EA042734B1 - COMBINATION CONTAINING A PPAR AGONIST AS ELAFIBRANOR AND AN ACETYL-CoA CARBOXYLASE (ACC) INHIBITOR - Google Patents

Description

The present invention relates to combination therapy for the treatment of inflammatory, metabolic, fibrotic and cholestatic diseases.

1-[4-Methylthiophenyl]-3-[3,5-dimethyl-4-carboxydimethylmethyloxyphenyl]prop-2-en-1-one (elafibranor or ELA, formerly GFT505) disclosed in patent document WO 2004/005233 has properties that may be useful in the treatment of a number of gastroenterological and liver diseases, in particular cholestatic diseases, such as PBC (primary biliary cholangitis) and PSC (primary sclerosing cholangitis), or liver diseases, in particular non-alcoholic fatty liver disease (NAFLD), for example non-alcoholic steatohepatitis (NASH).

Elafibranor was tested for clinical efficacy in NASH in a one-year phase 2b liver biopsy study (GFT505-212-7), one of the largest intervention studies ever conducted for NASH. To date, in more than 800 patients and healthy volunteers, elafibranor has demonstrated beneficial properties for NASH, including but not limited to improvement in markers of liver dysfunction including ALT, ACT, υΓΤΦ, ALP; improved insulin sensitivity and glucose homeostasis; beneficial effects on plasma lipids, including a reduction in plasma triglycerides and LDL-X, and an increase in HDL-X; anti-inflammatory properties; efficacy on histological parameters of NASH (steatosis, inflammation, fibrosis) in animal models of disease and antifibrotic activity. The absence of safety concerns was confirmed in a full toxicological analysis prior to two years of carcinogenicity studies. Elafibranor is currently being evaluated in Phase 3 clinical trials for the treatment of NASH. Phase 2 clinical trials are also scheduled to evaluate this molecule for the treatment of PBC.

Due to its good therapeutic and pharmacological profile, elafibranor is a very promising molecule that can potentially be used in combined pharmacological approaches to target parallel or complementary key pathways involved in a large number of inflammatory, metabolic, fibrotic and cholestatic diseases.

The essence of the invention

The present invention relates to a combination drug containing:

(i) a PPAR agonist, in particular a compound of formula (I) or a pharmaceutically acceptable salt thereof:

where Y ₁ represents a halogen, a group Ra or Ga-Ra;

A represents a CH=CH or CH2-CH2 group;

Y2 is a Gb-Rb group;

Ga and Gb, identical or different from each other, represent an oxygen or sulfur atom;

Ra represents a hydrogen atom, an unsubstituted (C ₁ -C ₆ )alkyl group, a (C ₆ -C ₁₄ )aryl group, or a (C ₁ -C ₆ )alkyl group which is substituted by one or more halogen atoms, (C ₁ -C ₆ ) alkoxy or (C ₁ -C ₆ ) alkylthio, (C ₃ -C ₁₄ ) cycloalkyl groups, (C ₃ -C ₁₄ ) cycloalkylthio groups or heterocyclic groups;

Rb is a (C ₁ -C ₆ )alkyl group substituted with at least a -COORc group, where Rc is a hydrogen atom or a (C ₁ -C ₆ )alkyl group which is substituted or unsubstituted by one or more halogen atoms, ( C ₃ -C ₁₄ cycloalkyl groups, or heterocyclic groups; And

Y ₄ and Y5, identical or different from each other, represent a (C ₁ -C ₆ )alkyl group which is substituted or unsubstituted by one or more halogen atoms, (C ₃ -C ₁₄ )cycloalkyl groups or heterocyclic groups;

(ii) an anti-NASH, anti-fibrotic or anti-cholestatic agent.

In a particular embodiment, a compound of formula (I):

Y1 is a halogen, Ra or Ga-Ra group;

A represents a CH=CH group;

Y2 is a Gb-Rb group;

Ga and Gb, identical or different from each other, represent an oxygen or sulfur atom;

- 1 042734

Ra is a (C1-C6)alkyl or ( _C3 - _C14 )cycloalkyl group, in particular a (C1- _C6 )alkyl or ( _C3 - _C14 )cycloalkyl group, whether or not substituted with one or more halogen atoms;

Rb is a (C ₁ -C ₆ )alkyl group substituted with a -COOR ₃ group, where Rc is a hydrogen atom or an alkyl group having one to four carbon atoms; And

Y ₄ and Y ₅ independently represent a (C ₁ -C ₄ )alkyl group.

In a particular embodiment, a compound of formula (I):

Y 1 represents a Ra or Ga-Ra group;

A is a CH2-CH2 group;

Y2 is a Gb-Rb group;

Ga is an oxygen or sulfur atom and Gb is an oxygen atom;

Ra is a (C1-C ₆ )alkyl or (C ₃ -C ₁₄ )cycloalkyl group;

Rb is a (C1-C ₆ )alkyl group substituted with at least a -COORc group, where Rc is a hydrogen atom or a (C1-C ₄ )alkyl group;

Y ₄ and Y ₅ independently represent a (C1-C ₄ )alkyl group.

In a particular embodiment, a compound of formula (I):

Y ₁ represents a halogen atom or a Ra or Ga-Ra group;

A is a CH2-CH2 group;

Y ₂ is a Gb-Rb group;

Ga is an oxygen or sulfur atom and Gb is an oxygen atom;

Ra represents a (C1-C ₆ )alkyl or (C ₃ -C ₁₄ )cycloalkyl group which is substituted by one or more halogen atoms;

Rb is a (C1-C ₆ )alkyl group, substituted or unsubstituted with one or more halogen atoms and substituted with at least a -COORc group, where Rc is a hydrogen atom or a (C1-C ₄ )alkyl group; And

Y ₄ and Y ₅ represent a (C1-C ₄ )alkyl group.

In a specific embodiment, in the compound of formula (I), Gb is an oxygen atom and Rb is a (C1-C ₆ )alkyl group substituted with a -COORc group, where Rc is a hydrogen atom or an unsubstituted linear or branched (C1-C ₄ ) an alkyl group.

In a specific embodiment, in the compound of formula (I), Y ₁ is a (C1-C ₆ )alkylthio group that contains a (C1-C ₆ )alkyl group that is linear or branched, that is substituted or unsubstituted by one or more halogen atoms .

In a specific embodiment, the compound of formula (I) is selected from the group consisting of:

1-[4-methylthiophenyl]-3-[3,5-dimethyl-4-carboxydimethylmethyloxyphenyl]prop-2-en-1-one (elafibranor or GFT505),

1-[4-methylthiophenyl]-3-[3,5-dimethyl-4-isopropyloxycarbonyldimethylmethyloxyphenyl]prop-2-en1-one,

1-[4-methylthiophenyl]-3-[3,5-dimethyl-4-tert-butyloxycarbonyldimethylmethyloxyphenyl]prop-2en-1-one,

1-[4-trifluoromethylphenyl]-3-[3,5-dimethyl-4-tert-butyloxycarbonyldimethylmethyloxyphenyl]prop2-en-1-one,

1-[4-trifluoromethylphenyl]-3-[3,5-dimethyl-4-carboxydimethylmethyloxyphenyl]prop-2-en-1-one,

1-[4-trifluoromethyloxyphenyl]-3-[3,5-dimethyl-4-tert-butyloxycarbonyldimethylmethyloxyphenyl]prop-2-en-1-one,

1-[4-trifluoromethyloxyphenyl]-3-[3,5-dimethyl-4-carboxydimethylmethyloxyphenyl]prop-2-en-1-one, 2-[2,6-dimethyl-4-[3-[4-(methylthio )phenyl]-3-oxopropyl]phenoxy]-2-methylpropanoic acid and 2-[2,6-dimethyl-4-[3-[4-(methylthio)phenyl]-3-oxopropyl]phenoxy]-2- isopropyl ester methylpropanoic acid.

In a specific embodiment of the invention, component (ii) is an anti-NASH agent. Illustrative, non-limiting anti-NASH agents useful in the practice of the present invention include:

acetyl-CoA carboxylase inhibitors;

A3 adenosine receptor agonists;

aldosterone antagonists and mineralocorticoid antagonists;

AMPK-activated protein kinase stimulator, amylin receptor agonist and calcitonin receptor agonists;

angiopoietin-like protein 3 inhibitors;

anti-LPS antibodies;

inhibitors of the apical sodium-dependent bile acid transporter;

betaine anhydrous or RM-003;

- 2 042734 biologically active lipids;

cannabinoid CBl receptor antagonists;

dual inhibitor of cannabinoid CB1 receptors/iNOS;

caspase inhibitors;

cathepsin inhibitors;

CCK antagonists;

chemokine CCK3 modulators and eotaxin 2 ligand inhibitors;

diacylglycerol O-acyltransferase (dGaT) inhibitors;

dipeptidyl peptidase IV (dPP4) inhibitors;

agonists of insulin ligand and insulin receptors;

an insulin sensitizer and an MHC-1 receptor antagonist;

NOX inhibitors (Nadfn-oxidase), for example dual NOX inhibitors 1 and 4;

extracellular matrix protein modulators;

stearoyl-Coa desaturase-1 inhibitors/fatty-bile acid conjugates (FABAC);

fatty acid synthase (FAS) inhibitors:

fibroblast growth factor 19 (FGF-19) receptor ligands, such as recombinant fibroblast growth factor 19 (FGF-19) protein or a functional engineered variant of the FGF-19 protein;

fibroblast growth factor 21 (FGF-21) receptor ligands, for example, fibroblast growth factor 21 (FGF-21) protein or a functional engineered variant of the FGF-21 protein;

farnesoid X receptor (FXR) agonists;

galectin 3 inhibitors;

glucagon-like peptide-1 (GLP-1) analogs and GLP-1 receptor agonists;

G-protein coupled receptor (GPCR) modulators;

G protein-coupled receptor antagonist 84, connective tissue growth factor ligand inhibitor and free fatty acid receptor agonists 1;

inhibitors of the Hedgehog signaling pathway in cells;

integrin inhibitors;

ketohexokinase inhibitors, leukotriene (LT)/phosphodiesterase (PDE)/lipoxygenase (LO) inhibitors;

lysyl oxidase 2 homologue inhibitors (LOXL2 inhibitors);

macrolides;

methyl-CpG-binding protein modulator and transglutaminase inhibitors;

miRNA antagonists;

a mitochondrial carrier family inhibitor and a mitochondrial phosphate carrier protein inhibitor;

monoclonal antibodies;

myeloperoxidase inhibitors;

mTOR modulators;

stimulator of Nad-dependent deacetylase sirtuin-1;

PDE-5 inhibitor;

nicotinic acid receptor agonists (GPR109);

nuclear receptor ligands;

agonists of the P2Y13 protein;

phenylalanine hydroxylase stimulants;

protease-activated receptor (PAR)-2 antagonists;

protein kinase modulators;

PPAR alpha agonists;

PPAR-gamma agonists;

PPAR delta agonists;

PPAR alpha/gamma agonists;

PPAR alpha/delta agonists;

PPAR-gamma/delta;

PPAR alpha/gamma/delta agonists or PPAR pan agonists;

inhibitors of Rho-associated protein kinase 2 (ROCK2);

inhibitors of sodium glucose transporter (SGLT) 1;

sodium glucose transporter (SGLT) 2 inhibitors;

stearoyl-Coa desaturase-1 inhibitors;

signal-regulating kinase 1 (ASK1) inhibitors;

agonists of thyroid β-receptors (THR β);

antagonists of toll-like receptors 2 (TLR-2);

toll-like receptor 4 (TLR-4) antagonists;

- 3 042734 inhibitors of natural killer T-cells type I;

tyrosine kinase receptor modulators (RTK);

urate anion exchanger 1 inhibitors and xanthine oxidase inhibitors;

vascular adhesion protein-1 (VAP-1) inhibitors; and vitamin D receptor (VDR) agonists.

In a further specific embodiment of the invention, component (ii) is an anti-NASH agent.

In a particular embodiment, the anti-NASH agent is selected from:

acetyl-Coa carboxylase inhibitors;

anti-LPS antibodies;

inhibitors of the apical sodium-dependent bile acid transporter;

biologically active lipids;

cannabinoid CB1 receptor antagonists;

a dual inhibitor of cannabinoid CB1 receptors/iNOS;

caspase inhibitors;

cathepsin inhibitors;

CCK antagonists;

diacylglycerol O-acyltransferase (dGaT) inhibitors;

dipeptidyl peptidase IV (dPP4) inhibitors;

NOX (NadPH oxidase) inhibitors, eg dual NOX 1 and 4 inhibitors;

extracellular matrix protein modulators;

stearoyl-Coa desaturase-1/fatty-bile acid conjugates (FABAC) inhibitors;

fibroblast growth factor 19 (FGF-19) receptor ligands, such as recombinant fibroblast growth factor 19 (FGF-19) protein or a functional engineered variant of the FGF-19 protein;

fibroblast growth factor 21 (FGF-21) receptor ligands, for example, fibroblast growth factor 21 (FGF-21) protein or a functional engineered variant of the FGF-21 protein;

farnesoid X receptor (FXR) agonists;

galectin 3 inhibitors;

analogues of glucagon-like peptide-1 (GLP-1);

G-protein coupled receptor (GPCR) modulators;

integrin inhibitors;

leukotriene (LT)/phosphodiesterase (PDE)/lipoxygenase (LO) inhibitors;

macrolides;

miRNA antagonists, monoclonal antibodies;

mTOR modulators;

nuclear receptor ligands;

agonists of the P2Y13 protein;

protease-activated receptor (PAR)-2 antagonists;

protein kinase modulators;

PPAR-alpha agonists;

PPAR-gamma agonists;

PPAR delta agonists;

PPAR alpha/gamma agonists;

PPAR alpha/delta agonists;

PPAR-gamma/delta;

PPAR alpha/gamma/delta agonists or PPAR pan agonists;

inhibitors of Rho-associated protein kinase 2 (ROCK2);

sodium glucose transporter (SGLT) 2 inhibitors;

signal-regulating kinase 1 (ASK1) inhibitors;

agonists of thyroid β-receptors (THR β);

antagonists of toll-like receptors 4 (TLR-4);

tyrosine kinase (RTK) receptor modulators;

vascular adhesion protein-1 (VAP-1) inhibitors; and vitamin D receptor (VDR) agonists.

Other anti-NASH agents include KB-GE-001 and NGM-386 as well as NGM-395, NC-10 and TMC-606F. Additional anti-NASH agents include icosabutate, NC-101, NAIA-101, colesevelam, and PRC-4016.

In a particular embodiment of the invention, component (ii) is an anti-fibrotic agent. Illustrative, non-limiting anti-fibrotic agents useful in the practice of the present invention include:

- 4 042734 A3 adenosine receptor agonists;

angiotensin II receptor blockers; antisense oligonucleotides targeting transforming growth factor beta 2 (TGF-e2);

biologically active lipids;

caspase inhibitors;

cannabinoid CB2 receptor mimetics;

double farnesoid X receptor (FXR)/TGR5 agonists;

NOX (naDPH oxidase) inhibitors, eg dual NOX 1 and 4 inhibitors;

galectin 3 inhibitors;

inhibitors of the Hedgehog signaling pathway in cells;

immunomodulators;

integrin inhibitors;

macrophage mannose receptor modulators;

metalloproteinase-9 (MMP-9) stimulators;

monoclonal antibodies;

NF-kappa-B inhibitors;

non-steroidal anti-inflammatory drugs (nPVDs);

PDGFR modulators;

PPAR alpha agonists;

PPAR-gamma agonists;

PPAR delta agonists;

PPAR alpha/gamma agonists;

PPAR alpha/delta agonists;

PPAR-gamma/delta;

PPAR alpha/gamma/delta agonists or PPAR pan agonists.

In another specific embodiment, the antifibrotic agent is selected from the group consisting of:

antisense oligonucleotides targeting transforming growth factor beta 2 (TGF-e2);

biologically active lipids;

caspase inhibitors;

cannabinoid CB2 receptor mimetics;

dual farnesoid X receptor (FXR)/TGR5 agonists;

NOX (nadPn oxidase) inhibitors, eg dual NOX 1 and 4 inhibitors;

galectin 3 inhibitors;

immunomodulators;

integrin inhibitors;

macrophage mannose receptor modulators;

stimulators of metalloproteinases-9 (MMP-9);

monoclonal antibodies;

NF-kappa-B inhibitors;

non-steroidal anti-inflammatory drugs (nPVD) PDGFR modulators;

PPAR-alpha agonists;

PPAR-gamma agonists;

PPAR delta agonists;

PPAR alpha/gamma agonists;

PPAR alpha/delta agonists;

PPAR-gamma/delta;

PPAR alpha/gamma/delta agonists; or PPAR pan agonists.

Other antifibrotic agents include HEC-585, INV-240, therapeutic

RNA interference (Silence Therapeutics) and the SAMiRNA program (Bioneer Corp).

Other exemplary antifibrotic agents include pirfenidone or tyrosine kinase receptor inhibitors (RTKIs) such as nintedanib, sorafenib and other RTKIs or angiotensin II receptor (AT1) blockers or a CTGF inhibitor or any antifibrotic compound, a compound capable of interfering with TGFe- and BMP- activated pathways, including TGFe latent complex activators, eg MMP2, MMP9, THBS1 or cell surface integrins, TGFe type I (TGFBRI) or type II (TGFBRII) receptors and their ligands, eg TGFe, activin, inhibin, nodal, anti-Müllerian hormone, GDF or BMPs, accessory co-receptors (also known as type III receptors), or components of a SMAD-dependent canonical pathway, including SMAD regulatory or inhibitory proteins, or members of SMAD-independent or non-canonical pathways, including various branches of the MAPK signaling pathway, the TAK1 signaling pathway , the Rho GTPases signaling pathway, the phosphatidylinositol-3 kinase/AKT pathway, the TGFe-induced EMT process, or canonical and non-canonical Hedgehog signaling pathways, including Hh ligands or target genes, or any members of the WNT pathway, or the Notch pathway that are sensitive to the influence of TGFe.

In a particular embodiment of the invention, component (ii) is an anti-cholestatic agent. Illustrative, non-limiting, anti-cholestatic agents useful in the practice of the present invention include:

inhibitors of the apical sodium-dependent bile acid transporter (ASBTi);

bile acids;

cathepsin inhibitors;

CCK antagonists;

CD40 inhibitors;

CD80 inhibitors;

NOX (NaDPH oxidase) inhibitors, eg dual NOX 1 and 4 inhibitors;

farnesoid X receptor (FXR) agonists;

recombinant fibroblast growth factor (FGF) 19;

fractalkine ligand inhibitors;

inhibitors of the sodium-dependent bile acid cotransporter in the ileum; monoclonal antibodies;

PPAR alpha agonists;

PPAR-gamma agonists;

PPAR delta agonists;

PPAR alpha/gamma agonists;

PPAR alpha/delta agonists;

PPAR-gamma/delta;

PPAR alpha/gamma/delta agonists or PPAR pan agonists.

In a particular embodiment, the anti-cholestatic agent is selected from the group consisting of:

inhibitors of the apical sodium-dependent bile acid transporter (ASBTi);

bile acids;

cathepsin inhibitors;

CCK antagonists;

CD40 inhibitors;

CD80 inhibitors;

NOX inhibitors (NaDPH oxidase);

farnesoid X receptor (FXR) agonists;

recombinant fibroblast growth factor (FGF) 19;

fractalkine ligand inhibitors;

inhibitors of the sodium-dependent bile acid cotransporter in the ileum; monoclonal antibodies;

PPAR-alpha agonists;

PPAR-gamma agonists;

PPAR delta agonists;

PPAR alpha/gamma agonists;

PPAR alpha/delta agonists;

PPAR-gamma/delta;

PPAR alpha/gamma/delta agonists or PPAR pan agonists;

Exemplary acetyl-CoA carboxylase inhibitors include, but are not limited to, GS-0976, ND-654, AC-8632, PF05221304, CP640186, gemcaben, MK-4074, and PF05175157.

Exemplary A3 adenosine receptor agonists include, but are not limited to, 2-(1-hexynyl)-N-methyladenosine, piclidenosone CF-101 (IB-MECA), namodenosone CF-102, 2-C1-IB-MECA, CP-532,903, inosine, LUF-6000 and MRS-3558.

Exemplary aldosterone antagonists and mineralocorticoid receptor antagonists include, but are not limited to, apararenone (MT 3995), amiloride, spironolactone, eplerenone, potassium canrenone and canrenoate, progesterone, drospirenone, gestodene, and benidipine.

Exemplary AMPK stimulators include, but are not limited to, PXL-770, MB-11055 debio-0930B metformin, CNX-012, O-304, mangiferin calcium, eltrombopag, carotuximab, and imeglimin.

Exemplary amylin receptor agonists and calcitonin receptor agonists include, but are not limited to, KBP-042 and KBP-089.

- 6 042734

Exemplary angiopoietin-like protein 3 inhibitors include, but are not limited to,

ARO-ANG3, IONIS-ANGGPTL3-LRx or AKCEA-ANGPTL3LRx, evinacumab, and ALN-ANG.

According to the invention, the term angiotensin type 1 receptor antagonists in the context of this document includes, but is not limited to, irbesartan.

According to the invention, the term anti-LPS antibodies in the context of this document includes, but is not limited to, IMM-124-E.

Exemplary antisense oligonucleotides targeting transforming growth factor beta 2 include, but are not limited to, ASPH-0047, IMC-TR1, and ISTH-0047.

An exemplary inhibitor of the apical sodium dependent bile acid transporter includes, but is not limited to, A-4250, volixibate, maralixibate, formerly SHP-625, GSK-2330672, elobixibate, and CJ-14199.

Exemplary bile acids include, but are not limited to, obeticholic acid (OCA) and UDCA, norursodeoxycholic acid, and ursodiol.

Illustrative bioactive lipids include, but are not limited to, 5-hydroxyeicosapentaenoic acid (15-HEPE, DS-102).

In a further specific embodiment, the biologically active lipid may be selected from unsaturated fatty acids, for example 25 arachidonic acid, icosapentethyl ester, eicosapentaenoic acid, and docosahexaenoic acid.

Illustrative cannabinoid CB1 receptor antagonists include, but are not limited to, namacizumab, GRC-10801, MRI-1569, MRI-1867, DBPR-211, AM-6527: AM-6545, NESS-11-SM, CXB-029, GCC- 2680, TM-38837, Org-50189, PF-514273, BMS-812204, ZYO-1, AZD-2207, AZD-1175, otenabant, ibipinabant, surinabant, rimonabant, drinabant, SLV-326, V-24343 and O- 2093.

Illustrative cannabinoid CB2 receptor mimetics include, but are not limited to, perinasum (resunab, JKT-101).

Exemplary caspase inhibitors include, but are not limited to, emricasan, belnacasan, nivocasan, IDN-7314, F-573, VX-166, YJP-60107, MX-1122, IDN-6734, TLC-144, SB-234470, IDN-1965 , VX-799, SDZ-220-976 and L-709049.

Exemplary cathepsin inhibitors include, but are not limited to, VBY-376, VBY-825, VBY-036, VBY-129, VBY-285, Org-219517, LY3000328, RG-7236, and BF/PC-18.

Exemplary CCK antagonists include, but are not limited to, CCK2/5 antagonists such as cenicriviroc; PG-092, RAP-310, INCB-10820, RAP-103, PF-04634817 and CCX-872.

Exemplary CD40 inhibitors include, but are not limited to, FFp-104, x1-050, DOM-0800, XmAb-5485, KGYY-15, FFP-106, TDI-0028 and ABI-793.

Exemplary CD80 inhibitors include, but are not limited to, Rudex, FPT-155, tolerimab, galiximab, SCH-212394, IGM-001, ASP-2408, and SCH-204698.

Exemplary chemokine CCK3 modulators and eotaxin 2 ligand inhibitors include, but are not limited to, bertilimumab, CM-101 (humanized), CM-102, and RNS-60.

Exemplary diacylglycerol O-acyltransferase inhibitors include, but are not limited to, IONIS-DGAT2Rx (formerly ISIS-DGAT2Rx), LY-3202328, BH-03004, KR-69530, OT-13540, AZD-7687, PF-06865571, PF-06424439 and ABT-046.

Exemplary dipeptidyl peptidase IV inhibitors include, but are not limited to, evogliptin, vidagliptin, fotagliptin, alogliptin, saxagliptin, tylogliptin, anagliptin, sitagliptin, retagliptin, melogliptin, gosogliptin, trelagliptin, teneligliptin, dutogliptin, linagliptin, gemigliptin, yogliptin, yogliptin, betarigliptin, betarigliptin vidagliptin and denagliptin.

Exemplary fatty acid synthase (FAS) inhibitors include, but are not limited to, TVB-2640; TVB-3664; TVB-3166, TVB-3150, TVB-3199, TVB-3693BZL-101, 2-octadecic acid, MDX-2, fasnall, MT-061, G28UCM, MG-28, HS-160, GSK-2194069, KD-023 , cilostazol.

In a specific embodiment, the FAS inhibitor is a compound selected from the following list of compounds:

- 7 042734

- 8 042734

In a specific embodiment, the FAS inhibitor is TVB-2640.

Exemplary farnesoid X receptor (FXR)/TGR5 agonists include, but are not limited to, INT-767.

Exemplary NOX (NADPH oxidase) inhibitors include, but are not limited to, dual NOX inhibitors 1 and 4; GKT-831 (2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1Hpyrazolo[4,3-c]pyridine-3,6(2H,5H)-dione, formerly GKT137831 and GKT-901.

Exemplary extracellular matrix protein modulators include, but are not limited to, CNX-024, CNX-025, and SB-030.

Exemplary farnesoid X receptor (FXR) agonists include, but are not limited to, obeticholic acid (OCA), GS-9674, LJN-452 or LJN452, LMB763, EDP-305, AKN-083, INT-767, GNF-5120, LY2562175 , INV-33, NTX-023-1, EP-024297, Px-103 and SR-45023.

Exemplary fractalkine ligand inhibitors include, but are not limited to, E-6011 and KAN-0440567.

Exemplary fibroblast growth factor 19 (FGF-19) receptor ligand, recombinant fibroblast growth factor 19 (FGF-19) protein, or FGF-19 functional engineered variant include, but are not limited to, NGM-282.

An exemplary fibroblast growth factor 21 (FGF-21) receptor ligand, fibroblast growth factor 21 (FGF-21) protein, includes, but is not limited to, PEG-FGF21 (formerly BMS-986036), YH-25348, BMS-986171, YH- 25723, LY-3025876 and NNC-0194-0499.

Exemplary galectin 3 inhibitors include, but are not limited to, GR-MD-02, TD-139, ANG-4021, galectin-3C, LJPC-201, TFD-100, GR-MD-03, GR-MD-04, GM- MD-01, GM-CT-01, GM-CT-02, Gal-100 and Gal-200.

Illustrative glucagon-like peptide (GLP-1) analogs include, but are not limited to, semaglutide, liraglutide, exenatide, albiglutide, dulaglutide, lixisenatide, loxenatide, efpeglenatide, taspoglutide, MKC-253, DLP-205, and ORMD-0901

Exemplary glucagon-like peptide-1 (GLP-1) receptor agonists include, but are not limited to, LY-3305677 and long acting oxyntomodulin.

Exemplary G protein coupled receptor (GPCR) modulators include, but are not limited to, CNX-023.

Exemplary G protein-coupled receptor 84 antagonist (GPR84 antagonist), connective tissue growth factor ligand inhibitor, and free fatty acid receptor 1 agonist (FFAR1 agonist) include, but are not limited to, PBI-4050, PBI-4265, PBI-4283, and PBI -4299.

- 9 042734

Exemplary Hedgehog signaling inhibitors in cells include, but are not limited to, vismodegib, TAK-441, IPI-926, saridegib, sonidegib/erismodegib, BMS-833923/XL139, PF04449913, taladegib/LY ₂ 940680, ETS-2400, SHR-1539 and CUR61414.

Exemplary inhibitors of the sodium-dependent bile acid cotransporter in the ileum include, but are not limited to, A-4250, GSK-2330672, volixibate, CJ-14199, and elobixibate.

Illustrative immunomodulators include, but are not limited to, PBI-4050, PBI-4265, PBI4283, PBI-4299 and AIC-649.

Exemplary insulin sensitizer and MHC-1 receptor agonist include, but are not limited to, MSDC-0602k, MSDC-0602, CSTI-100, and AMRI.

Exemplary integrin inhibitors include, but are not limited to, Pliant Therapeutic Integrin Inhibitors, Indalo Therapeutics Integrin Inhibitors, Saint Louis University Integrin Inhibitors, ProAgio, and GSK-3008348.

Exemplary ketohexokinase inhibitors include, but are not limited to, JNJ-28165722; JNJ-42065426; JNJ-42152981; JNJ-42740815; JNJ-42740828 and PF-06835919.

Exemplary leukotriene/phosphodiesterase/lipoxygenase inhibitors include, but are not limited to, tipelukast (formerly MN-001), tomelukast, sulukast, masilukast, zafirlukast, pranlukast, montelukast, gemilukast, verlukast, aclukast, pobilikast, cinalukast, and iralukast.

Exemplary lysyl oxidase 2 homologue inhibitors include, but are not limited to, Rappaport, Intermun, Pharmaxis, AB-0023, Simtuzumab, PXS-5382A, and PXS-5338.

Illustrative macrolides include, but are not limited to, solitromycin, azithromycin, and erythromycin.

Exemplary macrophage mannose receptor modulators include, but are not limited to, AB-0023, MT-1001, [18F]FB18mHSA, xemis, Tc 99m technetium tilmanocept, and CDX-1307.

Exemplary methyl-CpG-binding protein modulator and transglutaminase inhibitors include, but are not limited to, cysteamine, EC cysteamine, enteric-coated cysteamine bitartrate, cysteamine bitartrate (enteric-coated), bennu, cysteamine bitartrate (enteric-coated), raptor, cysteamine bitartrate , DR cysteamine, delayed-release enteric cysteamine bitartrate, mercaptamine, mercaptamine (enteric-coated), bennu, mercaptamine (enteric-coated), raptor, RP-103, RP-104, procisbi, and mercaptamine (enteric-coated).

Exemplary miRNA antagonists include, but are not limited to, RG-125 (formerly AZD4076), RGLS-5040, RG-101, MGN-5804, and MRG-201.

Exemplary metalloprotease-9 (MMP-9) stimulators include, but are not limited to, Elastomics Ab MMP-9 stimulator.

Exemplary mitochondrial carrier family inhibitor and mitochondrial phosphate carrier protein inhibitor include, but are not limited to, TRO-19622, trophos, olesoxime, RG-6083, or RO-7090919.

Exemplary myeloperoxidase inhibitors include, but are not limited to, PF-06667272.

Illustrative monoclonal antibodies (mAbs) include, but are not limited to, bertilimumab, NGM-313, IL-20 targeting mAbs, frezolimumab (anti-TGFe) (formerly GC1008), thymolumab, formerly BTT-1023, namacizumab, omalizumab, ranibizumab, bevacizumab, lebrikizumab, epratuzumab, felvizumab, matuzumab, monalizumab, reslizumab, foralumab (NI-0401, anti-CD3), simtizumab (GS-6624) anti-LOXL2 mAb, ustekinumab, anti-TNF antibody, and inebilizumab

Exemplary monoclonal antibodies are selected from the group consisting of anti-P.20 mAbs, antiTGFe antibodies, anti-CD3 antibodies, anti-.OX.2 antibodies, and anti-TNF antibodies.

Exemplary mTOR modulators include, but are not limited to, MSDC-0602 and AAB-based gene therapy co-administered with SVP-sirolimus.

An exemplary NAD-dependent deacetylase sirtuin-1 stimulator; PDE-5 inhibitor include, but are not limited to, NS-0200.

Exemplary NF-kappa-B inhibitors include, but are not limited to, LC-280126.

Exemplary nicotinic acid receptor (GPR109) agonists include, but are not limited to, ARI-3037MO, MMF, LUF 6283, acifran, IBC 293, MK-1903, GSK256073, MK-6892, MK-0354, SLx-4090, lomitapide, lexibulin, apabetalone, acifran, laropiprant, daporinad, anacetrapib, INCB-19602, ST-07-02, lomefloxacin, niacin, and controlled release laropiprant.

Illustrative non-steroidal anti-inflammatory drugs (NSAIDs) include, but are not limited to, F-351, salicylates (aspirin), acetaminophen, propionic acid derivatives (ibuprofen, naproxen), acetic acid derivatives (indomethacin, diclofenac), enolic acid derivatives (piroxicam, phenylbutazone ), anthranilic acid derivatives (meclofenalmic acid, flufenamic acid), selective COX-2 inhibitors (celecoxib, parecoxib) and sulfonanilides (nimesulide).

Exemplary nuclear receptor ligands include, but are not limited to, DUR-928 (formerly

- 10 042734

DV 928).

Exemplary P2Y13 protein agonists include, but are not limited to, C-209.

Exemplary PDGFR modulators include, but are not limited to, BOT-501 and BOT-191.

Exemplary phenylalanine hydroxylase stimulants include, but are not limited to, pegvalase, sapropterin, AAV-PAH, CDX-6114 sepiapterin, RMN-168, ALTU-236, ETX-101, hepastem, rolipram, and alprostadil.

Illustrative PPAR alpha agonists include, but are not limited to, fenofibrate, ciprofibrate, pemafibrate, gemfibrozil, clofibrate, binifibrate, clinofibrate, clofibric acid, nicofibrate, pyrifibrate, plafibride, ronifibrate, theofibrate, tocofibrate, and SR10171;

Exemplary PPAR-gamma agonists include, but are not limited to, pioglitazone, deuterated pioglitazone, rosiglitazone, efatutazone, ATx08-001, OMS-405, CHS-131, THR-0921, SER-150-DN, KDT-501, GED-0507- 34-Levo, CLC-3001 and ALL-4.

Exemplary PPAR delta agonists include, but are not limited to, GW501516 (endurabol or ({4-[({4-methyl-2-[4-(trifluoromethyl)phenyl]-1,3-thiazol-5-yl}methyl)sulfanyl ]-2-methylphenoxy}acetic acid)), MBX8025 (celadelpar or {2-methyl-4-[5-methyl-2-(4-trifluoromethyl-phenyl)-2H[1,2,3]triazol-4-ylmethylsilfanyl ]phenoxy}acetic acid), GW0742 ([4-[[[2-[3-fluoro-4-(trifluoromethyl)phenyl]-4-methyl-5-thiazolyl]methyl]thio]-2-methylphenoxy]acetic acid) , L165041, HPP-593 and NCP-1046.

Illustrative PPAR-alpha/gamma agonists (also referred to as glitazars) include, but are not limited to, saroglitazar, aleglitazar, muraglitazar, tesaglitazar, and DSP-8658.

In addition to elafibranor, exemplary PPAR alpha/delta agonists include, without limitation, T913659.

Exemplary PPAR gamma/delta agonists include, but are not limited to, conjugated linoleic acid (CLA) and T3D-959.

Exemplary PPAR alpha/gamma/delta agonists or PPAR pan agonists include, but are not limited to, IVA337 (lanifibranor), TTA (tetradecylthioacetic acid), bavachinin, GW4148, GW9135, bezafibrate, lobeglitazone, and CSO38.

Exemplary protease-activated receptor (PAR)-2 antagonists include, but are not limited to, PZ-235 and NP-003.

Exemplary protein kinase modulators include, but are not limited to, CNX-014, MB-11055, ALF-1, mangiferin, amlexanox, GS-444217, REG-101, and valine.

Exemplary inhibitors of Rho-associated protein kinase 2 (ROCK2) include, but are not limited to, KD-025, TRX-101, BA-1049, LYC-53976, INS-117548, and RKI-1447.

Exemplary signal-regulating kinase 1 (ASK1) inhibitors include, but are not limited to, seloncertib (formerly GS-4997).

Exemplary sodium glucose transporter (SGLT) 1 inhibitors include, but are not limited to, LX-4212/LX-4211/Sotagliflozin, SAR-439954, LIK-066 (lycoglyfosin), LX-2761, GSK161235, LP-925219, KGA-2727 , SAR-7226, SAR-474832, SY-008 and AVX-3O3O.

Exemplary sodium glucose transporter (SGLT) 2 inhibitors include, but are not limited to, remogliflozin, dapagliflozin, empagliflozin, ertugliflozin, sotagliflozin, ipragliflozin, tianagliflozin, canagliflozin, tofogliflozin, yanagliflozin, bexagliflozin, luceogliflozin, sergliflozin, HEC-44616, AST-1935, and PLD-101.

Exemplary stearoyl-CoA desaturase-1/fatty-bile acid conjugates include, but are not limited to, aramchol, GRC-9332, stimchol, SN-2998, GSK-1940029, and XEN-801.

Exemplary thyroid hormone P receptor (THRβ) agonists include, but are not limited to, VK-2809, MGL-3196, MGL-3745, SKL-14763, sobetir, BCT-304, ZYT-1, MB-07811, and eprotir.

Exemplary toll-like receptor 2 and 4 (TLR-2) antagonists include, but are not limited to, CI-201, also known as VB-201.

Exemplary toll-like receptor 4 (TLR-4) antagonists include, but are not limited to, naltrexone, JKB-121, also known as nalmefene, M-62812, resatorvid, dendrofilin, CS-4771, AyuV-1, AyuV-25, NI -0101, EDA-HPVE7 and eritoran.

Exemplary type I natural killer T cell inhibitors include, but are not limited to, GRI-0621.

Exemplary tyrosine kinase (RTK) receptor modulators include, but are not limited to, CNX-025, KBP-7018, nintedanib, and sorafenib.

Exemplary urate anion exchanger 1 inhibitors and xanthine oxidase inhibitors include, but are not limited to, lesinurad, RLBN-1001, verinurad, KUX-1151, and lesinurad + allopurinol.

Exemplary inhibitors of vascular adhesion protein-1 (VAP-1), also referred to as copper-containing oxidases 2 (AOC3), include, but are not limited to, BI-1467335, formerly PXS-4728A, CP-664511, PRX-167700, ASP-8232, RTU -1096, RTU-007 and BTT-1023.

Exemplary vitamin D receptor (VDR) agonists include, but are not limited to, calciferol, alfacalcidol, 1,25-dihydroxyvitamin D3, vitamin D2, vitamin D3, calcitriol, vitamin

D4, vitamin D5, dihydrotachysterol, calcipotriol, tacalcitol, 1,24-dihydroxyvitamin D3, and paricalcitol.

According to the present invention, the term PPAR agonists refers to peroxisome proliferator-activated receptor agonists, which are a class of drugs that play a central role in lipid and glucose homeostasis. PPARa mainly affects fatty acid metabolism and its lipid activation, while PPARy is mainly involved in the regulation of adipogenesis, energy balance and lipid biosynthesis. PPARδ is involved in fatty acid oxidation, mainly in skeletal and cardiac muscle, but also regulates blood glucose and cholesterol levels.

In a more specific embodiment, the compound of formula (I) is elafibranor or a pharmaceutically acceptable salt thereof.

In a specific embodiment, the combination drug of the present invention:

component (i) is elafibranor or a pharmaceutically acceptable salt thereof;

component (ii) is selected from GKT-831, aramhol, SHP-625, emrikasan, saroglitazar, IMM-124-E, GS-9674, NGM-282, A-4250, GR-MD-02, gS-4997, F- 351, solitromycin, remogliflozin, BTT-1023, IVA-337 (lanifibranor), JKB-121 (nalmefene), KD-025, MSDC-0602 or MSDC-0602k, PBI-4050, PEG-FGF21, tipelukast, VK-2809, MGL-3196, Gs-0976, RG-125, Volixibate, Pioglitazone, Semaglutide, GSK2330672, MBX-8025, CP-640186, Seloncertib, GKT-831, PXS-4728A, Vismodegib, CF-102 (Namodenoson), MT-3995 (apararenone), icosapentethyl ether, KD-025, DUR-928 and gemcaben, in particular seloncertib, GKT-831, PXS-4728A, aramchol, PBI-4050, MSDC-0602k, VK-2809, MGL-3196, vismodegib, CF -102 (namodenoson), MT-3995 (apararenone), JKB-121 (nalmefene), emrikasan, KD-025 and DUR-928.

In a specific embodiment, the combination drug of the present invention:

component (i) is elafibranor or a pharmaceutically acceptable salt thereof;

component (ii) is selected from GKT-831, aramhol, SHP-625, emrikasan, saroglitazar, IMM-124-E, GS-9674, NGM-282, A-4250, GR-MD-02, GS-4997, LJN- 452, F-351, solitromycin, remogliflozin, BTT-1023, IVA-337 (lanifibranor), JKB-121, KD-025, MSDC-0602, PBI-4050, PEG-FGF21, tipelukast, VK-2809, MGL-3196 , GS-0976, pentases, RG-125, volixibate, pioglitazone, ursodeoxycholic acid, semaglutide, GSK2330672 and MBX-8025, specifically from aramchol, SHP-625, emrikasan, saroglitazar, IMM-124-E, GS-9674, NGM -282, A-4250, GR-MD-02, GS-4997, LJN-452, F-351, solitromycin, remogliflozin, BTT-1023, IVA-337 (lanifibranor), JKB-121, KD-025, MSDC- 0602, PBI-4050, PEG-FGF21, tipelukast, VK-2809, MGL-3196, GS-0976, RG-125, volixibate, pioglitazone, ursodeoxycholic acid, semaglutide, GSK2330672 and MBX-8025.

In a specific embodiment, the combination drug of the present invention:

component (i) is elafibranor or a pharmaceutically acceptable salt thereof;

component (ii) is selected from GKT-831, aramhol, SHP-625, emrikasan, saroglitazar, IMM-124-E, GS-9674, NGM-282, A-4250, GR-MD-02, gS-4997, F- 351, solitromycin, remogliflozin, BTT-1023, IVA-337 (lanifibranor), JKB-121, KD-025, MSDC-0602, PBI-4050, PEG-FGF21, tipelukast, BK-2809, MGL-3196, GS-0976 , pentases, RG-125, volixibate, pioglitazone, semaglutide, GSK2330672 and MBX-8025.

In a particular embodiment, the combination drug is a combination of ELA and GKT-831, ELA and Seloncertib, ELA and GS-0976, or ELA and Pentasa.

In a specific embodiment, the combination drug is a combination of ELA and GS-0976, ELA and CP-640186, ELA and seloncertib, ELA and GKT-831 (formerly GKT137831), ELA and BI-1467335/PXS-4728A, ELA and aramchol, ELA and PBI-4050, ELA and MSDC-0602k, ELA and VK-2809, ELA and MGL-3196, ELA and vismodegib, ELA and CF-102 (namodenoson), ELA and MT-3995 (apararenone), ELA and JKB- 121 (nalmefene), ELA and emrikasan, ELA and KD-025, ELA and DUR-928 or ELA and gemkaben.

In a particular embodiment, the combination drug is a combination of ELA and seloncertib, ELA and GKT-831 (formerly GKT137831), ELA and BI-1467335/PXS4728A, ELA and aramchol, ELA and PBI-4050, ELA and MSDC-0602k, ELA and VK-2809, ELA and MGL-3196, ELA and vismodegib, ELA and CF-102 (namodenoson), ELA and MT-3995 (apararenone), ELA and JKB-121 (nalmefene), ELA and emrikasan, ELA and KD-025 , as well as ELA and DUR-928

In a further specific embodiment of this implementation, component (ii) is not OCC or CVC.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is selected from an ACC inhibitor, an ASK1 inhibitor,

- 12 042734 dual NOX1 and NOX4 inhibitor, VAP-1 inhibitor, stearoyl-CoA desaturase1/fatty bile acid conjugate inhibitors, GPR84 antagonist/FFAR1 agonist or immunomodulator, mTOR modulator or insulin sensitizer, THRe agonist, hedgehog signaling pathway inhibitor, agonist adenosine A3 receptors, aldosterone receptor antagonist, antagonist

TLR-4, a caspase inhibitor, a ROCK2 inhibitor, and a nuclear receptor ligand.

In a specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an ACC inhibitor (particularly GS-0976 or CP-640186 or gemcaben), an ASK1 inhibitor (particularly seloncertib) , dual NOX1 and NOX4 inhibitor (particularly GKT-831, formerly GKT137831), VAP-1 inhibitor (particularly BI-1467335/PXS-4728A), stearoyl-CoA desaturase-1 inhibitors/fatty bile acid conjugate ( eg aramhol), GPR84 antagonist/FFAR1 agonist or immunomodulator (eg PBI-4050), mTOR modulator or insulin sensitizer (eg MSDC-0602k), THRe agonist (eg VK-2809 or MGL-3196) , Hedgehog signaling inhibitor (particularly vismodegib), adenosine A3 receptor agonists (particularly CF-102 (namodenoson)), aldosterone receptor antagonist (particularly MT-3995 (apararenone)), TLR-4 antagonist (particularly , JKB-121 (nalmefene)), a caspase inhibitor (particularly emrikasan), a ROCK2 inhibitor (particularly KD-025), and a nuclear receptor ligand (particularly DUR-928).

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof; and component (ii) is an ASK1 inhibitor, a dual NOX1 and NOX4 inhibitor, a VAP-1 inhibitor, stearoyl-CoA desaturase-1 inhibitors/fatty bile conjugate acid, GPR84 antagonist/FFAR1 agonist or immunomodulator, mTOR modulator or insulin sensitizer, THRe agonist, hedgehog signaling pathway inhibitor, A3 adenosine receptor agonist, aldosterone receptor antagonist, TLR-4 antagonist, caspase inhibitor, ROCK2 inhibitor, and nuclear receptor ligand.

In a specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an ASK1 inhibitor (particularly seloncertib), a dual NOX1 and NOX4 inhibitor (particularly GKT-831, formerly GKT137831), VAP-1 inhibitor (particularly BI-1467335/PXS-4728A), stearoyl-CoA desaturase-1 inhibitors/fatty bile acid conjugate (particularly aramchol), GPR84 antagonist/FFAR1 agonist or immunomodulator (particularly PBI -4050), mTOR modulator or insulin sensitizer (particularly MSDC-0602k), THRe agonist (particularly VK-2809 or MGL-3196), hedgehog signaling pathway inhibitor (particularly vismodegib), adenosine A3 receptor agonist (in in particular CF-102 (namodenoson)), aldosterone receptor antagonist (in particular MT-3995 (apararenone)), TLR-4 antagonist (in particular JKB-121 (nalmefene)), caspase inhibitor (in particular emrikasan), a ROCK2 inhibitor (particularly KD025); and a nuclear receptor ligand (particularly DUR-928).

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an AKC inhibitor.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is GS-0976, CP-640186, or gemcaben.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is GS-0976.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is CP-640186.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is gemcaben.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an ASK1 inhibitor.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is seloncertib.

In a specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is a dual inhibitor of NOX1 and NOX4.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is GKT-831.

In a specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is a VAP-1 inhibitor.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is BI-1467335/PXS-4728A.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is stearoyl-CoA desaturase-1/fatty bile acid conjugate inhibitors.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is aramchol.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is a GPR84 antagonist/FFAR1 agonist.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is PBI-4050.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an mTOR modulator or insulin sensitizer.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is, in particular, MSDC-0602k.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is a THRe agonist.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is VK-2809 or MGL-3196.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is VK-2809.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is MGL-3196.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an inhibitor of the Hedgehog signaling pathway in cells.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is vismodegib.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an A3 adenosine receptor agonist.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is CF-102 (namodenoson).

In a specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an aldosterone receptor antagonist.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is MT-3995 (apararenone).

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is a TLR-4 antagonist.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is JKB-121 (nalmefene).

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is a nuclear receptor ligand.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is emrikasan.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is a ROCK2 inhibitor.

In a more specific embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is KD-025.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is a nuclear receptor ligand.

In a particular embodiment, component (i) is elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is DUR-928.

In a specific embodiment, the combination drug product of the invention further comprises at least one other therapeutically active agent selected from JAK/STAT inhibitors and another anti-inflammatory agent and/or immunosuppressive agent.

Illustrative anti-inflammatory and/or immunosuppressive agents include glucocorticoids, NSAIDs, cyclophosphamide, nitrosoureas, folic acid analogs, purine analogs, pyrimidine analogs, methotrexate, azathioprine, mercaptopurine, cyclosporine, myriocin, tacrolimus, sirolimus, mycophenolic acid derivatives, fingolimod, and other sphingosine modulators. 1-phosphate receptors 1, monoclonal and/or polyclonal antibodies against targets such as pro-inflammatory cytokines and pro-inflammatory cytokine receptors, T-cell receptors and integrins.

In another specific embodiment, the combination of the present invention may further comprise at least one therapeutically active agent with known antifibrotic activity, such as pirfenidone, or tyrosine kinase receptor inhibitors (RTKIs), such as nintedanib, sorafenib, and other RTKIs, or angiotensin receptor blockers. II (AT1), or CTGF inhibitor, or any antifibrotic compound capable of interfering with TGFe- and BMP-activated pathways, including TGFe latent complex activators, e.g. MMP2, MMP9, THBS1 or cell surface integrins, TGFe type I receptors (TGFBRI ) or type II (TGFBRII) and their ligands, e.g. TGFe, activin, inhibin, nodal, anti-Müllerian hormone, GDF or BMP, accessory co-receptors (also known as type III receptors) or components of the SMAD-dependent canonical pathway, including regulatory or inhibitory SMAD proteins, or members of SMAD-independent or non-canonical pathways, including various branches of the MAPK signaling pathway, TAK1 signaling pathway, Rho GTPases signaling pathway, phosphatidylinositol-3 kinase/AKT pathway, TGFe-induced EMT process, or canonical and non-canonical Hedgehog signaling pathways, including ligands Hh or target genes, or any members of the WNT pathway or Notch pathway that are sensitive to the effects of TGFe signaling.

In a specific embodiment of the invention, the other therapeutically active agent is a PPAR agonist.

In another specific embodiment, the PPAR agonist is a PPAR alpha agonist, a PPAR gamma agonist, a PPAR delta agonist, a PPAR alpha/gamma dual agonist, a PPAR alpha/delta dual agonist, a PPAR gamma/delta dual agonist, or a pan- PPAR-alpha/gamma/delta agonist.

In a specific embodiment, the other therapeutically active agent is: at least one PPAR alpha agonist;

at least one PPAR-gamma agonist;

at least one PPAR delta agonist;

at least one PPAR alpha/delta dual agonist;

at least one PPAR alpha agonist and at least one PPAR delta agonist;

at least one PPAR alpha/gamma dual agonist;

at least one PPAR alpha agonist and at least one PPAR gamma agonist;

at least one PPAR gamma/delta dual agonist;

at least one PPAR gamma agonist and at least one PPAR delta agonist;

at least one PPAR alpha/gamma/delta pan agonist and at least one PPAR alpha agonist, at least one PPAR gamma agonist and at least one PPAR delta agonist.

In a particular embodiment, the combination drug of the invention is a composition containing components (i) and (ii) as described above and a pharmaceutically acceptable carrier.

In a specific embodiment, the combined drug product is a composite kit comprising components (i) and (ii) as described above, for sequential, separate or simultaneous use.

In a further embodiment, components (i) and (ii) are formulated as an injectable suspension, gel, oil, pill, tablet, suppository, powder, capsule, aerosol, ointment, cream, patch, or using galenic formulations for prolonged and/or slow release.

The present invention also relates to a combination drug according to the invention for use as a medicine.

The invention also relates to a combination medicinal product disclosed herein for use in a method of treating a disease. In another embodiment, the invention relates to a method of treating a disease comprising administering to a subject in need thereof a therapeutically effective amount of a combination drug described herein. In another embodiment, the combination drug of the invention is used for the manufacture of a medicament for the treatment of a disease.

In particular, the combination drug of the present invention is useful in the treatment of diseases such as immune, inflammatory, metabolic, fibrotic and cholestatic diseases. In a particular embodiment, the disease is selected from the group consisting of metabolic liver disease, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), drug-induced liver disease, alcohol-induced liver disease, infectious agent-induced liver disease, inflammatory liver disease, liver disease mediated by immune system dysfunction, dyslipidemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathy, eg, primary sclerosing cholangitis (PSC), primary biliary cholangitis (PBC) , biliary atresia, progressive familial intrahepatic cholestasis type 3 (PSIC3), inflammatory bowel disease, Crohn's disease,

- 15 042734 ulcerative colitis, keloid, myocardial infarction, scleroderma/systemic sclerosis, inflammatory diseases, neurodegenerative diseases, cancers, liver cancer, hepatocellular carcinoma, gastrointestinal tract cancer, gastric cancer, meningioma on the background of neurofibromatosis, pancreatic neuroendocrine tumors , exocrine pancreatic tumors, leukemia, myeloproliferative/myelodysplastic diseases, mastocytosis, dermatofibrosarcoma, solid tumors including breast, lung, thyroid, or colon and rectal cancer, prostate cancer, liver fibrosis or cirrhosis of any origin, liver fibrosis or cirrhosis liver fibrosis or cirrhosis caused by NAFLD, liver fibrosis or cirrhosis caused by NASH, liver fibrosis or cirrhosis caused by alcohol, liver fibrosis or cirrhosis caused by a drug, liver fibrosis or cirrhosis caused by an infectious agent, fibrosis or cirrhosis liver fibrosis or cirrhosis caused by a parasitic infection, liver fibrosis or cirrhosis caused by a bacterial infection, liver fibrosis or cirrhosis caused by a viral infection, liver fibrosis or cirrhosis caused by an HBV infection, liver fibrosis or cirrhosis caused by an HCV infection, liver fibrosis or cirrhosis caused by HIV infection, fibrosis or cirrhosis of the liver caused by dual HCV and HIV infection, fibrosis or cirrhosis of the liver caused by radiation or chemotherapy, fibrosis of the biliary tract, fibrosis or cirrhosis of the liver due to any chronic cholestatic disease, intestinal fibrosis of any etiology, fibrosis caused by Crohn's disease , fibrosis due to ulcerative colitis, fibrosis of the intestinal tract (eg, small intestine), fibrosis of the colon, fibrosis of the stomach, fibrosis of the skin, fibrosis of the epidermis, fibrosis of the endodermis, fibrosis of the skin due to scleroderma/systemic sclerosis, fibrosis of the lungs, fibrosis of the lungs due to chronic inflammatory diseases respiratory tract, eg, COPD, asthma, emphysema, smoker's lung, tuberculosis, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), cardiac fibrosis, renal fibrosis, nephrogenic systemic fibrosis, muscle fibrosis, soft tissue fibrosis (eg, mediastinal or retroperitoneal), fibrosis bone marrow, arthrofibrosis, tendon fibrosis, cartilage fibrosis, pancreatic fibrosis, uterine fibrosis, nervous system fibrosis, testicular fibrosis, ovarian fibrosis, adrenal fibrosis, arterial fibrosis, vein fibrosis, ocular fibrosis, endomyocardial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis , massive progressive fibrosis (a complication of pneumoconiosis in coal industry workers), proliferative fibrosis, neoplastic fibrosis, peri-implantation fibrosis and asbestos pneumoconiosis, arthrofibrosis, adhesive capsulitis.

In the most preferred embodiment, the disease is selected from the group consisting of metabolic liver disease, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), drug-induced liver disease, alcohol-induced liver disease, infectious liver disease, inflammatory liver disease, liver disease mediated by immune system dysfunction, dyslipidaemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathy, eg primary sclerosing cholangitis (PSC), primary biliary cholangitis (PBC) , biliary atresia, progressive familial intrahepatic cholestasis type 3 (PSIC3), inflammatory bowel disease, Crohn's disease, ulcerative colitis, liver cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, colorectal cancer, liver fibrosis or cirrhosis caused by metabolic diseases, fibrosis or cirrhosis of the liver caused by NAFLD, fibrosis or cirrhosis of the liver caused by NASH, fibrosis or cirrhosis of the liver caused by alcohol, fibrosis or cirrhosis of the liver caused by a drug, fibrosis or cirrhosis of the liver caused by an infectious agent, fibrosis or cirrhosis of the liver, liver fibrosis or cirrhosis caused by bacterial infection liver fibrosis or cirrhosis caused by viral infection liver fibrosis or cirrhosis caused by HBV infection liver fibrosis or cirrhosis caused by HCV infection liver fibrosis or cirrhosis caused by HIV infection, fibrosis or cirrhosis of the liver caused by dual infection with HCV and HIV, fibrosis or cirrhosis of the liver caused by radiation or chemotherapy, fibrosis of the biliary tract, fibrosis or cirrhosis of the liver due to any chronic cholestatic disease, intestinal fibrosis of any etiology, fibrosis due to Crohn's disease , fibrosis due to ulcerative colitis, fibrosis of the intestinal tract (for example, small intestine), fibrosis of the colon, fibrosis of the stomach, fibrosis of the lungs, fibrosis of the lungs due to chronic inflammatory diseases of the respiratory tract, such as COPD, asthma, emphysema, smoker's lungs, tuberculosis, pneumofibrosis, idiopathic pulmonary fibrosis (IPF).

In a further aspect, the invention relates to a combination of the invention for use in inhibiting the proliferation and/or activation of fibroblasts responsible for the formation of collagen fibers and/or responsible for the secretion of extracellular matrix.

According to the present invention, the term autoimmune disease is used to refer to a condition that results from an abnormal immune response of the body to substances and tissues normally present in the body. The disease may be limited to certain

- 16 042734 organs (for example, in type I diabetes or autoimmune thyroiditis) or to affect a specific tissue in different places (for example, in Goodpasture's syndrome, basement membrane damage in the lung and kidney).

The term inflammation is used to refer to a condition that results from a protective response involving host cells, blood vessels and proteins, and other mediators that may serve to eliminate the cause of cell/tissue damage and necrotic cells/tissue from the initial stroke. and start the recovery process. The inflammatory response can present with pain, heat, redness, swelling, dilation of blood vessels, increased blood flow, and loss of function.

According to the present invention, the terms fibrosis, fibrotic disease, fibrotic disorder and related abnormalities mean a pathological condition of excessive overlay of fibrous connective tissue in an organ or tissue. More specifically, fibrosis is a pathological process that includes increased fibrous scar formation and increased secretion of extracellular matrix by connective tissue in response to tissue injury. Physiologically, the deposition of connective tissue can disrupt the structure and function of the corresponding organ or tissue.

According to the present invention, fibrosis or fibrotic disorder can be associated with any organ or tissue fibrosis. Illustrative, non-limiting examples of specific organ fibrosis include fibrosis of the liver, intestines, kidney, skin, epidermis, endoderm, muscle, tendon, cartilage, heart, pancreas, lung, uterus, nervous system, testicle, penis, ovary, adrenal gland, artery , vein, colon, intestinal tract (for example, small intestine), biliary tract, soft tissue (for example, mediastinum or retroperitoneal space), bone marrow, fibrosis of the joint or stomach, in particular fibrosis of the liver, kidney, skin, epidermis, endoderm, muscle, tendon, cartilage, heart, pancreas, lung, uterus, nervous system, testicle, ovary, adrenal gland, artery, vein, colon, intestinal tract (eg, small intestine), biliary tract, soft tissue (eg, mediastinum or retroperitoneum), bone marrow, joint, eye or stomach.

According to the present invention, the terms cholestasis or cholestatic disease or cholestatic disorder and the corresponding abnormalities mean a pathological condition defined by a decrease in the outflow of bile due to impaired secretion by hepatocytes or obstruction of the outflow of bile through the intra- or extrahepatic bile ducts. Therefore, the clinical definition of cholestasis is any condition that retains substances that are normally excreted in the bile.

In a specific embodiment, the fibrotic disorder is selected from the group consisting of liver, intestinal, lung, heart, kidney, muscle, skin, soft tissue (e.g., mediastinal or retroperitoneal), bone marrow, intestinal, and articular (e.g., knee, shoulder or other joints) fibrosis.

In a preferred embodiment, the fibrotic disorder is selected from the group consisting of liver, lung, skin, kidney and intestinal fibrosis.

In a more preferred embodiment of the present invention, the fibrotic disorder to be treated is selected from the group consisting of the following non-exhaustive list of fibrotic disorders: non-alcoholic steatohepatitis (NASH), pulmonary fibrosis, idiopathic pulmonary fibrosis, skin fibrosis, ocular fibrosis (e.g., capsular fibrosis), endomyocardial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, massive progressive fibrosis (a complication of pneumoconiosis in coal workers), proliferative fibrosis, neoplastic fibrosis, pulmonary fibrosis due to chronic inflammatory airway diseases (COPD, asthma, emphysema, smoker's lungs, tuberculosis), liver fibrosis, alcohol or drug-induced liver cirrhosis, infectious agent-induced liver fibrosis, radiation or chemotherapy-induced liver fibrosis, nephrogenic systemic fibrosis, Crohn's disease, ulcerative colitis, keloid, previous myocardial infarction, scleroderma/systemic sclerosis, arthrofibrosis, some forms of adhesive capsulitis, chronic fibrosing cholangiopathy, such as primary sclerosing cholangitis (PSC) and primary biliary cholangitis (PBC), biliary atresia, progressive familial intrahepatic cholestasis type 3 (PSIC3), peri-implant fibrosis, and asbestos pneumoconiosis.

Cholestasis is defined as a decrease in the outflow of bile due to impaired secretion by hepatocytes (hepatocellular cholestasis) or obstruction of the outflow of bile through the intra- or extrahepatic bile ducts (obstructive cholestasis). In clinical practice, cholestasis is any condition in which the flow of bile from the liver is slowed down or blocked. In accordance with a specific embodiment of the invention, the cholestatic disease is selected from the group consisting of primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), intrahepatic cholestasis of pregnancy, progressive familial intrahepatic cholestasis, biliary atresia, cholelithiasis, infectious cholangitis, cholangitis associated with 17 042734 gergans cell histiocytosis, Alagille syndrome, non-syndromic biliary deficiencies, drug-induced cholestasis, and total parenteral nutrition-associated cholestasis. In a preferred embodiment, the cholestatic disease is PBC or

PSC, in particular PBC.

Examples of inflammatory diseases, fibrotic diseases, metabolic diseases, and cholestatic diseases include metabolic liver disease, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), drug-induced liver disease, alcohol-induced liver disease, infectious agent-induced liver disease , inflammatory liver disease, liver disease mediated by immune system dysfunction, dyslipidemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathy eg primary sclerosing cholangitis (PSC), primary biliary cholangitis (PBC) ), biliary atresia, progressive familial intrahepatic cholestasis type 3 (PSIC3), inflammatory bowel disease, Crohn's disease, ulcerative colitis, keloid, previous myocardial infarction, scleroderma/systemic sclerosis, inflammatory diseases, neurodegenerative diseases, cancers, liver cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, neurofibromatosis meningioma, pancreatic neuroendocrine tumors, pancreatic exocrine tumors, leukemia, myeloproliferative/myelodysplastic diseases, mastocytosis, dermatofibrosarcoma, solid tumors including breast, lung, thyroid cancer or colon and rectum, prostate cancer, fibrosis or cirrhosis of the liver of any origin, fibrosis or cirrhosis of the liver caused by metabolic diseases, fibrosis or cirrhosis of the liver caused by NAFLD, fibrosis or cirrhosis of the liver caused by NASH, fibrosis or cirrhosis of the liver caused by alcohol, fibrosis or cirrhosis of the liver caused by a drug, fibrosis or cirrhosis of the liver caused by an infectious agent, fibrosis or cirrhosis of the liver caused by a parasitic infection, fibrosis or cirrhosis of the liver caused by a bacterial infection, fibrosis or cirrhosis of the liver caused by a viral infection, fibrosis or cirrhosis of the liver, liver fibrosis or cirrhosis caused by HCV infection, liver fibrosis or cirrhosis caused by HIV infection, liver fibrosis or cirrhosis caused by dual HCV and HIV infection, liver fibrosis or cirrhosis caused by radiation or chemotherapy, biliary tract fibrosis , fibrosis or cirrhosis of the liver due to any chronic cholestatic disease, intestinal fibrosis of any etiology, fibrosis due to Crohn's disease, fibrosis due to ulcerative colitis, fibrosis of the intestinal tract (for example, small intestine), fibrosis of the colon, fibrosis of the stomach, fibrosis of the skin, fibrosis of the epidermis , endoderm fibrosis, skin fibrosis due to scleroderma/systemic sclerosis, pulmonary fibrosis, pulmonary fibrosis due to chronic inflammatory airway diseases, eg COPD, asthma, emphysema, smoker's lung, tuberculosis, pneumofibrosis, idiopathic pulmonary fibrosis (IPF), cardiac fibrosis, fibrosis kidney, nephrogenic systemic fibrosis, muscle fibrosis, soft tissue fibrosis (e.g. mediastinal or retroperitoneal), bone marrow fibrosis, arthrofibrosis, tendon fibrosis, cartilage fibrosis, pancreatic fibrosis, uterine fibrosis, nervous system fibrosis, testicular fibrosis, ovarian fibrosis, adrenal fibrosis, arterial fibrosis, vein fibrosis, ocular fibrosis, endomyocardial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, massive progressive fibrosis (a complication of pneumoconiosis in coal workers), proliferative fibrosis, neoplastic fibrosis, peri-implant fibrosis and asbestos pneumoconiosis, arthrofibrosis, adhesive capsulitis.

Preferably, the disease is selected from the group consisting of metabolic liver diseases, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), drug-induced liver diseases, alcohol-induced liver diseases, infectious liver diseases, inflammatory liver diseases, liver disease mediated by immune system dysfunction, dyslipidemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathy, eg, primary sclerosing cholangitis (PSC), primary biliary cholangitis (PBC), biliary atresia , progressive familial intrahepatic cholestasis type 3 (PSIC3), inflammatory bowel disease, Crohn's disease, ulcerative colitis, liver cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, colorectal cancer, liver fibrosis or cirrhosis caused by metabolic diseases, liver fibrosis or cirrhosis caused by NAFLD, liver fibrosis or cirrhosis caused by NASH, liver fibrosis or cirrhosis caused by alcohol, liver fibrosis or cirrhosis caused by a drug, liver fibrosis or cirrhosis caused by an infectious agent, liver fibrosis or cirrhosis caused by a parasitic infection , fibrosis or cirrhosis of the liver caused by a bacterial infection, fibrosis or cirrhosis of the liver caused by a viral infection, fibrosis or cirrhosis of the liver caused by HBV infection, fibrosis or cirrhosis of the liver caused by HCV infection, fibrosis or cirrhosis of the liver caused by HIV infection, fibrosis or cirrhosis of the liver caused by dual infection with HCV and HIV, fibrosis or cirrhosis of the liver caused by radiation or chemotherapy, fibrosis

- 18 042734 biliary tract, fibrosis or cirrhosis of the liver due to any chronic cholestatic disease, intestinal fibrosis of any etiology, fibrosis caused by Crohn's disease, fibrosis caused by ulcerative colitis, fibrosis of the intestinal tract (for example, small intestine), fibrosis of the large intestine, fibrosis of the stomach, lung fibrosis, pulmonary fibrosis due to chronic inflammatory airway diseases, eg COPD, asthma, emphysema, smoker's lung, tuberculosis, pneumofibrosis, idiopathic pulmonary fibrosis (IPF).

The term therapy or treatment refers to the cure or prevention of a disorder in a subject in need thereof. The treatment comprises administering to a subject having the claimed disorder a compound, in particular one contained in a pharmaceutical composition, i.e. to the patient in order to cure, delay, arrest or slow the development of the disorder, thereby improving the condition of the subject. Treatment may also be given to a patient who is healthy or at risk of developing a cholestatic or fibrotic disorder to prevent or delay the disorder.

Therefore, according to the invention, the treatment of an immune, inflammatory, metabolic, fibrotic, and cholestatic disease comprises administering a combination of the present invention, for example, in the form of a pharmaceutical composition containing components (i) and (ii) of the combination, to a subject declared to have a disorder, for treatment, delay, arrest or slow the progression of the disorder, thereby improving the condition of the patient or healthy subject, in particular the subject who is at risk of developing such a disease.

Treatment includes administering a combination of the invention to a symptomatic patient to cure, delay or slow progress, thereby improving the condition of the patient or a healthy subject, in particular a subject who is at risk of developing inflammatory, metabolic, fibrotic and cholestatic diseases.

The subject to be treated is a mammal, preferably a human. The subject to be treated according to the invention may be selected based on several criteria associated with fibrotic diseases, e.g., prior drug therapies, associated pathologies, genotype, exposure to risk factors, viral infection, as well as the detection of any relevant biomarker that can be assessed. using imaging techniques and immunological, biochemical, enzymatic, chemical or nucleic acid detection methods.

Subjects to be treated according to the invention may be selected based on several criteria related to inflammatory, metabolic, fibrotic and cholestatic diseases, such as prior drug therapies, associated pathologies, genotype, exposure to risk factors, viral infection, as well as any other relevant biomarker, which can be assessed by imaging and immunological, biochemical, enzymatic, chemical or nucleic acid detection methods.

In a specific embodiment, the treatment of inflammatory, metabolic, fibrotic and cholestatic disease may include the introduction of a composition containing at least two compounds of formula (I). In this embodiment, the input component (ii) is provided in the same composition as at least two compounds of formula (I), or in a separate form, for example, in a different composition.

In another embodiment, the combination according to the invention is intended for simultaneous, sequential or separate administration in therapy, therefore, can be included in various compositions. In the case of sequential administration, the compound of formula (I), in particular ELA, can be introduced before component (ii), or component (ii) is introduced before the compound of formula (I).

The compound of formula (I) may be formulated as pharmaceutically acceptable salts, in particular acid or base salts compatible with pharmaceutical use. Salts of compounds of formula (I) include pharmaceutically acceptable acid addition salts, pharmaceutically acceptable base addition salts, pharmaceutically acceptable metal salts, ammonium salts and alkylated ammonium salts. These salts can be obtained during the final purification step of the compound or by incorporating the salt into the pre-purified compound.

The pharmaceutical compositions of the present invention may also contain one or more excipients or carriers acceptable in a pharmaceutical context (eg, saline solutions, saline solutions, isotonic solutions, etc., compatible with pharmaceutical use and well known to a person skilled in the art).

These compositions may also contain one or more agents or carriers selected from among dispersing agents, solubilizers, stabilizers, preservatives, and the like. Agents or carriers suitable for these compositions (liquid and/or injectable and/or solid) are, in particular, methylcellulose, hydroxymethylcellulose, carboxymethylcellulose, polysorbate 80, mannitol, gelatin, lactose, vegetable oils, gum arabic, liposomes, etc. .d.

These compositions can be formulated in the form of injectable suspensions, gels, oils, ointments, pills, tablets, suppositories, powders, gelatin capsules, capsules, aerosols, etc., in some cases using galenic forms or devices that provide prolonged and / or

- 19 042734 slow release. For this type of composition, agents such as cellulose, carbonates or starches may preferably be used.

Pharmaceutical compositions of the present invention containing a compound of formula (I) and one or more components (ii) may be administered in various ways and in various forms. For example, the compound(s) may be administered systemically, per os, parenterally, by inhalation, by nasal spray, by nasal instillation, or by injection, such as, for example, intravenously, intramuscularly, subcutaneously, intradermally, external application, by intra-arterial administration, etc.

Of course, the route of administration will be adapted to the form of the compounds administered, in accordance with procedures well known to those skilled in the art.

Components (i) and (ii) of the combination drug according to the invention are administered in therapeutically effective amounts. In the context of the present invention, the term effective amount refers to an amount of a compound sufficient to produce the desired therapeutic result.

The frequency and/or dose of administration may be adapted by one of ordinary skill in the art depending on the patient, pathology, form of administration, etc. Typically, the combination (eg, in the form of a pharmaceutical composition or kit of parts) of the present invention may be administered for the treatment of fibrotic disease for component (i) or component (ii) at a dose of 0.01 to 4000 mg/day, for example, from 50 to 2000 mg/day, and in particular from 100 to 1000 mg/day.

In a preferred embodiment of the invention, ELA is used in combination with component (ii) at a dose of 80 to 120 mg/day for elafibranor.

In another preferred embodiment, the active ingredients are administered as one or more pharmaceutical compositions in the form of a pill or tablet intended for oral administration.

The introduction can be carried out once a day or even several times, if necessary.

The invention is further described with reference to the following non-limiting examples.

Description of figures

Abbreviations used in figures, tables and text:

α-SMA - α-smooth muscle actin,

AP-1 - activating protein-1,

ASBTi is an inhibitor of the apical sodium-dependent bile acid transporter,

ASK1 - apoptotic signal-regulating kinase 1,

AT1 - angiotensin II type 1 receptors,

CLA, CLA - conjugated linoleic acid,

COPD, COPD - chronic obstructive pulmonary disease,

CTGF - connective tissue growth factor,

CVC - cenicrivirok,

DGAT, DGAT - diacylglycerol O-acyltransferase,

DMSO, DMSO - dimethyl sulfoxide,

DPP4, DPP4 - dipeptidyl peptidase 4,

ELISA, ELISA - enzyme immunoassay,

EOB - Bliss difference,

EOBHSA is the most effective single Bliss agent,

FABAC - conjugate of fatty and bile acids,

FBS, FBS - fetal bovine serum,

FGF - fibroblast growth factor,

FXR - farnesoid X receptor,

GDF - growth and differentiation factor,

GLP-1, GLP-1 - glucagon-like peptide-1,

GPCR - G-protein coupled receptor

HBV - hepatitis B virus,

HCV - hepatitis C virus,

15-HEPE - 5-hydroxyeicosapentaenoic acid,

HIV, HIV - human immunodeficiency virus,

HSC, HSC - liver stellate cell,

IC ₅₀ - concentration of half-maximal inhibition, iNOS - inducible nitric oxide synthase,

IPF, IPF - idiopathic pulmonary fibrosis,

LO - lipoxygenase,

LPS - lipopolysaccharide,

LT - leukotrienes,

MAPK - mitogen-activated protein kinase,

- 20 042734

MMP-9, MMP-9 - matrix metalloproteinase 9,

MMPase, MMP - matrix metalloproteinase,

NADPH, NADP - nicotinamide adenine dinucleotide phosphate,

NAFLD - non-alcoholic fatty liver disease,

NAFLD, NASH - non-alcoholic steatohepatitis,

NF-kB - nuclear factor kappa-B,

NOX NADPH - NOX, NADPH oxidase,

NSAIDs, NSAIDs - non-steroidal anti-inflammatory drugs,

PAR is a protease-activated receptor

PBC, PBC - primary biliary cholangitis,

PBS, FSB - phosphate-buffered saline solution,

PDE, PDE - phosphodiesterase,

PDGF - platelet growth factor,

PFIC3, PSI3 - progressive familial intrahepatic cholestasis type 3,

PFOR - pyruvate:ferredoxin oxidoreductase,

PPAR, peroxisome proliferator-activated receptor

PPRE - PPAR Responding Element,

PSC, PSC - primary sclerosing cholangitis,

ROCK - Rho-associated protein kinase 2,

RTK - tyrosine kinase receptor,

SGLT - sodium glucose transporter,

STAT - signal carriers and transcription activators,

TGFe - transforming growth factor β,

TGFBRI - type I TGFe receptors,

TGFBRII - type II TGFe receptors,

THBS1 - thrombospondin 1,

THR β - thyroid hormone β-receptor,

TIMP - tissue inhibitor of metalloproteinases 1,

TLR-4 - toll-like receptor 4,

VAP-1 - vascular adhesion protein-1,

VDR - vitamin D receptor.

Fig. 1: Effect of combination of 1 mg/kg/day ELA and 10 mg/kg/day OCA on fibrosis surface index.

Fig. 2: Effect of combination of 3 mg/kg/day ELA and 10 mg/kg/day OCA on fibrosis surface index.

Fig. 3: Effect of the combination of 1 mg/kg/day ELA and 10 mg/kg/day OCA on hepatic collagen.

Fig. 4: Effect of the combination of 3 mg/kg/day ELA and 10 mg/kg/day OCA on hepatic collagen.

Fig. 5: Effect of combination of 3 mg/kg/day ELA and 10 mg/kg/day OCA on markers of fibrosis.

Fig. Figure 6: Different antifibrotic effects of elafibranor versus cenicriviroc and bezafibrate in TGFe-induced human HSC.

Serum-deprived HSCs were pre-incubated for 1 h with elafibranor (A), cenicriviroc (B), or bezafibrate (a PPAR-α/γ/δ panagonist) prior to activation with the profibrogenic cytokine TGFe1 (1 ng/mL).

After 48 hours of incubation, α-SMA expression was measured by ELISA.

The values obtained were converted to percent inhibition compared to the TGFe1 control. Data are presented as mean (triple replication) ± standard deviation (SD). Statistical analysis was performed using one-way ANOVA followed by Bonferroni-adjusted post-hoc analyzes using Sigma Plot 11.0 software [*: p<0.05; *: p<0.01; *: p<0.001 (comparison with TGFe1 1 ng/mL group)]. Curve fitting and calculation of half-maximal inhibition concentration (IC ₅₀ ) was performed using XLFit 5.3.1.3 software.

Fig. 7: The combination of Elafibranor with Cenicriviroc synergistically inhibits α-SMA in human HSCs induced by TGFe1.

The combinations were tested in a matrix form dose-response study and analyzed according to the Bliss difference additivism model.

Dilution series of elafibranor (horizontal row) and cenicriviroc (vertical row) were prepared, including their respective DMSO controls.

The resulting mixtures were added to serum-deprived HSCs 1 h prior to activation by the profibrogenic cytokine TGFe1 (1 ng/mL).

(A) Percent inhibition of α-SMA compared to TGFe1 control for all pairs of combinations. Data are presented as the mean of quadruple replication.

- 21 042734 (B) Bliss scores were calculated as described in the Materials and Methods section. Any pair of compounds with Bliss values >10 was considered synergistic (colored from light gray to black). A total Bliss score including all combinations was also calculated.

(C) The values of the obtained data of a pair of synergistic combinations are plotted as a histogram. Data are presented as mean (four times) ± standard deviation (SD). Statistical analysis was performed by one-way ANOVA followed by Bonferroni-adjusted retrospective analyzes using Sigma Plot 11.0 software [*: p<0.05; *: p<0.01; *: p<0.001 (comparison with combination drug group)].

Fig. 8: Bezafibrate does not synergize with cenicriviroc to reduce fibrosis in TGFe1-induced human HSC

The combinations were tested in a matrix form dose-response study and analyzed according to the Bliss difference additivism model.

Dilution series of elafibranor (horizontal row) and bezafibrate (vertical row) were prepared, including their respective DMSO controls. The resulting mixtures were added to serum-deprived HSCs 1 h prior to activation by the profibrogenic cytokine TGFe1 (1 ng/mL).

(A) Percent inhibition of α-SMA compared to TGFe1 control.

(B) Bliss difference scores were calculated as described in the Materials and Methods section. Any pair of compounds with Bliss values >10 was considered synergistic (colored from light gray to black). A total Bliss score including all combinations was also calculated.

Fig. 9: Elafibranor combinations with MSDC-0602, PXS-4728A, apararenone, CF-102. vismodegib. PBI-4050, KD-025, DUR-928, VK-2809, and emrycane synergistically inhibit α-SMA in TGFe1-induced human HSCs.

The combinations were tested in a matrix form dose-response study and analyzed according to the Bliss difference additivism model. Percent inhibition of α-SMA compared to TGFe1 control plotted as a histogram for representative synergistic combinations. Data are presented as mean (four times) ± standard deviation (SD). *: p<0.05; *: p<0.01; *: p<0.001 using one-way ANOVA and retrospective analysis with Fisher's least significant difference (LSD) test. MSDC=MSDC-0602.

Fig. Figure 10: Combinations of Elafibranor with CP-640186, GS-0976, or JKB-121 (nalmefene) synergistically inhibit collagen secretion in hepatic microtissues

Microtissues were treated by metabolic induction with NASH stimulus with or without elafibranor alone (white bar), with compound (ii) alone (black bar), or a combination of both (grey bar). The combinations were tested in a matrix form dose-response study and analyzed according to the Bliss difference additivism model. Percent NASH inhibition versus stimulus control plotted as a histogram for representative synergistic combinations. Data are presented as mean (triple replication) ± standard deviation (SD). *: p<0.05; *: p<0.01; *: p<0.001 using one-way ANOVA and retrospective analysis with Fisher's least significant difference (LSD) test.

Fig. 11: The combination of elafibranor with gemcaben synergistically inhibits TNF-α secretion in LPS-activated macrophages.

The combinations were tested in a matrix form dose-response study and analyzed according to the Bliss difference additivism model. Percentage of TNFa inhibition compared to LPS control plotted as a histogram for representative synergistic combinations. Data are presented as mean (four times) ± standard deviation (SD). *: p<0.05; *: p<0.01; *: p<0.001 using one-way ANOVA and retrospective analysis with Fisher's least significant difference (LSD) test.

Fig. 12: Combinations of elafibranor with CP640186, VK-2809, apararenone (Apa), or aramchol (Aram) synergistically inhibit fat accumulation in HepG2.

The combinations were tested in a matrix form dose-response study and analyzed according to the Bliss difference additivism model. Percent inhibition of fat accumulation compared to FFA-treated control plotted as a histogram for representative synergistic combinations. Data are presented as mean (four times) ± standard deviation (SD). *: p<0.05; *: p<0.01; *: p<0.001 using one-way ANOVA and retrospective analysis with Fisher's least significant difference (LSD) test.

Fig. 13: The combination of Elafibranor with MGL-3196 synergistically inhibits fat accumulation in 3D Huh7 spheroid culture.

Spheroids were treated with the NASH metabolic stimulus with or without Elafibranor alone (white bar), with MGL3196 alone (grey bar), or a combination of the two (black bar).

Measurement of lipid accumulation was performed as described in materials and methods. Standard deviations are shown as whiskers (n=3). The calculated Bliss value is indicated in the upper left corner. Significant differences (*p<0.05; *p<0.01; *p<0.001) after one-way analysis of variance (ANOVA) and Fisher's least significant difference (LSD) test.

Fig. 14: Elafibranor (GFT505, 3 mg/kg/day) and selonsertib (SEL, 30 mg/kg/day) synergistically reduce fibrosis, tissue remodeling, and inflammatory markers in NASH mice (CDFF-fed mice).

(A) Fibrosis surface percentage was assessed by morphometric quantification of the area positively stained with picrosirius relative to the area of the liver section.

(B) Hepatic collagen content.

(C) Plasma concentration of PIIINP, surrogate markers of liver fibrosis.

(D) Plasma concentration of TIMP1, surrogate markers of liver fibrosis,

Expression of Col1a1 (E), MMP2 (F), TGFe1 (G) as markers of fibrosis and tissue remodeling, as well as TNFa (H) and CCK2 (I), markers of inflammation, was assessed by quantitative real-time PCR.

Data are expressed as mean ± SD, a p<0.05, aa p<0.01, aaa p<0.001 using a one-tailed Student's t-test with Welch's correction. HSA, the most efficient single agent model.

Fig. 15: Elafibranor (GFT505, 1 or 3 mg/kg/day) and GKT-831 (GKT, 60 mg/kg/day) synergistically reduce NASH and fibrosis in NASH mice (CDFF-fed mice).

(A) Fibrosis surface percentage was assessed by morphometric quantification of the area positively stained with picrosirius relative to the area of the liver section.

(B) Histological evaluation of inflammatory lesions in 10 microscopic fields (20x).

(C) NAFLD activity score calculated by calculating the sum of the degrees of steatosis, balloon degeneration and lobular inflammation (minimum 0 - maximum 8) according to the NASH Clinical Research Network (Kleiner 2005, Brunt 1999).

Data are expressed as mean ± SD, a p<0.05, aa p<0.01, aaa p<0.001 using one-tailed Student's t-test with Welch's correction. $ p<0.05, $$ p<0.01, $$$ p<0.001 using one-tailed Mann-Whitney U-test (non-parametric). HSA, Most Efficient Single Agent Model

Fig. 16: Elafibranor (GFT505, 1 mg/kg/day) and GS-0976 (GS, 30 mg/kg/day) synergistically reduce steatosis and body weight in NASH mice (CDFF-fed mice).

(A) The degree of steatosis, assessed by histological examination in accordance with the recommendations of the NASH Clinical Research Network.

(B) Hepatic triglyceride content.

(C) Weight loss after 8 weeks of treatment compared to controls. Data are expressed as mean ± SD, a p<0.05, aap<0.01, aaa p<0.001 using one-tailed Student's t-test with Welch's correction. HSA, Most Efficient Single Agent Model

Examples

Example 1 Combination Therapy Study Design.

Materials and methods.

Compounds were dissolved in dimethyl sulfoxide (DMSO, Fluka cat. no. 41640).

1. An example in a model of human HSC induced by TGFe1.

The culture of human HSP.

Primary human liver stellate cells (HSCs) (Innoprot) were cultured in STeCM medium (ScienCell, cat. no. 5301) supplemented with 2% fetal bovine serum (FBS, ScienCell, cat. no. No. 0503) and Stellate Growth Supplement (SteCGS; ScienCell Cat. No. 5352). To improve adhesion, cell culture flasks were coated with poly-L-lysine (Sigma, cat. no. P4707).

Preparation of compositions.

Two-component matrix of combinations.

For these experiments, a chess matrix was created. Stock ELA and component (ii) were serially diluted in DMSO in a series of 5 points in a horizontal row (ELA) and in a series of 11 points in a vertical row (component (ii)) of a 96-well plate. Subsequently, a 5X11 combination matrix was obtained by mixing all concentrations of one agent in a 1:1 ratio. Experimental concentrations for each compound were selected based on the respective IC ₅₀ of each compound as a single agent, obtained by measuring the content of α-SMA in a model of HSCs stimulated with TGFe1.

Human HSC TGFe1 activation and compound treatment.

Primary human liver stellate cells (HSCs) (Innoprot) were cultured under standard conditions as described above. The cells were then seeded at a density of 2x10 ⁴ cells/well in 96-well plates for measuring α-SMA by ELISA. The next day, the culture medium was removed and the cells were washed with PBS (Invitrogen, cat. no. 14190). Human HSCs were cultured for 24 h in serum-free and SteCGS-free medium. For treatment with ELA component (ii) and the respective ELA/component (ii) combinations, serum-deprived human HSCs were pre-incubated for 1 h with the compounds followed by the addition of TGF-β 1 profibrogenic stimuli (PeproTech cat. no. 100-21, 1 ng/ ml) in serum-free and SteCGS-free medium for an additional 48 hours.

ELISA α-SMA.

The level of α-SMA was measured using a sandwich ELISA. Briefly, the wells of the ELISA plate were first coated with immobilized antibody (mouse monoclonal anti-ACTA2, Abnova) at 4°C overnight. After 3 washes in PBS + 2% Tween-20 for 1 hour, a blocking solution consisting of PBS + 0.2% BSA was added, followed by another wash cycle. Cell lysates were transferred to the wells for binding to the immobilized antibody for 2 hours at room temperature. After the washing procedure, identification antibody (biotinylated mouse monoclonal anti-ACTA2 antibody, Abnova) was added for 2 hours at room temperature followed by three washes. For detection, streptavidin conjugated to HRP (R&D Systems cat. no. DY998) was used first for 30 minutes at room temperature. After washing, TMB HRB substrate (BD, cat. no. 555214) was added and incubated for 7 min at room temperature in the dark. After oxidation, TMB forms a water-soluble blue reaction product, which turns yellow with the addition of sulfuric acid (stopping solution), which allows accurate measurement of the intensity at 450 nm using a spectrophotometer. The resulting color is directly proportional to the amount of α-SMA present in the lysate.

2. An example in a model of HSC activation in 3D human liver microtissue.

3D human liver microtissue culture.

Cryopreserved primary human hepatocytes (IPHH 11) and cryopreserved primary human non-parenchymal cells (NPCs, IPHN 11) were supplied by BioreclamationIVT. Cryopreserved primary human liver stellate cells (HSCs) were supplied by Innoprot. 3D human liver microtissue samples InSightTM (MT-02-302-95; InSphero AG) were obtained using IPHH 11, IPHN 11 and human HSC in a 96-well hanging drop culture platform (Gravity PLUSTM). After microtissue formation, they were transferred to a special 96-well microtissue culture and analysis platform (Gravity TRAPTM). Further manipulations and processing of compounds were carried out in tablets Gravity TRAPTM. After formation, 3D microtissues were cultured in 3D InSight™ Human Liver Maintenance Medium-INF (hLiMM CS-07-001b-01; InSphero AG) at 37°C, 5% CO ₂ in a humidified cell culture incubator for 4 days. Half of the nutrient medium was renewed every 2 days.

Preparation of compositions: Two-component combination matrix.

For these experiments, a chess matrix was created. Stock ELA and component (ii) were serially diluted in DMSO in a two-dot-in-horizontal (ELA) series and in a three-dot-in-vertical series (component (ii)) of a 96-well plate. Subsequently, a 2X3 combination matrix was obtained by mixing all concentrations of one agent in a 1:1 ratio.

Metabolic stimulation of 3D human liver microtissue InSightTM and treatment with compounds.

3D human liver microtissue InSightTM (InSPhero) was cultured under standard conditions as described above. Then the microtissues were cultured for 24 h in a serum-free medium. For ELA treatment with component (ii) and the respective ELA/component (ii) combinations, serum-deprived microtissues were treated with both metabolic induction with NASH stimulus and compounds (Day 0) followed by resumption of metabolic induction with NASH stimulus on day 3 for an additional 3 days . Supernatants for Col1a1 measurement were collected on day 6.

ELISA Col1a1.

Col1a1 levels were measured using sandwich ELISA. Briefly, the wells of the ELISA plate were first coated with immobilized antibody (immobilized mouse anti-human procollagen Ia1 antibody, Elisa Pro-Collagen Ia1/COLIA1, DuoSet ELISA, R&D, cat. no. DY6220-05) at room temperature overnight. After three washes in PBS + 0.5% Tween-20 for 1 hour, a blocking solution consisting of PBS + 0.1% BSA was added, followed by another wash cycle. The culture supernatants were transferred to the wells for binding to the immobilized antibody for 2 hours at room temperature. After the washing procedure, identification antibody (detectable biotinylated sheep anti-human procollagen Ia1 antibody) was added for 2 hours at room temperature followed by three washes. For detection, streptavidin conjugated with HRP was first used for 20 min at room temperature. After washing, TMB HRB substrate (BD, cat. no. 555214) was added and incubated for 20 min at room temperature in the dark. After oxidation, TMB forms a water-soluble blue reaction product, which turns yellow with the addition of sulfuric acid (stopping solution), which allows accurate measurement of the intensity at 450 nm using a spectrophotometer. The color obtained is directly proportional to the amount of col1a1 present in the supernatant.

3. An example in macrophages activated by LPS.

Differentiation of THP-1 monocytes into macrophages.

THP-1 monocytes (ECACC, cat. no. 88081201) were seeded at a density of 25550 cells/well in a 384-well plate with RPMI1640 medium (Gibco, 21875) supplemented with 10% SVF and differentiated into macrophages using PMA (phorbol-12- myristate-13-acetate, Sigma, P8139) at a final concentration of 100 ng/ml for 24 hours.

Preparation of compositions: Two-component combination matrix.

For these experiments, a chess matrix was created. Stock ELA and component were serially diluted in DMSO in a 6 dot in vertical row (ELA) series and in a 10 dot in a horizontal row (component) series of a 96-well plate for other compounds. Subsequently, a 6X10 combination matrix was obtained by mixing all concentrations of one agent in a 1:1 ratio.

Compound treatments and LPS stimulation.

After 24 h, the medium with PMA was removed and replaced with serum-free RPMI medium. For treatments with ELA component and appropriate ELA/component combinations, serum-deprived THP-1 macrophages were pre-incubated for 24 h with compounds followed by addition of LPS lipopolysaccharide (100 ng/mL, E. coli 055 B5, Sigma, L6529) for an additional 6 h .

Quantitative determination of human TNFa.

Human TNFa in the supernatant was quantified using time resolved homogeneous fluorescence (HTRF) technology (Cisbio 62HTNFAPEG) based on FRET technology. FRET (fluorescence resonance energy transfer) is based on the transfer of energy between two fluorophores, a donor and an acceptor, when they are in close proximity. Molecular interactions between biomolecules can be assessed by associating each partner with a fluorescent label and determining the level of energy transfer (665 nm). The cell supernatant, sample or standard was placed directly into the assay plate for detection with HTRF® reagents. HTRF donor and acceptor labeled antibodies were premixed and added in one dosing step. The intensity of the signal is proportional to the amount of antigen-antibody complex formed and, consequently, to the concentration of TNFa. By fitting data with a four-parameter logistic model, a seven-point calibration curve was generated (from 39 pg/ml to 2500 pg/ml with human TNFa injected).

4. Example in hepatocytes loaded with fat (HepG2).

Cell culture of HepG2.

Human hepatocellular carcinoma cells were cultured in DMEM with 4.5 g/L glucose (Gibco cat. no. 31053 supplemented with 10% fetal bovine serum (PBS, Gibco cat. no. 10270), 1% penicillin/streptomycin no. 15140), 1% MEM NSAA (Gibco, cat. no. 11140), 1% L-glutamine (Gibco, cat. no. 25030), and 1% sodium pyruvate (Gibco, cat. no. 11360).

Composition preparation: Two-component combination matrix

For these experiments, a chess matrix was created. Stock ELA and component were serially diluted in DMSO in a series of 5 dots in a horizontal row (ELA) and in a series of 11 dots in a vertical row (component) of a 384-well plate. Subsequently, a 5X11 combination matrix was obtained by mixing all concentrations of one agent in a 1:1 ratio.

Free fatty acid (FFA) preparation.

Oleic (cat. no. O1383) and palmitic (P0500) acids were purchased from Sigma. Stock solutions of FFA (100 mM) were prepared in 0.1 M NaOH at 80°C. Working solutions of 4.5 mM palmitate/10% bovine serum albumin (BSA) and 9 mM oleate/10% BSA were prepared by complexing an appropriate volume of stock solution with 10% BSA (low endotoxin without FFA; Sigma-Aldrich, Bornem, Belgium). ) in a water bath at 55°C (15 min).

Fat loading and compound processing.

To assess lipid droplet content, HepG2 was seeded at a density of 40,000 cells/well in 384-well plates. The next day, the culture medium was removed and the cells were washed with PBS (Invitrogen, cat. no. 14190). HepG2 was cultured for 24 h in a serum-free medium. For treatment with ELA component and appropriate ELA/component combinations, serum-deprived HepG2 was pre-incubated for 24 h with compounds followed by addition of oleic acid:palmitic acid (2:1) at a final concentration of 0.5 mM for an additional 24 h.

Measurement of intracellular lipid droplets.

To measure the intracellular content of lipid droplets, the cells were brought to room temperature and washed with 40 µl of PBS. Cells were incubated for 30 min at room temperature with 40 µl of diluted Adipored reagent (2.5 µl of Adipored reagent in 200 µl of PBS) (Lonza,

Walkersville, MD). Relative fluorescence was measured (k excitation at 485 nm, k emission at 580 nm) using a fluorescence spectrometer (Spark Tecan cat. no. 30086376, SN no. 1801002745). Analyzes were performed in four repetitions.

5. Example in 3D culture of Huh7 spheroids.

3D culture of Huh7 spheroids.

Cryopreserved Huh7 were purchased from ECACC. Cells were grown in untreated plates (Costar), William's medium (Sigma) containing 10% PBS (Gibco) at 37° C., 5% CO ₂ in a humidified cell culture incubator. The cells aggregated and formed spheroids for 5 days.

Preparation of compositions: Two-component combination matrix.

For these experiments, a chess matrix was created. Stock ELA and component (ii) were serially diluted in DMSO in a two-dot-in-horizontal (ELA) series and in a three-dot-in-vertical series (component (ii)) of a 96-well plate. Subsequently, a 2X3 combination matrix was obtained by mixing all concentrations of one agent in a 1:1 ratio.

Metabolic stimulation of 3D culture of Huh7 spheroids and treatment with compounds.

Huh7 3D spheroids were cultured under standard conditions as described above. Then they were cultured for 24 h in a serum-free medium. For ELA treatment with component (ii) and the respective ELA/component (ii) combinations, serum-deprived spheroids were treated with both the NASH metabolic stimulus and compounds (Day 0) followed by the resumption of the NASH metabolic stimulus and compound on day 4 for an additional 3 days . Spheroids were stained for lipid accumulation on day 7.

Staining and quantification of lipids.

Intracellular lipid accumulation was quantified using the AdipoRedTM Assay Reagent (Lonza). The spheroids were subjected to quantitative fluorescence analysis at λexc: 485 nm and λem: 572 nm using a plate reader spectrophotometer (TECAN).

Results and discussion.

Abnormal persistence of differentiated myofibroblasts is characteristic of many fibrotic diseases. After liver injury, quiescent HSCs undergo an activation process that is characterized by differentiation into (α-SMA)-positive myofibroblasts. The PPAR agonist elafibranor has antifibrotic activity in human HSCs activated by the profibrogenic cytokine TGFe1 (Fig. 9). Here it is shown that combinations of MSDC-0602, PXS-4728, apararenone, CF-102 (namodenoson), vismodegib, PBI-4050, emrikasan, DUR-928, VK-2809 or KD-025 with elafibranor unexpectedly synergistically inhibit α-SMA secretion ZKP (Fig. 9).

Because the liver is made up of different cell types (hepatocytes, immune cells, HSC, ...) and because HSC activation can be the result of different stimuli involving other liver cells, a liver microtissue model was also used to test combination treatments for fibrosis. Treatment with NASH metabolic stimulus increased collagen secretion by microtissue. In this model, elafibranor synergized with CP-640186, GS-0976 and nalmefene to inhibit collagen secretion (Fig. 10).

Taken together, these results demonstrate synergistic antifibrotic effects of elafibranor combinations with MSDC-0602, PXS-4728, apararenone, CF-102 (namodenosone), vismodegib, PBI-4050, emrikasan, DUR-928, VK-2809, KD-025, CP- 640186, GS-0976 or nalmefene (JKB-121).

Metabolic diseases such as NAFLD/NASH are associated with non-specific inflammation. Activation of immune cells produces cytokines that alter the metabolic functions of the liver and peripheral organs (adipose tissue, pancreas, ...). The permeability of the intestinal wall, described in metabolic and hepatic diseases, leads to an increase in circulating bacterial components (lipopolysaccharides or LPS) that activate macrophages in the liver and peripheral organs (adipose tissue). Because PPARs have anti-inflammatory activity, the inventors investigated whether elafibranor and other compounds could inhibit macrophage activation by LPS. In a THP1 monocyte model differentiated into macrophages, LPS treatment activates macrophages as measured by TNF-α secretion. Only elafibranor (1 μm) inhibited TNFa by 21% (Fig. 11). The combination of elafibranor with gemcaben surprisingly effectively inhibited TNFa secretion by 50% (Fig. 11). Therefore, this result shows the ability of elafibranor to synergize with other compounds to reduce the level of inflammation seen in a number of diseases, including NASH and metabolic diseases.

NAFLD/NASH is characterized by a primary accumulation of fat in hepatocytes (steatosis) that causes lipotoxicity leading to inflammation, cell death, tissue remodeling and ultimately fibrosis. Since PPARa and PPARδ are known to induce fat oxidation and inhibit de novo lipogenesis, we wanted to see if elafibranor in combination with other compounds could prevent fat accumulation in hepatocytes. Thus, HepG2 cells were treated

- 26 042734 free fatty acid (FFA) to cause accumulation of lipid droplets. In this model, elafibranor alone (10 µM) reduced fat accumulation by 20%. The decline unexpectedly reached

40% when elafibranor was combined with CP-640186, VK-2809, apararenone, or aramchol (Fig. 12).

Also, to solve this issue, a three-dimensional (3D) model of hepatocytes in vitro was used, which allows more physiologically to reproduce the structure of the liver. In this model, fat accumulation was obtained by treatment with a NASH metabolic stimulus. Elafibranor (3 μM) reduced fat content by 12% (Fig. 13). The combination of elafibranor with MGL-3196 (1 μM) effectively reduced hepatocyte lipids by 28% (Fig. 13), showing a synergistic effect when both drugs were used together.

Taken together, these results indicate that elafibranor synergizes with CP-640186, VK-2809, apararenone, aramchol, and MGL-3196, in particular to reduce steatosis.

In conclusion, these results show the ability of elafibranor to interact with MSDC-0602, PXS-4728, apararenone, CF-102 (namodenosone), vismodegib, PBI-4050, emrikasan, DUR-928, KD-025, CP-640186, GS-0976, nalmefene (JKB-121), BK-2809, MGL-3196 and aramchol, in particular to reduce NAFLD levels.

Example 2 Combination of ELA and OCC.

Materials and methods.

Evaluation of elafibranor, OCA, and the combination of elafibranor + OCA in a chronic CDAA + 1% cholesterol model (12 weeks).

The prophylactic effects of elafibranor alone, OCA, and their combination were evaluated in a rat model of fibrosing NASH fed a CDAA + 1% cholesterol diet. Male Wistar rats weighing 150-175 g received a control diet (CSAA), CDAA diet + 1% cholesterol or CDAA + 1% diet with the addition of elafibranor at a dose of 1, 3 and 10 mg/kg/day, OCA at a dose of 10 and 30 mg / kg / day or combined drugs (elafibranor at a dose of 1, 3 and 10 mg / kg / day in combination with OCA at a dose of 10 mg / kg / day) for 12 weeks.

Body weight and food intake were monitored twice a week. On the last day of treatment, rats were sacrificed after a 6 hour fasting period. The liver was quickly removed for biochemical and histological studies.

All animal procedures were performed according to standard protocols and in accordance with standard guidelines for the proper care and use of laboratory animals.

Histology.

Tissue filling and cutting.

Parts of the liver were first fixed for 12 h in a 4% formalin solution. Then the liver pieces were washed for 30 min in PBS and dehydrated in ethanol solutions (successive baths of 70%, 80%, 95%, and 100% ethanol). The liver pieces were aged in three different baths of xylene (Sigma-Aldrich, cat. no. 534056) and then in two baths of liquid paraffin (56°C). The liver pieces were then placed in trays which were carefully filled with Histowax® to completely cover the tissue.

Paraffin blocks containing tissue pieces were removed from the trays and stored at room temperature. Sections of 3 μm thick were obtained from liver blocks.

Hematoxylin/eosin staining.

Liver sections were deparaffinized, rehydrated and incubated for 3 min in Mayer's hematoxylin (Microm cat. no. F/C0303). Then the liver sections were washed with water and incubated for 1 min in eosin G (VWR, cat. no. 1.09844.1000). Sections were washed in water, then dehydrated and mounted using CV Mount medium (Leica cat. no. 14046430011).

Stained with picrosirius red.

Liver sections were deparaffinized, rehydrated, and, before washing in a 0.5% acetic acid bath (Panreac, cat. no. 131008.1611), incubated for 15 min in 0.1% Fast Green FCF solution (Sigma-Aldrich, cat. No. F7258). The liver sections were then washed with water and incubated for 30 min in 0.1% Sirius Red (Direct Red 80, Fluka, cat. no. 43665) in saturated aqueous picric acid (Sigma-Aldrich, cat. no. P6744). Sections were then dehydrated and mounted using CV Mount medium (Leica, cat. no. 14046430011).

Histological studies.

Histological studies were performed by a specialist working with anonymized data on the source of each liver sample. Virtual slides were obtained using a Pannoramic 250 scanner from 3D Histech. Scores summarizing the main histological lesions in NASH were determined from the NASH Clinical Research Network (Kleiner 2005, Brunt 1999) for each animal. Briefly, steatosis, lobular inflammation, and balloon degeneration of hepatocytes were assessed. The NAFLD activity rating scale score (NAS score) was set for each test animal as the unweighted sum of the determination of the severity of steatosis (0-3), lobular inflammation (0-3) and balloon dystrophy (0-2).

Using Quant Center software (3D Histech including Pattern Quant modules

- 27 042734 and Histo Quant), the number of areas with stained collagen was determined. In short, the module

Pattern Quant was used to detect tissue and measure its surface. The Histo Quant module was then used to determine the content of colored collagen and measure its surface based on the color threshold method. The area of fibrosis was then expressed as a percentage of collagen surface to total tissue per animal.

Measurement of hepatic collagen content.

Hepatic collagen content was determined using the appropriate QuickZyme kit (Total Collagen Assay, cat. no. QZB-totcol2). The assay is based on the detection of hydroxyproline, which is a non-proteinogenic amino acid found primarily in the collagen triple helix. Thus, hydroxyproline in tissue hydrolysates can be used as a direct measure of the amount of collagen present in tissue (without distinction between procollagen, mature collagen, and collagen breakdown products).

Complete hydrolysis of tissue samples in 6 M HCl at 95°C is necessary before dosing hydroxyproline. The analysis results in the formation of a chromogen with maximum absorbance at 570 nm. Results are expressed as mg collagen/g liver.

alpha-2-macroglobulin (a2M).

Plasma concentration of a2M was determined using the Abcam kit (p/n ab157730) according to the manufacturer's instructions. Briefly, the microplate is pre-coated with an antibody specific for rat a2M. The standards, controls and samples were then pipetted into the wells and any a2M present in the plasma was bound to the immobilized antibody. After washing, a secondary antibody labeled with horseradish peroxidase is added to the wells. After washing, the substrate solution is added to the wells. The enzymatic reaction is stopped by adding a stop agent. The color intensity measured at 450 nm is proportional to the amount of a2M bound initially. The sample values were then derived from the calibration curve. Results are expressed in ng/ml.

N-terminal propeptide of procollagen III (PIIINP).

Plasma concentration of PIIINP was determined by ELISA using a kit from Cloud-Clone Corp (Cat. No. SEA573Ra) according to the manufacturer's instructions. The microtiter plate is pre-coated with an antibody specific for PIIINP. Standards or samples are added to the appropriate wells of a microtiter plate with biotinylated PIIINP specific antibody. Avidin conjugated with horseradish peroxidase (HRP) is then added to each well of the microplate and incubated. After adding the TMB substrate solution, only those wells containing PIIINP, biotinylated antibody, and enzyme-conjugated avidin will show a color change. The enzyme-substrate reaction was stopped by adding a sulfuric acid solution and the color change was measured spectrophotometrically at a wavelength of 450±10 nm. The concentration of PIIINP in the samples was then determined by comparing the OD of the samples with the calibration curve. Results are expressed in pg/ml.

Analysis of liver gene expression.

Total RNA was isolated from rat liver using the Rneasy Mini Kit (Qiagen) according to the manufacturer's instructions. Total RNA was reverse transcribed into cDNA using M-MLV RT (Moloney mouse leukemia virus reversetase) (Invitrogen, cat. no. 28025) in 1x RT buffer (Invitrogen), 0.5 mM DTT (Invitrogen), 0.18 mM mixture dNTP (Promega), 200 ng pdN6 (Amersham) and 30 u. RNase inhibitor (Promega).

Quantitative PCR was then performed using the detection system of the CFX96 Touch™ real-time PNR analyzer (Biorad). Briefly, PCR was performed in a 25 µl total volume 96-well plate format containing 1 µl reverse transcription reaction, 0.5 µl reverse and forward primers (10 pmol each) and 12.5 µl 2X iQ SYBR Green Supermix ( BioRad) using the following primer sequences:

- 28 042734

Gene Straight Back RPLP0 CATGCTCAACATTCTCCCCCTTCT SS (SEQIDNO:1) GGGAAGGTGTAATCCGTCTCCA CAG (SEQ ID NO:2) aSMA (ASTA2) ACTGGGACGACATGGAAAAG (SEQ ID NO:3) CATCTCCAGAGTCCACACA (SEQ ID NO:4) TIMP1 TCCCCAGAAATCATCGAGAC (SEQ ID NO:5) TCAGATTATGCCAGGGAACC (SEQ ID NO:6) TGFB1 TGAGTGGCTGTCTTTTGACG (SEQ ID NO:7) TGGGACTGATTCCCATTTGATT (SEQ ID NO:8) SCK5 CAGAACAGTCAACTTTGGGG SEQ ID NO:9 ACGTGGAAAATGAGGACTGC (SEQ ID NO: 10)

Expression levels were normalized using RPLP0 gene expression as a housekeeping reference gene in the samples. For each gene, calibration curves were built by selecting the best points (at least three points) to have a PCR efficiency close to 100% and a correlation coefficient close to 1. Expression levels were determined using the calibration curve equation as for housekeeping genes, and for the target gene (taking into account the specific efficiency of PCR for each target gene).

Results and discussion.

The results are presented in the following table and in FIG. 1-5.______________________________ GFT505 3 mg/kg/day OHK 10 mg/kg/day GFT505+OXK Fibrosis surface 34±17%* 74±45% 19±4%# The content of hepatic collagen 45±12%* 67±23%* 34±5%# aSMA mRNA level 66±27% 109±68% 39±18%# TIMP1 mRNA level 78±23% 110±43% 46±13% ## TGFpl mRNA level 94±20% 110±23% 67±16% ## CCK5 mRNA level ⁺ 103±51% 81±28% 56±17%#

Percent compared to untreated CDAA + 1% cholesterol diet in rats. *p<0.01,*p<0.001 vs. CDAA + 1% cholesterol group (ANOVA+Bonferroni). # p<0.05, ## p<0.07 versus best single agent (Student's t-test). (+ inflammation marker).

Western lifestyles are consistently associated with a high incidence of non-alcoholic steatohepatitis (NASH), a chronic liver disease that often progresses to fibrosis and cirrhosis, and can eventually lead to hepatocellular carcinoma. There is currently no approved therapy for NASH. Combinations of drugs that target multiple therapeutic targets simultaneously have the potential to significantly improve drug response and benefit a broader patient population. Drug combinations have previously been tested in other systemic diseases, such as hypertension, dyslipidemia, or type 2 diabetes, and have shown better control of the underlying diseases and reduced morbidity and mortality. Both elafibranor (a PPAR α/δ agonist) and OCA (FXR agonist) have been shown to be effective in NASH and fibrosis at the endpoints of recent phase 2B studies. The inventors wanted to compare their effects on respective outcomes in NASH pathology and to determine the therapeutic effects of the combination.

To achieve this goal, NASH histology and fibrosis were induced by feeding Wistar rats on a choline-deficient L-amino acid diet supplemented with cholesterol (CDAA/chol diet). Animals in the experimental group received either elafibranor, or OCA, or both during the entire study period. NASH and development of fibrosis were assessed histologically. Additional biochemical and molecular analyzes were also performed with various relevant biomarkers.

Wistar rats fed a CDAA/Chol diet developed NASH-related histology and fibrosis with a high level of severe disease involvement. All animals showed progressive steatosis, lobular inflammation, and balloon dystrophy, and the NAS score ranged from 6 to 8. Liver histology (positive picrosirius staining area) and biochemistry (hepatic collagen concentration) showed an average four-fold increase in liver fibrous tissue , and the fibrosis score was either 3 or 4 for all animals on the CDAA/x diet that did not receive drug treatment. Expression of genes associated with inflammation, oxidative stress, tissue remodeling, and fibrosis was increased and consistent with gene expression profiles previously reported in patients with severe NASH.

The introduction of only elafibranor and OCC led to a very significant weakening of the development of fibrosis. Similar efficacy in fibrosis was seen in animals treated with both compounds, albeit at significantly lower doses. Hepatocyte injury, as judged by swelling, was prevented or attenuated by elafibranor in a dose-dependent manner. In contrast, single OCC showed partial relief of ballooning at the doses used in this study. Lobular inflammation was attenuated with elafibranor in a dose-dependent manner and to a lesser extent with OCA. Finally, administration of one of the candidate drugs partially attenuated the increase in markers of tissue remodeling, inflammation, and oxidative stress, and the combination of both compounds was more effective than any single agent.

Thus, it is shown here that the synergistic effect of elafibranor and OCA on hepatic fibrosis in the CDAA/x diet-induced model of NASH results in a comparable therapeutic effect at significantly lower doses of both candidate drugs compared to either single agent. Based on this study, it can be reliably expected that the doses of both candidate drugs can be reduced by at least 1.5, 2, 2.5 or even at least 3 times in order to obtain results similar to the starting dose of each. compound used alone. In addition, elafibranor showed a clear protective effect against the background of liver damage. The effects of OCA on balloon dystrophy and lobular inflammation were rather modest in this model. From this study, it can be concluded that the combination of elafibranor/OHC will be useful for a wider category of patients, and an appropriate reduction in the therapeutic dose will reduce the incidence of side effects of the drug.

Example 3 Combination of ELA and CVC.

Materials and methods.

Compounds were dissolved in dimethyl sulfoxide (DMSO, Fluka cat. no. 41640). CVC was supplied commercially by CLINISCIENCES (ref: A13643-10, Serial no: 497223-25-3).

Bezafibrate was synthesized by Genfit.

The culture of human HSP.

Primary human liver stellate cells (HSCs) (Innoprot) were cultured in STeCM medium (ScienCell, cat. no. 5301) supplemented with 2% fetal bovine serum (FBS, ScienCell, cat. no. No. 0503) and Stellate Growth Supplement (SteCGS; ScienCell Cat. No. 5352). To improve adhesion, cell culture flasks were coated with poly-L-lysine (Sigma, cat. no. P4707).

Preparation of compositions.

Two-component combination matrix (elafibranor/CVC).

For these experiments, a chess matrix was created. Stock CVC and elafibranor were serially diluted in DMSO in a series of five points in a horizontal row (elafibranor) and in a series of six points in a vertical row (cenicrivirok) of a 96-well plate. Subsequently, a 6X7 combination matrix was obtained by mixing all concentrations of one agent in a 1:1 ratio. Experimental concentrations for each compound were selected based on the respective IC ₅₀ of each compound as a single agent, obtained by measuring the content of α-SMA in a model of HSCs stimulated with TGFe1.

Human HSC TGFe1 Activation and Compound Treatment

Primary human liver stellate cells (HSC) (Innoprot) were cultured under standard conditions as described above. Cells were then seeded at a density of 2×10 ⁴ cells/well in 96-well plates to measure α-SMA by ELISA.

The next day, the culture medium was removed and the cells were washed with PBS (Invitrogen, cat. no. 14190). Human HSCs were cultured for 24 h in serum-free and SteCGS-free medium. For treatment with CVC, elafibranor, bezafibrate, and CVC/elafibranor and CVC/bezafibrate paired combinations, serum-deprived human HSCs were pre-incubated for 1 h with the compounds followed by the addition of TGF-e1 profibrogenic stimuli (PeproTech, cat. no. 100-21, 1 ng/ ml) in serum-free and SteCGS-free medium for an additional 48 hours.

ELISA α-SMA.

The level of α-SMA was measured using a sandwich ELISA. Briefly, the wells of the ELISA plate were first coated with immobilized antibody (mouse monoclonal anti-ACTA2, Abnova) at 4°C overnight. After 3 washes in PBS + 0.2% Tween-20 for 1 hour, a blocking solution consisting of PBS + 0.2% BSA was added, followed by another wash cycle. Cell lysates were transferred to the wells for binding to the immobilized antibody for 2 hours at room temperature. After the washing procedure, identifying antibody (biotinylated mouse monoclonal anti-ACTA2 antibody, Abnova) was added for 2 hours at room temperature with

- 30 042734 three subsequent washes. For detection, streptavidin conjugated to HRP (R&D Systems cat. no. DY998) was used first for 30 minutes at room temperature. After washing, TMB HRB substrate (BD, cat. no. 555214) was added and incubated for 7 min at room temperature in the dark. After oxidation, TMB forms a water-soluble blue reaction product, which turns yellow with the addition of sulfuric acid (stopping solution), which allows accurate measurement of the intensity at 450 nm using a spectrophotometer. The resulting color is directly proportional to the amount of α-SMA present in the lysate.

Determination of synergy by the Bliss difference method.

The α-SMA values obtained using the ELISA method were first converted to percent inhibition compared to the TGF-e1 control. Bliss difference was then determined using these percentage inhibitions to determine the synergistic effects of the drug combinations. First, the expected Bliss additivism score (E) was determined using the formula

E=(A+B)-(AxB), where A and B are the percentage inhibition of elafibranor (A) (or bezafibrate) and cenicriviroc (B) at a given dose.

The difference between Bliss' expected and observed inhibition of combined CVC/elafibranor (or bezafibrate) at the same dose is the Bliss Difference score.

A Bliss difference score of 0 indicates that the combination treatment is additive (as expected for effects alone);

A Bliss difference score > 0 indicates activity greater than additive (synergism); And

Bliss difference score < 0 means that the activity of the combination is less additive (antagonism).

For combinations of elafibranor + CVC and bezafibrate + CVC, an additional overall Bliss score was calculated by summing all Bliss scores.

To confirm synergy, the experimental values corresponding to the highest Bliss score for the CVC/elafibranor combination were plotted as a histogram.

The significance of observed differences between CVC/elafibranor or CVC/bezafibrate compared to the most effective individual agent was determined using Student's t-test. [*: p<0.05; *: p<0.01; *: p<0.001]

Results and conclusions.

Abnormal persistence of differentiated myofibroblasts is characteristic of many fibrotic diseases.

After liver injury, quiescent HSCs undergo an activation process that is characterized by differentiation into (α-SMA)-positive myofibroblasts.

The PPAR agonist elafibranor exhibits antifibrotic activity in human HSCs activated by the profibrogenic cytokine TGFe1. The α-SMA marker was reduced by 80% with an IC ₅₀ of 3.17 μM (FIG. 6A). However, other PPAR agonists, such as bezafibrate, showed a weak antifibrotic profile (FIG. 6C), suggesting that PPAR agonists are not equivalent in terms of their antifibrotic properties. CVC alone at all doses showed no significant effect in TGFe-activated HSCs (FIG. 6B). To evaluate whether the combination of elafibranor with CVC could synergistically reduce fibrosis, matrix combination experiments were performed in TGFe-induced HSC. Briefly, CVC and elafibranor solutions were serially diluted in a staggered format, creating a matrix of 42 combinations covering a large panel of elafibranor/CVC combinations. Synergy was determined for the first time by calculating the Bliss difference score. These experiments showed that elafibranor can synergize with CVC to reduce α-SMA secretion in activated HSCs (Fig. 7A and B). One of the best examples of synergy is shown in Fig. 7C with 5 μM of each compound. Although 5 µM of CVC alone did not show any antifibrotic activity, their addition to 5 µM elafibranor can significantly synergistically increase elafibranor activity and achieve 60% inhibition (compared to 40% with 5 µM elafibranor). In contrast, the combination of CVC with bezafibrate showed much lower Bliss scores (Figures 8A and B) and neither combination was statistically significant.

In conclusion, Applicants have found unexpected antifibrotic activities for the combination of ELA and CVC. These results indicate that the combination of a compound of formula (I) with CVC may be synergistic and may provide therapeutic effects in several types of diseases, such as fibrotic diseases.

Example 4 Elafibranor Combinations with Seloncertib (SEL), GKT-831 or GS-0976 (GS): evaluation in a mouse model of fibrosing NASH (8 weeks).

The prophylactic effects of combinations of elafibranor with seloncertib, GKT-831 or GS-0976 were evaluated in mice fed a choline-deficient L-amino acid (CDAA) diet supplemented with 2% cholesterol and 30% milk fat and high fructose corn syrup 55 (55%

- 31 042734 fructose/45% glucose for a final concentration of 42 g/l) in drinking water Mells et al. J. Nutr. Biochem.

2015) (CDFF diet). Male C57Bl/6J mice aged 5-6 weeks were fed on the control (CSAA) diet (n=4), CDFF (n=12) or CDFF supplemented with elafibranor (at a dose of 1 or 3 mg/kg/day), seloncertib ( at a dose of 30 mg/kg/day) or GKT-831 (at a dose of 60 mg/kg/day) or GS-0976 (at a dose of mg/kg/day) alone or in combination (n=8 per group) for 8 weeks.

Body weight, food and water intake were monitored twice a week. On the last day of treatment, plasma samples were obtained by retroorbital sinus blood sampling and mice were sacrificed after a 6 hour fasting period. The liver was quickly removed for biochemical and histological analysis. All animal procedures were performed according to standard protocols and in accordance with standard guidelines for the proper care and use of laboratory animals.

Histology.

Tissue filling and cutting.

Liver sections were fixed in 4% formalin solution. Then the liver pieces were washed for 30 min in PBS and dehydrated in ethanol solutions (successive baths of 70%, 80%, 95%, and 100% ethanol). The liver pieces were aged in three different xylene baths (Honeywell, cat. no. 534056) and then in two changes of liquid paraffin (59°C). The liver pieces were then placed in trays which were carefully filled with Histowax® to completely cover the tissue.

Paraffin blocks containing tissue pieces were removed from the trays and stored at room temperature. Sections of 3 μm thick were obtained from liver blocks.

Staining with hematoxylin/eosin/safranin.

Liver sections were deparaffinized, rehydrated and incubated for 3 min in Mayer's hematoxylin (Microm cat. no. F/C0303). Then the liver sections were washed with water and incubated for 1 min in 0.5% alcohol solution of eosin Y (VWR, cat. no. 1.02439.0500) and 0.5% erythrosin solution (VWR, cat. no. 1.15936.0010) and washed with ethanol. Sections were then incubated for 2 min in safranin and finally dehydrated and mounted using CV Mount medium (Leica cat. no. 046430011).

Stained with picrosirius red.

Liver sections were deparaffinized, rehydrated, and, before washing in a 0.5% acetic acid bath (Panreac, cat. no. 131008.1611), incubated for 15 min in 0.1% Fast Green FCF solution (Sigma-Aldrich, cat. No. F7258). The liver sections were then washed with water and incubated for 30 min in 0.1% Sirius Red (Direct Red 80, Fluka, cat. no. 43665) in saturated aqueous picric acid (Sigma-Aldrich, cat. no. P6744). Sections were then dehydrated and mounted using CV Mount medium (Leica, cat. no. 14046430011).

Histological studies.

Histological studies were performed by a specialist working with anonymized data on the source of each liver sample. Virtual slides were obtained using a Pannoramic 250 scanner from 3D Histech. Scores summarizing the main histological lesions in NASH were determined from the NASH Clinical Research Network (Kleiner 2005, Brunt 1999) for each animal. Briefly, steatosis, lobular inflammation, and balloon degeneration of hepatocytes were assessed. The NAFLD Activity Scale (NAS) score was set for each test animal as the unweighted sum of the determination of the severity of steatosis (0-3), lobular inflammation (0-3) and balloon dystrophy (0-2).

Using the Quant Center software (3D Histech, including Pattern Quant and Histo Quant modules), the number of areas with stained collagen was determined. In short, the Pattern Quant module was used to detect tissue and measure its surface. The Histo Quant module was then used to determine the content of colored collagen and measure its surface based on the color threshold method. The area of fibrosis was then expressed as a percentage of collagen surface to total tissue per animal.

Biochemical analysis of liver samples.

Measurement of hepatic collagen content.

Hepatic collagen content was determined using the appropriate QuickZyme kit (Total Collagen Assay, cat. no. QZB-totcol2). The assay is based on the detection of hydroxyproline, which is a non-proteinogenic amino acid found primarily in the collagen triple helix. Thus, hydroxyproline in tissue hydrolysates can be used as a direct measure of the amount of collagen present in tissue (without distinction between procollagen, mature collagen, and collagen breakdown products).

Complete hydrolysis of tissue samples in 6 M HCl at 95°C is necessary before dosing hydroxyproline. The analysis results in the formation of a chromogen with maximum absorbance at 570 nm. Results are expressed as mg collagen/g liver.

Measurement of hepatic triglycerides.

Approximately 100 mg of frozen liver tissue was homogenized using a homogenizer

- 32 042734 tissues (Precellys®24, Bertin Technologies, France) in 150 mM NaCl buffer containing 15.4 mM NaN ₃ .

The lipid fractions in the homogenates were extracted with chloroform-methanol (2:1, v/v) followed by triglyceride measurement (Biolabo cat. no. 80019).

Measurement of N-terminal propeptide of plasma procollagen III (PIIINP).

Plasma concentration of PIIINP was determined by ELISA using a kit from Cloud-Clone Corp (cat. no. SEA573Mu), according to the manufacturer's instructions. The microtiter plate is pre-coated with an antibody specific for PIIINP. Standards or samples are added to the appropriate wells of a microtiter plate with biotinylated PIIINP specific antibody. Avidin conjugated with horseradish peroxidase (HRP) is then added to each well of the microplate and incubated. After adding the TMB substrate solution, only those wells containing PIIINP, biotinylated antibody, and enzyme-conjugated avidin will show a color change. The enzyme-substrate reaction was stopped by adding a sulfuric acid solution and the color change was measured spectrophotometrically at a wavelength of 450±10 nm. The concentration of PIIINP in the samples was then determined by comparing the OD of the samples with the calibration curve. Results are expressed in pg/ml.

Measurement of plasma tissue metalloproteinase inhibitor 1 (TIMP-1).

Plasma levels of TIMP-1 were measured using a quantitative sandwich ELISA using a kit from R&D Systems (cat. no. MTM100), according to experimental protocol PRO LIDO 000020. Briefly, a monoclonal antibody specific for mouse TIMP- 1 was pre-applied to a microplate. Standards, controls, and samples were pipetted into the wells, and any mouse TIMP-1 present was bound to the immobilized antibody. After washing any unbound substances, a mouse TIMP-1 specific polyclonal antibody coupled to the enzyme was added to the wells. After washing to remove any unbound antibody-enzyme reagent, the substrate solution is added to the wells. The enzymatic reaction produces a blue product which turns yellow upon addition of Stop Reagent. The intensity of the measured color is proportional to the amount of mouse TIMP-1 bound initially. The sample values were then calculated from the standard curve. Results are expressed in pg/ml.

Analysis of liver gene expression.

Total RNA was isolated from mouse liver using the Rneasy Mini Kit (Qiagen) according to the manufacturer's instructions. Total RNA was reverse transcribed into cDNA using M-MLV RT (Moloney mouse leukemia virus reversetase) (Invitrogen, cat. no. 28025) in 1x RT buffer (Invitrogen), 0.5 mM DTT (Invitrogen), 0.18 mM mixture dNTP (Promega), 200 ng pdN6 (Amersham) and 30 u. RNase inhibitor (Promega).

Quantitative PCR was then performed using the CFX96 Touch™ Real Time PCR Detection System (Biorad). Briefly, PCR was performed in a 25 µl total volume 96-well plate format containing 1 µl reverse transcription reaction, 0.5 µl reverse and forward primers (10 pmol each) and 12.5 µl 2X iQ SYBR Green Supermix ( BioRad) using the following primer sequences:

Gene Straight Back GAPDH TATGACTCCACTCACGGCAA (SEQ ID NO: 11) TCCACGACATACTCAGCACC (SEQ ID NO: 12) Coital AGGCGAACAAGGTGACAGAG (SEQ ID NO: 13) GCCAGGAGAACCAGCAGAG (SEQ ID NO: 14) TGFpl TTGCTTCAGCTCCACAGAGA (SEQ ID NO: 15) TGGTTGTAGAGGGCAAGGAC (SEQ ID NO: 16) SCK2 TAATATGTTACCTCAGTTCATCCA CGG (SEQ ID NO: 17) TGCTCTTCAGCTTTTTACAGCCTA TC (SEQ ID NO: 18) MMP2 TCCCTAAGCTCATCGCAGAC (SEQ ID NO: 19) GCTTCCAAACTTCACGCTCT (SEQ ID NO:20) TNFa CGTGGAACTGGCAGAGAGG (SEQ ID NO:21) AGACAGAAGAGCGTGGTGGC (SEQ ID NO:22)

Expression levels were normalized using GAPDH gene expression as a housekeeping reference gene in the samples. For each gene, calibration curves were built by selecting the best points (at least three points) to have a PCR efficiency close to 100% and a correlation coefficient close to 1. Expression levels were determined using the calibration curve equation as for housekeeping genes, and for the target gene (taking into account the specific efficiency of PCR for each target gene).

-

Claims (5)

Results and conclusions. Elafibranor, seloncertib, GKT-831, and GS-0976 have shown efficacy in NASH and fibrosis at endpoints in recent clinical trials. The inventors wanted to compare their effects on respective outcomes in NASH pathology and to determine the therapeutic effects of the combination. To achieve this goal, NASH was induced by feeding C57Bl/6J mice on a choline deficient L-amino acid diet supplemented with cholesterol and milk fat and high fructose corn syrup in drinking water (CDFF diet). Animals in the experimental groups received either elafibranor, seloncertib, GKT-831 or GS-0976 alone or in combination with elafibranor throughout the study period. The development of NASH was assessed by histological and biochemical measurements and by hepatic expression of genes involved in pathways relevant to NASH pathology. Mice fed the CDFF diet developed NASH with a high rate of severe disease. All animals exhibited progressive steatosis and lobular inflammation resulting in a high NAS score of 6 or 7 (FIG. 15C). Expression of genes associated with fibrogenesis, tissue remodeling, and inflammation was increased and consistent with gene expression profiles previously reported in patients with severe NASH (Fig. 14E-I). In this model, elafibranor (3 mg/kg/day) improves NASH histology by reducing liver steatosis and lobular inflammation, resulting in an overall decrease in NAFLD activity scores (not shown). Elafibranor also reduces the expression of genes associated with inflammation, tissue remodeling, and fibrogenesis (Fig. 14E-I), resulting in a marked reduction in hepatic fibrosis, as assessed by histology, in hepatic collagen content and the release of PIIINP and TIMP-1 in the blood (Fig. 14E-I). .14A-D). Seloncertib alone (30 mg/kg/day) reduced liver fibrosis in this model, although to a lesser extent than elafibranor (Figure 14). The combination of elafibranor (3 mg/kg/day) and seloncertib (30 mg/kg/day) resulted in a synergistic beneficial effect on hepatic fibrosis (as assessed by histology, hepatic collagen content, and release of PIIINP and TIMP-1) as well as hepatic expression genes involved in fibrogenesis, tissue remodeling and inflammation (Fig. 14). GKT-831 alone (60 mg/kg/day) had no positive effect on NASH and fibrosis in this model. However, when combined with a suboptimal dose of elafibranor (1 mg/kg/day), it reduced hepatic inflammatory infiltrates, NAFLD activity score, and fibrosis (Figure 15). Treatment with GS-0976 (30 mg/kg/day) had a modest positive effect on liver fat and body weight in this model (FIG. 16). However, combination with elafibranor at a suboptimal dose (1 mg/kg/day) resulted in a synergistic effect on whole body fat burning resulting in a 20% weight loss and a marked reduction in hepatic steatosis and triglyceride levels (Fig. 16). In conclusion, the inventors found synergistic effects between elafibranor and MSDC-0602, PXS-4728, MT-3995 (apararenone), CF-102 (namodenosone), vismodegib, PBI-4050, gemcaben, CP-640186, GS-0976, JKB- 121 (nalmefene), VK-2809, MGL-3196, aramhol, emrikasan, DUR-928 (25-hydroxycholesterol-3-sulfate), seloncertib, KD-025, or GKT-831. Reference materials 1. Brunt E.M. et al., 1999, Am. J. Gastroenterol.; 94(9):2467-74. 2. Kleiner D.E. et al., 2005, Hepatology; 41(6):1313-21. CLAIM 1. The use of a combined medicinal product for the treatment of fibrotic disease, where the medicinal product includes: (i) elafibranor or a pharmaceutically acceptable salt thereof; and (ii) an AKC inhibitor selected from the group consisting of gemcaben, CP-640186 and GS-0976 or a pharmaceutical salt thereof. 2. The use according to claim 1, where the combination drug is a composition containing components (i) and (ii) and a pharmaceutically acceptable carrier. 3. The use according to claim 1 or 2, where the combination drug is a composite kit including components (i) and (ii) for sequential, separate or simultaneous use. 4. Use according to any one of claims 1 to 3, wherein the components (i) and (ii) are in the form of an injection suspension, gel, oil, pill, tablet, suppository, powder, capsule, aerosol, ointment, cream, patch or with using galenic forms for prolonged and/or slow release. 5. Use according to claim 1, wherein the fibrotic disease is selected from the group consisting of fibrosis of the liver, kidney, skin, epidermis, endoderm, muscle, tendon, cartilage, heart, pancreas, -