EA042990B1 - TREATMENT OF GENOTYPED DIABETES PATIENTS WITH DPP-4 INHIBITORS SUCH AS LINAGLIPTIN - Google Patents

Description

The field of technology to which the present invention relates

The present invention provides dipeptidyl peptidase-4 (DPP-4) inhibitors, pharmaceutical compositions or combinations comprising a DPP-4 inhibitor as defined herein, and optionally one or more other active compounds for use in methods of treating or preventing conditions, as described herein, such as, for example, among others, one or more conditions selected from type 1 diabetes mellitus, type 2 diabetes mellitus, impaired glucose tolerance, impaired fasting blood glucose, and hyperglycemia.

In a specific embodiment, the therapeutic and/or prophylactic methods of the present invention comprise the step of identifying a patient to be treated and/or prevented, said identification comprising identifying in the patient variant(s) in one or more of the genes associated with metabolic diseases (e.g., belonging to the patient to the TCF7L2 risk genotype as described herein), or identifying an appropriate wild-type genotype in a patient (e.g., identifying a wild-type TCF7L2 genotype in a patient as described herein), and further the step of administering said DPP-4 inhibitor, pharmaceutical compositions or combinations to a patient identified as being treatable.

In addition, in one embodiment, the use of a DPP-4 inhibitor, pharmaceutical composition, combination, or drug, each as described herein, in a therapeutic and/or prophylactic method or for use according to the present invention for a patient who has a variant ( s) in one or more genes associated with metabolic diseases (such as, for example, a patient with the risk genotype TCF7L2, as described in this context).

Patients with the TCF7L2 risk genotype of the present invention include, but are not limited to, patients (especially type 2 diabetic patients) who have genetic risk variants in the TCF7L2 gene, and in most cases suffer from the pathological consequences of these variants, primarily associated with the rs7903146 TCF7L2 risk T-allele, such as patients with identified heterozygous CT risk genotype rs7903146 TCF7L2 or patients identified with homozygous TT risk genotype rs7903146 TCF7L2.

In addition, in another embodiment, the use of a DPP-4 inhibitor, pharmaceutical composition, combination or drug, each as described herein, in a therapeutic and/or prophylactic method or for use according to the present invention for a patient with a wild-type TCF7L2 genotype, primarily with the wild-type CC rs7903146 TCF7L2 genotype.

In addition, the present invention provides a diagnostic method for identifying a subject (primarily a type 2 diabetic patient) who is statistically most likely to experience a favorable response (e.g., achieving glycemic control, e.g., HbA1c levels) to administration of a therapeutically effective amount of an inhibitor. DPP-4, optionally in combination with one or more other active compounds (e.g., antidiabetic agents), said method being that the subject is diagnosed with the TCF7L2 risk genotype (primarily the CT or TT risk genotype rs7903146 TCF7L2) or the wild-type TCF7L2 genotype. type (primarily CC genotype rs7903146 TCF7L2 wild type), while a subject that is homozygous CC genotype rs7903146 TCF7L2 wild type (and to a lesser extent, a subject that is heterozygous genotype at risk CT rs7903146 TCF7L2) has an increased likelihood of a favorable response on administration of a DPP-4 inhibitor compared to a subject with a homozygous TT risk genotype rs7903146 TCF7L2.

In addition, the present invention provides a method for preventing, slowing the progression, arresting or treating a metabolic disorder;

improving glycemic control and/or lowering fasting plasma glucose, postprandial plasma glucose, and/or glycated hemoglobin HbA1c levels;

preventing, slowing, arresting or reversing the progression of diseases from impaired glucose tolerance, impaired fasting blood glucose, insulin resistance and/or metabolic syndrome to type 2 diabetes mellitus;

preventing, slowing the progression, arresting or treating a condition or disorder selected from the group consisting of complications mediated by diabetes mellitus;

reducing body weight and/or adipose tissue or preventing an increase in body weight and/or adipose tissue or accelerating the reduction of body weight and/or adipose tissue;

preventing or treating degeneration of pancreatic β-cells and/or improving and/or restoring or protecting the functionality of pancreatic β-cells and/or restoring the functionality of pancreatic insulin secretion;

preventing, slowing, arresting or treating diseases or conditions associated with abnormal accumulation of liver fat or ectopic fat; or maintaining and/or improving insulin sensitivity and/or treating or preventing hyperinsulinemia and/or insulin resistance;

- 1 042990 prevention, delay, suspension or treatment of diabetes for the first time developed after transplantation (DTDP) and / or post-transplant metabolic syndrome (PTMS);

prevention, delay or reduction of complications associated with DVRPT and/or PTMS, including micro- and macrovascular diseases and events, graft rejection, infection and death;

treatment of conditions associated with hyperglycemia and hyperuricemia in patients in need of such treatment, for example, in patients (primarily patients with type 2 diabetes mellitus) who have variant(s) in one or more genes associated with metabolic diseases (such as, for example, patients with the TCF7L2 risk genotype, as described herein), or in patients who are of the corresponding wild-type genotype (such as, for example, the wild-type TCF7L2 genotype, as described herein), wherein said the method is that a variant(s) in one or more genes associated with metabolic diseases are detected in a patient/patient (for example, a TCF7L2 risk genotype is detected in a patient/patient, as described in this context) or the corresponding wild genotype is detected in a patient type (eg wild type TCF7L2 genotype as described herein) and a DPP-4 inhibitor as defined below (preferably linagliptin) is administered, optionally in combination with one or more other active compounds.

In addition, the present invention provides the use of a DPP-4 inhibitor for the preparation of a medicament for use in a method as described herein.

In addition, the present invention provides the use of a DPP-4 inhibitor for the treatment of a patient (primarily a human with type 2 diabetes mellitus) as described herein.

In addition, the present invention provides the use of a DPP-4 inhibitor in the treatment or prevention (especially metabolic) of a disease, disorder or condition (especially diabetes, especially type 2 diabetes mellitus and conditions mediated by it, such as, for example, those associated with diabetes complications) as described in this context.

In addition, the present invention provides the use of a pharmaceutical composition or combination of the present invention for the preparation of a medicament for use in a method as described herein.

The present invention also provides DPP-4 inhibitors as described herein for use in a method as described herein, said method comprising administering a DPP-4 inhibitor to a patient, optionally in combination with one or more other active compounds (which, for example, can be selected from the compounds mentioned in this context).

BACKGROUND OF THE INVENTION

Type 2 diabetes is becoming an increasingly common disease, which, due to the high rate of complications, leads to a significant reduction in life expectancy. Due to diabetes-related microvascular complications in industrialized countries, type 2 diabetes is currently the most common cause of visual loss, kidney failure and limb amputations in adults. In addition, type 2 diabetes increases the risk of cardiovascular disease by 2-5 times.

After a long period of disease progression, most type 2 diabetic patients become resistant to oral treatments as well as insulin dependent, requiring daily injections and multiple daily glucose measurements.

The UK Diabetes Prospective Study (UKPDS) found that intensive treatment with metformin, sulfonylurea or insulin resulted in only a limited improvement in glycemic control (difference in HbA1c levels of ~0.9%). In addition, even in patients in the intensive treatment group, glycemic control significantly deteriorates over time, which is explained by the deterioration of β-cell function. It is important to note that with intensive treatment, there is no significant reduction in microvascular complications; cardiovascular events. As such, many patients suffering from type 2 diabetes mellitus are largely untreatable, due in part to the limitations of long-term efficacy, tolerability, and dosing difficulties that characterize current hypoglycemic treatments.

Oral and non-oral antidiabetic drugs commonly used in treatment (eg, such as first or second line therapies and/or mono- or combination (primary or add-on) therapies) include, but are not limited to, metformin, sulfonylurea , thiazolidinediones, glinides, α-glucosidase inhibitors, glucagon-like peptide 1 (GLP-1) or GLP-1 analogs, and insulin or insulin analogs.

Many cases of treatment failure are the main reason for the high rate of long-term complications associated with hyperglycemia or chronic diseases (including micro- and macrovascular complications, such as diabetic nephropathy, retinopathy or

- 2 042990 neuropathy or cardiovascular complications) in patients suffering from type 2 diabetes.

Genetic association studies have identified genetic variants in several genes that are associated with an increased risk of developing type 2 diabetes. For example, variants in the TCF7L2, KCNJ11, and PPARG genes independently and consistently increase the risk of disease progression from impaired fasting glucose and impaired glucose tolerance to overt diabetes. Although a variation in KCNJ11 may alter insulin secretion and a variation in PPARG may alter insulin action, TCF7L2 (factor 2, similar to T-specific transcription factor 7) is the main susceptibility gene currently identified for type 2 diabetes in various ethnic groups (e.g. , Europeans, Indians and Japanese, Mexican Americans, and West Africans). Polymorphisms (single nucleotide polymorphisms, so-called SNPs) in the TCF7L2 gene, such as, for example, rs12255372 and above all rs7903146 are mainly associated with diabetes. The risk of developing type 2 diabetes increases by approximately 45% (odds ratio is 1.45) among carriers of the T-risk allele of the rs7903146 polymorphism of the TCF7L2 gene (heterozygous CT) and at least doubles (odds ratio is 12.41) among homozygous TT genotypes for compared with homozygous wild-type CC genotypes (Grant et al., Nature Genetics, vol. 38, pp. 320-323 (2006)). TCF7L2 risk genotypes are associated with increased expression of TCF7L2 in pancreatic β-cells, impaired (glucose-stimulated) insulin secretion, incretin action, and an increased rate of hepatic glucose production, as well as susceptibility to type 2 diabetes and the predicted development of type 2 diabetes in the future (see Table 1). Lyssenko et al., The Journal of Clinical Investigation, vol. 117, no. 8, pp. 2155-2163 (2007)). It has been proven that risk variants of the rs7903146 polymorphism of the TCF7L2 gene are associated with a reduced effect of incretins on insulin secretion, which may be due, at least in part, to impaired sensitivity of β-cells to incretins.

In this regard, problems should be expected during the antidiabetic treatment of patients with diabetes who have identified TCF7L2 risk variants, especially carriers of the rs7903146 TCF7L2 risk T-allele, such as patients with identified CT genotype rs7903146 TCF7L2 or primarily patients with identified TT genotype rs7903146TCF7L2.

There is therefore an unfulfilled need in medicine to develop methods, drugs and pharmaceutical compositions or combinations with sufficiently high efficacy in terms of glycemic control, in terms of disease-modifying properties, and in reducing morbidity and mortality associated with cardiovascular diseases. , and at the same time characterized by an improved safety profile.

DPP-4 inhibitors are another new class of agents that have been developed to treat or improve glycemic control in patients with type 2 diabetes.

For example, DPP-4 inhibitors and their use are described in WO 2002/068420, WO 2004/018467, WO 2004/018468, WO 2004/018469, WO 2004/041820, WO 2004/046148, WO 2005/051950, WO 2005/ 082906, WO 2005/063750, WO 2005/085246, WO 2006/027204, WO 2006/029769, WO2007/014886, WO 2004/050658, WO 2004/111051, WO 2005/05 8901, WO 2005/097798, WO 2006/068163 , WO 2007/071738, WO 2008/017670, WO 2007/128721, WO 2007/128724, WO 2007/128761 or WO 2009/121945.

Purpose of the present invention

The purpose of the present invention is to provide a medicament and/or method for preventing, slowing the progression, arresting or treating a metabolic disorder, especially type 2 diabetes mellitus.

A further object of the present invention is to provide a medicament and/or method for improving glycemic control in a patient in need of such treatment, especially in patients with type 2 diabetes mellitus, for example, in patients who have variant(s) in one or more genes associated with metabolic diseases (such as, for example, patients with the risk genotype TCF7L2, as described herein), or in patients who have the corresponding wild-type genotype.

Another object of the present invention is to provide a medicament and/or method for improving glycemic control in a patient with insufficient glycemic control despite treatment in a monotherapy regimen using an antidiabetic drug, for example, metformin, or despite combined treatment with two or three antidiabetic drugs. , for example, in a patient with variant(s) in one or more metabolic disease-associated genes (such as, for example, a patient with the risk genotype TCF7L2, as described herein), or in a patient who has the corresponding wild-type genotype .

Another object of the present invention is to provide a medicament and/or method for preventing, slowing or arresting disease progression from impaired glucose tolerance (IGT), impaired fasting blood glucose (IFG), resistance to

- 3 042990 insulin and/or metabolic syndrome to type 2 diabetes mellitus.

Yet another object of the present invention is to provide a medicament and/or method for preventing, slowing the progression, arresting or treating a condition or disorder selected from the group consisting of complications mediated by diabetes mellitus.

A further object of the present invention is to provide a medicament and/or method for reducing body weight or preventing weight gain in a patient in need thereof, for example, in a patient who has variant(s) in one or more genes associated with metabolic diseases (such as, for example, a patient with the TCF7L2 risk genotype as described herein), or in a patient that is of the corresponding wild-type genotype.

Another object of the present invention is to develop a drug that is highly effective in the treatment of metabolic disorders, especially diabetes mellitus, IGT, NGN, and/or hyperglycemia, and said drug is characterized by sufficiently or extremely high pharmacological and/or pharmacokinetic and/or physico - chemical properties.

Other objects of the present invention appear obvious to those skilled in the art based on the description and examples of the present application.

Brief summary of the invention

The present invention has found that a DPP-4 inhibitor, preferably linagliptin, as well as a pharmaceutical composition or combination comprising a DPP-4 inhibitor and optionally one or more other active compounds (for example, antidiabetic agents), is therapeutically effective for improving glycemic control and treatment diabetes mellitus type 2 patients with risk genotype CT or TT rs7903146 TCF7L2, as well as patients with wild-type CC genotype rs7903146 TCF7L2.

First of all, it was found that all studied patients with the TCF7L2 genotype (patients with the CT or TT risk genotype rs7903146 TCF7L2 or with the wild-type CC rs7903146 TCF7L2 genotype) had a clinically significant response to the administration of a DPP-4 inhibitor, preferably linagliptin.

In this regard, in the present invention, certain subgroups of diabetic patients amenable to the antidiabetic treatment of the present invention (including preferably the use of linagliptin, optionally in combination with one or more other active compounds, such as, for example, other antidiabetic compounds, as described in this context ), include, for example, but not limited to, patients who have the CC or CT or TT genotype rs7903146 TCF7L2, respectively.

The present invention has further found that DPP-4 inhibitors as defined herein, as well as pharmaceutical compositions or combinations comprising a DPP-4 inhibitor as defined herein and optionally one or more other active compounds, can be used. in a method for preventing, slowing the progression, arresting (for example, arresting the onset of development) or treating a metabolic disorder (especially diabetes, especially type 2 diabetes mellitus and related conditions, for example, diabetes-mediated complications), especially in a method for improving the glycemic control of a patient , such as a patient who has identified variant(s) in one or more genes associated with metabolic diseases (such as, for example, patients with the risk genotype TCF7L2, as described in this context).

The present invention has further found that DPP-4 inhibitors as defined herein, as well as pharmaceutical compositions or combinations comprising a DPP-4 inhibitor as defined herein and optionally one or more other active compounds, can be used. in a method for preventing, slowing the progression, arresting (for example, arresting the onset of development) or treating a metabolic disorder (primarily diabetes, primarily type 2 diabetes mellitus and related conditions), primarily in a method for improving the glycemic control of a patient, such as a patient who is to the wild-type TCF7L2 genotype, primarily to the wild-type CC rs7903146 TCF7L2 genotype.

In one embodiment, the method includes the step of identifying a patient susceptible to the method used, for example, comprising identifying in the patient variant(s) in one or more genes associated with metabolic diseases (for example, the patient's belonging to the TCF7L2 risk genotype, as described in this context) , or whether the patient is of the wild-type TCF7L2 genotype as described herein, and the step of administering said DPP-4 inhibitor, pharmaceutical composition, or combination to a patient who has been found to be susceptible to the method.

This principle opens up new therapeutic possibilities for the treatment and prevention of type 2 diabetes mellitus, overweight, obesity, diabetes-related complications and related pathological conditions, including patients who have variant(s) in one or more genes. associated with metabolic diseases (such as, for example, patients with the TCF7L2 risk genotype, as described herein), as well as patients who

- 4 042990 refer to the corresponding wild-type genotype (for example, such as patients with the genotype

TCF7L2 wild-type, as described in this context).

In addition, the present invention provides a method for determining the likelihood of a favorable response (for example, while providing glycemic control) or the magnitude of a favorable change in the level of HbA1c in an individual as a result of treatment of an individual with a DPP-4 inhibitor, preferably linagliptin, or a DPP-4 inhibitor in combination with one or more than other active compounds (for example, antidiabetic agents), and this method consists in identifying whether the subject belongs to the TCF7L2 risk genotype (primarily to the TT risk genotype rs7903146 TCF7L2) or to the wild-type TCF7L2 genotype (primarily to the SS genotype rs7903146 TCF7L2 wild-type), with the likelihood of a favorable response or a significant beneficial change in HbA1c levels as a response to the administration of a DPP-4 inhibitor, preferably linagliptin, or a DPP-4 inhibitor in combination with one or more other active compounds (for example, antidiabetic agents) increased in an individual with a homozygous wild-type CC genotype rs7903146 TCF7L2 and decreased in an individual with a homozygous TT risk genotype rs7903146 TCF7L2 (but still, for example, clinically significant or significant).

In this regard, in one object, a pharmaceutical composition or combination is provided, including:

(a) a DPP-4 inhibitor, and optionally (b) a second anti-diabetic agent selected from the group G3, including biguanides (primarily metformin), thiazolidinediones, sulfonylureas, glinides, α-glucosidase inhibitors, GLP-1 or GLP-1 analogues, as well as insulin or insulin analogs, and optionally (c) a third antidiabetic agent other than agent (b) selected from group G3, including biguanides (primarily metformin), thiazolidinediones, sulfonylureas, glinides, α-glucosidase inhibitors, GLP-1 or analogs of GLP-1, as well as insulin or insulin analogs, or a pharmaceutically acceptable salt of these compounds.

The sub-object proposes a pharmaceutical composition or combination comprising:

(a) a DPP-4 inhibitor, and optionally (b) a second anti-diabetic agent selected from the group G3, including biguanides (primarily metformin), thiazolidinediones, sulfonylureas, glinides, α-glucosidase inhibitors, GLP-1 or GLP-1 analogues, as well as insulin or insulin analogs, and optionally (c) a third antidiabetic agent other than agent (b) selected from the group consisting of metformin, sulfonylurea, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP-1, or an analogue of GLP-1, as well as insulin or an analogue of insulin, or a pharmaceutically acceptable salt of these compounds.

In another sub-object, a pharmaceutical composition or combination is provided, comprising:

(a) a DPP-4 inhibitor, and optionally (b) a second antidiabetic agent selected from the group consisting of metformin, a sulfonylurea, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP1 or GLP-1 analog, and insulin or an insulin analog, and optionally (c) a third anti-diabetic agent other than agent (b) selected from group G3 comprising biguanides (primarily metformin), thiazolidinediones, sulfonylureas, glinides, α-glucosidase inhibitors, GLP-1 or GLP analogs -1, as well as insulin or insulin analogs, or a pharmaceutically acceptable salt of these compounds.

The following sub-object provides a pharmaceutical composition or combination comprising:

(a) a DPP-4 inhibitor, and optionally (b) a second antidiabetic agent selected from the group consisting of metformin, a sulfonylurea and pioglitazone, and optionally (c) a third antidiabetic agent other than agent (b) selected from the group consisting of metformin , sulfonylurea, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP-1 or GLP-1 analog, and insulin or insulin analog, or a pharmaceutically acceptable salt of these compounds.

In another sub-object, a pharmaceutical composition or combination is provided, comprising:

(a) a DPP-4 inhibitor, and optionally (b) a second antidiabetic agent selected from the group consisting of metformin, a sulfonylurea, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP1 or GLP-1 analog, and insulin or an insulin analogue, and optionally (c) a third antidiabetic agent other than (b) selected from the group consisting of metformin, a sulfonylurea and pioglitazone, or a pharmaceutically acceptable salt of these compounds.

In yet another sub-object, a pharmaceutical composition or combination is provided, comprising:

(a) a DPP-4 inhibitor, and optionally

- 5 042990 (b) a second antidiabetic agent selected from the group consisting of metformin and pioglitazone, and optionally (c) a third antidiabetic agent other than agent (b) selected from the group including metformin, a sulfonylurea and pioglitazone, or a pharmaceutically acceptable salt the indicated compounds.

In yet another sub-object, a pharmaceutical composition or combination is provided, comprising:

(a) a DPP-4 inhibitor, and optionally (b) a second antidiabetic agent selected from the group consisting of metformin, a sulfonylurea and pioglitazone, and optionally (c) a third antidiabetic agent other than agent (b) selected from the group consisting of metformin and pioglitazone, or a pharmaceutically acceptable salt of these compounds.

If a third antidiabetic agent is selected along with the second antidiabetic agent, said third antidiabetic agent is preferably selected from a different class than the second antidiabetic agent. Thus, it should be understood that the second and third antidiabetic agents are different and preferably belong to different classes (eg, if the second antidiabetic agent is selected from the biguanide class, the third antidiabetic agent is preferably selected from another class). Classes of antidiabetic agents include, for example, the biguanide class mentioned above, the thiazolidinedione class, the sulfonylurea class, the glinide class, the α-glucosidase inhibitor class, the GLP-1 analog class, the insulin class, and the like.

In a specific embodiment, the present invention provides monotherapy treatment with a DPP-4 inhibitor as defined herein and/or pharmaceutical compositions comprising a DPP-4 inhibitor as the sole active ingredient.

In the case of combinations and/or combination treatments of the present invention, in a particular embodiment, dual combinations and/or dual therapy are provided, in another embodiment, triple combinations and/or triple therapy are provided.

In another aspect, a method is provided for preventing, slowing the progression, arresting, or treating a metabolic disorder selected from the group consisting of type 1 diabetes mellitus, type 2 diabetes mellitus, IGT, NGN, hyperglycemia, postprandial hyperglycemia, overweight, obesity, and metabolic syndrome. in a patient in need of such treatment, and said method comprises administering to the patient a DPP-4 inhibitor and optionally a second and optionally a third antidiabetic agent as defined herein, eg, as a combination.

In another aspect, a method is provided for preventing, slowing the progression, arresting, or treating a metabolic disorder selected from the group consisting of insulin resistance, hyperlipidemia, hypercholesterolemia, dyslipidemia, hypertension, chronic systemic inflammation, retinopathy, neuropathy, nephropathy, atherosclerosis, endothelial dysfunction, nonalcoholic adipose liver disease (NAFLD) and osteoporosis in a patient in need of said treatment, and said method comprising administering to the patient a DPP-4 inhibitor and optionally a second and optionally third antidiabetic agent as defined herein, e.g., as a combination.

In another aspect, a method is provided for improving glycemic control and/or lowering fasting plasma glucose, postprandial plasma glucose, and/or glycated hemoglobin HbA1c levels in a patient in need thereof, said method comprising administering an inhibitor to the patient. DPP-4 and optionally a second and optionally a third anti-diabetic agent as defined herein, eg as a combination.

The pharmaceutical composition of the present invention may also have valuable disease-modifying properties in relation to diseases or conditions associated with IGT, NGN, insulin resistance and/or metabolic syndrome.

In another object, a method is provided for preventing, slowing, arresting or reversing the progression of diseases from IGT, NGN, insulin resistance and/or metabolic syndrome to type 2 diabetes mellitus in a patient in need thereof, said method consisting in the fact that the patient administering a DPP-4 inhibitor and optionally a second and optionally a third anti-diabetic agent as defined herein, eg as a combination.

Since the use of the pharmaceutical composition or combination of the present invention provides improved glycemic control in patients in need thereof, conditions and/or diseases associated with or mediated by elevated blood glucose can also be treated.

In another aspect, a method is provided for preventing, slowing the progression, arresting, or treating a condition or disorder selected from the group consisting of complications mediated by diabetes mellitus such as cataracts, as well as micro- and macrovascular diseases, such as nephropathy, retinopathy, neuropathy, cognitive impairment. ability and memory, neurodegenerative or cognitive disorders, cardio- or cerebrovascular diseases, atherosclerosis, hypertension, endothelial dysfunction, myocardial infarction, acute coronary syndrome, unstable angina, stable angina, cardiomyopathy, heart failure, cardiac arrhythmias, vascular restenosis , peripheral artery occlusive disease, stroke, tissue ischemia, or diabetic foot or diabetic ulcers in a patient in need of said treatment, said method comprising administering to the patient a DPP-4 inhibitor and optionally a second and optionally third antidiabetic agent as defined in in this context, for example, as a combination. First of all, you can treat, slow the progression or prevent the development of one or more manifestations of diabetic nephropathy, such as hyperperfusion, proteinuria and albuminuria (including micro- and macroalbuminuria). The term tissue ischemia primarily refers to diabetic macroangiopathy, diabetic microangiopathy, impaired wound healing, and diabetic ulcer. In the present description, the terms micro- and macrovascular diseases and micro- and macrovascular complications are used interchangeably.

In one embodiment, with the introduction of the pharmaceutical composition or combination of the present invention, no increase in body weight is observed, or even a decrease in body weight occurs.

In another object, a method is provided for reducing body weight and/or adipose tissue in the body or preventing an increase in body weight and/or adipose tissue or accelerating the reduction of body weight and/or adipose tissue in a patient in need thereof, said method comprising: the patient is administered a DPP-4 inhibitor and optionally a second and optionally third anti-diabetic agent as defined herein, eg, as a combination.

In one embodiment, administration of a pharmaceutical composition or combination of the present invention may delay or prevent β-cell degeneration and decrease in β-cell functionality, such as apoptosis or necrosis of pancreatic β-cells. In addition, it is possible to increase or restore the functionality of pancreatic cells, as well as to increase the number and size of pancreatic β-cells. It can be found that the differentiation status and hyperplasia of pancreatic β-cells disturbed by hyperglycemia can be normalized by treatment with the pharmaceutical composition or combination of the present invention.

In another aspect, a method is provided for preventing, slowing, halting or treating pancreatic β-cell degeneration and/or reducing pancreatic β-cell functionality and/or improving and/or restoring pancreatic β-cell functionality and/or restoring the functionality of pancreatic insulin secretion. gland in a patient in need thereof, said method comprising administering to the patient a DPP-4 inhibitor and optionally a second and optionally a third anti-diabetic agent as defined herein, eg as a combination.

In one embodiment, administration of the pharmaceutical composition or combination of the present invention can reduce or suppress abnormal accumulation of (ectopic) fat, primarily in the liver.

In another aspect, a method is provided for preventing, slowing, arresting, or treating diseases or conditions mediated by abnormal accumulation of liver fat or ectopic fat in a patient in need thereof, said method comprising administering to the patient a DPP-4 inhibitor and optionally a second and optionally a third anti-diabetic agent as defined herein, eg as a combination. Diseases or conditions that are mediated by abnormal accumulation of liver fat or ectopic fat are preferably selected from the group consisting of non-specific fatty liver disease, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hyperalimentation-induced fatty liver disease, diabetic fatty liver disease, alcoholic fatty liver disease. hepatosis or toxic fatty liver, especially NAFLD, including fatty liver, NASH and / or liver fibrosis.

In a further aspect of the present invention, there is provided a method for preventing, slowing the progression, arresting, ameliorating symptoms, treating or reversing the progression of fatty liver, (hepatic) inflammation and/or abnormal accumulation of liver fat in a patient in need thereof, said method comprising: that the patient is administered a DPP-4 inhibitor and optionally a second and optionally third anti-diabetic agent, as defined herein, for example, as a combination.

In another aspect, a method is provided for maintaining and/or improving insulin sensitivity and/or treating or preventing hyperinsulinemia and/or insulin resistance in a patient in need thereof, said method comprising administering to the patient a DPP-4 inhibitor and optionally a second and optionally a third anti-diabetic agent as defined herein, eg as a combination.

In another object, a method is provided for preventing, slowing the progression, stopping or treating DDPRT and/or PTMS in a patient in need thereof, said method comprising administering to the patient a DPP-4 inhibitor and optionally a second and optionally third

- 7 042990 anti-diabetic agent, as defined in this context, for example, as a combination.

In yet another aspect of the present invention, a method is provided for preventing, arresting, or ameliorating symptoms of complications mediated by DDPRT and/or PTMS, including micro- and macrovascular disease and events, transplant rejection, infection, and death, in a patient in need thereof, wherein said method comprises administering to the patient a DPP-4 inhibitor and optionally a second and optionally third anti-diabetic agent as defined herein, for example, as a combination.

In another aspect, the present invention provides a method for treating hyperglycemia and hyperuricemia mediated conditions such as, for example, gout, hypertension and renal failure in a patient in need of said treatment, said method comprising administering to the patient a DPP-4 inhibitor and optionally a second and optionally a third anti-diabetic agent as defined herein, eg as a combination.

In another aspect, the present invention provides the use of a DPP-4 inhibitor for the manufacture of a medicament for use in a method for preventing, slowing the progression, arresting, or treating a metabolic disorder selected from the group consisting of type 1 diabetes mellitus, type 2 diabetes mellitus, IGT, NGN. , hyperglycemia, postprandial hyperglycemia, overweight, obesity, and metabolic syndrome; or improving glycemic control and/or lowering fasting plasma glucose, postprandial plasma glucose, and/or glycated hemoglobin HbA1c levels; or preventing, slowing, arresting or reversing the progression of diseases from IGT, NGN, insulin resistance and/or metabolic syndrome to type 2 diabetes mellitus; or prevention, retardation of progression, suspension or treatment of a condition or disorder selected from the group including complications associated with diabetes mellitus such as cataracts, as well as micro- and macrovascular diseases such as nephropathy, retinopathy, neuropathy, tissue ischemia, atherosclerosis, myocardial infarction, stroke and peripheral arterial occlusive disease; or reducing body weight and/or adipose tissue or preventing an increase in body weight and/or adipose tissue or accelerating the reduction of body weight and/or adipose tissue; or preventing, slowing, arresting or treating pancreatic β-cell degeneration and/or reduction of pancreatic β-cell functionality and/or improving and/or restoring or protecting pancreatic β-cell functionality and/or restoring the functionality of pancreatic insulin secretion; or prevention, delay, suspension or treatment of diseases or conditions mediated by abnormal accumulation of fat in the liver or ectopic fat; or maintaining and/or improving insulin sensitivity and/or treating or preventing hyperinsulinemia and/or insulin resistance; or the prevention, slowing down of progression, suspension or treatment of DVRPT and/or PTMS; or preventing, slowing down, or reducing symptoms of complications mediated by DDPRT and/or PTMS, including micro- and macrovascular disease and events, graft rejection, infection, and death; or treating hyperglycemia and hyperuricemia mediated conditions in a patient in need thereof, said method comprising administering to the patient a DPP-4 inhibitor and optionally a second and optionally a third antidiabetic agent as defined herein, e.g., as a combination.

In another aspect, the use of a second antidiabetic agent, as defined herein, is provided for the manufacture of a medicament for use in a method for preventing, slowing the progression, arresting, or treating a metabolic disorder selected from the group consisting of type 1 diabetes mellitus, type 2 diabetes mellitus. , IGT, NGN, hyperglycemia, postprandial hyperglycemia, overweight, obesity, and metabolic syndrome; or improving glycemic control and/or lowering fasting plasma glucose, postprandial plasma glucose, and/or glycated hemoglobin HbA1c levels; or preventing, slowing, arresting or reversing the progression of diseases from IGT, NGN, insulin resistance and/or metabolic syndrome to type 2 diabetes mellitus; or prevention, retardation of progression, suspension or treatment of a condition or disorder selected from the group including complications associated with diabetes mellitus such as cataracts, as well as micro- and macrovascular diseases such as nephropathy, retinopathy, neuropathy, tissue ischemia, atherosclerosis, myocardial infarction, stroke and peripheral arterial occlusive disease; or reducing body weight and/or adipose tissue or preventing an increase in body weight and/or adipose tissue or accelerating the reduction of body weight and/or adipose tissue; or preventing, slowing, arresting or treating pancreatic β-cell degeneration and/or reduction of pancreatic β-cell functionality and/or improvement and/or restoration of pancreatic β-cell functionality and/or restoration of pancreatic insulin secretion functionality gland; or prevention, delay, suspension or treatment of diseases or conditions mediated by abnormal accumulation of fat in the liver or ectopic fat; or maintaining and/or improving insulin sensitivity and/or treating or preventing hyperinsulinemia and/or insulin resistance in a patient in need thereof, said method comprising administering to the patient a second antidiabetic agent in combination with a DPP-4 inhibitor and optionally with a third anti-diabetic agent as defined herein.

In another aspect of the present invention, the use of the pharmaceutical composition of the present invention is provided for the preparation of a medicament intended for a therapeutic and prophylactic method as described herein.

Patients with the TCF7L2 risk genotype (in this context, the so-called patients belonging to the TCF7L2 risk genotype) of the present invention will include patients who are carriers of one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, primarily a SNP selected from the rs7903146 polymorphism . CT genotype or TT genotype, especially patients who are carriers of two T-alleles of the SNP rs7903146 of the TCF7L2 gene, i.e. TT genotype, and are at high risk of developing the disease, and which may have problems with treatment (for example, when achieving adequate glycemic control).

The present invention provides a DPP-4 inhibitor (preferably linagliptin), pharmaceutical composition, combination or medicament of the present invention for use in a therapeutic and/or prophylactic method as described herein (e.g. for the treatment of type 2 diabetes), in one or more of the following patient groups:

patients with the high-risk genotype TCF7L2 who are carriers of two T-alleles of the SNP rs7903146 of the TCF7L2 gene, i.e. TT genotype (this provides a clinically significant response, for example, with glycemic control);

patients with the risk genotype TCF7L2 who are carriers of one SNP T-allele rs7903146 of the TCF7L2 gene, i.e. CT genotype (this provides a clinically favorable response, for example, with glycemic control);

patients with the wild-type TCF7L2 genotype who are carriers of two CC SNP rs7903146 alleles of the TCF7L2 gene, i.e. CC genotype (this provides a clinically more favorable response, for example, with glycemic control).

In a specific aspect of the present invention, a DPP-4 inhibitor, pharmaceutical composition or combination of the present invention is provided for a therapeutic and/or prophylactic method or use as described herein (e.g., treatment of type 2 diabetes), said method or use comprising that (1) identifying a patient who is susceptible to said therapeutic and/or prophylactic method or use, including identifying the patient for any TCF7L2 risk genotype, primarily identifying the patient for one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2 rs7903146, rs12255372 and rs10885406 polymorphisms, for example, the detection of at least one T-allele of the SNP rs7903146 of the TCF7L2 gene in a patient, for example, the CT genotype (i.e. the detection of one T-allele of the SNP rs7903146 gene in a patient TCF7L2) or, first of all, the detection of the TT genotype in a patient (i.e., the detection of two T-alleles of the SNP rs7903146 of the TCF7L2 gene in the patient), or the detection of the wild-type TCF7L2 genotype in the patient, primarily two C-alleles of the SNP rs7903146 of the TCF7L2 gene (i.e. e. wild-type CC genotype); and (2) administering to the patient identified in step (1) an effective amount of the DPP-4 inhibitor, pharmaceutical composition, or combination.

In another specific aspect, the present invention provides a DPP-4 inhibitor, pharmaceutical composition, combination, or medicament of the present invention for a therapeutic and/or prophylactic method or use as described herein (e.g., for the treatment of type 2 diabetes) in patients with risk genotype TCF7L2, for example, in patients who have one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, primarily a SNP selected from the polymorphism rs7903146, rs12255372 and rs10885406, especially the polymorphism rs7903146, more specifically, in patients who are carriers of at least one SNP T-allele rs7903146 of the TCF7L2 gene, i.e. CT genotype or TT genotype.

In another specific aspect, the present invention provides a DPP-4 inhibitor, pharmaceutical composition, combination or medicament of the present invention for a therapeutic and/or prophylactic method or use as described herein (e.g., for the treatment of type 2 diabetes) , in patients with the wild-type TCF7L2 genotype, for example, in patients who are carriers of two alleles of the SS SNP rs7903146 of the TCF7L2 gene, i.e. genotype SS.

In this context, a specific subpopulation of patients described in this context (for example, patients in need of a therapeutic or prophylactic method, as described in this context), are patients who have one or more SNPs in the gene encoding TCF7L2, primarily, at least one SNP selected from the polymorphism rs7903146, rs12255372 and rs10885406, especially the polymorphism rs7903146, more specifically, patients who carry at least one SNP T-allele rs7903146 of the TCF7L2 gene, i.e. CT genotype or TT genotype.

More specifically, patients who carry at least one SNP T-allele rs7903146 of the TCF7L2 gene, i.e. CT genotype or TT genotype, primarily carriers of two T-alleles of the SNP rs7903146 of the TCF7L2 gene, i.e. TT genotype are highly susceptible to increased expression of TCF7L2 in pancreatic β-cells, impaired insulin secretion, incretin actions, increased rate of hepatic glucose production and/or diabetes. The TCF7L2 gene rs7903146 polymorphism tail is associated with impaired insulinotropic action of incretin hormones, decreased 24-hour plasma insulin and glucagon profiles, and increased hepatic glucose production.

Another specific subpopulation of patients described in this context (for example, patients in need of a therapeutic or prophylactic method, as described in this context), are patients who belong to the wild-type TCF7L2 genotype, primarily patients who belong to the rs7903146 TCF7L2 CC genotype wild type.

In one embodiment of said subject matter, the present invention provides a DPP-4 inhibitor, pharmaceutical composition, combination, or medicament of the present invention for a therapeutic and/or prophylactic method or use as described herein (primarily for the treatment and/or prevention of type 2 diabetes and/or obesity), in patients with reduced (glucose-stimulated) insulin secretion, increased hepatic gluconeogenesis, and/or reduced insulinotropic effect or action of incretin hormones (e.g. GLP-1 and/or gastric inhibitory peptide (GIP)), e.g. with impaired incretin sensitivity mediated by the TCF7L2 risk genotype, especially the TCF7L2 risk genotype, as mentioned above.

In another aspect of said aspect of the present invention, there is provided a method for assessing patient response to treatment with a DPP-4 inhibitor, pharmaceutical composition, combination, or drug of the present invention, said method comprising the step of identifying the patient's TCF7L2 risk genotype as described herein, e.g. , assigning a patient to a specific subpopulation of carriers of the TCF7L2 risk genotype, or assigning a patient to the wild-type TCF7L2 genotype, for example, identifying a wild-type CC allele, rs7903146 polymorphism of the TCF7L2 gene in a patient.

In another embodiment of said aspect of the present invention, a DPP-4 inhibitor, pharmaceutical composition, combination or medicament of the present invention is provided for use in a therapeutic and/or prophylactic method as described herein (primarily for the treatment and/or prevention of type 2 diabetes and/or obesity) in a patient in need thereof, wherein said method is that any TCF7L2 risk genotype is detected in the patient as described herein.

In another embodiment of said aspect of the present invention, a DPP-4 inhibitor, pharmaceutical composition, combination or medicament of the present invention is provided for use in a therapeutic and/or prophylactic method as described herein (primarily for the treatment and/or prevention of type 2 diabetes and/or obesity) in a patient in need thereof, said method comprising detecting the wild-type TCF7L2 genotype in the patient as described herein.

In another aspect of the present invention, detection of the TCF7L2 risk genotype can be used to stratify patients, for example, to expand the patient population participating in clinical trials to evaluate the efficacy of a DPP-4 inhibitor.

In another aspect of the present invention, a method for evaluating an individual's response to treatment (for example, including detection of TCF7L2 risk genotype or wild-type genotypes as described herein) can be used to assess a patient's potential response to a lower DPP-4 inhibitor level or need for a higher the level of a DPP-4 inhibitor, which is optionally administered in combination with one or more other active compounds.

In another aspect of the present invention, an assessment of an individual's sensitivity to treatment, including detection of the TCF7L2 risk genotype or wild-type genotypes as described herein, can be used to assess whether a patient can be treated in a monotherapy or combination treatment regimen using one or more additional antidiabetic agents of the present invention. invention, for example, to ensure adequate glycemic control. For example, in the case of patients less likely to have a favorable response, it may be necessary to

- 10 042990 combined treatment, for example, to achieve adequate glycemic control.

Definitions

The term active ingredient of a pharmaceutical composition or combination of the present invention means a DPP-4 inhibitor and/or, if present, a second antidiabetic agent and/or, if present, a third antidiabetic agent of the present invention.

The term body mass index or BMI of a person means weight in kilograms divided by height in meters squared, i.e. BMI units are kg/m ² .

The term overweight refers to a condition in which a patient's BMI is greater than 25 kg/m ² but less than 30 kg/m ² . The terms overweight and preobesity are used interchangeably.

The term obesity refers to a condition in which a patient's BMI is 30 kg/m ² or more. According to the definition of the World Health Organization (WHO), the term obesity is classified as follows: the term obesity of the first degree refers to a condition in which the BMI is 30 kg / m ² or more, but less than 35 kg / m ² , the term obesity of the second degree denotes a condition in which BMI equal to 35 kg/m ² or more, but less than 40 kg/m ² , the term obesity of the third degree refers to a condition in which the BMI is 40 kg/m ² or more.

The term visceral obesity refers to a condition in which the waist circumference/hip circumference ratio is 1.0 or more in men and 0.8 or more in women. This indicator indicates the risk of developing insulin resistance and prediabetes.

The term central (abdominal) obesity usually refers to a condition in which the waist circumference is >40 inches or 102 cm in men and >35 inches or 94 cm in women. In a Japanese ethnic group or in Japanese patients, central obesity refers to a waist circumference >85 cm in men and >90 cm in women (see, for example, data from the Metabolic Syndrome Research Committee in Japan).

The term euglycemia refers to a condition in which a patient has a fasting blood glucose concentration within the normal range of more than 70 mg/dL (3.89 mmol/L) and less than 110 mg/dL (6.11 mmol/L) or 100 mg /dl (5.6 mmol/l). The term fasting has its usual medical meaning.

The term hyperglycemia refers to a condition in which a patient's fasting blood glucose concentration is above the normal range, more than 110 mg/dL (6.11 mmol/L) or 100 mg/dL (5.6 mmol/L). The term fasting has its usual medical meaning.

The term hypoglycemia refers to a condition in which a patient's blood glucose concentration is below the normal range of 60 mg/dL to 115 mg/dL (3.3 mmol/L to 6.3 mmol/L), especially below 70 mg /dl (3.89 mmol/l).

The term postprandial hyperglycemia refers to a condition in which a patient has a blood or serum glucose level greater than 200 mg/dL (11.11 mmol/L) 2 hours after a meal.

The term impaired fasting glucose or IUH refers to a condition in which a patient has a fasting blood glucose concentration or fasting serum glucose concentration in the range of 100 mg/dL to 125 mg/dL (i.e., 5.6 mmol/L up to 6.9 mmol/l), especially more than 110 mg/dl and less than 126 mg/dl (7.00 mmol/l). A normal fasting blood glucose level in a patient refers to a fasting glucose concentration of less than 100 mg/dl, i.e. less than 5.6 mmol/l.

The term Impaired Glucose Tolerance or ITG refers to a condition in which a patient's blood or serum glucose concentration 2 hours after a meal is more than 140 mg/dL (7.78 mmol/L) and less than 200 mg/dL (11,11 mmol/l). Abnormal glucose tolerance, i.e. the concentration of glucose in the blood or serum 2 hours after a meal, is measured by the level of sugar in the blood in mg of glucose in one dl of plasma 2 hours after ingestion of 75 g of glucose on an empty stomach. Normal glucose tolerance in a patient corresponds to a blood or serum glucose concentration 2 hours after a meal of less than 140 mg/dL (7.78 mmol/L).

The term hyperinsulinemia refers to a condition in which a patient with insulin resistance, in the presence or absence of euglycemia, has a higher fasting or postprandial insulin concentration in serum or plasma compared to normal lean patients without insulin resistance, in which the ratio waist circumference/hip circumference is <1.0 (men) or <0.8 (women).

The terms improving insulin sensitivity, improving insulin resistance, or reducing insulin resistance are synonymous and are used interchangeably.

The term insulin resistance refers to a condition that requires an excess amount of insulin in the bloodstream compared to the normal response to glucose in order to maintain a euglycemic state (Ford E. S. and others, JAMA, 287, cc. 356-359 (2002)). A method for determining insulin resistance includes a euglycemic-hyperinsulinemic clamp test. The ratio of insulin/glucose is determined by the method of co-infusion of insulin and glucose. Insulin resistance is defined as glucose absorption below the 25th percentile in the main study population (WHO method). Fairly less labor intensive

- 11 042990 comparison with the clamp test are the methods of the so-called minimal models, in which, during an intravenous glucose tolerance test, the concentrations of glucose and insulin in the blood are measured at certain time intervals and the data obtained are used to calculate the insulin resistance index. This method does not distinguish between insulin resistance of liver cells or peripheral tissues.

In addition, insulin resistance, insulin resistance patient response to treatment, insulin sensitivity, and hyperinsulinemia can be assessed by the Homeostatic Insulin Resistance Assessment Model (HMO-RI), which is a reliable measure of insulin resistance (Katsuki A. and et al., Diabetes Care, 24, pp. 362-365 (2001)). In addition, methods for determining the GMO-RI index for assessing insulin sensitivity are described in Matthews et al., Diabetologia, 28, cc. 412-419 (1985), the intact proinsulin/insulin ratio and the euglycemic clamp test are described in Forst et al., Diabetes, 52 (add. 1), A459 (2003). In addition, plasma adiponectin levels can be monitored as a proxy for insulin sensitivity. The value of insulin resistance by GMO-RI is calculated by the formula (Galvin R. and others, Diabet Med., 9, cc. 921-928 (1992)):

GMO-RI=[fasting serum insulin concentration (μU/mL)]x[fasting plasma glucose concentration (mmol/L)/22.5]

As a rule, in daily clinical practice, other parameters are used to assess insulin resistance. Preferably, for example, the patient's triglyceride concentration is used, since an elevated triglyceride level is strongly correlated with the presence of insulin resistance.

Patients predisposed to developing IGT or NGN or type 2 diabetes who are diagnosed with euglycemia with hyperinsulinemia are, by definition, insulin resistant. The typical patient with insulin resistance is usually overweight and obese. If insulin resistance is established, then this is primarily a serious sign of the presence of prediabetes. Thus, in order to maintain glucose homeostasis, the patient needs 2-3 times more insulin than a healthy person, while there are no clinical symptoms.

To study the functionality of pancreatic β-cells, methods similar to those described above for determining insulin sensitivity, hyperinsulinemia or insulin resistance are used: improvement in β-cell functionality can, for example, be assessed by determining the GMO-RI index for β-cell functionality (Matthews and et al., Diabetologia, 28, pp. 412-419, (1985)), by intact proinsulin/insulin ratio (Forst et al., Diabetes, 52 (add. 1), A459 (2003)), insulin secretion/C- peptide after an oral glucose tolerance test or a food tolerance test, or using a hyperglycemic clamp test and/or minimal simulation after multiple blood draws during an intravenous glucose tolerance test (Stumvoll et al., Eur. J. Clin. Invest., 31, pp. 380-381 (2001)).

The term prediabetes refers to a condition in which a patient is predisposed to developing type 2 diabetes. Prediabetes involves the identification of impaired glucose tolerance to include patients with fasting blood glucose levels above the normal range > 100 mg/dL (Meigs J. B. et al., Diabetes , 52, pp. 1475-1484 (2003)) and fasting hyperinsulinemia (elevated plasma insulin levels). The scientific and medical basis for identifying prediabetes as a serious health threat is set out in the joint opinion of the American Diabetes Association and the National Institute of Diabetes and Gastrointestinal and Kidney Diseases, The Prevention or Delay of Type 2 Diabetes (Diabetes Care, 25, pp. 742- 749 (2002)).

Patients who are likely to be insulin resistant suffer from two or more of the following symptoms:

1) overweight or obesity,

2) high blood pressure,

3) hyperlipidemia,

4) one or more first-degree symptoms associated with a diagnosis of IGT or NGN or type 2 diabetes.

Insulin resistance in these patients can be confirmed by the GMO-RI index. According to the present invention, insulin resistance is defined as a clinical condition in which a patient's GMO-RI index is >4.0 or the GMO-RI index is above the upper limit of the normal range, as determined by laboratory analyzes of glucose and insulin levels.

The term type 2 diabetes refers to a condition in which a patient has a fasting blood glucose concentration or a fasting serum glucose concentration of more than 125 mg/dL (6.94 mmol/L). The level of glucose in the blood is determined by the standard method of laboratory analysis. If a glucose tolerance test is performed, the blood sugar level of a diabetic patient exceeds 200 mg glucose per dl (11.1 mmol/l) in plasma 2 hours after ingestion of 75 g glucose on an empty stomach. During glucose tolerance

- 12 042990 test 75 g of glucose the patient takes orally after fasting for 10-12 hours, and the blood sugar level is recorded immediately before taking glucose and 1 hour and 2 hours after taking it. In a healthy individual, blood sugar levels before glucose ingestion range from 60 mg to 110 mg per dl of plasma, less than 200 mg/dl 1 hour after glucose ingestion, and less than 140 mg/dl 2 hours after glucose ingestion. If after 2 hours the value is between 140 and 200 mg, then this level indicates abnormal glucose tolerance.

The term patients with advanced type 2 diabetes mellitus includes patients with type 2 diabetes who are not responding to a second course of antidiabetic drugs, who are indicated for insulin therapy, and who have progression of micro- and macrovascular complications, such as diabetic nephropathy or coronary artery disease (CHD). ).

The term HbA1c refers to the product of non-enzymatic glycosylation of the B chain of hemoglobin, the method of determination of which is known to a person skilled in the art. When monitoring during the treatment of diabetes mellitus, the level of HbA1c is extremely important. Because its production is highly dependent on blood sugar levels and erythrocyte life span, HbA1c as a blood sugar memory reflects average blood sugar levels over the previous 4-6 weeks. Diabetic patients whose HbA1c levels are consistently maintained during intensive diabetes treatment (ie, <6.5% based on total hemoglobin in the sample) are largely protected from diabetic microangiopathy. For example, metformin alone provides an average improvement in HbA1c levels in a diabetic patient of 1.0-1.5%. This reduction in HbA1c is not sufficient to provide the desired HbA1c <6.5% and preferably <6% in all diabetic patients.

The term poor glycemic control or inadequate glycemic control, as used herein, refers to a condition in which a patient has HbA1c levels greater than 6.5%, preferably greater than 7.0%, more preferably greater than 7.5%, especially greater than 8%. .

The metabolic syndrome, the so-called syndrome X (if used in the context of a metabolic disorder), the so-called dysmetabolic syndrome, is a complex of syndromes with insulin resistance as the main feature (Laaksonen D. E. et al., Am. J. Epidemiol., 156 , pp. 1070-1077 (2002)). According to ATP III/NCEP Guidelines (National Cholesterol Education Program (NCEP) Third Report Highlights), Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III), Journal of the American Medical Association, 285 , pp. 2486-2497 (2001)), the diagnosis of metabolic syndrome is based on three or more of the following risk factors:

1) central obesity if waist circumference >40 inches or 102 cm in men and >35 inches or 94 cm in women, or in Japanese ethnic group or in Japanese patients waist circumference >85 cm in men and >90 cm in women,

2) triglyceride level >150 mg/dl,

3) high-density lipoprotein (HDL) cholesterol <40 mg/dl in men,

4) blood pressure >130/85 mm Hg. (systolic blood pressure (SBP) >130 mmHg or diastolic blood pressure (DBP) >85 mmHg),

5) fasting blood glucose >110 mg/dl or >100 mg/dl.

NCEP definitions are validated (Laaksonen D. E. et al., Am. J. Epidemiol., 156, pp. 1070-1077 (2002)). Blood triglyceride and HDL cholesterol levels can also be determined by standard laboratory testing methods and are described, for example, in Thomas L. (ed.), Labor und Diagnose, TH-Books Verlagsgesellschaft mbH, Frankfurt am Main (2000).

The well-known term hypertension refers to a condition in which the SBP is greater than 140 mmHg and the DBP is greater than 90 mmHg. If a patient has been diagnosed with diabetes, the recent recommendation is to lower the BP to less than 130 mmHg and the DBP to less than 80 mmHg.

The definitions of DTDP (new-onset diabetes after transplantation) and PTMS (post-transplant metabolic syndrome) closely match the diagnostic criteria for type 2 diabetes of the American Diabetes Association, as well as the International Diabetes Federation (IDF) and the American Heart Association/National Heart, Lung, and Blood Institute for metabolic syndrome. DDPRT and/or PTMS are associated with an increased risk of micro- and macrovascular disease and events, graft rejection, infection, and death. A number of DDD and/or PTMS-mediated prognostic factors have been identified as potential risk factors, including transplantation at an advanced age, male gender, pre-transplant BMI, pre-transplant diabetes, and immune suppression.

The term hyperuricemia refers to a condition characterized by high total serum urate levels. Uric acid concentrations in human blood from 3.6 mg/dL (approximately 214 µmol/L) to 8.3 mg/dL (approximately 494 µmol/L) are normal according to the recommendation

- 13 042990 of the American Medical Association. High total serum urate levels, or hyperuricemia, are in most cases associated with several diseases. For example, high total serum urate levels can cause arthritis of the joints, known as gout. Gout is a condition caused by the deposition of crystals of the monosodium salt of uric acid or uric acid in the articular cartilage of the joints, tendons or surrounding tissues due to elevated total urate concentrations in the bloodstream. The deposition of urate or uric acid in said tissues causes an inflammatory response in said tissues. Near-saturation levels of uric acid in the urine can lead to the formation of kidney stones when uric acid or urate crystallizes in the kidneys. In addition, high total serum urate levels are in most cases associated with the so-called metabolic syndrome, including cardiovascular disease and hypertension.

Used in this context, the term DPP-4 inhibitor means a compound that exhibits inhibitory activity against the enzyme, dipeptidyl peptidase 4 (DPP-4). Said inhibitory activity is characterized by an IC50 value. The DPP-4 inhibitor preferably has an IC50 value below 10,000 nM, preferably below 1,000 nM. Certain DPP-4 inhibitors have IC values below 100 nM, or even < 50 nM. IC50 values of DPP-4 inhibitors are typically greater than 0.01 nM, or even greater than 0.1 nM. DPP-4 inhibitors include biological and non-biological, primarily non-peptide compounds. The inhibitory effect on DPP-4 can be determined by methods known in the literature, primarily as described in WO 02/068420 or WO 2004/018468 (p. 34), which are incorporated herein by reference in their entirety. The term DPP-4 inhibitor also includes any pharmaceutically acceptable salts, hydrates and solvates of these compounds, including the corresponding crystalline forms.

The term treatment or similar terms primarily includes the therapeutic treatment of patients who have already developed the specified condition, especially in an explicit form. Therapeutic treatment is symptomatic treatment, the purpose of which is to reduce the intensity of the symptoms of a specified indication, or etiotropic treatment, aimed at reversing the progression or partial reversal of the progression of conditions, or at stopping or slowing down the progression of the disease. In this regard, the compositions and methods of the present invention can be used, for example, for therapeutic treatment over a period of time, as well as for treatment over an extended period of time.

The terms prophylactic treatment and prophylaxis or similar terms are used interchangeably and include the treatment of patients at risk of developing the conditions mentioned above in order to reduce the mentioned risk.

Detailed description of embodiments of the invention

Objects of the present invention, especially pharmaceutical compounds, compositions, combinations, methods and uses relate to DPP-4 inhibitors, second and/or third antidiabetic agents, as defined in this context.

In the first option (option A), the DPP-4 inhibitor in the context of the present invention is any DPP-4 inhibitor of formula (I) or formula (II) or formula (III) or formula (IV)

- 14 042990

CN where R1 is ([1,5]naphthyridin-2-yl)methyl, (quinazolin-2-yl)methyl, (quinazolin-6yl)methyl, (4-methylquinazolin-2-yl)methyl, 2-cyanobenzyl, ( 3-cyanoquinolin-2-yl)methyl, (3cyanopyridin-2-yl)methyl, (4-methylpyrimidin-2-yl)methyl or (4,6-dimethylpyrimidin-2-yl)methyl and R2 is 3-(R )-aminopiperidin-1-yl, (2-amino-2-methylpropyl)methylamino or (2(S)-aminopropyl)methylamino, or a pharmaceutically acceptable salt of these compounds.

In the second embodiment of the present invention (Variant B), the DPP-4 inhibitor of the present invention comprises a DPP-4 inhibitor selected from the group consisting of sitagliptin, vildagliptin, saxagliptin, alogliptin, (28)-1-{[2-(5-methyl -2-phenyloxazol-4-yl)ethylamino]acetyl}pyrrolidine-2carbonitrile, (28)-1-{[1,1-dimethyl-3-(4-pyridin-3-ylimidazol-1yl)propylamino]acetyl}pyrrolidine- 2-carbonitrile, (S)-1-((2S,3S, 11b8)-2-amino-9,10-dimethoxy-1,3,4,6,7,11b-hexahydro-2Hpyrido[2,1-a ]isoquinolin-3-yl)-4-fluoromethylpyrrolidin-2-one, (3,3-difluoropyrrolidin-1-yl)-((28.48)-4-(4-(pyrimidin-2-yl)piperazin-1yl )pyrrolidin-2-yl)methanone, (1-((3S,48)-4-amino-1-(4-(3,3-difluoropyrrolidin-1-yl)-1,3,5-triazin-2yl) pyrrolidin-3-yl)-5,5-difluoropiperidin-2-one, (28.48)-1-{2-[(38.1K)-3-(1H-1,2,4-triazol-1ylmethyl) cyclopentylamino]acetyl}-4-fluoropyrrolidine-2-carbonitrile, (R)-2-[6-(3-aminopiperidin-1-yl)-3-methyl-2,4-dioxo-3,4-dihydro-2Hpyrimide in -1-ylmethyl]-4-fluorobenzonitrile, bis-dimethylamide -5-yl)-10,11-dihydro-5Hdibenzo[a,c1]cyclohepten-2,8-dicarboxylic acid,

3-{(28.48)-4-[4-(3-methyl-1-phenyl-1H-pyrazol-5-yl)piperazin-1yl]pyrrolidin-2-ylcarbonyl}thiazolidine,

[(2R)-l-{[(3R)-pyrpolidin-3-ylamino]acetyl}pyrpolidin-2-yl]boronic acid, (28.48)-1-[2-[(4-ethoxycarbonylbicyclo[2.2.2 ]oct-1-yl)amino]acetyl]-4fluoropyrrolidine-2-carbonitrile,

2-({6-[(3R)-3-amino-3-methylpiperidin-l-yl]-l,3-dimethyl-2,4-dioκco1,2,3,4-tetrahydro-5H-pyrrolo[3, 2-d] pyrimidin-5-yl}methyl)-4fluorobenzonitrile,

6-[(ЗR)-3-aminopiperidin-l-yl]-5-(2-chloro-5-φτopbenzyl)-l,3-dimethyl-l,5dihydropyrrolo[3,2-b]pyrimidine-2,4- dione and (8)-2-methylpyrazolo[1,5-a]pyrimidine-6-carboxylic acid {2-[(2-cyanopyrrolidin-1-yl)-2-oxoethylamino]-2-methylpropyl}amide, or a pharmaceutically acceptable salt of these compounds.

In the first embodiment of the present invention (Embodiment A), preferred DPP-4 inhibitors include any or all of the following compounds and their pharmaceuticals.

- 15 042990 ceutically acceptable salts:

-[(4-methylquinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-(3-(K)-aminopiperidin-1yl)xanthine (see WO 2004 application) /018468, example 2(142)):

1-[([1,5]naphthyridin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((K)-3-aminopiperidin-1-yl)xanthine (see application WO 2004/018468, example 2(252)):

1-[(quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((K)-3-aminopiperidin-1-yl)xanthine (see WO 2004 /018468, example 2(80)):

2-((C.)-3-aminopiperidin-1-yl)-3-(but-2-ynyl)-5-(4-methylquinazolin-2-ylmethyl)-3,5dihydroimidazo[4,5-d]pyridazine -4-on (see application WO 2004/050658, example 136):

1-[(4-methylquinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-[(2-amino-2-methylpropyl)methylamino]xanthine (see application WO 2006/029769 example 2(1)):

1-[(3-cyanoquinolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((K)-3-aminopiperidin-1-yl)xanthine (see application WO 2005/085246, example 1(30)):

1-(2-cyanobenzyl)-3-methyl-7-(2-butyn-1-yl)-8-((K)-3-aminopiperidin-1-yl)xanthine (see WO 2005/085246, example 1(39)):

- 16 042990

1-[(4-methylquinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-[(S)-(2-aminopropyl)methylamino]xanthine (see application WO 2006/029769 example 2(4)):

-[(3-cyanopyridin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((K)-3-aminopiperidin-1-yl)xanthine (see application WO 2005/085246 example 1(52)):

1-[(4-methylpyrimidin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((K)-3-aminopiperidin-1yl)xanthine (see WO application 2005/085246, example 1(81)):

1-[(4,6-dimethylpyrimidin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((K)-3-aminopiperidin-1yl)xanthine (see application WO 2005/085246, example 1(82)):

1-[(quinoxalin-6-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((K)-3-aminopiperidin-1-yl)xanthine (see WO application 2005/085246, example 1(83)):

A more preferred DPP-4 inhibitor among the DPP-4 inhibitors of variant A mentioned above is 1-[(4-methylquinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8- (3-(K)-aminopiperidin-1yl)xanthine, especially the free base of the indicated compound (another name is linagliptin or drug BI 1356).

As other DPP-4 inhibitors, the following compounds should be mentioned:

sitagliptin (MK-0431) having the structural formula A below is (3K)-3-amino-1-[3-(trifluoromethyl)-5,6,7,8-tetrahydro-5H-[1,2 ,4]triazolo[4,3-a]pyrazin-7yl]-4-(2,4,5-trifluorophenyl)butan-1-one, another name is (2K)-4-oxo-4-[3-(trifluoromethyl )-5.6

- 17 042990 dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine,

In one embodiment, sitagliptin is in the form of dihydrogen phosphate, i. sitagliptin phosphate. In another embodiment, sitagliptin phosphate is in the form of a crystalline anhydrous compound or in the form of a monohydrate. This variant relates to sitagliptin phosphate monohydrate. Sitagliptin free base and pharmaceutically acceptable salts thereof are described in US Pat.

More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

The composition of the sitagliptin tablet is marketed under the trade name Januvia®. A tablet composition comprising a combination of sitagliptin/metformin is marketed under the trade name Janumet®.

Vildagliptin (LAF-237) having the structural formula B below is (2S)-{[(3-hydroxyadamantan-1-yl)amino]acetyl}pyrrolidine-2-carbonitrile, another name is (S)-1- [(3-hydroxy-1-adamantyl)amino]acetyl-2-cyanopyrrolidine,

Vildagliptin is primarily described in US Pat. No. 6,166,063 and in WO 00/34241, Example 1. Specific vildagliptin salts are described in WO 2007/019255. The crystalline form of vildagliptin as well as the composition of the vildagliptin tablet are described in WO 2006/078593. Vildagliptin can be formulated into dosage forms as described in WO 00/34241 or WO 2005/067976. A modified release vildagliptin composition is described in WO 2006/135723.

More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

The vildagliptin tablet formulation is marketed under the trade name Galvus®. The tablet composition comprising the vildagliptin/metformin combination is marketed under the trade name Eucreas®.

Saxagliptin (BMS-477118), characterized by the structural formula C below, is (1S,3S,5S)-2-{(2S)-2-amino-2-(3-hydroxyadamantan-1-yl)acetyl}- 2azabicyclo[3.1.0]hexane-3-carbonitrile, also known as (S)-3-hydroxyadamantylglycine-L-cis-4,5methanoprolinenitrile,

(WITH) .

Saxagliptin is primarily described in US Pat. No. 6,395,767 and in WO 01/68603, Example 60.

In one embodiment, saxagliptin is in the form of a hydrochloride or in the form of a monobenzoate, as described in WO 2004/052850. In another embodiment, saxagliptin is in free base form. In yet another embodiment, saxagliptin is in the form of a free base monohydrate as described in WO 2004/052850. Crystalline forms of the hydrochloride and free base of saxagliptin are described in WO 2008/131149. A process for the preparation of saxagliptin is also described in WO 2005/106011 and WO 2005/115982. Saxagliptin can be processed into tablets as described in WO 2005/117841.

More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

Alogliptin (SYR-322), characterized by the structural formula E below, is 2-({6-[(3R)-3-aminopiperidin-1-yl]-3-methyl-2,4-dioxo-3,4 -dihydro-2H-pyrimidin-1 yl} methyl)benzonitrile,

(E) .

Alogliptin is primarily described in US 2005/261271, EP 1586571 and WO 2005/095381.

In one embodiment, alogliptin is in the form of benzoate, hydrochloride, or tosylate, each of which is described in WO 2007/035629. This variant relates to alogliptin benzoate. Polymorphs of alogliptin benzoate are described in WO 2007/035372. A process for the preparation of alogliptin is described in WO 2007/112368 and, in particular, in WO 2007/035629. Alogliptin (namely its benzoate) can be formulated into tablets and administered as described in WO 2007/033266. The solid formulation of the alogliptin/pioglitazone composition, as well as its preparation and use, are described in WO 2008/093882. The solid formulation of the alogliptin/metformin composition, as well as its preparation and use, are described in WO 2009/011451.

More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

(2S)-1-{[2-(5-Methyl-2-phenyloxazol-4-yl)ethylamino]acetyl}pyrrolidine-2-carbonitrile or a pharmaceutically acceptable salt thereof, preferably mesylate, or (2S)-1-{[ 1,1-dimethyl-3-(4-pyridin-3ylimidazol-1-yl)propylamino]acetyl}pyrrolidine-2-carbonitrile or a pharmaceutically acceptable salt thereof.

These compounds and methods for their preparation are described in WO 03/037327.

The mesylate of the first compound as well as its crystalline polymorphs are described in WO 2006/100181. The fumarate of the latter compound as well as its crystalline polymorphs are described in WO 2007/071576. These compounds can be processed into a pharmaceutical composition as described in WO 2007/017423.

More detailed information, for example, on the method of obtaining, processing into dosage forms or the use of these compounds or their salts, is given in these documents, included in the present description by reference.

(S)-1-((2S,3 S, 11bS)-2-Amino-9,10-dimethoxy-1,3,4,6,7,11b-hexahydro-2H-pyrido[2,1-a] isoquinolin3-yl)-4-fluoromethylpyrrolidin-2-one (another name for carmegliptin) or a pharmaceutically acceptable salt thereof:

Said compound and methods for its preparation are described in WO 2005/000848. A process for preparing said compound (primarily the dihydrochloride of said compound) is also described in WO 2008/031749, WO 2008/031750 and WO 2008/055814. Said compound can be processed into a pharmaceutical composition as described in WO 2007/017423.

- 19 042990

More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

(3,3-Difluoropyrrolidin-1-yl)-((2S,4S)-4-(4-(pyrimidin-2-yl)piperazin-1-yl)pyrrolidin-2yl)methanone (another name for gosogliptin) or its pharmaceutical acceptable salt.

Said compound and methods for its preparation are described in WO 2005/116014 and US Pat. No. 7,291,618.

More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

(1-((3S,4S)-4-amino-1-(4-(3,3-difluoropyrrolidin-1-yl)-1,3,5-triazin-2-yl)pyrrolidin-3-yl)- 5,5difluoropiperidin-2-one or a pharmaceutically acceptable salt thereof:

Said compound and methods for its preparation are described in WO 2007/148185 and US Pat. No. 20070299076. as links.

(2S,4S)-1-{2-[(3S,1R)-3-(1H-1,2,4-triazol-1-ylmethyl)cyclopentylamino]acetyl}-4-fluoropyrrolidine2-carbonitrile (another name for melogliptin) or a pharmaceutically acceptable salt thereof:

Said compound and methods for its preparation are described in WO 2006/040625 and WO 2008/001195. Primarily claimed salts include methanesulfonate and p-toluenesulfonate. More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

(R)-2-[6-(3-Aminopiperidin-1-yl)-3-methyl-2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-ylmethyl]-4-fluorobenzonitrile or a pharmaceutically acceptable salt thereof :

Said compound and methods for its preparation and use are described in WO 2005/095381, US 2007060530, WO 2007/033350, WO 2007/035629, WO 2007/074884, WO 2007/112368, WO 2008/03 3851, WO 2008/114800 and WO 2008/114807. Primarily claimed salts include succinate (WO 2008/067465), benzoate, benzenesulfonate, p-toluenesulfonate, (R)-mandelate and hydrochloride. More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

Bis-dimethylamide 5-{(S)-2-[2-((S)-2-cyanopyrrolidin-1-yl)-2-oxoethylamino]propyl}-5-(1Нtetrazol-5-yl)-10,11- dihydro-5H-dibenzo[a,d]cycloheptene-2,8-dicarboxylic acid or a pharmaceutically acceptable salt thereof:

- 20 042990

Said compound and methods for its preparation are described in WO 2006/116157 and US 2006/270701. More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

3-{(2S,4S)-4-[4-(3-Methyl-1-phenyl-1H-pyrazol-5-yl)piperazin-1-yl]pyrrolidin-2-ylcarbonyl}thiazolidine (also called teneligliptin) or its pharmaceutically acceptable salt.

Said compound and methods for its preparation are described in WO 02/14271. Specific salts are described in WO 2006/088129 and WO 2006/118127 (including but not limited to hydrochloride, hydrobromide). Combination treatment with said compound is described in WO 2006/129785. More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

[(2R)-1-{[(3R)-Pyrrolidin-3-ylamino]acetyl}pyrrolidin-2-yl]boronic acid (also known as dutogliptin) or a pharmaceutically acceptable salt thereof.

Said compound and methods for its preparation are described in WO 2005/047297, WO 2008/109681 and WO 2009/009751. Specific salts are described in WO 2008/027273 (including citrate, tartrate). The composition of said compound is described in WO 2008/144730. The composition of dutogliptin (as dutogliptin tartrate) with metformin is described in WO 2009/091663. More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

(2S,4S)-1-[2-[(4-Ethoxycarbonylbicyclo[2.2.2]oct-1-yl)amino]acetyl]-4-fluoropyrrolidine-2carbonitrile or a pharmaceutically acceptable salt thereof.

Said compound and methods for its preparation are described in WO 2005/075421, US 2008/146818 and WO 2008/114857. More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

2-({6-[(3R)-3-Amino-3-methylpiperidin-1-yl]-1,3-dimethyl-2,4-dioxo-1,2,3,4-tetrahydro-5Hpyrrolo[3, 2-d]pyrimidin-5-yl}methyl)-4-fluorobenzonitrile or a pharmaceutically acceptable salt thereof, or 6-[(3R)-3-aminopiperidin-1-yl]-5-(2-chloro-5-fluorobenzyl) -1,3-dimethyl-1,5-dihydropyrrolo[3,2d]pyrimidine-2,4-dione or a pharmaceutically acceptable salt thereof.

These compounds and methods for their preparation are described in WO 2009/084497 and WO 2006/068163, respectively. Combination treatment using the latter of these two compounds is described in WO 2009/128360. More detailed information, for example, on the method of obtaining, processing into dosage forms or the use of these compounds or their salts, is given in these documents, included in the present description by reference.

{2-[(2-Cyanopyrrolidin-1-yl)-2-oxoethylamino]-2-methylpropyl}amide (S)-2-methylpyrazolo[1,5a]pyrimidine-6-carboxylic acid (anagliptin is another name) or its pharmaceutical acceptable salt.

Said compound and methods for its preparation are described in WO 2004/067509. Combination treatment with said compound is described in WO 2009/139362. More detailed information, for example, on the method of obtaining, processing into dosage forms, or the use of the specified compound or its salt, is given in these documents, included in the present description by reference.

Preferably, the DPP-4 inhibitor is selected from the group G2 comprising linagliptin, sitagliptin, vildagliptin, alogliptin, saxagliptin, carmegliptin, gosogliptin, teneligliptin, melogliptin and dutogliptin, or a pharmaceutically acceptable salt or prodrug of one of the DPP-4 inhibitors mentioned above.

More preferably, the DPP-4 inhibitor is selected from the group G2 comprising linagliptin, sitagliptin, vildagliptin, alogliptin, saxagliptin, teneligliptin and dutogliptin, or a pharmaceutically acceptable salt or prodrug of one of the DPP-4 inhibitors mentioned above.

A particularly preferred DPP-4 inhibitor of the present invention is linagliptin. Used in this context, the term linagliptin means linagliptin and its pharmaceutically acceptable salts, including hydrates and solvates of linagliptin, as well as crystalline forms of the specified connection. Crystalline forms are described in WO 2007/128721. Methods for the preparation of linagliptin are described, for example, in WO 2004/018468 and WO 2006/048427. Linagliptin differs from structurally comparable DPP-4 inhibitors in that it combines exceptional efficacy and long duration of action with favorable pharmacological properties, receptor selectivity and a favorable side effect profile, or provides unexpected therapeutic benefits or improvements when treated in a monotherapy regimen and / or when used in combination with a second and optionally third anti-diabetic agent of the present invention.

To avoid any ambiguity, the description of each of the documents cited above in connection with specific DPP-4 inhibitors is expressly incorporated herein by reference in its entirety.

In one aspect of the present invention, the pharmaceutical compositions, methods and uses of the present invention relate to compositions that include a DPP-4 inhibitor as the sole active ingredient (i.e. no second and third antidiabetic agents) and/or, respectively, to treatment in monotherapy mode using a DPP-4 inhibitor alone.

In another aspect of the present invention, the pharmaceutical compositions, combinations, methods and uses of the present invention relate to compositions or combinations that include a DPP-4 inhibitor and a second antidiabetic agent as the only active ingredients (i.e., there is no third antidiabetic agent), and/ or, respectively, to dual combination therapy using a DPP-4 inhibitor and a second antidiabetic agent.

In another aspect of the present invention, the pharmaceutical compositions, combinations, methods and uses of the present invention relate to compositions or combinations that include a DPP-4 inhibitor, a second and a third anti-diabetic agent, and/or triple combination therapy using a DPP- inhibitor, respectively. 4, the second and third anti-diabetic agent.

In addition, the DPP-4 inhibitor of the present invention may be further characterized in that said DPP-4 inhibitor does not cause significant impairment of glomerular and/or tubular kidney function in a type 2 diabetic patient with chronic renal failure (e.g., mild renal impairment). , moderate to severe, or end-stage renal disease), and/or that said DPP-4 inhibitor does not require dose optimization for a type 2 diabetic patient with renal impairment (e.g., mild renal impairment, moderate to severe or end-stage kidney disease).

The second antidiabetic agent and, if present, the third antidiabetic agent are selected from the group G3, including biguanides, thiazolidinediones, sulfonylureas, glinides, α-glucosidase inhibitors, GLP-1 or GLP-1 analogs, and insulin or insulin analogs, or a pharmaceutically acceptable salt the indicated compounds. The preferred embodiments regarding the second and/or third anti-diabetic agent are described below.

The G3 group includes the biguanides. Examples of biguanides are metformin, phenformin and buformin. The preferred biguanide is metformin. A DPP-4 inhibitor in combination with a biguanide, especially with metformin, can provide more effective glycemic control and/or provide, together with a biguanide, for example, a reduction in body weight, which has beneficial effects on, for example, the metabolic syndrome that is usually associated with sugar type 2 diabetes.

As used herein, the term metformin refers to metformin or a pharmaceutically acceptable salt thereof, such as metformin hydrochloride, metformin fumarate (2:1) and metformin succinate (2:1), metformin hydrobromide, para-chlorophenoxyacetate or metformin embonate, as well as other known salts. metformin mono- and dibasic carboxylic acids. Preferably the metformin of the present invention is metformin hydrochloride.

Group G3 includes thiazolidinediones. Examples of thiazolidinediones (TZDs) are pioglitazone and rosiglitazone. Treatment with TZD is accompanied by an increase in body weight and a redistribution of adipose tissue. In addition, TZDs cause fluid retention, which is contraindicated in patients with congestive heart failure. Long-term treatment with TZD is also associated with an increased risk of bone fractures. A DPP-4 inhibitor in combination with a thiazolidinedione, primarily pioglitazone, may provide more effective glycemic control and/or minimize the side effects of TZD treatment.

The term pioglitazone, as used in this context, refers to pioglitazone, including its

- 22 042990 enantiomers, mixtures of enantiomers and a racemate, or a pharmaceutically acceptable salt of pioglitazone, for example hydrochloride.

Used in this context, the term rosiglitazone means rosiglitazone, including its enantiomers, mixtures of enantiomers and the racemate, or a pharmaceutically acceptable salt of rosiglitazone, for example, maleate.

Group G3 includes sulfonylurea. Examples of sulfonylureas are glibenclamide, tolbutamide, glimepiride, glipizide, gliquidone, glibornuride, glyburide, glizoxepide and gliclazide. Preferred sulfonylureas are tolbutamide, gliquidone, glibenclamide and glimepiride, especially glibenclamide and glimepiride. Because the effectiveness of sulfonylurea decreases over the course of treatment, the combination of a DPP-4 inhibitor with a sulfonylurea may provide an additional benefit to the patient in terms of improved glycemic control. Treatment with sulfonylurea is also usually accompanied by a gradual increase in body weight during the course of treatment, and a DPP-4 inhibitor can minimize this side effect of sulfonylurea treatment and/or attenuate the metabolic syndrome. A DPP-4 inhibitor in combination with a sulfonylurea can also minimize hypoglycemia, which is another negative side effect of sulfonylurea. Such a combination may also provide a reduction in the dose of sulfonylureas, which may also lead to a reduction in hypoglycemia.

Each term from the group glibenclamide, glimepiride, gliquidone, glibornuride, gliclazide, glizoxepide, tolbutamide and glipizide, as used herein, refers to the respective active drug or a pharmaceutically acceptable salt thereof.

Group G3 includes glinides. Examples of glinides are nateglinide, repaglinide and mitiglinide. Because the efficacy of glinides declines over the course of treatment, the combination of a DPP-4 inhibitor with meglitinide may provide an additional benefit to the patient in terms of improved glycemic control. Treatment with meglitinides is also usually accompanied by a gradual increase in body weight during the course of treatment, and a DPP-4 inhibitor can minimize this side effect of meglitinide treatment and/or attenuate the metabolic syndrome. A DPP-4 inhibitor in combination with meglitinide can also minimize hypoglycemia, which is another negative side effect of meglitinides. This combination will also provide a reduction in the dose of meglitinides, which may also lead to a reduction in hypoglycemia.

Used in this context, the term nateglinide means nateglinide, including its enantiomers, mixtures of enantiomers and racemate, or pharmaceutically acceptable salts and esters of nateglinide.

As used herein, the term repaglinide means repaglinide, including its enantiomers, mixtures of enantiomers, and the racemate, or pharmaceutically acceptable salts and esters of repaglinide.

Group G3 includes α-glucosidase inhibitors. Examples of α-glucosidase inhibitors are acarbose, voglibose and miglitol. Additional advantages of the combination of a DPP-4 inhibitor and an α-glucosidase inhibitor include more effective glycemic control, for example, at lower doses of individual drugs, and/or a reduction in the negative side effects of α-glucosidase inhibitors on the gastrointestinal tract.

Each term from the group of acarbose, voglibose and miglitol, used in this context, denotes the corresponding active drug or its pharmaceutically acceptable salt.

Group G3 includes inhibitors of GLP-1 analogues. Examples of GLP-1 analogues are exenatide, liraglutide, taspoglutide, semaglutide, albiglutide and lixisenatide. The combination of a DPP-4 inhibitor and a GLP-1 analogue can provide highly effective glycemic control, for example, at lower doses of individual drugs. In addition, for example, the ability of a GLP1 analogue to reduce body weight may have a beneficial effect in combination with the properties of a DPP-4 inhibitor. On the other hand, when using a reduced dose of a GLP-1 analog in combination with a DPP-4 inhibitor, side effects (eg nausea, gastrointestinal side effects such as vomiting) can be reduced.

Each term from the group exenatide, liraglutide, taspoglutide, semaglutide, albiglutide and lixisenatide, as used in this context, denotes the respective active drug or a pharmaceutically acceptable salt thereof.

In Embodiment (E1), the pharmaceutical compositions, combinations, methods, and uses of the present invention refer to combinations wherein the DPP-4 inhibitor and the second anti-diabetic agent are preferably selected from the compounds listed in Table 1. 1.

- 23 042990

Table 1

DPP-4 inhibitor Second antidiabetic agent choose from option B choose from group G3 choose from option B Metformin choose from option B pioglitazone choose from option B Rosiglitazone choose from option B Glibenclamide choose from option B Glimepiride choose from option B Gliquidone choose from option B Nateglinide choose from option B Repaglinide choose from option B Acarbose choose from option B Vogliboz choose from option B Miglitol choose from option B Exenatide choose from option B Liraglutide choose from option B Taspoglutide choose from option B Semaglutide choose from option B Albiglutide choose from option B Lixisenatide Linagliptin choose from group G3 Linagliptin Metformin Linagliptin pioglitazone Linagliptin Rosiglitazone Linagliptin Glibenclamide Linagliptin Glimepiride

-24042990

Linagliptin Gliquidone Linagliptin Nateglinide Linagliptin Repaglinide Linagliptin Acarbose Linagliptin Vogliboz Linagliptin Miglitol Linagliptin Exenatide Linagliptin Liraglutide Linagliptin Taspoglutide Linagliptin Semaglutide Linagliptin Albiglutide Linagliptin Lixisenatide Sitagliptin choose from group G3 Sitagliptin Metformin Sitagliptin pioglitazone Sitagliptin Rosiglitazone Sitagliptin Glibenclamide Sitagliptin Glimepiride Sitagliptin Gliquidone Sitagliptin Nateglinide Sitagliptin Repaglinide Sitagliptin Acarbose Sitagliptin Vogliboz Sitagliptin Miglitol Sitagliptin Exenatide Sitagliptin Liraglutide Sitagliptin Taspoglutide Sitagliptin Semaglutide Sitagliptin Albiglutide Sitagliptin Lixisenatide Vildagliptin choose from group G3 Vildagliptin Metformin Vildagliptin pioglitazone Vildagliptin Rosiglitazone Vildagliptin Glibenclamide Vildagliptin Glimepiride Vildagliptin Gliquidone Vildagliptin Nateglinide Vildagliptin Repaglinide Vildagliptin Acarbose Vildagliptin Vogliboz Vildagliptin Miglitol Vildagliptin Exenatide Vildagliptin Liraglutide Vildagliptin Taspoglutide Vildagliptin Semaglutide Vildagliptin Albiglutide

- 25 042990

Vildagliptin Lixisenatide Alogliptin choose from group G3 Alogliptin Metformin Alogliptin pioglitazone Alogliptin Rosiglitazone Alogliptin Glibenclamide Alogliptin Glimepiride Alogliptin Gliquidone Alogliptin Nateglinide Alogliptin Repaglinide Alogliptin Acarbose Alogliptin Vogliboz Alogliptin Miglitol Alogliptin Exenatide Alogliptin Liraglutide Alogliptin Taspoglutide Alogliptin Semaglutide Alogliptin Albiglutide Alogliptin Lixisenatide Saxagliptin choose from group G3 Saxagliptin Metformin Saxagliptin pioglitazone Saxagliptin Rosiglitazone Saxagliptin Glibenclamide Saxagliptin Glimepiride Saxagliptin Gliquidone Saxagliptin Nateglinide Saxagliptin Repaglinide Saxagliptin Acarbose Saxagliptin Vogliboz Saxagliptin Miglitol Saxagliptin Exenatide Saxagliptin Liraglutide Saxagliptin Taspoglutide Saxagliptin Semaglutide Saxagliptin Albiglutide Saxagliptin Lixisenatide Carmegliptin choose from group G3 Carmegliptin Metformin Carmegliptin pioglitazone Carmegliptin Rosiglitazone Carmegliptin Glibenclamide Carmegliptin Glimepiride Carmegliptin Gliquidone Carmegliptin Nateglinide Carmegliptin Repaglinide Carmegliptin Acarbose

-26042990

Carmegliptin Vogliboz Carmegliptin Miglitol Carmegliptin Exenatide Carmegliptin Liraglutide Carmegliptin Taspoglutide Carmegliptin Semaglutide Carmegliptin Albiglutide Carmegliptin Lixisenatide Melogliptin choose from group G3 Melogliptin Metformin Melogliptin pioglitazone Melogliptin Rosiglitazone Melogliptin Glibenclamide Melogliptin Glimepiride Melogliptin Gliquidone Melogliptin Nateglinide Melogliptin Repaglinide Melogliptin Acarbose Melogliptin Vogliboz Melogliptin Miglitol Melogliptin Exenatide Melogliptin Liraglutide Melogliptin Taspoglutide Melogliptin Semaglutide Melogliptin Albiglutide Melogliptin Lixisenatide Dutogliptin choose from group G3 Dutogliptin Metformin Dutogliptin pioglitazone Dutogliptin Rosiglitazone Dutogliptin Glibenclamide Dutogliptin Glimepiride Dutogliptin Gliquidone Dutogliptin Nateglinide Dutogliptin Repaglinide Dutogliptin Acarbose Dutogliptin Vogliboz Dutogliptin Miglitol Dutogliptin Exenatide Dutogliptin Liraglutide Dutogliptin Taspoglutide Dutogliptin Semaglutide Dutogliptin Albiglutide Dutogliptin Lixisenatide Gosogliptin choose from group G3 Gosogliptin Metformin Gosogliptin pioglitazone

- 27 042990

Gosogliptin Rosiglitazone Gosogliptin Glibenclamide Gosogliptin Glimepiride Gosogliptin Gliquidone Gosogliptin Nateglinide Gosogliptin Repaglinide Gosogliptin Acarbose Gosogliptin Vogliboz Gosogliptin Miglitol Gosogliptin Exenatide Gosogliptin Liraglutide Gosogliptin Taspoglutide Gosogliptin Semaglutide Gosogliptin Albiglutide Gosogliptin Lixisenatide T eneligliptin choose from group G3 T eneligliptin Metformin T eneligliptin pioglitazone Teneligliptin Rosiglitazone Teneligliptin Glibenclamide Teneligliptin Glimepiride Teneligliptin Gliquidone Teneligliptin Nateglinide T eneligliptin Repaglinide T eneligliptin Acarbose T eneligliptin Vogliboz T eneligliptin Miglitol Teneligliptin Exenatide T eneligliptin Liraglutide T eneligliptin Taspoglutide Teneligliptin Semaglutide T eneligliptin Albiglutide T eneligliptin Lixisenatide

In a specific embodiment (E2), the pharmaceutical compositions, combinations, methods and uses of the present invention refer to combinations wherein the DPP-4 inhibitor is linagliptin. In option E2, the second antidiabetic agent is preferably selected from the compounds listed in table. 2.

table 2

Option Second antidiabetic agent E2L choose from group G3 E2.2 Metformin E2.3 pioglitazone E2.4 Rosiglitazone E2.5 Glibenclamide E2.6 Glimepiride E2.7 Gliquidone E2.8 Nateglinide E2.9 Repaglinide E2L0 Acarbose E2L1 Vogliboz E2L2 Miglitol E2LZ Exenatide E2L4 Liraglutide E2L5 Taspoglutide E2L6 Semaglutide E2L7 Albiglutide E2L8 Lixisenatide E2L9 Insulin or an insulin analogue E2.20 GPP-1 or analogue of GPP-1

The combination of a DPP-4 inhibitor and a second and optionally third antidiabetic agent of the present invention has been found to improve glycemic control primarily in patients as described herein compared to treatment alone with a DPP-4 inhibitor or a second or third antidiabetic agent. each individually,

- 28 042990 for example, compared with treatment in monotherapy with metformin, or dual therapy using a second and third antidiabetic agent. In addition, triple combinations of a DPP-4 inhibitor and a second and third antidiabetic agent of the present invention have been found to improve glycemic control primarily in patients as described herein compared to combination treatment using a DPP-4 inhibitor and a second or third antidiabetic agent. agent, or using a second and third anti-diabetic agent. Improved glycemic control is defined as an increase in blood glucose reduction and an increase in HbA1c reduction. When treated in a monotherapy regimen in a patient, especially in patients as described in this context, when the drug is administered in an amount above a certain maximum dose, there may not be a further significant improvement in glycemic control. In addition, prolonged treatment using the maximum dose is undesirable due to potential side effects. In this regard, satisfactory glycemic control of all patients cannot be achieved when treated in monotherapy with a DPP-4 inhibitor or a second or third antidiabetic agent each separately. In the event that treatment in monotherapy does not provide complete glycemic control, there is a need for dual therapy. Even combination treatment with two agents selected from DPP-4 inhibitors and a second and third antidiabetic agent does not provide complete glycemic control in all patients and/or over an extended period of time. If dual therapy does not provide complete glycemic control, triple therapy becomes necessary. Patients with inadequate glycemic control may continue to progress to diabetes mellitus and develop complications associated with diabetes mellitus, such as macrovascular complications. The pharmaceutical composition or combination, as well as the methods of the present invention, can reduce the level of HbA1c to the desired range, for example, to <7% and preferably <6.5% in a significant number of patients and over a longer period of therapeutic treatment, for example, in the case of dual or triple combination therapy compared with monotherapy with a single antidiabetic agent, or, respectively, dual therapy with two components of the combination.

In addition, it has been found that the combination of a DPP-4 inhibitor and a second and optionally third therapeutic agent of the present invention makes it possible to reduce the dose of a DPP-4 inhibitor or a second or third anti-diabetic agent, or even two or three active ingredients. Dose reduction is preferred for patients who may otherwise experience side effects when treated with a higher dose of one or more active ingredients, primarily taking into account the side effect caused by the second and/or third antidiabetic agent. In this regard, the pharmaceutical combination, as well as the methods of the present invention, are characterized by a reduction in side effects, thus increasing treatment tolerance and patient compliance with the course of treatment.

The DPP-4 inhibitor of the present invention is able to decrease glucagon secretion in a patient by increasing active GLP-1 levels, thus limiting hepatic glucose production. In addition, elevated levels of active GLP-1 as a result of the action of a DPP-4 inhibitor have beneficial effects on β-cell regeneration and neogenesis. All of these features of DPP-4 inhibitors indicate the applicability and therapeutic value of the pharmaceutical composition or combination or method of the present invention.

When the present invention relates to patients requiring treatment or prophylaxis, the invention primarily relates to human treatment and prophylaxis, but the pharmaceutical composition can also be used appropriately in mammalian veterinary medicine. Adult patients, preferably 18 years of age or older, are included within the scope of the present invention. Also included within the scope of the present invention are adolescents, ie. patients aged 10 to 18 years, preferably aged 13 to 18 years.

In one embodiment, patients in need of treatment or prophylaxis, as described herein, can be identified by identifying variant(s) (e.g., polymorphisms) in one or more metabolic disease-associated genes in patients and/or by identifying in patients variant(s) (eg, polymorphisms) in one or more genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, primarily when identifying patients with the TCF7L2 risk genotype, as described herein.

In another embodiment, patients in need of treatment or prophylaxis, as described herein, can be identified by identifying the appropriate wild-type genotype in patients, primarily if the wild-type TCF7L2 genotype is detected in patients, as described in this context.

A specific subpopulation of patients in need of treatment or prophylaxis as described herein are patients who have one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, primarily a SNP selected from rs7903146,

- 29 042990 rs12255372 and rs10885406, especially rs7903146, more specifically, patients who are carriers of at least one SNP T-allele rs7903146 of the TCF7L2 gene, i.e. CT genotype or TT genotype.

Another subpopulation of patients in need of treatment or prophylaxis, as described herein, are patients who are carriers of the wild-type CC rs7903146 TCF7L2 genotype.

Thus, in an aspect of the present invention, the treatment or prophylaxis of the present invention can be used for patients who are in need of said treatment or prophylaxis and who have variant(s) (e.g., polymorphisms) in one or more genes associated with metabolic diseases, and /or identified variant(s) (eg, SNPs) in one or more genes selected from TCF7L2, KCNJ11, PPARG and GLP1R, first identified risk genotype TCF7L2, as described in this context.

In another aspect of the present invention, the treatment or prophylaxis of the present invention can primarily be used for patients who are in need of said treatment or prophylaxis and who have the wild-type TCF7L2 genotype as described herein.

In a sub-object of the present invention, the treatment or prophylaxis of the present invention can be used for patients who are in need of said treatment or prophylaxis and who have one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, for example, at least one SNP is detected, selected from rs7903146, rs12255372 and rs10885406, e.g. rs7903146, primarily including patients who are carriers of at least one T allele of rs7903146 (i.e. CT or TT genotype), more specifically patients who are carriers of the T allele of rs7903146 (i.e. CT risk genotype) or more generally patients who carry two T alleles of rs7903146 (i.e. high risk TT genotype).

In another sub-object of the present invention, the treatment or prophylaxis of the present invention is primarily recommended for patients who are in need of said treatment or prophylaxis and who have two C-alleles of the wild type rs7903146 of the TCF7L2 gene (i.e. CC genotype).

In one embodiment of the present invention, the treatment or prophylaxis of the present invention may be used for patients who are in need of said treatment or prophylaxis and who are diagnosed with one or more conditions selected from the group consisting of overweight and obesity, especially first-degree obesity. , obesity of the second degree, obesity of the third degree, visceral obesity and central (abdominal) obesity. In addition, the treatment or prophylaxis of the present invention can be advantageously used for patients who are contraindicated in weight gain. Thus, any increase in body weight during treatment, for example due to the administration of a second and/or third anti-diabetic agent, can be reduced or even eliminated.

In another embodiment of the present invention, the pharmaceutical composition or combination of the present invention is characterized by extremely high efficacy in terms of glycemic control, primarily due to the reduction of fasting plasma glucose, postprandial plasma glucose and/or glycosylated hemoglobin (HbA1c) levels. . By administering the pharmaceutical composition or combination of the present invention, a reduction in HbA1c levels of preferably 1.0% or more, more preferably 2.0% or more, even more preferably 3.0% or more can be achieved, the reduction being primarily value in the range from 1.0 to 3.0%.

In addition, the method and/or use of the present invention can be used for patients who have one, two or more of the following conditions:

(a) a fasting blood glucose concentration or a fasting serum glucose concentration of more than 110 mg/dl or more than 100 mg/dl, in particular more than 125 mg/dl;

(b) the postprandial plasma glucose level is 140 mg/dl or more;

(c) the HbA1c level is 6.5% or more, especially 7.0% or more, especially 7.5% or more, even more preferably 8.0% or more.

The present invention also provides the use of a pharmaceutical composition or combination for improving glycemic control in patients with type 2 diabetes, or who are experiencing the first symptoms of prediabetes. In this regard, the present invention also includes the prevention of diabetes. Therefore, by using the pharmaceutical composition or combination of the present invention to improve glycemic control, the development of overt type 2 diabetes mellitus can be halted or prevented immediately after the onset of one of the above-mentioned symptoms of prediabetes.

In addition, the pharmaceutical composition or combination of the present invention can primarily be used in the treatment of patients with insulin dependence, i. patients who are or will be treated or in need of treatment with insulin or an insulin derivative or insulin substitute or a composition comprising insulin or an insulin derivative or substitute. These patients include type 2 diabetic patients and type 1 diabetic patients.

- 30 042990

Accordingly, an embodiment of the present invention provides a method for improving glycemic control and/or lowering fasting plasma glucose, postprandial plasma glucose, and/or glycated hemoglobin HbA1c in a patient in need thereof who has been diagnosed with impaired glucose tolerance (IGT), impaired fasting blood glucose (IFG), insulin resistance, metabolic syndrome, and/or type 2 or type 1 diabetes mellitus, said method comprising administering a DPP-4 inhibitor to the patient and optionally a second and optionally third anti-diabetic agent, as defined herein, for example, as a combination.

In another embodiment, the present invention provides a method for improving glycemic control in patients, especially in adult patients with type 2 diabetes mellitus, as an adjunct to diet and exercise.

In addition, in a specific embodiment of the present invention, the therapeutic or prophylactic method and/or use of the present invention may be used for patients who have variant(s) (e.g., polymorphisms) in one or more genes associated with metabolic diseases and/or which have variant(s) (eg, polymorphisms) in one or more of the genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R.

In this context, the subpopulation of patients described in this context are patients with the TCF7L2 risk genotype, such as, for example, patients who have one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, primarily at least one SNP, selected from rs7903146, rs12255372 and rs10885406, primarily rs7903146. More specifically, patients who carry at least one SNP T-allele rs7903146 of the TCF7L2 gene, i.e. CT genotype or TT genotype, primarily those who are carriers of two T-alleles of the SNP rs7903146 of the TCF7L2 gene, i.e. TT genotype are highly susceptible to increased expression of TCF7L2 in pancreatic β-cells, impaired insulin secretion, incretin actions, increased rate of hepatic glucose production, and/or diabetes. The T-allele rs7903146 of the TCF7L2 gene is associated with impaired insulinotropic action of incretin hormones, decreased 24-hour plasma insulin and glucagon profiles, and increased glucose production in the liver.

In this regard, the present invention also includes compounds, pharmaceutical compositions or combinations of the present invention for use in the treatment and/or prevention of diseases, disorders or conditions mentioned in this context, in patients who are carriers of one or more single nucleotide polymorphisms ( SNP) in the gene encoding TCF7L2, primarily at least one SNP selected from rs7903146, rs12255372 and rs10885406, primarily rs7903146, more specifically, in patients who are carriers of at least one T-allele of the SNP rs7903146 of the TCF7L2 gene, t .e. CT genotype or TT genotype, primarily in patients who are carriers of one T-allele of the SNP rs7903146 of the TCF7L2 gene, i.e. CT genotype, or who are carriers of two T-alleles of the SNP rs7903146 of the TCF7L2 gene, i.e. TT genotype.

Patients with the TCF7L2 risk genotype as described herein include, but are not limited to, Caucasian, Northern European, East Asian, Indian, and/or Caucasian patients.

The present invention further includes the therapeutic and/or prophylactic method or use of the present invention for a patient in need thereof, said method or use comprising the step of identifying in the patient variant(s) (e.g., polymorphisms) in one or more genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, primarily by identifying the TCF7L2 risk genotype in a patient, as described herein.

Identification or diagnosis in a patient of variant(s) (e.g., polymorphisms) in one or more of the genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, primarily the TCF7L2 risk genotype, as described herein, or identification of a wild-type genotype in a patient, especially the wild-type TCF7L2 genotype, as described herein, can be used to assess the likelihood (e.g., increased, reduced, or no likelihood) of a favorable therapeutic and/or prophylactic patient response to treatment with a DPP-4 inhibitor (or DPP inhibitor combination). -4 with a second and/or third anti-diabetic agent, as defined herein) in a therapeutic and/or prophylactic method or use as described herein (e.g., for the treatment of diabetes or to improve glycemic control), as well as in connection with with this to identify a subject who is susceptible to said treatment.

Thus, in another embodiment, the present invention further provides a method for assessing the likelihood (e.g., increased, reduced, or no likelihood) of a favorable response to administration of a pharmaceutically acceptable amount of a DPP-4 inhibitor (or a combination of a DPP-4 inhibitor with a second and/or a third antidiabetic agent as described herein) in a subject (primarily a patient diagnosed with diabetes), said method comprising the step of identifying the subject's variant(s) (e.g., polymorphisms) in one

- 31 042990 or more genes selected from TCF7L2, KCNJ11, PPARG and GLP1R, primarily detecting the TCF7L2 risk genotype in the subject as described in this context, or detecting the wild-type TCF7L2 genotype in the subject, primarily detecting the CC rs7903146 TCF7L2 genotype in the subject wild type.

In another specific embodiment, the present invention provides a DPP-4 inhibitor, pharmaceutical composition or combination of the present invention for use in a therapeutic or prophylactic method as described herein (primarily for the treatment or prevention of type 2 diabetes and/or obesity), wherein said method comprises (1) assessing a subject's susceptibility to a therapeutic or prophylactic method, said assessment comprising whether the subject has variant(s) (e.g., polymorphisms) in one or more of the genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, especially any TCF7L2 risk genotype as described herein, more specifically, the detection in a patient of one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, especially at least one SNP selected from rs7903146, rs12255372 and rs10885406, primarily rs7903146, e.g., detection in the subject of at least one SNP T-allele rs7903146 of the TCF7L2 gene, e.g., detection in the subject of the CT genotype (i.e. a single T allele of the SNP rs7903146 of the TCF7L2 gene), or a subject having a TT genotype (i.e., two T alleles of the SNP rs7903146 of the TCF7L2 gene), or a subject having a wild type TCF7L2 genotype, primarily a wild type CC rs7903146 TCF7L2 genotype, and thereby assessing the likelihood of a favorable response (e.g., a favorable change in HbA1c levels) as a result of therapeutic or prophylactic treatment of the subject with a DPP-4 inhibitor, pharmaceutical composition or combination, and (2) administering to the subject an effective amount of the DPP-4 inhibitor, pharmaceutical composition or combination, wherein said subject has a high likelihood of a favorable response (eg, a favorable change in HbA1c level) as a result of therapeutic or prophylactic treatment of the subject with a DPP-4 inhibitor, pharmaceutical composition or combination.

The present invention further provides a therapeutic and/or prophylactic method or use of the present invention for treating a patient in need thereof, said method or use comprising the following steps:

obtaining and analyzing a nucleic acid sample from an individual diagnosed with type 2 diabetes mellitus;

evaluating the efficacy and/or optional likelihood of a favorable response (eg, in providing glycemic control, such as a favorable change in HbA1c levels) to treatment with a DPP-4 inhibitor, preferably linagliptin, or a DPP-4 inhibitor in combination with one or more other active compounds ( e.g., anti-diabetic agents), including detection of genotype in a patient sample (i.e., TT or CT or CC alleles of the rs7903146 polymorphism of the TCF7L2 gene), where the presence of the TT, CT, or CC genotype indicates treatment efficacy, and/or optionally, the presence of the TT genotype indicates a low likelihood of a favorable response, and/or the presence of the CC genotype indicates a high likelihood of a favorable response to treatment; and administering to the subject a therapeutically effective amount of a DPP-4 inhibitor, preferably linagliptin, or a DPP-4 inhibitor in combination with one or more other active compounds (eg, antidiabetic agents).

In addition, it has been found that by using the pharmaceutical composition or combination of the present invention, an improvement in glycemic control can be achieved even in patients who have insufficient glycemic control, especially despite treatment with a second or third antidiabetic agent or a combination of a second and third antidiabetic agent, for example despite oral treatment as monotherapy with a maximum tolerated dose of metformin, a thiazolidinedione (eg, pioglitazone), or a sulfonylurea, or a combination of metformin with a thiazolidinedione (eg, pioglitazone), metformin with a sulfonylurea, or a thiazolidinedione (eg, pioglitazone) with a sulfonylurea.

It has also been found that improved glycemic control can be achieved using the combination of the present invention even in patients who have poor glycemic control, primarily despite treatment with a DPP-4 inhibitor or a combination of a DPP-4 inhibitor with a second or third antidiabetic agent, for example despite oral treatment as monotherapy with a maximum tolerated dose of a DPP-4 inhibitor or a dual combination of a DPP-4 inhibitor with a second or third antidiabetic agent.

The maximum tolerated dose of metformin is, for example, 2000 mg/day, 1500 mg/day (eg in Asian countries) or 850 mg three times a day, or any equivalent amount.

Thus, the method and/or use of the present invention can be used for patients who have one, two or more of the following conditions:

(a) poor glycemic control with only diet and exercise;

(b) inadequate glycemic control despite metformin monotherapy

- 32 042990 min, thiazolidinedione (eg pioglitazone), sulfonylurea, GLP-1 or GLP1 analog, or insulin or insulin analog, primarily despite oral treatment in monotherapy with the maximum tolerated dose of metformin, thiazolidinedione (eg pioglitazone) or sulfonylurea;

(c) inadequate glycemic control despite combination treatment with two agents selected from the group consisting of metformin, a thiazolidinedione (e.g., pioglitazone), a sulfonylurea, GLP-1 or GLP-1 analogue, and insulin or an insulin analogue, for example, despite combined treatment with a dual combination selected from a combination of metformin/pioglitazone, metformin/sulfonylurea, metformin/insulin, sulfonylurea/pioglitazone, sulfonylurea/insulin, and pioglitazone/insulin.

The dual or triple combination therapy method and/or use of the present invention can also be used for patients presenting with the following conditions (d) or (e), respectively:

(d) insufficient glycemic control despite oral treatment as monotherapy with a DPP-4 inhibitor, primarily despite oral treatment as monotherapy with a maximum tolerated dose of a DPP-4 inhibitor;

(e) insufficient glycemic control despite (oral) combination treatment with a DPP-4 inhibitor and a second or third antidiabetic agent, primarily despite oral dual therapy with the maximum tolerated dose of at least one of the components of the combination.

In one embodiment of the present invention, the pharmaceutical composition or combination can be used to treat patients who have been diagnosed with one or more of the following conditions:

insulin resistance, hyperinsulinemia, prediabetes, type 2 diabetes mellitus, especially advanced type 2 diabetes mellitus, type 1 diabetes mellitus.

In addition, the pharmaceutical composition or combination of the present invention can primarily be used to treat patients who are diagnosed with one or more of the following conditions (a) obesity (including obesity of the first degree, second degree and/or third degree), visceral obesity and/ or central (abdominal) obesity, (b) blood triglyceride levels are >150 mg/dl, (c) blood HDL cholesterol levels are <40 mg/dl in female patients and <50 mg/dl in male patients, (d) systolic blood pressure is >130 mmHg and diastolic blood pressure is >85 mmHg, (e) fasting blood glucose is >110 mg/dL or >100 mg/dL.

Patients diagnosed with Impaired Glucose Tolerance (IGT), Impaired Fasting Blood Glucose (IFG), Insulin Resistance and/or Metabolic Syndrome are expected to suffer from an increased risk of developing cardiovascular disease, such as, for example , myocardial infarction, coronary heart disease, heart failure, thromboembolic events. The glycemic control of the present invention may provide a reduction in the risk of cardiovascular disease.

In addition, the pharmaceutical composition and methods of the present invention can primarily be used to treat patients after organ transplantation, especially patients who have one or more of the following conditions:

(a) advanced age, especially patients over 50 years of age;

(b) male;

(c) overweight, obesity (including obesity of the first degree, second degree and/or third degree), visceral obesity and/or central (abdominal) obesity;

(d) diabetes before transplantation;

(e) immunosuppressive treatment.

The pharmaceutical composition or combination of the present invention, primarily due to the presence of a DPP-4 inhibitor, is characterized by a high safety profile. Therefore, the treatment or prophylaxis of the present invention can be used for patients who are contraindicated in monotherapy with another antidiabetic drug, such as, for example, metformin, and/or who are intolerant of these drugs at therapeutic doses. First of all, the treatment or prophylaxis of the present invention can preferably be used for patients who are included in the group of increased risk of one or more of the following disorders: renal failure or kidney disease, cardiac diseases, heart failure, liver disease, lung disease, catabolic conditions and / or the threat of lactic acidosis, or for female patients during pregnancy or lactation.

In addition, it was found that the introduction of the pharmaceutical composition or combination of the present invention does not lead to a risk or is accompanied by a negligible risk of hypoglycemia. In this regard, the treatment or prophylaxis of the present invention is also preferably used for patients included in the high risk of developing hypoglycemia.

The pharmaceutical composition or combination of the present invention can primarily be used in the long-term treatment or prevention of diseases and/or conditions as described herein, especially in the long-term glycemic control of patients with type 2 diabetes mellitus.

Used in this context, the term long-term treatment refers to the treatment of a patient or the administration of drugs to a patient for a period of more than 12 weeks, preferably more than 25 weeks, even more preferably more than 1 year.

In this regard, in a specific embodiment, the present invention provides a method of treatment, preferably oral treatment, with the aim of improving, especially long-term improvement in glycemic control of patients with type 2 diabetes mellitus, especially patients with advanced type 2 diabetes mellitus, especially patients, who are additionally diagnosed with overweight, obesity (including grade I, grade II and/or grade III obesity), visceral obesity, and/or central (abdominal) obesity.

Both of the effects mentioned above are observed when a DPP-4 inhibitor and a second and optionally third antidiabetic agent are co-administered, for example, when administered simultaneously in a single composition or two or three different compositions, and / or when administered alternately, for example, when two or three are administered sequentially. three separate compositions.

It should be understood that combinations or combined uses of the present invention include separate, sequential, simultaneous, joint, chronological or sequential administration of the components. It should also be understood that the DPP-4 inhibitor and the other active compound(s) may be administered in a single dosage form or in separate dosage forms.

As used herein, the term combination or combined also includes, but is not limited to, fixed and non-fixed forms and applications.

It should be understood that the amount of the pharmaceutical composition of the present invention to be administered to a patient and required for use in the treatment or prophylaxis of the present invention may vary depending on the route of administration, the nature and severity of the condition to be treated or prevented, age, weight body and condition of the patient, concomitant drug treatment, and ultimately determined by the attending physician. However, in general, the DPP-4 inhibitor and optionally the second and/or third antidiabetic agent of the present invention is included in the pharmaceutical composition, combination or dosage form in an amount that is sufficient to improve the glycemic control of the patient in need of treatment when they are administered.

The preferred ranges for the amount of the DPP-4 inhibitor, second and/or third anti-diabetic agent that are used in the pharmaceutical composition, as well as the methods and uses of the present invention, are described below. The indicated ranges refer to amounts intended for administration per day to an adult patient, especially a human, for example, with a body weight of approximately 70 kg, and these amounts can be optimized accordingly for administration 2, 3, 4 times a day or more, as well as for other methods of administration and for the patient, depending on his age. Dosage and amount ranges are calculated for the individual active agent. The combination treatment of the present invention preferably uses lower dosages of the individual DPP-4 inhibitor and/or the individual second and/or third antidiabetic agent used in monotherapy treatment or used in standard treatment regimens, thus avoiding potential toxicity and adverse side effects. arising from the use of these agents as monotherapeutic agents.

According to the present invention, the pharmaceutical composition or combination is preferably administered orally. Possible other routes of administration are described below. Preferably, the one or more dosage forms comprising the DPP-4 inhibitor and/or the second and/or third anti-diabetic agent are oral or commonly known.

In general, the amount of the DPP-4 inhibitor in the combinations, combined methods or combined uses of the present invention is preferably in the range of 1/5 to 1/1 of the amount normally recommended for monotherapy treatment with said DPP-4 inhibitor.

A preferred oral dosage range for linagliptin is 0.5 to 10 mg per day, preferably 2.5 mg to 10 mg, most preferably 1 mg to 5 mg per day.

- 34 042990

The preferred range of amounts in the pharmaceutical composition is from 0.5 mg to 10 mg, in particular from 1 to 5 mg. Examples of preferred dosages include 1 mg, 2.5 mg, 5 mg or 10 mg.

The active ingredient can be administered up to three times a day, preferably once or twice a day.

Suitable compositions for linagliptin include those described in WO 2007/128724, the contents of which are incorporated herein by reference in their entirety.

Example dosages of the immediate release (IR) linagliptin/metformin double fixed combination (tablet) include 2.5 mg/500 mg, 2.5 mg/850 mg, and 2.5 mg/1000 mg, which can be administered 1-3 times per day. days, especially twice a day.

Examples of dosages of the linagliptin/metformin extended-release (RT) double fixed combination (tablet) include 5 mg/500 mg, 5 mg/1000 mg and 5 mg/1500 mg, which can be administered 1-2 times a day, primarily once per day, preferably taken in the evening with meals, or 2.5 mg / 500 mg, 2.5 mg / 750 mg and 2.5 mg / 1000 mg, which can be administered 1-2 times a day, primarily take two tablets once a day, preferably in the evening during a meal.

The preferred oral dosage range of sitagliptin is 10 to 200 mg, especially 25 mg to 150 mg per day. The recommended dose of sitagliptin is 100 mg as active agent (anhydrous free base) once daily or 50 mg twice daily. The preferred range of amounts in the pharmaceutical composition is from 10 mg to 150 mg, in particular from 25 mg to 100 mg. Examples include 25 mg, 50 mg, 75 mg or 100 mg. The active ingredient can be administered up to three times a day, preferably once or twice a day. Equivalent amounts of sitagliptin salts, especially phosphate monohydrate, are calculated accordingly. For patients with renal insufficiency, optimized dosages of sitagliptin are used, for example 25 mg and 50 mg.

The preferred oral dosage range for vildagliptin is 10 to 150 mg per day, especially 25 mg to 150 mg, 25 mg and 100 mg or 25 mg and 50 mg or 50 mg and 100 mg per day. For example, vildagliptin is administered at a dose of 50 mg or 100 mg per day. The preferred range of amounts in the pharmaceutical composition is from 10 mg to 150 mg, in particular from 25 mg to 100 mg. Examples include 25 mg, 50 mg, 75 mg or 100 mg. The active ingredient can be administered up to three times a day, preferably once or twice a day.

A preferred oral dosage range for alogliptin is 5 mg to 250 mg per day, especially 10 mg to 150 mg per day. The preferred range of amounts in the pharmaceutical composition is from 5 mg to 150 mg, in particular from 10 mg to 100 mg. Examples include 10 mg, 12.5 mg, 20 mg, 25 mg, 50 mg, 75 mg and 100 mg. The active ingredient can be administered up to three times a day, preferably once or twice a day.

A preferred oral dosage range for saxagliptin is 2.5 to 100 mg per day, especially 2.5 mg to 50 mg per day. The preferred range of amounts in the pharmaceutical composition is from 2.5 mg to 100 mg, especially 2.5 mg and 50 mg. Examples include 2.5 mg, 5 mg, 10 mg, 15 mg, 20 mg, 30 mg, 40 mg, 50 mg and 100 mg. The active ingredient can be administered up to three times a day, preferably once or twice a day.

A preferred oral dosage range for dutogliptin is 50 to 400 mg per day, especially 100 mg to 400 mg per day. The preferred range of amounts in the pharmaceutical composition is from 50 mg to 400 mg. Examples include 50 mg, 100 mg, 200 mg, 300 mg and 400 mg. The active ingredient can be administered up to three times a day, preferably once or twice a day.

In a particular embodiment of the DPP-4 inhibitors of the present invention, oral DPP-4 inhibitors are provided that are therapeutically effective at low doses, e.g., doses of <100 mg or <70 mg per patient per day, preferably <50 mg, more preferably <30 mg or <20 mg, even more preferably 1 mg to 10 mg (if necessary divided into 1-4 single doses, especially 1 or 2 single doses, e.g. of the same size), especially 1 mg to 5 mg (greater than preferably 5 mg) per patient per day, which are preferably administered orally once a day, more preferably at any time of the day with or without food. Thus, for example, a daily oral amount (5 mg) of BI 1356 can be taken once a day (i.e., take 5 mg of BI 1356 once a day) or twice a day (i.e., take 2 .5 mg of BI 1356 twice daily) at any time of the day with or without food.

In general, the amount of the second and/or third anti-diabetic agent in the combinations, combined methods and/or combined uses of the present invention is preferably in the range of 1/5 to 1/1 of the amount normally recommended for monotherapy treatment with said anti-diabetic agent. . The use of lower dosages of the individual second and/or third antidiabetic agent compared to treatment in a monotherapy regimen eliminates or minimizes the possible toxicity and adverse side effects that are observed when using these agents as monotherapeutic agents.

- 35 042990

A preferred oral dosage range for metformin is 250 to 3000 mg, especially 500 mg to 2000 mg per day. The preferred range of amounts in the pharmaceutical composition is from 250 mg to 1000 mg, especially from 500 mg to 1000 mg or from 250 mg to 850 mg, respectively. Examples include 500 mg, 750 mg, 850 mg or 1000 mg. Preferably, said amounts are administered once, twice or three times a day. For example, the amounts of 500 mg, 750 mg and 850 mg preferably need to be administered once, twice or three times a day, and the amount of 1000 mg preferably needs to be administered once or twice a day. Certain controlled or sustained release formulations allow a once daily dose to be administered. Metformin can be administered, for example, in the form of commercial products sold under the trade names GLUCOPHAGE™, GLUCOPHAGE-D™ or GLUCOPHAGE-XR™.

The preferred oral dosage range for pioglitazone is 5 mg to 50 mg per day. The preferred range of amounts in the pharmaceutical composition is 5 to 50 mg, 10 to 45 mg and 15 to 45 mg, respectively. Examples include 15 mg, 30 mg or 45 mg. Preferably, said amounts are administered once or twice a day, preferably once a day. Pioglitazone can be administered in the form of a commercial product available, for example, under the trade name ACTOS™.

The preferred oral dosage range for rosiglitazone is 1 to 10 mg per day. The preferred range of amounts in the pharmaceutical composition is 1 to 10 mg, 2 to 8 mg, 4 to 8 mg and 1 to 4 mg. Examples include 1 mg, 2 mg, 4 mg or 8 mg. Preferably, these amounts are administered once or twice a day. Preferably the daily dose does not exceed 8 mg. Rosiglitazone can be administered in the form of a commercial product available, for example, under the trade name AVANDIA™.

The preferred oral dosage range for thiazolidinedione (as opposed to pioglitazone or rosiglitazone as described above) is 2 to 100 mg per day. The preferred range of amounts in the pharmaceutical composition for administration once, twice or three times a day is from 2 mg to 100 mg, from 1 mg to 50 mg and from 1 mg to 33 mg, respectively.

A preferred oral dosage range for glibenclamide is 0.5 mg to 15 mg, especially 1 mg to 10 mg per day. The preferred range of amounts in the pharmaceutical composition is from 0.5 to 5 mg, in particular from 1 to 4 mg. Examples include 1.0 mg, 1.75 mg and 3.5 mg. Preferably, said amounts are administered one, two, or three times per day. Glibenclamide can be administered in the form of a commercial product available, for example, under the trade name EUGLUCON™.

A preferred oral dosage range for glimepiride is 0.5 to 10 mg, especially 1 mg to 6 mg per day. The preferred range of amounts in the pharmaceutical composition is from 0.5 to 10 mg, in particular from 1 to 6 mg. Examples include 1 mg, 2 mg, 3 mg, 4 mg and 6 mg. Preferably, said amounts are administered once, twice, or three times a day, preferably once a day. Glimepiride can be administered in the form of a commercial product available, for example, under the trade name AMARYL™.

The preferred oral dosage range for gliquidone is 5 mg to 150 mg, especially 15 mg to 120 mg per day. The preferred range of amounts in the pharmaceutical composition is from 5 to 120 mg, in particular from 5 to 30 mg. Examples include 10 mg, 20 mg, 30 mg. Preferably, these amounts are administered one, two, three or four times a day. Gliquidone can be administered in the form of a commercial product available, for example, under the tradename GLURENORM™.

The preferred oral dosage range for glibornuride is 5 to 75 mg per day. The preferred range of amounts in the pharmaceutical composition is from 5 to 75 mg, in particular from 10 to 50 mg. Preferably, said amounts are administered one, two, or three times per day.

A preferred oral dosage range for gliclazide is 20 mg to 300 mg, especially 40 mg to 240 mg per day. The preferred range of amounts in the pharmaceutical composition is from 20 to 240 mg, in particular from 20 to 80 mg. Examples include 20 mg, 30 mg, 40 mg and 50 mg. Preferably, said amounts are administered one, two, or three times per day.

A preferred oral dosage range for glizoxepide is 1 mg to 20 mg, especially 1 mg to 16 mg per day. The preferred range of amounts in the pharmaceutical composition is from 1 mg to 8 mg, in particular from 1 mg to 4 mg. Preferably, these amounts are administered one, two, three or four times a day.

A preferred oral dosage range for tolbutamide is 100 to 3000 mg, preferably 500 mg to 2000 mg per day. The preferred range of amounts in the pharmaceutical composition is from 100 mg to 1000 mg. Preferably, these amounts are administered once or twice a day.

The preferred oral dosage range for glipizide is 1 mg to

- 36 042990 mg, primarily from 2.5 mg to 40 mg per day. The preferred range of amounts in the pharmaceutical composition for administration once, twice or three times a day is from 1 mg to 50 mg, from 0.5 mg to 25 mg and from

0.3 mg to 17 mg, respectively.

A preferred oral dosage range for nateglinide is 30 mg to 500 mg, especially 60 mg to 360 mg per day. The preferred range of amounts in the pharmaceutical composition is from 30 mg to 120 mg. Examples include 30 mg, 60 mg and 120 mg. Preferably, said amounts are administered once, twice or three times a day.

Nateglinide can be administered in the form of a commercial product available, for example, under the trade name STARLIX™.

A preferred oral dosage range for repaglinide is 0.1 to 16 mg, especially 0.5 mg to 6 mg per day.

The preferred range of amounts in the pharmaceutical composition is from 0.5 to 4 mg. Examples include 0.5 mg, 1 mg, 2 mg or 4 mg. Preferably, these amounts are administered one, two, three or four times a day. Repaglinide can be administered in the form of a commercial product available, for example, under the trade name NOVONORM™.

A preferred oral dosage range for acarbose is 50 mg to 1000 mg, especially 50 mg to 600 mg per day. The preferred range of amounts in the pharmaceutical composition is from 50 mg to 150 mg. Examples include 50 mg and 100 mg. Preferably, these amounts are administered one, two, three or four times a day. Acarbose can be administered in the form of a commercial product available, for example, under the trade name Crlucobay™.

A preferred oral dosage range for voglibose is 100 mg to 1000 mg, especially 200 mg to 600 mg per day. The preferred range of amounts in the pharmaceutical composition is from 50 mg to 300 mg. Examples include 50 mg, 100 mg, 150 mg, 200 mg and 300 mg. Preferably, these amounts are administered one, two, three or four times a day. Voglibose can be administered in the form of a commercial product available under the trade name Basen™ or Voghsan™, for example.

The preferred oral dosage range for miglitol is 25 mg to 500 mg, especially 25 mg to 300 mg per day. The preferred range of amounts in the pharmaceutical composition is from 25 mg to 100 mg. Examples include 25 mg, 50 mg and 100 mg. Preferably, these amounts are administered one, two, three or four times a day. Miglitol can be administered in the form of a commercial product available, for example, under the trade name Crlyset™.

A preferred dosage range for GLP-1 analogues, especially exenatide, is 5 to 30 µg, especially 5 µg to 20 µg per day.

The preferred range of amounts in the pharmaceutical composition is 5 to 10 μg. Examples include 5 µg and 10 µg. Preferably, said amounts are administered one, two, three or four times daily by subcutaneous injection. Exenatide can be administered in the form of a commercial product available, for example, under the trade name Byetta™.

The sustained release formulation, preferably administered by subcutaneous injection once a week, comprises exenatide in an amount of 0.1 mg to 3.0 mg, preferably 0.5 mg to 2.0 mg. Examples include 0.8 mg and 2.0 mg. An example of a long acting formulation of exenatide is the product under the trade name Byetta LAR™.

The preferred dosage range for liraglutide is 0.5 mg to 3 mg, especially 0.5 mg to 2 mg per day. The preferred range of amounts in the pharmaceutical composition is from 0.5 mg to 2 mg. Examples include 0.6 mg, 1.2 mg and 1.8 mg. Preferably, said amounts are administered once or twice daily by subcutaneous injection.

The amounts of the DPP-4 inhibitor and the second and/or third therapeutic agent in the pharmaceutical composition, as well as in the methods and uses of the present invention, are within the respective dosage ranges as described above. For example, preferred dosage ranges in the pharmaceutical composition, combination, method and use of the present invention include linagliptin in an amount of 0.5 mg to 10 mg (especially 1 mg to 5 mg, especially 2.5 or 5 mg) and /or optionally metformin in an amount of 250 to 1000 mg (especially 500 mg, 850 mg or 1000 mg). Oral administration once or twice a day is preferred.

In the combined methods and combined uses of the present invention, the DPP-4 inhibitor and the second and/or third therapeutic agent are administered in combinations including, but not limited to, administering the active ingredients at the same time, i. at the same time, or basically at the same time, or sequential administration of the active ingredient, i.e. first, one or two active ingredients are administered, and after a certain period of time, the other two active ingredients or one active ingredient are administered, i.e. at least two of the three active ingredients are administered sequentially. This period of time may vary from 30 minutes to 12 hours. Administration in combination or alternate administration is carried out once, twice, three or four times a day, preferably once or twice a day.

- 37 042990

In the combined administration of a DPP-4 inhibitor and a second and/or third antidiabetic agent, all three active ingredients may be present in a single dosage form, for example, in one tablet or capsule, or one or two active ingredients may be present in a separate dosage form, for example, in two different or identical dosage forms.

When administered alternately, one or two active ingredients are present in a separate dosage form, for example in two different or identical dosage forms.

Thus, the pharmaceutical combination of the present invention may be a single dosage form that includes a DPP-4 inhibitor and a second and optionally a third anti-diabetic agent. In another embodiment, the pharmaceutical combination of the present invention may be two separate dosage forms, with one dosage form comprising a DPP-4 inhibitor and the other dosage form comprising a second and optionally third anti-diabetic agent, or in the case of a triple combination, one dosage form comprising a DPP- inhibitor 4 and a second or third antidiabetic agent, and the other dosage form comprises a third or second antidiabetic agent, respectively. Alternatively, in the case of a triple combination, the pharmaceutical combination of the present invention may be three separate dosage forms, with one dosage form comprising a DPP-4 inhibitor, a second dosage form comprising a second antidiabetic agent, and a third dosage form comprising a third antidiabetic agent. Alternatively, in the case of a dual combination, the pharmaceutical combination of the present invention may be two separate dosage forms, with one dosage form comprising a DPP-4 inhibitor and the second dosage form comprising a second antidiabetic agent.

Included within the scope of the present invention is the case where the active ingredient needs to be administered more frequently, for example twice a day, compared to the other active ingredient(s), which, for example, needs to be administered once a day. In this regard, the term administration in combination also includes a course of administration when all the active ingredients are first administered in combination, and after a certain period of time the active ingredient is again administered, or vice versa.

Thus, the present invention also includes pharmaceutical combinations that are separate dosage forms, with one dosage form comprising a DPP-4 inhibitor and a second and optionally third therapeutic agent, and the other dosage form comprising only the second and/or third therapeutic agent.

In this regard, the present invention also includes pharmaceutical compositions or combinations for the separate, sequential, simultaneous, joint, sequential or chronological application of active ingredients or components.

The pharmaceutical composition, which is a single dosage form or a plurality of dosage forms, preferably a set of components, can be used in combination therapy, which provides a versatile therapeutic approach in accordance with the individual needs of the patient.

In the first version, the set of components includes:

(a) a first compartment containing a dosage form comprising a DPP-4 inhibitor and at least one pharmaceutically acceptable carrier; and (b) a second compartment containing a dosage form comprising a second antidiabetic agent and at least one pharmaceutically acceptable carrier; and optionally (c) a third compartment containing a dosage form comprising a third anti-diabetic agent and at least one pharmaceutically acceptable carrier.

In the second version, the set of components includes:

(a) a first compartment containing a dosage form comprising a DPP-4 inhibitor and a second or third antidiabetic agent, as well as at least one pharmaceutically acceptable carrier; and (b) a second compartment containing a dosage form comprising a third or second antidiabetic agent, respectively, and at least one pharmaceutically acceptable carrier.

In the third option, the set of components includes:

(a) a first compartment containing a dosage form comprising a DPP-4 inhibitor and at least one pharmaceutically acceptable carrier; and (b) a second compartment containing a dosage form comprising a second and third antidiabetic agent and at least one pharmaceutically acceptable carrier.

In one aspect of the present invention, there is provided a product comprising a pharmaceutical combination representing the individual dosage forms of the present invention and a label or package insert containing instructions that the individual dosage forms are to be administered in combination.

In a first embodiment, the product includes (a) a pharmaceutical composition containing a DPP-4 inhibitor of the present invention, and (b) a label or package insert containing instructions stating that the drug can or should be administered, for example, in combination with a drug comprising a second antidiabetic agent of the present invention, or a fixed or non-fixed combination (eg, drug) comprising a second antidiabetic agent and a third antidiabetic agent of the present invention.

In a second embodiment, the product comprises (a) a second antidiabetic agent of the present invention and (b) a label or package insert containing instructions stating that the drug may or should be administered, for example, in combination with a drug comprising an inhibitor. DPP-4 of the present invention, or with a fixed or non-fixed combination (eg drug) comprising a DPP-4 inhibitor and a third antidiabetic agent of the present invention.

In a third embodiment, the product includes (a) a pharmaceutical composition containing a DPP-4 inhibitor of the present invention and a second antidiabetic agent of the present invention, and (b) a label or package insert containing instructions stating that the drug can be or should be administered, for example, in combination with a drug comprising a third anti-diabetic agent of the present invention.

The required dose of the pharmaceutical composition of the present invention may generally be administered in a single daily dose or as divided daily doses administered at appropriate intervals, such as two, three or more doses per day.

The pharmaceutical composition can be formulated into a dosage form for oral, rectal, nasal, topical (including buccal and sublingual), transdermal, vaginal or parenteral (including intramuscular, subcutaneous and intravenous) administration in liquid or solid form or in a form suitable for administration by inhalation or blowing. Oral administration is preferred. The formulations are typically in unit dosage form, if desired, and may be prepared by any method known in the pharmaceutical art. All methods include the step of mixing the active ingredient with one or more pharmaceutically acceptable carriers, such as liquid carriers or finely divided solid carriers, or using both types of carriers, and then, if necessary, obtain a product of the desired form.

The pharmaceutical composition can be processed into tablets, granules, fine granules, powders, capsules, microtablets, soft capsules, pills, oral solutions, syrups, dry syrups, chewable tablets, lozenges, effervescent tablets, drops, suspensions, fast dissolving tablets, oral fast disintegrating tablets and etc.

The pharmaceutical composition and dosage forms preferably include one or more pharmaceutically acceptable carriers.

Preferred carriers are those which are acceptable in the sense of being compatible with the other ingredients of the composition and not adversely affecting the recipient. Examples of pharmaceutically acceptable carriers are known to those skilled in the art.

Pharmaceutical compositions suitable for oral administration are usually presented in discrete forms such as capsules, including soft gelatin capsules, sachets or tablets (each containing a predetermined amount of the active ingredient), powder or granules, solution, suspension or emulsion, for example , syrups, elixirs, or self-emulsifying drug delivery systems (SDSDS). The active ingredients may also be presented as boluses, porridges or pastes. Tablets and capsules for oral administration contain standard excipients such as binders, fillers, lubricants, disintegrants or wetting agents. Tablets can be coated by a known method. Oral liquid preparations may be, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be a dry product intended to be dissolved in water or other suitable vehicle immediately prior to use. Such liquid preparations contain conventional additives such as suspending agents, emulsifying agents, non-aqueous carriers (which include edible oils), or preservatives.

The pharmaceutical composition of the present invention can also be formulated into a parenteral (e.g., injection, e.g., bolus or continuous infusion) form and into unit dosage form in ampoules, pre-filled syringes, small volume infusion containers, or multiple dose containers with the addition of preservative. The compositions may be in forms such as suspensions, solutions or emulsions in oily or aqueous vehicles and may contain processing aids such as suspending, stabilizing and/or dispersing agents. In another embodiment, the active ingredients may be a powder obtained by isolation of a solid under sterile conditions or lyophilization from a solution, intended to be dissolved before use in a suitable carrier, for example, sterile, pyrogen-free water.

The most preferred unit dosage form of pharmaceutical compositions suitable for rectal administration, which include a solid carrier, are suppositories. Suitable carriers include cocoa butter and other known materials commonly used in

- 39 042990 of this field, and these suppositories are usually obtained by mixing the active(s) compound(s) with softened(s) or molten(s) carrier(s), and then cooled and shaped by molding.

When administered pharmaceutically to warm-blooded vertebrates, especially humans, the compounds of the present invention are usually administered at doses of 0.001 to 100 mg/kg body weight, preferably 0.1-15 mg/kg, in each case 1 to 4 times per day. . For this purpose, the compounds, optionally in combination with other active compounds, may be mixed with one or more inert standard carriers and/or diluents, e.g. corn starch, lactose, glucose, microcrystalline cellulose, magnesium stearate, polyvinylpyrrolidone, citric acid, tartaric acid. , water, water/ethanol mixture, water/glycerin mixture, water/sorbitol mixture, water/polyethylene glycol mixture, propylene glycol, cetyl stearyl alcohol, carboxymethyl cellulose, or fatty compounds such as tallow, or suitable mixtures thereof, and processed into standard herbal preparations, such as flat or coated tablets, capsules, powders, suspensions or suppositories.

Thus, pharmaceutical compositions of the present invention, comprising DPP-4 inhibitors, as defined herein, can be prepared by those skilled in the art using pharmaceutically acceptable formulation excipients. Examples of such excipients include, but are not limited to, diluents, binders, carriers, fillers, lubricants, flow agents, crystallization retarders, disintegrants, solubilizers, colorants, pH adjusters, surfactants, and emulsifiers.

Examples of suitable diluents for compounds according to option A include powdered cellulose, calcium hydrogen phosphate, erythritol, low substituted hydroxypropyl cellulose, mannitol, pregelatinized starch or xylitol. Among these diluents, the most preferred are mannitol, low substituted hydroxypropyl cellulose and pregelatinized starch.

Examples of suitable lubricants for the Option A compounds include talc, polyethylene glycol, calcium behenate, calcium stearate, hydrogenated castor oil or magnesium stearate. Among these lubricants, magnesium stearate is most preferred.

Examples of suitable binders for Option A compounds include copovidone (copolymers of vinylpyrrolidone and other vinyl derivatives), hydroxypropyl methylcellulose (HPMC), hydroxypropyl cellulose (HPC), polyvinylpyrrolidone (povidone), pregelatinized starch or low substituted hydroxypropylcellulose (HC-HPC). Among these binders, copovidone and pregelatinized starch are most preferred.

Examples of suitable disintegrating agents for compounds of Option A include cornstarch or crospovidone. Among these disintegrating agents, corn starch is the most preferred.

Suitable methods for preparing pharmaceutical compositions of the DPP-4 inhibitors of embodiment A of the present invention include:

direct tabletting of the active compound from powder mixtures with suitable tabletting excipients;

granulation in a mixture with suitable excipients, subsequent mixing with suitable excipients and subsequent tabletting, as well as film coating; or packaging powder mixtures or granules into capsules.

Suitable granulation methods include:

wet granulation in a high speed mixer followed by fluid bed drying;

granulation in one installation;

granulation in a fluidized bed; or dry granulation (eg by rotary compaction) in admixture with suitable excipients and subsequent tableting or capsule packaging.

A typical composition of the DPP-4 inhibitor according to option A of the present invention includes a first diluent - mannitol, pregelatinized starch as a second diluent with additional properties of a binder, a binder - copovidone, a corn starch disintegrant, and magnesium stearate as a lubricant, while copovidone and/or cornstarch are optional.

A more detailed description of dosage forms, compositions and methods of administration of DPP-4 inhibitors of the present invention is given in the scientific literature and/or in published patent documents, primarily cited in this context.

Pharmaceutical compositions (or formulations) can be packaged in a variety of ways. Typically, the product for distribution includes a container that contains the pharmaceutical composition in an appropriate form. Tablets are usually packaged in an appropriate primary packaging,

- 40 042990 convenient for transportation, distribution and storage, as well as providing a sufficiently high stability of the composition during prolonged contact with the environment during storage. Vials or blister packs are used as primary containers for tablets.

A suitable vial, for example, for a pharmaceutical composition or combination comprising a DPP-4 inhibitor according to option A of the present invention, is made of glass or polymer (preferably polypropylene (PP) or high density polyethylene (HDPE)) and is sealed with a screw cap. The screw cap is provided with a child-proof lock (eg, a press-and-twist lock) to prevent or hinder children from accessing the contents. If necessary (eg, under conditions of high humidity), the shelf life of the packaged composition can be extended by the additional use of a desiccant (such as, for example, bentonite clay, molecular sieves, or preferably silica gel).

A suitable blister pack, for example, for a pharmaceutical composition or combination containing a DPP-4 inhibitor according to embodiment A of the present invention, includes or consists of a top foil (which is torn when the tablets are removed) and a bottom (which contains the cells for the tablets). The top foil may comprise a metal foil, especially aluminum foil or an aluminum alloy foil (for example, 20 µm to 45 µm thick, preferably 20 µm to 25 µm), on the inside of which a heat-sensitive polymer layer (insulating side) is applied. The lower part may comprise a multilayer polymer foil (such as, for example, polyvinyl chloride (PVC) coated with polyvinylidene chloride (PVDC), or PVC foil laminated with polychlorotrifluoroethylene (PCTFE)) or a multilayer polymer/metal/polymer foil (such as, for example, PVC/aluminum/polyamide laminated composition obtained by cold forming).

The product also includes a label or package leaflet that contains the instructions usually included in commercial packages of drugs, which contain information about the indications, use, dosage, administration, contraindications and / or warnings regarding the use of these drugs. In one embodiment, the label or package insert indicates that the composition can be used for any of the purposes described in this context.

Pharmaceutical compositions and methods of the present invention are characterized by beneficial effects in the treatment and prevention of diseases and conditions, as described in this context. Double combinations are characterized by beneficial effects compared to treatment with the active ingredient in monotherapy regimen. Triple combinations are characterized by beneficial effects compared to dual therapy with one or two of the three active ingredients. Beneficial effects are manifested, for example, in terms of efficacy, dosage, frequency of dosing, pharmacodynamic properties, pharmacokinetic properties, reduction of side effects, convenient mode of administration, patient consent, and the like.

Methods for producing linagliptin are known to the skilled person and are described in the literature, primarily described in WO 2002/068420, WO 2004/018468 or WO 2006/048427, the contents of which are incorporated herein by reference. Polymorphic crystal modifications and formulations of specific DPP-4 inhibitors are described in WO 2007/128721 and WO 2007/128724, respectively, the contents of which are incorporated herein by reference in their entirety. Compositions of specific DPP-4 inhibitors with metformin or other combination components are described in WO 2009/121945, the contents of which are incorporated herein by reference in their entirety.

Methods for preparing other DPP-4 inhibitors are described in the scientific literature and/or in published patent documents, primarily those cited herein.

The active ingredients, primarily the DPP-4 inhibitor and/or the second and/or third antidiabetic agent, may be present as a pharmaceutically acceptable salt. Pharmaceutically acceptable salts include, but are not limited to, salts of inorganic acids such as hydrochloric acid, sulfuric acid and phosphoric acid, salts of organic carboxylic acids such as oxalic acid, acetic acid, citric acid, malic acid, benzoic acid, maleic acid , fumaric acid, tartaric acid, succinic acid and glutamic acid, as well as salts of organic sulfonic acids such as methanesulfonic acid and p-toluenesulfonic acid. Salts are obtained by mixing the compound and acid in appropriate amounts and ratios in a solvent and decomposing agent. They are also obtained by cation or anion exchange from other salts.

The active ingredients, or pharmaceutically acceptable salts thereof, may be present as a solvate, such as a hydrate, or an alcohol adduct.

Due to the fact that various metabolic functional disorders in most cases develop simultaneously, it is often recommended to combine a number of active agents with different mechanisms of action. Thus, depending on the diagnosed functional disorders, an improved method of treatment can be used if the DPP-4 inhibitor is combined with active compounds that are commonly used to treat the respective disorders, such as

- 41 042990 as, for example, one or more active compounds selected from other antidiabetic compounds, in particular active compounds which lower blood sugar or blood lipid levels, increase high-density lipoprotein (HDL) levels in the blood, lower blood pressure , or which are prescribed for the treatment of atherosclerosis or obesity.

The DPP-4 inhibitors mentioned above, in addition to their use for treatment in monotherapy, can also be used in combination with other active compounds, which leads to improved treatment results. Said combination treatment may be used as a free combination of compounds or as a fixed combination, eg tablets or capsules. The pharmaceutical compositions of the combination component required for this are commercial products or can be obtained by a person skilled in the art by standard techniques. Active compounds that can be obtained in the form of commercial pharmaceutical compositions are described in the prior art, for example, in the annually published drug list, in the Federal Pharmaceutical Industries Association's Rote Liste® drug formulary, or in the annually updated manufacturer's directory of prescription drugs. Physicians' Desk Reference.

Examples of antidiabetic combination components include metformin, sulfonylureas such as glibenclamide, tolbutamide, glimepiride, glipizide, gliquidone, glibornuride and gliclazide, nateglinide, repaglinide, thiazolidinediones such as rosiglitazone and pioglitazone, PPAR-γ modulators such as as metaglidases, PPAR-γ agonists such as rivoglitazone, mitoglitazone, INT-131 or balaglitazone, PPAR-γ antagonists, PPAR-γ/α modulators such as tezaglitazar, muraglitazar, aleglitazar, indeglitazar and KRP297, PPAR-γ/α modulators /δ such as lobeglitazone, AMPK activators such as AICAR, acetyl-CoA carboxylase inhibitors (ACC1 and ACC2), diacylglycerol acetyltransferase (DGAT) inhibitors, pancreatic β-cell GCRP agonists such as SMT3 receptor agonists and GPR119 , such as GPR119 agonists, 5ethyl-2-{4-[4-(4-tetrazol-1-ylphenoxymethyl)thiazol-2-yl]piperidin-1-yl}pyrimidine or 5-[1-(3isopropyl[1,2 ,4]oxadiazol-5-yl)piperidin-4-ylmethoxy]-2-(4-methanesulfonylphenyl)pyridine, Πβ-HSD inhibitors, FGF19 agonists or analogs, α-glucosidase blockers such as acarbose, voglibose and miglitol, a2, insulin and insulin analogs such as human insulin, insulin lispro, insulin gluzilin, rDNA-insulinaspart, insulin NPH, insulin detemir, insulin degludec, insulin tregopil, insulin zinc suspension and insulin glargine, GIP, amylin, and amylin analogs (e.g., pramlintide or dalintide), GLP-1 and GLP-1 analogues such as exendin-4, eg exenatide, exenatide LAR, liraglutide, taspoglutide, lixisenatide (AVE-0010), LY-2428757, dulaglutide (LY-2189265), semaglutide or albiglutide, SGLT2 inhibitors such as dapagliflozin, sergliflozin (KGT-1251), atigliflozin, canagliflozin, ipragliflozin, or tofogliflozin, protein tyrosine phosphatase inhibitors (eg, troduskvemin), glucose-6-phosphatase inhibitors, fructose-1,6-bisphosphatase modulators, glycogen phosphorylase modulators, glucagon receptor antagonists, phosphoenolpyruvate carboxykinase (PEPCK) inhibitors, pyruvate dehydrogenase kinase (PDK) inhibitors, tyrosine kinase inhibitors (50 mg to 600 mg) such as PDGF receptor kinase (see EP-A-564409, WO 98/35958, US 5093330, WO 2004/005281 and WO 2006/041976) or serine/threonine kinases, glucokinase/regulatory protein modulators, including glucokinase activators, glycogen synthase kinase inhibitors, inositol-5 inhibitors SH2-domain-containing type 2 phosphatase (SHIP2), IKK inhibitors such as high dose salicylate, JNK1 inhibitors, C-θ-protein kinase inhibitors, β-3 agonists such as ritobegron, YM 178, solabegron, talibegron, N -5984, GRC-1087, rafabegron, FMP825, aldose reductase inhibitors such as AS 3201, zenarestat, fidarestat, epalrestat, ranirestat, NZ314, CP-744809 and CT-112, SGLT-1 or SGLT-2 inhibitors such as, for example , dapagliflozin, sergliflozin, atigliflozin, canagliflozin, or (1S)-1,5-anhydro-1-[3-(1-benzothiophen-2-ylmethyl)-4fluorophenyl]-O-glucitol, KV 1.3 channel inhibitors, GPR40 modulators, such such as [(3S)-6({2',6'-dimethyl-4'-[3-(methylsulfonyl)propoxy]biphenyl-3-yl}methoxy)-2,3-dihydro-1-benzofuran- 3yl]acetic acid, SCD-1 inhibitors, CCR-2 antagonists, dopamine receptor agonists (bromocriptine mesylate (cycloset)), 4-(3-(2,6-dimethylbenzyloxy)phenyl)-4-oxobutanoic acid, sirtuin stimulants, as well as other DPP-4 inhibitors.

Metformin is usually given in doses of about 500 mg to 2000 mg, up to 2500 mg per day, using various courses of treatment from about 100 mg to 500 mg or from 200 mg to 850 mg (1-3 times a day), or from about 300 mg to 1000 mg once or twice daily, or in sustained-release form of metformin at doses of about 100 mg to 1000 mg, or preferably 500 mg to 1000 mg once or twice daily, or from about 500 mg up to 2000 mg once a day. Specific dosages include 250 mg, 500 mg, 625 mg, 750 mg, 850 mg, and 1000 mg metformin hydrochloride.

For children aged 10 to 16 years, the recommended starting dose of metformin is 500 mg once daily. If the indicated dose does not provide adequate results, the dose is increased to 500 mg twice a day. Then the dose is increased each time by 500 mg once a week to a maximum

- 42 042990 daily dose of 2000 mg administered in divided doses (eg 2 or 3 divided doses).

Metformin can be taken with food to reduce nausea.

The dose of pioglitazone is usually approximately 1-10 mg, 15 mg, 30 mg or 45 mg once a day.

Rosiglitazone is usually prescribed in doses of 4 mg to 8 mg once (or divided into two doses) per day (typical doses are 2 mg, 4 mg and 8 mg).

Glibenclamide (glyburide) is usually given in doses of 2.5-5 mg to 20 mg once (or divided into two doses) per day (typical doses are 1.25 mg, 2.5 mg, and 5 mg), or administered micronized glibenclamide at a dose of 0.75-3 mg to 12 mg once (or divided into two doses) per day (typical doses are 1.5 mg, 3 mg, 4.5 mg and 6 mg).

Glipizide is usually given in doses of 2.5 mg to 10-20 mg once (up to 40 mg divided into two doses) per day (typical doses are 5 mg and 10 mg), or glibenclamide is administered in a sustained release form in dose of 5 mg to 10 mg (up to 20 mg) once daily (typical doses are 2.5 mg, 5 mg and 10 mg).

Glimepiride is usually prescribed in doses of 1-2 mg to 4 mg (up to 8 mg) once daily (typical doses are 1 mg, 2 mg and 4 mg).

The dual combination of glibenclamide/metformin is usually given in doses ranging from 1.25 mg/250 mg once daily to 10 mg/1000 mg twice daily (typical doses are 1.25 mg/250 mg, 2.5 mg/500 mg and 5 mg/500 mg).

The dual combination of glipizide/metformin is usually given at doses ranging from 2.5 mg/250 mg to 10 mg/1000 mg twice daily (typical doses are 2.5 mg/250 mg, 2.5 mg/500 mg and 5 mg/day). 500 mg).

The dual combination of glimepiride/metformin is usually given at doses of 1 mg/250 mg to 4 mg/1000 mg twice daily.

The dual combination rosiglitazone/glimepiride is usually given in doses ranging from 4 mg/1 mg once or twice daily to 4 mg/2 mg twice daily (typical doses are 4 mg/1 mg, 4 mg/2 mg, 4 mg/day). 4 mg, 8 mg/2 mg and 8 mg/4 mg).

The dual pioglitazone/glimepiride combination is usually given at doses ranging from 30 mg/2 mg to 30 mg/4 mg once daily (typical doses are 30 mg/4 mg and 45 mg/4 mg).

The dual combination rosiglitazone/metformin is usually given at doses ranging from 1 mg/500 mg to 4 mg/1000 mg twice daily (typical doses are 1 mg/500 mg, 2 mg/500 mg, 4 mg/500 mg, 2 mg/day). 1000 mg and 4 mg/1000 mg).

The dual pioglitazone/metformin combination is usually given at doses ranging from 15 mg/500 mg once or twice daily to 15 mg/850 mg three times daily (typical doses are 15 mg/500 mg and 15 mg/850 mg).

Nateglinide, a non-sulfonylurea insulin secretagogue, is usually given in doses of 60 mg to 120 mg with food (up to 360 mg/day, typical doses are 60 mg and 120 mg), repaglinide is usually given in doses ranging from 0 to 120 mg. 5 mg to 4 mg with food (up to 16 mg/day; typical doses are 0.5 mg, 1 mg, and 2 mg). The repaglinide/metformin dual combination is usually prescribed at doses of 1 mg/500 mg and 2 mg/850 mg.

Acarbose is usually given in doses of 25 mg to 100 mg with meals. Miglitol is usually given in doses of 25 mg to 100 mg taken with food.

Examples of components of combinations that lower blood lipids include hydroxymethylglutaryl-coenzyme A reductase (HMG-KoA reductase) inhibitors such as simvastatin, atorvastatin, lovastatin, fluvastatin, pravastatin, pitavastatin and rosuvastatin, fibrates such as bezafibrate, fenofibrate , clofibrate, gemfibrozil, etofibrate and ethophyllinclofibrate, nicotinic acid and its derivatives such as acipimox, PPAR-α agonists, PPAR-δ agonists, acyl coenzyme A/cholesterol acyltransferase (ACAT, EC 2.3.1.26) inhibitors such as avazimibe, cholesterol resorption inhibitors such as ezetimibe, compounds that bind to bile acid such as cholestyramine, colestipol and colesevelam, bile acid transport inhibitors, active compounds that modulate HDL such as D4F, reverse D4F, active compounds that modulate LXR, as well as active compounds, FXR modulators, CETP inhibitors such as torcetrapib, JTT-705 (dalcetrapib) or compound 12 described in WO 2007/005572 (anacetrapib), low density lipoprotein receptor (LDL) modulators, MTP inhibitors (eg lomitapide), and antisense RNA encoding ApoB100.

The dose of atorvastatin is usually 1 mg to 40 mg or 10 mg to 80 mg once daily.

Examples of components of combinations that lower blood pressure include β-blockers such as atenolol, bisoprolol, celiprolol, metoprolol and carvedilol, diuretics such as hydrochlorothiazide, chlorthalidone, xipamide, furosemide, pyretanide, torasemide, spironolactone, eplerenone, amiloride and triamterene, calcium channel blockers such as amlodipine, nifedipine, nitrendipine, nisoldipine, nicardipine, felodipine, lacidipine, lercanipidin, manidipine, isradipine, nilvadipine, verapamil, gallopamil and diltiazem, ACE inhibitors such as ramipril, lisinopril, cilazapril, quinapril, captop ril, enalapril , benazepril, perindopril, fosinopril and trandolapril, as well as angiotensin II receptor blockers (ARBs) such as telmisartan, candesartan, valsartan, losartan, irbesartan,

- 43 042990 olmesartan, azilsartan and eprosartan.

The dose of telmisartan is usually 20 mg to 320 mg or 40 mg to 160 mg per day.

Examples of components of combinations that increase blood HDL levels include cholesterol ester transfer protein (CETP) inhibitors, endothelial lipase inhibitors, ABC1 regulators, LXRa antagonists, LXRe agonists, PPAR-δ agonists, LXRa/β regulators, and compounds that increase expression and/or plasma concentration of apolipoprotein A-I.

Examples of components of combinations intended for the treatment of obesity include sibutramine, tetrahydrolipstatin (orlistat), alizim (cetilistat), dexfenfluramine, axokine, cannabinoid 1 receptor antagonists such as the CB1 antagonist rimonobant, MCH-1 receptor antagonists, MC4 receptor agonists, NPY5 antagonists and NPY2 (e.g., wellneperit), e3-AR agonists such as SB-418790 and AD-9677, 5HT2c receptor agonists such as APD 356 (lorcaserin), myostatin inhibitors, Acrp30 and adiponectin, steroyl coenzyme A desaturase inhibitors ( SCD1), fatty acid synthase (FAS) inhibitors, CCK receptor agonists, ghrelin receptor modulators, Ruy 3-36, orexin receptor antagonists and tesofensine, as well as bupropion/naltrexone, bupropion/zonisamide, topiramate/phentermine, and pramlintide/metreleptin dual combinations.

Examples of components of combinations intended for the treatment of atherosclerosis include inhibitors of phospholipase A2, inhibitors of tyrosine kinases (from 50 mg to 600 mg), such as PDGF receptor kinase (see patent EP-A-564409, application WO 98/35958, US patent 5093330, applications WO 2004/005281 and WO 2006/041976), antibodies against oxLDL and vaccines against oxLDL, apoA-1 Milano, ASA preparations, as well as VCAM-1 inhibitors.

The scope of the present invention is not limited to the specific embodiments described in this context. Based on the present description, various modifications of the present invention will become apparent to those skilled in the art along with those described herein. These modifications are included within the scope of the present invention and in the appended claims.

All patent applications cited in this context are incorporated herein by reference in their entirety.

Other embodiments, features and advantages of the present invention will become apparent from the following examples. The following examples are intended to illustrate the essence of the present invention and do not limit its scope.

Examples

Example 1

BI 1356, an effective and selective DPP-4 inhibitor, is safe and effective in patients with inadequately controlled type 2 diabetes despite metformin treatment.

The efficacy and safety of BI 1356 (1 mg, 5 mg, or 10 mg once daily), an effective and selective dipeptidyl peptidase-4 (DPP-4) inhibitor, was evaluated in treated patients diagnosed with type 2 diabetes (DT2). metformin (MET, >1 g daily) who had inadequate control (baseline HbA1c was 7.5%-10.0%). The drug was compared with placebo add-on treatment (PBO) or open label treatment with glimepiride (GLIM, 1 mg to 3 mg once daily) in a randomized, double-blind, 12-week trial. An antidiabetic drug other than metformin was washed out for 6 weeks (in 34.7% of patients).

Change in baseline HbA1c adjusted for previous antidiabetic drug treatment was used as the primary endpoint. 333 patients (baseline mean HbA1c was 8.3%, baseline mean fasting plasma glucose (FPG) was 185 mg/dL) were randomized to BI 1356, PBO, or open label GLIM. After 12 weeks, treatment with BI 1356 resulted in a significant placebo-adjusted mean reduction in HbA1c (BI 1356 1 mg dose, n=65, reduction was -0.39%, 5 mg dose, n=66, reduction was -0.75 %, 10 mg dose, n=66, reduction was -0.73%). Patients treated with GLIM experienced only a non-significant PBO-adjusted mean decrease in HbA1c levels at week 12 (n=64, decrease was 0.90%). Treatment with BI 1356 showed a statistically significant reduction in FPG from baseline at week 12 (dose 1 mg, reduction was -19 mg/dL, dose 5 mg, reduction was -35 mg/dL, dose 10 mg, reduction was -30 mg/dL). Therefore, a dose-dependent response was observed for HbA1c and FPG levels, reaching a plateau at the 5 mg dose of BI 1356. This dose provided >80% inhibition of DPP-4 in >80% of patients at week 12.

Overall, 106 patients (43.1%) developed side effects (AEs) with the same frequency in all treatment groups. The most frequently recorded episodes of nasopharyngitis (7.5%), diarrhea (3.3%) and nausea (3.0%). During treatment with BI 1356 or PBO, episodes of drug-associated hypoglycemia were not recorded, however, this hypoglycemia was recorded in 3 patients who received GLIM. Ten patients (3.7%) had serious PD, but none of these

- 44,042,990 episodes were not drug related.

Additional treatment with BI in 1356 patients diagnosed with TD2 and inadequately controlled during MET treatment alone provided a clinically relevant and statistically significant reduction in HbA1c levels. When combined treatment with BI 1356 (1 mg, 5 mg and 10 mg) along with MET treatment, a fairly high tolerance was observed, while episodes of hypoglycemia were not registered. The frequency of PD in the treatment with BI 1356 is comparable to the incidence of PD in the treatment of PBO.

Example 2

The suitability of a DPP-4 inhibitor or combination of the present invention to provide the effect of the present invention (eg, beneficial effects on glycemic control) can be evaluated in clinical trials.

For example, the efficacy and safety of a DPP-4 inhibitor of the present invention (e.g., 5 mg linagliptin given orally once a day) was evaluated in a randomized, double-blind, placebo-controlled, parallel-group trial in patients diagnosed with underweight type 2 diabetes. glycemic control (HbA1c levels ranged from 7.0% to 10% or from 7.5% to 10% or from 7.5% to 11%) despite treatment with one or two standard hypoglycemic agents, for example, selected from metformin, thiazolidinediones (e.g. pioglitazone), sulfonylureas, glinides, α-glucosidase inhibitors, GLP-1 or GLP-1 analogs, and insulin or insulin analogs.

In this drug trial, sulfonylurea, the efficacy and safety of the DPP-4 inhibitor of the present invention was compared with placebo administered as adjunctive treatment to mainstream sulfonylurea treatment (preparation period of 2 weeks with placebo administration, double-blind treatment). for 18 weeks, then after the completion of the course of treatment, a survey of patients for 1 week, the main treatment with a constant dose of the drug, sulfonylurea, during the entire trial period, including the preparatory period with the introduction of placebo).

The effectiveness of this treatment was assessed by determining the level of HbA1c, when compared with baseline and/or with the level in the placebo group. A significant change in HbA1c levels from baseline and/or placebo levels is indicative of the effectiveness of the DPP-4 inhibitor in treatment. The effectiveness of treatment can also be assessed by fasting plasma glucose levels compared with baseline levels and/or levels in the placebo group. A significant decrease in fasting plasma glucose concentrations indicates the effectiveness of treatment. In addition, if the desired response is observed during treatment (ie, the HbA1c level as a result of treatment is <7%), then this also indicates the effectiveness of the treatment.

The safety and tolerability of the treatment was assessed by examining the patients and by corresponding changes in the initial state, for example, the frequency and intensity of adverse events (such as, for example, episodes of hypoglycemia, etc.) or by weight gain.

Example 3

Treatment for prediabetes.

The efficacy of a pharmaceutical composition or combination of the present invention in the treatment of prediabetes characterized by abnormal fasting glucose levels and/or impaired glucose tolerance can be evaluated in clinical trials. In trials over a shorter period (e.g., 2-4 weeks) after completion of treatment, treatment efficacy was assessed by fasting glucose levels and/or postprandial glucose levels or after an exercise test (oral glucose tolerance test (oGTT) or a food tolerance test after ingestion of certain foods) to investigate and compare these levels with pre-test levels and/or with levels in the placebo group. In addition, fructosamine levels can be assessed before and after treatment and compared with baseline and/or placebo levels. A significant decrease in fasting or postprandial glucose levels indicates the effectiveness of treatment. In trials over a longer period (12 weeks or more), the effectiveness of treatment was assessed by the level of HbA1c, when compared with the baseline level and / or with the level in the placebo group. A significant change in HbA1c levels from baseline and/or placebo levels is indicative of the efficacy of the DPP-4 inhibitors or combinations of the present invention in the treatment of prediabetes.

Example 4

Prevention of overt type 2 diabetes.

The goal of treating patients with abnormal fasting glucose levels and/or impaired glucose tolerance (prediabetes) is also to prevent the development of overt type 2 diabetes. , for 15 years) were treated with a pharmaceutical composition or combination of the present invention

- 45 042990 tania or placebo or a course of non-drug treatment or a course of treatment with other drugs. During and at the end of treatment, fasting glucose and/or exercise testing (eg, pGTT) was used to determine the number of patients with overt type 2 diabetes, i. number of patients with fasting glucose >125 mg/dl and/or 2-hour glucose test result of pGTT >199 mg/dl. The significant reduction in the number of patients who developed overt type 2 diabetes when treated with a DPP-4 inhibitor or combination of the present invention compared to one of the other types of treatment is indicative of the effectiveness of preventing the transition from pre-diabetes to overt diabetes.

Example 5

Treatment of type 2 diabetes.

Treatment of patients diagnosed with type 2 diabetes with the pharmaceutical composition or combination of the present invention, in addition to a short-term improvement in glucose metabolism, prevents metabolic disorders for an extended period. This can be observed when comparing patients who were treated with a pharmaceutical composition or combination of the present invention for a longer period, for example, from 3 months to 1 g or even from 1 g to 6 years, with patients who were treated other antidiabetic drugs. Evidence of therapeutic efficacy compared with patients treated with other antidiabetic drugs is the absence or only a slight increase in fasting glucose and / or HbA1c levels. Another evidence of therapeutic efficacy is provided if deterioration in glucose metabolism (eg, an increase in HbA1c to >6.5% or >7%), for which treatment with an additional oral antidiabetic drug or insulin or an insulin analogue is recommended, occurs in a significantly lower percentage of patients treated with a pharmaceutical composition or combination of the present invention compared to patients treated with other drugs.

Example 6

Treatment of insulin resistance.

The effectiveness of the treatment was evaluated in clinical trials conducted over various periods of time (for example, from 2 weeks to 12 months), using hyperinsulinemic-euglycemic clamp test. A significant increase in the rate of glucose infusion at the end of the trial compared to baseline or compared to the placebo group or the group of patients who received a different course of treatment indicates the effectiveness of the DPP4 inhibitor, pharmaceutical composition or combination of the present invention in the treatment of insulin resistance.

Example 7

Treatment of hyperglycemia.

Treatment of patients with hyperglycemia was evaluated in clinical trials conducted over various time periods (eg, 1 day to 12 months) by measuring fasting or postprandial glucose levels (eg, after a meal or exercise test with pGTT, or after intake of certain foods). A significant decrease in indicated glucose levels during the course of the trial or at the end of the trial compared to baseline or compared with the placebo group or with the group of patients who received a different course of treatment indicates the effectiveness of the DPP-4 inhibitor, pharmaceutical composition or combination of the present invention in treatment of hyperglycemia.

Example 8

Prevention of micro- or macrovascular complications.

Treatment of patients diagnosed with type 2 diabetes or pre-diabetes with a DPP-4 inhibitor, pharmaceutical composition or combination of the present invention prevents or reduces the risk of developing microvascular complications (eg, diabetic neuropathy, diabetic retinopathy, diabetic nephropathy, diabetic foot, diabetic ulcer) or macrovascular complications ( e.g. myocardial infarction, acute coronary syndrome, unstable angina, stable angina, stroke, peripheral artery occlusive disease, cardiomyopathy, heart failure, cardiac arrhythmias, vascular restenosis). Treatment of patients diagnosed with type 2 diabetes or pre-diabetes with a pharmaceutical composition or combination of the present invention was carried out over an extended period of time, for example, for 1-6 years, and compared with patients who were treated with other antidiabetic drugs or placebo. Evidence of therapeutic efficacy compared with patients treated with other antidiabetic drugs or placebo may be a lower number of single or multiple complications. In the case of macrovascular events, diabetic foot and/or diabetic ulcer, these numbers were calculated using the history and various methods of analysis. In case of diabetic retinop

- 46 042990 the effectiveness of treatment was determined by a computerized method with illumination and examination of the fundus or other ophthalmological methods. In the case of diabetic neuropathy, in addition to the history and clinical examination, nerve conduction velocity was determined using, for example, a calibrated tuning fork. In diabetic nephropathy, before the start of the study, during its conduct and at the end, the following parameters were determined: albumin secretion, creatinine clearance, serum creatinine concentration, the time period until the serum creatinine concentration doubled, the time period until the development of a condition that requires dialysis .

Example 9

Treatment of the metabolic syndrome.

The effectiveness of a DPP-4 inhibitor, pharmaceutical composition or combination of the present invention can be evaluated in clinical trials conducted over various periods of time (for example, from 12 weeks to 6 years), fasting or postprandial glucose levels (for example, after ingestion of food or exercise test with pGTT or after ingestion of certain foods) or HbA1c levels. A significant decrease in indicated glucose levels or HbA1c levels during or at the end of the trial compared with baseline or compared with a placebo group or with a group of patients who received a different course of treatment indicates the effectiveness of the active compound or combination of active compounds in the treatment of metabolic syndrome . Examples include a decrease in systolic and/or diastolic blood pressure, a decrease in plasma triglycerides, a decrease in total or LDL cholesterol, an increase in HDL cholesterol, or a decrease in body weight from baseline at baseline or compared with a placebo or placebo group. other course of treatment.

Example 10

Therapeutic response to treatment with a DPP-4 inhibitor.

Genomic DNA samples from specific patients participating in a clinical trial (e.g., clinical trial described herein) of a DPP-4 inhibitor (e.g., linagliptin administered, for example, orally at a dose of 5 mg daily, optionally in combination with one or more other antidiabetic agents), generated and genotyped to identify variant(s) (e.g., polymorphisms) in one or more candidate genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, primarily the TCF7L2 risk genotype described herein, and scored against to the response of each patient during a clinical trial (see, for example, example 21). The relationship between the likelihood (eg, increased, decreased, or no likelihood) of a favorable response to DPP-4 inhibitor treatment (eg, a favorable change in HbA1c levels) and genetic variants (eg, TCF7L2 risk genotypes) or reference markers can be assessed using statistical analysis of results. genotyping.

Thus, the likelihood of a favorable response of an individual as a result of treatment of the specified individual with a DPP-4 inhibitor can be assessed by the specified genotyping of the nucleic acid sample of the individual, for example, by detecting one or more single nucleotide polymorphisms (SNPs) in the TCF7L2 gene, for example, one SNP selected from rs7903146 , rs12255372 and rs10885406, or upon detection of the corresponding wild-type genotype (see, for example, example 21).

Genotyping methods, i.e. identifying genetic variants (eg, polymorphisms, primarily described in this context) of patients' nucleic acid samples are known in the art. For example, molecular genetic methods for detecting single nucleotide polymorphisms, for example, in the TCF7L2 gene, are based on gene sequencing, microarray analysis, or PCR analysis.

Example 11.

Treatment with linagliptin alone improves glycemic control and measures of β-cell function in type 2 diabetes.

The efficacy of treatment with linagliptin monotherapy (LI, 5 mg once daily) was compared with placebo (PBO) in a randomized, double-blind, placebo-controlled, parallel-group, 24-week trial at several medical centers in patients who had not previously treated with drugs (naive patients) or previously treated (treated patients), diagnosed with type 2 diabetes mellitus (T2DM, baseline HbA1c was 4.9%-10.6%). After a 2-week placebo run-in period (pre-treated patients were not treated with medication for 4 weeks prior to run-in), patients were randomized to receive either LI (n=336) or PBO (n=167) . The groups included patients with similar baseline mean demographics (HbA1c was 8.0% (standard deviation (SD) 0.87), fasting plasma glucose (FPG) was 166.0 mg/dL (SD 41.1) , body mass index (BMI) was 29.05 kg/m ² (SD 4.81), age was 55.7 years (SD 10.2)). The primary parameter was

- 47 042990 change in the initial level of HbAlc 24 weeks after the start of treatment. With LI treatment, the PBO-adjusted change in HbA1c from baseline was -0.69% (p<0.0001) with a continuous decline in HbA1c over time from -0.46% at week 6 to -0.69 % at week 24 (both p<0.0001). In patients in the LI group, the probability of a decrease in HbA1c levels >0.5% at week 24 was >4 times higher than the probability in the PBO group (47.1% compared with 19.0%, p<0.0001). For patients with baseline HbA1c >7.0% at week 24, the required reduction in HbA1c to <7.0% was observed in significantly more patients treated with LI compared to those treated with PBO (25.2% compared to 11.6%, odds ratio 2.9, p=0.0006). Patients with baseline HbA1c levels >9.0% had the most significant decrease in HbA1c (-0.86%) from baseline. The improvement in FPG was -23.3 mg/dL (p<0.0001) compared to the PBO group. In the food tolerance test at week 24, patients in the LI group had a greater decrease in the adjusted mean change in glucose at 2 hours after a meal (AGR) from baseline (-58.4 mg/dL, p<0.0001) compared to the PBO group. Changes in the GMO-%B index (5.02 in the LI group compared with -17.2 in the PBO group ((mU / L) / (mmol / L))), proinsulin / insulin ratio (-0.015 in the LI group compared from 0.024 in the PBO group) and the glucose distribution index (3.05 in the LI group compared with -0.68 in the PBO group) indicate an improvement in insulin secretion (p<0.05) with LI treatment. The proportion of patients who experienced at least one side effect (AE) is comparable for both groups (52.4% in the LI group, 58.7% in the PBO group). Hypoglycemia was observed rarely, in 1 patient in each group. Serious AEs were observed in both groups (3.0% in the LI group, 4.2% in the PBO group), but none of these episodes were drug related. The minimum levels of LI in patients with mild to moderate renal insufficiency are comparable to the minimum levels in patients with normal renal function.

Conclusion: When treated with linagliptin alone, there is a significant, clinically meaningful, and sustained improvement in glycemic control, as evidenced by changes in FPG and HbA1c levels, accompanied by an improvement in β-cell function. Linagliptin is safe and well tolerated without causing clinically significant changes in body weight or waist circumference. The minimum levels of LI in patients with mild to moderate renal insufficiency are comparable to the minimum levels of LI in patients with normal renal function, which confirms that there is no need for dose optimization for patients with impaired renal function.

Example 12.

Efficacy and safety of linagliptin in inadequately controlled type 2 diabetes during metformin monotherapy.

Efficacy and safety of linagliptin (LI) as adjunctive treatment to metformin (MET) in patients with hyperglycemia and type 2 diabetes mellitus (T2DM) with poor glycemic control (HbA1c levels ranged from >7.0% to <10.0% for patients previously treated with metformin alone, or >6.5% to <9.0% for patients previously treated with additional oral hypoglycemic drugs) was assessed in a 24-week randomized, double-blind, parallel-group trial. with placebo control in several medical centers. Subjects included in the study arms interrupted previous anti-diabetic drug treatment with non-metformin (>1500 mg/day) for 6 weeks (including a run-in period with placebo administration (PBO) in the last 2 weeks) prior to randomization to the LI treatment arms (n =524) or OBO (n=177). The groups included subjects with similar baseline means and demographics (HbA1c was 8.1%, FPG was 168.8 mg/dl, age was 56.5 years, BMI was 29.9 kg/m ² ). The primary endpoint was change in baseline HbA1c at 24 weeks post-treatment as assessed by analysis of covariance (ANCOVA), adjusted for baseline HbA1c and prior antidiabetic drug treatment. At 24 weeks post-treatment, the adjusted mean difference between LI+MET and PBO+MET treatment was -0.64% (p<0.0001), with the best change in HbA1c (%) occurring in the LI+MET group. Patients with baseline HbA1c levels >7.0% who were treated with LI+MET were more likely to have an improvement in HbA1c levels <7.0% compared with patients treated with PBO+MET (26.2% vs. 9.2 %, respectively, odds ratio 4.4, p=0.0001). At week 24, the LI+MET group had a greater decrease in mean FPG from baseline (-21.1 mg/dl, p<0.0001) compared to the PBO+MET group. At the end of the trial, according to food tolerance tests, in the group of patients who were treated with LI + MET, there was a significantly greater (p<0.0001) average decrease in GLP after 2 hours relative to baseline (-67.1 mg / d) compared with the PBO+MET group. The proportion of patients who experienced at least one side effect (AE) was comparable in the LI+MET and PBO+MET groups (52.8% and 55.4%, respectively). Hypoglycemia was rare, in 5 patients in the PBO+MET group (2.8%) and in 3 patients in the

LI+MET (0.6%), and in all cases there were episodes of mild severity. After 24 weeks, the two treatment groups showed a similar change in body weight from baseline (-0.5 kg in the PBO+MET group, -0.4 kg in the LI+MET group).

In conclusion, it should be noted that linagliptin at a dose of 5 mg once a day as an additional treatment for patients with inadequate control of T2DM in the treatment of metformin is characterized by a fairly high tolerance and provides significant and clinically significant improvements in glycemic control (decrease in HbA1c, FPG and UHL after 2 h without weight gain). Linagliptin as an add-on treatment to metformin treatment in patients with T2DM and poor glycemic control is characterized by a fairly high tolerability and a frequency of side effects comparable to placebo.

Example 13

Linagliptin improves glycemic control in patients with inadequately controlled type 2 diabetes during treatment with metformin and a sulfonylurea without weight gain or hypoglycemia.

Efficacy and safety of the DPP-4 inhibitor, linagliptin (LI, 5 mg once daily), administered to patients diagnosed with T2DM and poor glycemic control (HbA1c was 7.0-10.0%) in combined treatment with metformin (MET) and sulfonylurea (SM) were evaluated in a randomized, double-blind, parallel-group, placebo-controlled, 24-week, multicenter trial. The effectiveness of LI as an additional treatment was compared with placebo (PBO). All patients underwent placebo pretreatment for 2 weeks prior to randomization into the LI+MET+CM (n=793) or PBO+MET+CM (n=256) groups. The groups included patients with similar baseline mean parameters: HbA1c was 8.14% (SD 0.8), FPG was 160.1 mg/dL (36.6), age was 58.1 years (9.8) , BMI was 28.3 kg/m ² (4.7). The majority of patients (73.3%) had had T2DM for >5 years prior to enrollment in the study groups. The primary parameter was the change in baseline HbA1c at 24 weeks post-treatment, adjusted for baseline HbA1c. After 24 weeks of treatment, the mean change in HbA1c in the LI+MET+SM group was -0.62% lower (p<0.0001) compared to the PBO+MET+SM group. The maximum reduction in mean HbA1c (-0.84%) in the LI+MET+SM group was observed at week 12. Patients with a baseline HbA1c level >7.0% were likely to have their required HbA1c reduction to <7.0% at week 24 in the LI+MET+SM group (29.2%) was >5 times higher than in the PBO+MET+SM group (8.1%, odds ratio 5.5, p<0.0001). At week 24, there was a statistically significant (p<0.0001) adjusted mean difference in FPG change (-12.7 mg/dl) from baseline between the LI+MET+SM and PBO+MET+SM groups. Parameters related to β-cell function (fasting plasma insulin and GMO-%B), along with GMO-RI, improved significantly (p<0.05) in the LI+MET+SM group compared to the PBO+MET group +CM. The proportion of patients who reported a serious side effect (SAE) was insignificant for both LI+MET+SM and PBO+MET+SM groups (2.4% compared with 1.5%, respectively). The most common PD, which was more frequently reported in the LI+MET+SM group than in the PBO+MET+SM group, was hypoglycemia (22.7% versus 14.8%, respectively). It can be assumed that such APs are due to the administration of the combination with SM. No significant changes in body weight were observed in any treatment group. Conclusion: Treatment with linagliptin in addition to combined treatment with metformin and a sulfonylurea is effective and safe in providing significant and clinically meaningful improvements in glycemic control in patients diagnosed with T2DM. Linagliptin may provide an additional therapeutic benefit prior to insulin treatment in many patients with poor glycemic control during treatment with a combination of metformin and a sulfonylurea. Linagliptin has been found to have a favorable safety and tolerability profile. However, hypoglycemia may develop when linagliptin is used as an add-on treatment to a previous course of sulfonylurea treatment.

Example 14

Efficacy and safety of initial combined treatment with linagliptin and pioglitazone in patients with inadequately controlled type 2 diabetes.

The efficacy and safety of initial combination treatment with a DPP-4 inhibitor, linagliptin (LI), and pioglitazone (PIO) was evaluated in a randomized, double-blind, placebo-controlled, parallel-group, 24-week trial at multiple medical centers. Patients diagnosed with type 2 diabetes mellitus (T2DM) and poor glycemic control (HbA1c level was 7.5%-11.0%), i.e. naive patients or patients who had previously been treated with any oral hypoglycemic drug (OPG, treated patients) were randomized to receive 5 mg LI + 30 mg PIO once daily

- 49 042990 (n=259) or 30 mg PIO+placebo (PBO) once daily (n=130). Prior to randomization, patients had not taken any PGLS for at least 6 weeks. The groups included patients with similar baseline mean parameters (HbA1c level was 8.6%, FPG level was 190 mg/dl, age was 57.5 years, BMI was 29.0 kg/m ² ). The primary endpoint was change in baseline HbA1c at 24 weeks post-treatment, adjusted for baseline HbA1c and prior antidiabetic drug treatment. At 24 weeks post-treatment, the adjusted mean change in HbA1c in patients in the LI+PIO group (full analysis data set, carry forward of last measurement values) was -1.06% (standard error ±0.06). The difference in adjusted mean HbA1c in the LI+PIO group compared to the PBO+PIO group was -0.51% (p<0.0001, 95% confidence interval (CI): -0.71, -0.30). There was also a greater decrease in FPG in the LI+PIO group than in the PBO+PIO group, with a difference of -14.2 mg/dL at week 24 (p<0.0001, 95% CI: -21.1, -7.3). Patients in the LI+PIO group were more likely to achieve the required reduction in HbA1c to <7% compared with patients in the PBO+PIO group (42.9% vs. 30.5%, respectively, odds ratio 2.1, p= 0.0051), as well as a reduction in HbA1c >0.5% (75% vs. 50.8%, respectively, odds ratio 3.8, p<0.001). The proportion of patients who experienced at least one side effect (AE) is comparable in both groups of LI + PIO and PBO + PIO (136, 52.5% compared with 53.1%, respectively). Hypoglycemia was rare, with 3 patients (1.2%) in the LI+PIO group and no episodes in the PBO+PIO group. All episodes of hypoglycemia were characterized by mild severity.

Conclusion: The initial combination treatment with linagliptin and pioglitazone is characterized by significant and clinically significant improvements in FPG and HbA1c levels compared with PIO treatment alone, along with a greater improvement in β-cell function. Co-administration of linagliptin and pioglitazone is safe and well tolerated. Combination treatment with linagliptin and pioglitazone may provide an important synergistic treatment in patients diagnosed with T2DM with inadequate glycemic control or patients with renal insufficiency who are contraindicated in metformin treatment.

Example 15

Treatment with linagliptin alone for 12 weeks improves glycemic control in Japanese patients diagnosed with type 2 diabetes mellitus.

The efficacy and safety of the DPP-4 inhibitor, linagliptin (LI), was evaluated in a 12-week randomized, double-blind, placebo-controlled, parallel-group trial at multiple medical centers. Treatment efficacy with LI monotherapy (5 mg once daily and 10 mg once daily) was compared with placebo (PBO) in naïve Japanese patients or previously treated Japanese patients (treated patients) diagnosed with diabetes mellitus 2 (T2DM, baseline HbA1c was 7.0%-10.0% in naive patients and 7.0%-9.0% in treated patients). Prior to randomization to groups receiving LI 5 mg (n=159) or 10 mg (n=160) or PBO (n=80), all patients underwent a pre-treatment period of 2 weeks with PBO (patients treated with an oral hypoglycemic drug did not take the drug for 2 weeks prior to the run-in period). The groups included patients with similar mean baseline parameters and demographic data (SD indicated in brackets) (HbA1c level was 8.0% (0.68), FPN level was 163.5 mg/dL (32.4), BMI was 24 .97 g/m ² (3.86), age was 60.0 years (9.7)). The primary parameter was the change in HbA1c from baseline at 12 weeks. At week 12, the difference in adjusted mean changes in HbA1c from baseline was -0.87% with 5 mg LI compared with PBO (p<0.0001) and -0 with 10 mg LI. 88% compared with the PBO group (p<0.0001). The proportion of patients with HbA1c levels <7.0% at 12 weeks was 26.4% with 5 mg LI and 35.7% with 10 mg LI, compared to 10.0% with introduction of PBO. The proportion of patients whose HbA1c level decreased by at least 0.5% was 57.2% with 5 mg LI, 59.9% with 10 mg LI, and 8.8% with PBO. With the introduction of LI in both doses, 5 mg and 10 mg, there was a statistically significant difference compared with PBO (p<0.0001). FPG levels were significantly reduced with both 5 mg and 10 mg LI treatment compared with PBO: at 12 weeks, the difference in adjusted mean change from baseline was -19.7 mg/dL with 5 mg LI treatment compared with PBO (p<0.0001) and 20.4 mg/dl in the treatment of LI at a dose of 10 mg compared with PBO (p<0.0001). Changes in the proinsulin/insulin ratio (in the 5 mg LI group p=0.0065, in the 10 mg LI group p=0.0004) indicate that LI also significantly improves insulin secretion. The proportion of patients who experienced at least one side effect (AE) was comparable across the three groups (56.0% in the 5 mg LI treatment group, 53.1% in the 10 mg LI treatment group and 56.3 % in the IBO group). 9.4%, 8.8% and 10.0% of PD, respectively, were drug-induced. Episodes of hypoglycemia according to the investigator were not observed. Body weight in the treatment of LI at both doses, 5 mg and 10 mg, did not change: the changes were -0.39 kg and -0.06 kg, respectively, i.e. differed slightly from the change in weight with the introduction of IBO (-0.04 kg).

Conclusion: Linagliptin is characterized by a significant and clinically significant improvement in glycemic control, as evidenced by changes in HbA1c and FPG levels in patients of Japanese descent diagnosed with T2DM. Both doses of linagliptin, 5 mg and 10 mg, have similar efficacy in lowering HbA1c levels and are reasonably well tolerated in this population. The 5 mg dose of linagliptin is the therapeutic dose for Japanese patients and is the same as the therapeutic dose for Caucasian patients.

Example 16

Monotherapy with linagliptin provides more effective glycemic control in Japanese patients diagnosed with type 2 diabetes compared with voglibose.

The efficacy and safety of the DPP-4 inhibitor, linagliptin (LI), was compared with the α-glucosidase inhibitor, voglibose (WB), in a 26-week, randomized, double-blind, parallel-group, active-agent, multi-centre trial with naïve participants. patients of Japanese descent who were not previously treated with drugs, or patients of Japanese descent who were previously treated (treated patients), diagnosed with type 2 diabetes mellitus (T2DM, baseline HbA1c was 7.0% - 10.0% in naive patients and 7.0%-9.0% in patients who have previously taken any oral hypoglycemic drug (OHGL)). After 2 weeks of the preparatory period with the introduction of PBO, patients were randomized into groups in which LI was administered at a dose of 5 mg (n=159) or 10 mg (n=160) once a day, or VB was administered (0.2 mg three times a day). days, n=162). 2 weeks prior to the run-in period, any previous treatment with PGLS was discontinued. The groups included patients with similar baseline mean parameters and demographic data (SD in brackets) (HbA1c level was 8.01% (0.68), FPN level was 163.5 mg/dL (32.4), BMI was 24 .97 kg/m (3.86), age was 60.0 years (9.7)). The primary parameter was the change in HbA1c from baseline at 26 weeks. At week 26, the difference in adjusted mean changes in HbA1c levels was -0.32% with 5 mg LI treatment compared with WB treatment (p = 0.0003) and -0.39% with 10 mg LI treatment compared with treatment with WB (p<0.0001). The proportion of patients with HbA1c <7.0% at 26 weeks was 30.2% with 5 mg LI and 34.4% with 10 mg LI, compared to 22.2% with WB. The proportion of patients whose HbA1c decreased >0.5% was 57.2% and 53.5% with LI 5 mg and 10 mg, compared to 37.7% with WB. FPG levels were significantly reduced with both 5 mg and 10 mg LI treatment compared with WB treatment: the difference in adjusted mean change from baseline was -6.9 mg/dL with 5 mg LI treatment compared with WB treatment (p=0.02) and -9.8 mg/dl with LI treatment at a dose of 10 mg compared with WB treatment (p=0.0015). For both doses of LI, 5 mg and 10 mg, there was a significant decrease in HbA1c levels in patients previously treated with PGLS alone compared with WB (p=0.003 and p=0.0011, respectively). The development of >1 side effect (AP) is comparable for all groups (72.3% in the treatment of LI at a dose of 5 mg, 77.5% in the treatment of LI at a dose of 10 mg and 71.6% in the treatment of VB). 11.3%, 10.6% and 18.5% of PD, respectively, were drug related. Drug-related gastrointestinal disturbances were most frequently observed in the WB group (14.2%) compared with the LI groups (8.2% at the 5 mg dose, 8.1% at the 10 mg dose). In the WB group, 1 episode of hypoglycemia was recorded, while in the LI groups, no episodes of hypoglycemia were observed.

Conclusion: Treatment with linagliptin alone is more effective than WB in improving glycemic control in patients of Japanese descent diagnosed with T2DM. Both doses of linagliptin, 5 mg and 10 mg, after 26 weeks are characterized by comparable efficacy and statistically significant reductions in HbA1c and FPG levels from baseline compared with WB. Linagliptin is relatively well tolerated in Japanese patients diagnosed with T2DM compared with WB, with fewer APs per gastrointestinal tract and providing a valuable additional therapeutic effect to treatment courses in this population. The linagliptin dose of 5 mg is the therapeutic dose for patients of Japanese descent, which is the same as the therapeutic dose for white (European) patients.

Example 17.

Linagliptin restores β-cell function and survival of isolated human islet cells.

Studies in animal models of diabetes have shown that dipeptidylpetidase-4 (DPP-4) inhibitors reverse the progression of hyperglycemia and increase β-cell mass. In this example, the effect of linagliptin, a DPP-4 inhibitor, on human β-cell function was investigated. The isolated human islet cells were incubated at elevated glucose concentrations (5.5-33.3 mM),

- 51 042990 palmitic acid (0.5 mM), a mixture of interleukin-ΐβ (IL-Ιβ, 2 ng / ml) or interferon-γ (IFN-γ, 1000 U / ml) for 4 days or H ₂ O ₂ ( 50 μM) for 8 hours. Islet cells were pretreated with an IL-1 receptor antagonist (IL-1Ra, 500 ng/ml, which was found to restore β-cell function), linagliptin (100 nM), or vehicle for 1 h before exposure to diabetes stimulating agents, as well as during the entire treatment period for 4 days. Under control conditions, at a glucose concentration of 16.7 mM, islet cells secreted 3.8-fold more insulin compared to a glucose concentration of 2.8 mM. Conversely, the stimulation index decreased by 1.9- and 2.4-fold as a result of islet cell exposure to glucose at concentrations of 11.1 mM and 33.3 mM (P<0.05). As a result of the action on islet cells of palmitate, a mixture of cytokines or H ₂ O ₂ , a 2.1-, 2.2- and 1.9-fold decrease in glucose-stimulated insulin secretion (GSIS), respectively, was observed (P<0.05). Linagliptin significantly restored β-cell function under all conditions (SGSI increased by 1.9-, 2.5-, 3.3-, 1.9- and 3.7-fold in the presence of glucose at a concentration of 11.1 mM or 33.3 MM, in the presence of palmitic acid, cytokines or H ₂ O ₂ , P<0.05). IL-1Ra is characterized by a similar efficiency in restoring the function of β-cells under conditions of high glucose concentrations, in the presence of palmitic acid and cytokines, however, IL-1Ra does not restore the function of β-cells under conditions of oxidative stress caused by the action of H2O2. Due to the fact that the loss of function is mediated by oxidative stress, the concentration of nitrotyrosine was determined in islet cell lysates. In human islet cells, there was a significant increase in nitrotyrosine levels under all diabetic conditions (levels increased 13, 14, 6, 14 and 8 times at glucose concentrations of 11.1 mM or 33.3 mM, in the presence of palmitic acid, cytokines or H2O2, P <0.05), while no increased production of nitrotyrosine was observed when islet cells were treated with linagliptin.

In general, it has been found that the DPP-4 inhibitor linagliptin exerts, as IL-1Ra, comparable protective effects on gluco-, lipo- and cytokinotoxicity and furthermore improves β-cell function under conditions of oxidative stress, and also suppresses apoptosis (induced by the action of H ₂ O ₂ ). This example provides evidence for a direct protective effect of linagliptin on β-cell survival and insulin secretion.

Example 18.

Chronic kidney disease does not alter the pharmacokinetics of linagliptin, but increases the effects of sitagliptin and alogliptin in a rat model.

Renal failure is a common complication of T2DM. The effect of chronic kidney disease on the pharmacokinetics of dipeptidyl peptidase-4 inhibitors (linagliptin, sitagliptin, alogliptin) was studied in rat models with chronic renal failure (nephrectomy in 5/6 individuals (5/6H)). Eight weeks after surgery, rats were orally administered inhibitors for 4 days. As a result, in 5/6H individuals, the glomerular filtration rate decreased extremely significantly (P<0.001), which was assessed by creatinine clearance (simulation: 2510±210 ml/24 h, 5/6H: 1665±104.3 ml/24 h), and increased levels of cystatin C (sham: 700±35.7 ng/ml, 5/6H: 1434±77.6 ng/ml). Tubular function was significantly (P<0.001) impaired, as evidenced by plasma levels of neutrophil gelatinase-associated lipocalin (LAVH, sham: 286±23 ng/mL, 5/6H: 680±56.3 ng/mL) and β2 -microglobulin (simulation: 20.4±2.4 µg/ml, 5/6H: 33.3±1.34 µg/ml). DPP-4 activity was comparable in all groups.

When linagliptin (0.5 µmol/kg and 7 µmol/kg) was administered to 5/6H rats, no significant change in AUC(0-ot) was observed: simulation: 316±54.7 nmol/kg, 5/6H: 257±21, 54 nmolah/l, P=0.771 and sham: 1252±372 nmolahh/l, 5/6H: 748±74.5 nmolahh/l, P=0.284, respectively. In contrast, significantly (P=0.0001 and P=0.039) higher (41% and 28%) AUC(0-ot) values were observed for sitagliptin and alogliptin (7 µmol/kg): simulated sitagliptin: 3690±103 nmol/kg L, 5/6H: 6238±423 nmoleh/l and sham alogliptin: 1772±225 nmoleh/l, 5/6H: 2445±166 nmoleh/l). Moreover, tubular and glomerular function markers did not correlate with linagliptin AUC. On the contrary, for sitagliptin there was a significant correlation with creatinine clearance (r2=0.374, P<0.05), cystatin C (r2=0.499, P<0.01), LAF (r2=0.604, P<0.01) and β2 -microglobulin (r2=0.543, P<0.01). For alogliptin, there was a slight correlation with cystatin C (r2=0.376, P<0.05) and β2-microglobulin (r2=0.391, P<0.05), but no correlation with creatinine clearance and LAF.

The presented results indicate that renal insufficiency does not affect the pharmacokinetics of linagliptin, and at the same time, the action of sitagliptin and alogliptin is increased. Therefore, unlike sitagliptin and alogliptin, no dose optimization is required for linagliptin in patients with T2DM and renal insufficiency or diabetic nephropathy.

In addition, linagliptin significantly suppresses the expression of mRNA of profibrotic factors such as TGF-β1, T1MP-1 and collagen (Col3a1) in the heart of uremia rats, and these factors are markers of tissue fibrosis in cardiac fibrosis, and their levels are significantly increased in the heart with uremia. With uremia, in most cases characteristic cardiomyopathy develops with an increase in

- 52 042990 ventricles and fibrosis. In this regard, these antifibrotic properties of DPP-4 inhibitors can be used to treat myocardial and renal damage, uremia heart, cardiac fibrosis and/or cardiomyopathy with ventricular enlargement and fibrosis associated with uremia in patients diagnosed with type 2 diabetes. the action of linagliptin may have additional beneficial effects in patients with chronic kidney and/or heart disease, which in most cases accompanies type 2 diabetes.

Example 19.

Linagliptin reduces hepatic steatosis in a rodent model.

Liver steatosis is a hallmark in patients diagnosed with type 2 diabetes and non-alcoholic fatty liver disease (NAFLD). Linagliptin is a selective dipeptidyl peptidase-4 (DPP-4) inhibitor that is not excreted by the kidneys.

Linagliptin (3 mg/kg/day and 30 mg/kg/day, n=10) was tested for 4 weeks in a diet-induced obesity model (ATD, fed for 2 and 3 months). The content of lipids in the liver was determined in vivo by magnetic resonance spectroscopy (MRS), as well as ex vivo by the analysis of triglycerides in the liver. Linagliptin significantly (P<0.001) inhibits DPP4 activity, from 67% to 80% and from 79% to 89% (3 mg/kg/day and 30 mg/kg/day, respectively) compared with control. Significantly (P<0.01) reduced blood glucose levels (AUC) were observed after pGTT, ranging from 16% to 20% (3 mg/kg/day) and from 20% to 26% (30 mg/kg/day ). Similarly, the fat content in the liver was significantly reduced (detection by MRS). Changes in the content of fat in the liver were recorded no earlier than after 2 weeks of treatment. The correlation between hepatic lipids as measured by MPS and ex vivo hepatic triglyceride levels was r2=0.565 (P<0.0001).

In addition, ob/ob mice were examined after 14 days of treatment with linagliptin (3 mg/kg/day or control) and a blind histological analysis was performed (the severity and degree of obesity in points, the presence of inflammation markers were assessed). At the same time, inhibition of DPP-4 activity by 80% and a decrease in blood glucose (AUC) by 25% were observed (P<0.05). According to histological analysis (in points), in the linagliptin group, a lower degree of liver steatosis and inflammation was recorded in points (2.2±0.13, n=9, P<0.01) compared with the control group (3±0.18 , n=10).

In conclusion, linagliptin significantly reduced liver fat and NAFLD severity (as measured by histology) in a high-fat diet model. Linagliptin reverses the increase in the content of triglycerides in the liver and the development of hepatic steatosis (the therapeutic effect is significantly increased with more pronounced hepatic steatosis). Reversing the progression of hepatic steatosis confirms the importance of linagliptin in the treatment of patients diagnosed with type 2 diabetes and also with liver disease (NAFLD).

Example 20.

Linagliptin functionally reduces the degree of deregulated expression of DPP-4 in diabetic wounds.

Impaired wound healing is the main complication of diabetes mellitus. The dipeptidyl peptidase-4 (DPP-4) inhibitor, linagliptin, improves wound healing (according to tests in ob/ob mice). The effect of linagliptin on markers of inflammation in the skin wound was investigated and the beneficial effect of linagliptin on wound healing was evaluated.

In the wounds of ob/ob mice treated with linagliptin (3 mg/kg/day) and control ob/ob mice with wound sham, the content of inflammatory markers, COX-2 and MIP, was determined by the RNase protection assay, with no significant differences were found. Moreover, no increase in apoptotic infiltrating F4/80-positive macrophages was observed with linagliptin administration. In this regard, the expression of DPP-4 in the skin of diabetic and non-diabetic animals was evaluated. The results of immunohistochemical analysis (IHC) and immunoblotting indicated a significant expression of DPP-4 in the skin of healthy and diabetic mice (ob/ob lines), as well as keratinocytes as the main cellular source of this enzyme. Consistently, localization of the DPP-4 protein in the skin strongly correlated with full body autoradiography obtained after treatment with tritium-labeled linagliptin. The results of the analysis of DPP4 expression in mice with a wound through the entire thickness of the skin indicated a decrease in the expression of the DPP-4 protein in healthy mice 3 days after the wound was applied and the absence of this enzyme at the late stage of healing. It should be noted that when the skin is damaged, there is a significant deregulation of DPP-4 expression with a decrease in activity in proliferating keratinocytes at the wound border (IHC). In contrast, in acute wounds in diabetic mice, DPP-4 expression was not observed. However, DPP-4 protein expression was observed at a late stage of wound healing. Downregulation of the DPP-4 protein in diabetic skin compared to non-diabetic skin suggests that linagliptin would have a beneficial effect on wound healing processes. Thus, improvement in the wound healing process mediated by a suitable DPP-4 inhibitor, such as linagliptin, depends on the compensation (inhibition) of deregulated DPP-4 in diabetic wounds, and not on its hypoglycemic or immunomodulatory effects. In this regard, the DPP-4 inhibitor, which can be

- 53 042990 used to improve wound healing, is a DPP-4 inhibitor that is able to effectively bind to DPP-4 in the skin, for example, deregulated DPP-4 in diabetic wounds, preferably at its therapeutic dose.

In addition, in this context, a DPP-4 inhibitor that can be used to improve wound healing, especially in a patient diagnosed with type 2 diabetes, is a DPP-4 inhibitor that can be applied topically to wounds, for example, as part of wound dressings. or patches or creams or ointments. Thus, the present invention further provides devices for topical application to wounds, such as, for example, wound dressings or patches, comprising linagliptin and optionally one or more pharmaceutically acceptable carriers and/or excipients.

Example 21.

Relationship study (TCF7L2 genotyping, response to treatment).

Polymorphisms and variants of the TCF7L2 gene presented in Table. 3 were analyzed by the following method.

Table 3

Gene, variant nucleotides and rs-numbers

Gene Variant nucleotide rs number TCF7L2 p.382-41435 FROM rs7903146 p.483+9017 G>T rsl2255372 p.382-22060 A>G rsl0885406 With. 1102OG rs731788

Samples.

The assays used used patient DNA samples (50 ng/µl concentration) in 96-well plates.

Genotyping by Sanger direct sequencing.

Locus-specific DNA fragments were amplified using polymerase chain reaction (PCR) and genomic DNA as a template.

PCR was performed on the ABI BioRad® Tetrad PCR system. The quality of PCR products was analyzed by agarose gel electrophoresis. Purified PCR products were used as templates in sequencing reactions. According to the chain termination method described by Sanger et al. (1977), DNA sequence analysis is based on the termination of a growing DNA strand by the insertion of dye-labeled 2',3'dideoxyribonucleotide triphosphate (ddNTP) in the presence of DNA polymerase. Purified sequencing products were analyzed using an ABI PRISM® 3730 Genetic Analyzer.

Sequencing data was generated using licensed ABI software. The subsequent execution of the KB-basecaller base identification algorithm, as well as processing of the results, was carried out using the Staden software package. When executing the KB-basecaller algorithm, for all the bases identified on electrophoregrams of the automatic sequencer, the quality index (quality value) was determined using the KB-basecaller error probabilities. These quality indices were used in processing the results of single readings, and they were the main requirement for calculating the accuracy of sequencing (Applied Biosystems, 3730/3730x1/DNA Analyzer Sequencing Analysis Software Training).

A quality index (q) of 20 corresponds to an error probability (ep) of 1/100, a value of 30 corresponds to an error probability (ep) of 1/1000, and the like. At the stage of processing the results, these values were opposed to each other. Basically, sequencing was continued until each consensus base was assigned a quality index (q) of 50 or more, corresponding to an error probability (ep) of 1/100,000. Due to the fact that most of the consensus bases have an even higher quality index than the minimum index, the calculated cumulative probability of error for the final sequence is also significantly lower.

Sequencing data was loaded and analyzed using the JSI medical systems seqpatient software (version Seq Pilot 3.3.2, JSI medical systems GmbH, Friedhofstr. 5, 77971, Kippenheim, Germany).

For the following genotype analyses, only electrophoregrams that met internal quality parameters were processed.

Genotyping was performed by analyzing single polymorphisms rather than the whole gene. In this regard, the results of genotyping refer only to the positions of the variants indicated in Table. 3.

Genotyping using TaqMan PCR kit.

The TaqMan technique includes amplification of a PCR fragment with simultaneous detection of labeled probe degradation. Labels, an allele-specific dye and a quencher, were introduced into the probes by attaching them to both ends of the probe. During the amplification reaction, the specifically hybridized probe is displaced in the presence of DNA polymerase. This displacement occurs when the probe degrades

- 54 042990 under the action of the 5'-exonuclease activity of the polymerase in the case of high complementarity with the probe, or without degradation in the absence of complementarity. As the probe degrades, the quencher and dye separate and the fluorescent signal increases. An increase in the intensity of the fluorescent signal indicates the presence of the corresponding allele. Fluorescent signals were recorded using an ABI PRISM 7700 system (Applied Biosystems).

More specifically, a Master Mix containing all PCR components was prepared and aliquoted into the appropriate number of wells. DNA was then added to each well according to the plate format except for the no template control (NTC).

Analysis ID AB (rs7903146) C_29347861_10

SNP context sequence:

TAGA GAGCTAAGCACTTTTTAGATA [S/T] TATATAATTTAATTGCCGTATGAGG

The Master Mix contains the following ingredients per sample:

Nuclease free water 0.25 µl

2xPCR Master Mix 2.5 µl

20x Primer/Probe Mix 0.25 µl

DNA (10 ng/µl) 2 µl

Total: 5 µl

The following cycle conditions were used:

95°C, 10 min 95°C, 15 s 1-50 cycles 60°C, 90 s J

When performing the allele recognition (AD) assay, pre-read and post-read runs were performed using the TaqMan® reagent kit on the TaqMan® 7900HT Fast Real System. SDS software, version 2.3, calculates fluorescence intensity measurements during plate reading and plots normalized reporter (R _n ) values based on the signals in each well. Using the specified software, alleles with SNPs were identified in each sample. NTC values were not determined.

Statistical analysis.

To assess the homogeneity of variance (in assessing the effect of treatment on change in HbA1c levels from baseline at 24 weeks in genotypic subgroups with certain genotypes with SNP rs7903146 TCF7L2), an analysis of covariance (ANCOVA) model was used, including the interaction of treatment with covariant genotype for pooled data obtained in during four trials. The statistical model included as fixed effects the parameters Treatment, Genotype, Trial, Washout period of previously administered oral antidiabetic drugs (yes/no), Race and interaction term Treatment*Genotype, and baseline HbA1c as a linear covariant. The ANCOVA model provides an estimate of the mean change in HbA1c levels from baseline 24 weeks after treatment initiation for different genotypes, taking into account baseline clinical and demographic parameters.

Model pairwise comparisons were made between individuals with homozygous wild-type CC genotype and heterozygous wild-type CT genotype or rare wild-type TT genotype treated with linagliptin or combination treatment (linagliptin + pioglitazone, linagliptin + metformin, linagliptin + metformin + sulfonylurea).

In addition, for the entire population of patients who participated in the trials (full data set for analysis, FAS), as well as for the subpopulation of patients for whom genetic analyzes were performed (full data set for pharmacogenetic analysis, FASG), results are shown to illustrate the comparability of the observed effects corresponding ANCOVA models without fixed effects Genotype and Treatment*Genotype.

Statistical evaluation was performed using SAS software packages version 9.2 (SAS Institute Inc., Cary, NC, USA) and S-PLUS® 8.0 (Insightful Corp., Seattle, WA, USA).

In FIG. 1 shows mean values and 95% confidence intervals of baseline HbA1c levels for the entire population of patients participating in the trials (full data set for analysis, FAS), for the subpopulation of patients for whom genetic analyzes were performed (full data set for pharmacogenetic analysis, FASG) , as well as for subgroups of patients of the specified subpopulation with a certain genotype (CC, CT, TT). The number of patients in the placebo control trial and the number of patients treated with linagliptin are shown in brackets.

In FIG. Figure 2 shows the statistical relationship between genotypes with the SNP rs79031461 of the TCF7L2 gene and the likelihood of a favorable response in carriers of the CC/CT genotype to administration of a therapeutically effective amount of linagliptin or linagliptin in combination with another oral antidiabetic agent.

Results are presented as point estimates with 95% confidence intervals for mean HbA1c change from baseline (%) at 24 weeks, estimated using ANCOVA models. Results are presented for the entire population of patients who participated in the trials (full data set for analysis, FAS), for the subpopulation of patients for whom genetic analyzes were performed (full data set for pharmacogenetic analysis, FASG), as well as for subgroups of the indicated subpopulation with a certain genotype. (SS, ST, TT). The number of patients in the placebo control group and the number of patients treated with linagliptin are shown in brackets.

Also shown are point estimates and 95% confidence intervals for differences in HbA1c changes from baseline (%) to compare individuals with homozygous wild-type CC genotype and heterozygous wild-type CT genotype or rare homozygous wild-type TT genotype treated with linagliptin or combination therapy ( linagliptin + pioglitazone, linagliptin + metformin, linagliptin + metformin + sulfonylurea). The presented results indicate a statistically significant difference between the TT and CC genotypes (p value was 0.0192). (Other pairwise comparisons: CT versus CC: p=0.4359, CT versus TT: p=0.0712).

The presented results show a strong relationship between homozygous wild-type genotype and lower HbA1c levels on treatment.

Composition examples.

The following examples of compositions, which can be obtained by analogy with methods known in the art, are presented to more fully illustrate the present invention and do not limit its scope. The term active compound means one or more compounds of the present invention, i. denotes a DPP-4 inhibitor or the second or third antidiabetic compound of the present invention or a combination of two or three of these active ingredients, for example, selected from combinations of compounds listed in table. 1 or table. 2. Additional useful compositions of the DPP-4 inhibitor, linagliptin, are those described in WO 2007/128724, the contents of which are incorporated herein by reference in their entirety. Additional useful compositions of other DPP-4 inhibitors are compositions that are commercially available, or compositions described in the applications cited above in the Background of the Invention section, or compositions described in the literature, for example, in the current editions of the Rote Liste® handbooks ( Germany) or Physician's Desk Reference.

Example 1

Dry substance ampoule containing 75 mg of active compound in 10 ml of solution.

Composition

Active compound 75.0 mg

Mannitol 50.0 mg

Water for injection up to 10.0 ml

Receipt.

The active compound and mannitol were dissolved in water. After packaging, the solution was lyophilized. To obtain a solution ready for use, the product was dissolved in water for injection.

Example 2

Dry substance ampoule containing 35 mg of active compound in 2 ml of solution.

Composition

Active compound 35.0 mg

Mannitol 100.0 mg

Water for injection up to 2.0 ml

Receipt.

The active compound and mannitol were dissolved in water. After packaging, the solution was lyophilized.

To obtain a solution ready for use, the product was dissolved in water for injection.

Example 3

Tablet containing 50 mg of the active compound.

Composition.

- 56 042990 (1) Active compound 50.0 mg (2) Mannitol 98.0 mg (3) Corn starch 50.0 mg (4) Polyvinylpyrrolidone 15.0 mg (5) Magnesium stearate 2.0 mg

215.0 mg

Receipt.

Components (1), (2) and (3) were mixed and granulated in a mixture with an aqueous solution of component (4). Component (5) was added to the dried granular material. Biplanar tablets faceted on both sides with a separating notch on one side were pressed from this mixture.

Diameter of tablets is 9 mm.

Example 4

Tablet containing 350 mg of the active compound.

Receipt.

(1) Active compound 350.0 mg (2) Mannitol 136.0 mg (3) Corn starch 80.0 mg (4) Polyvinylpyrrolidone 30.0 mg (5) Magnesium stearate 4.0 mg

600.0 mg

Components (1), (2) and (3) were mixed and granulated in a mixture with an aqueous solution of component (4). Component (5) was added to the dried granular material. Biplanar tablets faceted on both sides with a separating notch on one side were pressed from this mixture.

Diameter of tablets is 12 mm.

Example 5

Capsules containing 50 mg of the active compound.

Composition.

(1) Active compound 50.0 mg (2) Dried corn starch 58.0 mg (3) Mannitol 50.0 mg (4) Magnesium stearate 2.0 mg

160.0 mg

Receipt.

Component (1) was ground in a mixture with component (3). The resulting mixture was added to the mixture of components (2) and (4) with vigorous stirring. This powder mixture was filled into size 3 hard gelatin capsules in a capsule filler.

Example 6

Capsules containing 350 mg of the active compound.

Composition.

(1) Active compound 350.0 mg (2) Dried corn starch 46.0 mg (3) Mannitol 30.0 mg (4) Magnesium stearate 4.0 mg

430.0 mg

Receipt.

Component (1) was ground in a mixture with component (3). The resulting mixture was added to the mixture of components (2) and (4) with vigorous stirring. This powder mixture was filled into size 0 hard gelatin capsules in a capsule filler.

Claims (5)

1. Use of linagliptin in a method for improving glycemic control compared to placebo in a patient with type 2 diabetes, said method comprising administering linagliptin 5 mg - 57 042990 once a day for at least 24 weeks, as an additional combination therapy with metformin, where the patient is a patient with type 2 diabetes with insufficient glycemic control on metformin, or as an additional combination therapy with metformin and a sulfonylurea, where the patient is a type 2 diabetic patient with insufficient glycemic control on the combination of metformin and a sulfonylurea. 2. Use in the method of claim 1, wherein the improvement in glycemic control is a reduction in HbA1c, FPG and/or GLP. 3. Use in the method of claim 1 or 2 wherein linagliptin 5 mg once daily is administered for at least 24 weeks as adjunctive combination therapy with metformin, wherein the patient is a type 2 diabetic patient with insufficient glycemic control for metformin . 4. Use in the method of claim 1 or 2 wherein linagliptin 5 mg once daily is administered for at least 24 weeks as adjunct combination therapy with metformin and a sulfonylurea, wherein the patient is a type 2 diabetic patient with poor glycemic control the combination of metformin and a sulfonylurea. 5. Use of linagliptin in a method for improving glycemic control compared to placebo in a type 2 diabetic patient with inadequate glycemic control for metformin, said method comprising administering linagliptin 5 mg once daily for at least 24 weeks as additional combination therapy with metformin, and a method for improving glycemic control compared to placebo in a type 2 diabetic patient with poor glycemic control on a combination of metformin and a sulfonylurea, said method comprising administering linagliptin 5 mg once daily for at least 24 weeks as an additional combination therapy with metformin and a sulfonylurea. Baseline HbA1c levels for the entire population of patients participating in the trials (full data set for analysis, FAS), for the subpopulation of patients for whom genetic analyzes were performed (full data set for pharmacogenetic analysis, FASG), as well as for subgroups of patients of the indicated subpopulation with SNP rs7903146 of the TCF7L2 gene with a specific genotype (CC, CT, TT) rs7903146 • Placebo ^A Linagliptin 1 II -----------------1-------------------------------- ---------------------------------------------1---- -------------------------------------------------- ----------------------1--------------------------- -------------------------------------------------- 1------------------------------------------------- ----------------------------1-----------FAS FASG SS ST TT (728/1876) (268/693) (139/356) (105/264) (24/73) Fig. 1 - 58 042990 Relationship between the SNP rs79031461 of the TCF7L2 gene and a favorable response to linogliptin Adjusted mean Placebo-adjusted mean Difference from SS Linagliptin Fig. 2 ^gj) Eurasian Patent Organization, EAPO Russia, 109012, Moscow, Maly Cherkassky per., 2