EA043573B1 - BIRDS WITH GENOME EDITED - Google Patents

Description

Field and background of the invention

This invention, in some embodiments, relates to genome-edited birds that lay eggs containing non-viable cockerel embryos.

Sex separation is important for all poultry species, but especially for broilers and virtually all egg-laying birds and turkeys. In the case of broilers and turkeys, segregation by sex allows for more appropriate care and feeding to suit the needs of both sexes, which is somewhat different from the uniform rearing practiced in most cases at the moment. In fact, all commercial hatcheries use sex-segregated flocks to raise hens that will become laying hens. The males at the hatchery are culled, while the females are obviously designated for egg production.

Currently, there are three ways to determine the sex of a bird. The sex of one-day-old chicks can be determined either by examining the cloaca or by looking at the plumage. Alternatively, cockerels and hens can be raised together until secondary sexual characteristics become apparent, at which point the chicks can be separated based on sex. Sex determination by cloacal examination is based on visual identification of sex based on the presence of sex-related anatomical structures. Determination of sex by plumage is based on plumage characteristics that differ between cockerels and hens, for example, the color characteristics of the down and/or the fast/slow growth rate of the flight feathers. The third method is based on the appearance of natural secondary sexual characteristics, for example, in males, combs and beards become larger than in females.

Determining the sex of one-day-old chicks by examining the cloaca is difficult and expensive. Highly qualified personnel are required to identify the sex of birds. Although sex determination by plumage is easier, it has the disadvantage of being limited to specific genetic crosses between birds. Sex determination based on secondary sexual characteristics is the simplest method, but has the disadvantage that birds of both sexes must be reared together during the first weeks after hatching, which due to feed costs and feed conversion considerations may be more expensive for the hatchery than costs of determining sex by examining the cloaca.

Most importantly, due to increased optimization of meat production on the one hand and egg production on the other, male breeds that are optimized for egg production are no longer suitable or economically attractive for meat production. Thus, in the US and Europe alone, more than 500 million bettas are killed each year by gassing, electrocution or grinding. This is not only an economic problem, but it is also increasingly becoming an ethical problem.

Clearly, there is a need in the commercial hatchery industry for a method that can sort birds while they are still in the egg and that does not rely on highly trained personnel.

Oishi et al., [Scientific Reports 6, Article number: 23980 (2016) doi:10.1038/srep23980] describe site-directed mutagenesis in chick primordial germ cells using the CRISPR/Cas9 system.

In Macdonald et al., [PNAS, 2012, p. 1466-1472] describe genetic modification and germline transmission of primordial germ cells using piggyBac and Tol2 transposons.

US Application No. 20060095980 describes the treatment of a number of endogenous primordial germ cells of a female bird to produce offspring that have a greater likelihood of becoming males than females.

Additional state-of-the-art work includes WO 2017094015.

Brief description of the invention

In accordance with an aspect of some embodiments of the present invention, there is provided a DNA editing agent comprising a first nucleic acid sequence for inducibly causing a lethal phenotype of male chick embryos in a bird egg and a second nucleic acid sequence for directing the first nucleic acid sequence to cause the lethal phenotype to occur on Z -chromosome of a bird cell.

In accordance with an aspect of some embodiments of the present invention, there is provided a cell population comprising avian cells that contain an exogenous polynucleotide that is stably integrated into the Z chromosome of the cells, wherein the exogenous polynucleotide is designed to provide a lethal phenotype in the male offspring of the avian.

In accordance with an aspect of some embodiments of the present invention, there is provided a chimeric bird produced in accordance with the method described in this invention.

In accordance with an aspect of some embodiments of the present invention, a transgenic bird is provided using a gamete from a chimeric bird described in the present invention.

In accordance with an aspect of some embodiments of the present invention, there is provided

- 1 043573 a method for reducing the number of cockerels hatched from fertilized poultry eggs, wherein the exogenous polynucleotide is stably integrated into the Z-chromosome of the bird, the exogenous polynucleotide is intended to inducibly provide a lethal phenotype in the male offspring of the said bird, wherein said method includes exposing the eggs to an inducer, which provides a lethal phenotype, thereby reducing the number of cockerels hatched from the bird's fertilized eggs.

In accordance with an aspect of some embodiments of the present invention, a chimeric bird is provided containing a population of cells described in the present invention.

In accordance with an aspect of some embodiments of the present invention, there is provided a method for producing a chimeric bird, comprising introducing a population of cells described in this invention into a recipient bird embryo under conditions sufficient to cause at least one of the primordial germ cells (PGCs) from populations of cells colonized the gonad of the recipient bird embryo, thus obtaining a chimeric bird.

In accordance with an aspect of some embodiments of the present invention, there is provided a DNA editing system comprising:

(i) a first agent comprising a first nucleic acid sequence for causing a lethal phenotype in a bird egg, operably linked to a recombinase recognition site, and a sequence for directing said first nucleic acid sequence to effect said lethal phenotype on the Z chromosome of the bird cell; and (ii) a second agent comprising a second nucleic acid sequence that encodes a recombinase enzyme and a sequence for directing said second nucleic acid sequence to the Z chromosome of the bird cell.

In accordance with an aspect of some embodiments of the present invention, there is provided a method for reducing the number of cockerels hatched from fertilized avian eggs, comprising:

mating of a female bird with a male bird, wherein a first exogenous polynucleotide that is operably linked to a recombinase recognition site is stably integrated into the Z chromosome of said male bird, wherein said exogenous polynucleotide is intended to provide a lethal phenotype in the bird's egg, and a second exogenous polynucleotide encoding a recombinase enzyme stably integrated into the Z chromosome of said female bird, or said first exogenous polynucleotide that is operably linked to a recombinase recognition site is stably integrated into the Z chromosome of said female bird, wherein said exogenous polynucleotide is intended to provide a lethal phenotype in the bird's egg, and a second exogenous polynucleotide encoding a recombinase enzyme is stably integrated into the Z chromosome of said male bird, thereby reducing the number of cockerels hatched from the bird's fertilized eggs.

In accordance with some embodiments of the invention, the provision is carried out in an inducible manner.

In accordance with some embodiments of the invention, the first nucleic acid sequence encodes a lethality protein and is operably linked to a nucleotide sequence encoding a switch that regulates expression of the lethality protein, the switch being regulated by an inducer.

In some embodiments, the lethality protein is selected from the group consisting of a toxin, a proapoptotic protein, a BMP antagonist, a Wnt signaling pathway inhibitor, and an FGF antagonist.

In accordance with some embodiments of the invention, the DNA editing agent is a single molecule.

In accordance with some embodiments of the invention, the first nucleic acid sequence and the second nucleic acid sequence are contained in non-identical molecules.

In accordance with some embodiments of the invention, the first nucleic acid sequence encodes an endonuclease enzyme that can perform genome editing, and is operably linked to a nucleotide sequence encoding a switch that regulates expression of the endonuclease protein, the switch being regulated by an inducer.

In accordance with some embodiments of the invention, the second nucleic acid sequence comprises:

(i) a left homology arm (LHA) nucleotide sequence that is substantially homologous to the 5' region flanking the target gene locus on the avian Z chromosome; and (ii) a right homology arm (RHH) nucleotide sequence that is substantially homologous to the 3' region flanking the target gene locus on the avian Z chromosome.

In accordance with some embodiments of the invention, the inductor is selected from the group consisting of temperature, ultrasound, electromagnetic energy, and chemical.

In accordance with some embodiments of the invention, the switch comprises

- 2 043573 a cleaved recombinase enzyme that combines to form an active enzyme in the presence of an inducer.

In accordance with some embodiments of the invention, the switch comprises an inducible promoter.

In accordance with some embodiments of the invention, the endonuclease enzyme is an RNA-guided DNA endonuclease enzyme.

In accordance with some embodiments of the invention, the DNA editing agent further comprises a nucleotide sequence that encodes a guide RNA that targets an essential bird gene, wherein the nucleotide sequence is operably linked to the nucleotide sequence encoding the switch.

In accordance with some embodiments of the invention, the essential gene is selected from the group consisting of BMPR1A, BMP2, BMP4, and FGFR1.

In accordance with some embodiments of the invention, the RNA-guided DNA endonuclease enzyme is selected from the group consisting of zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), effector nuclease), and caspase 9.

In accordance with some embodiments of the invention, the DNA editing agent further comprises a nucleotide sequence that encodes a reporter polypeptide.

In accordance with some embodiments of the invention, the inductor represents electromagnetic energy.

In accordance with some embodiments of the invention, electromagnetic energy is a component of visible light.

In accordance with some embodiments of the invention, the visible light component is blue light.

In accordance with some embodiments of the invention, the bird is selected from the group consisting of chicken, turkey, duck and quail.

In accordance with some embodiments of the invention, the cells include primordial germ cells (PGCs).

In accordance with some embodiments of the invention, the cells include gametes.

In accordance with some embodiments of the invention, the PTCs are selected from the group consisting of gonadal PTCs, blood PTCs, and germinal crescent PTCs.

In accordance with some embodiments of the invention, the method further includes incubating the chimera bird until it hatches after administration.

In accordance with some embodiments of the invention, the method further comprises raising the chimera bird to sexual maturity, wherein the chimera bird produces gametes derived from donor PGCs.

In accordance with some embodiments of the invention, administration is by injection in ovo (into the egg).

In accordance with some embodiments of the invention, the population of cells is derived from the same avian species as the recipient bird.

In accordance with some embodiments of the invention, the population of cells is obtained from a species of bird other than the recipient bird.

In some embodiments, the population of cells is administered when the recipient embryo is between approximately stage IX according to the Eyal-Giladi and Kohava staging system and approximately stage 30 according to the Hamburger and Hamilton staging system.

In some embodiments, the population of cells is administered when the recipient embryo is past stage 14 according to the Hamburger and Hamilton staging system.

In accordance with some embodiments of the invention, the first nucleic acid sequence encodes a lethal protein or endonuclease enzyme that can perform genome editing.

In accordance with some embodiments of the invention, the sequence for directing said first or said second nucleic acid sequence to the X chromosome comprises:

(i) a left homology arm (LHA) nucleotide sequence that is substantially homologous to the 5' region flanking the target gene locus on the avian Z chromosome; and (ii) a right homology arm (RHA) nucleotide sequence that is substantially homologous to the 3' region flanking the target gene locus on the avian Z chromosome.

Unless otherwise indicated, all technical and/or scientific terms used in this invention have the same meanings as commonly understood by those skilled in the art to which the invention pertains. Although methods and materials similar or equivalent to those described in this invention can be used in the practice or testing of embodiments of the invention, examples of methods and/or materials are described below. In the event of a conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

Brief description of graphic materials

Certain embodiments of the invention are described herein by way of example only with reference to the accompanying drawings. Now, by specific example of the detailed drawings, it is emphasized that the illustrated details are provided by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description together with the drawings will make it clear to those skilled in the art how the embodiments of the invention can be practiced.

On graphic materials:

fig. 1 is a drawing illustrating the generation of an optogenetic inducible chick line that will produce only female chicks. When crossing a wild-type (ZZ) rooster with a genetically modified hen (ZW), all female fertilized eggs will carry the wild-type ZW chromosomes, with the Z chromosome coming from the WT rooster. All male fertilized eggs will carry ZZ chromosomes, in which the red-labeled Z is derived from the chicken genome. This is the chromosome to be targeted. When fertilized eggs are illuminated with blue light, the optogenetic system on this chromosome will become active and activate a death mechanism that will result in early embryonic lethality shortly after egg laying. Females unaffected by blue light illumination will grow to maturity and lay infertile eggs for food.

In fig. Figure 2 illustrates a strategy for controlling gene expression using blue light illumination. Two fusion proteins are created: Cry2 with the N-terminus of Cre (Cry2-Cre-N-terminus) and CIBN fused to the C-terminus of Cre (CIBN-Cre-C-terminus). Without blue light illumination, Cre is inactive. When illuminated with blue light, CRY2 and CIBN form a heterodimer, and the two parts of Cre combine to form the active enzyme Cre ¹¹ .

In fig. Figure 3 illustrates the homology arms in chromosome Z. The genomic region downstream of the Hint1 locus is depicted (arrow). The 5' and 3' arms, PG-1 and PG-2, respectively, are indicated in the top diagram of the gene. Arm amplification primers are indicated by arrows. Between the homology arms in both DNA strands there are highly unique sequences specific and suitable for CRISPR-Cas9 (rectangles). The lower part of the figure illustrates in detail the region between the two homology arms.

The sequence shown in SEQ ID NO: 1 is illustrated.

In fig. 4A-C illustrate targeting vectors in accordance with embodiments of the present invention. The targeting vector contains 3 main elements. The first is the 5' and 3' homology arms (HRs) for homologous recombination (HR) flanking the entire inserted cassette, the second is the light-inducible system, in this case Cry2-CreN and CIBN-CreC, and the third is the lethality gene cassette. (A) Structure of the construction of a single targeting vector containing a 5' PG followed by the pGK promoter (rectangle as indicated), which drives the expression of the Cry2CreN and CIBN-CreC genes (rectangles as indicated), which are separated by the self-cleaving peptide P2A (rectangle as indicated) . This element is followed by a lethality gene cassette that contains the pGK promoter followed by the LoxP (circle as indicated) STOP (octagon as indicated) LoxP (LSL) sites followed by the lethality-inducing gene. This cassette is followed by a 3' PG (rectangle as indicated). Upon light induction, Cry2-CreN and CIBN-CreC dimerize to form the active form of Cre. The latter then excises the LSL element, which allows expression of the lethality-inducing gene, which leads to embryonic death among all embryos carrying this vector. (B) An alternative approach to A, instead of using the LSL element, is to use the Dio-lox flip strategy (triangles as indicated). Between the Dio-Lox sites, green fluorescent protein (GFP) is added, followed by polyadenylation site #1 (PA1, rectangle as indicated) and a lethal gene, followed by another polyadenylation site #2 (PA2) in reverse orientation. In this case, before activation by light, the pGK promoter drives the expression of ZPB. Upon activation by light, the cassette between the Dio-Lox sites flips and the lethal gene is now in the correct orientation for expression, while the ZPB is now in the reverse orientation and is no longer active. C) Alternative approach to A or B. After Cre activation, LSL is removed and Cas9 and ssRNA are expressed. This results in the introduction of a missense mutation into the coding region of an essential gene, thereby causing embryonic lethality.

In fig. 5A-F - obtaining and studying the characteristics of the slam-shut line. A, PZK culture; B, left, mRNA expression of various pluripotent and germ cell markers as indicated. Right, representative sex identification pattern of female PTCs (left, two PCR products of ribosomal S18 and W chromosome) and male PTCs (right, ribosomal S18 only). C, Antibody staining of the SSEA1 antigen. D, transfection of PGC with a plasmid encoding pCAGG-GFP using Lipofectamine 2000 reagent. E, transfection of PGC using electroporation with a plasmid encoding pCAGG-GFP. F, gonad (testis) of an embryo 10 days after transplantation of ZFB expressing cultured PGCs.

Fig. 6A-C. Design of ssRNA sites for CRISPR-mediated targeting. Representation of a genomic region on the Z chromosome to design optimal CRISPR targeting sites. The first 12 ssRNA sequences (guides #1-12) are presented, from which guides #1 and 3 were selected, which partially overlap, in opposite orientations. Potential off-target sequences of guide #1 are presented. In the table below. 1 shows the sequences of the guide RNAs shown in FIG. 6B.

Table 1

Guide SEQ IDNO: Subsequence 1 66 GCCAAATAAGGCACGTTATC 2 67 AATGTGGAAACGGCCAAAATA 3 68 ACCAGATAACGTGCCCTTATT 4 69 ACATGACAGCACGATTTTTGT 5 70 CTGGTATGAACCAATCAGAG 6 71 TGGTATGAACCAATCAGAGT 7 72 GACCTTGATGCAGAGAAAAC 8 73 CTCCTGTTTTCTCTGCATCA 9 74 GCAGAGAAAACAGGAGAAGA 10 75 AGAAGGATGAGAAAAGAATG AND 76 CTGTCATGTCCCACTCTGAT 12 77 ATGAGAAAAGAATGTGGAAA

the best search results for potential off-target sequences for guide #1, illustrated in FIG. 6C, of 15 the sequences of which are summarized in table. 2.

table 2

SEQ Ш NO: Subsequence 78 CCAACAGAAGGCACGTTATCCAG 79 TCAAAATAAAGTACGTTATCTAG 80 GGCATATAAAGCACGTTATACAG 81 GCATAATAATGTACGTTATCTGG 82 ACTAAATCAGGCACGTGATCTGG 83 GCTAAATTAAAGCTCGTTATCGGG 84 GTCAAAATGAGGCATGTTATCAGG 85 TTCAAATAAGCCACGTTATTCAG 86 GTCAAACAAGGCATGTTATCAGG 87 CCCTAATAAAGCACGTTTTCAGG

Fig. 7A-C. Confirmation of CRISPR activity using endonuclease assay. A. Positive control endonuclease assay using annealed 320 bp. WT PCR product and mutated product at the predicted CRISPR1 cleavage site in the indicated ratios. B. Endonuclease assay for 12 colonies transfected with the CRISPR1 plasmid. C. Endonuclease assay for 12 colonies transfected with the CRISPR3 plasmid. It should be noted that the distance between the two predicted cleavage sites of CRISPR1 and CRISPR3 is 12 bp.

Fig. 8A-D. Confirmation of CRISPR activity using DNA sequencing. A. DNA chromatogram of the WT genomic region at the predicted CRISPR1 cleavage site showing normal sequence as a negative control. B. Sequence of a mixture of DT and artificially mutated PNR products, showing the appearance of double peaks (arrow) after the predicted cleavage site, as a positive control. C. Sequencing of a negative colony demonstrating normal sequence. D. Sequence of a positive colony showing the appearance of double peaks after the CRISPR1 cleavage site (arrow). The sequence shown is AGATAACGT (SEQ ID NO: 65).

Fig. 9A-F. Construction of a targeting vector for genomic integration into the Z chromosome. And genomic DNA was used as a template for the PNR reaction with primers P1 and P2. This region contains a 5' PG and a 3' PG flanking the region containing the CRISPR site. B - ~3 kb product located downstream of the HINTZ locus was ligated into the shuttle vector pJet1.2. This plasmid was used as a template for PNR with primers P3 and P4. These primers have extension sequences (indicated by curly brackets) that correspond to equivalent regions in the pCAGG-Neo-IRES-GFP fragment (D). C is the linearized product, a vector containing two arms of homology, excluding the region containing the CRISPR site flanked by sequences that bind the ends of the pCAGG-Neo-IRES-GFP cassette during the Gibson reaction. D - plasmid pCAGG-Neo-5 043573

IRES-GFP was used as a template for the PCR reaction with primers P5 and P6. These primers contain extension sequences (indicated by curly braces) that correspond to equivalent regions at the edges of the homology arms. E is a linearized insertion cassette flanked by sequences that link the ends of the homology arms. The vector and insert were docked together to create the final targeting vector plasmid using the Gibson assembly reaction ¹⁰ . F is the targeting vector.

Fig. 10A-D. Cotransfection of targeting vector and CRISPR plasmids into PGCs. A. Lipofection-mediated cotransfection of CRISPR1 into PGC and GR targeting vector plasmids. B. Two weeks after selection with G-418, >99% of resistant PTCs were ZFB positive. C. Ten days after injection of targeted PGCs into the host embryo, numerous cells were found to be localized in the gonads (testes). D. Gonads were excised and both immunostained with anti-ZPB antibody and scanned with a confocal microscope (anti-ZPB green stained and 4',6-diamidino-2-phenylindole (DAPI) blue counterstained to nuclei).

Fig. 11A-D. PCR verification of GR integration in PGCs sorted by FACS. A. FACS sorting of PZKs resistant to G-418. The FACS score was developed to sort single (single) GFB-positive cells that were sorted as a pool or single cells in a 96-well plate. B. For PCR analysis, two sets of primers were designed for the 5' integration site (P7 and P8) and the 3' integration site (P9 and P10). C. Genomic DNA isolated from pooled cells was used as a template for PCR, and WT DNA served as a negative control. Predicted bands at 1.6 and 1.8 kb. were visible for correct GR integration in the 5′ and 3′ regions, respectively. D. Genomic DNA isolated from colonies of male and female cells obtained from PGCs sorted by FACS single cell sorting was used as a template for PNR, and WT DNA served as a negative control. Predicted bands at 1.6 and 1.8 kb. were visible for correct GR integration in the 5′ and 3′ regions, respectively.

Fig. 12A-D. Southern blot analysis of GR integration. A - schematic representation of the expected BglII cleavage products in Southern blot analysis for the DT allele and the allele that underwent GR integration. Probes used for 5', 3' and neo integration sites are indicated by yellow squares. The expected product size after BglII digestion for each DNA probe is described. B - obtaining dig-labeled probes using the PPR method. dig-labeled probes (+) or unlabeled probes (-) were analyzed on an agarose gel. It should be noted that dig-tagged products are shifted higher than their actual size, confirming the integration of dig-tagged nucleotides. Primer sets used for probe amplification are indicated. C - Southern blot analysis with 5' and 3' probes for DNA extracted from pooled and purified colonies obtained from male PGCs. WT DNA extracted from the parent line before GR served as a negative control. D - Southern blot analysis with 5' and Neo probes for female PTCs. In both cases, a single band at 7.5 kb is visible, indicating that correct GR has occurred and only one copy of the targeting vector has been integrated.

Fig. 13. Confirmation of the optogenetic system in HEK293 cells in vitro.

Triple transfection with plasmids pmCherry-Cry2-CreN, pmCherry-CIBN-CreC and PB-RAGE-GFP. Twenty-four hours after transfection, cells in the experimental group were illuminated with blue light for 15 s, while control cells were kept in the dark (top row). After illumination (bottom row), the cells were incubated for an additional 24 hours. In these cells, expression of ZPB was evident, confirming the activation of the Cre enzyme after illumination with blue light.

Fig. 14. Confirmation of the in ovo optogenetic system in chick embryos that were incubated for 5460 h before electroporation. Triple electroporation of plasmids pmCherry-Cry2-CreN, pmCherry-CIBN-CreC and pB-RAGE-GFP into chick embryos. Twelve hours after electroporation, experimental group embryos were illuminated with blue light in ovo for 15 s, while control embryos were kept in the dark (top row). After illumination (bottom row), embryos from both groups were incubated for an additional 12 h. After incubation, cells expressing ZPB were clearly visible in the illuminated group, confirming the activation of the optogenetic system and the Cre enzyme after illumination with blue light in chick embryos in ovo.

Fig. 15A-F. Construction of a single optogen expression vector under the control of the CAGG promoter. The optogen plasmids pmCherry-CIBN-CreC and pmCherry-Cry2-CreN were used as a template to amplify the optogen fusion proteins using primers P40-P41 and P42P43, respectively (15A). The two products have overlapping sequences at the P2A site, which was introduced into primers P41 and P42. This allowed one round of knob extension PCR to combine two fragments (15B) and one that was ligated into the pJet1.2 shuttle vector (15C). Using primers P44 and P45, which contain SmaI and NheI restriction site tails, respectively, the product illustrated in 15D was obtained. This product was digested using the appropriate restriction enzymes and ligated into pCAGG-IRES-GFP (15E), which was digested with the same enzymes (15F).

Fig. 16. Confirmation of the activity of the pCAGG-Optogene plasmid in HEK293 cells. Cotransfection with pCAGG-Optogene and pB-RAGE-mCherry plasmids. Twenty-four hours after transfection, then

- 6 043573 while the negative control group was kept in the dark (top row), the cells of the experimental group were illuminated with blue light for 15 s (bottom row). After illumination (bottom row), the cells were incubated for an additional 24 hours. mCherry expression was observed in these cells (white arrows), confirming activation of the Cre enzyme by the pCAGG-Optogene plasmid after illumination with blue light.

Fig. 17. Confirmation of the single-vector strategy using the pCAGG-Optogenes plasmid in ovo. Chick embryos at stage 14-16 H&H were co-electroporated with plasmids pCAGGOptogenes and pB-RAGE-mCherry. The latter plasmid serves as a reporter gene for the activity of the optogenic system. Twelve hours after electroporation, experimental group embryos (bottom row) were illuminated with blue light in ovo for 15 s, while control embryos were kept in the dark (top row). The embryos were further incubated for 12 hours. After incubation, ZPB-expressing cells were clearly visible in both groups, indicating successful electroporation, however, only in the illuminated group were mCherry-expressing cells visible, which confirms the activation of the optogenetic system and the Cre enzyme after blue illumination light in chick embryos in ovo.

Fig. 18. Expression of DTA under the control of the pGK promoter inhibits protein synthesis in ovo. Embryos at stage 14–16 H&H were electroporated with the expression vector pGK-IRES-GFP (top row) or pGK-DTA-IRES-GFP (bottom row). Negative control embryos widely express ZPB (top row, arrow), indicating normal protein synthesis. DTA-expressing cells do not show ZPB expression (bottom row), indicating that protein synthesis is inhibited in these embryos. Images of only the FB, only the bright field, and an overlay of the FB on the bright field are presented.

Fig. 19A-B illustrate targeting vectors in accordance with additional embodiments of the present invention. In these vectors, the activating enzyme (eg, Cre) is separated from the lethal gene cassette. In fig. 19A, the activating enzyme is inserted into the genome of the maternal hen, and the inactive lethality cassette is inserted into the Z chromosome of the rooster, which is homozygous for this allele. In this case, activation of lethality in male embryos is achieved by crossing two transgenic parents without the need for light induction. Cre in all males removes the LSL on the maternal Z chromosome, thus allowing expression of the lethality gene, whereas the female embryo contains an inactive lethality cassette, thus remaining unaffected. Alternatively, a Dio-Lox flip cassette containing the FLP recombinase in the right orientation followed by the reverse lethality gene driven by the CAGG promoter is targeted to the Z chromosome of the maternal chicken (FIG. 19B). The rooster is again homozygous for the Z chromosome, which is targeted by the CAGG-Cre cassette flanked by FRT sites. When these two birds are crossed, the male embryos will express Cre located on the paternal Z chromosome, the Dio-Lox cassette will flip over, and the lethal gene will become active, resulting in embryonic lethality of the male embryo. The zygote of the female embryo from this cross contains the maternal FLP recombinase enzyme, which was produced during oogenesis. This maternal protein removes the CAGG-Cre cassette from the Z chromosome, leaving the female embryo alive with only an FRT scar on the Z chromosome.

Description of Specific Embodiments of the Invention

This invention, in some embodiments, relates to genome-edited birds that lay eggs containing non-viable cockerel embryos.

Before at least one embodiment of the invention is explained in detail, it should be understood that the invention is not necessarily limited in its application to the details set forth in the following description or illustrated in the examples. The invention allows for other embodiments of its practical implementation or implementation in various ways.

Sex separation is an important aspect for all poultry species, but especially for broilers and virtually all egg-laying birds and turkeys. In the case of broilers and turkeys, segregation by sex allows for more appropriate care and feeding to suit the needs of both sexes, which is somewhat different from the uniform rearing practiced in most cases at the moment. Almost all commercial hatcheries use sex-based breeding to raise hens that will become laying hens. The males at the hatchery are culled, while the females are obviously designated for egg production.

The authors of this invention have come up with a way to get rid of the need for mass slaughter of billions of cockerels around the world. Specifically, the inventors have developed a method for creating a breed of chicken in which mothers from the breeding flock will lay fertilized eggs that will only hatch into hens, while male embryos will stop developing shortly after fertilization. This will eliminate the need to kill males and save 50% of valuable incubation space. It is important to note that both the laying eggs and the infertile eggs that are the final product for the consumer will be identical in all aspects

- 7 043573 laying hens and food eggs currently produced in this industry (i.e. not genetically modified).

Although the present invention is limited to practical implementation, the present inventors developed a targeting vector containing PG flanking Neo and ZFB genes under the control of the CAGG promoter, and showed that it undergoes correct GR to the Z chromosome, which was confirmed by PCR (Fig. 11A-D) and Southern blot analysis (Fig. 12A-D). In addition, it was found that the single-vector optogen system strategy that was constructed in the pCAGGOptogene vector was active both in vitro and in ovo in living chick embryos (Fig. 14). Finally, expression of DTA in chick embryos resulted in inhibition of protein synthesis (Fig. 18).

Thus, according to a first aspect of the present invention, there is provided a DNA editing agent comprising a first nucleic acid sequence for inducibly causing a lethal phenotype in betta embryos in a bird egg and a second nucleic acid sequence for directing the first nucleic acid sequence to cause the lethal phenotype to occur in Z -chromosome of a bird cell.

As used herein, the terms bird and bird species refer to any species of birds, including, but not limited to, chickens, turkeys, ducks, geese, quail, pheasants and ostriches.

In the context of this invention, the term egg refers to a avian egg that contains a living avian embryo. Thus, the term egg is intended to refer to a fertilized avian egg, and in one embodiment, the egg containing the avian embryo is capable of normal embryogenesis.

The DNA editing agent (contained in a single nucleic acid construct or a combination of nucleic acid constructs) contains targeting sequences that ensure stable integration of the first nucleic acid sequence into the Z chromosome of the avian cell. The DNA editing agent can be constructed using recombinant DNA technology well known to those skilled in the art.

The targeting sequences are selected so that the first nucleic acid sequence is specifically integrated into the Z chromosome, but not into any other chromosome of the cell. In addition, the targeting sequence is selected depending on which method is used to integrate the first nucleic acid sequence into the chromosome. Methods for integrating nucleic acid sequences into chromosomes are well known in the art [see, for example, Menke D. Genesis (2013) 51: - 618; Capecchi Science (1989) 244:1288-1292; Santiago et al., Proc Natl Acad Sci USA (2008) 105:5809–5814; international patent applications No. WO 2014085593, WO 2009071334 and WO 2011146121; US Patent Nos. 8771945, 8586526, 6774279 and UP Patent Application Publications Nos. 20030232410, 20050026157, US 20060014264; the contents of which are incorporated herein by reference in their entirety] and include directed homologous recombination, the use of site-specific recombinases, and genome editing using engineered nucleases. The use of PB transposases is also envisaged. Agents for introducing nucleotide changes into a gene of interest can be developed from publicly available sources or obtained commercially from Transposagen, Addgene and Sangamo Biosciences.

In one embodiment, the production of a DNA editing agent is based on spontaneous homologous recombination to insert a first nucleic acid sequence into the Z chromosome of a cell. In this embodiment, the DNA editing agent contains homology arms that serve as targeting sequences.

The DNA editing agent may be flanked by two arms that are homologous or have homology or identity of about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85. 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% with at least one nucleic acid sequence contained in the target loci on the Z chromosome that serves integration site to facilitate specific integration through NGR.

The homology arms correspond to the genomic sequence that is present on the Z chromosome. Preferably, the genomic sequence is located downstream of a gene that is transcriptionally active (eg, downstream of the Hint1 gene). Homology arms are typically at least 500 nucleotides in length, for example 500-3000 nucleotides. Typically, the required size of homology arms depends on the length of the cassettes that are flanked by these arms. Smaller cassettes require shorter arms and vice versa. Homologous recombination can occur spontaneously. Another intended target is Isl1 (gene ID 369383), also on the Z chromosome, which is expressed starting from the early stages of embryogenesis.

The following is a description of various additional exemplary methods that can be used by a DNA editing agent to integrate a first nucleic acid sequence into the Z chromosome in accordance with specific embodiments of the present invention, and a description of the targeting sequences that are necessary to accomplish this purpose.

Genome editing using engineered endonucleases - this approach refers to a reverse genetics technique that uses artificially engineered nucleases to

- 8 043573 cut and create specific double-strand breaks at the desired location(s) in the genome (i.e. on the Z chromosome), which are then repaired by cellular endogenous processes such as homology-directed repair (HDR) and non-homologous joining of ends (NGJK). NGSC directly joins the ends of DNA at a double-strand break, whereas GSR uses the homologous sequence as a template to regenerate the missing DNA sequence at the break point. To make specific nucleotide modifications to genomic DNA, a DNA repair template containing the required sequence must be present during NGR. Genome editing cannot be performed using traditional restriction endonucleases because most restriction enzymes recognize multiple base pairs in DNA as their target, and there is a very high probability that the recognized base pair combination will be found in many locations throughout the genome, resulting in multiple cuts not limited to the required location. To date, several distinct classes of nucleases have been discovered and developed to overcome this problem and create site-specific single- and double-strand breaks. These include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR/Cas system.

Meganucleases - Meganucleases are generally divided into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by structural motifs that influence catalytic activity and recognition sequence. For example, members of the LAGLIDADG family are characterized by having one or two copies of the conserved LAGLIDADG motif. The four families of meganucleases differ significantly from each other with respect to conserved structural elements and hence sequence specificity for DNA recognition and catalytic activity. Meganucleases are commonly found in microbial species and have the unique property of having very long recognition sequences (>14 bp), making them naturally very specific to cut at the desired location. This can be used to create site-specific double-strand breaks in genome editing. One skilled in the art can use these naturally occurring meganucleases, however, the number of such naturally occurring meganucleases is limited. To overcome this problem, mutagenesis and high-throughput screening techniques have been used to generate meganuclease variants that recognize unique sequences. For example, different meganucleases have been fused to create hybrid enzymes that recognize the new sequence. Alternatively, DNA amino acid-interacting meganucleases can be modified to construct sequence-specific meganucleases (see, for example, US Pat. No. 8,021,867). Meganucleases can be constructed using methods described, for example, in Certo, MT et al., Nature Methods (2012) 9:073-975; US patents No. 8304222; 8021867; 8119381; 8124369; 8129134; 8133697; 8143015; 8143016; 8148098; or 8163514, the contents of which are incorporated by reference in their entirety. Alternatively, meganucleases with site-specific cutting characteristics can be produced using commercially available technologies, such as Precision Biosciences Directed Nuclease Editor™ genome editing technology.

ZFN and TALEN are two distinct classes of engineered nucleases, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), both found to be effective in creating targeted double-strand breaks (Christian et al., 2010; Kim et al., 1996 ; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).

Essentially, ZFN and TALEN restriction endonuclease technology uses a nonspecific DNA-cutting enzyme that is associated with a specific DNA-binding domain (or a series of zinc finger domains or TALE repeats, respectively). Typically, a restriction enzyme is selected whose DNA recognition site and cleavage site are separated from each other. The cleavage portion is separated and then coupled to a DNA-binding domain, resulting in an endonuclease with very high specificity for the desired sequence. An example of a restriction enzyme with such properties is Fokl. Additionally, an advantage of Fokl is that dimerization is required to have nuclease activity, meaning that specificity increases dramatically as each nuclease partner recognizes a unique DNA sequence. To enhance this effect, Fokl nucleases were designed, which can function only as heterodimers and have increased catalytic activity. Functional heterodimeric nucleases eliminate the possibility of unwanted homodimeric activity and thus increase the specificity of double-strand breaks.

Thus, for example, to target a specific site, ZFN and TALEN are designed as pairs of nucleases, with each member of the pair designed to bind adjacent sequences at the target site. After transient expression in cells, nucleases bind to their target sites and the Fokl domains heterodimerize, creating a double-strand break. Repair of these double-strand breaks through the nonhomologous end joining (NEA) pathway most often results in indels, which are small deletions or small insertions at

- 9 043573 sequences. Since each repair performed by NGSC is unique, the use of a single pair of nucleases can result in an allelic series with a range of different deletions at the target site. Typically, deletions range from a few base pairs to several hundred base pairs in length, but larger deletions have been successfully created in cell culture using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010). In addition, when a DNA fragment with homology to the target region is introduced in combination with a pair of nucleases, the double-strand break can be repaired by homology-directed repair creating specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al. , 2005).

Although the nuclease portions of both ZFN and TALEN have similar properties, the difference between these engineered nucleases lies in their DNA recognition peptide. ZFN is based on Cys2-His2 zinc fingers, and TALEN is based on TALE. Both of these DNA recognition peptide domains are characterized by the fact that they occur naturally in combinations in their proteins. Cys2-His2 zinc fingers typically occur in repeats that are 3 bp apart. and are found in various combinations in a number of proteins that interact with nucleic acids. On the other hand, TALEs occur in repeats with a one-to-one recognition ratio between amino acids and nucleotide pairs recognized. Because both zinc fingers and TALEs occur in repeatable patterns, different combinations can be tried to create a wide range of sequence specificities. Approaches for creating site-specific zinc finger endonucleases include, but are not limited to, modular assembly (where triplet sequence-correlated zinc fingers are arrayed to cover the required sequence), OPEN (low-stringency selection of peptide domains against triplet nucleotides followed by high-stringency selection of peptide combinations against the final target in bacterial systems) and bacterial one-hybrid screening of zinc finger libraries. ZFNs can also be designed and obtained commercially, such as from Sangamo Biosciences™ (Richmond, CA).

The method for designing and preparing TALENs is described, for example, in Reyon et al., Nature Biotechnology 2012 May;30(5):460-5; Miller et al., Nat Biotechnol. (2011) 29: 143-148; Cermak et al., Nucleic Acids Research (2011) 39 (12): e82 and Zhang et al., Nature Biotechnology (2011) 29 (2): 149-53. A recently developed web-based program called Mojo Hand was introduced by the Mayo Clinic to design TAL and TALEN designs for genome editing applications (accessible at www(dot)talendesign(dot)org). Talene can also be engineered and obtained commercially, such as from Sangamo Biosciences™ (Richmond, CA).

CRISPR-Cas System - Many bacteria and archaea have endogenous RNA-based adaptive immune systems that can destroy the nucleic acids of invading phages and plasmids. These systems consist of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) genes that produce RNA components, and CRISPR-associated (Cas) genes that encode protein components. CRISPR RNAs (crRNAs) contain short regions of homology to specific viruses and plasmids and act as guides, directing Cas nucleases to degrade complementary nucleic acids of the corresponding pathogen. Studies of the type II CRISPR/Cas system from Streptococcus pyogenes have shown that three components form an RNA/protein complex and together are sufficient for sequence-specific nuclease activity: the Cas9 nuclease, an sgRNA containing 20 base pairs of homology to the target sequence, and a transactivating sgRNA ( tracrRNA) (Jinek et al., Science (2012) 337: 816-821.). Additionally, it has been demonstrated that a synthetic chimeric guide RNA (cRNA) consisting of a fusion between sgRNA and tracrRNA can direct Cas9 to cleave target DNAs that are complementary to sgRNA in vitro. It has also been demonstrated that transient expression of Cas9 in combination with synthetic nRNAs can be used to produce targeted double-strand breaks in a number of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al. , 2013a,b; Jinek et al., 2013; Mali et al., 2013).

The CRIPSR/Cas genome editing system contains two distinct components: an nRNA and an endonuclease, such as Cas9. The nRNA is typically a 20-nucleotide sequence encoding a combination of a target homologous sequence (sgRNA) and endogenous bacterial RNA that links the sgRNA to a Cas9 nuclease (tracrRNA) in a single chimeric transcript. The HPHK/Cas9 complex interacts with the target sequence through base pairing between the nRNA sequence and the complementary genomic DNA. For successful Cas9 binding, the genomic target sequence must also contain the correct Protospacer Adjacent Motif sequence immediately following the target sequence. Binding of the HPHK/Cas9 complex localizes Cas9 to the genomic target sequence so that Cas9 can cut both strands of DNA, resulting in a double-strand break. As with ZFN and TALEN, double-strand breaks generated by CRISPR/Cas can undergo homologous recombination or HSCR.

Cas9 nuclease has two functional domains: RuvC and HNH, each of which cuts a single DNA strand. When both of these domains are active, Cas9 creates double-strand breaks in the genome

DNA.

A significant advantage of CRISPR/Cas is that the high efficiency of this system, combined with the ability to easily create synthetic nRNAs, allows for the possibility of simultaneously targeting a number of genes. In addition, most cells carrying the mutation contain biallelic mutations in the target genes.

However, the apparent flexibility in the base-pairing interactions between the nRNA sequence and the target genomic DNA sequence allows for inexact matches to the target sequence to be excised by Cas9.

Modified versions of the Cas9 enzyme containing one inactive catalytic domain, RuvC- or HNH-, are called nickases. With only one active nuclease domain, Cas9 nickase cuts only one strand of the target DNA, creating a single-strand break or nick. A single-strand break or nick is usually quickly repaired by the NHR pathway using the intact complementary DNA strand as a template. In this case, two proximal nicks located on opposite strands introduced by Cas9 nickase are considered as a double-strand break, which is often called a double-nick CRISPR system. The double nick can be restored using NGSC or NGR depending on the desired effect on the gene target. Thus, if specificity and reduction of off-target effects are critical, using Cas9 nickase to create a dual nick by designing two nRNAs with target sequences in close proximity and on opposite strands of genomic DNA will reduce off-target effect, since either nRNA by itself will result in nicks that will not change genomic DNA.

Modified versions of the Cas9 enzyme containing two inactive catalytic domains (dead Cas9 or dCas9) do not have nuclease activity, but are still able to bind DNA based on nRNA specificity. dCas9 can be used as a platform for DNA transcriptional regulators to activate or repress gene expression by fusing the inactive enzyme to known regulatory domains. For example, the binding of a single dCas9 to a target sequence in genomic DNA can influence gene transcription.

There are a number of publicly available tools that help select and/or design target sequences, as well as lists of bioinformatically defined unique gRNAs for different genes in different species, such as the CRISPR design tool from Feng Zhang lab's, Target Finder (E-CRISP) from Michael Boutros lab's, RGEN tools: Cas-OFFinder, CasFinder: a flexible algorithm for identifying specific Cas9 targets in genomes and CRISPR Optimal Target Finder.

To use the CRISPR system, both gRNA and Cas9 must be expressed in the target cell. The insertion vector may contain both cassettes in a single plasmid, or the cassettes may be expressed from two separate plasmids. CRISPR plasmids are publicly available, such as the px330 plasmid from Addgene. In addition, mRNA encoding Cas9 and nRNA can be introduced into target cells, as well as recombinant Cas9 protein in complex with nRNA (i.e., an RNP complex can be introduced into the cell).

Genome Editing Using a Recombinant Adeno-Associated Virus (rAAV) Platform - This genome editing platform is based on rAAV vectors that allow the insertion, deletion, or replacement of DNA sequences in the genomes of living mammalian cells. The rAAV genome is a single-stranded deoxyribonucleic acid (ssDNA) molecule, sense or antisense, approximately 4.7 kb in length. These single-stranded viral DNA vectors have a high transduction rate and have the unique property of promoting endogenous homologous recombination in the absence of double-stranded DNA breaks in the genome. One skilled in the art can construct a rAAV vector to target the desired genomic locus and make gross and/or precise changes to endogenous genes in the cell. The advantage of rAAV genome editing is that it targets a single allele and does not result in any off-target genomic changes. rAAV-based genome editing technology is commercially available, such as the GENESIS™ rAAV-based system from Horizon™ (Cambridge, UK).

Methods for determining efficiency and detecting sequence changes are well known in the art and include, but are not limited to, DNA sequencing, electrophoresis, enzyme mismatch detection assays, and hybridization assays such as PLR, RTPCR, RNase protection, in situ hybridization, primer extension , Southern blot, Northern blot and dot blot analysis.

Sequence changes in a particular gene can also be determined at the protein level using, for example, chromatography, electrophoretic methods, immunodetection assays such as ELISA, and Western blot analysis and immunohistochemistry.

The DNA editing agent may encode a reporter protein that can be readily detected by its presence or activity, including, but not limited to, luciferase, fluorescent protein (eg, green fluorescent protein), chloramphenicol acetyltransferase, betagalactosidase, secreted placental alkaline phosphatase, beta -lactamase, human growth hormone and other secreted enzyme reporters. In general, a reporter gene encodes a polypeptide that is not otherwise produced by the host cell and that can be detected by cell(s) assay, such as direct fluorometric, radioisotope, or spectrophotometric assay of the cell(s), and typically without the need to kill cells to analyze the signal. In some cases, the reporter gene encodes an enzyme that causes a change in the fluorometric properties of the host cell, which can be detected by qualitative, quantitative or semi-quantitative function or transcriptional activation. Exemplary enzymes include esterases, β-lactamase, phosphatases, peroxidases, proteases (tissue plasminogen activator or urokinase) and other enzymes whose functions can be detected using appropriate chromogenic or fluorogenic substrates that are known to those skilled in the art or will be developed in the future.

In addition, one skilled in the art can easily design a DNA editing agent that contains positive and/or negative selection markers to effectively select transformed cells that have undergone a homologous recombination event with the construct. Positive selection provides a means to enrich the population of clones that have taken up foreign DNA. Non-limiting examples of such positive markers include glutamine synthetase, dihydrofolate reductase (DHFR), markers that confer antibiotic resistance such as neomycin, hygromycin, puromycin and blasticidin S resistance cassettes. Negative selection markers are required to select against random integrations and/or exclusion of a marker sequence (eg, a positive marker). Non-limiting examples of such negative markers include herpes simplex virus thymidine kinase (HSV-TK), which converts ganciclovir (GCV) to the cytotoxic nucleoside analog hypoxanthine phosphoribosyltransferase (HPRT), diphtheria toxin (DT), and adenine phosphoribosyltransferase (ARPT).

To facilitate homologous recombination, a chemical NGSC inhibitor such as SCR7 pyrazine can be used to enhance the efficiency of GR mediated by CRISPR genome editing. As stated above, the DNA editing agent of this aspect of the invention comprises a first nucleic acid sequence for inducibly producing a lethal phenotype in male birds hatched from a bird's egg.

Preferably, male embryos do not survive in the egg beyond the early stages of blastulation, known as EG&K stages X-XIII (Eyal-Giladi and Kochav, 1976). In one embodiment, the first nucleic acid sequence may encode a lethality protein that is operably linked to a nucleotide sequence encoding a switch that regulates expression of the lethality protein, the switch being regulated by an inducer.

In the context of this invention, the term lethal protein refers to a protein that is lethal to a bird embryo (eg, a male embryo), thereby preventing the betta from hatching live from the egg. Examples of lethality proteins include, but are not limited to, toxin, cytotoxic protein, proapoptotic protein, BMP antagonist, Wnt signaling inhibitor, and FGF antagonist.

Exemplary toxins contemplated by this invention include, but are not limited to, Pseudomonas exotoxin (GenBank Accession No. ABU63124), diphtheria toxin (GenBank Accession No. AAV70486), and ricin toxin (GenBank Accession No. EEF27734).

Typical cytotoxic proteins include, but are not limited to, interleukin-2 (GenBank accession no. CAA00227), CD3 (GenBank accession no. P07766), CD16 (GenBank accession no. NP_000560.5), interleukin-4 (GenBank accession no. NP_000580 .1) and interleukin-10 (GenBank accession no. P22301).

Exemplary pro-apoptotic proteins contemplated by this invention include, but are not limited to, Drosophila Reaper & Grim, which is known to induce apoptosis also in mammalian cells [McCarthy, J.V. & Dixit, V.M. Apoptosis induced by Drosophila reaper and grim in a human system. Attenuation by inhibitor of apoptosis proteins (cIAPs). J Biol. Chem. 273, 24009-15 (1998)], and proteins that activate apoptosis, such as CASP3 [Mien, O. & Wells, J.A. Caspases and their substrates. Cell Death Differ. (2017). doi:10.1038/cdd.2017.44].

Other predicted lethality proteins are those that influence major stages of early embryogenesis, such as N-cadherin, which is expressed during the early stages of gastrulation. Expression of a dominant negative form of this adhesion molecule results in early embryonic lethality.

Additional lethality proteins are those that interfere with important signaling pathways such as the BMP and FGF pathways. Overexpression of a BMP4 antagonist, such as noggin, arrests the embryogenic process and leads to early embryonic lethality.

In another embodiment, the first nucleic acid sequence may encode an endonuclease enzyme that can perform genome editing, and is operably linked to a nucleotide sequence encoding a switch that regulates expression of the endonuclease protein, the switch being regulated by an inducer.

- 12 043573

Examples of endonuclease proteins include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR/Cas system, which are further described herein above.

In this embodiment, the nucleic acid sequence further comprises a targeting sequence (or guide sequence) that directs the endonuclease to destroy a gene that is essential for the survival of the embryo. Thus, the embryo develops a lethal phenotype and a living chick (male) cannot hatch from the egg.

Examples of essential genes that can be disrupted include, but are not limited to, BMPR1A (Gene ID: 396308), BMP2 (Gene ID: 378779), BMP4 (Gene ID: 396165) and FGFR1 (Gene ID: 396516).

The DNA editing agent in accordance with this aspect of the invention typically comprises a promoter that is operably linked to drive the expression of a lethal protein or endonuclease enzyme.

Examples of promoters that can be used in a DNA editing agent include, but are not limited to, the lentiviral PGK promoter, the CMV promoter, the human synapsin I (hSyn) promoter, and the CAG promoter as in the pCAGGS expression vector.

Promoters and other sequences that regulate expression of the lethal protein or endonuclease enzyme are selected to ensure sufficient expression of the protein to confer a lethal phenotype in betta embryos.

Regardless of whether the DNA editing agent encodes an endonuclease or a lethal protein, the expression of these effector proteins is regulated by a switch that is included in (eg, encoded by) the DNA editing agent.

As used herein, the term switch refers to a single component or set of components that act in a coordinated manner to effect a change involving all aspects of a biological function, such as activation, inhibition, enhancement or termination of that function. In one embodiment, switches refer to inducible and repressible systems used in gene regulation. In general, an inducible system can be turned off in the absence of some molecule or energy form (called an inducer) that allows gene expression. Such a molecule is said to induce expression. The manner in which this occurs depends on control mechanisms as well as differences in cell type. The repressible system is always on, unless there is some molecule or energy form (called a corepressor) that represses gene expression. Such a molecule is said to inhibit expression. The manner in which this occurs depends on control mechanisms as well as differences in cell type.

In the context of this invention, the term inducible can cover all aspects of switching regardless of the molecular mechanism involved. Accordingly, the switch in accordance with the invention may include, but is not limited to, antibiotic-based inducible systems, electromagnetic energy-based inducible systems, small molecule-based inducible systems, nuclear receptor-based inducible systems, and hormone-based inducible systems. In some embodiments, the switch may be a tetracycline (Tet)/DOX inducible system, light inducible systems, abscisic acid (ABA) inducible system, cumate repressor/operator system, 40HT/estrogen inducible system, ecdysone inducible systems or the inducible FKBP12/FRAP system (FKBP12-rapamycin complex).

It is clear that the inductor must penetrate the bird's egg. In addition, the inducer itself must not be toxic or affect the development of the embryo inside the egg.

Typical inductors contemplated by this invention include, but are not limited to, temperature, ultrasound, electromagnetic energy, and chemical. Inducers can be applied to the egg during the process of egg formation in the hen's body before laying.

According to a particular embodiment, the switching is induced using electromagnetic energy (eg, a visible light component). The visible light component may have a wavelength in the range of 450-700 or 450-500 nm, i.e. this is blue light. The blue light may have an intensity of at least 0.2 mW/cm2 or at least 4 mW/ ^cm2 .

The visible light component may have a wavelength in the range of 620-700 nm, i.e. it's a red light.

One or more applications of visible light are contemplated in any order and in any combination. Visible light can be applied in one or more continuous applications or in pulses (pulsed application).

Examples of such optogenetic switches are described in Muller et al., Biol Chem. Feb 2015; 396(2):145-52. doi: 10.1515/hsz-2014-0199; Motta Mena et al., Nat Chem Biol. Mar 2014; 10(3): 196-202; and WO 2014018423, the contents of which are incorporated by reference.

In one embodiment, the switch controls the expression of an effector molecule,

- 13 043573 which is expressed when the switch is turned on using an inductor. Exemplary promoters for driving effector molecule expression include, but are not limited to, the lentiviral PGK promoter, the pCAGG promoter, the CMV promoter, the EF1-a promoter, and the human synapsin promoter.

I(hSyn).

In accordance with a specific embodiment, the effector molecule is a site-specific recombinase.

Typical optogenetic switches are illustrated in FIG. 4A-C, each using the light-sensitive dimerizing protein domains of cryptochrome 2 (CRY2) and CIB1 from Arabidopsis thaliana and a site-specific recombinase as an effector molecule. CRY2 is fused in frame to one half of the Cre recombinase, whereas CIB1 is fused in frame to the other half of the Cre recombinase, i.e. split recombinase enzyme. Thus, in the presence of an inducer (blue light), CRY2 and CIB1 heterodimerize to form a functional Cre recombinase, which is capable of site-specific recombination.

Site-specific recombination is further described in this invention below.

Site-specific recombinases, Cre recombinase, derived from bacteriophage P1, and Flp recombinase, derived from the yeast Saccharomyces cerevisiae, are site-specific DNA recombinases that each recognize a unique 34-bp DNA sequence (called Lox and FRT, respectively) , and sequences that are flanked by Lox sites or FRT sites can be easily removed by site-specific recombination upon expression of Cre or Flp recombinase, respectively.

Additionally, provided recombinase recognition sites include, but are not limited to, Lox511, Lox5171, Lox2272, m2, Lox71, Lox66, FRT, F1, F2, F3, F4, F5, FRT(LE), FRT(RE), attB, attP, attL and attR.

For example, the Lox sequence consists of an eight-bp asymmetric spacer region flanked by 13-bp inverted repeats. Cre recombines the 34-bp lox DNA sequence by binding to 13-bp inverted repeats and catalyzing strand cleavage and religation within the spacer region. The stepwise DNA cuts carried out by Cre at the spacer region are separated by 6 base pairs to produce an overlap region, which acts as a homology sensor to ensure that only recombination sites having the same overlap region recombine.

As such, the site-specific recombinase system provides a means for removing selective cassettes following homologous recombination. This system also allows the generation of conditionally altered alleles that can be inactivated or activated in a transient or tissue-specific manner. It should be noted that the Cre and Flp recombinases leave behind a 34-bp Lox or FRT scar. The remaining Lox or FRT sites usually remain in the intron or 3' UTR of the modified locus, and current evidence suggests that these sites usually do not significantly interfere with gene function.

Thus, recombination of Cre/Lox and Flp/FRT involves the introduction of a targeting vector with 3' and 5' homology arms containing the mutation of interest, two Lox or FRT sequences, and typically a selection cassette placed between the two Lox or FRT sequences. Positive selection is applied and homologous recombinants that contain the target mutation are identified. Transient expression of Cre or Flp in combination with negative selection removes the selection cassette and allows selection of cells lacking the cassette. The final target allele contains a Lox or FRT scar from exogenous sequences. An exemplary targeting vector that uses Cre/Lox recombination is illustrated in FIG. 4A and C. An exemplary targeting vector using Flp/FRT recombination is illustrated in FIG. 4B.

There are other methods of activation by energy, in particular electric field energy and/or ultrasound, which have a similar effect. If necessary, the switch protein pairs can be changed and/or modified for maximum effect when using a different energy source.

The electric field energy is preferably applied essentially as described in the art, using one or more electrical pulses from about 1 V/cm to about 10 kV/cm under in vivo conditions. Instead of or in addition to pulses, the electric field can be applied continuously. The electrical pulse can be applied for 1 to 500 milliseconds, preferably 1 to 100 milliseconds. The electric field can be applied continuously or pulsed for about 5 minutes. In the context of this invention, the term electric field energy represents the electrical energy that is applied to the cell. Preferably, the electric field has a strength of from about 1 V/cm to about 10 kV/cm or more under in vivo conditions (see WO 97/49450).

In the context of the invention, the term electric field includes one or more pulses at varying capacitance and voltage, including exponential and/or square wave and/or modulated and/or modulated square wave. References to electric fields and electricity should be understood to include reference to the presence of an electrical potential difference in the cell environment. Such an environment can be created through static electricity, alternating current (AC), direct current (DC), etc., as is known in the art. The electric field may be uniform, non-uniform, or otherwise, and may vary in strength and/or direction as a function of time.

One or more applications of an electric field, as well as one or more applications of ultrasound, in any order and in any combination, are also possible. Ultrasound and/or electric field can be applied in one or more continuous applications or in the form of pulses (pulsed application).

It should be noted that an alternative approach can be used in which the activating enzyme (eg, a recombinase enzyme such as, for example, Cre) is separated from the lethal gene cassette. In this case, the activating enzyme is inserted into the genome of a male or female bird, and the inactive lethality cassette is inserted into the Z chromosome of the bird of the appropriate sex. In this case, activation of lethality in male embryos is achieved simply by crossing two transgenic parents.

Thus, in accordance with another aspect of the present invention, there is provided a DNA editing system comprising:

(i) a first agent comprising a first nucleic acid sequence for causing a lethal phenotype 10 in a bird egg, operably linked to a recombinase recognition site, and a sequence for directing said first nucleic acid sequence to cause said lethal phenotype to act on the Z chromosome of a bird cell; and (ii) a second agent comprising a second nucleic acid sequence that encodes a recombinase enzyme and a sequence for directing said second nucleic acid sequence to the Z chromosome of the bird cell.

The DNA editing agents and systems of the present invention may also contain a reporter gene that encodes a reporter polypeptide that can be readily detected by its presence or activity, including, but not limited to, luciferase, fluorescent protein (eg, green fluorescent protein), chloramphenicol -acetyltransferase, beta-galactosidase, secreted placental alkaline phosphatase, beta-lactamase, human growth hormone and other secreted enzyme reporters. In general, a reporter gene encodes a polypeptide that is not otherwise produced by the host cell and that can be detected by cell(s) assay, such as direct fluorometric, radioisotope, or spectrophotometric assay of the cell(s), and typically without the need to kill cells to analyze the signal. In some cases, the reporter gene encodes an enzyme that causes a change in the fluorometric properties of the host cell, which can be detected by qualitative, quantitative or semi-quantitative function or transcriptional activation. Exemplary enzymes include esterases, beta-lactamase, phosphatases, peroxidases, proteases (tissue plasminogen activator or urokinase) and other enzymes whose functions can be detected using appropriate chromogenic or fluorogenic substrates that are known to those skilled in the art or will be developed in the future. The reporter gene may indicate successful integration of the construct into the Z chromosome.

Other components of the DNA editing agent include self-cleaving peptides such as 2A, including but not limited to P2A, T2A, E2A (Wang et al., Scientific Report 5, Article 16273 (2015), or internal ribosome entry site (IRES) sequences ).

The DNA editing agent can be constructed as a viral vector (using a single vector or multiple vectors). Such vectors are commonly used in gene transfer and gene therapy applications. Different viral vector systems have their own unique advantages and disadvantages. Viral vectors that can be used to integrate the first nucleic acid sequence of the present invention into the Z chromosome include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, alphaviral vectors, herpes simplex virus-based vectors, and retroviral vectors, as described in more detail below. In accordance with a specific embodiment, the vector is a lentiviral vector.

A viral construct, such as a retroviral construct, contains at least one transcriptional promoter/enhancer element or locus definition, or other elements that otherwise control gene expression, such as alternative splicing, nuclear RNA export, or post-translational modification of messenger RNA. Such vector constructs also contain a packaging signal, long terminal repeats (LTRs) or fragments thereof, and positive and negative strand primer binding sites appropriate to the virus used if one is not already present in the viral construct. In addition, such a construct typically contains a signal sequence for secretion of the peptide from the host cell into which it is introduced. Preferably, for this purpose, the signal sequence is a mammalian signal sequence or a signal sequence of polypeptide variants of certain embodiments.

- 15 043573 invention. Optionally, the construct may also contain a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence. By way of example, such constructs typically contain a 5'-LTR tRNA binding site, a packaging signal, a start point for second-strand DNA synthesis, and a 3'-LTR or fragment thereof. Other vectors that are non-viral can be used, such as cationic lipids, polylysine and dendrimers.

Preferably, the codons encoding the DNA editing agent proteins are optimized codons, that is, codons that are frequently found, for example, in highly expressed genes in birds, instead of those codons that are frequently used, for example, in the influenza virus. This frequency of codon usage ensures efficient protein expression in avian cells. Codon frequency profiles for high gene expression in many species are known from the literature (e.g., Nakamura et al., 1996; Wang et al., 1998; McEwan et al., 1998).

As mentioned, a DNA editing agent (or system) is used to create chickens that are capable of producing viable female offspring and nonviable male offspring.

As a first step, a DNA editing agent is introduced into the bird's primordial germ cells or directly into the bird's sperm.

Approaches for introducing nucleic acids of interest into recipient cells are known and include lipofection, transfection, microinjection, electroporation, transformation and microengineering, etc.

Thus, in accordance with another aspect of the present invention, there is provided a population of cells comprising cells (eg, primordial germ cells or gametes) of a bird that contain an exogenous polynucleotide that is stably integrated into the Z chromosomes of the cells, wherein said exogenous polynucleotide is designed to provide (e.g., in an inducible manner) of a phenotype that is lethal to the male offspring of the bird (but not to the female offspring of the bird).

As used herein, the terms primordial germ cell and PGC refer to the diploid cell 10 present in early embryos that can differentiate/develop into haploid gametes (i.e., sperm and eggs) in the adult bird. Primordial germ cells can be isolated at different stages of development and from different areas of the developing avian embryo, as known to those skilled in the art, including, but not limited to, the genital ridge, developing gonad, blood and terminal crescent. See, for example, Chang et al., Cell Biol Int 21:495-9, 1997; Chang et al., Cell Biol Int 19:143-9, 1995; Allioli et al., Dev Biol 165:30-7, 1994; Swift Am J Physiol 15:483-516; and international publication according to PCT No. WO 99/06533. The genital ridge is a part of the developing embryo known to one skilled in the art. See, for example, Strelchenko, Theriogenology 45: 130-141, 1996; Lavoir, J Reprod Dev 37: 413-424, 1994. As a rule, PGCs stain positively in the periodic acid-Schiff (PAS) reaction method. In several species, PGCs can be identified using an anti-SSEA antibody (one notable exception is turkey, whose PGCs do not present the SSEA antigen). Various methods for isolating and purifying PGCs are known in the art, including concentrating PGCs from blood using Ficoll density gradient centrifugation (Yasuda et al., J Reprod Fertil 96:521-528, 1992).

Obtaining a culture of PGC in vitro is possible using a medium containing chicken and bovine serum, conditioned medium, nutritional cells and growth factors such as FGF2 (van de Lavoir et al., 2006, Nature 441:766-769. doi:10.1038/nature04831 ); Choi et al., 2010, PLoS ONE 5:e12968. doi:10.1371/journal.pone.0012968; MacDonald et al., 2010. PLoS ONE 5:e15518. doi:10.1371/journal.pone.0015518). Recently, it was shown that nutrient replacement medium containing growth factors to activate the FGF, insulin and TGF-P signaling pathways can be used to propagate PGCs (Whyte et al., 2015, Stem Cell Rep 5:1171-1182. doi:10.1016/ j.stemcr.2015.10.008). In addition, in this work, the use of ovotransferrin as a substitute for iron-containing proteins present in avian serum allowed the proliferation of PGCs in the absence of feeder cells and serum, while the cells maintained a high proliferation rate.

Primordial germ cells (PGCs) can be obtained and prepared to implement the disclosed subject matter by any suitable method and, if necessary, stored, frozen, cultured, or the like. before use. For example, primordial germ cells can be obtained from donor embryos at the appropriate embryonic stage. The developmental stages of birds are described in this invention using one of two staging systems generally accepted in the art: the Eyal-Giladi and Kochav system (EG&K; see Eyal-Giladi & Kochav, Dev Biol 49:321-327, 1976), which uses Roman numerals to indicate stages of development of the primary stripes, and the Hamburger and Hamilton staging system (H&H; see, for example, Hamburger & Hamilton, J Morphol 88:49-92, 1951), which uses Arabic numerals to indicate stages after oviposition. Unless otherwise indicated, the stages mentioned in this invention are stages according to the H&H staging system.

- 16 043573

For example, PGCs can be isolated from stage 4 or terminal crescent stage to stage 30, with cells obtained from blood, genital ridge or gonad at later stages. Primordial germ cells are generally twice the size of somatic cells and are easily distinguished and separated from them by size. Male (or homogametic) primordial germ cells (ZZ) can be distinguished from heterogametic primordial germ cells (Zw) by any suitable means, such as obtaining germ cells from a particular donor and typing other cells from that donor, the resulting cells being of the same chromosomal type, as typed cells.

An alternative to the use of PTC is direct transfection of sperm using the DNA editing agent disclosed in this invention; see, for example, Cooper et al., 2016 Transgenic Res 26:331–347, doi:10.1007/s11248-016-0003-0.

To generate chimeric birds from in vitro edited PGCs, exogenous edited cells are intravenously injected into surrogate host embryos at the stage when their endogenous PGCs migrate to the genital ridge. Donor PGCs may be the same species as the surrogate host embryo or a different species. The edited donor PGCs must remain viable and, in one embodiment, displace endogenous PGCs if they are to colonize the developing gonad and transmit the edited chromosome(s) through the germline. To provide an advantage to donor PTCs, the number of endogenous PTCs can be reduced by chemical or genetic ablation (Smith et al., 2015, Andrology 3:1035-1049. doi:10.1111/andr.12107). Treatment of blastoderm of surrogate embryos with emulsified busulfan has been shown to increase germline transfer of donor PGCs to more than 90%, although this rate drops significantly if PGCs are cultured or cryopreserved (Nakamura et al., 2008, Reprod Fertil Dev 20:900-907. doi:10.1071/RD08138; Naito et al., 2015, Anim Reprod Sci. 153:50-61. doi:10.1016/j.anireprosci.2014.12.003). Other methods for changing the ratio of edited SCPs to proprietary SCPs are described in US Application No. 20060095980.

Optionally, PGCs can be transplanted into adult gonads, as is known in the art, see, for example, Trefil et al., 2017 Sci Rep, Oct 27;7(1): 14246 doi:10.1038/s41598-017-14475w.

Genetically modified cells (eg, PGCs) can be prepared for administration to other birds by dissociating the cells (eg, mechanical dissociation) and thoroughly mixing the cells with a pharmaceutically acceptable carrier (eg, phosphate-buffered saline). The primordial germ cells are, in one embodiment, gonadal primordial germ cells, and in another embodiment, blood primordial germ cells (gonad or blood refers to the origin of the tissue in the original embryonic donor). The introduced primordial germ cells can be heterogametic (Zw) or homogametic (ZZ). PZK can be administered in a physiologically acceptable vehicle, in one embodiment, at a pH of from about 6 to about 8 or 8.5, in a suitable amount to achieve the desired effect (for example, from 100 to 30,000 PZK per embryo). The POC may be administered without other ingredients or cells, or the other cells and ingredients may be administered together with the POC.

In ovo administration of primordial germ cells to a recipient animal can be done at any appropriate time when PGCs are still able to migrate into the developing gonads. In one embodiment, administration is carried out from approximately stage IX according to the Eyal-Giladi and Kokhava (EG&K) staging system and to approximately stage 30 according to the Hamburger and Hamilton embryonic development staging system, and in another embodiment at stage 15 Thus, for chicks, the time of administration corresponds to 1, 2, 3 or 4 days of embryonic development: in one embodiment, from 2 to 2.5 days. Administration is generally accomplished by injection into any suitable target site, such as the area defined by the amnion (including the embryo), yolk sac, etc. In one embodiment, the injection is carried out into the embryo itself (including the body wall of the embryo), and in alternative embodiments, intravascular or intracoelomic injection into the embryo can be used. In other embodiments, the injection is performed into the heart. The methods of the disclosed invention can be carried out with prior sterilization of the recipient bird in ovo (for example, by chemical treatment using busulfan or by gamma or x-ray irradiation). In the context of this invention, the term sterilization refers to the partial or complete inability to produce gametes derived from endogenous PGCs. When donor gametes are obtained from such a recipient, they can be obtained as a mixture of donor and recipient gametes. This mixture can be used directly or the mixture can be further processed to enrich the proportion of donor gametes in it.

The introduction of primordial germ cells in ovo can be carried out by any suitable method, manually or automatically. In one embodiment, in ovo administration is accomplished by injection. The mechanism of in ovo administration is not critical, but it should not excessively damage the tissues and organs of the embryo or the surrounding extraembryonic membranes so that the treatment does not unduly reduce hatching rates. A syringe for injection is suitable for this purpose.

- 17 043573 dermal injections, equipped with a needle of approximately 18-26 gauge. You can use an elongated glass pipette with a hole of about 20-50 microns in diameter. Depending on the exact stage of development and position of the embryo, the one-inch needle will penetrate the fluid above the chick or into the chick itself. A pilot hole can be punched or drilled into the shell before inserting the needle to prevent damage or blunting of the needle. If necessary, the egg can be sealed with a substantially bacteria-impermeable sealing material, such as wax or the like, to prevent subsequent entry of unwanted bacteria. It is contemplated that the high speed avian embryo injection system will be particularly suitable for practicing the disclosed invention. All such devices adapted for the practice of the methods disclosed in this invention contain an injector containing the composition of primordial germ cells described in this invention, the injector being intended for injection into the egg, carried out by the device at an appropriate location within the egg. In addition, a sealing device may be provided operatively connected to the injection device for sealing the hole in the egg after injection thereof. In another embodiment, an elongated glass micropipette can be used to introduce the PZC into a suitable location within the egg, for example, directly into the bloodstream, either into a vein or artery, or directly into the heart.

After injecting eggs with modified PGCs, the chimeric embryo is incubated until hatching. It grows to sexual maturity, with the chimeric bird producing gametes derived from donor PGCs.

Gametes (eggs or sperm) from the chimeras (or from material that has been directly genetically manipulated as described above in this invention) are then used to raise mother hens (F1). Molecular biology techniques known in the art (eg, PCR and/or Southern blot) can be used to confirm germline transmission. F1 chickens can be backcrossed to create homozygous ZZ carrier males and carrier (F2) females.

Gametes from F2 mother hens can then be used to expand breeding colonies. Colonies are usually grown until sexual maturity. Fertile eggs obtained from these flocks can be tested for early male embryonic lethality by exposure to an inducer that produces a lethal phenotype (eg blue light illumination). After induction, the eggs are incubated (eg for 8 days) and screened (eg by candling) to detect early embryonic lethality.

It is expected that many relevant DNA editing tools will be developed during the life of the patent obtained from this application, and the term DNA editing agent is intended a priori to include all such new technologies.

In the context of this invention, the term about refers to ±10%.

The terms contains, containing, includes, including, having and combinations thereof mean including, but not limited to.

The term consisting of means including and limited thereto.

The term consisting predominantly of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not lead to a significant change in the essential and novel characteristics of the claimed composition, method or structure.

As used herein, the singular form includes references to the plural unless the context clearly indicates otherwise. For example, the term compound or at least one compound may include a number of compounds, including mixtures thereof.

Throughout this application, various embodiments of this invention may be presented in range format. It should be understood that the description in range format is intended for convenience and brevity only and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, a range description should be considered to explicitly disclose all possible subranges as well as the individual numerical values within that range. For example, a description of a range such as 1 to 6 should be considered to explicitly disclose subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numeric values within that range, such as 1, 2, 3, 4, 5, and 6. This applies regardless of the width of the range.

Whenever a numeric range is specified in this invention, it is intended to include any listed numeric value (fractional or integer) within the specified range. The expressions in the range/ranges between the first specified number and the second specified number and in the range/ranges from the first specified number to the second specified number are used interchangeably in this invention and include the first and second specified numbers and all fractional and integer numbers between them. In the context of this invention, the term method refers to processes, means, technologies and procedures for performing a given task, including, but not limited to, those processes, means, technologies and procedures that are known or that can be easily developed based on known processes, means, technologies and procedures used by practitioners in

- 18 043573 areas of chemistry, pharmacology, biology, biochemistry and medicine.

It will be understood that certain features of the invention, which for clarity are described in the context of individual embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which for brevity are described in the context of one embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments should not be considered essential features of those embodiments unless the embodiment operates without those features.

Various embodiments and aspects of the present invention described above and claimed in the claims below are experimentally confirmed in the examples below.

Examples

The text below refers to the following examples, which together with the above description illustrate some embodiments of the invention in a non-limiting manner.

In general, the nomenclature used in this invention and the laboratory procedures used in this invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such technologies are described in detail in the literature. See for example

Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current

Protocols in Molecular Biology Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al.

Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989);

Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988);

Watson et al., Recombinant DNA, Scientific American Books, New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory

Press, New York (1998); methodologies given in US Pat. Nos. 4,666,828;

4683202; 4801531; 5192659 and 5272057; Cell Biology: A Laboratory Handbook, Volumes IIII Cellis, J. E., ed. (1994); Culture of Animal Cells - A Manual of Basic Technique by

Freshney, Wiley-Liss, N. Y. (1994), Third Edition; Current Protocols in Immunology Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), Basic and Clinical Immunology (8th Edition), Appleton & Lange, Norwalk, CT (1994); Michelle and Shiigi (eds), Selected

Methods in Cellular Immunology, W. H. Freeman and Co., New York (1980);

Available immunoassay methods are described in detail in the patent and scientific literature, see, for example, US patent Nos. 3,791,932; 3839153; 3850752; 3850578; 3853987; 3867517; 3879262; 3901654; 3935074; 3984533; 3996345; 4034074; 4098876; 4879219; 5011771 and 5281521;

Oligonucleotide Synthesis Gait, M. J., ed. (1984); “Nucleic Acid Hybridization

Hames, B. D., and Higgins S. J., eds. (1985); Transcription and Translation Hames, B. D., and Higgins S. J., eds. (1984); Animal Cell Culture Freshney, R. I., ed. (1986); Immobilized

Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol. 1317, Academic Press; PCR Protocols: A Guide To

Methods And Applications, Academic Press, San Diego, CA (1990); Marshak et al., Strategies for Protein Purification and Characterization - A Laboratory Course Manual CSHL

Press (1996);

which are all incorporated by reference as if fully set forth herein. Other general references are provided throughout the text of this invention. The procedures mentioned therein are believed to be well known in the art and are provided for the convenience of the reader. All information contained therein is incorporated by reference into the invention.

The working process.

Creating a line of genome-modified chickens is a multi-step process. The end result is a line of laying hens that is genomically identical to the laying hens currently used in the industry. Likewise, the final product, which is a barren egg used for food, will be identical - see FIG. 1.

The workflow consists of 5 main stages:

1) creation and cultivation of chicken lines of primordial germ cells (PGC);

2) genome modification in cultured PGCs;

- 19 043573

3) transplantation of modified PGCs into embryos and production of chimeric chickens, among which they will be screened for potential carriers;

4) breeding ancestral chickens from genetic material obtained from chimeras;

5) expansion of mother hen colonies into mother flocks and re-testing of germline transmission.

Materials and methods.

PGC culture medium: Avian PGC culture medium consists of calcium-free DMEM (Gibco) diluted with water to 250 mOsmol/L containing 12.0 mM glucose, 2.0 mM GlutaMax (Gibco), 1.2 mM pyruvate (Gibco ), 1xvitamin MEM (Gibco), 1xB-27 supplements (Gibco), 1x NEAA (Gibco), 0.1 mM P-mercaptoethanol (Gibco), 1x nucleosides (Biological industries), 0.2% ovalbumin (Sigma), 0 .1 mg/ml sodium heparin (Sigma), 0.15 mM CaCl ₂ (Sigma), 1x vitamin MEM (Gibco), 1x penicillin/streptomycin (Biological Industries), 0.2% chicken serum (Sigma) in poultry DMEM. The following growth factors were added before use: human activin A, 25 ng/ml (Peprotech); human FGF2, 4 ng/ml (R&D Biosystems), ovotransferrin (5 pg/ml) (Sigma). AkoDMEM refers to a dilute medium containing glucose, pyruvate and vitamins.

Obtaining PZK line: PZK lines were obtained by adding ~1.0-3.0 pl of blood isolated from stage 15-16 embryos (H&H) to 300 pl of medium in a 48-well plate. The medium was changed every 2 days. When the total number of cells reached 1x105, the total volume of medium was changed every 2 days and cells were multiplied at 2-4x105 cells/ml of medium. Cells were frozen in PCD culture medium containing 10% DMSO, the temperature was gradually reduced to -80°C, stored for 1-3 days and transferred to liquid nitrogen.

Determination of sex and characteristics of the PZK line. The characteristics of each PTC line were examined with respect to sex determination, mRNA expression of PTC markers, and protein expression of the known PTC marker SSEA1 ⁴ . DNA from the donor embryo was isolated and stored for future use. To determine sex, DNA was obtained from 2-4x105 PGC cells, resuspended in tail buffer (102-T, Viagen) containing 100 pg/ml proteinase K (Sigma), and incubated at 55°C for 3 hours. Proteinase K was inactivated at 85°C for 45 minutes. PNR for sex determination was performed with primers from the W chromosome that target the female chromosome (P17, P18) and ribosomal S18 (P19, P20) as a control ⁶ . For gene expression analysis, RNA was purified using TRIzol reagent, and 1 pg of RNA was used to generate a cDNA library using a reverse transcription PNR reaction (reverse transcriptase from GoScript, Promega). cDNA served as a template for PNR using primers Daz1, Sox2, cPouV, Nanog, Klf4, cVH primers, P21-P22, P23-P24, P25-P26, P27-P28, P29-P30, P31P32, respectively.

Immunohistochemistry with anti-SSEA1 antibody: Cells were collected, fixed with 4% PFA, blocked with 5% normal goat serum in 0.1% PBS-Triton and stained with a 1:100 dilution of anti-SSEA1 antibody (DSHB, Hybridoma bank ¹³ ) in blocking buffer for nights. After washing the cells for 30 min with 0.1% PBS-Triton, a secondary antibody (Alexa Fluor 488, molecular probes) was added for 1 h, the cells were stained with DAPI (Sigma), mounted in histological medium (Histomount, electron microscopy sciences) and covered .

PGC transfection, selection and FACS sorting: Plasmid transfection of PGCs was performed using lipofection or electroporation. Lipofectamine 2000 was used for lipofection according to the manufacturer's protocol. 3-5x105 cells were seeded in a 96-well plate in AkoDMEM containing NEAA, pyruvate, vitamins, CaCl2 and growth factors (activin A, hFGF and ovotransferrin). 100 ng of plasmids and 0.25 μl of Lipofectamine 2000 (invitrogen) were diluted separately in 20 pl of OPTIMEM mixture, mixed together, incubated for 20 min and pipetted onto the cells. For electroporation, 5 × 105 or 1.5 × 106 cells were washed in AkoDMEM and electroporated at 1000 V, 12 ms, 3 pulses on a Neon electroporator (Invitrogen) and immediately plated in a 96- or 48-well plate, respectively, in PZC medium without antibiotics. The medium was changed after 1-3 hours. Selection with 25-100 pg/ml G418 began after 72 hours and continued for 2-4 weeks. After selection, cells were individually isolated manually or by FACS sorting. For FACS sorting, cells were carefully pipetted and sorted into PGC culture medium. GFB-positive cells were sorted by FACS Aria II into a new 96-well plate, one cell per well, or pooled. (FACS analysis was performed using a BD FACS Aria II flow cytometer (BD, USA).

Preparation of plasmids.

Cloning of CRISPR plasmids: CRISPR sequences were designed using the CRISPR design tool from Zhang lab, MIT (www(dot)crispr(dot)mit(dot)edu) ⁹ . Plasmid px330-GFP (modified from Addgene plasmid #42230) ¹⁴ was cut using the restriction enzyme BbsI and served as a backbone for insertion of the CRISPR site to generate ssRNA. Oligonucleotides for CRISPR sites on sRNA - CRISPR1, CRISPR3 (oligonucleotides P34-P35 and P36-P37, respectively) were denatured at 95°C for 30 s, slowly annealed and ligated into the cut

- 20 043573

BbsI plasmids were transformed into E. coli, purified and sequence verified as described

B[mediadotaddgenedotorg/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da3b7d7960394c/zhang-lab-general-cloning-protocoldotpdf; _and Cong L, et al., Science. Jan 2013

3.10.1126/science. 1231143 PubMed 23287718].

Cloning of plasmid pJet-HA: the genomic region behind the HINTZ locus on the Z chromosome, containing both the 5' PG and 3' PG, was amplified from PZK DNA with primers P1 and P2 using PCR (Kara, Roche). The PCR product was purified and ligated into plasmid pJet1.2 (Invitrogen) according to the manufacturer's protocol.

Construction of targeting vector: Plasmid pCAGG-IRES-Neo-GFP was used as a template for PCR using primers P5-P6 to amplify the pCAGG-IRES-Neo-GFP insert. Plasmid pJet-HA was used as a template for PCR using primers P3-P4 to amplify a vector containing 5' PG and 3' PG (Fig. 3). The Gibson assembly reaction was performed on the purified vector and PCR insert products, taking 0.03 pm and 0.06 pm of linearized product, respectively. The products of the Gibson assembly reaction ¹⁰ were transformed into E. coli to obtain a plasmid, the sequence of which was verified.

Construction of the pCAGG-Optogene vector.

To create the pCAGG-Optogene vector, the optogen plasmids pmCherry-CIBN-CreC and pmCherry-Cry2-CreN ¹¹ were used as a template for amplification of optogens, using primers P40-P41 and P42-P43, which gave products of 1.3 and 2.1 t in size . By. respectively. These two products share overlapping sequences at the P2A site, which was introduced into primers P41 and P42. One round of overhang extension PCR was used to combine the two fragments into one 3.5-kb fragment. product that was purified from an agarose gel. This product was ligated into the shuttle vector pJet1.2, which was used as a template for PCR using primers P44 and P45, which contain tails with SmaI and NheI restriction sites, respectively. This product was digested using appropriate restriction enzymes and used as an insert for ligation into the SmaI and NheI digested plasmid pCAGG-IRES-GFP, which served as a vector. The ligation products were transformed into E. coli bacteria, and the sequence of the propagated plasmid was verified.

Construction of the pGK-DTA-IRES-GFP vector.

To create pGK-DTA-IRES-GFP, the expression vector pSK BS-PGK-DTA was used as a template for PCR with primers P46 and P47, which contain extension sequences for the XmaI and NheI restriction sites, respectively. Product size 0.65 kt. O. digested with appropriate enzymes and used as a ligation insert into the complementary XmaI-NheI site in the pGK-IRES-GFP plasmid, which served as a ligation vector. The ligation products were transformed into E. coli bacteria, and the sequence of the propagated plasmid was verified.

In ovo electroporation: In ovo electroporation was performed essentially as previously described ⁷ . Fertilized eggs were incubated for 56-60 hours at 37.8°C, a window was made in the eggshell, and plasmid DNA was introduced at a concentration of ~2 pg/μl using a pointed micropipette with a hole with a diameter of 10-15 pm into the neural tube. Three pulses of 25 V were applied for 30 ms using an ECM 830 square wave electroporation system (BTX). After electroporation, the eggshells were sealed with parafilm and the embryos continued to incubate until analysis.

Endonuclease Assay: PCBs were transfected with CRISPR1 or CRISPR3 plasmids using Lipofectamine 2000 reagent. After forty-eight hours, individual PCB-positive cells were isolated into a 96-well plate and grown to form pure colonies. DNA was obtained and PNR amplification of 350 bp was performed. region flanking CRISPR sites with primers P38-P39. PCR products were denatured at 95°C, slowly annealed, and incubated with T7 endonuclease for 1 hour at 37°C. For calibration purposes and as a positive control, 350 bp. the PCR product was subcloned into pJet1.2, and the CRISPR site was mutated using site-directed mutagenesis. The introduced mutation changed the sequence of DT

ATACCAGATAACGTgCCTTATTTGGCCGTT (SEQ ID NO: 2) on

ATACCAGATAACGTaatCCTTATTTGGCCGTT (SEQ ID NO: 3).

This artificial mutation served as a positive control for both the endonuclease assay (Fig. 7A) and the sequencing control (Fig. 8B).

Southern blotting. The Dig tag for the 5' PG, 3' PG and Neo gene probes was obtained by PNR amplification (Longamp, NEB) with primers P13-P14, P15-P16 and P11-P12, respectively, using DIG DNA labeling mix (Roche). 15 pg of genomic DNA was digested overnight at 37°C using the restriction enzyme BglII. DNA fragments were separated by electrophoresis on a 0.8 wt/vol% agarose gel (20 V, 12 h) and transferred to positively charged nylon membranes (GE Healthcare). After transfer, wet membranes were cross-linked using UV light at 254 nm for 3 min on each side, then washed with 2xSSC. The membranes were pre-hybridized for

- 21043573 h at 42°C using DIG Easy-Hyb hybridization solution (Roche). Probes (50 ng/ml) were denatured by heating to 95°C for 5 min and immediately immersed in ice. Denatured probes were added to 10 ml of warm DIG Easy-Hyb solution and hybridized for 12 h at 42°C. The membranes were washed twice for 10 min in 2xSSC, 0.1% SDS at room temperature with stirring, and then washed 3 times for 30 min in 0.2xSSC, 0.1% SDS at 65°C with stirring. Additional washing and blocking were performed using DIG wash solution and a blocking buffer set (Roche) according to their protocol. Detection of the DIG tag was performed using a 1:10,000 anti-digoxigenin-AP antibody (Roche) followed by a chemiluminescent reaction using CDP-Star reagent (Roche). Images were acquired using a G:BOX gel imaging system (Syngene).

Introduction of PZK into embryos and staining of the whole preparation: Freshly laid eggs were incubated with the pointed end up for 58-62 hours at 37.8°C with a humidity of 55%. After incubation, a 48 mm window in the egg shell was opened and 3000-8000 PZC were injected into the bloodstream using a pointed micropipette with an opening of ~30-40 pm. The window was covered with white eggshells and additionally sealed with parafilm (Parafilm) or leucoplast (BSN medical GmbH). Embryos were incubated until hatching. Some gonads of the injected embryos were isolated and used for staining the whole preparation with PBS. Gonads were fixed in 4% PFA, washed for 2 h with PBS, blocked with 5% normal donkey serum in 1% PBS-Triton and stained at a 1:20 dilution with mouse anti-SSEA1 antibody ¹³ or at a 1:500 dilution with rabbit anti-SPB antibody (Abcam ) in blocking buffer overnight. After washing for 2 h with 1% PBS-Triton, donkey anti-mouse cy3 secondary antibody 1:500 (Jackson Immunoresearch Laboratories) or anti-rabbit anti-Alex488 secondary antibody 1:500 (Molecular Probes) was added for 3 h in blocking buffer. The tissue was counterstained with DAPI (Sigma) and mounted in glycerol and imaged using a confocal microscope (Leica, TCS SPE, Wetzlar, Germany).

- 22 043573

Table 3

List of primers

Primer Subsequence P1 TTTTGAATGAAGGGCCTGAG SEQ ID NO: 4 P2 TGAACCAATCAGAGTGGGAC SEQ ID NO: 5 RZ GTCCCTCTTCTCTTATGGAGATCGCCGTTTCCACATTCTTTTTCTC SEQ ID NO: 6 P4 GGTGGCACTTTTCGGGGAAATGTGTGAACCAATCAGAGTGGGACATGAC SEQ ID NO: 7 P5 GTCATGTCCCACTCTGATTGGTTCACACATTTCCCCGAAAAGTGCCACC SEQ ID NO: 8 P6 GAGAAAAGAATGTGGAAACGGCGATCTCCATAAGAGAAGAGGGAC SEQ ID NO: 9 P7 GAAGTGTGCTGCTAACCTG SEQ ID NO: 10 P8 GCTATGAACTAATGACCCCG SEQ ID NO: 11 P9 TTTTCCTCCTCTCCTGACTAC SEQ ID NO: 12 RU GGCCTGGATGATAAGAGTCTTC SEQ ID NO: 13 RN GCTATTCGGCTATGACTGGG SEQ ID NO: 14 P12 GAAGGCGATAGAAGGCGATG SEQ ID NO: 15 P13 GTGGAACACAGCTTTTCCAG SEQ ID NO: 16 P14 GCTCTTCAACTTGCCATTTG SEQ ID NO: 17 P15 TCAACAGCACGTAAGCAAC SEQ ID NO: 18 P16 CCTGACTCCATTTTTGAGCC SEQ ID NO: 19 P17 CCCAAAATATAACACGCTTCACT SEQ ID NO: 20 P18 GAAATGAATTATTTTCTGGCGAC SEQ ID NO: 21 P19 AGCTCTTTCTCGATTCCGTG SEQ ID NO: 22 P20 GGGTAGACACAAGCTGAGCC SEQ ID NO: 23 P21 CAACTATCAGGCTCCACCAC SEQ ID NO: 24 P22 CTCAGACGGTTTTCAGGTT SEQ ID NO: 25 P23 AGGCTATGGGATGATGCAAG SEQ ID NO: 26 P24 GTAGGTAGGCGATCCGTTCA SEQ ID NO: 27 P25 CGAGACCAACGTGAAGGGAA SEQ ID NO: 28 P26 CAGACCCGGACAACGTCTTT SEQ ID NO: 29 P27 CTCTGGGGCTCACCTACAAG SEQ ID NO: 30 P28 AGCCCTGGTGAAATGTAGGG SEQ ID NO: 31 P29 AGCTCTCATCTCAAGGCACA SEQ ID NO: 32 RZO GGAAAGATCCACTGCTTCCA SEQ ID NO: 33 P31 AGCACAGGTGGTGAACGAACCA SEQ ID NO: 34 P32 TCCAGGCCTCTTGATGCTACCGA SEQ ID NO: 35 P34 CACCGCCAAATAAGGCACGTTATC SEQ ID NO: 36 P35 AAACGATAACGTGCCTTATTTGGGC SEQ ID NO: 37 P36 CACCGACCAGATAACGTGCCTTTATT SEQ ID NO: 38 P37 AAACAATAAGGCACGTTATCTGGT SEQ ID NO: 39 P38 TTGCAGTGGTTACCGTTCG SEQ ID NO: 40 P39 TAGTAGGCATCTTGTGGGGG SEQ ID NO: 41 P40 ATGAATGGAGCTATAGGAGG SEQ ID NO: 42 P41 CCACGTCTCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCATCGCCATCTTCCAGCAGGCG SEQ ID NO: 43 P42 TGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCTATGAAGATGG ACAAAAAGAC SEQ ID NO: 44 P43 TTACAGCCCGGACCGACGATG SEQ ID NO: 45 P44 ATCTGACCCGGGATGAATGGAGCTATAGGAGG SEQ ID NO: 46 P45 GTAGCTGCTAGCTTACAGCCCGGACCGACGATG SEQ ID NO: 47 P46 CAGGTCCCCGGGATGGATCCTGATGATGTTG SEQ ID NO: 48 P47 GCATGTGCTAGCTTAGAGCTTTAAATCTCTG SEQ ID NO: 49

- 23 043573

Plasmid sequences.

1. рХЗЗО-GFP (SEQ Ш NO: 50)

2. CRISPRI (SEQ GO NO: 51)

3. CRISPR3 (SEQ ID NO: 52)

4. plet-Has (SEQ ID NO: 53)

5. pCAGG-Neo-IRES-GFP (SEQ ID NO: 54)

6. Targeting Vector (SEQ ID NO: 55)

7. pmCherry-Cry2-CreN (SEQ ID NO: 56)

8. pmCherry-CIBN-CreC (SEQ ID NO: 57)

9. pB-RAGE-GFP (SEQ ID NO: 58)

10. pCAGG-IRES-GFP (SEQ ID NO: 59)

11. pCAGG-Optogenes (SEQ ID NO: 60)

12. pB-RAGE-mCherry (SEQ ID NO: 61)

13. pSK BS-PGK-DTA (SEQ ID NO: 62)

14. pGK-IRES-GFP (SEQ ID NO: 63)

15. pGK-DTA-IRES-GFP (SEQ ID NO: 64)

Results.

Obtaining and studying the characteristics of SCP lines.

During the earliest stages of embryonic development, shortly after oviposition and before the onset of gastrulation, PGCs migrate rostrally to the terminal crescent region in the anterior part of the extraembryonic layer of mesoderm. It is believed that this migration protects PGCs from differentiation processes, as occurs in the case of somatic cells. Only after the formation of the area opaca vasculosa, blood and heartbeat, after approximately 2.5 days of incubation (stage 14-17 H&H ¹ ), the cells return to the embryo through the bloodstream and colonize the genital ridge from which the gonads will develop. At these stages, using a micropipette with a hole with a diameter of ~40-60 pm, 1-3 pl of blood was taken from the vascular system of the embryos and transferred to a well in a 48-well plate containing the culture medium for PGC.

The culture medium of PGCs provides the possibility of rapid division of PGCs (20-24 h cell cycle) while maintaining an undifferentiated state in the absence of a feeder. After 2-3 weeks in culture, the blood cells decomposed and disappeared ² . Over an additional 1–2 weeks, cultured PGCs became confluent (Fig. 5A). These cells can be further grown for genetic modification, or they can be successfully frozen and thawed for modification later. Chick PGCs in culture have been extensively characterized in the literature by morphological characters, protein and mRNA expression profiles, and finally by their ability to migrate gonads when reinjected into the vasculature of a recipient embryo at the same developmental stage ^{3 - 5} . These characteristics were examined in the resulting PGC cell cultures to show that they retain the well-known properties of PGC. Morphologically, PGCs are large, slightly granular cells with a diameter of about 15-20 pm, containing large nuclei. PGCs are totipotent cells, so they express pluripotent markers such as cPouV, SOX2, KLF4 and Nanog, and two unique germ cell markers, cVH and DAZL. For each PGC line, DNA was extracted to determine sex using primers for ribosomal S18 (P19-P20, product size 256 bp) as a positive control and primers for the W chromosome (P17-P18, product size 415 bp). ) to identify females (Fig. 5B) ⁶ . In addition, PGCs express the membrane antigen SSEA-1 ⁴ (Fig. 5C).

PZK lines were established from cells of laying hens and broilers, both male and female lines. Plasmid transfection was carried out using the cationic lipid transfection reagent Lipofectamine 2000, which interacts with negatively charged DNA, allowing it to enter the cell. Transfection with a plasmid encoding GFB (pCAGG-GFP ⁷ ) resulted in a transfection efficiency of about 15-20% (Fig. 5D). In addition, the transfection efficiency of PGCs using electroporation resulted in an increase in efficiency of up to 90% (Figure 5E). To demonstrate that cultured PGCs successfully colonize gonads expressing GFB, PGCs were injected into the circulation at stage 14–16 H&H and the embryos were incubated for 10 days. Embryos were dissected and GFB-positive cells in the gonads were identified (Fig. 5F).

Construction of CRISPR-Cas9 targets on the Z chromosome.

DNA editing on the Z chromosome was carried out using CRISPR-Cas9 and homologous recombination processes. While the CRISPR-Cas9 system directly cuts DNA at a specific site on the Z chromosome, an endogenous repair system using the process of homologous recombin

- 24 043573 tions, allows for targeted insertion of the required DNA in an exact location. For this purpose, it is necessary to construct a targeting vector plasmid that contains homology arms corresponding to the insertion site on the Z chromosome. A site was selected for DNA insertion into the Z chromosome downstream of the HINTZ coding gene. Many studies have shown that the use of the CRISPR system improves direct DNA insertion. The plasmid px330, widely used for this purpose, contains an sRNA site and the Cas9 enzyme ⁸ . The sRNA site contains a unique sequence that directs the Cas9 enzyme to the target site and leads to the creation of a DNA double-strand break (DSB) targeted to a specific region of the genome. Using the CRISPR design tool, a unique sequence for the ssRNA was identified, as illustrated in FIG. 6A. The first 12 guides according to their evaluation are shown in Fig. 6B and in table. 1.

Twenty nucleotide sequences, guides 1 and 3, were selected by traditional secondary structure similarity and by screening possible off-target sites in the chicken genome, which were assigned mismatch scores. The first 10 search results for potential non-target sites for guide #1 are shown in FIG. 6C and in table. 2. It should be noted that the first 6 non-target sites each have 4 mismatches, which emphasizes the specificity of this guide.

Insertion of the DNA sequence was accomplished by cutting the modified plasmid px330, which contains ZPB in frame fused to the C terminus of Cas-9. Annealed primers containing ssRNA sequences were ligated to the restriction enzyme BbsI as previously described. (Fig. 6B). The ligation products were transformed into E. coli, the plasmids were purified, and the ssRNA inserts were confirmed by sequencing.

Testing the activity of the CRISPR-Cas9 system.

By growing PGCs in a feeder-free culture medium, pure colonies derived from single cells were obtained, allowing the performance characteristics of the CRISPR-Cas9 system to be studied. For this purpose, PGCs were transfected with plasmids pX330-GFP-CRISPR1 and pX330-GFP CRISPR3 and clonal colonies were grown. Total genomic DNA was extracted from colonies derived from single cells expressing ZPB. The DNA was analyzed by endonuclease assay and sequenced. A positive control was constructed for the endonuclease assay. This control was 320 bp. PCR product with introduced mutations in the predicted CRISPR-Cas9 activity site. This product was mixed with a WT product of similar length in various ratios, 1:15, 1:7, 1:1 mutated product:WT, respectively, and the annealed mixture was subjected to endonuclease activity (Figure 7A). Two short bands with a predicted size of 136 bp. and 184 bp were clearly visible at the 1:7 and 1:1 ratios, indicating that the assay was working correctly. Similarly, the same analysis was performed on genomic DNA obtained from 12 colonies transfected with CRISPR1 and CRISPR3 plasmids (Fig. 7B, C). In 9 of 12 colonies, a clear doublet with the predicted size was observed. This indicates that CRISPR1 and CRISPR3 plasmids efficiently generate DCRDs at the predicted site.

For sequencing analysis, the PCR products that were used for the endonuclease assay (Fig. 7A-C) were also sequenced (Fig. 8A-D). Sequencing of the negative control WT revealed the predicted CRISPR1 cleavage site (Fig. 8A). Sequencing of a mixture of WT and the artificially mutated product as a positive control revealed the appearance of double peaks in the DNA chromatogram immediately downstream of the predicted cleavage site (blue arrow, Fig. 8B). Similar sequencing of the same genomic region in transfected colonies revealed both negative (Fig. 8C) and positive (blue arrow, Fig. 8D) colonies, with the latter present in >70% of cases.

Construction of Targeting Vector for Genome Integration To demonstrate targeted genomic integration into the Z chromosome by GR, a targeting vector was constructed (Fig. 9A-F). The vector contains the pCAGG promoter followed by a neomycin selection gene, an internal ribosome entry site (IRES), a ZPB and a rabbit beta-globin polyadenylation site. This cassette was flanked by ~1.5 kb. homology arms at the 5' and 3' ends, respectively. To create this vector, a ~3 kb DNA fragment containing both arms of homology was amplified using primers P1 and P2 and ligated into the shuttle vector pjet1.2. It was found that the complete sequencing of this fragment is identical to the sequence of the chicken genome. This pJet-HAs plasmid was used as a template to generate a linearized PNR product containing two separated homology arms except for 23 bp. sequences between them that contain CRISPR ssRNA sites. Amplification was performed using primers P3 and P4, which contain sequences at the 5' end that correspond to the edges of the pCAGG-Neo-IRES-GFP cassette. This linear PCR product is called a vector. Plasmid pCAGG-Neo-IRES-GFP was used as a template to generate a linear PCR product. This fragment was amplified using primers P5 and P6 containing sequences that correspond to the 5' and 3' ends of the 5'PG and 3'PG ends, respectively. This product is called an insert. The vector and insert were docked together using the Gibson assembly reaction ¹⁰ to create the final targeting vector.

- 25 043573

Homologous recombination with the Z chromosome using a targeting vector and plasmid

CRISPR.

The ability to obtain pure PGC colonies from a single cell allows the identification of positive colonies that have undergone correct GR with the insert using techniques such as PCR and Southern blot. To transfect PGCs, lipofection was used with a transfection efficiency of 5-10% (Fig. 10A) or electroporation with an efficiency of >40%. Transfection was carried out with two plasmids, a targeting vector and one of the two CRISPR plasmids described above (CRISPR1 or CRISPR3). After transfection, cells were allowed to recover for 24 h and transferred to medium containing G418 for selection. After two weeks of selection, only G-418-resistant cells survived, of which >99% were ZPB-positive (Fig. 10B). To ensure that the cells retained the ability to colonize the gonads, they were introduced into host embryos as described above in FIG. 1F (Fig. 8C). The gonads were immunostained with an anti-ZPB antibody, and colonization of ZPB-positive PBC cells in the gonads was confirmed using a confocal microscope (Fig. 10D).

G-418-resistant GFB-positive cells consist of a potentially heterogeneous population. Thus, to verify GR integration and obtain a pure homogeneous population, individual GFB-positive cells were separated using FACS sorting into a 96-well plate (Fig. 11A). Pure colonies were grown and genomic DNA was extracted for PCR and Southern blot analysis. In parallel, the pooled PBS-positive cells were sorted by FACS. For PCR analysis, two sets of primers were designed. The first contained forward primer P7 upstream of 5'PG and reverse primer P8 from the CAGG promoter (product size 1.6 kb), and the second contained forward primer P9 from the rabbit beta-globin polyadenylation site and reverse P10 downstream of 3'PG ( product length 1.8 kb, Fig. 11B). In both pooled cells (Fig. 11C) and pure colonies (Fig. 11D), the expected products for 5' and 3' were detected, indicating that proper GR integration had occurred in these cells.

To further verify correct GR integration, as well as to confirm that only one copy of the targeting vector was integrated into the genome, Southern blot analysis was performed. Two PGC cell lines from male and female donors were analyzed. It should be noted that the female line has only one copy of the Z chromosome. Three dig-tagged DNA probes were designed (yellow boxes in Figure 12A and Figure 12B). The first two probes, amplified using primers P11-P12 and P13-P14, are 500 bp long. each, located above and below the 5' and 3' PGs, respectively. The third probe, amplified with 704 bp primers P15-P16, is designed to detect the Neo gene within the targeting vector, thereby confirming that only one copy of the vector has been integrated. The restriction enzyme BglII was used to digest genomic DNA for analysis. Two restriction sites located ~6.5 kb apart. from each other, located in the DT chromosome, above and below the 5' and 3' probes, respectively. An additional BglII site is located in the targeting vector, resulting in predicted 7.5-kb fragments. and 3.3 kb. to identify correct GR integration. Southern blot analysis of genomic DNA isolated from a male PGC line revealed 2 bands with a predicted size of 6.5 kb. for the DT allele and 7.5 kb. and 3.3 kb. for an allele that has undergone correct GR integration at the 5' and 3' sites, respectively. This was confirmed for both DNA from pooled cells and pure colonies (Fig. 12C). A similar analysis was performed for the female PGC cell line. In this case, one band with a predicted size of 7.5 kb was detected. for 5' integration site. Since the female genome contains only one copy of the Z chromosome, the DT allele (6.5 kb) was not detected. Probing of the Neo gene revealed a single 7.5-kb band, confirming that only one copy of the targeting vector was integrated into the genome (Fig. 12D).

Validation of the developmental system in HEK293 cells in vitro and in chick embryos in ovo.

To test the activity of the inducible system in vitro and in chick embryos in ovo, three plasmids, pmCherry-Cry2-CreN, pmCherry-CIBN-CreC and the PB-RAGE-GFP reporter, were transfected into HEK293 cells (Fig. 13) and into chick embryos ( Fig. 14). The first two optogenic plasmids encode the mCherry reporter gene, which confirms successful transfection. The PBRAGE-GFP expression vector contains a sequence of a number of stop codons flanked by LoxP sites before the coding region of the GPB. Once Cre is activated, the stop codons are removed, allowing expression of ZPB. Negative control HEK293 cells that were transfected three times and kept in the dark did not contain any ZPB-positive cells (Fig. 13, top row). In cells illuminated with blue light, 24 hours after transfection, many cells expressed ZPB (Fig. 13, bottom row), confirming the activation of the optogenetic system in these cells.

To test the activity of the optogenetic system in ovo, triple transfection with plasmids pmCherry-Cry2-CreN, pmCherry-CIBN-CreC and PB-RAGE-GFP was carried out by electroporation into the neural tubes of a chick embryo at stage 16 H&H. Twelve hours after electroporation, experimental group embryos were illuminated with blue light for 15 s, while negative control embryos were kept in the dark. Embryos were incubated for an additional 12 hours and checked for GFB expression under a fluorescent stereoscope (Fig. 14). While only mCherry was expressed in embryos kept in the dark (Fig. 14, top row), confirming successful electroporation, GFB-positive cells were clearly visible in embryos of the experimental group (Fig. 9, bottom row), confirming that there was light-inducible Cre is activated.

The optogenic plasmids pmCherry-Cry2-CreN and pmCherry-CIBN-CreC drive gene expression using the CMV ¹¹ promoter, which is undesirable in chicken cells. To overcome this and combine the two into one vector, the present inventors constructed a plasmid vector that drives the expression of CIBN-CreC and Cry2-CreN linked by a self-cleaving peptide P2A followed by IREG-GFP under the control of the CAGG promoter, which is highly active in chicken cages. The synthesis of pCAGG-CIBN-CreC-P2A-Cry2-CreN-IRES-GFP was based on modification of the original optogen plasmids described in Kennedy et al ¹¹ . Each of these plasmids encodes mCherry followed by an IRES sequence with CIBN-CreC (a truncated form of CIB1 fused to the C terminus of the Cre enzyme) or CRY2-CreN (cryptochrome 2 fused to the N terminus of the Cre enzyme, Fig. 15A). The goal of the next cloning was to combine the two fusion optogens with the self-cleaving peptide P2A under the control of the CAGG promoter followed by IRES-GFP. For this purpose, the CIBN-CreC plasmid was used as a template for HCC with primers P40 and P41, and the CRY2-CreN plasmid was used as a template for HCC with primers P42 and P43 (Fig. 15A). In particular, primers P41 and P42, which contain the P2A cleavage site, share an overlapping sequence that allows the two products to be combined in a single round of overhang extension PCR (Figure 15B). This product, which contains CIBN-CreC-P2A-CRY2-CreN, was ligated into the sequence-validated shuttle vector pJet1.2 (Fig. 15C). This plasmid served as a template for PCR with primers P44 and P45, which added a SmaI and NheI restriction site to the product at the 5' and 3' ends, respectively (Fig. 15D). This product was digested with restriction enzymes and ligated into the pCAGG-IRES-GFP plasmid, which was also cut using the same enzymes (Fig. 15E). This ligation product, containing the CAGG promoter followed by CIBN-CreC, the P2A self-cleaving peptide, Cry2-CreN, IRES, ZPB and a rabbit betaglobin polyadenylation site (referred to herein as pCAGG-Optogenes), was sequence checked (Figure 15F). .

To test the activity of the pCAGG-Optogene vector in vitro, a plasmid that expresses ZPB as a reporter of successful transfection was transfected into HEK293 cells together with pB-RAGEmCherry. Similar to the PB-RAGE-GFP vector described above (Fig. 13), pB-RAGE-mCherry contains a number of stop codon sequences flanked by LoxP sites upstream of the mCherry coding region. Once Cre is activated, the stop codons are removed, allowing mCherry to be expressed (Figure 16). While there were no mCherry-positive cells among HEK293 cells that were cotransfected and kept in the dark (Figure 16, top row), among cells that were illuminated with blue light, many cells expressed mCherry (Figure 16, bottom row), confirming that the single-vector pCAGG-Optogenes strategy preserves the optogenic properties of the system.

To test the activity of the pCAGG-Optogenes vector in living chick embryos in ovo, the plasmid was cotransfected by electroporation into chick embryos at stage 14-16 H&H along with pB-RAGE-mCherry. 12 h after electroporation, the eggs of the negative control group were kept in the dark, while the embryos of the experimental group were exposed to blue light for 15 s (Fig. 17). Both groups were further incubated for 12 h and examined under a fluorescence stereoscope. After incubation, both groups showed high levels of ZPB expression, indicating successful electroporation. However, only in the light-exposed group (Fig. 17, bottom row) were mCherry-positive expressing cells identified, indicating that the optogen system using the pCAGG-Optogenes single-vector strategy was activated in a light-inducible manner.

Induction of lethality in chicken embryos.

To demonstrate the feasibility of toxin-mediated lethality, the coding region of DTA ¹² , commonly used as a negative selection marker, was cloned into an expression vector containing the pGK promoter followed by the GFP IRES (pGK-IRESGFP). This plasmid also served as a negative control. The DTA coding region was cloned upstream of the IRES sequence to generate pGK-DTA-IRES-GFP, which, once expressed in cells, inhibits protein synthesis, leading to cell death.

To examine the effects of DTA expression in chick embryos, stage 14-16 H&H embryos were electroporated with the pGK-IRES-GFP vector as a negative control or with the pGK-DTA-IRES-GFP vector. Twelve hours after electroporation, embryos were analyzed for GPB expression under a fluorescence microscope (Fig. 18). While in control embryos ZPB was widely expressed in the neural tube (Fig. 18), in embryos expressing DTA no expression of ZPB was detected, indicating that protein synthesis in these cells was blocked.

Although the invention has been described in connection with specific embodiments thereof, it will be apparent to those skilled in the art that many alternatives exist.

-

Claims (12)

options, modifications and variations. Accordingly, it is intended to cover all such alternatives, modifications and variations that fall within the spirit and scope of the appended claims. All publications, patents and patent applications mentioned in this specification are hereby incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application had been specifically and individually stated to be incorporated by reference. Moreover, the citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art to this invention. To the extent that section headings are used, they should not be construed as mandatory limitations. Literature 1. HAMBURGER, V. & HAMILTON, N. L. A series of normal stages in the development of the chick embryo. J.Morphol. 88, 49-92 (1951). 2. Nandi, S. et al. Cryopreservation of specialized chicken lines using cultured primordial germ cells. Poult. Sci. 95, 1905-1911 (2016). 3. van de Lavoir, M.-C. et al. Germline transmission of genetically modified primordial germ cells. Nature 441, 766-9 (2006). 14. Karageng, L., Cinnamon, Y., Ginsburg, M. & Petitte, J. N. Origin of primordial germ cells in the prestreak chick embryo. Dev. Genet. 19, 290-301 (1996). 5. Naito, M., Harumi, T. & Kuwana, T. Long-term culture of chicken primordial germ cells isolated from embryonic blood and production of germline chimaeric chickens. Anim. Reprod. Sci. 153, 50-61 (2014). 6. Clinton, M., Haines, L., Belloir, B. & McBride, D. Sexing chick embryos: a rapid and simple protocol. Br. Poult. Sci. 42, 134-8 (2001). 7. Cinnamon, Y., Ben-Yair, R. & Kalcheim, C. Differential effects of N-cadherin-mediated adhesion on the development of myotomal waves. Development 133, 110112 (2006). 8. Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339.819-23 (2013). 9. Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281-2308 (2013). 10. Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345 (2009). 11. Kennedy, M. J. et al. Rapid blue-light?mediated induction of protein interactions in living cells. Nat. Methods Ί, 973-975 (2010). 12. Lu, Q. R. et al. Common developmental requirement for Olig function indicates a motor neuron/oligodendrocyte connection. Cell 109, 75-86 (2002). 13. Solter, D. & Knowles, V. B. Monoclonal antibody defining a stage-specific mouse embryonic antigen (SSEA-1). Proc. Natl. Acad. Sci. U.S.A. 75, 5565-9 (1978). 14. Mashiko, D. et al. Feasibility for a large scale mouse mutagenesis by injection CRISPR/Cas plasmid into zygotes. Dev. Growth Differ. 56, 122-9 (2014). CLAIM 1. A DNA editing agent comprising a first nucleic acid sequence for inducibly producing a lethal phenotype in betta embryos in a bird egg and a second nucleic acid sequence for directing said first nucleic acid sequence to the Z chromosome of a bird cell, wherein said first nucleic acid encodes: (i) a lethality protein selected from the group consisting of a toxin, a proapoptotic protein, proteins that affect the main stages of early embryogenesis, a Wnt signaling pathway inhibitor, a BMP antagonist, noggin, an FGF antagonist, and N-cadherin; or - 28 043573 (ii) a guide RNA that targets an essential avian gene selected from the group consisting of BMPR1A, BMP2, BMP4 and FGFR1; and wherein said second nucleic acid sequence comprises (iii) a left homology arm (LHA) comprising a nucleotide sequence that is substantially homologous to the 5' region flanking the target gene locus on the avian Z chromosome; and (iv) a right homology arm (RHH), containing a nucleotide sequence that is substantially homologous to the 3' region flanking the target gene locus on the avian Z chromosome. 2. A DNA editing agent according to claim 1, characterized in that said first nucleic acid sequence additionally contains: a sequence encoding an endonuclease enzyme that is operably linked to a nucleotide sequence encoding a switch that regulates the expression of said endonuclease enzyme, said switch being regulated by an inducer; and wherein said lethal protein or said guide RNA is operably linked to the activity of said endonuclease enzyme. 3. The DNA editing agent according to claim 2, characterized in that said inducer is a component of visible light. 4. The DNA editing agent according to claim 3, characterized in that the visible light component is blue light. 5. The DNA editing agent according to claim 1, characterized in that said first nucleic acid sequence further comprises a sequence encoding an RNA-guided DNA endonuclease enzyme. 6. The DNA editing agent according to claim 5, characterized in that said RNA-guided DNA endonuclease enzyme is selected from the group consisting of zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALENs) , English transcription activator-like effector nuclease), and caspase 9. 7. The DNA editing agent according to claim 1, characterized in that said bird is selected from the group consisting of chicken, turkey, duck and quail. 8. A population of cells comprising avian cells, wherein said cells contain primordial germ cells (PGCs) or gametes, and wherein said cells contain a DNA editing agent according to any one of claims 1 to 7 to produce a lethal phenotype in the male offspring of said avian . 9. A method for producing a chimeric bird, including introducing a population of PGCs into the embryo of a recipient bird under conditions sufficient for at least one of the PGCs to colonize the gonad of the embryo of the recipient bird, wherein said PGCs contain a DNA editing agent according to any one of claims 1- 7, thus obtaining a chimeric bird. 10. Chimeric bird obtained in accordance with the method according to claim 9. 11. A method for reducing the number of cockerels hatched from fertilized bird eggs, including: introducing a DNA editing agent according to any one of claims 1 to 7 into a chicken embryo in a bird egg to inducibly provide a lethal phenotype in cockerel embryos in the egg; and exposing said eggs to an inducer that produces a lethal phenotype, thereby reducing the number of male birds hatched from the fertilized eggs of the bird. 12. A method for reducing the number of cockerels hatched from fertilized bird eggs, including: mating of a female bird with a male bird, wherein a first exogenous polynucleotide that is operably linked to a recombinase recognition site is stably integrated into the Z chromosome of said male bird, wherein said exogenous polynucleotide is intended to produce a lethal phenotype in a cockerel embryo in the bird's egg, wherein said the first exogenous polynucleotide comprises a DNA editing agent according to any one of claims 1 to 7, and the second exogenous polynucleotide encoding a recombinase enzyme is stably integrated into the Z chromosome of said female bird, or mating of a female bird with a male bird, wherein the first exogenous polynucleotide, which is functionally associated with the recombinase recognition site, is stably integrated into the Z chromosome of the specified female bird, and the specified first exogenous polynucleotide is intended to provide a lethal phenotype in the cockerel embryo in the bird's egg, and the specified first exogenous polynucleotide contains a DNA editing agent according to any one of paragraphs .1-7, and the second exogenous polynucleotide encoding the recombinase enzyme is stably integrated into the Z chromosome of the specified male bird, thereby inducing a lethal phenotype in the cockerel embryo in the bird's egg, thereby reducing the number of cockerels hatching from fertilized bird eggs. -