EA042743B1 - CANOLA WITH ELITE EVENT NS-B50027-4 - Google Patents

Description

Related application

This application claims priority to U.S. Provisional Application No. 62/351,246, filed June 16, 2016, which is incorporated herein in its entirety for all purposes.

Sequence list

This application contains a sequence listing that has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety.

Technical field

The present embodiments of the invention relate to the field of canola breeding and agricultural products, specifically to the elite event NS-B5OO27-4.

State of the art

Canola is an important oilseed in many regions of the world. The fatty acid composition of canola oil is rich in both monounsaturated and polyunsaturated fatty acids, including short chain omega-3 fatty acids, but no long chain omega-3 fatty acids. Long-chain omega-3 fatty acids (LC-ω3) have proven health benefits, but currently LC-ω3 fatty acids are mainly sourced directly from algae or algae-eating marine fish. The recognition of dietary LC-ω3 fatty acids, especially docosahexaenoic acid (22:6 n-3; DHA) and eicosapentaenoic acid (20:5 n-3; EPA), has contributed to a dramatic increase in the demand for consumable fish oils. Thus, there is a need for alternative, direct sources of LC-ω3 fatty acids for human consumption. In addition, since farmed fish, such as Atlantic salmon, accumulate fatty acids in proportion to dietary fatty acids, it is necessary to maintain the amount of LC polyunsaturated fatty acids (LC-PUFA) in the fish feed and, in turn, to ensure the presence of these fatty acids in farmed fish. Accordingly, there is a need for sources rich in LC-PUFA that can be used in aquaculture. For example, there is a need for canola that can produce LC-PUFAs, in particular LC-ω3 fatty acids such as DHA, for use in aquaculture as well as for direct human consumption. However, despite advances in plant breeding and molecular genetic manipulation, there are no commercial sources of canola oil that contain LC-PUFA in amounts close to those produced by wild fish. In addition, a canola cultivar (not an F1 hybrid) must be homogeneous, homozygous and reproducible in order to be used to produce a cash crop on a reliable basis. Therefore, there remains a need for a canola line that can be grown as a sustainable crop whose seeds provide commercially viable amounts of LC-ω3 fatty acids such as DHA.

The essence of the invention

The embodiments of the invention described herein provide an inbred recombinant canola line, designated NS-B50027-4, whose seeds contain beneficial levels of ω3 and LC-ω3 fatty acids, thus providing a renewable terrestrial system for producing these valuable oils. A representative canola seed sample of inbred line NS-B50027-4 was deposited under the Budapest Treaty with the American Type Culture Collection (ATCC®) (Manassas, VA) on June 9, 2016, and was assigned accession number PTA-123186 (see appendix). A). This document also describes cells, tissues, seeds and canola oil of the inbred line NS-B50027-4. The combination of selection and breeding with transgenic manipulation allows variation in species where that variation does not exist. For example, the fatty acid profile of the NS-B50027-4 canola line described herein does not exist in native B. napus; and the traits described herein, in particular the preferred DHA-producing trait, have been developed with significant human technical intervention.

In one aspect, the present invention relates to a canola seed (Brassica napus L.) of line NS-B50027-4, a genetically modified canola of the cultivar AV Jade, which has been selected and developed into a stable, uniform cross line that accumulates in its seeds a high proportion (percentage) ω3 and LC-ω3 fatty acids relative to total fatty acids. The NS-B50027-4 inbred line was developed to produce canola plants that produce seeds containing LC-ω3 fatty acids, particularly DHA, at levels approaching those found in some wild fish oils. The edible oil derived from NS-B50027-4 has a significantly higher DHA content than other B. napus plants. A new, uniform cross line, NS-B50027-4, was developed through genetic transformation followed by careful selection and selection for high DHA into a stable, high yielding, morphologically appropriate canola line.

Accordingly, at least one embodiment of the invention described herein relates to canola seeds of the inbred line NS-B5OO27-4; to plants grown from canola seeds of the inbred line NS-B50027-4, and parts thereof, such as pollen, egg or seed; and to methods for obtaining seed from a canola plant by cultivating inbred canola

- 1 042743

NS-B50027-4 or by crossing canola of the inbred line NS-B50027-4 with itself, or with another canola line, or with the Brassica line to produce seed from cultivated progeny.

At least one embodiment of the invention relates to seed from a population of canola plants produced by the method described herein, said population deriving on average 10 to 100% of its alleles from canola line NS-B50027-4. Similarly, the present embodiments of the invention provide for the use of canola line NS-B50027-4, subline NS-B5OO27-4, progeny NS-B50027-4 or subline, or a plant obtained by crossing NS-B50027-4 with a second canola plant or Brassica, for breeding or for growing plants for the production of seeds, oil, meal or protein.

At least one embodiment of the invention relates to the seed of an oilseed rapeseed plant, such as the Brassica napus plant, containing in its genome at least a portion of the genome of the inbred line NS-B50027-4. At least one embodiment of the invention relates to a plant, such as a B. napus plant, containing in its genome at least a portion of the genome of the inbred line NS-850027-4. At least one embodiment of the invention relates to a cell of an oilseed rapeseed plant, such as the B. napus plant, containing in its genome at least a portion of the genome of the inbred line NS-B50027-4. In another embodiment, the invention relates to the genomic DNA of an oilseed rapeseed plant, such as the B. napus plant, containing at least a portion of the genome of the NS-B5OO27-4 lineage. At least one embodiment of the invention further relates to seeds, cells, tissues, tissue cultures, progeny and descendants of a plant containing at least a portion of the NS-850027-4 genome grown from seeds deposited in ATCC® having the accession number PTA- 123186. Another embodiment of the invention further relates to plants that can be obtained from (for example, by propagating or crossing) a canola plant containing at least a portion of the NS-B50027-4 genome (such as a plant grown from seed deposited in ATCC® having access number РТА-123186).

At least one embodiment of the invention relates to the seed of an oilseed rapeseed plant, such as the B. napus plant, containing in its genome an elite event of the lineage NS-B50027-4. At least one embodiment of the invention relates to a plant, such as a B. napus plant, containing in its genome an elite event of the inbred line NS-B50027-4. Another embodiment of the invention relates to the genomic DNA of an oilseed rapeseed plant, such as the B. napus plant, containing the NS-B50027-4 lineage elite event. At least one embodiment of the invention further relates to seeds, cells, tissues, progeny and progeny of a plant containing elite event NS-B50027-4 grown from seed deposited with ATCC® having accession number PTA-123186. Another embodiment of the invention further relates to plants obtained from (eg, by propagating or crossing) a canola plant containing an elite event (eg, a plant grown from seed deposited in ATCC® having accession number PTA-123186). Embodiments of the invention also relate to canola plants containing the elite event NS-B50027-4.

The reference seed of the inbred line NS-850027-4 of the present embodiments of the invention is deposited with ATCC® with accession number PTA-123186. At least one embodiment of the invention relates to seed NS-B50027-4, deposited with accession number PTA-123186, which grows into a canola plant, the seeds of which, when normally harvested, contain at least 5% DHA, about 6% DHA, about 7 % DHA, about 8% DHA, about 9% DHA, about 10% DHA, about 11% DHA, about 12% DHA, about 13% DHA, about 14% DHA, about 15% DHA, about 16% DHA, about 17 % DHA inclusive or more DHA, in wt.% of the total fatty acids in the seed.

In at least one embodiment, the ATCC® seed accession number PTA-123186 is a seed lot consisting of at least about 95% of inbred transgenic seeds having the NS-B50027-4 elite event transgenes that grow into a canola plant, the seed of which contains at least 5% DHA, about 6% DHA, about 7% DHA, about 8% DHA, about 9% DHA, about 10% DHA, about 11% DHA, about 12% DHA, about 13% DHA, about 14% DHA, about 15% DHA, about 16% DHA, about 17% DHA inclusive, or more DHA, in wt.% of the total fatty acids in the seed. ATCC® deposit seed accession number PTA-123186 is a seed lot consisting of at least about 95% transgenic seeds homozygous for the transgenic DNA containing the NS-B50027-4 elite event, which grow into a canola plant whose seed contains at least 5% LC-PUFA, about 6% LC-PUFA, about 7% LC-PUFA, about 8% LC-PUFA, about 9% LC-PUFA, about 10% LC-PUFA, about 11% LC-PUFA 12% LC-PUFA, about 13% LC-PUFA, about 14% LC-PUFA, about 15% LC-UFA, about 16% LC-PUFA, about 17% LC-PUFA, about 18% LC-PUFA, about 19 % LC-PUFA, about 20% LC-PUFA, about 21% LC-PUFA inclusive or more LC-PUFA as the sum of EPA, DPA and DHA, in wt.% of the total fatty acids in the seed.

In another embodiment of the invention, the seed or seeds of the progeny obtained or obtained from the deposited seed (for example, after crossing with a canola or Brassica plant with such

- 2 042743 or other genetic background) can be sown and the plants grown can have essentially the same phenotype as NS-B5OO27-4. In at least one embodiment of the invention, during normal harvesting, the fatty acid content of NS B50027 4-progeny seed comprises at least 5% DHA, about 6%, about 7% DHA, about 8% DHA, about 9% DHA, about 10 % DHA about 11% DHA, about 12% DHA, about 13% DHA, about 14% DHA, about 15% DHA, about 17% DHA, about 18% DHA, about 19% DHA, about 20% DHA, about 21% DHA about 22% DHA, about 23% DHA, about 24% DHA inclusive, or more DHA, in wt.% of the total fatty acids in the seed. In at least one embodiment of the invention, when harvested normally, the fatty acid content of the seed of NS-B50027-4 progeny is at least 5% LC-PUFA, about 6% LC-PUFA, about 7% LC-PUFA, about 8% LC -PUFA, about 9% LC-PUFA, about 10% LC-PUFA, about 11% LC-PUFA, about 12% LC-PUFA, about 13% LC-PUFA, about 14% LC-PUFA, about 15% LC- UFA, about 16% LC-PUFA, about 17% LC-PUFA, about 18% LC-PUFA, about 19% LC-PUFA, about 20% LC-PUFA, about 21% LC-PUFA, about 22% LC-PUFA , about 23% LC-PUFA, about 24% LC-PUFA, about 25% LC-PUFA, inclusive or more LC-PUFA, as the sum of EPA, DPA and DHA, in wt.% of the total fatty acids in the seed.

NS B50027-4 seed also contains significantly more ω3 ALA than conventional canola varieties. In at least one embodiment of the invention, when harvested normally, the fatty acid content of NS-B50027-4 progeny semen contains at least 15% ALA, about 16% ALA, about 17% ALA, about 18% ALA, about 19% ALA, about 20% ALA about 21% ALA, about 22% ALA, about 23% ALA, about 24% ALA inclusive or more ALA, wt.% of the total fatty acids in the seed.

Another aspect of the present embodiments relates to an oil with preferred levels of ω3 fatty acid and LC-ω3 fatty acid, wherein the fatty acid content comprises a higher ω3:ω6 fatty acid ratio than conventional canola oil. For example, AV Jade has no EPA/DPA/DHA(ω3) compared to LA (ω6); in one embodiment, the seed oil from NS-B5OO27-4 has an EPA/DPA/DHA(ω3):LA(ω6) ratio of about 1 to about 7, such as about 1.25. The ω3:ω6 ratio of the fatty acid of NS-B50027-4 is particularly preferred with respect to palmitic acid. The oil from the parent line AV Jade does not contain DHA and therefore does not have a DHA:palmitate ratio; the oil from NS-B50027-4 has a DHA:palmitate ratio of, for example, about 2.12; in comparison, farmed salmon oil has a DHA:palmitate ratio of 0.59; and wild salmon oil has a registered DHA:palmitate ratio of 1.02. In at least one embodiment, the ω3:ω6 ratio of fatty acid in NS-B50027-4 seed oil is from about 3 to about 7, such as a ratio of about 6.

In another aspect of the present embodiments, the oil, lipid, ω3-FA, LC-PUFA, or DHA from the seed of the inbred line NS-B50027-4 is used as a food product or in a food product (food or edible material, including beverages) or as nutraceutical supplements (food supplements) for humans or animals. In at least one embodiment of the invention, the oil, lipid, ω3-FA, LC-PUFA, or DHA from NS-B50027-4 seed is used to add to feed or as a feed additive for use in aquaculture. In at least one embodiment of the invention, the oil, lipid, ω3-FA, LC-PUFA, or DHA from seed with event NS-B50027-4 is used as a pharmaceutical composition or in a pharmaceutical composition. In at least one other embodiment of the invention, the seed meal or protein obtained concentrated from the seed of NS-B5OO27-4 or its progeny is in the form of a food product or in a food product (edible or edible material) or in nutraceutical supplements (food supplements ) for humans or animals. In specific embodiments of the invention, oil, lipids, meal or proteins from the seed of NS-B50027-4 or its progeny are used as feed for aquaculture.

An aspect of the present embodiments of the invention relates to a method for increasing LC-PUFA in a plant by providing (eg, by genetic transformation or crossing) a plant with multiple copies of genetic constructs expressing certain enzymes at the front end of the LC-PUFA biosynthetic pathway. For example, while not all enzymes from A6-desaturases, A5-desaturases, A5-elongases, and Δ15/ω3-desaturases can be considered exclusively front-end enzymes, in certain embodiments of the invention, these genes are assembled into an artificial locus that enhances the production of LC-PUFA , such as DHA, in a plant that produces LC-PUFA. In specific embodiments, the artificial locus containing some of the front end genes contains an A6 desaturase derived from Micromonas pusilla, an A5 elongase derived from Pyramimonas cordata, an A5 desaturase derived from Pavlova salina, and a Δ15/ω3 desaturase derived from Pichia pastoris.

An aspect of the described embodiments relates to a new cross between canola, designated NS-B50027-4, and an oilseed rapeseed plant such as Brassica napus L., with

- 3 042743 holding the elite event NS-B50027-4 in its nuclear genome. Brassica plants containing the genetic event line NS-B50027-4 are capable of seed-specific production of fatty acids that contain more unsaturated, longer chain fatty acids than those produced in conventional canola plants. The inbred canola plant line NS-B50027-4 has other agronomic characteristics that are substantially equivalent to non-transgenic isogenic canola plant lines; but such characters are distinguished from other lines so as to provide an independent line or cultivar. A representative canola seed sample of the inbred line NS-B50027-4 was deposited with ATCC® accession number PTA-123186.

At least one embodiment of the invention relates to transgenic canola seeds, plants or plant parts, their tissues or cells, having at least one transgenic insert stably integrated into the genome, containing an expression cassette containing sixteen heterologous genes, the transgenes being codon-optimized for plant expression and encode A4 desaturase derived from Pavlova salina, A5 desaturase derived from Pavlova salina, A5 elongase derived from Pyramimonas cordata, A6 desaturase derived from Micromonas pusilla, A6 elongase derived from Pyramimonas cordata, A12 a desaturase derived from Lachancea kluyveri, an A15/m3 desaturase derived from Pichia pastoris, and at least one matrix attachment site (MAR) derived from Nicotiana tabacum and a selectable marker gene; and at least one transgene insert containing an expression cassette of four heterologous genes, the transgenes being codon-optimized for plant expression and encoding the transgenes A6-desaturase derived from Micromonas pusilla, A5-elongase derived from Pyramimonas cordata, A5-desaturase derived from Pavlova salina, Δ 15/ω3-desaturase derived from Pichia pastoris, and at least one MAR derived from Nicotiana tabacum. The inbred transgenic line NS-B50027-4 illustrates this embodiment of the invention, and a representative sample of seeds with these heterologous genes has been deposited with ATCC® accession number PTA-123186.

Another aspect of the present embodiments relates to isolated or purified genomic DNA obtained from an inbred canola line NS-B50027-4 or canola plants containing the NS-B50027-4 elite event, the seeds of which have been deposited as ATCC with accession number PTA-123186 . Such genomic DNA can be used, for example, as a reference control material for the identification assays described herein. At least one embodiment of the invention relates to the genome of Brassica napus L. having a deletion in the 3' UTR of the HPP gene located in chrUn_random of the reference B. napus genome (2n=AACC, van Darmor) at position 118589903-118591677 and on chromosome A02 of the reference genome of B. rapa (2n=AA, van Chiifu) at position 18569298-18571066, where the deletion is GTAGCACGACAAGTT (SEQ ID NO: 38). The 15-bp deletion is located in chrUnrandom of the B. napus reference genome at position 118589927-118589941 and on chromosome A02 of the B. rapa reference genome at position 18569316-18569330. At least one embodiment of the invention relates to a Brassica napus L. plant having a deletion in the second exon of the gene encoding Pto-interacting protein (PTI) located on chromosome A05 of the reference (var. Darmor) B. napus genome at position 17267746-17270700 , the deletion of which disrupts the expression of PTI, where the deletion is CACGGTGGAGGTCACCATGT (SEQ ID NO: 39). These deletions are characteristic of the genome of the inbred canola line NS-B50027-4 and can be used to identify the NS-B50027-4 line and progeny derived from the NS-B50027-4 line.

Accordingly, the present embodiments of the invention further relate to methods for identifying a transgenic plant or its cells or tissues containing the transgenic aspect (elite event) of the inbred canola line NS-B50027-4, which method is based on identifying the presence of characterizing DNA molecules as having specific nucleotide sequences or encoding specific amino acids. For example, such characterizing DNA molecules contain sequences of 15 base pairs (bp), at least 15 bp, 20 bp, at least 20 bp, at least 24 bp ., at least 30 p. or more than 30 bp that contain the event insertion boundary site, i. e. as part of the inserted foreign DNA containing genes for the synthesis of fatty acids LC-sh3 or (genes including regulatory sequences for expression, etc.), and part of the canola or Brassica genome (flanking regions either 5' or 3' for each insert ) adjacent to them, which makes it possible to accurately identify the elite event. For example, the 5' boundary sequences of the insertion end of four genes on chromosome A02 of NS-B50027-4 comprise SEQ ID NO: 43; the border sequences of the 3' end of the insertion of four genes on chromosome A02 contain SEQ ID NO: 44; the boundary sequences of the 5' end of the sixteen gene insert on chromosome A05 of NS-B50027-4 comprise SEQ ID NO: 45; and the 3' boundary sequences of the insertion end of sixteen genes on chromosome A05 comprise SEQ ID NO: 46. Embodiments of the invention also relate to plants containing an elite event of the inbred canola line NS-B50027-4 identified by such methods.

Another aspect of the present embodiments of the invention relates to nucleic acid molecules

- 4 042743 acids (e.g., polynucleotides or DNA) containing an insertion site for the NS-B50027-4 elite event and sufficient polynucleotide lengths of both canola genomic DNA and transgenic DNA such as to be useful for detecting the NS-B50027 inbred lineage elite event -4 and characterization of plants containing the elite event NS-B5OO27-4 or belonging to the inbred line NS-B50027-4. Such molecules may contain, for example, at least nine canola genomic DNA nucleotides and a similar number of transgenic DNA nucleotides on each side of the boundary site, respectively. For example, such DNA molecules contain at least nine nucleotides of canola genomic DNA and the same number of nucleotides of transgenic (foreign) DNA containing genetic regions adjacent to the insertion site in SEQ ID NO: 40 (for example, nucleotides 2081 to 2098 and nucleotides from 14193 to 14210), SEQ ID NO: 41 (e.g. nucleotides 1151 to 1168 and nucleotides 47765 to 47782). In one aspect, the invention relates to canola plants containing such specific nucleic acid molecules.

At least one embodiment of the invention relates to transgenic Brassica or canola seeds or to plant cells, plants, plant parts or tissues having stable integration into the genome of at least one transgenic insert containing an expression cassette(s) containing(s) sixteen heterologous genes, the transgenes being plant codon-optimized A6-desaturase derived from Micromonas pusilla, A6-elongase, Δ-5-elongase derived from Pyramimonas cordata, Δ5-desaturase derived from Pavlova salina, Δ15/ω3-desaturase, derived from Pichia pastoris, Δ4-desaturase derived from Pavlova salina and Δ12-desaturase derived from Lachancea kluyveri, at least one matrix attachment site (MAR) derived from Nicotiana tabacum, and a selectable marker gene; an insert of sixteen transgenes characterized by nucleotides 1268 to 47773 of SEQ ID NO: 41; and at least one transgene insert containing an expression cassette(s) of four heterologous genes, the genes being codon-optimized for plant expression and encoding transgenes Δ6-desaturase derived from Micromonas pusilla, Δ5-elongase derived from Pyramimonas cordata, Δ5-desaturase derived from Pavlova salina, Δ15/ω3-desaturase derived from Pichia pastoris, and at least one MAR derived from Nicotiana tabacum; an insert of four genes characterized by nucleotides 2090 to 14201 of SEQ ID NO: 40. In at least one embodiment of the invention, two expression cassettes are located on two different chromosomes in the plant genome.

In another embodiment, the invention relates to a recombinant nucleic acid molecule having the nucleic acid sequence of SEQ ID NO: 40, SEQ ID NO: 41, or their complements. In another embodiment, the invention relates to a recombinant nucleic acid molecule having the nucleic acid sequence at positions 2090 to 14201 of SEQ ID NO: 40, or its complement. In another embodiment, the invention relates to a recombinant nucleic acid molecule having the nucleic acid sequence at positions 1160 to 47773 of SEQ ID NO: 41, or its complement. The present embodiments of the invention also relate to transgenic Brassica or canola seeds containing a nucleic acid molecule having a nucleic acid sequence of nucleotides 2090 to 14201 of SEQ ID NO: 40, or its complement; and Brassica or canola seeds containing a nucleic acid molecule having the nucleic acid sequence of nucleotides 1160-47773 of SEQ ID NO: 41, or its complement. In another embodiment, the invention relates to seeds or cells containing such nucleic acid molecules.

In another embodiment, the invention relates to a DNA molecule containing an artificial genetic locus containing, in order, the following nucleotide sequences:

(a) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 2747 to nucleotide 6250;

(b) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 6257 to nucleotide 8414;

(c) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 8415 to nucleotide 10374;

(d) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 10375 to nucleotide 11544; and (e) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 11545 to nucleotide 14049;

(f) a molecule with at least 80%, 95%, 97%, 98%, 99% or 99.5% sequence identity with respect to the nucleotide sequences (a)-(e); or (g) their complements.

A corresponding embodiment of the invention relates to plant cells, plant materials or plant seeds containing this artificial genetic locus.

In another embodiment, the invention relates to a DNA molecule containing an artificial genetic locus containing, in order, the following nucleotide sequences:

(a) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 1268 to nucleotide 5317;

(b) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 5324 to nucleotide 7481;

(c) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 7482 to nucleotide 9443;

(d) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 9444 to nucleotide 10611;

(e) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 10612 to nucleotide 13116;

- 5 042743 (f) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 13117 to nucleotide 17000;

(g) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 17001 to nucleotide 19606;

(h) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 19607 to nucleotide 29773;

(i) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 20783 to nucleotide 22987;

(j) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 23011 to 24370;

(k) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 42561 to nucleotide 25920;

(l) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 25943 to nucleotide 29324;

(m) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 28157 to nucleotide 29324;

(n) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 29324 to nucleotide 31830;

(p) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 31831 to nucleotide 35816;

(q) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 35817 to nucleotide 38319;

(r) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 38320 to nucleotide 39488;

(s) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 39489 to nucleotide 41449;

(t) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 41450 to nucleotide 43607;

(u) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 43614 to nucleotide 47662;

(v) a molecule with at least 80%, 95%, 97%, 98%, 99% or 99.5% sequence identity with respect to the nucleotide sequences (a)-(u), (a)-(j), (k)-( u); or (w) their complements.

A corresponding embodiment relates to plant cells, materials or seeds containing this artificial genetic locus.

In another embodiment, the invention relates to a DNA molecule containing an artificial genetic locus containing, in order, the following nucleotide sequences:

(a) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 2747 to nucleotide 4141;

(b) the nucleotide sequence of the complement of the nucleotide sequence of SEQ ID NO: 40 from nucleotide 7259 to nucleotide 8065;

(c) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 8841 to nucleotide 10121;

(d) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 12281 to nucleotide 13531;

(e) a molecule with at least 80%, 95%, 97%, 98%, 99% or 99.5% sequence identity with respect to the nucleotide sequences (a)-(d); or (f) their complements, where the artificial locus contains regulatory regions (eg, promoters, leader sequences, terminators) to provide expression from (a) to (d), or (e), or (f).

A corresponding embodiment of the invention relates to a plant cell, plant materials or plant seeds containing this artificial genetic locus.

In another embodiment, the invention relates to a DNA molecule containing an artificial genetic locus containing, in order, the following nucleotide sequences:

(a) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 1820 to nucleotide 3208;

(b) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 6326 to nucleotide 7126;

(c) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 7908 to nucleotide 9192;

(d) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 11352 to nucleotide 12596;

(e) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 15216 to nucleotide 16556;

(f) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 17619 to nucleotide 18866;

(g) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 21895 to nucleotide 22647;

(h) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 25943 to nucleotide 26283;

(i) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 30066 to nucleotide 31313;

(j) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 31831 to nucleotide 35816;

(k) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 36335 to nucleotide 38319;

(l) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 39749 to nucleotide 41023;

(m) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 41805 to nucleotide 42605;

(n) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 45724 to nucleotide 47111;

(o) a molecule with at least 80%, 95%, 97%, 98%, 99% or 99.5% sequence identity with respect to the nucleotide sequences (a)-(u), (a)-(j), (k)-( u); or (p) their complements, where the artificial locus contains regulatory regions (eg, promoters, leader sequences, terminators) to allow expression from (a) to (n), or (o), or (p).

A corresponding embodiment of the invention relates to a plant cell, plant materials or plant seeds containing this artificial genetic locus.

In one embodiment of the invention, the transgenes of the inbred line NS-B5OO27-4, as described herein, have the nucleotide sequence of SEQ ID NO: 40 from nucleotide positions 2090 to 14201, or its complement, or contain a molecule of at least 80, 95, 97 , 98, 99 or 99.5% sequence identity with respect to the nucleotide sequence of SEQ ID NO: 40 from nucleotide position 2090 to nucleotide position 14201 or its complement. IN

- 6 042743 one embodiment of the invention, the transgenes of the inbred line NS-B5OO27-4, as described herein, have the nucleotide sequence of SEQ ID NO: 41 from nucleotide positions 1268 to 47662 or its complement or contain a molecule of at least 80, 95 , 97, 98, 99, or 99.5% sequence identity with respect to the nucleotide sequence of SEQ ID NO: 41 from nucleotide position 1268 to nucleotide position 47662, or its complement.

The present invention also relates to a Brassica or canola plant, plant cell, tissue or seed, containing in its genome a nucleic acid molecule containing the nucleotide sequence of SEQ ID NO: 40 from nucleotide positions 2090 to 14201, or its complement, or containing a molecule with the identity sequences of at least 95, 97, 98, 99 or 99.5% with the nucleotide sequence of SEQ ID NO: 40 from nucleotide position 2090 to nucleotide position 14201 or its complement. In another embodiment, the invention provides a plant, plant cell, tissue or seed of Brassica or canola, containing in its genome a nucleic acid molecule containing the nucleotide sequence of SEQ ID NO: 41 from nucleotide positions 1268 to 47662, or its complement, or containing a molecule from to at least 80, 95, 97, 98, 99, or 99.5% sequence identity with the nucleotide sequence of SEQ ID NO: 41 from nucleotide position 1268 to nucleotide position 47662, or its complement.

Another aspect of the present embodiments relates to kits and methods for determining whether a canola plant is, or is an inbred NS-B50027-4, or is a canola plant that contains at least a portion of the genetic elite event of the NS-B5OO27-4 line. . Compositions and methods for simple and unambiguous methods for identifying the NS-B50027-4 elite event in biological samples are described herein. For example, the kit includes at least one set of sense (forward) and antisense (reverse) primers specific for the Brassica chromosomal DNA border and the inserted transgene. For example, DNA borders containing the sequences SEQ ID NO: 43 (TGGAGGTGTTCAAACACT), SEQ ID NO: 44 (ATAGTATTAGTATACAGA), SEQ ID NO: 45 (GGCTAAGGTAACACTGAT) and SEQ ID NO: 46 (CAGTGTTTGAAGGACAGA) are new NS elite event DNA sequences -B50027-4 and are diagnostic for the NS-B50027-4 canola plant and its progeny. More specifically, the boundary sequences in SEQ ID NO: 43 and SEQ ID NO: 44 are nine polynucleotides on each side of the insertion site of the canola DNA transgenic sequence fragment and genomic chromosome A02; and the border sequences in SEQ ID NO: 45 and SEQ ID NO: 46 are nine polynucleotides on each side of the insertion site of the canola DNA chromosome A05 chromosome sequence fragment insertion site. Longer or shorter polynucleotides may be selected from the flanking regions described herein.

The present embodiments of the invention further relate to methods for identifying an inbred canola line NS-B50027-4 elite event in a biological sample based on primers or probes that specifically recognize the flanking 5' or 3' regions of foreign DNA inserts containing the NS-B50027 elite event genetic event. -4. More specifically, a typical method involves amplifying a nucleic acid present in a biological sample by polymerase chain reaction with at least two primers, one of which recognizes the 5' or 3' Brassica flanking regions of the inserted foreign DNA (heterologous or transgenic DNA) of the elite event. NS-B50027-4, the other of which recognizes a sequence in foreign DNA, including, for example, foreign desaturase or elongase genes, to obtain a DNA fragment from 100 to 800 bp. Primers or probes can identify NS-B50027-4 by recognizing the sequence within the 5' region of chromosome A02 flanking the insert: SEQ ID NO: 40 from positions 1 to 2089 (or its complements) or within the 3' region of chromosome A02 flanking the insert : SEQ ID NO: 40 of positions 14202 to 15006 (or its complements); sequence within the 5' region of chromosome A05 flanking the insert: SEQ ID NO: 41 from positions 1 to 1159 (or its complements), or within the 3' region of chromosome A05 flanking the insert: SEQ ID NO: 41 from positions 47774 according to 49789 (or its complements); and at least one foreign DNA sequence containing, for example, SEQ ID NO: 40 from position 2090 to 14201 (or its complement) or SEQ ID NO: 41 from position 1160 to 47773 (or its complement).

At least one embodiment of the invention further relates to compositions suitable for PCR (KASP) assays with competitive alleles (two allele-specific forward primers, recognize SNPs), spot digital PCR (ddPCR) assays, quantitative PCR (qPCR) assays, paralog-specific assays, or assays for random presence (AR) testing. Particular embodiments of primers suitable for performing KASP assays to detect genetic traits of NS-B50027-4, particularly useful in introgression and hybrid development studies, include at least ten contiguous nucleotides of the primers SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8,

SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14,

SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20,

SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26,

- 7 042743

SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, or their complements. The previous primers or their complements may be included in the kit to identify NS-B50027-4, progeny of NS-B50027-4, or other plants or plant materials containing at least a partial NS-B50027-4 genome. A corresponding embodiment of the invention relates to plant material identified by such primers.

For example, at least one embodiment relates to a pair of isolated primers of DNA molecules, where the first primer contains at least eleven contiguous nucleotides from nucleotide 1 to 235 of the flanking 5' genomic region of SEQ ID NO: 47 or its complete complements, and the second primer contains at least eleven contiguous nucleotides of the transgenic region from nucleotide 236 to 470 of SEQ ID NO: 47, or its complete complements, wherein a pair of primer DNA molecules, when used together in a DNA amplification reaction, produces a diagnostic amplicon containing SEQ ID NO: 43 for event NS-B50027-4 canola or its progeny.

At least one embodiment of the invention relates to a composition containing a pair of isolated primers of DNA molecules, where the first primer contains at least eleven adjacent nucleotides from nucleotide 1 to 235 of the transgenic region of SEQ ID NO: 48 or its complete complements and the second primer contains at least at least eleven contiguous nucleotides of the flanking 3' genomic region of canola DNA from nucleotide 236 to 470 of SEQ ID NO: 48 or its full complement, where the DNA primer pair, when used together in a DNA amplification reaction, produces a diagnostic amplicon containing SEQ ID NO: : 44 for canola event NS-B50027-4 or its progeny.

At least one embodiment of the invention relates to a pair of isolated primers of DNA molecules, where the first primer contains at least eleven contiguous nucleotides from nucleotide 1 to 235 of the flanking genomic region 5' of canola SEQ ID NO: 49 or its complete complements and the second primer contains at least eleven contiguous nucleotides of the transgenic region from nucleotide 236 to 470 of SEQ ID NO: 49, or their complete complements, wherein the DNA primer pair, when used together in a DNA amplification reaction, produces a diagnostic amplicon containing SEQ ID NO: 45 for an NS event -850027-4 canola or its progeny.

At least one embodiment of the invention relates to a pair of isolated primers of DNA molecules, where the first primer contains at least eleven contiguous nucleotides from nucleotide 1 to 235 of the transgenic region of SEQ ID NO: 50 or its complete complements and the second primer contains at least eleven contiguous nucleotides of the flanking genomic region 3' of canola DNA from nucleotide 236 to 470 of SEQ ID NO: 50 or its complete complements, wherein the primer pair of DNA molecules, when used together in a DNA amplification reaction, produces a diagnostic amplicon containing SEQ ID NO: 46 for the event NS-850027-4 canola or its progeny.

In addition, DNA event primer pairs can also be used to generate an amplicon diagnostic for the NS B50027-4 event. These event primer pairs include, for example, AATTGTTGGAGGTGTTCAAACACT (SEQ ID NO: 51) and CGGAATCACAATCCCTGAATGATT (SEQ ID NO: 52) or their complements. The amplicon produced by SEQ ID NO: 51 and SEQ ID NO: 52 contains about 250 polynucleotides. In addition to these primer pairs, any primer pair derived from SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, or SEQ ID NO: 50, or their complements, which, when used in a DNA amplification reaction, produces amplicon diagnostics for the NS-B5OO27-4 event is an aspect of the present embodiments of the invention.

In another embodiment, the invention relates to at least one primer set for one of A4 desaturase derived from Pavlova salina, A5 desaturase derived from Pavlova salina, A5 elongase derived from Pyramimonas cordata, A6 desaturase derived from Micromonaspusilla, A6 elongase derived from Pyramimonas cordata, A12 desaturase derived from Lachancea kluyveri, A15/m3 desaturase derived from Pichia pastoris; and at least one set of primers specific for the 5' boundary between the insert and native Brassica chromosomal A02 DNA, such as the boundary from nucleotides 2033 to 2132 of SEQ ID NO: 40, a 100 bp region containing 43 bp. inserts and 57 p. Brassica chromosomal A02 DNA or at least one set of primers specific for the 3' boundary between the insert and native Brassica chromosomal A02 DNA, such as the boundary from nucleotides 14156 to 14255 of SEQ ID NO: 40, 100 bp region containing 46 By. inserts and 54 p. chromosomal A02 DNA of Brassica; at least one set of primers specific for the 5' boundary between the insert and native Brassica chromosomal A05 DNA, such as the boundary from nucleotides 1110 to 1209 of SEQ ID NO: 41, a 100 bp region containing 50 bp inserts and 50 p. Brassica chromosomal A05 DNA, or at least one set of primers specific for the 3' boundary between the insert and native Brassica chromosomal A05 DNA, such as the boundary from nucleotides 47724 to 47823 of SEQ ID NO: 41, a 100 bp region containing 50 b.p. inserts and 50 p. chromosomal A05 Brassica DNA.

- 8 042743

In another embodiment, the invention relates to primers that recognize the sequence in the foreign DNA NS-850027-4, including, for example, at least one primer of A6-desaturase DNA derived from Micromonas pusilla having the sequence of SEQ ID NO: 57, SEQ ID NO: 58 or their complements; A5 elongase derived from Pyramimonas cordata having the sequence of SEQ ID NO: 63, SEQ ID NO: 64 or their complements; A5 desaturase derived from Pavlova salina having the sequence of SEQ ID NO: 61, SEQ ID NO: 62 or their complements; Δ15/ω3-desaturase derived from Pichia pastoris having the sequence of SEQ ID NO: 55, SEQ ID NO: 56 or their complements; A4 desaturase derived from Pavlova salina having the sequence of SEQ ID NO: 65, SEQ ID NO: 66 or their complements; A12 desaturase derived from Lachancea kluyveri having the nucleotide sequence of SEQ ID NO: 53, SEQ ID NO: 54 or their complements; or A6 elongase derived from Pyramimonas cordata having the sequence of SEQ ID NO: 59, SEQ ID NO: 60 or their complements. Accordingly, the present embodiments of the invention relate to specific primers and specific DNA amplified using such primers, and primers that can be derived from the sequence information provided herein.

According to methods for identifying NS-B50027-4 and its progeny, in addition to a primer that specifically recognizes the 5' or 3' flanking region of the NS-B50027-4 elite event, the kits may contain a second primer that specifically recognizes a sequence in the foreign DNA, comprising at least one of A6 desaturase derived from Micromonas pusilla, A5 elongase derived from Pyramimonas cordata, A5 desaturase derived from Pavlova salina, Δ15/ω3 desaturase derived from Pichia pastoris, A4 desaturase derived from Pavlova salina, A6-elongase derived from Pyramimonas cordata, or Δ 12-desaturase derived from Lachancea kluyveri for use in a PCR identification protocol. The kits may contain at least two specific primers, one of which recognizes a sequence in the 5' flanking region of the NS-B50027-4 elite event, and the other of which recognizes a sequence in foreign DNA, comprising at least one of Δ6-desaturase derived from Micromonas pusilla, Δ5-elongase derived from Pyramimonas cordata, Δ5-desaturase derived from Pavlova salina, Δ15/ω3-desaturase derived from Pichia pastoris, Δ4-desaturase derived from Pavlova salina, or Δ12-desaturase derived from Lachancea kluyveri .

The invention also relates to a kit for identifying the NS-B5OO27-4 elite event in biological samples, said kit containing PCR primers containing or consisting (essentially) of the nucleotide sequences from SEQ ID NO: 1 to SEQ ID NO: 37 or their complements for use in the NS-B50027-4 Elite Event Identification Protocol described herein.

At least one embodiment of the invention relates to transgenic canola seeds, plants or plant parts, their tissues or cells, having at least one transgenic insert stably integrated into the genome, containing an expression cassette containing sixteen heterologous genes, and the transgenes are optimized for Δ6-desaturase derived from Micromonas pusilla, Δ5-elongase derived from Pyramimonas cordata, Δ5-desaturase derived from Pavlova salina, Δ15/ω3-desaturase derived from Pichia pastoris, Δ4-desaturase derived from Pavlova salina, Δ6- elongase derived from Pyramimonas cordata and Δ12-desaturase derived from Lachancea kluyveri, at least one matrix attachment site (MAR) derived from Nicotiana tabacum, and a selectable marker gene; and at least one transgene insert containing an expression cassette of four heterologous genes, the genes being codon-optimized for plant expression and encoding transgenes for Δ6-desaturase derived from Micromonas pusilla, Δ5-elongase derived from Pyramimonas cordata, Δ5-desaturase derived from Pavlova salina, Δ15/ω3-desaturase derived from Pichia pastoris, and at least one MAR derived from Nicotiana tabacum, a four-gene expression cassette characterized as nucleotides 2090 to 14201 of SEQ ID NO: 40. In at least one In an embodiment of the invention, two expression cassettes are located on two different chromosomes in the plant genome.

In another embodiment, the invention relates to a recombinant nucleic acid molecule having the nucleic acid sequence of FIG. 5 (SEQ ID NO: 40) or its complement. In another embodiment, the invention relates to a recombinant nucleic acid molecule having the nucleic acid sequence of FIG. 6 (SEQ ID NO: 41) or its complement. In one embodiment, the transgenes of the inbred line NS-B50027-4, as described herein, have the nucleotide sequence of SEQ ID NO: 40 from nucleotide positions 2090 to 14201, or its complement, or contain a molecule of at least 95, 97, 98, 99 or 99.5% sequence identity of the nucleotide sequence of SEQ ID NO: 40 from nucleotide position 2090 to nucleotide position 14201 or its complement. The present invention also relates to a canola plant, plant cell, tissue or seed containing in its genome the molecule

- 9 042743 nucleic acid containing the nucleotide sequence of SEQ ID NO: 40 from nucleotide positions 2090 to 14201, or its complement, or containing a molecule with at least 95, 97, 98, 99 or 99.5% sequence identity of the nucleotide sequence SEQ ID NO: 40 from nucleotide position 2090 to nucleotide position 14201 or its complement. In another embodiment of the invention, the transgenes of the inbred line NS-B50027-4, as described herein, have the nucleotide sequence of SEQ ID NO: 41 from nucleotide positions 1268 to 47662, or its complement, or contain a molecule of at least 95, 97, 98, 99 or 99.5% sequence identity of the nucleotide sequence of SEQ ID NO: 41 from nucleotide position 1268 to nucleotide position 47662 or its complement. The invention also relates to a canola plant, plant cell, tissue or seed, containing in its genome a nucleic acid molecule containing the nucleotide sequence of SEQ ID NO: 41 from nucleotide positions 1268 to 47662, or its complement, or containing a molecule with at least 95 , 97, 98, 99 or 99.5% sequence identity of the nucleotide sequence of SEQ ID NO: 41 from nucleotide position 1268 to nucleotide position 47662 or its complement.

Another aspect of the embodiments of the present invention relates to kits and methods for determining if a canola plant is, or if it belongs to the inbred line NS-B50027-4, or if the canola plant contains at least a portion of the NS-B50027-4 genetic elite event. This document describes compositions and methods for simple and unambiguous methods for identifying the NS-B50027-4 elite event in biological samples. For example, the kit includes at least one set of sense (forward) and antisense (reverse) primers specific for the Brassica chromosomal DNA border and the inserted transgene. The boundary sequences SEQ ID NO: 43 (TGGAGGTGTTCAAACACT), SEQ ID NO: 44 (ATAGTATTAGTATACAGA), SEQ ID NO: 45 (GGCTAAGGTAACACTGAT) and SEQ ID NO: 46 (CAGTGTTTGAAGGACAGA) are new DNA sequences in event NS-B50027-4 and are diagnostic for the canola plant with NS-B50027-4 and its progeny. The border sequences in SEQ ID NO: 43 and SEQ ID NO: 44 are nine polynucleotides on each side of the insertion site of the canola transgene sequence fragment and genomic chromosomal A02 DNA; and the border sequences in SEQ ID NO: 45 and SEQ ID NO: 46 are nine polynucleotides on each side of the insertion site of the canola transgene sequence fragment and genomic chromosomal A05 DNA. Longer or shorter polynucleotides may be selected from the flanking regions described herein.

In addition, DNA event primer pairs can also be used to generate an amplicon diagnostic for the NS B50027-4 event. These event primer pairs include, for example, AATTGTTGGAGGTGTTCAAACACT (SEQ ID NO: 51) and CGGAATCACAATCCCTGAATGATT (SEQ ID NO: 52) or their complements. The amplicon produced by SEQ ID NO: 51 and SEQ ID NO: 52 contains about 250 polynucleotides. In addition to these primer pairs, any primer pair derived from SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, or SEQ ID NO: 46, or their complements, which, when used in a DNA amplification reaction, produces an amplicon diagnostics for event NS-B50027-4 is an aspect of the present invention.

In another embodiment, the invention relates to at least one primer set for one of A6 desaturase derived from Micromonas pusilla, A5 elongase derived from Pyramimonas cordata, A6 elongase derived from Pyramimonas cordata, A5 desaturase derived from marine microalgae Pavlova salina, A15/m3 desaturase derived from yeast Pichia pastoris, A4 desaturase derived from Pavlova salina, or A12 desaturase derived from yeast Lachancea kluyveri; at least one set of primers specific for the 5' boundary between the insert and native Brassica chromosomal A02 DNA, such as the boundary from nucleotides 2033 to 2132 of SEQ ID NO: 40, a 100 bp region containing 43 bp. inserts and 57 p. Brassica chromosomal A02 DNA, or at least one set of primers specific for the 3' boundary between the insert and native Brassica chromosomal A02 DNA, such as the boundary from nucleotides 14156 to 14255 of SEQ ID NO: 40, a 100 bp region containing 46 b.p. inserts and 54 p. chromosomal A02 DNA of Brassica; at least one set of primers specific for the 5' boundary between the insert and native Brassica chromosomal A05 DNA, such as the boundary from nucleotides 1110 to 1209 of SEQ ID NO: 41, a 100 bp region containing 50 bp inserts and chromosomal A05 Brassica DNA; or at least one set of primers specific for the 3' boundary between the insert and native Brassica chromosomal A05 DNA, such as the boundary of nucleotides 47724 to 47823 of SEQ ID NO: 41, a 100 bp region containing 50 bp inserts and 50 p. chromosomal A05 Brassica DNA.

In a further aspect of the embodiments described herein, kits are provided for identifying the NS-850027-4 elite event in biological samples, said kits containing at least one primer or probe that specifically recognizes the 5' or 3' Brassica regions, that flank the foreign DNA, and at least one primer or probe that specifically recognizes at least one DNA insert

- 10 042743

A6 desaturase derived from Micromonas pusilla, which may contain the nucleotide sequence GAGCACCTTGTAGTTGAGTCC (SEQ ID NO: 57), AGTCTGAGGATGCTCCCTATGC (SEQ ID NO: 58) or their complements; A5 elongase derived from Pyramimonas cordata, which may contain the nucleotide sequence TGCTGGAACTCTTGGATACG (SEQ ID NO: 63), CTGGGTGATGTACTTCTTCC (SEQ ID NO: 64) or their complements; A5-desaturase derived from Pavlova salina, which may contain the nucleotide sequence GCTACCGATGCTTACAAGCA (SEQ ID NO: 61), TAGTGAAGTCCGTGCTTCTC (SEQ ID NO: 62) or their complements; Δ15/ω3 desaturase derived from Pichia pastoris, which may contain the nucleotide sequence GACGCTATCCCTAAGCACTGT (SEQ ID NO: 55), GTCCACTCTTGAGCATCGTA (SEQ ID NO: 56) or their complements; A4 desaturase derived from Pavlova salina, which may contain the nucleotide sequence GGCTTTCAGATCTGAGCATC (SEQ ID NO: 65), CTCAGCCTTAACAAGAGGAG (SEQ ID NO: 66) or their complements; A12 desaturase derived from Lachancea kluyveri, which may contain the nucleotide sequence TGGAGCTATCCCTCATGAGT (SEQ ID NO: 53), GATCCTAGAACAGTAGTGGTG (SEQ ID NO: 54) or their complements; A6 elongase derived from Pyramimonas CS0140, which may contain the nucleotide sequence TGTTGCTATGGCTCAAGAGC (SEQ ID NO: 59), CTAGCGTGGTGCTTCATGTA (SEQ ID NO: 60) or their complements.

The kit of this embodiment of the invention may contain, in addition to a primer that specifically recognizes at least one of the 5' or 3' flanking regions of the NS-850027-4 elite event; and in a primer that specifically recognizes a sequence in foreign DNA comprising at least one of Micromonas pusilla derived A6 desaturase, Pyramimonas cordata derived A5 elongase, Pavlova salina derived A5 desaturase, Δ15/ω3 desaturase derived from Pichia pastoris, A4 desaturase derived from Pavlova salina, A6 elongase derived from Pyramimonas cordata, or Δ 12 desaturase derived from Lachancea kluyveri for use in the PCR identification protocol. The kit may contain at least two specific primers, one of which recognizes a sequence in the 5' flanking region of the NS-B50027-4 elite event and the other recognizes a sequence in foreign DNA comprising at least one of Δ6-desaturase derived from Micromonas pusilla , Δ5-elongase derived from Pyramimonas cordata, Δ5-desaturase derived from Pavlova salina, Δ15/ω3-desaturase derived from Pichia pastoris, Δ4-desaturase derived from Pavlova salina, Δ6-elongase derived from Pyramimonas cordata, or Δ12 -desaturase derived from Lachancea kluyveri.

A related aspect relates to genomic DNA derived from or isolated from plants, comprising at least a portion of the NS-B50027-4 lineage elite event. Such genomic DNA can be used as a reference control material in the identification assays described herein.

Brief description of the drawings

In FIG. 1 shows a diagram (map) of the cassette for the GA7-modB transformation.

In FIG. 2 is a plasmid map of the binary vector, pJP3416.

In FIG. 3 shows grain yield versus predicted DHA in kg/ha at eight cultivation sites. ♦ refers to DHA, kg/ha; - refers to linear DHA kg/ha; y=29.296x+2.8315; R ² \u003d 0.8567.

In FIG. 4 shows grain yield versus predicted LC-PUFA (EPA, DPA and DHA) in kg/ha at eight plots. ♦ refers to LC-PFU kg/ha; - refers to linear LC-PUFA kg/ha; y=34.043x+3.4049; R ² \u003d 0.8636.

In FIG. 5 shows the DNA sequence of the four gene transgenic insert and its flanking B. napus sequences (bold) (SEQ ID NO:40).

In FIG. 6 shows the DNA sequence of the sixteen gene insert and its flanking B. napus sequences (bold) (SEQ ID NO:41).

Detailed description

It should be understood that this invention is not limited to the specific methodology, protocols and reagents, etc. described herein, and they may vary. The terminology used herein is only intended to describe specific embodiments of the invention and is not intended to limit the scope of the present invention, which is solely defined by the claims.

All such patents and other publications are incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that may be used in connection with the present invention, but should not be the source of definitions of terms inconsistent with those of this document. These publications are included solely for their disclosure prior to the filing date of this application. Nothing in this respect should be construed as an admission that the inventors are not entitled to invoke such disclosure by virtue of prior invention or for any other reason. All statements regarding the date or representation regarding the contents of these documents are based on the information available to the state

- 11 042743 lam, and does not constitute any admission as to the correctness of the dates or the content of these documents.

As used herein and in the claims, the singular forms include reference to the plural unless the context clearly indicates otherwise. Throughout this specification, unless otherwise indicated, contain, contains, and containing are used inclusively, and not exclusively, such that a specified integer or group of integers may include one or more other unspecified integers or groups of integers.

The term or is used inclusive unless changed to either, for example. Thus, unless the context indicates otherwise, the word or means any one member of a particular list, and also includes any combination of members of that list.

All values are approximate as there are some variations in fatty acid composition due to environmental conditions. Values are usually expressed as a percentage by weight of total fatty acid or by weight of the whole seed. Accordingly, except in the working examples or where otherwise indicated, all numbers expressing amounts or reaction conditions used herein are to be understood as modified in all instances by the term about.

Recombinant DNA techniques can be performed according to standard protocols known in the art. See Sambrook et al., MOLECULAR CLONING: LAB. MANUAL (2nd ed., Cold Spring Harbor Lab. Press, NY (1989); Ausubel et al., CURRENT PROTOCOLS MOLEC. BIOL. (1994 and updates); DNA CLONING: PRACTICAL APPROACH, vol. 1-4 (Glover & Hames , Eds., IRL Press, 1995, 1996), Croy, PLANT MOLEC.BIOL.LABFAX (BIOS Sci. Pub. Ltd. & Blackwell Sci. Pub., UK, 1993); WO 2015089587.

The headings are for convenience only and should not be construed as limiting the invention in any way. Unless otherwise indicated, all technical and scientific terms used in this document have the same meaning as those generally accepted by a person skilled in the art. The terminology used herein is only intended to describe specific embodiments of the invention and is not intended to limit the scope of the present invention, which is solely defined by the claims. In order that the present disclosure may be more easily understood, certain terms are first given. Additional definitions are set forth in the text of the detailed description of the invention.

A lineage is a group of plants that show very little general variation among individual members that fall under this designation. Lineage also refers to a homogeneous population of plants carrying essentially the same genetic material that shows little or no genetic difference between individual members for at least one trait. A variety or cultivar may be used interchangeably with a line, but in general the first two terms refer to a line that is suitable for commercial production. Genetically derived, used for example in the phrase genetically derived from parental lines, means that the characteristic in question is wholly or partly dictated by an aspect of the genetic structure of the plant in question.

The plant Brassica in the context of the present description refers to plants of the family Brassicaceae. The Brassica plant may belong to one of the species Brassica napus, B. rapa (or campestris) or B. juncea. Alternatively, the plant may be of a species derived from a crossing of these Brassica species, such as B. napocampestris, or from an artificial crossing of one of these Brassica species with another Cruciferacea species. Ploidy refers to whether the number of chromosomes displayed by a cultivar is diploid or tetraploid. Because Brassica napus is an allotetraploid (amphidiploid) that results from crossing and retaining both the genomes of Brassica rapa (formerly B. campestris) and B. oleracea, a B. napus plant containing the NS-B50027-4 transgenic event can be used with breeding methods. to introduce the NS-B50027-4 event, and thus the LC-w3 fatty acid production trait, as described herein, into other members of the genus Brassica. Accordingly, examples of members of the genus Brassica suitable for the practice of the present embodiments of the invention include, without limitation, B. juncea, B. napobrassica, B. oleracea, B. carinata, B. napus, B. rapa, and B. campestris, as well as any other plants belonging to the genus Brassica which allow crossbreeding between Brassica species. Typically, an oil plant refers to any of the species B. napus, B. rapa (or campestris) or B. juncea.

Brassica napus is commonly known as rapeseed or oilseed rape, and specific cultivars may be referred to as canola. As used herein, the term canola or canola plant refers to the Brassica plant that can be used to produce canola oil (i.e., oil meeting a certain quality designation of less than 2% erucic acid) and includes varieties Brassica napus, B. napoBrassica , B. rapa, B. juncea and B. campestris. Canola is an amphidiploid (also called allotetraploid), an interspecific hybrid that has a complete set of diploid chromosomes from each parental form with an AACC genome.

Canola and the canola plant are generally referred to as Brassica napus but include all cultivars.

- 12 042743 those plants that can be bred with canola. Canola and the canola plant also include plant parts. Canola oil must contain less than 2% erucic acid; and one gram of air-dried, oil-free hard canola seed must contain less than 30 µmol of 3-butenylglucosinolate, 4-pentenylglucosinolate, 2-hydroxy-3-butenylglucosinolate, 2-hydroxy-4-pentenylglucosinolate, or mixtures thereof. See, for example, CODEX ALIMENTARIUS: FATS, OILS & RELATED PRODUCTS, vol. 8 (2nd ed., Food & Agriculture Org. United Nations, Rome, Italy, 2001).

A plant part includes plant cells, plant organs, plant protoplasts, tissue cultures of plant cells from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or plant parts such as embryos, pollen, eggs. , seeds, pods, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, cotyledons, hypocotyls, rootlets, individual cells, gametes, cell cultures, tissue cultures, etc. The cotyledon is a type of seed leaf; a small leaf found on the embryo of a plant. The cotyledon contains tissue to store food for the seed. An embryo is a small plant contained in a mature seed. Plant cells also include non-regenerating plant cells. Progeny, derivatives, variants, and mutants of regenerated plants are also included within the scope of the present embodiments of the invention, provided that these portions contain nucleic acid molecules with the event NS-B50027-4. The present embodiments of the invention are also directed to the use of transgenes with the NS-B50027-4 elite event in plant cell culture and tissue culture. Embodiments of the invention include plants and plant parts from the elite event line NS-B50027-4, as well as other plants obtained by the methods described.

An allele is any of one or more alternative forms of a gene that share the same trait or characteristic. In a diploid cell or organism, two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes.

The locus confers one or more traits such as, for example, modified fatty acid metabolism, modified phytic acid metabolism, modified carbohydrate metabolism, male infertility, herbicide resistance, insect resistance, disease resistance, or modified protein metabolism. This trait may, for example, be due to the presence of a naturally occurring gene introduced into the line's genome by backcrossing, natural or induced mutation, or a transgene introduced using genetic transformation techniques. A locus may contain one or more alleles integrated at the same chromosomal location. Quantitative trait loci (QTLs) refer to genetic loci that control at least to some extent numerically representable traits that are typically continuously distributed.

An event is an artificial genetic locus that, as a result of genetic manipulation, carries foreign DNA containing at least one copy of the genes of interest. Typical allelic event states are the presence or absence of foreign DNA. An event can be phenotypically characterized by the expression of one or more transgenes. At the genetic level, an event is part of the plant's genetic makeup. At the molecular level, an event is characterized by a restriction map (eg, as determined by Southern blotting) or flanking sequences of the transgene upstream or downstream, or the molecular configuration of the transgene. Typically, the transformation of plant cells or plant parts with transforming DNA results in multiple events, each unique.

The term gene refers to a DNA molecule, usually containing several operably linked regions of DNA, such as a promoter and a 5' untranslated region (5'UTR or 5' non-coding sequences), which together form a promoter region; a coding region (which may or may not code for a protein); and an untranslated 3' region (3'UTR or 3' non-coding sequences) containing a polyadenylation site. Typically, in plant cells, the coding regions 5'UTR and 3'UTR are transcribed into an RNA molecule, which, in the case of a protein-coding gene, is translated into a protein. A coding sequence thus refers to a sequence of nucleotides in a DNA molecule providing codons that translate a specific amino acid sequence. A gene may contain additional regions of DNA, such as, for example, introns. Genotype refers to the genetic makeup of a cell or organism. A genetic locus is usually the position of a given gene in the plant genome.

The term transgene refers to a gene of interest that is incorporated into the genome of a plant. Accordingly, a transgenic plant contains at least one transgene in the genome of all its cells. The transgenes of the present embodiment comprise at least one copy of a gene of interest, more specifically at least one copy of: A4 desaturase derived from Pavlova salina, A5 desaturase derived from the marine microalgae Pavlova salina, A5 elongase derived from microalgae Pyramimonas cordata, A6 desaturase derived from microalgae Micromonas pusilla, A6 elongase derived from Pyramimonas cordata, A12 desaturase from

- 13 042743 yeast Lachancea kluyveri and A15/m3-desaturase obtained from yeast Pichia pastoris; and at least one additional copy of an A6 desaturase derived from the microalgae Micromonas pusilla, an A5 elongase derived from Pyramimonas cordata, an A5 desaturase derived from the marine microalgae Pavlova salina, and an A15/m3 desaturase derived from the yeast Pichia pastoris. The transgenes are located in binary form in expression cassettes that include their respective regulatory regions. The transgenes described above are artificial in the sense that they were designed using a codon optimization strategy and thus the transgenes do not otherwise exist in nature. The transgene expression cassette may include at least one matrix attachment site (MAR) from Nicotiana tabacum. The transgenic cassette may also include a selectable marker gene. See US Pat. No. 8,816,111.

Alien or heterologous, when referring to a gene or DNA molecule in relation to a plant species, indicates that the gene or DNA molecule, or part of it (for example, a specific region), is not found in that plant species in its natural environment or does not occur in that genetic locus in this plant species in the natural environment. The term foreign DNA also refers to a DNA molecule that will or has been incorporated into the plant genome as a result of transformation. In the context of this disclosure, a transgene, transgene cassette, or transgene expression cassette contains at least one foreign or heterologous DNA.

The term chimeric, when referring to a gene or DNA molecule, is used to mean that a gene or DNA molecule contains at least two functionally relevant regions of DNA (such as promoter, 5'UTR coding region, 3'UTR, intron), which are not related to each other in the natural environment and originate from different sources, such that at least one DNA region is foreign to another DNA region in the chimeric molecule.

The terms plasmid and vector refer to an extrachromosomal element, often carrying genes that are not part of the cell's central metabolism and are usually in the form of circular double-stranded DNA fragments. Such elements can be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular single- or double-stranded DNA or RNA, derived from any source in which a number of nucleotide sequences have been added or recombined into a unique construct that is capable of introducing a fragment. promoter and DNA sequence for the selected gene product along with the appropriate 3' untranslated sequence into the cell. For transgenic plants, such plasmids or vectors may contain T-DNA regions to facilitate the insertion of the transgene(s) into the plant genome.

An expression cassette refers to a genetic construct containing a transgene and having elements in addition to a foreign gene that allow that gene to be expressed in a foreign host, and may refer to the cassette before and after insertion into the plant genome. In other words, the transgenic insert contains an expression cassette.

Transforming DNA refers to a recombinant DNA molecule used for transformation, such as an expression vector. The transforming DNA typically contains at least one gene of interest (eg, a chimeric gene) that is capable of conferring one or more specific characteristics to the transformed plant.

Transformation refers to the transfer of a nucleic acid molecule into a host organism, resulting in genetically stable inheritance. The nucleic acid molecule may be a plasmid that replicates autonomously, for example, or it may integrate into the genome of the host organism. Host organisms containing transformed nucleic acid fragments are referred to as transgenic or recombinant or transformed organisms.

The term recombinant DNA molecule is used for purposes of illustration and thus may include an isolated nucleic acid molecule, which may be DNA and which may be produced by recombinant or other procedures such as synthetic DNA synthesis or PCR. PCR (Polymerase Chain Reaction) is a reaction in which replicated copies of a target polynucleotide are generated using primers consisting of upstream and downstream primers and a polymerization catalyst such as DNA polymerase and a generally thermally stable polymerase enzyme. PCR methods are known in the art. See, for example, PCR (McPherson & Moller, eds., BIOS Sci. Publ. Ltd., Oxford, 2000). PCR can be performed on genomic DNA or cDNA.

DNA insert refers to heterologous DNA introduced into plant material through a transformation process and includes DNA that differs from the original DNA used for such transformation as explained herein. The DNA insert is typically a transgenic expression cassette. Elite event nucleic acid insert NS-B50027-4 and event DNA insert NS-B50027-4 refer to a nucleic acid molecule characterized as consisting of the nucleotide sequence 2090 to 14201 of SEQ ID NO: 1 or its complements; And

- 14 042743 nucleic acid molecule, characterized in that it contains a nucleotide sequence at positions 987 to 1894 of SEQ ID NO: 2 or from 1 to 910 of SEQ ID NO: 3 or their complements.

Suitable regulatory sequences refer to nucleotide sequences upstream (eg, 5'UTR), within or downstream (3'UTR) of a coding sequence that affect transcription, RNA processing, or stability or translation of an associated coding sequence. Regulatory sequences may include promoters, enhancer elements, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, and loop-on-stem structures.

A promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. Typically, the coding sequence is located at position 3' relative to the promoter sequence. Promoters may be entirely derived from a native gene, or may be composed of different elements derived from different naturally occurring promoters, or even contain synthetic DNA segments. Those skilled in the art will recognize that different promoters may direct gene expression in different tissue or cell types, or at different developmental stages, or in response to different environmental or physiological conditions. Promoters that cause a gene to be expressed in most cell types in most cases are commonly referred to as constitutive promoters. In addition, it is recognized that, since in most cases the exact boundaries of the regulatory sequences have not been fully defined, DNA fragments of different lengths may have identical promoter activity.

The terms 3' non-coding sequences and transcription terminator refer to DNA sequences located below the coding sequence. These include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of influencing mRNA processing or gene expression. The polyadenylation signal is typically characterized by the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor. The 3' region can affect the transcription, processing, or stability of the RNA, or the translation of the associated coding sequence.

The term operably linked refers to the association of nucleic acid sequences on one nucleic acid fragment such that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence when it is capable of influencing the expression of that coding sequence (ie, the coding sequence is under the transcriptional control of the promoter). Coding sequences may be operably linked to regulatory sequences in either sense or antisense orientation.

As used herein, the term expression refers to the transcription and stable accumulation of sense (mRNA) derived from the nucleic acids of the invention. Expression may also refer to the translation of an mRNA into a polypeptide.

Reference to a cell includes a plant cell, whether isolated in tissue culture or incorporated into a plant or plant part, unless otherwise indicated or clear from the context.

Progeny means all progeny, including progeny and derivatives of a plant or plants, and includes the first, second, third and subsequent generations, and can also be obtained by self-pollination or crossing with plants with the same or different genotypes and can be modified with a number of suitable genetic engineering techniques. Cultigen generally refers to plants that have been deliberately modified and selected by humans. T0 refers to the first generation of transformed plant material, T1 refers to seed produced from T0 plants, T1 seeds grow into plants that produce T2 seeds, and so on. to subsequent offspring of Tx.

Breeding includes all methods of development or propagation of plants and includes both intraspecific and interspecific, and intra- and inter-line crosses, as well as all suitable traditional methods of selection and artificial breeding. Desired traits (e.g. trait NS-B50027-4 DHA) can be transferred to other lines, varieties or cultivars of canola or B. napus using traditional propagation methods and can also be transferred to other Brassica species such as B. juncea and B. .rapa by interspecific crossing. Conventional breeding methods and interbreeding methods, as well as other methods for transferring genetic material between plants, are well known in the art.

Backcrossing is a process in which the breeder repeatedly crosses hybrid progeny back into a parent line, such as a first generation F1 hybrid, with one of the F1 hybrid parental genotypes.

Fatty acid composition or fatty acid content generally refers to the weight percent of the various fatty acids present in the endogenously formed oil of mature, whole, partially dried seeds. It is common industry practice to refer to percent fatty acid composition as a percentage of area (normalized area) rather than presenting it in absolute terms. Percent

- 15 042743 areas are easy to calculate and easy to compare with many others in the industry that are reported in a similar way. The area percentage is not equal to the absolute mass percentage, but approaches it. Absolute results can be calculated using individual reference standards of known concentration and an internal standard to calculate results in mg/kg. It is also possible to use correction factors to calculate fatty acid mass without using individual fatty acid standards, although an internal standard may still be needed. Typically, fatty acid content is determined by crushing the seeds and extracting the fatty acids as fatty acid methyl esters (FAME), which can be analyzed for fatty acid content using a variety of techniques that generate area percent data or from which area percent can be derived. . Examples of analytical approaches include gas chromatography (GC), GC-mass spectrometry (GC-MS), liquid chromatography-mass spectrometry (LC-MS), nuclear magnetic resonance (NMR) or near-infrared reflectance spectroscopy. The entire lipid content can be separated by techniques known in the art to purify fractions such as the TAG fraction, for example. Those skilled in the art are aware of other ways to characterize fatty acid compositions. See, for example, Tinoco et al., 3 Anal. Biochem., 514 (1962); CANOLA: CHEMISTRY, PRODUCTION, PROCESSING & UTILIZATION (Daun et al., eds., AOCS Press, Urbana, IL, 2011) (Daun et al., 2011); US 2015/0166928; US 20160002566.

Similarly, the oil content is the typical percentage of oil present in mature, whole, partially dried seeds (typically containing about 6 or 7% moisture). The oil percentage is calculated as the weight of the oil divided by the weight of the seed at 0% moisture. The oil content can be a characteristic of different varieties. It can be determined using various analytical techniques such as NMR (MQC, Oxford Instruments), NIR and Soxhlet extraction. For example, canola oil content can be measured by nuclear magnetic resonance techniques (Rossell & Pritchar, ANALYSIS OF OILSEEDS, FATS & FATTY FOODS 48-53 (Elsevier Sci. Pub. Ltd, London, 1991), using an NMS 100 Minispec pulsed wave (Balker Pty Ltd Scientific Instruments, Germany) while measuring moisture content Seed oil content can also be measured by near infrared reflectance (NIR) spectroscopy Li et al., 67, Phytochem., 904 (2006).

The phrases extracted plant lipid, isolated plant lipid, extracted lipid, and the like. refer to compositions containing lipids that have been extracted, for example, from crushed plants or plant parts such as seeds. The extracted lipid may be a relatively crude composition obtained, for example, by grinding plant material such as seeds; or more purified composition in which most, if not all, of the water, nucleic acids, proteins, or carbohydrates derived from plant material have been removed from the oil. Examples of purification methods are known in the art. In some embodiments, the extracted or isolated plant lipid contains at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% (w/w .) lipid by weight of the composition. The extracted lipid may be solid or liquid at room temperature, the latter being considered an oil. In some embodiments, the extracted lipid has not been mixed with another lipid, such as DHA obtained from another source (eg, DHA from fish oil). In some embodiments of the invention, after extraction, the ratio of oleic acid to DHA, palmitic acid to DHA, linoleic acid to DHA, or total ω6 fatty acids to total ω3 fatty acids did not change significantly (e.g., no more than 10% or 5% change) compared to with the ratio in the intact seed or cell. In other words, the extracted lipid was not enriched in a particular fatty acid, such as DHA. In other embodiments, the extracted plant lipid has not been subjected to a procedure, such as hydrogenation or fractionation, that changes the ratio of oleic acid to DHA, palmitic acid to DHA, linoleic acid to DHA, or total ω6 fatty acids to total ω3 fatty acids from ratio in an intact seed or cell. In other words, the extracted lipid was not enriched in a particular fatty acid, such as DHA. When the extracted plant lipid of the present invention is an oil, the oil may further contain non-fatty acid molecules such as sterols.

As noted above, the phrases extracted vegetable oil and isolated vegetable oil refer to compositions containing an extracted vegetable lipid or an isolated vegetable lipid that is liquid at room temperature. The oil is obtained from a plant or part of it, such as a seed. The extracted or isolated oil may be a relatively crude composition obtained, for example, by grinding plant seeds, or a more purified composition in which most, if not all, of the water, nucleic acids, proteins, or carbohydrates derived from plant material have been removed from oils. The composition may contain other

- 16 042743 components which may be lipid or non-lipid, for example non-fatty acid molecules such as sterols. In one embodiment, the oil composition contains at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% (w/w) of extracted vegetable lipid. In one embodiment, the extracted oil of the invention has not been mixed with another oil or fatty acid such as DHA derived from another source (eg DHA from fish oil). In one embodiment of the invention, after extraction, the ratios of fatty acids did not change significantly (eg, a change of no more than 10 or 5%) compared to the ratio in the intact seed or cell; in addition, the extracted vegetable oil has not been subjected to a procedure such as hydrogenation or fractionation, which significantly changes the ratio of fatty acids in the extract compared to the ratios in the intact seed or cell. In other words, the extracted oil has not been fortified with a particular fatty acid, such as DHA.

As used herein, an oil is a predominantly lipid-containing composition that is liquid at room temperature. For example, the oil according to the invention preferably contains at least 75%, at least 80%, at least 85% or at least 90% by weight of lipids. Typically, refined vegetable oil contains at least 90% triacylglycerols (TAG) based on the weight of lipid in the oil. Minor oil components such as diacylglycerols (DAG), free fatty acids (FFA), phospholipids, or sterols may be present in the oil.

As used herein, the term fatty acid refers to a carboxylic acid, often with a long aliphatic tail, either saturated or unsaturated. Typically, fatty acids have a carbon-carbon chain length of at least 8 carbons, such as at least 12 carbons, 16 carbons, 18 carbons, 20 carbons, or 22 carbons in length. Most natural fatty acids have an even number of carbons because their biosynthesis involves acetate, which has two carbons. Fatty acids can be in a free state (non-esterified); in esterified form such as part of triglyceride (TAG), diacylglyceride (DAG), monoacylglyceride; or be linked to an acyl-CoA (thioether) bond or in another linked form. The fatty acid may be esterified as a phospholipid such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidyl linositol or diphosphatidylglycerol.

Saturated fatty acids do not contain carbon-carbon double bonds (alkenes) or other functional groups in the chain. Saturated refers to the presence of hydrogen at all possible carbon atoms (except the carboxylic acid group [-COOH]). In other words, in a saturated fatty acid, the omega (ω) end (also called the n-terminus) of the fatty acid contains three hydrogen atoms (-CH ₃ ) and each carbon in the chain contains two hydrogen atoms (-CH ₂ -).

Unsaturated fatty acids have a similar backbone to saturated fatty acids except that they contain at least one alkene group (-CH=CH-) in the carbon chain. The two flanking carbons (attached to either side of the alkene group) can occur in the cis or trans configuration. Monounsaturated fatty acids refer to fatty acids that have at least twelve carbon atoms but only one alkene group in the carbon chain. Polyunsaturated fatty acids or PUFAs refer to fatty acids that have at least twelve carbon atoms and at least two alkene groups in the carbon chain. Long chain polyunsaturated fatty acids and LC-PUFAs refer to fatty acids that have at least twenty carbon atoms in the carbon chain and have at least two alkene groups. Very long chain polyunsaturated fatty acids and VLC-PUFAs refer to fatty acids that have at least twenty-two carbon atoms and at least three alkene groups in the carbon chain. Link to LC-PUFA includes VLC-PUFA. Typically, the number of carbon atoms in the carbon chain of fatty acids refers to the straight carbon chain. Atoms in the side groups are excluded from the number of carbon atoms if the carbon chain is branched.

In one embodiment, the LC-PUFA is a ω3 fatty acid: it has a desaturation (alkene group) in the third carbon-carbon bond from the methyl end of the fatty acid. In another embodiment, the LC-PUFA is a ω6 fatty acid: it has a desaturation (alkene group) at the sixth carbon-carbon bond from the methyl end of the fatty acid. The position of the alkene (double bond) in the fatty acid chain is also indicated using A (or delta), where the position of the alkene is numbered relative to the carboxyl end of the fatty acid. For example, linoleic acid can also be referred to as cis-A9, cis-A12 octadecadienoic acid, or ^Δ9.12 octadecadienoic acid. Fatty acids can also be identified with reference to the C:D lipid number, where C is the number of carbon atoms and D is the number of double bonds in the main carbon chain. For example, for arachidic acid, 20:4Δ ^{5, , ,} , may be indicated, which means a carbon chain of twenty atoms with four

- 17 042743 with three alkene groups located at carbon atoms 5, 8, 11 and 14 from the carboxyl end of the fatty acid. This name also indicates that arachidic acid is a ω6 fatty acid, because if there are twenty carbons and an alkene at C14 from the carboxyl end, the first alkene at the methyl end must be at C6.

In a further embodiment, the LC-PUFA is selected from the group consisting of arachidic acid (ARA, 20:4Δ ^{5, ,} ; ω6), eicosatetraenoic acid (ETA, 20:4Δ ^{8, , , 7} ; ω3), eicosapentaenoic acid ( EPA, 20:20:5Δ ^5.8.11.14.17 ; ω3), docosapentaenoic acid (DPA, 22:5Δ ^{7.10.13.16.19} ; ω3) or docosahexaenoic acid (DHA, 22:6Δ ^{4 ,7,10,13,16,19} , ω3). LC-PUFA can also be dihomo-γ linoleic acid (DGLA) or eicosatrienoic acid (ETrA, 20:3Δ ^11,14,17 ; ω3). The LC-PUFAs prepared in accordance with the present embodiments of the invention may be a mixture of any or all of the above and may include other LC-PUFAs or derivatives of any of these LC-PUFAs. However, LC-PUFAs produced in elite event canola are generally purer than those derived from fish oils. In at least one embodiment of the invention, the ω3 fatty acids are at least one of DHA; DPA and DHA or EPA, DPA and DHA.

In addition, as indicated above, LC-PUFA and VLC-PUFA may be free fatty acid (non-esterified), esterified, or in another bound form. Thus, the LC-PUFAs of the present embodiment may be present as a mixture of forms in a cell lipid, an extracted lipid, or a purified oil. In at least one embodiment of the invention, the oil contains at least 75% or at least 85% triacylglycerols, with the remainder present as other lipid forms, such as those mentioned, with triacylglycerols containing at least one LC-PUFA. The oil may then be further refined or processed, such as by hydrolysis with a strong base to release free fatty acids, or by distillation, or the like.

Accordingly, the total amount of ω3 fatty acids, the total content of ω3 fatty acids, and the like. refers to the sum of all ω3 fatty acids, esterified and non-esterified, in an extracted lipid, oil, recombinant cell, plant part, or seed, as determined by the context, and is usually expressed as a percentage of total fatty acids. These ω3 fatty acids include ALA, SDA, ETrA, ETA, EPA, DPA or DHA and exclude any ω6 fatty acids or monounsaturated fatty acids. New ω3 fatty acids, content of new ω3 fatty acids, etc. refer to the sum of all ω3 fatty acids excluding ALA, esterified and non-esterified, in an extracted lipid, oil, recombinant cell, plant part, or seed, as determined by context, expressed as a percentage of total fatty acids. These novel ω3 fatty acids are fatty acids that are produced in the cells, plants, plant parts, and seeds of the present embodiment via the expression of elite event transgene constructs and, if present, include SDA, ETrA, ETA, EPA, DPA, or DHA, but excluding ALA, any ω6 fatty acids, or monounsaturated fatty acids. The approximate total ω3 fatty acid content and the new ω3 fatty acid content can be determined by converting the fatty acids in the sample to FAME and analyzing by GC using methods known in the art. See, for example, American Oilseed Chemists' Society (AOCS) method Celd-91.

Similarly, the total amount of ω6 fatty acids, the total content of ω6 fatty acids, and the like. refers to the sum of all ω6 fatty acids, esterified and non-esterified, in an extracted lipid, oil, recombinant cell, plant part, or seed, as the context requires, and is expressed as a percentage of total fatty acids. The total content of ω6 fatty acids, if present, may include LA, GLA, DGLA, ARA, EDA or ω6-DPA and excludes any ω3 fatty acids or monounsaturated fatty acids. New ω6 fatty acids, content of new ω6 fatty acids, etc. refers to the sum of all ω6 fatty acids excluding LA, esterified and non-esterified, in an extracted lipid, oil, recombinant cell, plant part, or seed, as determined by context, expressed as a percentage of total fatty acids. These novel ω6 fatty acids are fatty acids that are produced in cells, plants, plant parts, or seeds as described herein through the expression of elite event transgenes and may include GLA, DGLA, ARA, EDA, or ω6-DPA, but with the exception of LA, any ω3 fatty acids or monounsaturated fatty acids.

Semi-seed analysis is a procedure in which fatty acid analysis is carried out on one of two cotyledons (half-seed) and the remaining seedling bearing the second cotyledon forms a plant.

The protein content is the typical weight percentage of protein in the oil-free meal of mature whole dried seeds, determined by methods known in the art. See, for example, Daun et al., 2011, AOCS Official Meth. Ba 4e-93 Combustion Meth. Determination Crude Protein.

- 18 042743

Mature seeds grown by commercial growers for purposes other than growing or propagating the species are sometimes referred to as grains.

genetic events.

Phenotypic expression of transgenes in canola is determined both by the structure of the transgene cassette itself and by the location of its insertion in the plant genome: the presence of transgenes at specific locations in the plant genome can affect transgene expression and the overall plant phenotype. Agronomically or industrially successful introduction of a commercially interesting trait into a plant by genetic manipulation can be a lengthy procedure depending on various factors. The actual transformation and production of genetically transformed plants is only the first in a series of breeding steps that involve extensive genetic characterization, selection and evaluation in field trials, which ultimately leads to the selection of an elite event.

An aspect of an embodiment of the present invention relates to the unexpected copy number of expressed transgenes in the plant genome. Expressed means that the primary structure of the DNA molecule, i.e. the coding sequence of the transgene indicates that the gene encodes an active protein. However, expressed coding sequences may not be expressed because gene knockout occurs through various mechanisms of homologous transgene inactivation in vivo. Homologous transgene inactivation has been described in plants in which the transgene is inserted in sense orientation, with the surprising result that both the gene and the transgene were downregulated. Napoli et al., 2 Plant Cell, 279 (1990). Possible mechanisms for the inactivation of homologous genetic sequences include transcriptional inactivation via methylation, in which duplicated stretches of DNA signal endogenous mechanisms of gene shutdown and post-transcriptional shutdown, in which pooled mRNA levels from both the endogenous gene and the transgene initiate threshold-induced degradation of both messages. van Bokland et al., 6, Plant J., 861 (1994). Surprisingly, however, although NS-B50027-4 has at least three copies of several transgenes, some of which are in the same orientation, NS-B50027-4 shows synergistic expression of DHA.

An elite genetic event can be characterized by the location(s) and configuration at the site(s) of incorporation of the recombinant DNA molecule(s) into the plant genome. The site in the plant genome at which the recombinant DNA cassette has been inserted is also referred to as the insertion site or the target site. A flanking region or flanking sequence is a region of DNA, eg, at least 20 base pairs, at least 50 base pairs, or up to 5,000 base pairs, of the plant genome located immediately upstream and adjacent or directly downstream and adjacent to the transgenic cassette. Transformation that results in random integration of foreign DNA results in transformants with distinct flanking regions that are characteristic and unique to each transformant (elite event).

Typically, when a transgene is introduced into a plant by conventional breeding, its insertion site in the plant genome and its flanking regions are not altered. An insertion region refers to a region corresponding to a region of at least 40 base pairs, such as at least 100 base pairs or up to more than 10,000 base pairs, spanned above and below the flanking regions of the transgene in the (untransformed) plant genome and comprising the insertion site (and possible deletion of the target site). Considering minor differences due to mutations within a species, an insertion region may retain at least 85%, such as 90, 95, or 100% sequence identity with flanking regions up and down the foreign DNA in a given plant of that species. However, the insertion of a transgenic cassette into the plant genome can sometimes be associated with a deletion of the plant's DNA, referred to as a target site deletion.

Expression of genes of interest refers to the fact that transgenes confer on a plant one or more phenotypic traits (e.g., production of LC-w3 fatty acids) that were intended to be conferred by the introduction of transforming DNA (based on the structure and function of some or all of the genes, of interest). In embodiments of the present invention, several transgenes provide a biosynthetic pathway for the production of LC-w3 fatty acids in a transformed plant.

An elite event, as used herein, is an event selected from a group of events obtained by transformation with the same transforming DNA or by backcrossing with plants resulting from such transformation, based on the expression and stability of the transgene construct( constructs), its compatibility with the optimal agronomic characteristics of the plant containing it, and the realization of the desired phenotypic trait. Thus, the selection criteria for elite events are at least one, and predominantly all of the following:

(a) the presence of the transgene does not compromise other desirable characteristics of the plant, such as those relating to agronomic characteristics or commercial value;

(b) the event is characterized by a well-defined molecular configuration that is stable

- 19 042743 is inherited and for which appropriate diagnostic tools can be developed to control identity;

(c) the genes of interest in the transgene cassette show correct, appropriate and stable spatial and temporal phenotypic expression, both in the heterozygous (or hemizygous) and homozygous state of the event, at a commercially acceptable level under a range of environmental conditions, under which the plants carrying the event may be subject to normal agronomic use. Foreign DNA can also be associated with a position in the plant genome that allows for introgression into further desirable commercial genetic backgrounds.

The status of an event as an elite event can be confirmed by introgression of the elite event in various relevant genetic backgrounds and observation of compliance with at least one of the criteria, for example (a), (b) and (c) above. In addition, the selection of elite events can also be determined by compatibility, more specifically that the progeny resulting from a cross between a plant carrying the NS-B50027-4 elite event and a plant carrying at least one other event, so that the progeny carries both events. Accordingly, an elite event refers to a genetic locus containing a transgenic cassette that meets the criteria described above. A plant, seed, plant material, or progeny may include one or more elite events in its genome.

Elite event NS-B50027-4 was selected as an elite event in the development of canola that produces LC-PUFA, in particular LC-w3 fatty acids, and in particular DHA. The incorporation of a recombinant DNA molecule into the plant genome usually occurs as a result of cell or tissue transformation (or other genetic manipulations). The specific incorporation site(s) may be random or predefined (if a targeted integration process is used). Canola line NS-B50027-4 is a stable and uniform breeding line as described herein. It has been grown with careful attention to the uniformity of plant type. The line was enlarged while constantly monitoring uniformity. Canola line NS-B50027-4 is not the parent of any other canola cultivar commercialized at the time of patent filing for line NS-850027-4.

The advent of new molecular biological techniques has made it possible to isolate and characterize genetic elements with specific functions, such as encoding specific protein products. Scientists in the field of plant biology have shown great interest in designing a plant genome containing and expressing foreign genetic elements, or additional or modified versions of native or endogenous genetic elements, to alter plant traits in a specific way. Any DNA molecules, whether from a different species or from the same species, that are inserted into the genome of a species using transformation are collectively referred to herein as transgenes. The transformation process is the insertion of DNA into the genome. Several methods have been developed for producing transgenic plants, and the present invention, in specific embodiments, also relates to transformed variants of the claimed canola line NS-B50027-4.

Numerous methods for plant transformation have been developed, including biological and physical protocols for plant transformation. In addition, expression vectors and in vitro culture methods are available for plant cell or tissue transformation and plant regeneration. See, for example, Miki et al., Procedures for introducing foreign DNA into plants, in METH. PLANT MOLEC. BIOL. & BIOTECHNOL. at 63 (Glick & Thompson, eds., CRC Press, Boca Raton, 1993); Gruber et al., Vectors for plant transformation, id. on R 89; Genetic transformation for the improvement of Canola, PROC. WORLD CONF. BIOTECHNOL. FATS & OILS INDUS, at 43-46 (Am. Oil. Chem. Soc, Champaign, IL, 1988).

The most common types of plant transformation involve the construction of an expression vector. Such a vector contains a DNA molecule that contains a coding region under the control of a regulatory region or is operably linked to it, for example, by a promoter. The vector may contain one or more genes and one or more regulatory elements. At least one of the coding regions and their respective control elements may be located in opposite orientations within the vector, providing a binary vector. Theoretically, the arrangement of genes susceptible to gene shutdown in binary form can minimize gene shutdown.

For example, the original transformation cassette, pJP3416_GA7-modB, included seven genes capable of stimulating the accumulation of omega-3 fatty acids in canola seed and one selectable marker gene to facilitate the selection of putative transgenic plants in vitro. See WO 2013/185184; US Patent Publication 2015/0374654; CIIIA patents No. 8816111 and No. 8946460; Petrie et al., 6, Plant Meth., 8 (2010).

All expressed genes were synthetic - codon-optimized and synthesized - therefore, transgenic DNA molecules are not found in any natural organ

- 20 042743 low. Similar sequences have been described and used as a template for codon optimization. See Petrie et al., 12, Metab. Eng'g, 233 (2010a); Petrie et al., 11, Plant Methods, 6 (2010b); Petrie et al., 21, Transgenic Res., 139 (2012).

As is well known in the art, functional gene promoters are regions of DNA that are important for gene transcription but do not code for functional products such as peptides. For example, a common promoter for constitutive expression is from Cauliflower Mosaic Virus. Kay et al., 236, Science, 1299 (1987); Coutu et al., 16, Transgenic Res., 771 (2007). Terminator regions, which include polyadenylation signals, are required for the production of complete and stable mRNA molecules. For example, the A. tumefaciens nopaline synthase (NOS) terminator is a useful terminator. Bevan, 12, Nucl. Acid Res. 8711 (1984); Rogers et al., in BIOTECHNOL. PLANT SCI., 219 (Acad. Press, Inc., New York, NY, 1985); Sanders et al., 15, Nucl. Acids Res., 1543 (1987). A number of regulatory sequences were used in combination to start and terminate transcription of various expression cassettes. Seed-specific promoters used in GA7-modB have been described previously: A. thaliana FAE1 (Rossack et al., 46, Plant Molec. Biol., 717 (2001)); L. usitatissimum Cnl1 and Cnl2 (Chaudhary et al., WO 2001/016340); and the truncated B. napus napin promoter (Stalberg et al., 23, Plant Molec. Biol., 671 (1993)). See also U.S. Patent No. 8,816,111.

A more detailed description of transgenes containing open reading frames of the 5' and 3' regulatory regions and other non-coding regions of the transgene expression cassettes used to introduce the LC-PUFA pathways into canola is given in Table 1. 1.

Table 1

Genetic Elements in Elite Event NS-B50027-4

Promoter (PRO) Coding sequence (CDS) Termination (TER) MAR Name Source Name Source Name Source PRO Linus- Cnl2 promoter conlin2 Linum usitatissimum c/ enhancer leader 5’ UTR tobacco mosaic virus (TMV) CDS Micpud6D A6-desatura for micromonas pusilla TER Linus- Clnl2 conlinin terminator2 Linum usitatissimu m - PRO Arath- FAE1 elongase promoter fatty acid TMV leader Arabidopsis thaliana CDS Pyrco delta-5 elongase A5-elongase Pyramimona s cordata TER Glyma Lectin lectin terminator Glycine max - PRO Brana- FP1 promoter napina TMV leader Brassica napus CDS Pavsad5D Δ5- desaturase Pavlova salina TER Agrtu- NOS terminator nopaline- Agrobacteriu m synthase tumerfaciens MAR Nikta- RB7 PRO Linus- Cnll conlinin promoter! TMV leader L. usitatissimum CDS Picpaw3D A15/sw-desa turase Pichia pastoris TER Linus- Cnll conlinin terminator! L. usitatissimu m -

- 21 042743

PRO Linus- Cnl2 conlinin2 L promoter. usitatissimum CDS Pavsad4D Δ4- desaturase Pavlova salina TER Linus- Cnl2 conlinin terminator 2 L. usitatissimu m - PRO Linus- Cnll conlinin promoter! L. usitatissimum CDS Lackldl2D Δ12- desaturase Lachancea kluyveri TER Linus- Cnll conlinin terminator 1 L. usitatissimu m MAR Nikta- RB7 PRO Arath- FAE1::E NHANC ER-TMV leader elongase promoter TMV fatty acid leader A. thaliana CDS Pyrco delta-6 elongase L6-elongase Pyramimona's cordata TER Glyma Lectin lectin terminator G. max - PRO 35Sx2 Mosaic Virus Color cabbage CDS phosphino-thricin A-acetyl transferase Streptomyce s viridochro- mogenes TER AgrtuNOS nopaline synthase terminator A. tumefaciens -

Accordingly, transgene detection primers and probes can be used to determine if a biological sample contains at least a portion of the LC-PUFA pathway present in NS-B50027-4. Specific primers suitable for detecting transgenes are shown in Table 1. 2, in which each primer has a renaturation temperature of 62 and size (bp) refers to the number of base pairs in the PCR product.

table 2

Example of PCR primer sets for gene expression cassette detection

Target gene sense primer antisense primer Δ12 desaturase TGGAGCTATCCCTCATGAGT (SEQ ID NO:53) GAT C C TAGAACAG TAG T GG T G (SEQ ID NO:54) Δ15/ω3 desaturase GACGCTATCCCTAAGCACTGT (SEQ ID NO:55) GTCCACTCTTGAGCATCGTA (SEQ ID NO:56) Δ6 desaturase GAGCACCTTGTAGTTGAGTCC (SEQ ID NO:57) AGTCTGAGGATGTCTCCTATGC (SEQ ID NO:58) Δ6 Elongase TGTTGCTATGGCTCAAGAGC (SEQ ID NO:59) CTAGCGTGGTGCTTCATGTA (SEQ ID NO:60) Δ5 desaturase GCTACCGATGCTTACAAGCA (SEQ ID NO:61) TAGTGAAGTCCGTGCTTCTC (SEQ ID NO:62) Δ5 elongase TGCTGGAACTCTTGGATACG (SEQ ID NO:63) CTGGGTGATGTACTTCTTCC (SEQ ID NO:64) Δ4 desaturase GGCTTTCAGATCTGAGCATC (SEQ ID NO:65) C T CAG C C T TAACAAGAG GAG (SEQ ID NO:66)

The original transformants cultured from the Brassica napus L. (van AV Jade) germline showed a wide variation in fatty acid production levels, especially in EPA and DHA levels. For the second and third generations, the selection was based mainly on the content of DHA and EPA in transgenic seeds. In some cases, especially in T2 or T3 generations, segregation patterns (determined by growing twenty to forty individual seeds from one plant to twenty to forty offspring, and then measuring the DHA and EPA content of the individual seeds of those offspring) have also shown scattered results, indicating complex or multicopy insertions taking place. Thus, many of the original generations of T2 or T3 plants were discarded. Initially, it was concluded that multiple copies of the transgenic insert would produce

- 22 042743 unstable transformants, as well as demonstrate the classic gene knockout observed in homozygous genotypes. Therefore, if PCR analysis of transformed plants showed a copy number >1, these transformants were often discarded.

Surprisingly, the NS-B50027-4 elite event was found to contain a multicopy event: a sixteen-gene insert including two cassettes bordering eight-TDNA-genes arranged in left-border-to-left binary (reversed) border (similar to a massive palindrome); and a separate smaller cassette with four genes; and this combination of transgenic inserts acts synergistically in DHA production in the inbred line NS-B50027-4. More specifically, the combination of crossing, backcrossing and self-crossing segregated a sixteen-gene insertion on the A05 chromosome (also referred to as N05) and a four-gene insertion on the A02 chromosome (also referred to as N02). The contribution of each transgenic chromosome was determined by selecting each segregant to obtain pure homozygous lines for each event. For example, in one experiment, a segregant containing an insert of sixteen genes produced about 4% DHA; a segregant containing an insert of four genes did not produce DHA; but when segregants were selected to combine the A02 transgenic chromosome locus and the A05 transgenic chromosome locus, the combination of the two transgenic inserts resulted in a plant that produced at least about 7% DHA to at least about 14% DHA, inclusive, in its seed. This result was unexpected. As already noted, despite the unusual genetic composition of the NS-B5OO27-4 elite event, the line appeared to be stable and consistent in fatty acid production.

As for the smaller insert of four genes located on A02, this insert replaced about 15 bp. the 3' UTR region of the gene of unknown function (HPP gene).

The B. napus partial insert and its flanking sequences are well described herein. An insert of four genes includes the A6-desaturase, A5-elongase, A5-desaturase, and A15/m3-desaturase transgenes; but does not include the genes for A4-desaturase, A12-desaturase, A6-elongase and the genetic selection marker PAT. Since A4 desaturase is required for DHA production in the plant seed cell, it was unexpected and surprising that the insertion of four genes synergistically promoted DHA production in the NS-B50027-4 transgenic line. The four-gene insert and its flanking B. napus regions on A02 are shown in FIG. 5 (SEQ ID NO: 40). Specifically, nucleotides 1 to 2089 of SEQ ID NO: 40 represent the 5' (upper) flanking region of the insertion site of the small insert; nucleotides 2090 to 14201 of SEQ ID NO: 40 refer to the heterologous nucleic acid from the transgenic cassette; and nucleotides 14202 to 15006 of SEQ ID NO: 40 represent the 3' (lower) region of the insertion site with an area of 808 bp. Nucleotides 1 to 2089 and 14202 to 15006 of SEQ ID NO: 40 are native to the B. napus A02 chromosome. Genetic analysis comparing native B. napus sequence and insertion site revealed a deletion insert: the transgenic insert replaced a 15 bp fragment (GTAGCACGACAAGTT; SEQ ID NO: 38) that would otherwise be on chrUn_random in the reference Darmor cultivar B. napus (2n=AACC) at position 118589927118589941 and on chromosome A02 of the reference genome from the Chiifu B. rapa cultivar (2n=AA) at position 18569316-18569330. See Chalhoub et al., 345, Sci., 950 (2014); NCBI Ref. Seq. NC_024796.1; Wang et al., 43, Nat. Genet., 1035 (2011); NCBI Ref. Seq. XM_009130638.

The sixteen-gene insert was confirmed to be in the Brassica gene encoding the Pto-interacting protein (PTI), a serine-threonine kinase that would otherwise be involved in hypersensitivity-mediated signaling. The PTI gene is located on chromosome A05 of the reference genome of B. napus (Darmor cultivar) at position 17267746-17270700. This larger insert is also associated with a deletion insert that replaces a 20 bp stretch of DNA. (CACGGTGGAGGTCACCATGT; SEQ ID NO: 39) in the second exon of the PTI protein; and thus disrupted the expression of PTI. This deletion is 20 bp long. was located on chromosome A05 of the reference genome at position 17269790-17269809. The DNA sequence of the sixteen gene insert and its flanking B. napus regions on A05 is shown in FIG. 6 (SEQ ID NO: 41). Specifically, nucleotides 1 to 1159 of SEQ ID NO: 41 represent the 5' (upper) flanking region of the insertion site of the large insert; nucleotides 47774 to 49789 of SEQ ID NO: 41 represent the 3' (lower) flanking region of the insertion site. Nucleotides 1 to 1159 of SEQ ID NO: 41 and 47774 to 49789 of SEQ ID NO: 41 are native to chromosome A05 of Brassica napus.

Accordingly, in another embodiment, the invention relates to a DNA molecule containing an artificial binary genetic locus containing in order the following nucleotide sequences (arrows indicate the direction of transcription with respect to the reference DNA sequence 5'-3'):

(a) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 2747 to nucleotide 6250 (Micpu-d6D ^ including PRO, leader, TER);

b) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 6257 to nucleotide 8414 (^ Pyrco-d5E, including PRO, leader, TER);

(c) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 8415 to nucleotide 10374

- 23 042743 (^ Pavsa-d5D, including PRO, leader, TER);

(d) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 10375 to nucleotide 11544 (^ MAR); and (e) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 11545 to nucleotide 14049 (Picpa-w3/d15D ^ including PRO, leader, TER);

(f) molecules with at least 80%, 95%, 97%, 98%, 99% or 99.5% sequence identity to the nucleotide sequences (a)-(e); or (g) their complements.

A corresponding embodiment of the invention relates to plant cells, plant materials or plant seeds containing this artificial binary genetic locus.

In another embodiment, the invention relates to a DNA molecule containing an artificial binary genetic locus containing, in order, the following nucleotide sequences:

(a) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 1268 to nucleotide 5317 (Cnl2 PRO through the leader through the coding region for Micpu-d6D ^ through TER);

(b) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 5324 to nucleotide 7481 (PRO through ^ Pyrco-d5E through TER);

(c) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 7482 to nucleotide 9443 (PRO via leader and ^ Pavsa-d5D via TER);

(d) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 9444 to nucleotide 10611 (^MAR);

(e) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 10612 to nucleotide 13116 (PRO via leader and Picpa-w3/d15D ^ via TER);

(f) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 13117 to nucleotide 17000 (PRO through ^ Pavsa d4D through TER);

(g) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 17001 to nucleotide 19606 (PRO through ^ Lack-d12D through TER);

(h) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 19607 to nucleotide 29773 (^MAR);

(i) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 20783 to nucleotide 22987 (PRO through ^Pyrco-d6E through TER);

(j) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 23011 to 24370 (PRO through ^PAT through TER);

(k) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 42561 to nucleotide 25920 (PRO through PAT ^ through TER);

(l) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 25943 to nucleotide 29324 (PRO through Pyrco-d6E ^ through TER);

(m) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 28157 to nucleotide 29324 (MAR ^);

(n) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 29324 to nucleotide 31830 (PRO through Lack-d12D ^ through TER);

(o) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 31831 to nucleotide 35816 (PRO via Pavsa d4D ^ via TER);

(p) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 35817 to nucleotide 38319 (PRO via leader and ^ Picpa-w3/d15D via TER);

(q) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 38320 to nucleotide 39488 (MAR ^);

(r) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 39489 to nucleotide 41449 (PRO through Pavsa-d5D ^ through TER);

(s) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 41450 to nucleotide 43607 (PRO through Pyrco-d5E ^ through TER);

(t) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 43614 to nucleotide 47662 (PRO^Micpu-d6D through TER);

(u) a molecule with at least 80%, 95%, 97%, 98%, 99% or 99.5% sequence identity to the nucleotide sequences (a)-(u), (a)-(j), (k)-(u); or (v) their complements.

A corresponding embodiment of the invention relates to plant cells, materials or plant seeds containing this artificial binary genetic locus.

In another embodiment, the invention relates to a DNA molecule containing an artificial binary genetic locus containing, in order, the following nucleotide sequences:

(a) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 2747 to nucleotide 4141 (Micpu-d6D^);

(b) the nucleotide sequence of the complement of the nucleotide sequence of SEQ ID NO: 40 from nucleotide 7259 to nucleotide 8065 (^ Pyrco-d5E);

(c) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 8841 to nucleotide 10121 (^ Pavsa-d5D);

(d) the nucleotide sequence of SEQ ID NO: 40 from nucleotide 12281 to nucleotide 13531 (Picpa-w3/d15D^);

(e) a molecule with at least 80%, 95%, 97%, 98%, 99% or 99.5% sequence identity to the nucleotide sequences (a)-(d); or (f) their complements, where the artificial locus includes regulatory regions (eg, promoters, leader sequences, terminators) to allow expression from (a) to (d), or (e), or (f). A corresponding embodiment of the invention relates to plant cells, plant materials or plant seeds containing this artificial binary genetic locus.

In another embodiment, the invention relates to a DNA molecule containing an artificial binary genetic locus containing, in order, the following nucleotide sequences:

(a) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 1820 to nucleotide 3208 (Micpu-d6D^);

(b) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 6326 to nucleotide 7126 (^ Pyrco-d5E);

(c) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 7908 to nucleotide 9192 (^ Pavsa-d5D);

(d) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 11352 to nucleotide 12596 (Picpa-w3/d15D^);

(e) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 15216 to nucleotide 16556 (^ Pavsa d4D);

(f) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 17619 to nucleotide 18866 (^ Lack-d12D);

(g) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 21895 to nucleotide 22647 (^Pyrco-d6E);

(h) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 25943 to nucleotide 26283 (Pyrco-d6E^);

(i) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 30066 to nucleotide 31313 (Lack-d12D^);

(j) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 31831 to nucleotide 35816 (Pavsa-d4D^);

(k) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 36335 to nucleotide 38319 (^ Picpa-w3/d15D);

(l) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 39749 to nucleotide 41023 (Pavsa-d5D^);

(m) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 41805 to nucleotide 42605 (Pyrco-d5E^);

(n) the nucleotide sequence of SEQ ID NO: 41 from nucleotide 45724 to nucleotide 47111 (^ Micpu-d6D);

(o) a molecule with at least 80%, 95%, 97%, 98%, 99% or 99.5% sequence identity to the nucleotide sequences (a)-(u), (a)-(j), (k)-(u); or (p) their complements, where the artificial locus includes regulatory regions (eg, promoters, leader sequences, terminators) to allow expression of (a)-(n), or (o), or (p). A corresponding embodiment of the invention relates to plant cells, materials or plant seeds containing this artificial binary genetic locus.

A genetic trait, such as has been introduced into a particular canola plant using transformation techniques such as those described herein, can be transferred to another canola or Brassica line using conventional breeding techniques well known in the field of plant breeding. For example, plants carrying the NS-B5OO27-4 elite event can, for example, be obtained from seeds deposited with the ATCC. Such plants can be further propagated and/or used in a conventional breeding scheme to introduce the elite event NS-B50027-4 into other

- 25 042743 cultivars of the same plant species. The deposited seeds belong to the species Brassica napus. However, methods for introducing alleles or transgenes located on the A or C genome from B. napus to B. juncea are well known in the art and include repeated backcrossing. A backcrossing approach can be used to move a transgene from a transformed canola plant into an elite inbred line and the resulting progeny includes the transgene. In addition, if an inbred line is used for transformation, the transgenic plants can be crossed with another line to produce a transgenic hybrid canola plant. As used herein, the term crossing may refer to a simple crossing of X with Y, or a backcrossing process, depending on the context. Various genetic elements can be further introduced into the plant genome using transformation. These elements include, but are not limited to, genes; coding sequences; inducible, constitutive and tissue-specific promoters; enhancer sequences; and signaling and targeting sequences.

Canola inbred line NS-B50027-4.

Canola line NS-B50027-4 is a stable and uniform breeding line as described herein. It was bred with particular attention to the uniformity of plant type, and the line was enlarged with constant monitoring of uniformity. NS-B50027-4 is notable in particular for the production in its seeds of LC-PUFA, in particular LC-ω3 fatty acids, and more specifically DHA. Canola line NS-B50027-4 is not the parent of any other canola cultivar commercialized at the time of patent filing for line NS-B50027-4.

The inbred transgenic canola line NS-E50027-4 has the following morphological and physiological characteristics (based on data collected and averaged from eight different locations in Australia during 2015).

Table 3

Descriptive information: NS-B50027-4 and AV Jade

NS-B50027-4 Comparator: AV Jade View Brassica napus Brassica napus Sheet: Green medium medium Leaf: Doli There is There is Sheet: Number of beats medium medium Sheet: Serrated edge medium medium Leaf: Length medium medium flowering time medium to late medium Flower: Petal color yellow yellow Flower: Petal Width medium medium Flower: Pollen production There is There is Plant: Seedling Power medium to high medium Plant: Height at full bloom medium medium Plant: lodging at maturity low low Disease resistance Black leg There is There is Pod: Length medium to long medium to long Pod: Spout Length medium medium Pod: Leg length medium to long medium to long grain destruction low low

- 26 042743

grain destruction low low Grains: Exit high high Grains % Oils moderately moderately Grains: % Erucic Acid absent absent Grains: % EPA C20:5p3 There is No Grains: % DPA C22:5p3 There is No Grains: % DHA C22:6p3 There is No

In another aspect, the invention relates to a method for obtaining a Brassica napus plant obtained from NS-B50027-4, or parts thereof, such as seeds, comprising crossing a B. napus plant or parts thereof, described above, comprising obtaining a Brassica plant, described above, and growing the plant under the growing conditions of the Brassica plant. In another aspect, the invention relates to a method for growing B. napus line NS-B50027-4, representative seeds of which have been deposited with ATCC accession number PTA-123186, subline NS-B50027-4, progeny NS-B50027-4, or subline, or plant obtained by crossing NS-B50027-4 with a second canola or Brassica plant, comprising obtaining the Brassica seeds described above and growing the plant under Brassica plant growing conditions. In another aspect, the invention relates to a method for producing a Brassica napus plant obtained from NS-B50027-4, or parts thereof, such as seeds, comprising crossing a Brassica napus plant or parts thereof.

Fatty acids LC-ω3.

In the canola plant line NS-B5OO27-4 of the present embodiments, LC-ωβ fatty acids can be commercially produced from canola seeds NS-B50027-4. Thus, techniques for breeding and propagating transformed plants yield many plants with advantageous traits of NS-B50027-4 that are harvested in a conventional manner and extract fatty acids from the tissue of interest, such as seeds.

As noted above, fatty acid content or fatty acid composition generally refers to the percentage by weight of the various fatty acids present in the endogenously formed oil of mature, whole, partially dried seeds (typically containing about 6 or 7% moisture), calculated as the percentage of the particular fatty acid. in the form of a normalized area; or in relation to a known standard; or as a weight ratio of fatty acid per gram of seed (eg, mg DHA/g seed).

In common industry practice, the composition of fatty acids is presented as a percentage of the area (normalized area), and not in absolute terms. For example, in chromatography, data is often obtained as peaks and the area under each peak is integrated and presented as a percentage of the total area under all fatty acid peaks in the chromatogram. The area percentage is easy to calculate and compare with results reported by others in the industry that also report area percentage. The area percentage is not absolute, but provides a reasonable approximation. Absolute results in mg/kg can be calculated, for example, by including reference standards of known concentration and an internal standard. Correction factors can also be used to calculate the mass amounts of fatty acids.

For example, when determining fatty acid content, seeds can be milled, oily triacylglycerides (TAG) extracted, followed by saponification and methylation with methanol and sodium methoxide, or by reaction with 1.25% 3-(trifluoromethyl)phenyltrimethylammonium hydroxide in methanol (Meth Prep II™, Fischer Scientific Cat #AT18007) to form fatty acid methyl esters. The resulting fatty acid methyl esters (FAME) can be analyzed by gas liquid chromatography (GLC) using a capillary column that separates FAME based on degree of unsaturation and fatty acid chain length. FAME can also be analyzed, for example, using GC, LC-MS, GC-MS, NMR or near-infrared reflectance spectroscopy. The fatty acid composition can also be determined from whole seeds, for example by breaking the seed coat and subjecting the broken seeds to direct methylation. The total lipid content can be separated by techniques known in the art to purify fractions such as the TAG fraction. For example, thin layer chromatography (TLC) can be performed on an analytical scale to separate TAG from other lipid fractions such as DAG, acyl-CoA or phospholipid to determine the composition of fatty acids, in particular TAG. A number of other analytical techniques known to those skilled in the art may be used. See, for example, Tinoco et al., 3, Anal. Biochem., 514 (1962); CANOLA: CHEMISTRY, PRODUCTION, PROCESSING & UTILIZATION (Daun et al., eds., AOCS Press, Urbana, IL, 2011) (Daun et al., 2011); US 2015/0166928; US 20160002566.

In a further embodiment of the invention, the extracted plant lipid may be treated to increase the DHA level as a percentage of total fatty acids. For example, processing includes the hydrolysis of esterified fatty acids to form free fatty acids.

- 27 042743 acids or interesterification. For example, canola oil can be processed to convert the fatty acids in the oil to alkyl esters such as methyl or ethyl esters, which can then be purified or fractionated to enrich the lipid or DHA oil. In embodiments of the invention, the lipid fatty acid composition after such treatment comprises at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% DHA.

The present embodiments of the invention also relate to the progeny and descendants of these new lines of B. napus from line NS-B50027-4. The progeny or descendants can be obtained by selection or tissue culture methods that are known to those skilled in the art. For example, the offspring or offspring may contain the canola fatty acid profile developed in these lines.

Accordingly, descendants or offspring can have any number of genes from the developed lines. The offspring or offspring may contain only those genes that provide the canola fatty acid phenotype provided herein, or additional genes. This can be determined by molecular analysis, as is known to those skilled in the art.

In one aspect, the invention relates to a method for obtaining Brassica napus seeds having the same phenotype as NS-B50027-4. For example, the DHA fatty acid content of NS-B50027-4 seeds is at least about 7%, at least about 8%, at least about 9%, at least about 10% DHA, at least about 11% DHA. , at least about 12%, at least about 13%, at least about 14%, at least about 15% or more DHA (% fatty acids). For example, the content of LC-PUFA fatty acids in NS-B50027-4 seeds is at least about 10% LC-PUFA, at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18% or more LC-PUFA (sum of EPA, DPA, DHA in % fatty acids).

In another aspect, the invention provides a homogeneous population of crushed Brassica napus seeds obtained from the plants described herein, wherein the crushed B. napus seeds have at least about 30%, at least about 35%, such as from about 36% to about 40% inclusive by weight of the total fatty acid content (wt.% seeds). In specific embodiments, for example, the fatty acid content of a homogeneous population of ground B. napus seeds comprises at least about 7% DHA, at least about 8% DHA, at least about 9% DHA, at least about 10% DHA, at least about 11% DHA, at least about 12% DHA, at least about 13% DHA, at least about 14% DHA, at least about 15% DHA or more DHA (% fatty acids). In specific embodiments, for example, the fatty acid content of a homogeneous population of ground B. napus seeds comprises at least about 8% LC-PUFA, at least about 9% LC-PUFA, at least about 10% LC-PUFA, at least about 11% LC-PUFA, at least about 12% LC-PUFA, at least about 13%, at least about 14% LC-PUFA, at least about 15% LC-PUFA, at least about 16%, at least about 17%, at least about 18% or more LC-PUFA (sum of EPA, DPA, DHA in % fatty acids). The invention also relates to oil and meal from such crushed seeds.

The invention also relates to a homogeneous population of crushed seeds of the line NS-B50027-4 or a homogeneous population of crushed seeds of B. napus from the progeny or descendant of NS-B50027-4, where the crushed seeds have a DHA content of at least about 7% DHA, at least about 8% DHA, at least about 9% DHA, at least about 10% DHA, at least about 11% DHA, at least about 12% DHA, at least about 13% DHA, at least about 14% DHA, at least about 15% DHA or more DHA (% fatty acids). For example, a homogeneous population of crushed seeds of Brassica napus NS-B50027-4 or a homogeneous population of crushed seeds of B. napus from the progeny or progeny of NS-850027-4, where the homogeneous population of crushed seeds contains at least about 8% LC-PUFA, at least about 9% LC-PUFA, at least about 10% LC-PUFA, at least about 11% LC-PUFA, at least about 12% LC-PUFA, at least about 13%, at least about 14% LC-PUFA, at least about 15% LC-PUFA, at least about 16%, at least about 17%, at least about 18% or more LC-PUFA (sum of EPA, DPA, DHA as % fatty acids). The invention also relates to oil and meal from such crushed seeds.

In another aspect described herein, the invention relates to a process for producing oil or meal from the line Brassica napus NS-B50027-4, representative seeds of which have been deposited under ATCC accession number PTA-123186, subline NS-B50027-4, progeny NS- B50027-4 or a subline or plant obtained by crossing NS-B50027-4 with a second canola or Brassica plant, comprising growing the plant described above under Brassica plant growing conditions; seed collection; and extraction of oil or meal.

In another aspect described herein, a method is described for obtaining oil from the NS-B50027-4 Brassica napus line, representative seeds of which have been deposited under Accession No.

- 28 042743

ATCC PTA-123186, subline NS-B50027-4, progeny of NS-B50027-4 or subline, or a plant obtained by crossing NS-B50027-4 with a second Brassica plant, involving seed crushing of the line NS-850027-4, the representative seeds of which were deposited under ATCC accession number PTA-123186, subline NS-B50027-4, progeny NS-B50027-4 or subline, or a plant obtained by crossing NS-B50027-4 with a second canola or Brassica plant; and extracting oil from said seeds.

In another aspect, the invention relates to meal and protein and oil from the seed of NS-B50027-4 or seed obtained from the progeny of NS-B50027-4. Extraction of protein from plant biomass can be carried out by known methods. See, for example, Nepeu & Orr, 114 Anal. Biochem. 92 (1981). Meal from NS-B50027-4 may be particularly preferred as it contains at least some DHA and other ω3 fatty acids. Similarly, the protein fraction from NS-B5OO27-4 contains at least some beneficial DHA and other ω3 fatty acids.

Despite having a lower oleic acid content than oils claimed to have resistance to DHA and other LC-PUFAs due to its high oleic acid content, NS-B50027-4 seed LC-PUFA oil ω3 fatty acids exhibits unexpected stability . More specifically, LC-PUFA ω3 fatty acids are notoriously unstable and are particularly prone to oxidation. It will be understood by those skilled in the art that encapsulation, blending with other oils, in particular high oleic acid oils, or the addition of antioxidants are necessary to extend the shelf life of LC-PUFA and food products containing LC-PUFA. However, despite the lack of such processing, some evidence suggests that the crude oil extracted from the crushed seed of NS-B50027-4 retains freshness for several months at room temperature.

In another aspect, the present embodiments of the invention relate to a source of DHA and LC-PUFA for use in nutritional supplements and foods for humans and non-human animals. In particular, NS-B50027-4 seed oil provides a sustainable source of DHA and LC-PUFA for aquaculture applications. Due to the high global demand for fish and the resulting overfishing at sea, marine and freshwater aquaculture is becoming increasingly important. Betancor et al., 4, Sci. Rep., 8104 (2014). For example, the farming and consumption of salmon fish has increased dramatically over the past 20 years. However, the diet of wild fish is very different from that of those species in aquaculture. In fact, aquaculture is still heavily dependent on marine fisheries to provide key nutrients such as fishmeal and fish oil. Indeed, fishmeal and fish oil are the main sources of ω3-LC PUFA in aquaculture. Since fish oil contains the limiting factor for the rapidly growing aquaculture industry (5 to 10% per year), aquaculture diets contain a wide range of alternative plant ingredients such as legume seeds, oilseed meal, leaf meal and increased portions of vegetable oil. The replacement of fish oils with traditionally low LC-PUFA vegetable oils means that less LC-PUFA is available in the fish diet, although some oils, such as linseed oil, contain some ALA which can be converted, albeit only to a limited extent, into LC metabolites in fish. In general, existing vegetable oils in fish feeds can have a detrimental effect on the distribution of FA in fish and can alter the ω3/ω6 ratio.

For example, typical vegetable oils contain large amounts of ω6 PUFA, mainly in the form of linoleic acid (C18:2 ω6; LA). The oil from the parent line AV Jade does not contain DHA, therefore there is no DHA:LA ratio; oil from NS-850027-4 has a DHA:LA ratio of 1.048; compared to farmed salmon oil having a DHA:LA ratio of 0.908. Strobel et al., 11, Lipids Health Dis., 144 (2012). Interestingly, the ω3 FA ratios from NS-850027-4 are particularly beneficial for palmitic acid, a saturated fatty acid associated with cardiovascular disease and dyslipidemia. Diet, Nutrition & Prevention of Chronic Dis., WHO Tech. Rep. Series, 916, Report of a Joint WHO/FAO Expert Consultation, 88 (World Health Organization, Geneva, 2003). The oil from the AV Jade parent line does not have DHA and therefore does not have a DHA:palmitate relationship; the oil from NS-B50027-4 has a DHA:palmitate ratio of 2.122; in comparison, farmed salmon oil has a DHA:palmitate ratio of 0.591; and wild salmon oil has a DHA:palmitate ratio of 1.018. Strobel et al., 2012. The preparation of aquafeeds comprising LC-PUFA is known in the art. See Betancor et al., 2014; Petrie et al., 9 PLOS ONE, 1, 2014; Tocher, Aquaculture (2015). Therefore, the scope of the present embodiments covers the use of oil from NS B50027-4 as a source of ω3 fatty acids for aquaculture feed and aquaculture feed containing oil derived from NS-B50027 and its offspring.

Identification of NS-B50027-4 and its progeny.

An elite genetic event can be characterized by the location(s) and configuration at the site(s) of incorporation of the recombinant DNA molecule(s) into the plant genome. Site in the genome

- 29 042743 ion into which the recombinant DNA cassette has been inserted is also called the insertion site or the target site. A flanking region or flanking sequence is a region of DNA, e.g., at least 20 base pairs, at least 50 base pairs, or up to 5000 base pairs, of the plant genome both immediately upstream and adjacent to or immediately downstream and adjacent to the transgenic cassette. Transformation that results in random integration of foreign DNA results in transformants with distinct flanking regions that are characteristic and unique to each transformant (elite event).

In another aspect, the invention relates to a method for producing a Brassica napus plant derived from NS-B50027-4, or parts thereof, comprising crossing the Brassica napus plant, or parts thereof, described above with a second plant to produce first generation progeny;

growing said first generation progeny to produce an F1 generation plant;

optionally repeating the steps of crossing and growing to obtain successive daughter generations of the specified seed to obtain a line of propagation of seeds, plants or parts thereof, derived from NS-B5OO27-4 Brassica napus.

The plant or plant parts (including any hybrid) produced by this method are also the subject of the invention. In one embodiment of the invention, a genetic trait that has been inserted into the genome of a particular canola plant can be transferred to the genome of another cultivar using conventional breeding techniques that are well known in the field of plant breeding. For example, a backcrossing approach can be used to move a transgene from a transformed canola cultivar into an already developed canola cultivar and the resulting backcrossed plant will contain the transgene(s).

Accordingly, in another aspect, the present embodiments of the invention relate to compositions, methods, and kits for detecting NS-B50027-4. It would be useful to be able to detect the presence of a particular event in order to determine if the progeny of a sexual cross contains a transgene of interest. In addition, a method for detecting a particular event would be useful for complying with regulations requiring, for example, premarket approval and labeling of foods derived from recombinant crops. The presence of a transgene can be detected by any known nucleic acid detection method such as polymerase chain reaction (PCR) or DNA hybridization using nucleic acid probes. These detection methods typically focus on frequently used genetic elements such as promoters, terminators, marker genes, and so on. As a result, such methods may not be useful in distinguishing between different events, especially those produced using the same DNA construct, unless the chromosomal DNA sequence adjacent to the inserted DNA (flanking DNA) is known. Event-specific PCR assays have been described. See, for example, Windels et al. (Med. Fac. Landbouww, Univ. Gent, 64/5b: 459-462, 1999 (Identification of a soybean glyphosate tolerant event by PCR using a primer set spanning the boundary between insert and flanking DNA, specifically one primer , which included the sequence from the insert, and a second primer, which included the sequence from the flanking DNA). in hypersensitivity response mediated signaling located on chromosome A05 Although no phenotypic changes were observed, this invention provides another marker to identify NS-B5OO27-4 or progeny derived from NS-B50027-4.

The methods and kits herein are useful for identifying the presence in biological samples of plant material, including in particular the transgenes in NS-B50027-4, as well as transgenic canola plants, plant materials and seeds containing such an event. The NS-B5OO27-4 elite event described herein can be identified by genotype, which can be characterized by a genetic marker profile that can identify plants of the same cultivar or a related cultivar, or be used to determine or confirm pedigree. Genetic marker profiles can be generated by techniques such as restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), random primer polymerase chain reaction (AP-PCR), DNA amplification fingerprinting (DAF), amplified regions with sequence characterization (SCAR), amplified fragment length polymorphisms (AFLP), simple sequence repeats (SSRs), which are also called microsatellites, and single nucleotide polymorphisms (SNPs).

For example, the elite event NS-B50027-4 described herein can be identified by generating a genetic map from a sample of plant material. A genetic map can be generated by conventional RFLP, polymerase chain reaction (PCR) analysis or SSR, which identifies the approximate chromosomal position of an integrated DNA molecule encoding a foreign protein. See Glick & Thompson, METHODS IN PLANT MOLEC. BIOL. & bio

- 30 042743

TECHNOL. 269 (CRC Press, Boca Raton, FL, 1993). Information on the map regarding the arrangement of chromosomes is useful for patent protection of the transgenic plant in question. For example, a map of an area of integration can be compared with similar maps for suspect plants to determine if the latter share a common origin with the plant in question. Map comparisons may include hybridization, RFLP, PCR, SSR, and sequencing, which are all conventional techniques.

In another aspect, the present embodiments of the invention relate to kits and methods for determining whether a canola plant is, or if it belongs to the inbred line NS-B50027-4, or is a canola plant that contains at least a portion of the genetic elite event of the line NS-B50027 -4. This document describes compositions and methods for simple and unambiguous methods for identifying the NS-B50027-4 elite event in biological samples.

For example, the kit may include at least one primer set for identifying one or more NS-B50027-4 genetic markers, such as a set of sense (forward) and antisense (reverse) primers. See table. 2. Specific primer embodiments include the following primers used in KASP assay kits to detect genetic traits of NS-B50027-4, particularly useful for introgression and hybrid development studies. See Example 2. These primers may consist of a nucleic acid molecule containing at least ten consecutive nucleic acids of the following sequence:

GAAGGTGACCAAGTTCATGCTCCAAGCACCGTAGTAAGAGAGCA (SEQ ID NO:1, Micopu-A6D); GCTAAGAAGTGGGGACTCAACTACAA (SEQ ID NO:2, Micopu-A6D); GAAGGTGACCAAGTTCATGCTGCTCTTGCTGGAACTCTTGG (SEQ ID NO:3, PyrcoΔ5Ε); GGGTTAGCCACATTGTAGGTAACGTA (SEQ ID NO:4, Rugco-L5E); GAAGGTGACCAAGTTCATGCTTAAGAGACACCCTGGTGGAAAGA (SEQ ID NO:5, Pavsa-A5D); TAGCATCAGTTCCAACTTGGTAAGCAAT (SEQ ID NO:6, Pavsa-A5D); GAAGGTGACCAAGTTCATGCTGAACACGTAAGCAGACCAAGCAG (SEQ ID NO:7, Picpa-ro3D); CCCCTTCTCCCTAACGAATTCCTT (SEQ ID NO:8, Picpa-ro3D);

GAAGGTGACCAAGTTCATGCTGAGGAACCTGTTGCTGCTGATGA (SEQ ID NO:9, Pavsa-A4D); GCGATCCTAGCACAAAGTTGAAGGTA (SEQ ID NO: 10, Pavsa-A4D); GAAGGTGACCAAGTTCATGCTGGATGGATCGCTTACCTCTTCGT (SEQ ID NO: 11, Lackl-A12D); CAGGGTAAGGTTGTCCTGTAACGTT (SEQ ID NO: 12, Lackl-A12D); GAAGGTGACCAAGTTCATGCCTTATTGGATGGGGACTCAAGC (SEQ ID NO: 13, PyrcoΔ6Ε); GGGAGATTCCTTAGTAGCAGAAGAGAT (SEQ ID NO: 14, Rugso-LbE); GAAGGTGACCAAGTTCATGCTCCTGAGAGGCGTCCTGTTGAAAT (SEQ ID NO: 15, PAT); AACAGCAGCCATATCAGCAGCAGTA (SEQ ID NO: 16, PAT); GAAGGTGACCAAGTTCATGCTTGTTCTTGGGTGGGTCTGTCCTTC (SEQ ID NO: 17;

A05 Insertion boundary 1);

GAAGGTCGGAGTCAACGGATTGTGTTCTTGGGTGGGTCTGTCCTTA (SEQ ID NO: 18, A05 Insertion Boundary 1); ATCCACTAGCAGATTGTCGTTTCCC (SEQ ID NO: 19, A05 Insertion Boundary 1); GTTGGCTAAGGTCACGGTGGAG (SEQ ID NO:20, A05 Insertion Boundary 1);

GAAGGTGACCAAGTTCATGCTCCGCCTTCAGTTTAAACTATCAGTGTT (SEQ ID NO:21, A05 Insertion Boundary1);

GAAGGTCGGAGTCAACGGATTGGTCACGGTGGAGGTCACCA (SEQ ID NO:22, A05 Insertion boundary 1), GGTGTGTTCTTGGGTGGGTCTG (SEQ ID NO:23, A05 Insertion boundary1);

GAAGGTGACCAAGTTCATGCTACTTTTTTTTCAACTGTTGGCTAAGGTA (SEQ ID NO:24, A05 Insertion Boundary2);

GAAGGTCGGAGTCAACGGATTACTTTTTTTTCAACTGTTGGCTAAGGTC (SEQ ID NO:25, A05 Insertion boundary 2), GTGTGTTCTTGGGTGGGTCTG (SEQ ID NO:26, A05 Insertion boundary 2); GTCGTTTCCCGCCTTCAGTTT (SEQ ID NO:27, A05 Insertion Boundary 2);

- 31 042743

GAAGGTGACCAAGTTCATGCTAAACTATCAGTGTTTTGAACACCCCC (SEQ ID NO:28,

A02 Insertion boundary1);

GAAGGTCGGAGTCAACGGATTACAACTTGTCGTGCTACACACCT (SEQ ID NO:29,

A02 Insertion boundary 1); GGTTGTGTGAAAACGTGTGGC (SEQ ID NO:30, A02

Insertion boundary1);

GAAGGTGACCAAGTTCATGCTCTTTTAGCTAAATAAGAGGTTCTGTATACT (SEQ ID

NO:31, A02 Insertion boundary2);

GAAGGTCGGAGTCAACGGATTTCTTTTAGCTAAATAAGAGGTTCTGTATACA (SEQ ID

NO:32, A02 Insertion boundary 2); GATTGTGATTCCGGGCAGT (SEQ ID NO:33, A02

insertion boundary 2); GTGTGAAAACGTGTGAGCAAT (SEQ ID NO:34, A02

insertion boundary 2); GAAGGTGACCAAGTTCATGCTTTGTGATTCCGGGCAGTAG (SEQ ID NO:35, A02 Insertion Boundary 2),

GAAGGTCGGAGTCAACGGATTTGTGAGCAATTGTTGGAGGT (SEQ ID NO:36, A02 Insertion Boundary 2); TCTTATCAACATTAAGAACATAATCTTTTAG (SEQ ID NO:37, A02 Insertion Boundary 2); or their complements.

The present invention also provides methods for identifying a canola plant elite event NS-B50027-4 comprising (a) forming a mixture comprising a biological sample containing canola plant DNA and a first and second nucleic acid primer capable of amplifying a specific nucleic acid molecule with an NS- B50027-4;

(b) reacting the mixture under conditions that allow the first and second nucleic acid primers to amplify a specific nucleic acid molecule with an NS-B50027-4 event; and (c) detecting the presence of an amplified fragment of a nucleic acid molecule, wherein the presence of a specific nucleic acid molecule with canola elite event NS-B50027-4 indicates that the canola plant is a canola plant with NS-B50027-4.

In another embodiment, the invention relates to methods for detecting a nucleic acid molecule with the NS-B50027-4 elite event in a biological sample, comprising (a) forming a mixture containing a biological sample containing DNA and a nucleic acid probe capable of hybridizing to a specific nucleic acid molecule with event NS-B50027-4;

(b) reacting the mixture under conditions that allow the probe to hybridize to a specific nucleic acid molecule with an NS-B50027-4 event; and (c) detecting the presence of a hybridized nucleic acid molecule, where the presence of a specific nucleic acid molecule with an NS-B50027-4 event indicates that the sample contains a nucleic acid molecule with an NS-B50027-4 event.

Another embodiment of the invention relates to methods for detecting the presence of a specific nucleic acid molecule with an NS-B50027-4 event in a biological sample, comprising (a) forming a mixture containing a biological sample containing DNA and a first primer capable of renaturating the insertion region into the nucleic acid molecule events NS-B50027-4, and a second primer capable of renaturating a flanking nucleic acid molecule in the genome of a host cell;

(b) reacting the mixture under conditions that allow the first and second nucleic acid primers to produce an amplified nucleic acid molecule containing an insertion fragment of the NS-B50027-4 event of the nucleic acid molecule; and (c) detecting the presence of the amplified nucleic acid molecule, wherein the presence of the nucleic acid molecule with the NS-B50027-4 event insert indicates that the sample contains DNA with the NS-B50027-4 event insert.

Proper testing should reveal any serious errors and establish the degree of superiority or improvement over existing cultivars. In addition to high productivity, the demand must be for a new cultivar compatible with industrial industry standards or creating a new market. The introduction of a new cultivar will incur additional costs for the seed producer, grower, processor and consumer for special advertising and marketing, seed production change practices and commercial production, and use of the new product. Testing prior to the release of a new cultivar should take into account the costs of research and development, as well as the technical superiority of the final cultivar. It should be possible for seed-propagated cultivars to produce seeds easily and economically.

- 32 042743

For example, the kit may contain at least one set of sense (forward) primers and antisense (reverse) primers specific for A6 desaturase derived from the microalgae Micromonas pusilla, A5 elongase derived from the microalgae Pyramimonas cordata, A5 desaturase derived from marine microalgae Pavlova salina, A15/m3 desaturase derived from the yeast Pichia pastoris, A4 desaturase derived from Pavlova salina, or A12 desaturase derived from the yeast Lachancea kluyveri (see, for example, Table 2); and at least one set of primers specific for the 5' boundary between the insert and native Brassica chromosome A02 DNA, such as the nucleotide boundary 2033 to 2132 of SEQ ID NO: 40, a 100 bp region containing 43 bp. inserts and 57 p. Brassica A02 chromosome DNA, or at least one set of primers specific for the 3' boundary between the insert and native Brassica chromosome A02 DNA, such as the nucleotide boundary 14156 to 14255 of SEQ ID NO: 40, 100 bp region containing 46 By. inserts and 54 p. Brassica A02 chromosome DNA; at least one set of primers specific for the 5' boundary between the insert and native DNA of chromosome A05 Brassica, such as the boundary of nucleotides 1110 to 1209 of SEQ ID NO: 41, a 100 bp region comprising 50 bp inserts and 50 p. Brassica A05 chromosome DNA, or at least one set of primers specific for the 3' boundary between the insert and native Brassica chromosome A05 DNA, such as the 47724 to 47823 nucleotide boundary of SEQ ID NO: 41, a 100 bp region comprising 50 By. inserts and 50 p. DNA chromosome A05 Brassica.

Amplification conditions for methods that use DNA primers to generate amplicon diagnostics for the NS-B5OO27-4 event are known to those skilled in the art. In addition, a pair of control primers for amplifying the endogenous canola gene is included as an internal standard for reaction conditions and produces an amplicon of approximately 100-5000 nucleotides. Analysis of the NS-B50027-4 event plant tissue sample should include a positive tissue control from the NS-B50027-4 event, a negative canola plant control that is not an NS-B50027-4 event, and a negative control that does not contain the canola DNA template. Additional primers may be selected from the boundaries shown in SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, and SEQ ID NO: 50 by those skilled in the art of DNA amplification techniques, as well as conditions optimized for amplicon production, which can be anything that will result in an amplicon diagnosis for NS-B5OO27-4. The use of these DNA primer sequences with modifications is within the scope of the embodiments of the invention described herein. Amplicon generated using at least one primer sequence derived from SEQ ID NO: 47 or at least one primer sequence derived from SEQ ID NO: 48 or at least one primer sequence derived from SEQ ID NO: 49, or at least one primer sequence derived from SEQ ID NO: 50, which, when used in a PCR method, results in an amplicon diagnosis for the NS B50027-4 event, can be used in the described methods and is an aspect of the present embodiments of the invention. Obtaining an amplicon of the NS-B50027-4 event can be carried out using a thermal cycler or by methods and devices known to those skilled in the art.

The present invention also provides methods for identifying a canola plant elite event NS-B50027-4 comprising (a) forming a mixture comprising a biological sample containing canola plant DNA and a first and second nucleic acid primer capable of amplifying a specific nucleic acid molecule with an NS- B50027-4;

(b) reacting the mixture under conditions that allow the first and second nucleic acid primers to amplify a specific nucleic acid molecule with an NS-B50027-4 event; and (c) detecting the presence of an amplified fragment of a nucleic acid molecule, wherein the presence of a specific nucleic acid molecule with canola elite event NS-B50027-4 indicates that the canola plant is a canola plant with NS-B50027-4.

In another embodiment, the invention relates to methods for detecting a nucleic acid molecule with the NS-B50027-4 elite event in a biological sample, comprising (a) forming a mixture containing a biological sample containing DNA and a nucleic acid probe capable of hybridizing to a specific nucleic acid molecule with event NS-B50027-4;

(b) reacting the mixture under conditions that allow the probe to hybridize to a specific nucleic acid molecule with an NS-B50027-4 event; and (c) detecting the presence of a hybridized nucleic acid molecule, where the presence of a specific nucleic acid molecule with an NS-B50027-4 event indicates that the sample contains a nucleic acid molecule with an NS-B50027-4 event.

Another embodiment of the invention relates to methods for detecting the presence of a specific nucleic acid molecule with an NS-B50027-4 event in a biological sample, comprising (a) forming a mixture containing a biological sample containing DNA and a first primer,

- 33 042743 capable of renaturing the insertion region of the NS-B50027-4 event of the nucleic acid molecule, and a second primer capable of renaturing the flanking nucleic acid molecule in the genome of the host cell;

(b) reacting the mixture under conditions that allow the first and second nucleic acid primers to produce an amplified nucleic acid molecule containing an insertion fragment of the NS-B50027-4 event of the nucleic acid molecule; and (c) detecting the presence of the amplified nucleic acid molecule, wherein the presence of the nucleic acid molecule with the NS-B50027-4 event insert indicates that the sample contains the DNA insert with the NS-B50027-4 event.

Offspring.

The NS-B50027-4 line described in this document can also be used to breed other lines. For example, starting materials can be self-pollinated, cross-crossed, back-crossed, used to produce double haploids, used as starting materials for genetic transformation, genetically transformed, further mutagenized, and used for other forms of breeding known to those skilled in the art. Methods and results of using the starting material for breeding other lines are also within the scope of these embodiments of the invention.

With the advent of molecular biology techniques that have made it possible to isolate and characterize genes encoding specific protein products, plant biologists have shown great interest in engineering the plant genome for the maintenance and expression of foreign genes, or additional or modified versions of native or endogenous genes (possibly driven by different promoters) in order to change the traits of the plant in a certain way. Any DNA sequences, whether from different species or from the same species, which are introduced into the genome using transformation or various propagation methods, are collectively referred to herein as transgenes. Over the past 15-20 years, several methods have been developed for obtaining transgenic plants, and the present invention, in particular embodiments of the invention, also relates to transformed variants of the claimed line.

Nucleic acids, oligonucleotides or polynucleotides refer to RNA or DNA molecules that are linear or branched, single or double stranded, or hybrids thereof, including RNA/DNA hybrids. The terms also cover 3' UTR and 5' UTR, typically at least about 1000 nucleotides of sequence upstream from the 5' end of the coding region and at least about 200 nucleotides of sequence downstream from the 3' end of the coding region of the gene. Less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others can also be used to pair antisense, dsRNA and ribozymes. For example, polynucleotides that contain the C-5 propyne analogs of uridine and cytidine have been shown to bind RNA with high affinity and are potent antisense inhibitors of gene expression. Other modifications can also be made, such as modification of the phosphodiester backbone or 2'-hydroxy in the ribose-sugar group of the RNA. Antisense polynucleotides and ribozymes may consist solely of ribonucleotides or may contain mixed ribonucleotides and deoxyribonucleotides. The polynucleotides of the invention can be prepared by any means, including genomic preparations, cDNA preparations, in vitro synthesis, RT-PCR, and in vitro or in vivo transcription.

Plant transformation involves constructing an expression vector that will function in plant cells. Such a vector contains DNA containing a gene that is under the control of or operably linked to a regulatory element (eg, a promoter). The expression vector may contain one or more of these operably linked gene/regulatory element combinations. The vector(s) may be in the form of a plasmid and may be used alone or in combination with other plasmids to produce transformed canola plants using transformation methods known in the art to incorporate transgenes into the genetic material of the canola plant(s), including canola plants with NS-850027-4.

A genetic trait that has been introduced into a particular canola plant using transformation techniques can be transferred to another line using conventional breeding techniques well known in the field of plant breeding. For example, plants bearing the elite event NS-B50027-4 can, for example, be obtained from seeds deposited with the ATCC. Such plants can be further propagated or used in a conventional breeding scheme to introduce the elite event NS-B50027-4 to other cultivars of the same plant species. The deposited seeds belong to the species Brassica napus. However, methods for introducing alleles or transgenes located on the A or C genome from B. napus to B. juncea are well known in the art and include backcrossing. A backcrossing approach can be used to move a transgene from a transformed canola plant into an elite inbred line and the resulting progeny includes the transgene. In addition, if an inbred line is used for transformation, then the transgenic plants can be crossed with another line to produce a transgenic hybrid canola plant. Is

- 34 042743 as used herein, the term crossing may refer to a simple crossing of X with Y, or a backcrossing process, depending on the context.

Various genetic elements can be further introduced into the plant genome using transformation. These elements include, but are not limited to, genes; coding sequences; inducible, constitutive and tissue-specific promoters; enhancer sequences; and signaling and targeting sequences. The advent of new molecular biological techniques has made it possible to isolate and characterize genetic elements with specific functions, such as encoding specific protein products. Scientists in the field of plant biology have shown great interest in engineering the plant genome for the maintenance and expression of foreign genetic elements, or additional or modified versions of native or endogenous genetic elements to change plant traits in a specific way. Any DNA molecules, whether from a different species or from the same species, inserted into the genome using transformation, are collectively referred to herein as transgenes. The transformation process is the insertion of DNA into the genome. Several methods have been developed for producing transgenic plants, and the present invention, in specific embodiments, also relates to transformed variants of the claimed canola line NS-B50027-4.

Numerous methods for plant transformation have been developed, including biological and physical protocols for plant transformation. In addition, expression vectors and in vitro culture methods are available for transforming plant cells or tissues and regenerating plants. See, for example, Miki et al., Procedures for introducing foreign DNA into plants, in METH. PLANT MOLEC. BIOL. & BIOTECHNOL., 63 (Glick & Thompson, eds., CRC Press, Boca Raton, 1993); Gruber et al., Vectors for plant transformation, id., R 89; Genetic transformation for the improvement of Canola, PROC. WORLD CONF. BIOTECHNOL. FATS & OILS INDUS, 43-46 (Am. Oil. Chem. Soc, Champaign, IL, 1988).

The most common types of plant transformation involve the construction of an expression vector. Such a vector contains a DNA molecule that contains a coding region under the control of or operably linked to a regulatory region, such as a promoter. The expression vector may contain one or more genes and one or more regulatory elements. At least one of the coding regions and their respective control elements may be located in opposite orientations within the vector, providing a binary vector. Theoretically, the arrangement of genes susceptible to gene shutdown in binary form can minimize gene shutdown. The vector(s) may be in the form of a plasmid and may be used alone or in combination with other plasmids to produce transformed canola plants using transformation methods known in the art to incorporate the transgenes into the genetic material of the plant NS-B50027 -4 or a plant derived from NS-B50027-4.

For example, the original transformation cassette, pJP3416_GA7-modB, included seven genes capable of stimulating the accumulation of omega-3 fatty acids in canola seeds and one selectable marker gene to facilitate in vitro selection of putative transgenic plants. See WO2013185184; US Patent Publication No. 2015/0374654; Petrie et al., 6, Plant Meth., 8 (2010). All expressed genes are synthetic (codon-optimized and synthesized); therefore, transgenic DNA molecules are not found in any natural organism. Initial sequences have been described and used as templates for codon optimization. See Petrie et al., 12 Metab. Eng'g, 233 (2010a); Petrie et al., 11, Plant Methods, 6 (2010b); Petrie et al., 21, Transgenic Res., 139 (2012).

As is well known in the art, functional gene promoters are regions of DNA that are important for gene transcription but do not code for functional products such as peptides. For example, a common promoter for constitutive expression is derived from the cauliflower mosaic virus. Kay et al., 236 Sci., 1299 (1987); Coutu et al., 16, Transgenic Res., 771 (2007). Developmentally controlled promoters include promoters that preferentially initiate transcription in certain tissues such as seeds, leaves, roots, fibers, xylem vessels, tracheids, or sclerenchyma. Promoters of particular importance are seed-preferred promoters that initiate transcription predominantly or only in the seed. Seed-preferred promoters include both seed-specific promoters (such promoters act during seed development, such as protein storage promoters in seeds) and seed germination promoters (such promoters act during seed germination). See Thompson et al., 10, BioEssays, 108 (1989). Such seed-preferred promoters include, but are not limited to, Cim1 (cytokinin-induced message); cZ19Bl (19 kDa maize zein); milps (myo-inositol-1-phosphate synthase) (See WO 2000/11177; and US Pat. No. 6,225,529). For dicots, seed-specific promoters include, but are not limited to, β-phaseolin, napin, β-conglycinin, soy lectin, cruciferin, conlinin, and the like. Seed-specific promoters used in GA7-modB have been described previously: A. thaliana FAE1 (Rossack et al., 46, Plant Molec. Biol., 717 (2001)); L. usitatissimum Cnl1 and Cnl2 (Chaudhary et al., WO 2001016340); and truncated napin promoter

- 35 042743

B. napus (Stalberg et al., 23, Plant Molec. Biol., 671 (1993)). See also WO 2013185184.

An inducible promoter is a promoter that is under environmental control. Examples of environmental conditions that can affect inducible promoters include chemical control (induced in the presence of certain chemicals), anaerobic conditions, or the presence of light. Tissue-specific, tissue-preferred (eg, seed-specific) and inducible promoters comprise a class of unconstitutional promoters. See Ward et al., 22, Plant Mol. Biol., 361 (1993); Meft et al., 90, PNAS, 4567 (1993) (copper induced); Gatz et al., 243, Mol. Gen. Genet., 32 (1994) (induced by herbicide antidotes); Gatz et al., 227, Mol. Gen. Genet., 229 (1991) (tetracycline induced); Schena et al., 88, PNAS, 10421 (1991) (glucocorticosteroid-induced). See also WO 2001016340 and the promoters discussed therein.

A constitutive promoter is a promoter that is active under most environmental conditions. Typical constitutive promoters include promoters from plant viruses such as the 35S promoter from Cauliflower Mosaic Virus (CMV) (Odell et al., 313 Nature 810 (1985)), and promoters from genes such as rice actin (McElroy et al., 2, Plant Cell, 163 (1990)); ubiquitin (Christensen et al., 12, Plant Mol. Biol., 619 (1989); Christensen et al., 18, Plant Mol. Biol., 6759 (1992)); pEMU (Last et al., 81, Theor. Appl. Genet., 581 (1991)); MAS (Velten et al., 3, EMBO J., 2723 (1984)) and maize histone H3 (Lepetit et al., 231, Mol. Gen. Genet., 276 (1992); Atanassova et al., 2, Plant J., 291 (1992)). The ALS promoter, the 5' Xbal/Ncol fragment of the Brassica napus ALS3 structural gene (or a nucleotide sequence similar to said Xbal/Ncol fragment), provides another constitutive promoter. See also WO 1996/30530 and the promoters discussed therein. The CMV promoter is also associated with a suitable enhancer region. See WO 1996/30530 and WO 2013185184 and promoters discussed therein.

Terminator regions, which include polyadenylation signals, are required for the production of complete and stable mRNA molecules. For example, the A. tumefaciens nopaline synthase (NOS) terminator provides the desired terminator. Bevan, 12, Nucl. Acid Res. 8711 (1984); Rogers et al., BIOTECHNOL. PLANT SCI., 219 (Acad. Press, Inc., New York, NY, 1985); Sanders et al., 15, Nucl. Acids Res., 1543 (1987). A number of regulatory sequences were used in combination to start and terminate transcription of various expression cassettes.

Transport of a protein produced by transgenes into a subcellular compartment such as a chloroplast, vacuole, peroxisome, glyoxisome, cell wall, or mitochondrion, or for secretion into the apoplast, is accomplished by operably linking the nucleotide sequence encoding the signal sequence to the 5' or 3' region of the gene, encoding the protein of interest. Targeting sequences at the 5' or 3' end of a structural gene can be determined during protein synthesis and processing, where the encoded protein is ultimately compartmentalized.

The presence of a signal sequence directs the polypeptide either to an intracellular organelle, or to a subcellular compartment, or to be secreted into the apoplast. Many signal sequences are known in the art. See, for example, Becker et al., 20, Plant Mol. Biol., 49 (1992); Knox et al., 9, Plant Mol. Biol., 3 (1987); Lerner et al., 91, Plant Physiol., 124 (1989); Fontes et al., 3, Plant Cell, 483 (1991); Matsuoka et al., 88, PNAS, 834 (1991); Creissen et al., 2, Plant J., 129 (1991); Kalderon et al., 39, Cell, 499 (1984); Steifel et al., 2, Plant Cell, 785 (1990).

Expression vectors typically contain at least one genetic marker operably linked to a regulatory element (eg, a promoter) that allows transformed cells containing the marker to either be regenerated by negative selection, i. inhibit the growth of cells that do not contain a selectable marker gene, either by positive selection, i.e. screening for a product encoded by a genetic marker. Many commonly used selectable marker genes for plant transformation are well known in the transformation art and include, for example, genes that encode enzymes that metabolically detoxify a selective chemical agent, which may be an antibiotic or herbicide, or genes that encode an altered target that is insensitive to the inhibitor. Positive selection methods are also known in the art.

One commonly used selectable marker gene for plant transformation is the neomycin phosphotransferase II (nptII) gene, isolated from the Tn5 transposon, which, when placed under the control of plant regulatory signals, confers resistance to kanamycin. Fraley et al., 80, PNAS, 4803 (1983). Another commonly used selectable marker gene is the hygromycin phosphotransferase gene, which confers resistance to the antibiotic hygromycin. Vanden Elzen et al., 5, Plant Mol. Biol., 299 (1985). Additional selectable marker genes of bacterial origin that confer antibiotic resistance include gentamicin acetyltransferase, streptomycin phosphotransferase, aminoglycoside 3'-adenyltransferase, a bleomycin resistance determinant. Hayford et al., 86, Plant Physiol., 1216 (1988); Jones et al., 210, Mol. Gen. Genet., 86 (1987); Svab et al., 14, Plant Mol. Biol., 197 (1990); Hille et al., 7, Plant Mol. Biol., 171 (1986). Other selectable marker genes confer resistance to herbicides such as glyphosate, glufosinate, or bromoxynil. Comai et al., 317, Nature, 741 (1985); Gordon-Kamm et al., 2, Plant Cell, 603 (1990); Stalker et al., 242, Sci., 419 (1988). Selectable marker genes for the transformation of plants that do not have a bacterial

- 36 042743 origin include, for example, mouse dihydrofolate reductase, plant 5-enolpyruvylshikimate-3-phosphate synthase, and plant acetolactate synthase. Eichholtz et al., 13, Somatic Cell Mol. Genet., 67 (1987); Shah et al., 233, Sci., 478 (1986); Charest et al., 8, Plant Cell Rep., 643 (1990).

Another class of marker genes for plant transformation requires screening of putatively transformed plant cells rather than direct genetic selection of transformed cells for resistance to a toxic agent such as an antibiotic. These genes are particularly useful for quantifying or visualizing the spatial pattern of gene expression in specific tissues, and are often referred to as reporter genes because they can be fused to a gene or gene regulatory sequence to study gene expression. Commonly used genes for screening putatively transformed cells include α-glucuronidase (GUS), α-galactosidase, luciferase and chloramphenicol acetyltransferase. Jefferson, R.A., Plant. Mol. Biol., 5: 387 (1987); Teeri et al., EMBO J. 8:343 (1989); Koncz et al., PNAS, 84: 131 (1987); and DeBlock et al., EMBO J. 3:1681 (1984). Some in vivo methods for imaging GUS activity do not require disruption of plant tissues. Molecular Probes, Publication, 2908, IMAGENE GREEN, 1-4 (1993); Naleway et al, 115, J. Cell Biol., 151a (1991). However, methods for in vivo imaging of GUS activity had problems: they showed low sensitivity, high fluorescent background, and limitations associated with the use of luciferase genes as selectable markers. Green fluorescent protein (GFP) can be used as a marker for gene expression in prokaryotic and eukaryotic cells. Chalfie et al., 263, Sci., 802 (1994). GFP and GFP mutants can be used as screening markers.

NS-B50027-4 and progeny of NS-B50027-4 can be transformed to confer disease or pest resistance. For example, a plant line can be transformed with a cloned resistance gene to produce plants that are resistant to particular pathogen strains. See, for example, Jones et al., 266, Sci., 789 (1994) (Cf-9 tomato gene cloning for resistance to Cladosporium fulvum); Martin et al., 262, Sci., 1432 (1993) (tomato Pto gene for resistance to Pseudomonas syringae pv. Tomato, protein kinase); Mindrinos et al., 78, Cell, 1089 (1994) (Arabidopsis RSP2 gene for P. syringae resistance); Geiser et al., 48, Gene, 109 (1986) (Bacillus thuringiensis 5-endotoxin gene); Van Damme et al., 24, Plant Mol. Biol., 25 (1994) (mannose-binding lectin Clivia miniata); Sumitani et al., 57, Biosci. Biotech. Biochem., 1243 (1993) (amylase inhibitor); Abe et al., 262, J. Biol. Chem., 16793 (1987) (cysteine proteinase inhibitor); Huub et al., 21, Plant Mol. Biol., 985 (1993) (tobacco proteinase I inhibitor); Regan, 269, J. Biol. Chem., 9 (1994) (insect diuretic hormone receptor); Pratt et al., 163, Biochem. Biophys. Res. Comm., 1243 (1989) (allostatin); Tomalski et al., US Pat. No. 5,266,317 (insect-specific paralytic neurotoxins); Scott et al., WO 1993/02197 (callase gene); Kramer et al., 23, Insect Biochem. Mol. Biol., 691 (1993) (tobacco worm chitinase); Kawalleck et al., 21, Plant Mol. Biol., 673 (1993) (parsley ubi-4-2-polyubiquitin gene); WO 1995/16776 (derivatives of tachyplesin-inhibiting fungi); WO 1995/18855 (synthetic antimicrobial peptides); Jaynes et al., 89, Plant Sci., 43 (1993) (cecropin-β, a lytic peptide renders transgenic tobacco plants resistant to Pseudomonas solanacearum); Botella et al., 24, Plant Mol. Biol., 24: 757 (1994) (mung bean calmodulin); Griess et al., 104, Plant Physiol., 1467 (1994) (maize calmodulin); Taylor et al., Abstract #497, 7th Int'l Symp. Molec. Plant-Microbe Interactions (Edinburgh, Scotland (1994) (enzymatic inactivation in tobacco via transgenic single chain antibody); Tavladorakiet al., 366, Nature, 469 (1993) (viral resistance via transgenic antibody); Lamb et al., 10, Bio technol., 1436 (1992) (Fungal endo-α1,4O-polygalacturonase fragments promote fungal colonization and nutrient release from plants by solubilizing the plant cell wall with homo-α-1,4-Ogalacturonase; Toubart et al., 2, Plant J., 367 (1992) (bean endopolygalacturonase inhibitory protein); Logemann et al., 10, Bio/technology, 305 (1992) (transgenic plants expressing a barley ribosome inactivating gene that have increased resistance to fungal diseases) .

As noted, herbicide resistance is another useful trait that can be introduced through genetic modification. For example, resistance to herbicides that inhibit the growth cone or meristem, such as imidazolinone or sulfonylurea, can be conferred by mutant ALS and AHAS enzymes. See, for example, Lee et al., 7, EMBO J., 1241 (1988); Miki et al., 80, Theor. Appl. Genet., 449 (1990); glyphosate resistance is provided by aroA genes and mutant 5-enolpyruvlshikimate-3-phosphate synthase (EPSPS) genes; resistance to glufosinate is provided by the phosphinothricin acetyltransferase genes; and resistance to pyridineoxy or phenoxypropionic acids and cyclohexones is conferred by genes encoding an ACCase inhibitor. See, for example, US Pat. No. 4,940,835 (EPSPS confers glyphosate resistance); mutant aroA gene, accession number ATCC 39256; see Comai, US patent No. 4769061; see also Umaballava-Mobapathie, 8, Transgenic Research, 33 (1999) (Lactuca sativa, glufosinate resistant); Kumada et al., EP 0333033; Goodman et al., US Pat. No. 4,975,374 (EPSPS confers resistance to herbicides such as L-phosphinothricin); Leemans et al., EP 0242246 (phosphinothricin acetyltransferase); DeGreef et al., 7,

- 37 042743

Bio/technol., 61 (1989) (chimeric bar genes encoding phosphinothricin acetyltransferase); Marshall et al., 83, Theor. Appl. Genet., 435 (1992) (the Acc1-S1, Acc1-S2 and Acc1-S3 genes confer resistance to phenoxypropionic acids and cyclohexones such as sethoxydim and haloxyfop); Przibilla et al., 3, Plant Cell, 169 (1991) (PsbA and gs+ genes confer triazine resistance); Stalker, US Pat. No. 4,810,648 (nitrilase genes confer resistance to benzonitrile); Hayes et al., 285, Biochem. J., 173 (1992) (glutathione-S-transferase); Hattori et al., 246, Mol. Gen. Genet., 419 (1995) (acetohydroxy acid synthase confers resistance to multiple herbicides); Shiota et al., 106, Plant Physiol., 17 (1994) (yeast NADPH cytochrome P450 oxidoreductase); Aono et al., 36, Plant Cell Physiol., 1687 (1995) (glutathione reductase and superoxide dismutase); Datta et al., 20, Plant Mol. Biol., 619 (1992) (various phosphotransferases); WO 2001/12825; US patents No. 6288306; 6282837; 5,767,373 (plants with altered protox activity are resistant to duct-targeting herbicides).

NS-B50027-4 and progeny derived from NS-B50027-4 can be further modified to confer any number of valuable traits known in the art. See, for example, Goto et al., 521, Acta Horticulturae, 101 (2000) (soybean ferritin gene); Curtis et al., 18, Plant Cell Rep., 889 (1999) (nitrate reductase); Knultzon et al., 89, PNAS, 2625 (1992) (stearyl ACP desaturase); Shiroza et al., 170, J. Bacteriol., 810 (1988) (nucleotide sequence of Streptococcus mutans fructosyltransferase gene); Steinmetz et al., 20, Mol. Gen. Genet., 220 (1985) (Bacillus subtilis levansucrose gene); Pen et al., 10, Bio/technol., 292 (1992) (transgenic plants express Bacillus licheniformis α-amylase); Elliot et al., 21, Plant Mol. Biol., 515 (1993) (tomato invertase genes); Sngaard et al., 268, J. Biol. Chem., 22480 (1993) (site-directed mutagenesis of the barley α-amylase gene); Fisher et al., 102, Plant. Physiol., 1045 (1993) (branching enzyme II starch corn endosperm).

Canola line NS-B50027-4 can also be treated to be male sterile by any of a number of methods known in the art, including mechanical methods, chemical methods, self-incompatibility (SI), cytoplasmic male sterility (CMS or ogura or other system) or nuclear male infertility (NMS). The term manipulated to be male sterile refers to the use of any available techniques to produce a male sterile version of the NS-B50027-4 canola line. Male sterility can be partial or complete male sterility. See, for example, WO 2001/29237 (introduction of a deacetylase gene under the control of a tapetum-specific promoter and using the chemical N-Ac-PPT); WO 1992/13956, WO 1992/13957 (stamen-specific promoters); Paul et al., 19, Plant Mol. Biol., 611 (1992) (introduction of barnase and barstar genes); see also US Pat. Nos. 5,859,341; 6297426; 5478369; 5824524; 5850014; 6265640; Hanson et. al., 16, Plant Cell, S154 (2004).

Numerous methods for plant transformation have been developed, including biological and physical protocols for plant transformation. See, for example, WO 2013185184; Miki et al., in METHS. PLANT MOLEC. BIOL. BIOTECHNOL., 67-88 (Glick & Thompson, eds., CRC Press, Inc., Boca Raton, FL, 1993). In addition, expression vectors and in vitro culture methods are available for plant cell or tissue transformation and plant regeneration. See, for example, WO 2013185184; Gruber et al., METHS. PLANT MOLEC. BIOL. BIOTECHNOL., 89-119 (Glick & Thompson, eds., CRC Press, Inc., Boca Raton, FL, 1993). One method of introducing an expression vector into plants uses the natural transformation system of Agrobacterium; see Horsch et al., 227, Sci., 1229 (1985); Curtis et al., 45, J. Exper. Botany, 1441 (1994); Torres et al., 34, Plant Cell Tissue Organ Culture, 279 (1993); Dinant et al., 3, Molec. Breeding, 75 (1997); Kado, 10, Crit. Rev. Plant Sci., 1 (1991) (Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectively, carry the genes responsible for plant genetic transformation); Gruber et al; Miki et al.; Moloney et al., 81 Plant Cell Rep., 238 (1989) (Agrobacterium vector systems, Agrobacterium mediated gene transfer methods); US patent No. 5591616.

As an alternative to Agrobacterium-mediated transformation, several plant transformation methods have been developed, collectively referred to as direct gene transfer. A common method of plant transformation is microparticle-mediated transformation, in which DNA is transferred to the surface of microparticles ranging in size from 1 to 4 μm. The expression vector is introduced into plant tissues using a biolistic device that accelerates microparticles to velocities of 300 to 600 m/s, which is sufficient to penetrate plant cell walls and membranes. Russell et al., 12, Plant Cell Rep., 165 (1993); Aragao et al., 20, Plant Mol. Biol., 357 (1992); Aragao et al., 12, Plant Cell Rep., 483 (1993); Aragao, 93, Theor. Appl. Genet., 142 (1996); Kim & Minamikawa, 117, Plant Sci., 131 (1996); Sanford et al., 5, Part. sci. Technol., 27 (1987); Sanford, 6, Trends Biotech., 299 (1988); Klein et al., 6, Bio/technol., 559 (1988); Sanford, 7, Physiol. Plant. 206 (1990); Klein et al., 10, Bio/technol., 268 (1992).

Methods for physically delivering DNA to plants are also known in the art. See, for example, Zhang et al., 9, Bio/technol., 996 (1991) (sonication); Deshayes et al., 4, EMBO J., 2731 (1985) (liposomes); Christou et al., 84, PNAS, 3962 (1987) (spheroplast NHW11915); Hain et al., 199, Mol. Gen. Genet., 161 (1985) (precipitation of CaCl ₂ ); Draper et al., 23, Plant Cell Physiol., 451 (1982) (polyvinyl alcohol or poly-L-ornithine); Saker et al., 40, Biology Plantarum, 507 (1997/98)

- 38 042743 (electroporation of protoplasts). Additional methods include, but are not limited to, expression vectors introduced into plant tissues using a direct gene transfer method such as microparticle-mediated delivery with a biolistic device, DNA injection, electroporation, and the like. Following transformation, expression of the selectable marker genes described above may allow for the preferential selection of transformed cells, tissues, or plants using regeneration and selection methods well known in the art. See, for example, WO 2013185184.

The above methods of transformation are usually used to obtain a transgenic line. The transgenic line can then be crossed with another (untransformed or transformed) line to produce a new transgenic canola line. Alternatively, a genetic trait inserted into a particular canola or Brassica using well known transformation techniques can be introduced into another line using conventional backcrossing techniques which are also well known in the field of plant breeding. For example, a backcrossing approach can be used to move an engineered trait from a public non-elite inbred line to an elite inbred line, or from an inbred line containing a foreign gene in its genome to an inbred line or lines that do not contain that gene. As used herein, the term crossbreeding may refer to a simple crossing of X with Y, or to a backcrossing process, depending on the context.

When the term plant NS-B50027-4 is used in the context of the present embodiments of the invention, it also includes any transformations of the genes of this line. The term genetically converted plant refers to those NS-B50027-4 plants that are obtained by backcrossing, genetic engineering, or mutation, wherein substantially all of the desired morphological and physiological characteristics of the variety are restored in addition to one or more genes transferred to the derived NS- B5OO27-4 line by backcrossing, genetic engineering or mutation. Backcrossing techniques can be used with the present embodiments of the invention to improve or introduce a characteristic into a variety. As used herein, the term backcrossing refers to the recrossing of a hybrid progeny back to a recurrent parent, i. Backcrossing 1, 2, 3, 4, 5, 6, 7, 8, 9 or more times to a recurrent parent. A Brassica parent plant that contributes a gene for a desired characteristic is called a non-recurrent or donor parent. This terminology refers to the fact that the recurrent parent is used once in the backcross protocol and therefore is not repeated. A Brassica parent plant that receives a gene or genes from a non-recurrent parent is known as a recurrent parent because it is used for multiple rounds in the backcross protocol. Poehlman & Sleper, 1994; Fehr, 1993. In a typical backcrossing protocol, the original variety of interest (the recurrent parent) is crossed with a second variety (the non-recurrent parent) that carries the gene of interest to be transferred. The resulting progeny from this cross is then crossed again to the recurrent parent and the process is repeated until a canola plant is produced in which substantially all of the desired morphological and physiological characteristics of the recurrent parent are restored in the transformed plant in addition to the gene transfer from the non-recurrent parent .

Choosing a suitable recurrent parent is an important step for a successful backcrossing procedure. The goal of a backcross protocol is to change or replace a trait or characteristic in the original line. To do this, the gene of the recurrent cultivar is modified or replaced with the desired gene in the non-recurrent parent, while retaining essentially everything else about the desired genetic and therefore the desired physiological and morphological characteristics of the original line. The choice of a specific non-recurrent parent will depend on the purpose of the backcross. One of the main goals is to add some commercially desirable, agronomically important traits to the plant. The exact backcrossing protocol will depend on the characteristic or trait being changed to determine the appropriate testing protocol. Although backcrossing methods are simplified when the trait being transferred is a dominant allele, a recessive allele can also be transferred. In this case, it may be necessary to introduce progeny testing to determine if the desired trait has been successfully transferred.

Genetic traits can be identified that are not routinely selected in the development of a new line, but which can be improved by backcrossing techniques. Genetic traits may or may not be transgenic. Examples of these traits include, but are not limited to, male sterility, modified carbohydrate metabolism, herbicide resistance, resistance to bacterial, fungal, or viral diseases, insect resistance, nutrient enhancement, industrial use, crop stability, and yield enhancement. These genes are usually inherited through the nucleus. See, for example, US Pat. Nos. 5,969,212; 7164059.

Further reproduction of the inbred line NS-B5OO27-4 can occur by tissue culling.

- 39 042743 tours and regenerations. The term tissue culture refers to a composition containing isolated cells of the same or different type, or a collection of such cells, organized into parts of a plant. Typical types of tissue cultures are protoplasts, calli, meristematic cells, and plant cells that can generate tissue cultures that are intact in plants or plant parts such as leaves, pollen, embryos, roots, root tips, anthers, pistils, flowers, seeds, petioles, suckers, etc. Means for preparing and maintaining tissue culture of plants are well known in the art. Tissue culture of various canola tissues and plant regeneration from them is well known. See, for example, Teng et al., 27, HortSci., 1030 (1992); Teng et al, 28, HortSci., 669 (1993); Zhang et al., 46, J. Genet. Breeding, 287 (1992); Webb et al., 38, Plant Cell Tissue Organ Cult., 77 (1994); Curtis et al., 45, J. Exp. Bot., 1441 (1994); Nagata et al., 125, J. Am. Soc'y Hort. Sc., 669 (2000); Ibrahim et al., 28, Plant Cell Tissue Organ Cult., 139 (1992); US patents No. 5959185; 5973234; No. 5,977,445. Tissue culture as well as microspore culture for the regeneration of canola plants can be successfully achieved. See Chuong et al., 4, Plant Cell Rep., 4 (1985); Barsby et al., 5, Plant Cell Rep., 101 (1986); Kartha et al., 31, Physiol. Plant, 217 (1974); Narasimhulu et al., 7, Plant Cell Rep., 104 (1988); Swanson, 6, Meth. Molec. Biol., 159 (1990); Cell Culture Tech. & Canola Improvement, 66, J. Am. oil chem. Soc., 455 (1989). From the literature it is clear that the state of the art is such that these methods of obtaining plants are usually used with a high degree of success. Thus, another aspect of the present embodiments of the invention relates to cells that, when grown and differentiated, produce canola plants having the physiological and morphological characteristics of the inbred transgenic line NS-850027-4.

Typically, when a transgene is introduced into a plant by conventional breeding, its insertion site in the plant genome and its flanking regions are not altered. An insertion region refers to a region corresponding to a region of at least 40 base pairs, such as at least 100 base pairs or up to more than 10,000 base pairs, spanned by flanking regions upstream and downstream of the transgene in the (untransformed) plant genome, and comprising insertion site (and possible deletion of the target site). Considering minor differences due to mutations within a species, an insertion region may retain at least 85%, such as 90, 95, or 100% sequence identity with flanking regions up and down the foreign DNA in a given plant of that species. However, the insertion of a transgenic cassette into the plant genome can sometimes be associated with a deletion of the plant's DNA, referred to as a target site deletion. However, additional transgenes or other genetic manipulations can be made in NS-B50027-4 without undue experimentation; and NS-B50027-4 derived plants can be identified as described herein.

The starting material NS-B50027-4 can be used to produce hybrid seed lines if it is backcrossed to a male-sterile cytoplasmic source or some other source to sterilize the inbred line as female. Alternatively, the line can be used directly. For example, B. napus line NS-B50027-4 can be crossed with another canola plant to form a population of F1 first generation plants. The population of first generation F1 plants produced by this method is also an embodiment of the invention. This first generation F1 plant population contains a substantially complete set of canola lineage NS-B50027-4 alleles. The F1 hybrid is generally considered to have all the alleles of each parent. One skilled in the art can use either broodbooks or molecular methods to identify a particular F1 plant produced using canola line NS-B50027-4, and any such single plant is also covered by this invention. These embodiments of the invention also cover the use of these methods with transgenic or single gene transformations of the NS-850027-4 lineage.

In another embodiment, this invention relates to a method of using canola line NS-B50027-4 in breeding, which comprises re-backcrossing with canola line NS-B50027-4 any number of times. Using the transgenic methods described herein, backcrossing methods, or other breeding methods known to those skilled in the art, single plants and plant populations can be developed that retain at least 25, 30, 35, 40, 45, 50, 55 , 60, 65, 70, 75, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% of the genetic profile of the NS-B50027-4 canola line. The percentage of genetics retained in offspring can be measured either by ancestry analysis or by using genetic techniques such as molecular markers or electrophoresis. In lineage analysis, on average 50% of the original germplasm would be passed on to the progeny line after one cross to another line, 25% after another cross to another line, and so on. Molecular markers can also be used to confirm and/or determine the lineage of offspring.

The specific production method of the line obtained from the canola line NS-B50027-4 is as follows. One skilled in the art crosses canola line NS-850027-4 with another canola plant, such as an elite line. The F1 seed obtained from this cross is grown with

- 40 042743 formation of a homogeneous population. The F1 seed contains 50% alleles from the NS-B50027-4 canola line and 50% alleles from another plant. The F1 seed is grown and allowed to develop, thereby forming the F2 seed. On average, an F2 seed received 50% of its alleles from the NS-B50027-4 line and 50% from another canola plant, but various individual plants in the population have a much higher percentage of their alleles derived from the NS-B50027-4 event. Wang et al., 40, Crop Sci., 659 (2000); Bernardo et al., 102, Theor. Appl. Genet., 986 (2001). In this context, the term population refers to a statistically representative sample. F2 seed is grown and plants are selected based on visual observation or measurement of traits. The traits used for selection could be a high DHA production trait in canola seed line NS-B50027-4. Progeny from event NS-B50027-4 that exhibit the desired trait derived from NS-B5OO27-4 are selected and each plant is harvested separately. This F3 seed from each plant is grown in separate rows and left to itself. Then selected rows or plants from the rows are harvested and threshed individually. Selections are again based on visual observation of plant phenotype or measurements of desirable plant traits, such as the desired trait derived from NS-B50027-4. The growing and selection process is repeated any number of times until an inbred canola plant derived from NS-B50027-4 is obtained.

The canola plant derived from NS-B50027-4 contains desirable traits derived from the NS-B50027-4 canola line, some of which may not have been expressed by the other canola plant to which the NS-B50027-4 canola line was crossed, and some of them may have been expressed by both canola lines but are now at levels equal to or greater than those expressed in NS-B50027-4.

F1 canola plants derived from NS-B50027-4 or Brassica have an average of 50% of their genes derived from NS-B50027-4, but various individual plants in the population have a much higher percentage of alleles derived from NS-B50027-4. The process of propagation, crossing, selfing and selection is repeated to produce another population of canola plants derived from NS-B50027-4 with an average of 25% of their genes derived from the NS-B50027-4 canola line, but different individual plants from the population have much a larger percentage of their alleles derived from NS-B50027-4. Another embodiment of the invention is an inbred canola plant derived from NS-B50027-4 that has obtained the desired high DHA trait from NS-B50027-4.

The previous example can be modified in a variety of ways, for example, selection may or may not occur at each self-pollinating generation, selection may occur before or after the actual self-pollination process, or individual selections may be made by collecting single pods, plants, rows, or patches at any point during described breeding process. In addition, double haploid breeding techniques can be applied at any stage of the process. The population of plants produced in each generation of self-pollination is also a variant of the present embodiments of the invention, and each such population will consist of plants containing approximately 50% of its genes from the NS-B50027-4 canola line, 25% of its genes from the NS-B5OO27 line -4 canola in the second breeding and selection cycle, 12.5% of her genes from the NS-B5OO27-4 canola line in the third breeding and selection cycle, etc.

In another embodiment, the invention relates to a method for producing a homozygous canola plant NS-B50027-4 obtained by crossing the NS-B5OO27-4 canola line with another canola plant and applying dual haploid methods to an F1 seed or an F1 plant or to any generation of the NS line -B50027-4 canola obtained by self-pollination of this cross. Breeding is usually used to improve self-pollinating crops or inbred lines of cross-pollinating crops. Two parents that have favorable, complementary traits are bred to produce F1. An F2 population is obtained by self-pollination of one or more F1s or by crossing two F1s (crossing between sibs). The selection of the best individuals usually starts in the F2 population. Then, starting with F3, the best individuals from the best families are selected. Retesting of families or hybrid combinations involving individuals from these families often continues into the F4 generation in order to increase the efficiency of selection for traits with low heritability. At an advanced stage of inbreeding (ie F6 and F7), the best lines or mixtures of phenotypically similar lines are tested for potential release as new cultivars.

In addition, the present embodiments of the invention are directed to methods for producing canola plants derived from NS-B50027-4 by crossing the canola line NS-850027-4 with a canola plant and growing the progeny seed and repeating the breeding steps with the NS-B50027 derived -4 canola plant 1 to 2 times, 1 to 3 times, 1 to 4 times, or 1 to 5 times and self-pollination any number of times after the first, second, third, fourth or fifth cross. Massive and recurrent selections can be used to improve populations of both self-pollinated and cross-pollinated crops. A genetically variable population of heterozygous individuals is either identified or created by intercrossing several different parents. Ray

- 41 042743 Breeding plants are selected on the basis of individual excellence, outstanding progeny, or superior combination ability. Selected plants are intercrossed to create a new population in which further selection cycles continue.

Backcrossing has been used to transfer genes for a simply inherited, highly inherited trait into the desired homozygous cultivar or line that is the recurrent parent. The source of the transmitted trait is called the donor parent. The resulting plant is expected to have the attributes of the recurrent parent (eg cultivar) and the desired trait passed down from the donor parent. After the initial crossing, individuals with the phenotype of the donor parent are selected and recrossed (backcrossed) to the recurrent parent. The resulting plant is expected to have the attributes of the recurrent parent (eg cultivar) and the desired trait passed down from the donor parent.

Single seed generation in the strict sense means planting a segregated population, collecting a sample of one seed per plant, and using a sample of one seed to plant the next generation. As the population progresses from F2 to the desired level of inbreeding, the plants from which the lines are derived will each be traceable to different F2 individuals. The number of plants in a population decreases with each generation because some seeds do not germinate or some plants produce at least one seed. As a result, not all F2 plants initially selected in the population will be represented by offspring after the completion of generation development.

An additional embodiment of the invention relates to the conversion of a single NS-B50027-4 gene. Gene conversion occurs when DNA sequences are introduced using traditional (non-transformational) breeding techniques such as backcrossing. DNA sequences, whether naturally occurring or transgenes, can be introduced using these traditional breeding techniques. Desired traits imparted through this process include, but are not limited to, fertility modification, fatty acid profile modification, other nutritional performance enhancements, industrial enhancements, disease resistance, insect resistance, herbicide tolerance, and yield enhancement. The trait of interest is passed from the donor parent to the recurrent parent, in this case the canola plant described herein. Single gene traits can result from the transfer of either a dominant allele or a recessive allele. The selection of offspring containing the trait of interest is carried out by direct selection of the trait associated with the dominant allele. Selecting offspring for a trait that is transmitted through a recessive allele requires rearing and selfing the first backcross in order to determine which plants carry the recessive alleles. Recessive traits may require additional testing of the offspring in subsequent backcross generations in order to determine the presence of the gene of interest. Along with selection for the trait of interest, offspring are selected for the phenotype of the recurrent parent. It will be appreciated that sometimes additional polynucleotide sequences or genes are carried along with a single gene conversion feature of interest. Progeny containing at least 90%, 95%, 96%, 97%, 98%, 99% or 99.5% of the genes from the recurrent parent disclosed herein of the canola plant, and also containing the trait of gene conversion, is considered to be genetically transformed NS-B50027-4 . When a trait is controlled by two genes (for example, some resistance to diseases), selection is carried out simultaneously for two genes, and so on.

Mutation breeding is another way to introduce new traits into canola varieties. Mutations that occur spontaneously or are artificially induced can be useful sources of variability for the breeder. The goal of artificial mutagenesis is to increase the rate of mutation for a desired characteristic. Mutation rates can be increased in a variety of ways, including temperature, long term seed storage, tissue culture conditions, radiation (such as X-rays, gamma rays, neutrons, beta rays, or ultraviolet rays), chemical mutagens (such as base analogs like 5- bromuracil), antibiotics, alkylating agents (such as sulfur mustard, nitrogen mustard, epoxides, ethyleneamines, sulfates, sulfonates, sulfones or lactones), azide, hydroxylamine, nitrous acid or acridines. Once a desired trait has been discovered through mutagenesis, that trait can then be incorporated into existing germplasm using conventional breeding techniques. See, for example, Fehr, PRINCIPLES CULTIVAR DEVEL. (Macmillan Pub'l Co., 1993).

It should be understood that the canola line of the present embodiments of the invention can be obtained in male sterile form by routine manipulation of cytoplasmic genes, nuclear genes, or other factors, as described in the references discussed previously. Such embodiments of the invention are also within the scope of the present claims. The present embodiments of the invention thus provide hybrid F1 seeds and plants produced using the NS-B5OO27-4 canola line.

There are many laboratory techniques available for analysis, comparison and characterization of plant genotype; these include isozyme electrophoresis, restriction length polymorphism

- 42 042743 fragments (RFLP), randomly amplified polymorphic DNA (RAPD), random primer polymerase chain reaction (AP-PCR), DNA amplification fingerprint (DAF), sequence characterization amplified regions (SCAR), amplified fragment length polymorphisms (AFLP) ), simple sequence repeats (SSRs, also called microsatellites), and single nucleotide polymorphisms (SNPs).

Isoenzyme electrophoresis and RFLP have been widely used to determine the genetic composition. Shoemaker & Olsen (Molecular Linkage Map of Soybean (Glycine max), p. 6.131-6.138 in S. J. O'Brien (ed.) Genetic Maps: Locus Maps of Complex Genomes, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1993 )) developed a map of molecular genetic relationships that consisted of 25 linkage groups with about 365 RFLPs, 11 RAPDs, three classical markers, and four isozyme loci. See also Shoemaker, R.C, RFLP Map of Soybean, p. 299-309, in Phillips, R.L. and Vasil, I.K. (eds.), DNA-Based Markers in Plants, Kluwer Academic Press, Dordrecht, the Netherlands (1994).

SSR technology is currently an efficient and practical marker technology; more marker loci and more alleles per marker locus can be used using SSR compared to RFLP. See, for example, Diwan & Cregan, 95 Theor. Appl. Genet. 22 (1997). SNPs can also be used to identify the unique genetic composition of the invention and the progeny varieties that retain that unique genetic composition. Various molecular marker techniques can be used in combination to improve overall resolution. Molecular markers, which include those identified by techniques such as isozyme electrophoresis, RFLP, RAPD, AP-PCR, DAF, SCAR, AFLP, SSR, and SNP, can be used in plant breeding. One application of molecular markers is the mapping of quantitative trait loci (QTLs). QTL mapping is the use of markers that are known to be closely related to alleles that have a measurable effect on a quantitative trait. Selection during breeding is based on the accumulation of markers associated with positively affecting alleles, or the removal of markers associated with negatively affecting alleles, from the plant genome.

Molecular markers can also be used in the breeding process to select for qualitative traits. For example, markers closely associated with alleles, or markers containing sequences within the actual alleles of interest, can be used to select plants that contain alleles of interest during a backcross breeding program. The markers can also be used to select for the genome of the recurrent parent and against the markers of the donor parent. This procedure attempts to minimize the amount of genome from the donor parent that remains in the selected plants. It can also be used to reduce the number of backcrosses to a recurrent parent required in a backcross program. The use of molecular markers in the selection process is often referred to as either genetic marker selection or marker assisted selection. Molecular markers can also be used to identify and exclude certain germplasm sources from parental varieties or plant ancestors by providing a means of tracking genetic profiles through crosses.

Thus, it is clear that in the prior art these methods of obtaining plants are generally accepted in the sense that they are used regularly and have a high degree of success. The usefulness of the NS-B50027-4 canola line also extends to crosses with other species. Generally suitable species are in the family Brassicaceae. Accordingly, any and all methods using canola with elite event NS-B50027-4 in breeding are covered by the present embodiments, including selfing, breeding, backcrossing, hybrid production, and backcrossing with populations. All plants and plant populations produced using a canola line with the NS-B50027-4 elite event as a parent are within the scope of these embodiments, including those obtained from varieties derived from the NS-B50027-4 canola line. Those skilled in the art can use unique molecular marker profiles or breeding records to identify progeny lines or progeny populations derived from the NS-B5OO27-4 canola line.

Examples

Example 1 Characterization and selection of the NS-B50027-4 line in a field trial.

A difficult task in plant breeding is to identify individual plants that are genetically superior because for most traits, true genotypic value can be masked by other confounding plant traits or environmental factors. One way to identify a superior plant is to observe its performance against other experimental plants and one or more commonly grown standard cultivars. If one observation is inconclusive, repeated observations provide a better estimate of genetic value.

Plants originally identified as B0050-027-18 were selected based on a single seed generation procedure by collecting a sample of one seed per plant and using the sample

- 43 042743 one seed for planting the next generation. As a rule, the number of plants in a population decreases with each generation due to the fact that some seeds do not germinate or some plants produce at least one seed. As a result, not all plants originally selected in a population are represented by offspring when the generation progression is completed. Moreover, original transgenic events exacerbate the complexity of inheritance so that the genotype or phenotype of offspring cannot be predicted. In this way, plants were self-pollinated and type-selected for successive generations until a particular line became homozygous, exhibiting selected traits with excellent agronomic properties, and producing a uniform population of pure-breeding offspring. In particular, the test lines were selected following a reselection breeding program at the Nuseed Innovation Center (NIC), Horsham (Victoria, Australia). Selection and promotion of candidate lines was based on (a) copy number of the T-DNA insert;

(b) a DHA expression segregation pattern;

(c) homozygosity (based on fatty acid phenotype and genotype);

(d) production of LC-ω3-DHA; and (e) suitable agronomic traits for growing crops based on progeny testing in the field during winter and summer.

In Australia, canola is grown in the southern drylands and mainly under winter rainfall conditions. In Australia, mainly spring-type canola cultivars are grown, which have low vernalization requirements. In general, Australian cultivars generally retain a slight delay in early flowering and have relatively high plant vigor or biomass production during the winter months.

Canola plants in Australia are typically sown from April to May after the first major rain and harvested from October to December. The yield is influenced, first of all, by the availability of water during the growing season and the efficiency of the cultivar's water use. Genetic resistance of the underlying pathotype to blackleg disease caused by Leptosphaeria maculans may differentiate cultivars in terms of seedling survival and stem ulceration, but Australian cultivars are generally considered to be highly resistant when grown according to recommended agronomic practices. Seed development follows a growing season of five to seven months and occurs in late spring or early summer. In addition to the presence of water, large temperature fluctuations (from <0°C to >35°C) can significantly affect the yield, which can cause underdevelopment of seeds and seed pods.

As noted herein, canola germplasm transformation was accomplished with an eight-gene construct that resulted in seed-specific accumulation of LC-ω3 fatty acids, specifically DHA. Simply put, the phenotype was characterized by production quality (PQ) (obtained omega-3 fatty acids), although the plants carried a marker gene (MG). Transformed material was reselected for locus homozygosity, DHA seed expression and agronomic traits and potential yield suitable for commercial production.

Three siblings derived from the T2 generation from the transgenic event were compared with eight other canola cultivars (lines) for a number of important agronomic and seed traits at eight experimental points (plots). In Victoria in 2015, the rainfall during the growing season was below the long-term average and reduced the length of the growing season. The eight Australian plots represented a wide range of yield potentials in the environment, as evidenced by the average plot yield range (ie AV Garnet: 0.7 to 2.4 t/ha). The transgenic line B0050-027-18-X was represented by three transgenic lines: B0050-027-18-20 (T3), B0050-027-18-36-13 (T4) and B0050-027-18-105-13 (T4 ). Changes in agronomic traits in the tested lines were comparable to those in commercial varieties evaluated in all tested media. This conclusion was supported by the fact that the yield of grain on the highest yielding line tested was statistically comparable, based on site-to-site analysis (MET-REML), with the highest yielding commercial cultivars. In addition, for each plot, the highest yielding test line had a significantly higher yield than at least one cultivar, except for one plot where there was no significant difference. The test lines produced seeds with slightly lower plant seed oil percentages and different fatty acid compositions; but this did not affect yield or agronomic performance. Expression of the LC ω3 DHA fatty acid was very stable in all media tested.

The test lines were obtained from transformed seedlings (var. AV Jade). The seeds swelled, allowing the plants to self-pollinate in isolation (i.e. under insect-proof awnings).

Control cultivars (commercial breeding lines) used for comparison provided an agronomically diverse (e.g., land cover, phenology) range of good

- 44 042743 adapted (i.e. with high but varying yield and oil content potential) cultivars widely grown in the planting area. All of these cultivars are open pollinated, described and carefully evaluated in, for example, the Australian National Variety Testing Program and the Regional Annual Harvest Reports. See the nvtonline website. In addition, variation in plant disease resistance is well documented for blackleg in Australia. Van De Wouw et al., 67, Crop & Pasture Sci., 273 (2015). In Australia, blackleg disease can lead to crop losses of up to 90%. Marcroft & Bluett, Agricul. Notes, AG1352, Victoria, Dept. Primary Indian. (2008). Genetic variability among commercial cultivars for certain seed fatty acid composition and seed oil content has been documented over time. See Seberry et al., Quality of Australian canola, 2011 (Australian Oilseeds Fed., 2012). Plants from the AV Jade cultivar were transformed to produce transgenic T0 and therefore AV Jade can be considered a non-transformed isoline of the transgenic event described herein.

Phenotypic variability for the tested lines was characterized by plant germination, plant vigor, flowering time, flowering duration, plant height, seed cracking, lodging resistance, blackleg heaviness, plant yield, grain yield, grain moisture, seed oil percentage, and fatty acid content. , in particular the LC-ω3 polyunsaturated fatty acid (LC-PUFA) in the seed, especially with respect to the yield of EPA, DPA and DHA. For all measured traits, limited estimated probability analyzes were performed using ASREML in GenStat statistical software. Gilmour et al., ASREML user guide, release 3.0, Biometric Bulletin (3) (VSV Int'l, Waterhouse Stm Hemel Hempstead, UK, 2009). The statistical method of the linear mixed model was used to account for the spatial variation of the field, as it was described in detail and used for field breeding and genetic studies. Cullis & Gleeson, 47, Biometrics, 1449 (1991); Smith et al., 57 Biometrics 1138 (2001); Welham et al, Analysis of linear mixed models by ASReml-R with Applications in Plant Breeding: Course Notes (VSV Int'l, Waterhouse Stm Hemel Hempstead, UK, 2013). To determine grain yield (t/ha), an inter-site Meta-REML analysis was then performed to determine the Best Linear Objective Prediction (BLUP) for the tested lines.

With regard to plant emergence, this calculation was made by counting the number of plants that emerged approximately twelve days after sowing in two quadrants of one square meter (1 m ² ) per plot in all eight plots. The average of both quadrants was used to estimate the number of plants emerging per square meter and analyzed as a trait change. Evaluation of plant emergence, based on a visual assessment of the average plant density in the plot, was recorded for each plot in all plots and analyzed as a change in trait (for example, 1=low=0-5 plants/m ² ; 5=moderate=25-30 plants /m ² 9=high=45-50 plants/m ² ). Plant emergence based on number per square meter and plant emergence rate varied significantly between treatment lines for all eight plots. The statistical variability for plant germination in the transgenic lines was significant within the range expressed by the cultivars in all experiments. Plant vigor was predicted at the beginning of the growing season using observations of 1 to 9 points of vegetative biomass at the cabbage plant stage (i.e. from the six-leaf stage) for each plot in all plots and analyzed as a trait variance.

Flowering time was recorded as the number of days from sowing until 50% of the plants in the plot had at least one open flower. It was recorded for each site in all trials and analyzed as a change in trait. Flowering onset (number of days after planting) based on 50% plant flowering varied significantly between treatment lines for all plots. The mean flowering time at the plot ranged from 99 to 110 days and is indicative of environmental differences between experimental plots for this trait. Statistically, the change in flowering time of the transgenic lines was largely within the range expressed by the cultivars in all experiments.

Bloom time was the calculated difference between bloom time and end bloom time (expressed as number of days). It was calculated for each site across all trials and analyzed as a trait variable:

Bloom Duration=Blossom End Day-Blossom Time (50%)

Flowering onset (number of days after planting), based on 50% plant flowering, varied significantly between treatment lines for all eight plots. The average flowering time at the plot ranged from 99 to 110 days, reflecting environmental differences in experimental plots for this trait. Statistically, the change in flowering time of the transgenic line was largely within the range expressed by the cultivars in all experiments. The end of flowering (number of days after sowing), based on 90% of plants having no flowers, varied significantly between lines for all eight plots. The mean end-of-flowering time at the plot ranged from 128 to 139 days, reflecting environmental differences in the experimental plots for this trait. Statistically, the change in the end of flowering of transgenic lines was significant.

- 45 042743 a significant degree within the range expressed by cultivars in all plots.

Plants at harvest in terms of number of plants per square meter varied significantly between lines for all eight plots. Statistically, the change in the number of plants at harvest time for the transgenic lines was largely within the range expressed by the cultivars at all plantings and locations. The number of plants at emergence was significantly correlated with the number of plants registered at harvest. Some of the calculated survival percentages exceeded 100%, reflecting the slow emergence of two varieties (ATR Wahoo and AV Jade): not all seedlings appeared at the time of the plant emergence count.

The height of the plant at the stage of maturation of dry seeds was measured from the base to the top in the center of the plot. The site center was used to avoid blending effects likely associated with the spatial area between sites (edge effects). This trait was recorded for each site in all trials and analyzed as a trait change. Plant height at maturity (cm) varied significantly between treatment lines for all plots. The average plant height at the plot ranged from 63 to 105 cm, indicating environmental differences in the experimental plots for this trait. Statistically, the change in height of maturity for the transgenic lines was largely within the range expressed by the cultivars in all experiments.

Seed degradation (sometimes referred to as bean cracking) at maturity was analyzed using seed counts per 1/8 square meter recorded over a two week period. This was done by placing two trays between seeded rows and under a canopy for each plot in all locations and analyzed as a trait change. The seed destruction score (on a scale of 1 (zero) to 9 (height: +40)) was also recorded at one site based on the number of seeds observed on the ground just before harvest and analyzed as a trait change. Seed destruction, based on the number of seeds on the ground at the time of harvest, varied significantly between treatment lines for four of the eight plots. The average seed destruction value ranged from 3 to 15 (per 1/8 square meter) and indicated a low level of destruction in all plots. The rate of seed destruction at one of the plots also varied significantly between lines and was closely correlated with the average number of broken seeds. This indicates that the breakage recorded as a score was a good predictor of seed breakage. Statistically, the variation for seed destruction, based on seed numbers and scores for transgenic lines, was largely within the range expressed by cultivars in all experiments.

Lodging resistance was recorded as 1 (resistant) to 9 (susceptible), calculated based on the angle of the plant from the base of the plant at maturity. There were no statistically significant changes in plant lodging. The lack of variation for this trait is likely due to below-average rainfall in the late pod growth stage.

Blackleg leaf severity symptoms characteristic of Leptosphaeria maculans and Leptosphaeria biglobosa were scored as 1 (low <5%) to 9 (high >40%) in one repeat at five sites. Not all sites were evaluated due to the lack of noticeable changes. Symptoms associated with ulceration and breakage of the trunk were not observed. Observed blackleg leaf symptoms were at very low levels at all eight sites. One plot was sown using bare seeds (seeds not treated with fungicide). There were no relative differences in plant germination among the lines tested between this site and other sites treated with the seed fungicide. Leaf symptoms do not always predict the degree of stem ulceration caused by L. maculans (leading cause of yield loss and basis for Australian resistance rating, see Sosnowski et al., 33, Australian Plant Pathol., 401 (2004)). Several studies have evaluated blackleg resistance based on pathogenic infection on cotyledons, leaves, stems (cankers) and plant survival in the field. Given the absence of pitting and stem damage, canola lines can be considered resistant to the prevailing disease pressure for the purposes described herein.

The amount of plant yield was estimated by counting plants in two quadrants of one square meter in each plot in all eight plots. The average of both quadrants was then used to estimate the number of plants per square meter and analyzed as a feature of variation. Plant survival (%) was calculated by expressing the averages for the expression site for the number of plants in % of the averages for the plant emergence rates:

Plant Survival %=(Plant Yield x 100)/Plant Germination Amount

The grain was harvested when the seeds were physiologically mature and dry (~7%) using a trial and breeding plot harvester. Harvest direction was kept constant (ie front to back range for each row) for each trial in order to avoid harvest direction errors. Dry grain weight for each plot was determined and converted

- 46 042743 in units of t/ha based on plot area and analyzed as a trait change.

Grain moisture at harvest and in the laboratory sample was recorded and analyzed as a trait change. A handheld moisture meter was used to analyze bulk samples directly at the point of harvest in the field. Moisture percentage was also determined using an oven drying method based on the Australian Oilseed Federation (AOF) method 4-1.5. This method involved oven drying a 5 g sample in open jars at 130° C. for 1 hour. The samples were cooled in a desiccator for 40 minutes and weighed, and the percentage moisture was determined as the percentage weight loss. Grain moisture at harvest (%) varied significantly between processing lines for all eight plots. The average grain moisture at harvest varied from 9 to 12%, indicating that the seeds were harvested at a similar stage of grain development. Statistically, the change in grain moisture at harvest for the transgenic lines was largely within the range expressed by the cultivars in all experiments. Grain Moisture % at Harvest also correlated with flowering time such that seeds from late flowering lines (i.e. ATR Wahoo and Monola515TT) had a significantly higher % Grain Moisture at Harvest in all locations. Laboratory seed moisture varied significantly between lines at all plots. However, the differences between lines and across sites were very low, averaging about 7%. This indicates that there are no interfering effects of seed storage. The change in seed moisture in the laboratory for the transgenic line was significant (P<0.05) within the range expressed by the non-transgenic lines.

Seed oil content (%) was analyzed using nuclear magnetic resonance spectrometry (NMR) on seeds with 6% moisture. Briefly, 5 to 10 g seed samples were weighed into an NMR tube and analyzed with an NMR spectrometer. Seed oil results were determined using a software calibration created initially using twenty reference samples with a known percentage of oil, which was determined by gravimetric oil extraction. Vegetable oil content varied significantly (P<0.05) between lines in all eight plots. The average seed oil percentage at the site ranged from 37.0 to 41.5%, which was generally below the average for the planting sites and was likely due to below-average rainfall and higher-than-average temperatures observed in grain filling period. The relative differences in the lines were quite constant in different plots. The variation in seed oil content for transgenic lines was somewhat lower compared to non-transgenic lines in all plots, averaging about 2%, which may serve as a target for genetic improvement. The lower oil content may not be genetically related to the transgenic event, but may result from the transformation of a cultivar with a lower oil content, i.e. AV Jade.

A brief description of the characteristics of the agronomic traits of the event NS-B50027-4 compared with the characteristics of non-transgenic varieties is presented in Table. 4 (REML analysis; F pr<0.001 Sig for all features).

Table 4 _________ Intersectional analysis of agronomic traits _________

Feature: Germination Quantity Harvested Plants Germination Plant Power Beginning of Flowering End of Bloom Flowering duration Mature Height Shattered Seed Exit Grain moisture at harvest Name line Unit: Raste NIY Plants per m Score (1-9) Score (1-9) Day Day days cm no. t/ha %

- 47 042743

us sq. sq. ATR Bonito 18.2 16.0 7.3 6.8 103.8 131.2 27.5 90.0 13.0 1.35 10.6 ATR GEM 17.9 16.6 7.1 6.7 105.3 133.6 28.2 91.0 10.9 1.21 13.0 ATR Stingray 17.6 17.3 7.1 5.9 100.9 129.7 28.8 82.7 14.4 1.34 8.2 ATR WAHOO P,2 P,8 5.9 6.1 108.2 136.0 27.3 92.3 10.7 1.12 18.7 AV GARNET 18.6 16.3 7.4 7.2 104.4 132.8 28.6 102, 1 15.0 1.31 10.2 AV JADE 7.8 12.5 5.0 4.8 106.7 134.8 28.3 89.9 9.8 0.96 9.9 AV ZIRCON 19.0 15.7 7.3 7.0 104.4 132.0 27.6 98.7 22.5 1.31 9.5 Monola515TT 20.3 18.5 7.5 5.8 108.6 136.1 27.3 87.9 12.3 1.24 12.4 NS-B50027-4 18.1 15.7 7.1 5.9 107.8 135.0 27.2 88.2 10.5 1.17 By B0050-027-18-36- 13 22.5 20.3 7.2 5.9 106.6 134.4 27.9 76.4 10.3 0.95 10.8 B0050-27-18-105- 13 22.6 19.8 7.6 5.4 108.5 135.8 27.3 70.6 8.9 0.92 P,1 Min Value for Cultivar 7.8 11.8 5.0 4.8 100.9 129.7 27.3 82.7 9.8 0.96 8.2 NS-B50027-4 18.1 15.7 7.1 5.9 107.8 135.0 27.2 88.2 10.5 1.17 11.0 Max Value for Cultivar 20.3 18.5 7.5 7.2 108.6 136.1 28.8 102.1 22.5 1.35 18.7 Average 17.6 16.4 7.0 6.2 104.7 133.2 28.5 90.0 12.0 1.14 11.0 VAR 0.67 0.98 0.02 0.01 0.04 0.07 0.13 1.35 2.74 0.00 0.15 SE 0.81 0.98 0.14 0.11 0.21 0.27 0.35 1.15 1.65 0.06 0.39 LSD 1.62 1.95 0.28 0.21 0.41 0.54 0.71 2.30 3.30 oh p 0.78 cv% 4.6 6.0 2.0 1.7 0.2 0.2 1.3 1.3 13.8 5.0 3.6

Fatty acids were determined using solvent extraction followed by saponification and methylation and analysis by GC-FID. Briefly, this involved crushing seed samples and extracting oil into solvent from a sample of crushed seeds. The solvent was evaporated under a nitrogen atmosphere and the oil sample was diluted in a new solvent. An aliquot was reacted with Meth Prep II (saponification/methylation reagent). Samples were heated at 40° C. to speed up the reaction and then injected into GC-FID using a BPX-70 fatty acid column. Fatty acids were calculated as % of oil composition, where the area of each fatty acid peak was defined as a percentage of the sum of all fatty acid peaks in the chromatogram. These scores were analyzed individually as an indication of change. The specific fat percentage has been estimated for: palmitic acid; stearic acid; oleic and cis-vaccenic; linoleic; alphalinolenic acid (ALA); arachidic (also known as eicosanoic acid) and stearidonic (SDA); poplinic, gondoic and gadoleic acids; erucic and eicosatetraenoic (ETA); eicosapentaenoic acid (EPA); docosapentaenoic acid (DPA); and docosahexaenoic acid (DHA). In table. 5 is an inter-site analysis of seed fatty acid content (all values are percentages; REML analysis; Fpr<0.001 Sig for all traits).

-48042743

Table 5

Intersectional Analysis of Seed Fatty Acid Content

laboratory Seed Moisture Seed Oil palmitic Stearic Oleic & Cisvaccenic Linoleic ALA, Arachinoic & SDA ishshniil, Gondoeva & sc AND SC A DHA EPA amount DPA DHA ATR Bonito 6.7 41.9 3.9 1.7 60.5 20.9 10.1 1.1 0.0 0.0 0.0 0.0 ATR GEM 6.8 41.5 3.7 1.7 66.3 14.9 10.2 1.2 0.0 0.0 0.0 0.1 ATR Stingray 6.6 40.8 4.3 1.8 60.6 20.5 9.7 1.0 0.0 0.0 0.1 0.1 ATR WAHOO 6.8 41.7 3.7 1.6 60.7 20.4 10.4 1.2 0.0 0.0 0.1 0.1 AV GARNET 7.1 40.4 3.6 1.7 69.6 I,8 9.7 1.5 0.0 0.0 0.1 0.1 AV JADE 6.7 41.0 4.0 2.2 61.0 18.7 AND 2 1.0 0.0 0.0 0.1 0.2 AV ZIRCON 6.8 41.0 3.8 1.6 69.3 I,8 10.4 1.3 0.0 0.0 0.0 0.0 Monola515TT 6.9 40.9 3.6 2.1 73.3 12.2 5.2 1.4 0.0 0.0 0.1 0.2 NS-B50027-4 6.9 37.0 4.1 2.1 45.9 8.2 20.7 3.4 0.4 1.0 8.6 9.9 B0050-027-18-36- 7.1 35.5 4.2 2.4 41.8 7.9 22.2 3.8 0.6 1.2 10.5 12.2 13 B0050-27-18-105- 13 7.2 35.3 4.1 2.4 42.0 7.7 22.1 3.9 0.5 1.2 10.3 12.0 Min Value for Cultivar 6.6 40.4 3.6 1.6 60.5 11.8 5.2 1.0 0.0 0.0 0.0 0.0 NS-B50027-4 6.9 37.0 4.1 2.1 45.9 8.2 20.7 3.4 0.4 1.0 8.6 9.9 Max Value for Cultivar 7.1 41.9 4.3 2.2 73.3 20.9 11.2 1.5 0.0 0.0 θ,ι 0.2 Average 6.8 39.6 3.9 2 55 14.8 15 2.3 0.1 0.6 3.1 3.8 VAR 0.002 0.05 0.00 05 0.00 03 0.19 12 0.03 85 0.04 75 0.00 32 0.00 01 0.00 05 0.02 48 0.03 45 SE 0.04 0.22 0.02 0.02 0.43 0.19 0.22 0.06 0.01 0.02 0.16 0.18 LSD 0.09 0.44 0.04 0.03 0.87 0.39 0.43 0.11 0.02 0.05 0.31 0.37 cv% 0.7 0.6 0.5 0.9 0.8 1.3 1.5 2.5 6.3 4.1 5.1 4.9

The percentage of fatty acid in the seed as stearic acid as determined by GC-FID analysis varied significantly between lines across all eight plots. The site average % stearic acid showed very little change and ranged from 1.6 to 2.2%. Statistically, the change in % stearic acid for the transgenic line was largely within the range expressed by the non-transgenic lines at all sites.

The percentage of fatty acid in the seed as oleic and cis-vaccenic acids as determined by GC-FID analysis varied significantly between lines across all eight plots. The plot average % of oleic and cis-vaccenic acids ranged from 51 to 58%. Statistically, the change in % oleic and cis-vaccenic acids for the transgenic line was significantly lower than the range expressed by non-transgenic lines in all plots. This result is related to the transgenic insertion and does not affect commercial agronomy or grain production.

The percentage of fatty acid in the seed as linoleic acid as determined by GC-FID analysis varied significantly between lines across all eight plots. The average % of linoleic acid in the areas ranged from 13.4 to 14.7%. The change in % linoleic acid for transgenic lines of sibs derived from a single T2 event (plant B0050-027-18) was significantly (P<0.05) lower than the range expressed by cultivars at all plots and by sibs derived from sibs with other events. The significant difference in % linoleic acid is probably due to the expression of the transgenes. The decrease in % linoleic acid is likely due to the transgenic insertion, but does not affect agronomy or industrial scale grain production.

The percentage of fatty acids present as ALA, arachidic and SDA varied significantly between lines in all eight plots. The site mean for % ALA, arachidic and SDA ranged from 5 to 11%. Variation for % ALA, arachidic and SDA for transgenic lines was significant.

- 49 042743 significantly (P<0.05) higher than the variation expressed by non-transgenic cultivars in all experiments. Significant differences observed for this trait at some sites were associated with the expression of transgenes. This result is related to the transgenic insertion and does not affect commercial agronomy or grain production. A specialized high oleic oil cultivar (Monola515 TT) produced a significantly (P<0.05) lower % ALA compared to other cultivars due to the SNP in the Fad genes.

The percentage of fatty acid in the form of pollinic, gondoic and gadoleic acid varied significantly between lines in all eight plots. The site average for % pollinic, gondoyic and gadoleic acid ranged from 2.0 to 2.5%. Variation for % pollinic, gondoic and gadoleic acid for transgenic lines was significantly (P<0.05) higher than the variation expressed by non-transgenic cultivars in all experiments. This result is related to the transgenic insertion and does not affect commercial agronomy or grain production.

The percentage of fatty acid in the form of erucic acid and ETA was recorded at five sites and varied, as a rule, close to 0%. The result associated with the transgenic insert does not commercially affect agronomy or grain production.

LC-ω3 polyunsaturated fatty acid (LC-PUFA) from seed, specifically EPA, DPA and DHA, was calculated as a percentage for each plot sample and analyzed as a trait variation, where

LC-PUFA=EPA%+DPA ^o /o+DHA%

The predicted DHA in units of kg/ha was calculated for each plot and analyzed as a trait variation:

DHA, kg/ha=(% oilχ0.01)χ(DHA%χ0.01)χGrain yield (t/ha)х1000

The predicted LC-PUFA in units of kg/ha was calculated for each plot and analyzed as a trait variance:

DHA kg/ha=(% oilχ0.01)χ(LC-PUFA%χ0.01)χGrain yield (t/ha)x1000

The percentage of fatty acid in the form of EPA varied significantly (P<0.05) among the lines in all eight plots. The % variation for transgenic lines was significantly (P<0.05) higher than that expressed by non-transgenic cultivars. This transgenic insertion outcome does not affect agronomy or grain production, but may indeed make the grain more valuable.

The percentage of fatty acid in the form of DPA varied significantly (P<0.05) between lines at all plots. The % variation for transgenic lines was significantly (P<0.05) higher than the variation expressed by non-transgenic cultivars at all plots. This result is related to the transgenic insertion and does not affect agronomy or commercial grain production.

The percentage of fatty acid in the form of DHA varied significantly between lines in all eight plots. The % variation for transgenic lines was significantly (P<0.05) higher than the variation expressed by non-transgenic cultivars at all plots. This result is related to the transgenic insertion and does not affect commercial agronomy or grain production. The scatter between transgenic sibling lines was used as a basis for selection. Percentage of DHA by plot and comparison of elite event NS-B50027-4 with non-transgenic cultivars (as determined by GC-FID) are shown in Table 1. 6 (REML analysis; Fpr<0.001 Sig for all locations).

Table 6

Plot by Average % DHA (C22:6p3) Seed in Cultivar/Elite Event

Name Line Plot: A V c D E F G H Average no plots ATR Bonito 0.0 0.0 0.0 0.1 0.1 oh, oh 0.1 0.0 0.2 ATR Gem 0.0 0.0 0.0 0.1 0.1 0.1 0.1 0.0 ο,ι ATR Stingray 0.0 0.1 0.2 0.3 0.0 0.1 0.1 0.0 0.3 ATR Wahoo 0.1 0.2 0.1 0.2 0.0 0.2 0.1 0.0 0.2 AV Garnet 0.0 0.0 0.0 0.2 0.1 0.2 0.2 0.0 0.2 AV Jade 0.0 0.3 0.5 oh, oh 0.2 0.1 0.3 0.0 0.3 A.V. Zircon 0.0 0.1 0.1 0.1 0.2 0.1 0.1 0.0 0.2

- 50 042743

Monola 515TT 0.1 0.1 oh, s 0.2 ο,ι ο,ι 0.2 oh oh 0.2 NS-B50027-4 8.1 9.8 7.8 7.5 8.5 8.4 8.8 10.2 8.6 В0050-027-18-36-13 10.0 12.2 9.5 9.7 Yu,1 10.4 10.8 13.3 10.8 В0050-27-18-105-13 10.5 n,s 9.0 9.6 10.2 9.7 10.9 12.5 10.5 Min Value for Cultivar 0.0 0.0 0.0 0.0 0.0 0.0 0.1 0.0 0.1 NS-B50027-4 8.1 9.8 7.8 7.5 8.5 8.4 8.8 10.2 8.6 Max Value for Cultivar 0.1 0.3 0.5 0.3 0.2 0.2 0.3 0.0 0.3 Average 3.5 3.6 3 2.49 3.7 3.56 3.88 4.1 VAR 0.15 0.07 0.079 0.29 0.14 0.14 oh and 0.18 SE 0.39 0.27 0.281 0.53 0.37 0.37 0.33 0.42 LSD 0.78 0.54 0.6 1.1 0.75 0.73 0.65 0.84 cv% AND 7.5 9.4 21.5 10 10.6 8.4 10.4

Predicted DHA, expressed in kg/ha, calculated from fatty acid profile, % seed oil and grain yield, varied significantly (P<0.05) between lines at all plots. The % variation for transgenic lines was significantly (P<0.05) higher than the variation expressed by non-transgenic lines at all locations. This result is due to the transgenic insertion and does not affect commercial agronomy or grain production, other than making the grain more valuable. The scatter between transgenic sibling lines was used as a basis for selection. A high stability of DHA in terms of unit production per unit area (kg/ha) was noted due to the low variation between seed oil and % DHA produced in seeds. Predicted DHA yields (kg/ha) by plot and comparison of elite event NS-B50027-4 with non-transgenic cultivars are shown in Table 1. 7 (REML analysis, F pr<0.001 Sig for all locations).

Table 7

Plot by average predicted DHA content (kg/ha) in seed line

Name Line Plot: A V WITH D E F G Η Average by plots ATR Bonito 0 1 0 1 0 0 1 0 0 ATR Gem 0 0 0 0 2 2 2 1 1 ATR Stingray 0 0 0 1 0 0 0 0 0 ATR Wahoo 1 0 1 0 0 1 1 0 0 AV Garnet 0 1 2 1 1 4 1 2 1 AV Jade 0 0 1 0 1 0 0 0 0 A.V. Zircon 0 0 0 2 0 4 1 0 1 Monola 515TT 0 0 2 0 2 0 0 0 0 NS-B50027-4 thirty 28 39 36 50 49 24 41 37 B0050-027-18-36- 13 25 27 41 41 52 53 24 36 37 B0050-27-18-105- 13 24 25 34 50 46 40 26 33 35 Min Value for Cultivar 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

- 51 042743

NS-B50027-4 30.0 28.0 39.0 36.0 50.0 49.0 24.0 41.0 37.0 Max Value for Cultivar 1.0 ι, ο 2.0 2.0 2.0 4.0 2.0 2.0 ι, ο Average 8 8 12 12 16 17 8 12 VAR 3.93 3.08 14.60 38.66 10.77 24.55 7.60 6.94 SE 1.98 1.75 3.81 6.20 3.28 4.79 2.75 2.63 LSD 4.0 3.5 7.6 12.4 6.6 9.6 5.5 5.3 cv% 23.6 22.5 33.1 53.4 20.3 29.8 34.2 22.7

With regard to LC-PUFA omega-3 in seeds - the percentage of EPA, DPA and DHA - the percentage of LC-PUFA varied significantly (P<0.05) among the lines in all eight plots. The % difference for transgenic lines was significantly (P<0.05) higher than that expressed by cultivars in all experiments. This result is related to the transgenic insertion and does not affect agronomy or commercial grain production other than to increase the value of the grain. The scatter between transgenic sibling lines was used as a basis for selection. Trace levels of LC-PUFA observed in non-transgenic lines are likely related to pollen flow, seed movement, or GC-FID error.

In table. 8 shows percentage values determined by GC-FID (REML analysis; F pr<0.001 Sig for all locations):

Table 8

Plot by average content of LC-PUFA (% of total EPA+DPA+DHA) in seeds of cultivar or transgenic line

Name lines Plot: A IN WITH D E F G H Average by plots ATR Bonito 0.0 0.0 0.0 0.1 0.1 oh oh 0.2 0.2 oh, s ATR Gem 0.0 0.0 0.0 0.1 0.2 0.1 0.1 0.1 0.2 ATR Stingray 0.0 0.1 0.2 0.3 oh oh 0.1 0.1 0.5 0.3 ATR Wahoo 0.1 0.2 0.1 0.2 oh oh 0.2 0.1 0.2 0.2 AV Garnet 0.0 oh oh 0.0 0.1 0.1 0.2 0.2 oh oh oh, s AV Jade 0.0 0.4 0.5 0.0 0.2 0.1 oh, s oh oh oh, s A.V. Zircon 0.0 0.2 0.1 0.1 0.2 0.1 0.1 oh, s 0.2 Monola515TT 0.1 0.1 0.3 0.2 0.2 0.1 0.2 oh oh oh, s NS-B50027-4 9.5 I,4 9.1 8.9 9.8 9.8 10.3 I,8 Yu,1 B0050-027-18-36- 13 I,7 14.2 and about I,4 I,8 12.2 12.7 15.3 12.5 B0050-27-18-105- 13 12.2 13.2 10.5 from I,9 from 12.7 14.5 12.3 Min Value for Cultivar 0.0 0.0 0.0 0.0 0.0 0.0 0.1 0.0 0.2 NS-B50027-4 9.5 11.4 9.1 8.9 9.8 9.8 10.3 11.8 10.1 Max Value for Cultivar 0.1 0.4 0.5 0.3 0.2 0.2 0.3 0.5 0.3 Average 4.3 4.4 3.6 3.05 4.5 4.34 4.75 4.9 VAR 0.23 oh and 0.112 0.33 0.19 0.2 0.14 0.23 SE 0.48 0.33 0.334 0.58 0.44 0.43 0.38 0.48 LSD 0.95 0.66 0.7 1.2 0.87 0.87 0.76 0.96 cv% AND 7.6 9.3 18.9 9.7 10.3 8 9.8

The predicted LC-PUFA, expressed in kg/ha, calculated from the fatty acid profile, % seed oil, and grain yield, varied significantly between treatment lines at all plots. Statistically, the % variation for the transgenic lines was significantly higher than the variation expressed by the cultivars in all experiments. This result is related to the transgenic insert and has no commercial impact on agronomy or grain production. The scatter between transgenic sibling lines was used as a basis for selection. Trace amounts in cultivar seeds are likely due to pollen flow, seed movement, or GC-FID error. There is a high stability of LC-PUFA in terms of unit production per unit area (kg/ha) due to low seed-to-seed variation for seed oil and % DHA produced in seed. In table. 9 shows predicted kg/ha LC-PUFU (F pr<0.001 for all plots).

Table 9

Plot by average predicted amount of LC-PUFA (Kg/ha) in cultivar seeds (lines)

Name Line Plot: A IN C D E F G H Average no plots ATR Bonito 0 1 0 1 0 0 1 0 0 ATR Gem 1 0 0 0 2 3 3 0 1 ATR Stingray 1 0 0 1 0 0 0 0 0 ATR Wahoo 0 0 2 0 0 1 1 0 1 AV Garnet 0 1 2 1 1 4 1 0 1 AV Jade 0 1 1 0 1 0 0 0 0 A.V. Zircon 0 0 0 2 0 4 2 0 1 Monola 515TT 0 0 2 0 2 0 0 0 1 NS-B50027-4 35 33 46 43 58 58 28 46 43 B0050-027-18-36- 29 32 48 48 60 61 28 41 43 13 B0050-27-18-105- 13 28 29 40 58 53 46 thirty 40 41 Average 10 10 14 14 20 20 10 14 VAR 5.50 4.34 21.71 54.48 15.98 34.93 11.14 58.10 SE 2.34 2.08 4.65 7.36 3.99 5.71 3.33 4.04 LSD 4.7 4.2 9.3 14.7 8.0 11.4 6.7 8.1 cv% 22.6 21.9 33.1 51.9 20.1 28.9 33.5 54.8

The oil content of the seeds, determined by NMR, was also tabulated for each of the cultivation sites and presented in table. 10 (units are percentages; REML analysis; F pr<0.001 Sig for all plots).

Table 10

Plot by Average % Oil Content in Cultivated Seed Oil

Line Plot: A IN C D E F G H Average no plots ATR Bonito 43.0 40.6 43.6 43.4 42.6 41.8 39.1 39.6 41.7 ATR Gem 43.7 40.7 43.9 42.7 42.3 40.5 37.8 39.5 41.3 ATR Stingray 41.4 39.7 42.6 42.8 41.1 39.1 38.9 39.9 40.6 ATR Wahoo 43.1 41.0 43.3 43.4 42.5 40.1 39.0 39.9 41.4 AV Garnet 43.9 39.9 43.4 41.8 41.5 39.1 36.5 36.4 40.2 AV Jade 41.7 40.2 42.6 42.2 42.5 38.6 37.5 39.4 40.6 A.V. Zircon 44.0 40.6 43.6 42.1 41.5 39.8 36.9 38.8 40.9 Monola 515TT 42.2 40.1 42.3 42.1 42.2 38.8 38.1 39.3 40.6 NS-B50027-4 38.7 36.1 39.3 38.2 37.3 36.5 34.2 35.1 36.9 B0050-027-18- 36-13 36.7 34.3 37.2 37.9 36.8 34.3 33.4 33.2 35.5 B0050-27-18- 36.3 34.4 37.9 37.4 35.8 34.1 32.1 33.0 35.1

- 53 042743

105-13 Min Value FOR cultivar 41.4 39.7 42.3 41.8 41.1 38.6 36.5 36.4 40.2 NS-B50027-4 38.7 36.1 39.3 38.2 37.3 36.5 34.2 35.1 36.9 Max Value For cultivar 44.0 41.0 43.9 43.4 42.6 41.8 39.1 39.9 41.7 Average 40.8 38.7 41.5 41.2 39.8 38.01 37 37.8 VAR 0.13 0.09 0.23 0.13 0.13 0.19 0.18 ο,ι SE 0.36 oh, s 0.477 0.36 0.36 0.42 0.43 0.31 LSD 0.71 0.59 1 0.7 0.73 0.85 0.85 0.62 CV% 1 0.8 1.2 0.9 0.9 1.1 1.2 0.8

Additional analysis of the content of fatty acids in the seeds of NS-B50027-4 is presented in table. eleven.

Table 11

Detailed fatty acid data for NS-B50027-4

NS-B50027-4, Generation T7, Summer 2015-2016 GLA ALA SDA C14: 0 C16: 0 S16:1p 7s C18: 0 S18:1p 9s S18:1p 7s S18:2p 6s C18:3 pb S18:3 pZ C20: 0 S18:4 pZ S20:1p 9s ^1st 0.05 4.33 0.24 2.16 38.83 4.26 7.81 0.58 21.54 0.64 2.20 1.31 2 0.05 4.28 0.23 2.19 38.32 4.17 7.76 0.59 21.58 0.65 2.21 1.31 3 0.05 4.20 0.22 2.19 38.77 4.06 7.81 0.60 21.73 0.66 2.22 1.28 4 0.05 4.19 0.21 2.16 38.69 4.09 7.79 0.61 21.66 0.63 2.25 1.34 5 0.05 4.26 0.21 2.18 38.35 4.22 7.81 0.59 21.78 0.64 2.25 1.29 0.05 4.25 0.22 2.18 38.69 4.16 7.80 0.60 21.66 0.64 2.23 1.30 NS-B50027-4, Generation Tb, Winter 2015 C14: 0 C16: 0 S16:1p 7s C18: 0 S18:1p 9s S18:1p 7s S18:2p 6s C18:3 pb S18:3 pZ C20: 0 S18:4 pZ S20:1p 9s 1 0.0 4.60 0.21 2.22 41.95 3.10 6.35 0.47 21.06 0.69 2.27 1.14 2 oh oh 5.00 0.25 2.01 36.02 3.50 6.70 0.66 21.46 0.66 3.21 1, Yu 3 0.09 4.67 0.24 2.32 34.45 3.41 6.33 0.60 22.53 0.71 3.35 1.01 4 oh oh 4.57 0.20 2.01 34.27 3.08 6.47 0.59 23.14 0.65 3.24 1.08 5 oh oh 5.08 0.30 2.22 36.51 3.99 6.55 0.57 21.59 0.72 3.41 1.06 0.02 4.78 0.24 2.15 36.64 3.42 6.48 0.58 21.95 0.69 3.10 1.08 NS-B50027-4, Generation T5, Summer 2014-2015 1 0.05 4.51 0.21 2.05 39.18 4.10 8.67 0.66 21.93 0.60 1.86 1.38 NS-B50027-4, Generation T4, Winter 2014 1 0.17 3.93 0.16 2.14 44.54 2.65 7.02 0.45 19.4 0.64 2.21 1.26 *Sample number

- 54 042743

NS-B50027-4, Generation T7, Summer 2015-2016 (continued) DGLA ETE ETA ERA DPA6 DPA3 DHA S21: 0 S20:Zp 6 S20:Zp 3 C22: 0 S20:4p 3 S22:1p 9s S20:5p 3 C24: 0 S22:5p 6 S24:1p 9s S22:5p 3 S22:6p 3 ^1st 0 0 0.71 0.31 0 0 0.40 0.24 0.10 0.85 9.69 2 0 0 0.70 0.32 0 0 0.39 0.23 oh and 0.88 9.78 3 0 0 0.72 0.32 0 0 0.40 0.23 0.09 0.89 9.83 4 0 0 0.71 0.33 0 0 0.41 0.23 0.08 0.91 9.92 5 0 0 0.72 0.32 0 0.01 0.41 0.23 0.10 0.89 9.80 0 0 0.71 0.32 0 0 0.40 0.23 0.10 0.88 9.80 NS-B50027-4, TB Generation, Winter 2015 (continued) 1 0 0 0.59 0.34 0 0 0.55 0 0.09 0 0.89 10.22 2 0 0 0.47 0.33 0 0 0.68 0 oh and 0.10 1.21 13.34 3 0 0 0.60 0.33 0 0 0.80 0 0 0.09 1.13 14.02 4 0 0 0.63 0.38 0 0 0.71 0.14 0.10 0.10 1.07 13.99 5 0 0 0.52 0.37 0 0 0.60 oh and 0 0.13 1.06 12.10 0 0 0.56 0.35 0 0 0.67 0.05 0.06 0.08 1.07 12.73 NS-B50027-4 Generation T5 Summer 2014-2015 (continued) 1 0.14 0 0.83 0.33 0 0 0.32 0.8 0.16 0.13 0.71 8.43 NS-B50027-4 Generation T4 Winter 2014 (continued) 1 0.07 0.46 0.26 1.09 0 0.41 0.85 8.89 *Sample number NS-B50027-4, Generation T7, Summer 2015-2016 (continued) Oil NMR Amount of EPA, DPA, DHA General content of Ω3 General content Ω6 Ω3/Ω 6 Total Saturated Fat Total Monounsaturated Fat General PUFA content ^1st 39.3 10.94 35.39 8.39 4.22 7.74 44.74 43.78 2 38.8 11.04 35.54 8.36 4.25 7.41 44.62 43.89 3 39.2 11.12 35.79 8.41 4.26 7.64 44.41 44.20 4 39.5 11.23 35.85 8.40 4.27 7.59 44.41 44.25 5 39.4 11.10 35.85 8.40 4.27 7.68 44.19 44.25 11.09 35.68 8.39 4.25 7.67 44.48 44.07 NS-B50027-4, TB Generation, Winter 2015 (continued) 1 11.66 35.58 6.91 5.15 7.85 46.40 42.48 2 15.23 40.37 7.47 5.41 7.99 40.96 47.84

- 55 042743

3 15.95 42.42 6.93 6.12 8,I 39.19 49.35 4 15.76 42.78 7.17 5.97 7.75 38.73 59.94 5 13.75 39.27 7.12 5.52 8.49 41.98 46.38 14.47 40.08 7.12 5.63 8.04 41.45 47.20 NS-B50027-4 Generation T5 Summer 2014-2015 (continued) Oil NMR Amount of EPA, DPA, DHA General content of Ω3 General content Ω6 Ω3/Ω 6 Total maintenance Total content of movable fat General PUFA content 1 9.46 34.09 9.49 3.59 7.76 45.00 43.58 *Sample number

The data in the table. 11 confirm that, in addition to LC-sh3 fatty acids, NS-B50027-4 seeds also contain significantly more ALA than conventional canola varieties. See also table. 5. Although ALA is not an LC-PUFA, it is a ω3 fatty acid. The ratio ω3:ω6 of fatty acids in NS-B50027-4 seed oil in Table. 11 is from about 3.59 to about 6.12; the ω3:ω6 ratio of fatty acids in conventional canola oil is about 0.5. Patterson et al, J. Nutr. Metab. (2012).

In table. 12 shows data relating to the percentage of DHA and LC-PUFA in seeds from sixteen generations of elite event NS-B50027-4 grown in experimental plots in Australia. An additional field trial in Australia yielded many seeds with 9.6% DHA and 10.1% LC-PUFA.

Table 12

DHA% and LC-PUFA% in seeds from elite event NS-B50027-4 per generation

Generation seed sample Environment Vegetative Period Year in Field Place location DHA% in seed LC-PUFA % V seed 1 T1 One Greenhouse controlled A 5.7 6.0 plant Wednesday 2 T2 One plant Greenhouse controlled Wednesday A 9.5 Yu,1 3 TK One plant Greenhouse controlled Wednesday A 12.6 13.1 4 TK- X A bunch of Insulation tarpaulin Winter spring 2014 IN 8.9 10.2 5 TK- 2x A bunch of open Field Summer 2014-15 WITH 8.4 9.5 6 TK- Zx A bunch of open Field Winter spring 2015 D 9.0 10.6 7 T4 One plant Greenhouse controlled Wednesday A 11.9 13.2 8 T5 One plant Greenhouse controlled Wednesday A 13.4 14.6 9 T5- X A bunch of Insulation tarpaulin Winter spring 2015 IN 12.7 14.5

-56042743

10 T5- 2x A bunch of open Field Summer 2015-16 WITH 9.8 ID eleven T5- Zx A bunch of open Field Winter spring 2016 D 9.6 10.6 12 Tb One plant Greenhouse controlled Wednesday A 12.9 14.4 13 T6- X A bunch of Insulation tarpaulin Summer 2015-16 WITH 17.3 18.8 14 T6- 2x A bunch of Insulation tarpaulin Winter spring 2016 E Yu,1 12.1 15 T7 One plant Greenhouse controlled Wednesday A 13.8 15.1 16 G7- X A bunch of Insulation tarpaulin Winter spring 2016 IN 12.5 14.1

In addition, the ability of NS-B50027-4 to grow in Canada was tested under controlled experimental conditions at two different locations in 2016. 13 shows agronomic and yield data comparing NS-B50027-4 with several non-transgenic canola lines.

Table 13

Agronomic measurement data for non-transgenic canola cultivars and experimental transgenic test lines from two Canadian experimental cultivations in 2016.

Feature: Germination Plant Height at Maturity Beginning of Flowering End of Bloom Bloom Time Lodging at Maturity Shattered Seeds Number of Harvested Plants Symptoms of Alternariosis Black leg resistance Plant Power Grain moisture 1 % garnet grain Grain output Name lines Plant per ^m2 cm Day Day days Score (1-9) no. Plants per m ² Score (1-9) Score (1-9) Score (1-9) % % t/ha ATR Bonito 23 90 49 75 26 8 3 24 2 6 6 8 76 1.9 ATR Gem 22 98 48 76 27 7 2 23 β 6 6 8 79 2.0 ATR Stingray 21 88 48 75 27 9 6 26 7 5 6 61 1.7 ATR Wahoo 22 98 48 75 27 7 4 26 2 7 6 10 87 2.2 AV Garnet 27 110 48 76 28 6 7 23 3 7 6 8 100 2.6 AV Jade 27 109 48 76 29 8 3 27 2 7 7 7 85 2.1 A.V. Zircon 14 125 50 76 26 8 9 18 1 7 5 8 101 2.6 Monola515TT 26 79 47 73 27 8 13 25 2 6 6 6 60 1.6 DK 7444 21 112 47 72 25 7 4 23 2 7 7 5 FROM 2.8 LL 130 18 123 47 73 26 8 4 21 2 7 6 6 114 2.9 NS-B50027-4 T3 AND 109 49 77 28 8 4 16 2 8 4 8 80 2.1 NS-B50027-4 T5 16 111 49 76 27 8 2 18 2 8 6 9 82 2.3 Min Value for Cultivar 14 79 47 72 25 6 2 18 1 6 5 5 60 1.7 NS-B50027-4 14 110 49 76 28 8 3 18 2 8 5 8 81 2.2 Max Value for Cultivar 27 125 50 76 29 9 13 26 3 7 7 10 114 2.9

- 57 042743

Since the canola line NS-B50027-4 is essentially homogeneous, it can be reproduced by planting seeds of this line, growing the resulting canola plants under self-pollination or sib-pollination conditions with adequate isolation, and harvesting the resulting seeds using conventional agronomic methods.

Example 2 Competitive allele-specific PCR (KASP) assays.

Phenotypic expression of transgenes in canola is determined both by the structure of the transgene cassette itself and by the location of its insertion in the plant genome: the presence of transgenes at specific locations in the plant genome can affect transgene expression and the overall plant phenotype. The incorporation of a recombinant DNA molecule into the plant genome usually occurs as a result of cell or tissue transformation (or other genetic manipulations). The specific inclusion site(s) may be random(s) or predefined(s) (if a targeted integration process is applied). Agronomically or industrially, the introduction of a commercial trait of interest into a plant through genetic manipulation can be a lengthy procedure, depending on various factors. The actual transformation and regeneration of genetically transformed plants is only the first in a series of selection steps that involve extensive genetic characterization, selection and evaluation in field trials, which ultimately leads to the selection of an elite event.

NS-B50027-4 was developed after extensive breeding and field testing and provides a canola cultivar that produces at least about 7-15% DHA. Genetic analysis showed that NS-B50027-4 had a transgenic insert on the A02 chromosome and another transgenic insert on the A05 chromosome. The insert at A05 includes two complete T-DNA border cassettes of eight genes (Micpu-A6D, Pyrco-A5E, Pavsa-A5D, Picpa-ω3D, Pavsa-A4D, Lackl-A12D, Pyrco-A6E, and the PAT marker) face-aligned -to-face (RB-LB:LB-RB). The insert on chromosome A02 consists of a set of four genes Micpu-6D, Pyrco-D5E, Pavsa-5D, and Picpa-ω3D. Surprisingly, segregation crosses showed that insertions on both the A02 chromosome and the A05 chromosome were required to achieve a DHA production of about 11%.

Approximately 1200 progeny from eight different BC and F ₂ populations obtained by introgression breeding of canola with DHA were used to isolate DNA based on the LGC Octopure SOP developed at the Nuseed Molecular Lab in Woodland. Briefly, two 0.25 inch diameter lyophilized leaf discs were ground in 300 µl of DNA extraction buffer (100 mM Tris-HCl, pH 8.0; 25 mM EDTA, pH 8.0; 0.5% SDS, 1.5 M NaCl) at 1400 rpm for 8 min with GenoGrinder. After incubation in a water bath at 55° C. for 45 min and centrifugation at 4500 rpm for 30 min, 50 μl of the supernatant was transferred into 100 μl of LGC-binding buffer with sbeadex magnetic beads. After binding and washing, the DNA was eluted with 80 μl of LGC DNA elution buffer.

DNA concentration was measured with a NanoDrop 8000 (Thermo Scientific) and ranged from 5.0 to 20.0 ng/µl with a mean value of 10.0 ng/µl. DNA samples were diluted 1x. For each reaction, 2.0 µl (~5.0 ng/µl) of the genomic DNA sample and 2 µl of primer master mix were placed in a 384-well KASP genotyping plate.

In addition to progeny from introgressive canola DHA populations, eight controls were included in genotyping. They included two non-GMO controls (Dwarf and AV Jade), two hemizygous controls (2.5 ng Av Jade or 2.5 ng Dwarf+2.5 ng B0050-027-18-20-12-19); two positive event controls (B0050-027-18-20-12-19) and four non-template controls (NTC). The positive control (plant T5 B0050-027-18-20-12-19) was previously used to characterize a canola DHA event by sequencing.

The KASP assays were designed to provide a simple, cost-effective, high-throughput, and flexible way to detect and monitor the eight transgenes and four specific NS-B50027-4 boundaries, and to further facilitate NS-B50027-4 introgression in breeding programs. KASP™ genotyping chemistry, assay design, genotyping and evaluation were performed according to the manufacturer's standard protocol (LGC Ltd., Middlesex, UK) with modifications.

Sequence information was loaded into the LGC Kraken Workflow Manager and KASP analyzes were designed using its Primer Picker analysis design program. A typical KASP assay includes two allele-specific primers (Primer_Allele X for the transgenic allele and Primer_Allele Y for the wild-type non-transgenic allele) and one common locus-specific primer (Primer_Common). Primer_Allele X associates with fluorescent FAM and Primer_Allele Y with fluorescent HEX.

Most of the border-targeting assays were three primer assays (Table 14). Four primer assays have also been developed for the detection of canola DHA, in addition to the conventional three primer assays mentioned above. The four primer assays contained the transgenic allele-specific PrimerAllele X, wild-type allele-specific PrimerAllele Y, PrimerCommon specific for the Omega 3 gene, and PrimerCommon 2 specific for

- 58 042743 wild type, in reaction. To detect eight genes in the Omega 3 cassette, only two primers, Primer Allele X and PrimerCommon (two primer assay) were used in each assay; both primers were gene-specific for Omega-3 (Table 14):

Table 14

Primer sequences 14 analyzes

KASP for detection and introgression NS-B50027-4

ID Analysis KASP Target Primer name primer sequence NBN001 Micpu-A6D PrimerAllele X GAAG G T GAG CAAG TTCATGCTC CAAG CAC C G T AGTAAGAGAGCA (SEQ ID NO :1) PrimerCommon GCTAAGAAGTGGGGACTCAACTACAA ID No :2) (SEQ NBN002 Rugso-A5E Primer Allele X GAAGGTGACCAAGTTCATGCTGCTCTTGCTGG AACTCTTGG (SEQ ID No:3) PrimerCommon GGGTTAGCCACATTGTAGGTAACGTA ID No:4) (SEQ NBN003 Pavsa-A5D Primer Allele X GAAG G T GAG GAAG T T CAT G C T TAAGAGACAC C CTGGTGGAAAGA (SEQ ID No :5) PrimerCommon TAGCATCAGTTCCAACTTGGTAAGCAAT (SEQ ID No:6) NBN004 Picpa-co3D Primer Allele X GAAG G T GAG GAAG T T CAT G C T GAAGAC G TAAG CAGACCAAGCAG (SEQ ID No:7) PrimerCommon CCCTCTTCTCCCTAACGAATTCCT ID No:8) (SEQ NBN005 Pavsa-A4D Primer Allele X GAAGGTGACCAAGTTCATGCTGAGGAACCTGT TGCTGCTGATGA (SEQ ID No:9) PrimerCommon GCGATСSTAGCACAAAGTTGAAGGTA ID No:10) (SEQ NBN006 Lacky- Primer Allele X GAAGGTGACCAAGTTCATGCTGGATGGATCGC TTACCTCTTCGT (SEQ ID No:11) A12D PrimerCommon CAGGGTAAGGTTGTCCTGTAACGTT ID No:12) (SEQ NBN007 Pyrco-A6E Primer Allele X GAAGGTGACCAAGTTCATGCCTCTATTGGATGG GGACTCAAGC (SEQ ID No:13) PrimerCommon GG GAGAT C C T T AG T AG C AGAAGAGAT ID No:14) (SEQ NBN008 PAT Primer Allele X GAAGGTGACCAAGTTCATGCTCCTGAGAGGCG TCCTGTTGAAT (SEQ ID No:15)

-59042743

PrimerCommon AAGAGCAGCCATATGAGGAGGAGTA (SEQ ID No:16) NBN009 A05 Border 1 Inserts PrimerAllele X GAAGGTGACCAAGTTCATGCTTGTTCTTGGGT GGGTCTGTCCTTC (SEQ ID No:17) PrimerAllele Y GAAGGTCGGAGTCAACGGATTGTGTTCTTGGG TGGGTCTGTCCTTA (SEQ ID No:18) PrimerCommon 1 ATCCACTAGCAGATTGTCGTTTCCC (SEQ ID No:19) PrimerCommon 2 GTTGGCTAAGGTCACGGTGGAG (SEQ ID No :2 0) NBN010 A05 Border 1 Inserts Primer Allele X GAAGGTGACCAAGTTCATGCTCCGCCTTCAGT TTAAACTATCAGTGTT (SEQ ID No:21) Primer Allele Y GAAGGTCGGAGTCAACGGATTGGTCACGGTGG AGGTCACCA (SEQ ID No:22) PrimerCommon GGTGTGTTCTTGGGTGGGTCTG (SEQ ID No:23) NBN011 A05 Border 2 Inserts Primer Allele X GAAGGTGACCAAGTTCATGCTACTTTTTTTTC AACTGTTGGCTAAGGTA (SEQ ID No:24) PrimerAllele Y GAAGGTCGGAGTCAACGGATTACTTTTTTTTC AACTGTTGGCTAAGGTC (SEQ ID No:25) PrimerCommon 1 GTGTGTTCTTGGGTGGGTCTG (SEQ ID No :2 6) PrimerCommon 2 GTCGTTTCCCGCCTTCAGTTTT (SEQ ID No :2 7) NBN014 A02 Border 1 Inserts Primer Allele X GAAG G T GAG CAAG T T CAT G C TAAAC TAT GAG T GTTTGAACACCTCC (SEQ ID No:28) Primer Allele Y GAAGGTCGGAGTCAAGGGATTAGAAGTTGTCG TGCTACACACCT (SEQ ID No:29) PrimerCommon GGTTGTGTGAAAACGTGTGGC (SEQ ID No :3 0) NBN015 A02 Border 2 Inserts Primer Allele X GAAGGTGAGGAAGTTCATGCTTTTTAGCTAA ATAAGAGGTTCTGTATACT (SEQ ID no :31) Primer Allele Y GAAGGTCGGAGTCAACGGATTTCTTTTAGCTAA ATAAGAGGTTCTGTATACA (SEQ ID No:32) PrimerCommon 1 GATTGTGATTCCGGGCAGT (SEQ ID No:33) PrimerCommon 2 GTGTGAAAACGTGTGAGCAAT (SEQ ID No:34) NBN016 A02 Border 2 Inserts Primer Allele X GAAGGTGACCAAGTTCATGCTTTGTGATTCCG GGCAGTAG (SEQ ID No:35) Primer Allele Y GAAGGTCGGAGTCAACGGATTTGTGAGCAATT GTTGGAGGT (SEQ ID No:36) Primer_Common T C T TAT GAAGAT TAAGAACATAAT C T T T TAG (SEQ ID No:37)

The KASP genotyping system requires two components: an assay mix and a master mix. The assay mix is a mix of the required primers and the master mix contains all other required components including PCR buffer, universal fluorescence reporting system and Taq polymerase.

- 60 042743

The KASP reaction was performed in a volume of 4.0 µl, consisting of 2.0 µl (10.0 ng) of genomic DNA, 2.0 µl of the 2x KASP master mix, and 0.06 µl of the assay (primer) mixture. The assay (primer) mixture is a combination of 12 µM allele-specific Primer_Allele X and 12 µM Primer_Common for dual primer assays, a combination of 12 µM allele-specific Primer_Allele X, 12 µM allele-specific Primer_Allele Y and 30 µM Primer_Common for triple primer assays and a combination of 12 μM allele-specific Primer_Allele X, 12 μM allele-specific Primer_Allele Y, 12 μM Primer_Common and 12 μM Primer_Common2 for four primer assays.

Reactions were run in a 384-well plate in an LGC Hydrocycler 16 with the following cycling parameters: 1 cycle at 94°C for 15 min followed by eight cycles at 94°C for 30 s and 64-57°C (dip 1.0° C per cycle) for 60 s, followed by thirty cycles at 94°C for 30 s and 57°C for 60 s. If no clear genotyping clusters were obtained, the plate was further thermocycled with three additional cycles at 94° C. for 30 seconds and 57° C. for 60 seconds.

After completion of the KASP reactions, the transgenic allele was labeled with FAM through PrimerAllele X and the non-transgenic wild-type allele was labeled with HEX through PrimerAllele Y. Fluorescent signals were read in a PheraStar microplate reader with an excitation wavelength of 485 nm and an emission wavelength of 520 nm for FAM and 535 /556 nm for HEX. The data was analyzed using the LGC Kraken database.

A gene-specific dominant (NBN01-NBN08; one assay/gene) was designed to detect eight genes in the construct cassette. Insert-specific co-dominant KASP assays designed for ascending (NBN57, NBN68, NBN58, NBN85 and NBN14) and descending (NBN16, NBN62 and NBN64) borders of insertion at A02 and ascending (NBN52, NBN51, NBN09, NBN50, NBN48 and N BN10) and descending (NBN83, NBN82, NBN84, NBN66, NBN41, and NBN43) insertion boundaries at A05 were developed and validated by 1200 progeny from introgressive NS-B5OO27-4 populations (Table 14). Over 10,000 samples have been genotyped with these markers.

Thirty competitive allele-specific PCR assays have been developed and validated that target eight genes and four borders of two canola DHA inserts with event NS-B50027-4. These assays offered a simple, cost effective, high throughput and flexible approach to detect and monitor NS-B50027-4 in a breeding program.

Example 3 Detailed comparison of NS-B50027-4 and non-transgenic canola.

Data on canola seed production in pilot field plots for 2014-2016. were summarized in a table. The DHA range and total EPA+DPA+DHA were based on several observations in the field. The content of essential fatty acids in both NS-B50027-4 and non-transgenic Control canola can vary by several percentage points depending on growing conditions.

In the next table. 15 0.0 may refer to a trace value defined as below the amount needed to accurately quantify the component.

Table 15 Detailed comparison of _______ fatty acid content in NS-B5OO27-4 and control _______

Fatty acid NS-B50027-4 (%) Control Canola (%) Myristic C14:0 0.1 0.1 palmitic С16:0 4.3 3.9 Palmitoleic C16.1 0.2 0.2 Stearic С18:0 2.2 1.6 Oleic S18:1p9s 38.7 63.6 Cis-vaccinal S18:1p7s 4.2 3.5 Linoleic S18:2pbs 7.8 13.1 GLA S6:3 pb 0.6 0.0 ALA S18:ZpZ 21.7 10.3 Arachinoic S20:0 0.6 0.6 SDA S18:4pZ 2.2 0.0

- 61 042743

Gondoeva S20:1p9s 1.3 1.5 Geneicosanoic С21:0 0.0 oh oh DGLA S20:Zpb 0.0 oh oh ETE S20:ZpZ 0.7 oh oh Begenovaya C22:0 oh, s oh, s ETA S20:4p3 oh oh oh oh Erucovaya S22:1p9s oh oh oh oh ERA S20:5pZ 0.4 oh oh Lignoceric С24:0 0.2 0.1 DPA6 C22:5pb oh oh oh oh Nervonovaya S24:1p9s 0.1 0.2 DPA3 S22:5pZ 0.9 oh oh DHA S22:6pZ 9.8 (8-10) oh oh Other 3.8 1.3 Amount: EPA+DPA+DHA 11.1 (10-12) oh oh Total Omega 3 Content 35.7 10.4 Total Omega 6 Content 8.4 from ω3/ω6 4.3 0.9 Total Saturates 7.7 6.7 General Content Monounsaturated 44.5 68.9 General Content Polyunsaturated 44.1 23.5

The seeds collected from the experimental cultivation of NS-B50027-4 were crushed and the oil obtained by cold pressing. Seeds harvested from the parental isogenic line AV Jade were treated in a similar manner and the content of each oil was compared as shown in Table 1. 16.

Table 16

Oil content of NS-B5OO27-4

Component (units) NS-B50027-4 AV Jade Saturated TAG (%) С4:0 Oily <0.1 <0.1 С6:0 Nylon <0.1 <0.1 С8:0 Caprylic <0.1 <0.1 From 10:0 Capric <0.1 <0.1 From 12:0 Lauric <0.1 <0.1 From 14:0 Myristic <0.1 <0.1 С15:0 Pentadecanoic <0.1 <0.1 From 16:0 Palmitic 4.3 3.9 From 17:0 Margarine <0.1 <0.1 С18:0 Stairine 2.9 2.5 C20:0 Arachinoic 0.8 0.5 C22:0 Begen 0.4 0.2 C24:0 Lignoceric 0.1 0.1 Total Saturates 8.7 7.3

- 62 042743

Monounsaturated TAG (%) C 14:1 Myristoleic <θ,ι <0.1 C 16:1 Palmitoleic 0.2 OD C 17:1 Heptadecenoic <0.1 <0.1 С18:1 Oleic 44.9 58.8 C20:1 Eicosene 1.3 1.0 C22:1 To goat <0.1 <0.1 C24:1 Nervonic <0.1 <0.1 PUFA TAG (%) Ο18:2ω6 Linoleic 7.6 18.9 Ο18:3ω6 gamma linolenic 0.5 <0.1 Ο18:3ω3 alpha-linolenic 20.9 10.5 020:2ω6 Eicosadiene <0.1 <0.1 Ο20:3ω6 Eicosatriene <0.1 <0.1 C20:SuZ Eicosatriene 0.6 <0.1 Ο20:4ω6 Arachidon <0.1 <0.1 Ο20:5ω3 Eicosapentaenoic 0.4 <0.1 Ο22:2ω6 Docosadiene <0.1 <0.1 Ο22:4ω6 Docosatetraenoic <0.1 <0.1 Ο22:5ω3 Docosapentaenoic 1.0 <0.1 C22:6sh3 Docosahexaenoic 9.4 0.2 Total PUFA Content (%) 40.6 29.9 Total Mono Trans Fatty Acids 0.1 0.2 Total Poly Trans Fatty Acid Content 0.8 0.2 P : M : S ratio 4.7:5.4:1 4.1:8.2:1 PUFA (%) Omega 3 Fatty Acids 32.3 10.9 Omega 6 Fatty Acids 8.2 19.0 ω3:ω6 3.94 0.57 vitamins

- 63 042743

Component (units) NS-B50027-4 AV Jade beta-carotene (µg/100g) 110 82 alpha-tocopherol (mg/100g) 19 15 beta-tocopherol (mg/100g) <0.1 <0.1 delta-tocopherol (mg/100g) 0.6 0.8 gamma-tocopherol (mg/100g) 43 42 Astaxanthin (mg/kg) <0.05 <0.05 Vitamin K1 (µg/100g) 17 15 Phytosterols (mg/100g) Cholesterol <5.0 <5.0 Brassicasterin 29 67 campesterol 250 170 Campestanol <5.0 <5.0 Stigmasterin <5.0 <5.0 beta-sitosterol 370 320 beta-sitostanol 34 27 General content Phytosterols 690 600

In accordance with the Budapest Treaty, applicants have deposited at least 2,500 canola seeds NS-B50027-4 with the American Type Culture Collection (ATCC®), located at 10801 University Blvd., Manassas, Va., 20110-2209, USA., accession number PTA-123186 and seed viability was confirmed by ATCC®. During the consideration of this application, access to the invention may be granted to the Commissioner upon request; all restrictions on availability to the public are irrevocably waived upon the grant of a patent; line deposit NS-B5OO27-4 will be held at the ATCC depository, which is a government depository, for 30 or 5 years after the most recent request or for the duration of the patent, whichever is greater, and will be replaced if it becomes unviable during this period. Seed viability was tested at the time of deposit. Applicants complied with all requirements of 337 C.F.R. § 1.801-1.809. Applicants place no restrictions on the availability of deposited materials from the ATCC; however, the applicant is not entitled to waive any restrictions imposed by law on the transfer of biological material or its transport in commerce. Applicant does not waive any infringement of its rights under this patent or the Plant Variety Protection Act (7 U.S.C. § 2321 et seq.).

While the foregoing embodiments of the invention have been described in some detail by way of illustration and example for the purposes of clarity and understanding, one skilled in the art will appreciate that certain alterations and modifications, such as single gene modifications and mutations, somoclonal variants, variant individuals selected from large populations of plants of a given inbred line, and the like, can be carried out within the scope of the invention, which is limited solely by the appended claims.

Claims (27)

1. Seed useful for the production of docosahexaenoic acid (DHA), wherein said seed is from an inbred transgenic Brassica line or progeny thereof, designated NS-B50027-4, wherein a representative seed of said NS-B50027-4 is deposited under Accession Number ATCC PTA- 123186, wherein the seed is identified by genetic analysis of the border of the first transgenic locus, characterized as containing SEQ ID NO: 43 and/or SEQ ID NO: 44, sequences at least 95% identical to any or both of the specified sequences, or their complements, and the boundaries of the second transgenic locus, characterized as containing SEQ ID NO: 45 and/or SEQ ID NO: 46, sequences at least 95% identical to any or both of these sequences, or their complements, and the specified the boundaries of the first transgenic locus and the second transgenic locus are the A02 transgenic locus and the A05 transgenic locus, respectively. 2. Method for in vitro detection of the presence of DNA characteristic of the transgenic Brassica, designated - 64 042743 as NS-B50027-4, in a sample containing DNA, where the specified method includes (a) contacting the specified sample with a pair of primers for the region of the border of the first transgenic locus and a pair of primers for the region of the border of the second transgenic locus, which when used in the reaction nucleic acid amplifications with genomic DNA from the NS-B5OO27-4 elite event produce a first transgenic locus amplicon and a second transgenic locus amplicon that are diagnostic for the NS B50027-4 elite event; (b) carrying out a nucleic acid amplification reaction, thereby obtaining said first and second amplicons; and (c) detecting amplicons, wherein the amplicon for said first transgenic locus comprises the border region of SEQ ID NO: 43 and/or SEQ ID NO: 44 or their complement, and the amplicon for said second transgenic locus contains the border region of SEQ ID NO: 45 and/ or SEQ ID NO: 46 or their complement, moreover, the detected amplicons for the first transgenic locus and the second transgenic locus indicate the presence of the transgenic locus of the A02 chromosome and the transgenic locus of the A05 chromosome, respectively, which are characteristic of the elite transgenic object NS-B50027-4, seed characteristics which were deposited under access number АТСС РТА-123186. 3. The method of claim 2, wherein said primer pair for said region of the border of the first transgenic locus is selected from SEQ ID NO: 17-23 (A05 Insertion border 1) or SEQ ID NO: 24-27 (A05 Insertion border 2), according to at least ten contiguous nucleotides of any of these primers or their complements; said pair of primers for said region of the border of the second transgenic locus is selected from SEQ ID NOs: 28-30 (A02 Insertion border 1) or SEQ ID NOs: 31-36 (A02 Insertion border 2), at least ten contiguous nucleotides of any of these primers or their complements. 4. An in vitro method for detecting the presence of at least one transgenic locus in a sample containing plant DNA, the method being diagnostic for a transgenic Brassica designated NS B50027-4, a representative seed of which has been deposited under ATCC accession number PTA-123186, wherein said the method includes (a) contacting said sample with at least one first primer that binds to a first transgene flanking boundary region of said first transgenic locus, said at least one first primer being selected from the primer group consisting of SEQ ID NOs: 17- 23 (A05 Insertion boundary 1); at least one second primer that binds to a second transgene flanking boundary region of said first transgenic locus, said at least one second primer being selected from the primer group consisting of SEQ ID NOs: 24-27 (A05 Insertion boundary 2); at least one third primer that binds to a first transgene flanking boundary region of said second transgenic locus, said at least one third primer being selected from the primer group consisting of SEQ ID NOs: 28-30 (A02 Insertion boundary 1); at least one fourth primer that binds to a second flanking transgene boundary region of said second transgenic locus, said at least one fourth primer being selected from the primer group consisting of SEQ ID NOs: 31-37 (A02 Insertion boundary 2); or at least ten contiguous nucleotides or complements thereof; (b) subjecting said sample to a polymerase chain reaction; and (c) analysis of the amplicons generated between said primers, wherein the generated amplicons for the first and second transgenic locus are indicative of the presence of the A02 chromosome transgenic locus and the A05 chromosome transgenic locus, respectively, which are diagnostic for the elite transgenic event NS-B50027-4, the characteristic seed which is deposited under the access number АТСС РТА-123186. 5. The method of claim 4, wherein said method is a competitive allele-specific PCR based genotyping assay. 6. The method of claim 4, further comprising in step (a) contacting said sample with at least one primer that generates an amplicon characteristic of at least one NS-B5OO27-4 transgene, the primer being selected from SEQ ID NO: 1 -16, at least ten contiguous nucleotides of any of these primers or their complements, with at least one transgene selected from Micromonas pusilla Δ6 desaturase, Pyramimonas cordata Δ5-elongase, Pavlova salina Δ5-desaturase, Pichia pastoris Δ15/ω3-desaturase gene , Pavlova salina Δ4-desaturase, Lachancea kluyveri Δ12-desaturase, or P. cordata Δ6-elongase. - 65 042743 7. A kit containing components for carrying out the method according to claims 2-6, where said kit contains at least one DNA selected from SEQ ID NO: 17-37, SEQ ID NO: 51, or SEQ ID NO: 52. 8. Plant or plant part identified by the method according to any one of claims 2-6. 9. Seed identified by the method according to any one of claims 2-6. 10. A process for producing canola oil containing docosahexaenoic acid (DHA), comprising treating seed from an inbred canola line designated as NS-B50027-4 or a progeny thereof, wherein a representative seed of said inbred canola line is deposited under ATCC accession number PTA-123186, to obtain canola oil containing DHA. 11. A process for producing canola oil containing docosahexaenoic acid (DHA) comprising the steps of (a) introgressing NS-B50027-4 deposited under ATCC accession number PTA-123186 into an elite line of Brassica that is sterile; (b) introgression of NS-B50027-4 into a second elite line of Brassica that is fertile; (c) crossing two lines (a) and (b) to obtain hybrid offspring; (d) cultivating the seed of the hybrid progeny; (e) collecting grain resulting from the cultivation of the hybrid progeny; and (f) extracting the oil containing DHA from the hybrid progeny seed. 12. The method of claim 11, wherein said hybrid progeny comprises at least one trait selected from herbicide resistance, insect resistance, bacterial disease resistance, fungal disease resistance, viral disease resistance, or sterility. 13. The method according to claim 11 or 12, wherein said Brassica is B. juncea or B. napus. 14. Genomic DNA of an inbred canola line NS-B50027-4, wherein a representative seed of said NS-B50027-4 is deposited under ATCC accession number PTA-123186, said genomic DNA is characterized by the content of SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45 and SEQ ID NO: 46 or their complements, the sequences of which represent the boundaries of the transgenic loci of chromosome A02 and chromosome A05, which are characteristic of the inbred canola line NS-B50027-4. 15. A plant cell useful for identifying a Brassica plant that produces docosahexaenoic acid, the cell being from an inbred transgenic Brassica line or progeny thereof, designated NS B50027-4, with a representative seed of said NS-B50027-4 deposited under Accession Number ATCC PTA -123186 and contains (a) SEQ ID NO: 43 and SEQ ID NO: 44, sequences at least 95% identical to the specified sequences, or their complements; (b) SEQ ID NO: 45 and SEQ ID NO: 46, sequences at least 95% identical to the specified sequences, or their complements; or (c) both (a) and (b); the sequences of which represent the boundaries of the transgenic loci of chromosome A02 and chromosome A05, which are characteristic of the inbred canola line NS-B50027-4. 16. A method for detecting the presence of an NS-B50027-4 transgenic entity in canola or its progeny in a sample containing plant DNA, said method comprising (a) contacting said sample with at least one primer specific for a 5' flanking boundary region between insert A02 and native DNA A02 chromosome Brassica, and the specified 5' flanking boundary region is in the range of nucleotides from 2033 to 2132 of the sequence of SEQ ID NO: 40; or at least one primer specific for a 3' flanking boundary region between the A02 insert and native Brassica chromosome A02 DNA, said 3' flanking boundary region being in the range of nucleotides 14156 to 14255 of SEQ ID NO: 40; or at least one primer specific for the 5' flanking boundary region between the A05 insert and the native A05 DNA of the Brassica chromosome, said 5' flanking boundary region being in the range of nucleotides 1110 to 1209 of SEQ ID NO: 41; or at least one primer specific for the 3' flanking boundary region between the A05 insert and the native A05 DNA of the Brassica chromosome, said 3' flanking boundary region being in the range of nucleotides 47724 to 47823 of SEQ ID NO: 41; or at least ten or fifteen contiguous nucleotides or complements thereof; (b) subjecting said sample to a polymerase chain reaction; and (c) analyzing the amplicons generated between said primers, said method being diagnostic for an elite transgenic event. - 66 042743 NS-B50026-4, whose characteristic seed was deposited under accession number ATCC PTA-123186. 17. The method of claim 16, wherein the method is a competitive allele-specific PCR based genotyping assay. 18. The method according to p. inserts and 57 p. DNA chromosome A02 Brassica. 19. The method according to p. inserts and 54 p. DNA chromosome A02 Brassica. 20. The method according to p. inserts and 50 p. DNA chromosome A05 Brassica. 21. The method according to p. inserts and 50 p. DNA chromosome A05 Brassica. 22. A method for detecting the presence of an NS-B50027-4 transgenic entity in a sample containing plant DNA, said method comprising (a) contacting said sample with at least one primer specific for the 5' flanking boundary region between the A02 insert and the native DNA A02 chromosome Brassica, and the specified 5' flanking boundary region is in the range of nucleotides from 2040 to 2139 of the sequence of SEQ ID NO: 40; or at least one primer specific for the 3' flanking boundary region between the A02 insert and the native A02 DNA of the Brassica chromosome, said 3' flanking boundary region being in the range of nucleotides 14152 to 14251 of SEQ ID NO: 40; or at least one primer specific for the 5' flanking boundary region between the A05 insert and the native A05 DNA of the Brassica chromosome, said 5' flanking boundary region being in the range of nucleotides 1110 to 1209 of SEQ ID NO: 41; or at least one primer specific for the 3' flanking boundary region between the A05 insert and the native A05 DNA of the Brassica chromosome, said 3' flanking boundary region being in the range of nucleotides 47724 to 47823 of SEQ ID NO: 41; or at least ten or fifteen contiguous nucleotides or complements thereof; (b) subjecting said sample to a polymerase chain reaction; and (c) analyzing the amplicons generated between said primers, said method being diagnostic for the elite transgenic event NS-B50026-4, whose characteristic seed is deposited under ATCC accession number PTA-123186. 23. The method of claim 22, wherein the method is a competitive allele-specific PCR based genotyping assay. 24. The method according to p. inserts and 50 p. DNA chromosome A02 Brassica. 25. The method according to p. inserts and 50 p. DNA chromosome A02 Brassica. 26. The method according to p. inserts and 50 p. DNA chromosome A05 Brassica. 27. The method according to p. inserts and 50 p. DNA chromosome A05 Brassica.