTCTATTAGA GGGCT kkk-d8kdkdk 78 13 26 972023 N/A N/ A 5449 546 4 GTTATATTTTGA TCCTC kkk-d8kekek 66 19 00 972033 N/A N/ A 8332 834 7 CACATCATTGG GTTAT kkk-d8kekek 58 35 6 972043 1035 105 0 13126 131 41 CTGAAGATTG GCTCTG kkk-d8kekek 36 19 39 972053 N/A N/ A 6704 671 9 GTGTATTTCTT GATGT kkk-d8kekek 84 19 40

- 218 044295

972063 N/A N/ A 8831 884 6 AAGCTTTAAA CTCAGG kkk-d8kekek 16 13 27 972073 N/A N/ A 5450 546 5 TGTTATATTTG ATSST kkk-d8kekek 59 18 87 972083 N/A N/ A 8333 834 8 ACACATCATTG GGTTA kkk-d8kekek 32 42 6 972093 2341 235 6 14432 144 47 TGTTCTAACTC TTGGG kkk-d9keke 88 31 3 972103 N/A N/ A 8165 818 0 GCATTCAGAA TTTSSA kkk-d9keke 84 19 37 972113 N/A N/ A 8306 832 1 GTTCAAAAGC AGCATT kkk-d9keke 85 13 972123 N/A N/ A 6548 656 3 ATCAGATGGG TASTTS kkk-d9keke 85 48 1 972133 N/A N/ A 8829 884 4 GCTTTAAAACTC AGGTG kkk-d9keke 82 81 972143 N/A N/ A 5853 586 8 TTGTAAGTGCA ACCAA kkk-d9kkke 78 10 25 972153 N/A N/ A 8365 838 0 TTTATACCAGT GTCTT kkk-d9kkke 80 19 14 972163 2251 226 6 14342 143 57 CGTCAATATATA TSTTT kkk-d9kkke 95 19 25 972173 N/A N/ A 7922 793 7 GGAATTATGG AATTGC kkk-d9kkke 65 12 49 972183 N/A N/ A 8307 832 2 GGTTCAAAAG CAGCAT kkk-d9kkke 74 97 8 972193 N/A N/ A 6703 671 8 TGTATTTCTTG ATGTG kkk-d9kkke 87 19 26

Example 2: Dose-dependent antisense inhibition of human APOL1 in A431 cells.

Gapmers from Example 1 demonstrating significant in vitro suppression of APOL1 mRNA were selected and tested at various doses in A431 cells. Antisense oligonucleotides were tested in a series of experiments using similar culture conditions. The results of each experiment are presented in the individual tables shown below.

Cells were seeded at a density of 10,000 cells per well and transfected by free uptake with various concentrations of cEt gapmers 3-10-3 as indicated in the tables below. After a treatment period of approximately 16 h, RNA was isolated from cells and APOL1 mRNA levels were measured by quantitative real-time PCR. The human primer and probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured using RIBOGREEN®. Results are presented as the percentage of APOL1 suppression relative to untreated control cells.

The half-maximal inhibition concentration (IC50) for each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.

-219044295

Table 39 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 19 60 83 93 0.2 903830 54 85 95 97 <0.1 903862 49 69 88 93 <0.1 903894 41 67 87 94 0.1 904119 49 70 82 85 <0.1 904758 36 63 83 92 0.1 904760 75 93 99 99 <0.1 904823 50 74 85 91 <0.1 905142 32 74 90 95 0.1 905143 52 76 92 97 <0.1 905270 44 78 90 94 <0.1 905271 44 66 86 91 0.1 905398 59 82 94 96 <0.1 905462 42 73 90 95 0.1 905463 42 67 85 94 0.1 905494 51 73 84 91 <0.1 905654 57 74 92 94 <0.1 905655 61 80 90 94 <0.1

- 220 044295

Table 40 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 15 58 82 88 0.3 903544 46 72 87 92 <0.1 904026 62 88 96 98 <0.1 904058 62 83 94 98 <0.1 904121 50 78 86 90 <0.1 904216 32 64 78 82 0.2 904761 19 46 78 92 0.3 905114 36 73 88 91 0.1 905144 35 50 75 82 0.2 905146 42 71 87 97 0.1 905401 52 79 89 94 <o,1 905402 57 82 94 96 <0.1 905496 29 68 90 93 0.1 905497 78 91 95 96 <0.1 905498 60 84 94 94 <0.1 905657 47 67 84 93 0.1 905688 25 71 86 92 0.2 905689 68 87 93 94 <0.1 905690 57 78 88 92 <0.1

- 221 044295

Table 41 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 10 57 83 92 0.3 903644 35 72 85 92 0.1 903996 50 79 88 97 <0.1 904027 28 61 81 88 0.2 904443 54 84 96 98 <0.1 904444 74 91 96 98 <0.1 904763 70 91 97 98 <0.1 904764 47 84 95 99 <0.1 904828 79 92 97 97 <0.1 905020 46 73 90 95 <0.1 905147 37 71 87 93 0.1 905148 22 60 83 94 0.2 905276 29 63 83 92 0.2 905370 8 46 74 84 0.4 905371 38 67 86 94 0.1 905372 59 82 92 95 <0.1 905468 40 67 87 94 0.1 905499 72 87 92 93 <0.1 905691 53 77 85 92 <o,1

Table 42

Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 12 56 81 92 0.3 903613 47 68 81 88 <0.1 903805 28 58 75 82 0.2 903998 56 86 93 96 <0.1

- 222 044295

904029 34 58 79 88 0.2 904030 45 78 92 96 <0.1 904253 46 74 85 92 <0.1 904766 96 98 99 99 <0.1 904829 41 75 84 89 0.1 905021 38 73 90 95 0.1 905022 47 76 92 97 <0.1 905149 38 65 85 93 0.1 905277 24 50 80 92 0.3 905373 74 93 98 99 <0.1 905404 27 58 77 88 0.2 905501 29 67 86 92 0.1 905565 20 49 73 89 0.3 905757 18 56 78 86 0.3 905758 26 65 85 92 0.2

Table 43 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 36 64 85 94 0.1 903807 46 78 90 95 <0.1 903872 38 72 88 94 0.1 903999 32 66 83 91 0.1 904000 90 98 99 100 <0.1 904001 95 99 100 100 <0.1 904063 24 65 81 89 0.2 904223 47 75 84 89 <0.1 904224 60 86 91 94 <0.1 904254 35 62 82 86 0.1 904862 9 49 64 89 0.4 905086 28 55 80 89 0.2 905120 70 90 97 98 <0.1 905374 48 70 80 88 <o,1 905407 38 67 86 93 0.1 905408 23 61 83 92 0.2 905471 59 82 86 86 <o,1 905600 52 81 94 98 <0.1 905631 32 52 71 83 0.2

-223 044295

Table 44 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 17 59 83 91 0.2 903874 44 70 87 95 OD 903939 64 87 94 97 <0.1 904002 904003 904034 904226 904675 905121 905123 905473 905475 905505 905601 905633 905634 905665 905697 905698 53 47 41 77 80 64 62 47 43 58 49 51 54 thirty 51 85 82 76 70 95 95 87 85 61 71 87 79 81 82 76 78 97 92 90 88 98 99 93 92 65 90 95 92 92 91 91 92 99 97 96 94 99 99 95 95 61 96 97 96 94 96 94 96 99 <0.1 <o.1 0.1 <0.1 <0.1 <0.1 <0.1 <0.1 0.1 <0.1 <0.1 <0.1 <0.1 0.1 <0.1 <0.1

- 224 044295

Table 45 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 73 85 92 95 <0.1 903940 64 83 92 96 <0.1 904101 74 85 92 94 <0.1 904102 75 88 94 96 <0.1 904420 22 40 58 62 0.8 904452 78 88 93 96 <0.1 904484 76 87 92 96 <o,1 904515 43 72 85 91 0.1 904517 78 89 92 93 <0.1 905028 63 82 90 93 <0.1 905029 85 88 93 96 <0.1 905093 58 82 91 95 <0.1 905094 95 99 99 99 <0.1 905476 54 85 95 97 <0.1 905477 78 93 96 98 <0.1 905510 65 84 90 94 <0.1 905636 17 45 69 78 0.4 905667 41 65 82 89 0.1 905700 75 88 92 95 <0.1

- 225 044295

Table 46

Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 68 81 90 95 <0.1 903976 80 90 95 97 <0.1 904103 61 79 87 91 <0.1 904104 85 92 95 97 <0.1 904264 72 81 85 85 <0.1 904424 41 75 91 95 0.1 904680 74 87 94 96 <0.1 904743 46 68 86 93 0.1 904744 82 92 97 98 <0.1 904840 66 81 89 93 <0.1 904871 64 75 90 95 <0.1 904872 68 82 93 96 <0.1 904968 53 78 89 94 <0.1 905031 38 66 83 89 0.1 905032 53 78 89 93 <0.1 905095 83 95 97 98 <0.1 905479 82 89 94 95 <0.1 905511 54 75 87 90 <0.1 905704 61 84 93 96 <0.1

Table 47

Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 21 63 83 93 0.2 904009 35 68 88 95 0.1 904041 67 88 95 97 <0.1 904202 24 62 77 88 0.2 904425 84 97 99 99 <0.1 904426 37 72 90 95 0.1 904522 37 73 86 94 0.1

- 226 044295

Table 48

Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 12 55 80 90 0.3 903820 56 85 94 98 <0.1 903821 63 89 97 98 <0.1 904523 40 72 90 95 0.1 904716 33 63 85 92 0.1 904717 53 82 93 97 <0.1 904718 39 73 88 95 0.1 904747 47 79 91 94 <0.1 904748 60 83 93 95 <0.1 905036 52 77 91 95 <0.1 905292 46 75 91 95 <0.1 905419 41 71 84 88 0.1 905422 19 59 88 97 0.2 905485 32 61 80 92 0.2 905580 35 71 89 96 0.1 905581 39 70 89 95 0.1 905582 19 65 86 94 0.2 905707 50 76 89 91 <o,1 905867 33 67 84 92 0.1

- 227 044295

Table 49

Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 15 56 79 91 0.3 903825 72 89 94 95 <0.1 903856 68 75 89 N/A <0.1 904209 61 89 96 96 <0.1 904210 65 90 97 98 <0.1 904720 31 70 92 95 0.1 905456 48 85 91 94 <0.1 905457 45 70 84 89 <0.1 905520 36 68 96 97 0.1 905521 thirty 65 88 97 0.1 905712 25 60 86 94 0.2 905808 37 74 90 92 0.1

Table 50 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 9 59 85 94 0.3 903826 47 81 93 97 <0.1 903956 48 74 88 94 <0.1 904082 56 84 93 95 <0.1 904083 82 95 97 98 <0.1 904084 83 96 98 98 <0.1 904114 48 71 86 89 <0.1 904211 62 88 96 98 <0.1 904212 79 93 97 98 <0.1 904242 33 61 81 89 0.2 904626 25 55 82 93 0.2 904627 86 93 99 99 <o,1 904628 67 90 98 99 <0.1 905139 54 83 94 97 <0.1 905140 35 71 88 95 0.1 905490 66 85 91 92 <0.1 905491 74 91 95 96 <0.1 905586 35 63 81 88 0.1 905684 57 86 95 97 <0.1

Cells were also seeded at a density of 10,000 cells per well and transfected by free uptake with various concentrations of antisense oligonucleotides as indicated in the tables below. After a treatment period of approximately 16 h, RNA was isolated from

- 228044295 cells and measured APOL1 mRNA levels using quantitative real-time PCR. Human primer and probe set HTS7376 (forward sequence GGCAGCCTTGTACTCTTGGAA, designated herein as SEQ ID NO: 1942; reverse sequence GCTGGTAATCCCGGTCAAAG, designated herein as SEQ ID NO: 1943; probe sequence CTGGGATGGAGTTGGGAATCACAGCCX, designated herein as SEQ ID NO : 1944) was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured using RIBOGREEN®. Results are presented as the percentage of APOL1 suppression relative to untreated control cells.

The concentration of half-maximal inhibition ( _IC50 ) for each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.

Table 51 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 73 84 90 95 <0.1 903807 59 83 91 95 <0.1 903872 69 76 86 90 <0.1 903999 76 85 93 94 <0.1 904000 83 94 96 97 <0.1 904001 95 97 98 98 <0.1 904063 71 83 89 92 <0.1 904223 38 48 63 74 0.3 904224 83 91 93 95 <0.1 904254 28 50 72 72 0.3 904862 0 thirty 55 74 1.0 905086 8 32 65 72 0.7 905120 79 88 94 96 <0.1 905374 59 67 77 82 <0.1 905407 62 83 88 93 <0.1 905408 68 82 90 94 <0.1 905471 37 55 64 47 0.4 905600 73 88 93 97 <0.1 905631 19 39 51 69 0.8

Table 52 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 71 83 91 95 <o,1 903874 27 52 76 87 0.2

-229044295

903939 82 92 96 97 <0.1 904002 39 65 81 91 0.1 904003 62 82 90 94 <0.1 904034 55 74 87 90 <0.1 904226 60 85 91 93 <0.1 904675 81 94 98 99 <0.1 905121 78 89 93 95 <0.1 905123 83 92 95 96 <0.1 905473 82 86 86 88 <0.1 905475 72 83 91 95 <0.1 905505 42 73 87 91 0.1 905601 49 76 89 95 <0.1 905633 40 72 84 86 0.1 905634 53 76 88 91 <0.1 905665 61 79 89 93 <0.1 905697 34 70 84 88 0.1 905698 91 97 99 99 <0.1

Table 53 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 64 83 91 94 <0.1 903501 65 82 95 95 <0.1 903543 65 80 92 95 <0.1 903596 100 84 91 95 <0.1 903639 37 35 62 61 0.6 903991 22 42 44 44 >4.0 903997 25 54 77 85 0.2 904055 39 47 76 89 0.2 904509 51 45 52 43 0.1 904629 thirty 58 83 86 0.2 905005 32 48 63 63 0.4 905015 39 58 72 81 0.1 905019 34 63 78 86 0.1 905037 42 63 69 75 0.1 905111 3 44 36 70 1.2 905141 14 50 76 92 o, s 905269 38 58 84 92 0.1 905469 56 81 90 95 <0.1 905685 54 76 95 95 <0.1

- 230 044295

Table 54 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression 1C ₅₀ (µM) 62.5 nM 250 nM 1000 nM 4000 nM 793406 18 54 78 84 0.3 903545 51 68 75 86 <0.1 903557 thirty 54 65 72 0.3 903558 55 69 70 83 <0.1 903564 57 65 64 79 <0.1 903572 40 60 82 90 0.1 903573 48 66 65 80 <0.1 903574 29 44 58 56 0.8 903585 40 66 63 70 0.1 903587 37 43 58 81 0.3 903595 56 72 79 88 <0.1 903597 51 60 69 66 <0.1 903598 28 27 65 62 0.8 903599 31 58 64 79 0.2 903600 43 61 61 79 0.1 903606 57 73 84 91 <0.1 903607 55 69 85 82 <0.1 903639 17 0 23 39 >4.0 905037 0 21 3 37 >4.0

In another assay, cells were seeded at a density of 10,000 cells per well and transfected by free uptake with various concentrations of antisense oligonucleotides as indicated in the tables below. After a treatment period of approximately 16 h, RNA was isolated from cells and APOL1 mRNA levels were measured by quantitative real-time PCR. The human primer and probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured using RIBOGREEN®. Results are presented as the percentage of APOL1 suppression relative to untreated control cells.

The concentration of half-maximal inhibition (IC ₅₀ ) for each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.

- 231 044295

Table 55 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression IC50 (µM) 4.8 nM 19.5 nM 78.1 nM 312.5 nM 1250 nM 5000 nM 793406 0 0 24 53 75 87 0.2 793444 0 0 4 21 31 53 0.9 903822 49 0 27 53 74 88 0.2 904082 1 14 57 87 91 90 OD 904101 5 15 28 67 80 86 0.2 904226 AND 22 71 94 98 99 OD 904628 8 21 59 87 96 98 OD 904763 13 17 46 85 95 98 OD 905032 17 16 60 87 95 97 0.1

Table 56 Multidose assay with cEt gapmers 3-10-3

Connection number % suppression IC50 (µM) 4.8 nM 19.5 nM 78.1 nM 312.5 nM 1250 nM 5000 nM 905139 0 0 48 82 91 96 0.2 905373 10 20 74 93 98 99 OD 905469 And 0 38 73 88 96 0.2 905505 18 27 74 94 96 98 OD 905521 13 2 35 75 88 95 0.2 905633 20 38 79 96 98 99 OD 905634 14 22 60 90 96 98 OD 905665 0 15 40 74 88 94 OD 905758 31 0 thirty 61 85 89 0.2

In another assay, cells were seeded at a density of 11,000 cells per well and transfected by free uptake with varying concentrations of antisense oligonucleotides as indicated in the tables below. After a treatment period of approximately 16 h, RNA was isolated from cells and APOL1 mRNA levels were measured by quantitative real-time PCR. The human primer and probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured using RIBOGREEN®. Results are presented as the percentage of APOL1 suppression relative to untreated control cells.

The half-maximal inhibition concentration (IC50) for each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.

-232 044295

Table 57

Multi-dose assay with deoxy-, MOE- and cEt-gapmers

Connection number Chemical characteristics % suppression IC50 (mkM) 8 nM 40 nM 200 nM 1000 nM 5000 nM 969157 kek-d9-eekk 0 31 83 98 99 0.07 969162 kek-d9-eekk 20 70 98 99 99 0.02 969210 kk-dlO-keke 12 64 96 98 99 0.03 969361 kk-d9-eeekk 13 52 94 98 99 0.04 969408 kk-d9-ekeke 10 53 91 98 99 0.04 969433 kk-d9-ekeke 8 58 92 96 96 0.03 969437 kk-d9-ekeke 14 47 91 97 98 0.04 969502 kk-d9-kdkdk 5 41 87 95 95 0.05 971997 kkk-d8-kdkdk 1 34 79 93 94 0.07 972002 kkk-d8-kdkdk 12 57 86 92 92 0.04 972116 kkk-d9-keke 14 53 90 96 96 0.04 972139 kkk-d9-kkke 20 59 94 99 99 0.03 972163 kkk-d9-kkke 20 65 94 96 96 0.02 972190 kkk-d9-kkke 19 38 84 97 99 0.05 972268 kkk-dlO-kkk 15 42 81 91 93 0.05

In another assay, cells were seeded at a density of 10,000 cells per well and transfected by free uptake with various concentrations of antisense oligonucleotides as indicated in the tables below. After a treatment period of approximately 16 h, RNA was isolated from cells and APOL1 mRNA levels were measured by quantitative real-time PCR. The human primer and probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured using RIBOGREEN®. Results are presented as the percentage of APOL1 suppression relative to untreated control cells.

The concentration of half-maximal inhibition (IC ₅₀ ) for each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.

Table 58

Multi-dose assay with deoxy-, MOE- and cEt-gapmers

Connection number Chemical characteristics % suppression IC50 (mkM) 15.6 nM 62.5 nM 250 nM 1000 nM 905095 kkk-dlO-kkk 39 87 98 99 <0.01 905491 kkk-dlO-kkk 37 66 88 94 0.03 905634 kkk-dlO-kkk 31 55 86 94 0.04 969064 k-dlO-kekek 22 50 80 91 0.1

- 233 044295

969084 k-dlO-kekek 26 56 78 92 0.1 969164 kek-d9-eekk 23 63 90 97 0.05 969194 kk-dlO-keke 26 56 81 92 0.1 969204 kk-dlO-keke eleven 47 82 94 0.1 969214 kk-dlO-keke 33 75 91 96 0.02 969314 kk-d9-eeekk 2 31 67 89 0.1 969354 kk-d9-eeekk 15 48 76 92 0.1 969404 kk-d9-ekeke 8 37 69 64 0.2 969474 kk-d9-kdkdk 15 44 76 93 0.1 971944 kk-d9-kekek 25 59 84 93 0.05 971984 kk-d9-kekek 21 38 69 89 0.1 972014 kkk-d8-kdkdk 18 54 81 93 0.1 972044 kkk-d8-kekek thirty 57 84 94 0.04 972124 kkk-d9-keke 50 80 96 97 <0.01 972144 kkk-d9-kkke 15 60 87 94 0.1

Table 59

Multi-dose assay with deoxy-, MOE- and cEt-gapmers

Connection number Chemical characteristics % suppression IC50 (mkM) 15.6 nM 62.5 nM 250 nM 1000 nM 905095 kkk-dlO-kkk 38 88 98 99 <0.01 969155 kek-d9-eekk 13 42 69 87 0.1 969175 kk-dlO-keke 6 35 67 85 0.1 969185 kk-dlO-keke 10 59 87 96 0.1 969205 kk-dlO-keke 18 46 74 90 0.1 969254 kk-d8-kekekk 5 12 44 80 0.3 969345 kk-d9-eeekk 8 38 84 96 0.1 969355 kk-d9-eeekk 21 60 86 94 0.1 969434 kk-d9-ekeke 6 23 59 80 0.2 969435 kk-d9-ekeke 23 62 89 97 0.05 969475 kk-d9-kdkdk 9 38 68 89 0.1 971925 kk-d9-kekek 44 77 92 96 <0.01 971995 kkk-d8-kdkdk 23 61 84 93 0.1 972004 kkk-d8-kdkdk 24 59 82 86 0.1 972104 kkk-d9-keke 16 47 74 90 0.1 972146 kkk-d9-kkke 45 78 95 98 <0.01 972165 kkk-d9-kkke 2 46 76 87 0.1 972174 kkk-d9-kkke 5 25 64 82 0.2 972194 kkk-d9-kkke 3 24 54 80 0.2

-234044295

Table 60

Multi-dose assay with deoxy-, MOE- and cEt-gapmers

Connection number Chemical characteristics % suppression IC ₅₀ (mkM) 15.6 nM 62.5 nM 250 nM 1000 nM 905095 kkk-dlO-kkk 63 94 99 99 <0.01 969056 k-dlO-kekek 29 50 70 87 0.1 969076 k-dlO-kekek 14 46 80 92 0.1 969086 k-dlO-kekek 24 58 86 96 0.1 969156 kek-d9-eekk 0 37 76 90 0.1 969157 kek-d9-eekk 37 71 91 98 0.02 969186 kk-dlO-keke eleven 44 80 93 0.1 969206 kk-dlO-keke 33 59 81 92 0.04 969226 kk-d8-eeekk 0 thirty 61 87 0.2 969316 kk-d9-eeekk 10 49 79 93 0.1 969336 kk-d9-eeekk 20 35 65 85 0.1 969406 kk-d9-ekeke 25 53 79 91 0.1 972046 kkk-d8-kekek 26 46 68 88 0.1 972096 kkk-d9-keke 24 66 89 95 0.04 972116 kkk-d9-keke 35 72 90 95 0.03 972166 kkk-d9-kkke 17 48 72 88 0.1 972176 kkk-d9-kkke 21 56 85 93 0.1 972186 kkk-d9-kkke 36 70 92 96 0.02 972196 kkk-d9-kkke 33 73 90 92 0.03

- 235 044295

Table 61

Multi-dose assay with deoxy-, MOE- and cEt-gapmers

Connection number Chemical characteristics % suppression IC ₅₀ (mkM) 15.6 nM 62.5 nM 250 nM 1000 nM 904082 kkk-dlO-kkk 38 62 87 93 0.03 905095 kkk-dlO-kkk 63 93 98 99 <0.01 969087 k-dlO-kekek 0 52 79 91 0.1 969127 k-d9-kekeke 0 46 78 90 0.1 969187 kk-dlO-keke 17 38 75 86 0.1 969207 kk-dlO-keke 36 46 78 91 0.1 969217 kk-dlO-keke 14 41 74 92 0.1 969337 kk-d9-eeekk 35 62 81 92 0.03 969347 kk-d9-eeekk 38 72 91 96 0.02 969377 kk-d9-eeekk 41 68 85 91 0.02 969437 kk-d9-ekeke 40 78 92 97 0.02 969457 kk-d9-ekeke 36 65 83 92 0.03 969467 kk-d9-ekeke 20 58 84 92 0.1 971967 kk-d9-kekek 20 41 75 90 0.1 971997 kkk-d8-kdkdk 40 66 85 93 0.02 972027 kkk-d8-kekek 17 61 80 89 0.1 972097 kkk-d9-keke 21 67 89 97 0.05 972147 kkk-d9-kkke 34 61 83 92 0.04 972197 kkk-d9-kkke 43 69 88 94 0.02

- 236 044295

Table 62

Multi-dose assay with deoxy-, MOE- and cEt-gapmers

Connection number Chemical characteristics % suppression IC50 (mkM) 15.6 nM 62.5 nM 250 nM 1000 nM 904619 kkk-dlO-kkk 24 50 84 93 0.1 905095 kkk-dlO-kkk 74 94 99 100 <0.01 969158 kek-d9-eekk 31 40 70 89 0.1 969167 kek-d9-eekk 14 43 64 84 0.1 969178 kk-dlO-keke 27 56 80 93 0.1 969198 kk-dlO-keke 31 53 79 92 0.1 969318 kk-d9-eeekk 37 78 94 98 0.02 969358 kk-d9-eeekk 28 61 86 96 0.04 969368 kk-d9-eeekk 39 72 91 97 0.02 969388 kk-d9-eeekk 18 51 79 91 0.1 969407 kk-d9-ekeke 8 thirty 61 86 0.2 969408 kk-d9-ekeke 36 66 90 96 0.03 969428 kk-d9-ekeke 40 41 71 90 0.1 969448 kk-d9-ekeke 33 61 86 96 0.04 969458 kk-d9-ekeke 19 40 74 92 0.1 969477 kk-d9-kdkdk 16 34 72 85 0.1 969497 kk-d9-kdkdk 3 28 59 75 0.2 971987 kkk-dlO-kkk 8 17 51 80 0.2 972178 kkk-d9-kkke 19 54 78 91 0.1

Table 63

Multi-dose assay with deoxy-, MOE- and cEt-gapmers

Connection number Chemical characteristics % suppression IC50 (mkM) 15.6 nM 62.5 nM 250 nM 1000 nM 905095 kkk-dlO-kkk 65 94 99 99 <0.01 969159 kek-d9-eekk 21 46 84 96 0.1 969169 kek-d9-eekk 22 41 69 89 0.1 969208 kk-dlO-keke 25 53 84 89 0.1 969219 kk-dlO-keke 16 35 66 87 0.1 969289 kk-d8-kekekk 3 36 70 88 0.1 969328 kk-d9-eeekk 19 40 61 85 0.1

- 237 044295

969338 kk-d9-eeekk 13 34 72 90 0.1 969359 kk-d9-eeekk 24 61 84 93 0.05 969389 kk-d9-eeekk 20 42 77 92 0.1 969398 kk-d9-ekeke 14 41 62 86 0.1 969449 kk-d9-ekeke 43 64 83 92 0.02 969469 kk-d9-kdkdk 25 63 83 94 0.05 969479 kk-d9-kdkdk 40 71 91 96 0.02 969498 kk-d9-kdkdk 10 40 71 87 0.1 969508 kk-d9-kdkdk 17 34 70 88 0.1 971969 kk-d9-kekek 28 63 86 92 0.04 972118 kkk-d9-keke 10 42 70 87 0.1 972139 kkk-d9-kkke 35 69 88 96 0.03

Table 64

Multi-dose assay with deoxy-, MOE- and cEt-gapmers

Connection number Chemical characteristics % suppression IC50 (mkM) 15.6 nM 62.5 nM 250 nM 1000 nM 905095 kkk-dlO-kkk 68 93 99 99 <0.01 969160 kek-d9-eekk 39 73 92 96 0.02 969180 kk-dlO-keke 7 38 74 92 0.10 969210 kk-dlO-keke 59 89 97 99 <0.01 969229 kk-d8-eeekk 4 23 80 91 0.10 969340 kk-d9-eeekk 23 60 87 98 0.05 969350 kk-d9-eeekk 12 46 74 92 0.10 969380 kk-d9-eeekk 27 59 84 93 0.05 969409 kk-d9-ekeke 22 48 80 93 0.10 969419 kk-d9-ekeke 8 25 58 84 0.20 969429 kk-d9-ekeke 17 41 71 85 0.10 969430 kk-d9-ekeke 29 59 83 96 0.05 969440 kk-d9-ekeke 29 60 82 95 0.04 972069 kkk-d8-kekek 25 55 84 93 0.10 972119 kkk-d9-keke 15 41 73 83 0.10 972120 kkk-d9-keke 32 65 88 96 0.03 972129 kkk-d9-keke 9 42 75 85 0.10 972189 kkk-d9-kkke 32 63 84 91 0.04 972190 kkk-d9-kkke 38 71 93 98 0.02

Example 3: Tolerance of modified oligonucleotides targeting human APOL1 in BALB/c mice.

BALB/c mice are a versatile mouse model often used for safety and efficacy testing. Mice were treated with antisense oligonucleotides selected from the studies described above and assessed for changes in the levels of various plasma biochemical markers.

Treatment.

Groups of male mice aged 6 to 7 weeks were given a single subcutaneous injection of 200 mg/kg of the modified oligonucleotides. One group of male BALB/c mice was administered by

- 238 044295 PBS injections. Mice were euthanized 72–96 h after a single dose, and plasma was collected for further analysis.

Study 1.

To evaluate the effect of the modified oligonucleotides on liver function, plasma transaminase levels were measured using an automated chemistry analyzer (Beckman Coulter AU480, Brea, CA). Modified oligonucleotides that caused changes in transaminase levels outside the expected range for antisense oligonucleotides were excluded from further studies. Connections with

[D 793406, 903807,

903822, 903853, 904016, 904063, 904082, 904084, 904101, 904212, 904223, 904224, 904226,

904424, 904426, 904443, 904444, 904619, 904627, 904628, 904763, 904766, 905031, 905032,

905036, 905095, 905121, 905123, 905139, 905141, 905143, 905146, 905147, 905269, 905373,

905408, 905418, 905469, 905471, 905491, 905496, 905505, 905510, 905511, 905521, 905581,

905582, 905633, 905634, 905636, 905654, 905655, 905665, 905684, 905688, 905690, 905697, 905700, 905758, and 905867 were considered tolerable in this study and were selected s for further evaluation. Study 2.

In the second study, to evaluate the effect of modified oligonucleotides on liver function, plasma transaminase levels were measured using an automated chemistry analyzer (Beckman Coulter AU480, Brea, CA). Modified oligonucleotides that caused changes in transaminase levels outside the expected range for antisense oligonucleotides were excluded from further studies. Connections with ID

969157, 969160, 969162, 969210, 969214, 969231, 969318, 969347, 969361, 969362, 969408,

969433, 969437, 969479, 969501, 969502, 971925, 971973, 971997, 972002, 972116, 972139,

972163, 972190, 972268, and 972288 were considered tolerable in this study and were selected for further evaluation.

Example 4: Effect of antisense silencing of hAPOL1 in a transgenic mouse model.

The transgenic mouse model was developed using the ABC12-49114OOOM18 fosmid, which, when cleaved, produced a 31.6-kb fragment containing only the APOL1 gene, with 5 kb. above and 12 t.o. below the gene. The gene fragment was inserted into eggs of C57BL/6NTAc mice via pronuclear injection to generate two primary strains. Line 1 was used in the experiments described herein. Human APOL1 transcript is predominantly found in the liver, and hAPOL1 protein is consistently detected in the plasma of these mice. In this model, the effectiveness of modified oligonucleotides was assessed.

Transgenic mice were maintained on a 12-h light/dark cycle and fed standard Purina ad libitum mouse chow. Animals were acclimatized for at least 7 days in the research laboratory before the start of the experiment. Antisense oligonucleotides (ASO) were prepared in buffered saline (PBS) and sterilized by filtration through a 0.2-μm filter. For injection, oligonucleotides were dissolved in PBS.

Study 1.

Mice transgenic for hAPOL1 were divided into groups of 2-4 mice each. The groups received subcutaneous injections of the modified oligonucleotide at a dose of 25 mg/kg three times a week for one week, for a total of 3 doses. One group of mice received subcutaneous injections of control oligonucleotide 549148 (GGCTACTACGCCGTCA, designated SEQ ID NO: 1948; cEt gapmer 3-10-3, no known target) at a dose of 25 mg/kg three times a week for one week, total 3 doses. One group of mice received subcutaneous injections of PBS three times a week for one week. The saline-injected group served as a control group to which the oligonucleotide-treated groups were compared.

On day 7, animals were sacrificed and RNA was extracted from the kidneys and liver for real-time PCR analysis of hAPOL1 mRNA expression. Results are presented as percentage change in mRNA levels compared to PBS control, normalized using RIBOGREEN®. Two separate experiments were performed under similar conditions and the results are presented in separate tables. As shown in the tables below, treatment with antisense oligonucleotides resulted in a significant decrease in hAPOL1 mRNA levels compared to PBS control.

- 239 044295

Table 65

Percentage of APOL1 suppression by cEt gapmers 3-10-3 in transgenic mice compared to PBS control

Connection ID % suppression (liver) % suppression (kidney) 549148 15 5 793406 83 29 903853 82 37 904016 64 21 904063 49 0 904082 93 46 904212 69 24 904223 66 10 904224 65 15 904226 89 28 904424 59 13 904426 43 27 904443 75 16 904444 65 26 904627 96 50

- 240 044295

904628 77 43 905031 86 15 905032 92 38 905036 80 23 905141 90 1 905143 75 0 905146 76 20 905147 79 0 905269 54 8 905373 86 46 905408 78 10 905418 67 20 905471 87 32 905496 71 21 905505 95 16 905511 92 40 905521 86 31 905581 55 6 905582 51 0 905633 79 32 905636 22 0 905655 63 18 905688 81 3 905690 74 21 905697 81 7 905758 85 44 905867 83 31

-241 044295

Table 66

Percentage of APOL1 suppression by cEt gapmers 3-10-3 in transgenic mice compared to PBS control

Connection ID % suppression (liver) % suppression (kidney) 549148 10 7 793406 73 37 903807 51 32 903822 93 50 904084 87 43 904619 86 48 904763 88 56 904766 82 65 905095 92 69 904101 58 47 905121 93 66 905123 74 49 905139 87 51 905469 83 56 905491 95 69 905510 95 61 905634 60 46 905654 53 40 905665 85 47 905684 52 33 905700 79 45

Study 2.

hAPOL1 transgenic mice were divided into groups of 4 mice each. The groups received subcutaneous injections of the modified oligonucleotide at a dose of 25 mg/kg twice a week for 1 week, for a total of 3 doses. One group of mice received subcutaneous injections of control oligonucleotide 549148 at a dose of 25 mg/kg three times a week for one week, for a total of 3 doses. One group of mice received subcutaneous injections of PBS three times a week for 1 week. The saline-injected group served as a control group to which the oligonucleotide-treated groups were compared.

On day 7, animals were sacrificed and RNA was extracted from the kidneys and liver to measure hAPOL1 mRNA expression by real-time PCR analysis. Results are presented as percentage change in mRNA levels compared to PBS control, normalized using RIBOGREEN®. As shown in the tables below, treatment with antisense oligonucleotides resulted in a significant decrease in hAPOL1 mRNA levels compared to PBS control.

- 242 044295

Table 67

Percentage of APOL1 suppression by gapmers in transgenic mice compared to PBS control

Connection ID Chemical characteristics % suppression (liver) % suppression (kidney) 549148 kkk-dlO-kkk 2 0 793406 kkk-dlO-kkk 88 32 969157 kek-d9-eekk 85 41 969160 kek-d9-eekk 78 41 969162 kek-d9-eekk 92 56 969210 kk-10-keke 88 35 969214 kk-dlO-keke 89 45 969231 kk-d8-eeekk 57 29 969318 kk-d9-eeekk 64 17 969347 kk-d9-eeekk 75 22 969361 kk-9-eeekk 61 38 969362 kk-d9-eeekk 74 21 969408 kk-d9-ekeke 84 40 969433 kk-d9-ekeke 84 37 969437 kk-d9-ekeke 94 44 969479 kk-d9-kdkdk 74 23 969501 kk-d9-kdkdk 80 thirty 969502 kk-9-kdkdk 83 43 971925 kk-d9-kekek 78 39 971973 kk-d9-kekek 82 26 971997 kkk-d8-kdkdk 76 36 972002 kkk-d8-kdkdk 81 54 972116 kkk-d9-keke 80 46 972139 kkk-d9-kkke 88 56 972163 kkk-d9-kkke 91 52 972190 kkk-d9-kkke 90 46 972268 kkk-dlO-kkk 50 46 972288 kkk-dlO-kkk 64 28

Study 3.

Effect of antisense silencing of APOL1 in proteinuric mice.

Mice transgenic for hAPOL1 were divided into groups of 3-4 mice each. The groups received subcutaneous injections of the modified oligonucleotide 972190 at a dose of 50 mg/kg once a week for 4 weeks. One group of mice received subcutaneous injections of control oligonucleotide 549148 at a dose of 50 mg/kg once a week for 4 weeks. One group of mice received subcutaneous injections of PBS once a week for 4 weeks. A single dose of IFNy was administered at a rate of 1.125 x 107 U/kg one day after the last dose of oligonucleotide to induce proteinuria in mice. The saline-injected group served as a control group to which the oligonucleotide-treated groups were compared.

48 h after IFNy administration, urine was collected and the animals were sacrificed. RNA was extracted from kidney and liver to measure hAPOL1 mRNA expression using real-time PCR analysis. Results are presented as percentage change in mRNA levels compared to PBS control.

- 243 044295 normalized with RIBOGREEN®. As shown in the tables below, treatment with antisense oligonucleotides resulted in a significant decrease in hAPOL1 mRNA levels compared to PBS control. As also shown in the tables below, treatment with 972190 resulted in a significant reduction in urinary albumin levels and plasma ALT levels compared to IFNy-dosed control animals. The results indicate that treatment with modified oligonucleotides targeting APOL1 protected APOL1 transgenic mice from proteinuria and reduced the increase in plasma ALT levels.

Table 68

Percentage of APOL1 expression by gapmers in transgenic mice compared to PBS control

Treatment Processing with IFNy Bud Liver PBS Yes 179 120 549148 No 76 133 Yes 140 142 972190 No 41 7 Yes 47 3

Table 68

Effect of APOL1 suppression by gapmers in transgenic mice compared to controls

Treatment Processing with ΙΡΝγ Albumin in urine (mcg/mg creatinine) ALT in blood plasma (IU/l) PBS No 41 163 Yes 727 211 549148 No 77 207 Yes 980 225 972190 No 56 63 Yes 50 61

Example 5.

Tolerance of modified oligonucleotides targeting hAPOL1 in CD1 mice.

The CD1® mouse (Charles River, MA) is a versatile mouse model often used for safety and efficacy testing. Mice were treated with cEt-gapmer 3-10-3 oligonucleotides selected from the studies described above and assessed for changes in the levels of various plasma biochemical markers.

Treatment.

Groups of 7-8 week old male CD1 mice were treated by subcutaneous injection with 25 mg/kg ISIS oligonucleotides (dose equal to 50 mg/kg/week) twice weekly for six weeks. One group of male CD1 mice were treated with PBS by subcutaneous injection twice weekly for 6 weeks. Mice were euthanized 48 h after the last dose, and organs and blood plasma were collected for additional analysis. Two separate studies were conducted under similar conditions, and the results are presented in separate tables for the analysis of each outcome.

Study 1.

Biochemical markers of blood plasma.

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, bilirubin, creatinine, and BUN were measured using an automated chemistry analyzer (Beckman Coulter AU480, Brea, CA). The results are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any marker of liver or kidney function outside the expected range for antisense oligonucleotides were excluded from further studies.

- 244 044295

Table 68

Plasma biochemical markers in plasma of CD1 mice at week 6

ID connections ALT (IU/l) AST (IU/l) Albumen (g/dl) BUN (mg/dl) Creatinine (mg/dl) General beat. (mg/dl) PBS 26 43 2.7 21.3 0.05 0.3 793406 42 75 2.6 21.7 0.04 o, s 903853 413 470 2.5 22.8 0.06 o, s 904082 33 54 2.6 21.4 0.07 0.2 904226 40 74 2.4 21.1 0.05 0.2 904627 1122 1245 2.4 19.6 0.06 0.2 904628 41 75 2.5 22.5 0.02 0.2 905032 106 84 2.5 23.6 0.04 0.2 905373 81 88 2.4 22.4 0.05 0.1 905505 62 88 2.2 21.1 0.05 0.1 905511 303 159 2.2 20.3 0.05 0.1 905521 120 117 2.5 22.0 0.06 0.1 905633 31 40 2.5 23.1 0.06 0.1 905758 68 92 2.3 19.0 0.04 0.1 905867 168 199 2.3 24.0 0.03 0.1

Hematological tests.

Blood obtained from all groups of mice was sent to IDEXX BioResearch for hematocrit (HCT) measurements and analysis, as well as measurements of various blood cell parameters such as WBC, RBC, lymphocytes, monocytes and platelets. The results are presented in the tables below. ISIS oligonucleotides that caused changes in the levels of any hematological marker outside the expected range for antisense oligonucleotides were excluded from further studies.

- 245 044295

Table 69 Hematological markers in mice. CD1

ID connections No (%) LYM (10 ³ /µl) MON (10 ³ /µl) PLT (10 ³ /µl) RBC (10 ⁶ /µl) WBC (10 ³ /µl) PBS 43 4.4 0.2 1225 9.3 5.5 793406 44 5.7 0.4 892 9.6 7.5 903853 44 5.9 0.4 673 9.1 7.4 904082 41 5.4 o, s 1009 9.0 6.5 904226 41 4.3 o, s 624 9.2 5.2 904627 44 3.8 0.5 764 9.3 6.1 904628 42 2.7 0.1 765 9.2 4.0 905032 38 2.3 0.2 861 8.1 3.1 905373 42 4.7 0.4 922 8.8 6.1 905505 39 4.4 o, s 1252 8.3 6.1 905511 44 7.0 0.7 858 9.2 9.9 905521 42 3.1 0.3 734 8.8 4.1 905633 44 3.6 o, s 853 9.4 4.6 905758 40 3.2 o, s 628 8.5 4.0 905867 40 5.0 0.5 833 8.6 7.3

Study 2.

Biochemical markers of blood plasma.

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, bilirubin, creatinine, and BUN were measured using an automated chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the table below. ISIS oligonucleotides that caused changes in levels of any marker of liver or kidney function outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 70

Plasma biochemical markers in plasma of CD1 mice at week 6

ID connections ALT (Chalk) AST (IU/l) Albumin (g/dl) BUN (mg/dl) Creatinine (mg/dl) General beat. (mg/dl) PBS 248 213 2.7 21.3 0.11 0.19 793444 51 73 2.4 23.4 oh and 0.14 903822 68 171 2.6 23.8 0.13 0.15 904101 39 62 2.5 19.5 0.10 0.15 904619 590 466 2.1 17.2 0.06 0.14 904763 90 87 2.5 24.0 0.08 0.16 904766 297 262 2.3 19.3 0.07 0.16 905095 246 294 2.2 18.5 0.07 0.19 905139 92 95 2.4 18.3 0.09 0.16 905469 60 72 2.5 19.1 0.10 0.17 905491 972 989 1.9 22.4 0.06 0.20 905634 42 71 2.3 17.1 0.08 0.13 905665 182 118 2.1 20.8 0.07 0.13

- 246 044295

Hematological tests.

Blood obtained from all groups of mice was sent to IDEXX BioResearch for hematocrit (HCT) measurements and analysis, as well as measurements of various blood cell parameters such as WBC, RBC, lymphocytes, monocytes and platelets. The results are presented in the tables below. ISIS oligonucleotides that caused changes in the levels of any hematological marker outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 71

Hematological Markers in CD1 Mice

ID connections NST (%) LYM (10 ³ /µl) MON (10 ³ /µl) PLT (10 ³ /µl) RBC (10 ⁶ /µl) WBC (10 ³ /µl) PBS 50 2.8 o, s 824 10.7 6.2 793444 46 h,o 0.2 831 10.5 4.0 903822 44 4.0 0.2 525 Yu, 1 5.4 904101 47 7.7 0.9 733 10.3 10.9 904619 42 21.0 1.2 686 9.5 26.5 904763 49 3.5 0.2 950 AND 2 4.3 904766 51 7.9 0.9 603 N.5 10.3 905095 46 8.2 0.7 645 10.2 11.2 905139 49 4.2 0.4 997 10.7 6.2 905469 52 4.2 0.2 614 11.8 5.4 905491 43 7.8 2.4 495 9.6 23.1 905634 43 3.2 o, s 716 9.6 4.2 905665 41 4.7 0.3 686 8.6 6.6

Study 3.

Values of body weight and organs.

To evaluate the effect of ISIS oligonucleotides on animal health, body and organ weights were measured at the end of the study. The results are presented in the table below. ISIS oligonucleotides that caused any mass changes outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 72

Body and organ weight values of CD 1 mice at week 6

Liver Bud Spleen Body mass PBS 2.1 0.6 0.1 41.6 969157 2.4 0.6 0.2 39.0 969160 2.2 0.5 0.2 36.7 969162 2.2 0.6 0.2 40.8

- 247 044295

969210 2.2 0.6 0.2 41.0 969214 2D 0.6 0.2 41.0 969361 2.2 0.5 0.2 40.3 969408 2.4 0.6 0.2 42.4 969433 2.6 0.6 0.2 43.3 969437 2.5 0.6 0.2 41.3 969502 2.4 0.6 0.2 37.9 971925 2.5 0.7 0.2 41.5 971997 2.2 0.5 OD 40.1 972002 2.7 0.5 0.2 40.4 972116 2D 0.5 0.2 38.8 972139 2.4 0.5 0.2 40.3 972163 2D 0.5 0.2 41.1 972190 2.3 0.6 OD 41.0 972268 3.1 0.6 o, s 46.0

Biochemical markers of blood plasma.

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, bilirubin, creatinine, and BUN were measured using an automated chemistry analyzer (Beckman Coulter AU480, Brea, CA). The results are presented in the table below. ISIS oligonucleotides that caused changes in levels of any marker of liver or kidney function outside the expected range for antisense oligonucleotides were excluded from further studies. Table 73

Plasma biochemical markers in plasma of CD 1 mice at week 6

ALT (IU/l) AST (IU/l) Albumin (g/dl) BUN (mg/dl) Creatinine (mg/dl) General beat. (mg/dl) PBS 31 77 3.1 26.4 0.2 0.2 969157 818 1083 2.9 23.2 0.2 o, s 969160 482 715 2.8 22.4 0.2 0.2

-248 044295

969162 68 141 2.6 21.5 0.1 0.2 969210 87 166 2.6 25.5 0.2 0.2 969214 456 502 2.6 23.9 0.1 0.2 969361 70 147 2.8 23.0 0.1 0.2 969408 76 138 2.6 23.3 0.1 0.1 969433 84 136 2.6 20.0 0.1 0.2 969437 240 281 2.4 21.5 0.1 0.1 969502 184 217 2.7 23.1 0.1 0.1 971925 114 168 2.8 23.6 0.1 0.2 971997 52 101 2.9 22.1 0.1 0.1 972002 147 192 2.5 21.2 0.1 0.1 972116 75 107 h,o 21.1 0.1 0.1 972139 61 115 2.7 22.2 0.1 0.1 972163 86 124 h,o 20.4 0.1 0.2 972190 70 93 2.8 20.5 0.1 0.2 972268 41 79 2.6 19.1 0.1 0.1 Hematological tests.

Blood obtained from all groups of mice was sent to IDEXX BioResearch for hematocrit (HCT) measurements and analysis, as well as measurements of various blood cell parameters such as WBC, RBC, lymphocytes, monocytes and platelets. The results are presented in the tables below. ISIS oligonucleotides that caused changes in the levels of any hematological marker outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 74

Hematological Markers in CD1 Mice

Neutrophils (%) WBC (thousand/m class) RBC (million/m cells) Lymphocytes (%) NST (%) Number of platelets (thousand/μl) Lymphocytes (/µl) Monocytes (/µl) PBS 16 4 10 54 47 1152 2185 144

- 249 044295

9691 57 23 6 10 65 48 1338 4078 543 9691 60 20 13 10 69 46 974 7953 1425 6961 62 16 8 10 74 46 1002 6067 641 9692 10 20 7 10 70 48 920 5322 524 9692 14 17 5 10 69 44 1076 3781 687 9693 61 16 9 9 75 43 931 6617 599 9694 08 35 7 9 58 42 1069 4416 506 9694 33 25 6 10 70 46 1054 3900 182 9694 37 23 7 AND 69 47 1316 4780 526 9695 02 14 8 10 75 44 1075 5845 651 9719 25 18 5 10 74 44 961 3529 312 9719 97 18 4 9 73 43 1216 2646 239 9720 02 27 7 9 67 41 1069 4781 286 9721 16 23 6 10 69 44 1141 4415 336 9721 39 19 5 9 77 37 877 3947 224 9721 63 10 6 10 81 43 925 5197 437 9721 90 15 7 10 77 47 1453 5281 400 9722 68 39 7 10 54 46 1468 3891 406

Example 6. Tolerance of modified oligonucleotides targeting hAPOLl in Sprague-Dawley rats.

The Sprague-Dawley rat is a multipurpose model used to evaluate safety and efficacy. Rats were treated with cEt-gapmer oligonucleotides 3-103 from the studies described in the examples above and assessed for changes in the levels of various plasma biochemical markers.

Treatment.

Sprague-Dawley rats were maintained on a 12-h light/dark cycle and fed standard Purina rat chow, diet 5001, ad libitum. Groups of Sprague-Dawley rats

- 250 044295 4 individuals each, once a week for 6 weeks, were administered by subcutaneous injection of 50 mg/kg of ISIS oligonucleotide. Forty-eight hours after the last dose, rats were euthanized and organs and blood plasma were collected for additional analysis. Two separate studies were conducted under similar conditions.

Study 1.

Liver function.

To evaluate the effect of ISIS oligonucleotides on liver function, plasma transaminase levels were measured using an automated chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results expressed in IU/L are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any liver function markers outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 75

Markers of liver function in rats, Sprague-Dawley strain

Connection ID ALT (Chalk) AST (IU/l) PBS 45 66 793406 31 56 904082 67 114 904226 125 251 904628 42 87 905032 195 293 905373 54 90 905505 66 94 905521 41 67 905633 83 114 905758 85 144

Kidney function.

To evaluate the effect of ISIS oligonucleotides on renal function, plasma levels of residual urea nitrogen (BUN) and creatinine were measured using an automated chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results, expressed in mg/dL, are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any marker of renal function outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 76

Markers of kidney function in Sprague-Dawley rats

ID connections Albumin (g/dl) BUN (mg/dl) Creatinine (mg/dl) General beat. (mg/dl) PBS 3.7 16.0 0.3 0.2 793406 2.9 23.1 0.4 0.2 904082 4.0 27.0 0.4 0.2 904226 2.8 26.6 0.4 0.2 904628 3.2 18.9 0.4 0.1

- 251 044295

905032 3.5 21.0 0.5 0.2 905373 3.1 19.9 0.4 0.1 905505 3.4 18.2 0.4 0.2 905521 1.9 78.0 1.1 0.1 905633 3.3 20.6 0.4 0.1 905758 3.1 37.5 0.4 0.2

Hematological tests.

Blood obtained from all groups of rats was sent to Antech Diagnostics for hematocrit (HCT) measurements and analysis, as well as measurements of various blood cell parameters such as WBC, RBC, and total hemoglobin content. The results are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any hematological marker outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 77

Hematological markers in Sprague-Dawley rats

Connection ID NST (%) LYM (10 ³ /µl) MON (10 ³ /µl) EOS (10 ³ /µl) BAS (10 ³ /l) NEU (10 ³ /l) RET (10 ³ /l) PBS 51 9 0.5 88 15 1.2 263 793406 47 14 2.1 101 53 z, z 156 904226 33 AND 1.4 0 54 0.6 99 904628 42 21 3.0 18 167 1.3 176 905032 48 19 1.7 54 56 1.2 112 905373 43 19 1.4 18 49 0.9 216 905505 46 13 1.3 15 58 0.6 119 905521 44 AND 1.3 17 24 2.5 37 905633 47 8 0.8 55 17 0.8 149 905758 50 24 3.7 37 74 2.1 128

Table 78

Hematological markers in Sprague-Dawley rats

Connection ID men (pg) msns (g/dl) MCV (fl) PLT (10 ³ /µl) HGB RBC (10 ⁶ /µl) WBC (10 ³ /µl) PBS 19 32 59 747 16 9 AND 793406 18 33 55 625 15 9 20 904226 18 33 55 145 AND 6 13 904628 18 32 55 220 13 8 26 905032 18 33 54 684 16 9 22 905373 17 32 55 619 14 8 21 905505 18 33 55 590 15 9 15 905521 17 34 52 799 15 9 15 905633 19 34 54 658 16 9 10 905758 18 33 53 559 17 10 thirty

Organ mass values.

At the end of the study, the weights of the liver, spleen and kidneys were measured and are presented in the table below. ISIS oligonucleotides that caused any changes in organ mass values outside the expected range for antisense oligonucleotides were excluded from further studies.

-252 044295

Table 79

Organ mass values (g)

ID connections Liver (g) Kidney (g) Spleen (g) PBS 14.8 2.7 0.8 793406 13.5 2.5 1.0 904082 13.8 3.6 1.7 904226 13.4 3.2 2.2 904628 15.6 2.7 3.2 905032 10.6 2.6 1.2 905373 14.7 2.4 1.9 905505 14.0 2.6 1.5 905521 11.7 3.4 0.8 905633 13.3 2.3 1.2 905758 12.9 2.7 2.1

Study 2.

Liver function.

To evaluate the effect of ISIS oligonucleotides on liver function, plasma transaminase levels were measured using an automated chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results expressed in IU/L are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any liver function markers outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 80

Markers of liver function in Sprague-Dawley rats

GO connections ALT (IU/l) AST (IU/l) PBS 44 65 793444 59 89 903822 46 148 904101 55 89 904763 66 96 905139 212 447 905469 41 78 905634 135 112 905665 82 105

Kidney function.

To evaluate the effect of ISIS oligonucleotides on renal function, plasma levels of residual urea nitrogen (BUN) and creatinine were measured using an automated chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results, expressed in mg/dL, are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any marker of renal function outside the expected range for antisense oligonucleotides were excluded from further studies.

- 253 044295

Table 81

Markers of kidney function in Sprague-Dawley rats

ID connections Albumin (g/dl) BUN (mg/dl) Creatinine (mg/dl) General beat. (mg/dl) PBS 3.5 17.5 0.3 0.2 793444 z, z 18.7 o, s 0.2 903822 3.0 16.7 o, s o, s 904101 3.5 21.4 0.4 0.2 904763 3.4 19.1 0.4 0.2 905139 4.0 21.0 0.4 2.5 905469 3.4 16.7 o, s 0.1 905634 3.5 19.3 0.4 0.2 905665 2.9 20.0 0.4 0.2

Hematological tests.

Blood obtained from all groups of rats was sent to Antech Diagnostics for hematocrit (HCT) measurements and analysis, as well as measurements of various blood cell parameters such as WBC, RBC and total hemoglobin content. The results are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any hematological marker outside the expected range for antisense oligonucleotides were excluded from further studies. N.d. indicates that the parameter was not measured for that particular oligonucleotide.

Table 82

Hematological markers in Sprague-Dawley rats

ID connections WBC (thousand/µl) RBC (million/µl) Lymphocyte (/µl) NST (%) Monocyte (/µl) Platelet count (thousand/µl) PBS AND 8.4 7781 53 thirty 687 793444 16 9.5 n.d. 55 n.d. 559 903822 13 6.5 12446 40 462 670 904101 13 8.7 11510 51 35 680 904763 10 8.3 8612 49 n.d. 785 905139 20 7.9 14922 46 274 769 905469 12 7.8 n.d. 49 n.d. 592 905634 12 8.6 10853 51 0 668 905665 13 9.1 6794 56 79 814

Organ mass values.

At the end of the study, the weights of the liver, spleen and kidneys were measured and are presented in the table below. ISIS oligonucleotides that caused any changes in organ mass values outside the expected range for antisense oligonucleotides were excluded from further studies.

- 254 044295

Table 83

Organ mass values (g)

ID connections Liver (g) Kidney (g) Spleen (g) PBS 18.7 h,o 0.9 793444 13.4 2.7 1.0 903822 16.0 3.2 2.9 904101 16.6 2.9 1.4 904763 18.0 2.6 1.2 905139 16.9 3.4 1.9 905469 18.4 2.9 1.9 905634 20.3 2.8 1.4 905665 16.5 h,o 1.4

Study 3.

Liver function.

To evaluate the effect of ISIS oligonucleotides on liver function, plasma transaminase levels were measured using an automated chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results expressed in IU/L are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any liver function markers outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 84

Markers of liver function in Sprague-Dawley rats

ALT (IU/l) AST (IU/l) Bilirubin (mg/dl) PBS 34 58 0.2 969162 41 119 0.2 972139 35 94 0.2 972002 41 83 0.2 972163 37 81 0.2 972116 31 59 OD 972190 62 93 OD 972268 336 286 0.8 969408 104 132 0.2 969361 240 386 0.4 969433 31 99 OD 971997 50 84 0.2 969210 32 87 0.2

Kidney function.

To evaluate the effect of ISIS oligonucleotides on renal function, plasma levels of residual urea nitrogen (BUN) and creatinine were measured using an automated chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results, expressed in mg/dL, are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any marker of renal function that were outside the expected range for antisense oligonucleotides were excluded from further studies.

-255 044295

Table 85

Levels of kidney function markers in blood plasma of Sprague-Dawley rats

BUN (mg/dl) Creatinine (mg/dl) Albumin (g/dL) PBS 17 OD 3.3 969162 21 o, s 2.8 972139 67 0.8 2.8 972002 23 o, s 2.7 972163 19 o, s 2.9 972116 19 o, s 2.9 972190 19 o, s 3.0 972268 16 o, s h,o 969408 19 o, s 3.2 969361 24 0.4 2.8 969433 21 o, s 2.7 971997 21 o, s 2.9 969210 19 o, s ZD

Table 86

Levels of kidney function markers in the urine of Sprague-Dawley rats

Creatinine (mg/dl) Protein (mg/dl) Ratio Protein/Creatinine PBS 121 FROM 1.0 969162 101 452 4.2 972139 61 283 4.0 972002 110 895 7.4 972163 96 394 4.0 972116 105 405 3.8 972190 109 261 2.4 972268 52 214 4.1 969408 51 147 h,o 969361 48 255 5.2 969433 51 224 4.3 971997 67 268 4.3 969210 86 338 3.9

Hematological tests.

Blood obtained from all groups of rats was sent to Antech Diagnostics for hematocrit (HCT) measurements and analysis, as well as measurements of various blood cell parameters such as WBC, RBC and total hemoglobin content. The results are presented in the table below. ISIS oligonucleotides that caused changes in the levels of any hematological marker outside the expected range for antisense oligonucleotides were excluded from further studies. N.d. indicates that the parameter was not measured for that particular oligonucleotide.

-256 044295

Table 87

Hematological markers in Sprague-Dawley rats

ID connected WBC (thousand/µl) RBC (million/µl Lymphocyte (/µl) No (%) Monocyte (/µl) Platelet count PBS 8 9 7035 51 252 725 969162 23 6 20273 36 2219 144 972139 20 6 16184 34 2500 427 972002 18 7 13972 43 1946 547 972163 25 8 22377 43 2302 556 972116 26 7 22581 42 1973 325 972190 9 8 8171 48 791 703 972268 20 8 16780 48 2237 737 969408 15 8 11733 46 1840 685 969361 32 7 25970 43 4802 230 969433 22 5 17649 31 2434 112 971997 24 7 20272 38 2077 458 969210 34 6 27724 37 3880 294

Organ mass values.

Liver, spleen and kidney weights and body weight values were measured at the end of the study and are presented in the table below. ISIS oligonucleotides that caused any changes in mass values outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 88 Mass values (g)

Liver Bud Spleen B.W. PBS 17 3.1 0.8 412 969162 17 3.3 z, z 358 972139 16 4.5 2.8 322 972002 24 3.8 2.5 365 972163 16 3.1 2.2 351 972116 17 3.5 2.8 357 972190 16 3.0 1.4 342 972268 17 2.9 1.4 355 969408 15 2.6 1.4 359 969361 17 2.6 2.9 344 969433 20 4.0 4.1 365 971997 16 2.6 2.3 355 969210 16 3.5 2.7 378

Example 7. Dose-dependent suppression of hAPOL1 in a transgenic mouse model.

The hAPOL1 transgenic mice described above were maintained on a 12-hour light/dark cycle and fed standard Purina ad libitum mouse chow. Animals were acclimatized for at least 7 days in the research laboratory before the start of the experiment. Antisense oligonucleotides (ASO) were prepared in buffered saline (PBS) and sterilized by filtration through a 0.2-μm filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

Study 1.

hAPOL1 transgenic mice were divided into groups of 4 mice each. The groups received subcutaneous injections of cEt-gapmer 3-10-3 at a dose of 5, 15, or 50 mg/kg once weekly for four weeks, for a total of 4 doses, as indicated in the tables below. One group of mice received subcutaneous injections of PBS once a week for 4 weeks. The saline-injected group served as a control group to which the oligonucleotide-treated groups were compared.

RNA analysis.

- 257 044295

Mice were sacrificed 48 h after the last dose, and RNA was extracted from the kidneys and liver to measure hAPOL1 mRNA expression by real-time PCR analysis. Results are presented as percentage change in mRNA levels compared to PBS control, normalized using RIBOGREEN®. Two separate experiments were performed under similar conditions and the results are presented in separate tables. As shown in the tables below, treatment with antisense oligonucleotides resulted in a significant decrease in hAPOL1 mRNA levels compared to PBS control.

Table 89

Percentage of suppression of hAPOL1 mRNA in the kidney of a transgenic mouse compared to PBS control (experiment ___________________________1)__________________________

Weekly dose 5 mg/kg 15 mg/kg 50 mg/kg EDso (mg/kg/week) ID connections % suppression of hAPOLl 793406 0 20 35 >50 793444 6 17 38 >50 903822 1 21 32 >50 904101 0 0 17 >50 904763 7 20 49 >50 905139 0 21 35 >50 905469 AND 25 50 >50 905634 0 0 39 >50 905665 0 23 39 >50

Table 90

Percentage of hAPOL1 mRNA suppression in transgenic mouse liver compared to PBS control (experiment 2)

Weekly dose 5 mg/kg 15 mg/kg 50 mg/kg EDso (mg/kg/week) ID connections % suppression of hAPOL 793406 6 68 92 11.8 793444 9 29 73 26.5 903822 24 78 95 8.5 904101 0 19 70 32.8 904763 36 83 92 6.8 905139 39 73 93 7.0 905469 39 75 96 9.3 905634 13 72 93 9.3 905665 2 71 92 10.5

Study 2.

hAPOL1 transgenic mice were divided into groups of 4 mice each. The groups received subcutaneous injections of cEt-gapmer 3-10-3 at a dose of 5, 15, or 50 mg/kg once weekly for four weeks, for a total of 4 doses, as indicated in the tables below. One group of mice received subcutaneous injections of PBS once a week for 4 weeks. The saline-injected group served as a control group to which the oligonucleotide-treated groups were compared.

RNA analysis.

Mice were sacrificed 48 h after the last dose, and RNA was extracted from the kidneys and liver to measure hAPOL1 mRNA expression by real-time PCR analysis. Results are presented as percentage change in mRNA levels compared to PBS control, normalized using RIBOGREEN®. Two separate experiments were performed under similar conditions and the results are presented in separate tables. As shown in the tables below, treatment with antisense oligonucleotides resulted in a significant decrease in hAPOL1 mRNA levels compared to PBS control.

Table 91

Percentage of hAPOL1 mRNA suppression in transgenic mouse kidney compared to PBS control (experiment 1)

Weekly dose 5 mg/kg 15 mg/kg 50 mg/kg ED50 (mg/kg/week) GO connections % suppression of hAPOLl 793406 22 42 51 40.6 904082 33 50 61 18.1 904226 17 36 59 31.7 904628 33 41 50 >50 905032 22 15 45 >50 905373 26 50 35 >50 905505 22 52 57 23.6 905521 25 46 53 21.4 905633 18 16 48 >50 905758 27 27 49 >50

Table 92

Percentage of suppression of hAPOL1 mRNA in the liver of a transgenic mouse compared to PBS control (experiment 2)____________________

Weekly dose 5 mg/kg 15 mg/kg 50 mg/kg EDso (mg/kg/week) GO connections % suppression of hAPOLl 793406 19 60 94 11.7 904082 54 81 94 4.4 904226 32 73 96 8.0 904628 57 70 91 3.7 905032 65 92 96 3.3 905373 39 84 35 >50 905505 28 83 92 7.6 905521 0 68 95 12.3 905633 0 18 79 21.9 905758 0 60 81 11.8

Study 3.

hAPOL1 transgenic mice were divided into groups of 4 mice each. The groups received subcutaneous injections of the modified oligonucleotide at a dose of 1.5, 5, 15 or 50 mg/kg once a week for four weeks, for a total of 4 doses, as indicated in the tables below. One group of mice received subcutaneous injections of PBS once a week for 4 weeks. The saline-injected group served as a control group to which the oligonucleotide-treated groups were compared.

RNA analysis.

Mice were sacrificed 48 h after the last dose, and RNA was extracted from the kidneys and liver for

- 259 044295 measurement of hAPOLl mRNA expression using real-time PCR analysis. Results are presented as percentage change in mRNA levels compared to PBS control, normalized using RIBOGREEN®. As shown in the tables below, treatment with antisense oligonucleotides resulted in a significant decrease in hAPOL1 mRNA levels compared to

PBS control.

Table 93

Percentage of hAPOL1 mRNA suppression in transgenic kidney. mice compared to PBS control

Weekly dose 1.5 mg/kg 5 mg/kg 15 mg/kg 50 mg/kg ED40 (mg/kg/week) ID connections % suppression of hAPOLl 793406 0 33 43 60 13.7 904763 19 29 52 62 9.3 905469 20 26 34 59 15.9 905505 28 23 45 47 >50 905634 9 16 27 45 >50 905665 12 thirty 45 56 13.2 972163 0 32 45 60 13.5 972190 13 27 46 57 13.1

Table 94

Percentage of hAPOL1 mRNA suppression in transgenic mouse liver compared to PBS control

Weekly dose 1.5 mg/kg 5 mg/kg 15 mg/kg 50 mg/kg EDso (mg/kg/week) GO connections % suppression of hAPOLl 793406 4 58 61 96 6.4 904763 17 42 72 93 5.4 905469 31 37 61 96 7.0 905505 15 45 78 95 5.7 905634 2 32 48 72 15.8 905665 3 43 79 91 5.4 972163 14 60 85 93 4.2 972190 18 48 83 92 5.1

Example 8: Confirmation of dose-dependent antisense inhibition for human lead compounds targeting APOL1 in A431 cells.

Gapmers selected from the studies described above were tested at various doses on A431 cells.

Study 1.

Cells were seeded at a density of 10,000 cells per well and transfected by free uptake with various concentrations of antisense oligonucleotides as indicated in the table below. After a treatment period of approximately 16 h, RNA was isolated from cells and APOL1 mRNA levels were measured by quantitative real-time PCR. The human primer and probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured using RIBOGREEN®. Results are presented as the percentage of APOL1 suppression relative to untreated control cells.

The concentration of half-maximal inhibition (IC ₅₀ ) for each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.

- 260 044295

Table 95 Multidose assay with cEt gapmers 3-10-3

% suppression Number 8 40 200 1000 5000 1C ₅₀ connections nM nM nM nM nM (µM) 905505 22 69 92 97 97 0.02 905373 13 55 92 98 98 0.03 905634 10 41 86 97 98 0.05 793406 6 15 53 84 93 0.19 905633 21 68 94 98 98 0.02 904763 AND 37 81 96 97 0.06

Study 2.

Cells were seeded at a density of 10,000 cells per well and transfected by free uptake with various concentrations of antisense oligonucleotides as indicated in the table below. After a treatment period of approximately 16 h, RNA was isolated from cells and APOL1 mRNA levels were measured by quantitative real-time PCR. The human primer and probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured using RIBOGREEN®. Results are presented as the percentage of APOL1 suppression relative to untreated control cells.

The concentration of half-maximal inhibition (IC ₅₀ ) for each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.

Table 96

Multi-dose assay to confirm lead compounds

Connection number Chemical characteristics % suppression 1C ₅₀ (µM) 8 nM 40 nM 200 nM 1000 nM 5000 nM 793406 kkk-10-kkk 4 AND 41 72 88 0.34 904763 kkk-10-kkk 6 23 63 93 98 0.12 905469 kkk-10-kkk 9 15 48 81 94 0.22 905505 kkk-10-kkk 0 35 81 95 98 0.07 905634 kkk-10-kkk 7 18 59 86 93 0.15 905665 kkk-10-kkk 7 AND 56 82 93 0.19 972163 kkk-9-kkke 2 36 85 95 95 0.06 972190 kkk-9-kkke 2 24 69 94 99 0.10

Example 9: Effect of ISIS antisense oligonucleotides targeting human APOL1 in cynomolgus monkeys.

Cynomolgus monkeys were treated with ISIS antisense oligonucleotides selected from the studies described in the examples above. The efficacy and tolerability of antisense oligonucleotides, as well as their pharmacokinetic profile in the liver and kidneys, were assessed. Cynomolgus macaques are reported to have the APOL1 pseudogene.

The human antisense oligonucleotides tested cross-react with the cynomolgus macaque genomic sequence (the sequence complementary to GENBANK accession no. NC_022281.1 truncated at nucleotides 15021761-15036414, designated herein as SEQ ID NO: 1949). The greater the complementarity between the human oligonucleotide and the cynomolgus sequence, the greater the likelihood that the human oligonucleotide may cross-react with the cynomolgus sequence. The start and stop sites for each oligonucleotide targeting SEQ ID NO: 1949 are presented in the table below. The start site indicates the nucleoside closest to the 5' end in the cynomolgus gene sequence targeted by the gapmer. 'Mismatches' indicate the number of nucleobases in the human oligonucleotide that do not match the entire length of the cynomolgus gene sequence.

Table 97

Antisense oligonucleotides complementary to the cynomolgus APOL1 genomic sequence (SEQ ID NO: 1949)________________

Connection ID Target starting site Mismatches Chemical characteristics SEQ ID NO 793406 9979 1 kkk-dlO-kkk 13 904763 8065 0 kkk-dlO-kkk 1095 905469 9836 2 kkk-dlO-kkk 1730 905505 9999 3 kkk-dlO-kkk 76 905634 10424 2 kkk-dlO-kkk 1326 905665 10821 3 kkk-dlO-kkk 81 972190 8066 0 kkk-d9-kkke 1164 972163 15761, 16086 2 kkk-d9-kkke 1925

Treatment.

Prior to the start of the study, the monkeys were kept in quarantine, during which time the general health of the animals was assessed daily. Each monkey was 2-4 years old and weighed 2-4 kg. Eight groups of 4 randomly assigned male cynomolgus monkeys each were administered 30 mg/kg of the modified oligonucleotide or PBS once a week for 12 weeks. One group of monkeys received a dose of saline once a week for 12 weeks. The saline-injected group served as a control group to which the oligonucleotide-treated groups were compared. Approximately 48 h after the last dose, monkeys were sacrificed and tissues were collected for analysis.

Tolerability assessment was based on clinical observations, body weight, food intake and clinical pathology. A complete autopsy was performed and any macroscopic abnormalities were recorded. The final autopsy was performed on day 85. Organ weight values were measured. In addition, blood, CSF, and tissue (at autopsy) were collected for toxicokinetic evaluation. The protocols described in this example were approved by the Institutional Animal Care and Use Committee (IACUC).

Lowering the target level.

RNA analysis.

RNA was extracted from the liver for real-time PCR analysis of cynoAPOL1 mRNA expression. RTS35787 (forward sequence: CTCCTGCTGAGTGACCATAAAG (SEQ ID NO. 1945), reverse sequence: GGACTTCTTCGAGCCAGTTT (SEQ ID NO. 1946), probe sequence: AGAGTGGTGGCTACTGCTGAACTG(SEQIDNO:1947)) was used to detect APOL1 of the cynomolgus monkey. Results are presented as percent change in mRNA levels compared to saline control normalized to monkey cyclophilin A. As shown in the table below, for some oligonucleotides, treatment with the modified oligonucleotides resulted in a decrease in cynomolgus APOL1 mRNA levels compared to the PBS control.

- 262 044295

Table 98

Suppression of APOL1 in cynomolgus monkey compared to PBS control

Connection ID Discrepancy with the cynomolgus macaque sequence % suppression 793406 1 40 904763 0 74 905469 2 0 905505 3 0 905634 2 91 905665 3 0 972163 2 0 972190 0 93

Tolerability studies.

Measurements of body weight and organs.

To evaluate the effect of ISIS oligonucleotides on the general health of the animals, body and organ weight values were measured. Body weight values were measured on day 84 and are presented in the table below. After euthanasia, organ weight values were measured and the data are also presented in the table below. The results indicate that the effect of antisense oligonucleotide treatment on body and organ weight values was within the expected range for antisense oligonucleotides. In particular, treatment with ISIS 972190 was well tolerated in terms of body weight and organ weight values of the monkeys.

Table 99

Body and organ weight values in cynomolgus monkeys after 12 weeks of treatment with a modified oligonucleotide

Body weight ( ^g ) Heart (g) Kidney (g) Spleen (g) Thymus (g) Liver with gall bladder (g) PBS 2473 9.7 12.6 2.3 3.5 50 793406 2419 9.1 I,9 3.5 3.0 53 904763 2511 9.5 14.3 2.9 4.0 56 905469 2395 9.3 16.0 3.5 2.5 59 905505 2550 9.4 12.9 4.7 4.5 65 905634 2488 9.8 14.7 3.6 3.2 61 905665 2462 9.8 14.2 3.9 4.1 56 972163 2606 10.8 14.8 3.3 4.2 68 972190 2666 and about 14.6 3.0 3.6 64

Liver function.

To evaluate the effect of ISIS oligonucleotides on liver function, blood samples were collected from all study groups. Blood samples were collected by femoral venipuncture 48 hours after dosing. The monkeys were fasted overnight before blood collection. Blood was collected into tubes containing the anticoagulant K2-EDTA, which were centrifuged to obtain blood plasma. The levels of various liver function markers were measured using a Toshiba 200FR NEO biochemical analyzer (Toshiba Co., Japan). Plasma ALT and AST levels were measured and the results expressed in IU/L are presented in the table below. Bilirubin levels, a marker of liver function, were measured in a similar manner and the results expressed in mg/dL are presented in the table below. The results indicate that the antisense oligonucleotides do not have an effect on liver function beyond the expected range for antisense oligonucleotides. In particular, in monkeys, treatment with ISIS 972190 was well tolerated from

-263 044295 view of liver function.

Table 100

Markers of liver function in blood plasma in cynomolgus monkeys

ALT (IU/l) AST (IU/l) Bilirubin (mg/dl) Albumin (g/dl) PBS 37 57 0.3 4.3 793406 59 55 o, s 4.3 904763 50 48 o, s 4.4 905469 54 68 0.2 3.9 905505 46 54 0.2 4.1 905634 566 417 0.5 4.1 905665 57 80 o, s 4.3 972163 58 81 0.2 4.1 972190 47 46 0.2 4.2

Kidney function.

To evaluate the effect of ISIS oligonucleotides on renal function, blood samples were collected from all study groups. Blood samples were collected by femoral venipuncture 48 hours after dosing. The monkeys were fasted overnight before blood collection. Blood was collected into tubes containing the anticoagulant K2-EDTA, which were centrifuged to obtain blood plasma. BUN and creatinine levels were measured using a Toshiba 200FRNEO chemistry analyzer (Toshiba Co., Japan). The results, expressed in mg/dL, are presented in the table below.

Also, before killing, urine analysis was performed using a COBAS U 411 analyzer, Combur 10 Test M urine test strips (Roche, Germany) and a Toshiba 120 FR automatic chemical analyzer (Toshiba Co., Japan). Urine was tested for potassium (U-K), microprotein (UTP), creatinine (UCRE), albumin (UALB), chloride (Ca), sodium (Na) and protein/creatinine ratio (P/C) was calculated. The results are presented in the tables below.

Plasma and urine biochemical data indicate that most ISIS oligonucleotides did not have any effect on renal function beyond the expected range for antisense oligonucleotides. In particular, in monkeys, treatment with ISIS 972190 was well tolerated in terms of renal function.

Table 101

Plasma BUN and creatinine levels (mg/dL) in cynomolgus monkeys

BUN Creatinine Physiological solution 25 0.7 793406 24 1.0 904763 25 0.7 905469 28 0.8 905505 27 0.9 905634 27 1.0 905665 24 0.8 972163 thirty 0.8 972190 20 0.8

- 264 044295

Table 102

Urine levels in cynomolgus monkeys

R/S (ratio) Creatinine (mg/dl) Albumin (mg/dl) Physiological solution 0.08 84 o, s 793406 0.14 71 1.7 904763 0.04 44 0.03 905469 0.10 52 0.2 905505 0.02 77 0.1 905634 0.06 106 0.5 905665 0.04 124 0.4 972163 0.01 69 0.2 972190 0.03 34 0.01

Hematology.

To assess whether the ISIS oligonucleotides had any effects on hematological parameters in cynomolgus monkeys, approximately 1.3 ml of blood was collected from each available study animal in tubes containing K2-EDTA. Samples were analyzed for red blood cell (RBC) count, white blood cell (WBC) count, individual white blood cell counts such as monocytes, neutrophils, lymphocytes, platelet count, hemoglobin and hematocrit using an ADVIA120 hematology analyzer (Bayer, USA). The data is presented in the tables below.

The data indicate that the oligonucleotides did not cause any changes in hematological parameters outside the expected range for antisense oligonucleotides at this dose. In particular, in monkeys, treatment with ISIS 972190 was well tolerated in terms of hematological parameters.

Table 103

Blood cell count in cynomolgus monkeys

RBC (x 10 ⁶ / µl) Platelets (x 10 ³ / µl) WBC (X 10 ³ /µl) Neutrophils (x 10 ³ / µl) Lymphocytes (x 10 ³ / µl) Monocytes (x 10 ³ / µl) Saline 5.9 380 8.7 2.5 5.8 0.2 793406 6.8 437 I,1 4.4 6.2 o, s 904763 6.1 412 10.6 5.2 5.0 0.2 905469 5.6 483 9.8 6.1 3.4 0.2 905505 5.8 400 13.2 5.5 7.0 0.4 905634 6.3 340 9.9 4.0 5.2 o, s 905665 6.0 440 8.3 2.8 5.0 0.2 972163 5.9 377 I.5 5.4 5.5 o, s 972190 6.0 392 10.5 4.5 5.6 o, s

- 265 044295

Table 104

Hematological parameters in cynomolgus monkeys

C-reactive protein and C3 activation.

To assess any inflammatory effect of ISIS oligonucleotides in cynomolgus monkeys, blood samples were collected for analysis. The monkeys were fasted overnight before blood collection. Approximately 1.5 ml of blood was collected from each animal into tubes without anticoagulant to separate the blood serum. The tubes were kept at room temperature for a minimum of 90 min and then centrifuged at 3000 rpm for 10 min at room temperature to obtain serum. C3 levels were measured to assess complement activation resulting from oligonucleotide treatment. The level of C-reactive protein (CRP), which is synthesized in the liver and serves as a marker of inflammation, was measured using a Toshiba 200FRNEO chemistry analyzer (Toshiba Co., Japan). The results indicate that treatment with ISIS 972190 did not cause any inflammation in the monkeys.

Table 105

Plasma levels of C-reactive protein (mg/L) in cynomolgus monkeys

CRP Physiological solution 1.7 793406 1.4 904763 2.4 905469 8.4 905505 4.1 905634 6.7 905665 10.7 972163 4.7 972190 9.5

Oligonucleotide concentration analysis.

Quantitative analysis of the concentration of each antisense oligonucleotide in different organs was carried out. Most oligonucleotides had an acceptable pharmacokinetic profile in the liver and kidney.

Table 106

Antisense oligonucleotide concentration (μg/g tissue)

No. ISIS Liver Bud 793406 349 1253

- 266 044295

904763 296 982 905469 288 2636 905505 547 1712 905634 516 2307 905665 392 942 972163 553 2054 972190 978 2654

Overall, the study results indicate that ISIS 972190 is the most effective and well-tolerated compound tested for APOL1 inhibition and is an important candidate for the treatment of APOL1-associated diseases.

Claims (8)

CLAIM 1. A compound according to the following formula (SEQ ID NO: 1164): its pharmaceutically acceptable salt. 2. A compound or a pharmaceutically acceptable salt thereof containing a modified oligo- -267044295 nucleotide, where the modified oligonucleotide is 16 linked nucleosides in length and has the nucleobase sequence consisting of SEQ ID NO: 1164, where the modified oligonucleotide contains: a gap segment consisting of nine linked deoxynucleosides; 5'-terminal flanking segment consisting of three linked nucleosides; And 3'-terminal flanking segment consisting of four linked nucleosides; wherein the gap segment is located between the 5'-terminal flanking segment and the 3'-terminal flanking segment; where the 5'-terminal flanking segment contains cEt-nucleosides; wherein the 3'-terminal flanking segment contains cEt-nucleoside, cEt-nucleoside, cEt-nucleoside and 2'-O-methoxyethylnucleoside in the 5'-3' direction; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine. 3. A compound according to claim 1 or 2, wherein the pharmaceutically acceptable salt is a sodium salt. 4. A compound according to claim 1 or 2, wherein the pharmaceutically acceptable salt is a potassium salt. 5. A pharmaceutical composition containing a compound according to claim 1 or 2 and a pharmaceutically acceptable carrier. 6. A method for suppressing the expression of APOL1 in a cell, comprising bringing the cell into contact with a compound according to claim 1 or 2, thereby suppressing the expression of APOL1 in the cell. 7. The method according to claim 6, where the cell is located in the kidney of the individual. 8. Use of a compound according to claim 1 or 2 for the treatment, prevention or reduction of the severity of manifestations of a disease associated with APOL1.