EA042641B1 - QINOXALINONE COMPOUNDS, COMPOSITIONS, METHODS AND KITS FOR INCREASING THE EFFICIENCY OF GENOME EDITING - Google Patents

Description

Cross-reference to related applications

This application claims priority to U.S. Provisional Application No. 62/618385, filed January 17, 2018, the entire contents of which are hereby incorporated by reference.

Sequence list

The present application contains a sequence listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII file created on January 16, 2019 is named 14390-687 Sequence listing_ST25.txt and is 4 KB in size.

Field of invention

The present invention relates generally to compounds, compositions, methods and kits for enhancing the efficiency of genome editing by administering a DNA protein kinase (DNA-PK) inhibitor, and to a genome editing system in a cell(s).

Prerequisites for the creation of the invention

Precise methods of targeting the genome are needed to enable systems engineering of genetic variation. In the past few years, the use of genome editing systems, and in particular CRISPR endonuclease based genome editing technology systems, has grown exponentially. The bacterial innate immune system CRISPR-Cas9 type II was used as an effective genome editing tool for targeted modification of the human genome (Wiedenheft, V. 2012; Hsu, P.D. eta. 2014). Recently, CRISPR-Cpf genome editing systems have been described. Genome editing based on the CRISPR endonuclease relies in part on non-homologous end joining (NHEJ) and homologous targeted repair (HDR) pathways to repair DNA double strand breaks. For cells, the NHEJ repair mechanism is more preferable than HDR.

Although some reports have shown that NHEJ is up to 70% efficient in achieving insertions or deletions (insertions/deletions), achieving HDR efficacy remains challenging, with less than 1% efficiency.

Accordingly, there is a need to improve the efficiency of genome editing, in particular the efficiency of HDR.

The essence of the invention

The present invention can improve HDR performance by inhibiting NHEJ enzymes such as DNA-PK through the use of DNA-PK inhibitors.

In some embodiments, the invention relates to a compound represented by the structural formula (I)

or a pharmaceutically acceptable salt thereof, or a co-crystal thereof, wherein m and n are independently 1 or 2;

X is O or NR; where R represents H or C1-C ₄ -alkyl;

Y is a bond, O or NR, where R is H or C1- _C4 alkyl;

R ¹ is C1- _C4 alkyl;

R ² is a 5- or 6-membered aryl or heteroaryl ring containing one or two heteroatoms selected from the group consisting of N, O and S, where the aryl and heteroaryl ring may be substituted with 0, 1, 2 or 3 substituents R ³ independently selected from the group consisting of CN, halogen, C1-C4 alkyl, C3-C6 cycloalkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, C(=O)NHR1, and 5 - or a 6-membered heterocycloalkyl or heteroaryl ring, where each ring contains 1, 2 or 3 heteroatoms selected from N, O and S; where R ¹ represents C1-C4 alkyl; or where two R ³ groups connected to adjacent carbon atoms of the aryl or heteroaryl ring may form a fused 5- or 6-membered ring which may contain a heteroatom selected from O, N and S; or COOR ⁴ where R ⁴ is C1-C4 alkyl or benzyl.

Each of C1- _C4 alkyl, C1- _C4 haloalkyl, C1- _C4 alkoxy and C1- _C4 haloalkoxy may be further substituted with OR ⁵ or NR ⁶ R ⁷ .

Each of R ⁵ , R ⁶ and R ⁷ independently represents H, C1-C ₄ -alkyl or C ₃ -C ₆ -cycloalkyl.

R ⁶ and R ⁷ and the nitrogen atom to which they are attached may form a saturated 5- or 6-membered ring which may contain 0 or 1 additional heteroatom selected from N, O and S, and where the ring may be further substituted with C ₁ -C ₄ -alkyl.

- 1 042641

Ring A is selected from the group consisting of

W is N or CR ³ ; and Z is O or S; where R ³ represents H or C1-C ₄ -alkyl.

In some embodiments, the invention relates to a compound represented by structural formula (I), or a pharmaceutically acceptable salt or co-crystal thereof, where R ² is a 5- or 6-membered aromatic or heteroaromatic ring containing one or two heteroatoms selected from the group, consisting of N, O and S, where the aromatic or heteroaromatic ring may be substituted with 0, 1 or 2 substituents R ³ independently selected from the group consisting of CN, halo, C1-C4 alkyl, C1-C4 haloalkyl and C1- C4-haloalkyl-C1-C4-alkoxy, C1-C4 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C4-alkyl; or where two R ³ groups attached to adjacent carbon atoms of an aromatic or heteroaromatic ring may form a fused 5-membered ring which may contain a heteroatom selected from O, N and S; or COOR ⁴ where R ⁴ represents C1-C ₄ -alkyl or benzyl.

In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (I); and o is 0, 1, or 2.

In some embodiments, a compound of formula (I) is represented by structural formula (II), structural formula (II'), structural formula (II), or structural formula (II')

or a pharmaceutically acceptable salt or co-crystal thereof.

In some embodiments, Ring A is selected from the group consisting of

and R ² is

In other embodiments, the compound of formula (I) is represented by structural formula (III), structural formula (III'), structural formula (III), or structural formula (III')

- 2 042641

In some embodiments, R ² is

In some embodiments, the compound is a co-crystal that includes a compound having the structure of formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III '), formula (III) or formula (III'), and the co-crystal is formed with an acid selected from adipic acid, citric acid, fumaric acid, maleic acid, succinic acid or benzoic acid.

The invention also relates to a method for editing one or more target genomic regions, where the method includes introducing into one or more cells having one or more target genomic regions, a genome editing system and a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III') or formula (III'), or a pharmaceutically acceptable salt or co-crystal thereof.

In some embodiments, the invention relates to a method for editing one or more target genomic regions, where the method includes introducing into one or more cells having one or more target genomic regions, a genome editing system and a compound represented by structural formula (I), formula (II ), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III) or formula (III'), or a pharmaceutically acceptable salt or co-crystal thereof.

In some embodiments, the invention also relates to a method for repairing (repairing) a DNA break in one or more target genomic regions using the homologous targeted repair (HDR) pathway, where the method includes introducing into one or more cells having one or more target genomic regions, genome editing systems and a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III' ) or formula (III), or a pharmaceutically acceptable salt or co-crystal thereof.

The genome editing system interacts with nucleic acid(s) of target genomic regions resulting in DNA breakage, and where the DNA break is repaired, at least in part, via the HDR pathway.

The invention also relates to a method for inhibiting or suppressing the repair of a DNA break in one or more target genomic regions through the NHEJ pathway, where the method includes introducing into one or more cells having one or more target genomic regions, a genome editing system and a compound represented by the structural formula ( I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III) or formula (III'), or its pharmaceutical acceptable salt or co-crystal thereof.

The genome editing system interacts with the nucleic acid(s) of one or more target genomic regions, resulting in DNA breakage, and where repair of the DNA break via the NHEJ pathway is inhibited or suppressed.

The invention also relates to a method for modifying the expression of one or more genes or proteins, where the method includes introducing into one or more cells that contain one or more target genomic regions, a genome editing system and a compound represented by structural formula (I), formula (II) , formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III) or formula (III'), or a pharmaceutically acceptable salt or co-crystal thereof.

The genome editing system interacts with the nucleic acid(s) of one or more target genomic regions of a target gene(s), resulting in editing of one or more target genomic regions, where the editing modifies the expression of the downstream gene(s) and/or protein(s). ) associated with the target gene(s).

In some embodiments, the DNA break includes DNA double strand break (DSB).

In some embodiments, the compound is a co-crystal that includes a compound having the structure of formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III '), formula (III) or formula (III'), and the co-crystal is formed with an acid selected from adipic acid, citric acid, fumaric acid, maleic acid, succinic acid or benzoic acid.

Brief description of the figures

In FIG. 1 shows a design of assays for gene editing.

In FIG. 2 is a graph showing the levels of gene editing in BEC treated with a DNA-PK inhibitor.

- 3 042641

In FIG. 3A and 3B are graphs showing levels of gene editing in CD34+ cells from two different donors after treatment with a PK-DNA inhibitor.

In FIG. 4 is a graph showing levels of gene editing in iPSCs treated with PK DNA inhibitor.

In FIG. 5 is a graph showing the kinetics of gene editing in BEC with a DNA-PK inhibitor at ECmax.

In FIG. 6 is a graph showing the kinetics of gene editing in BEC with a DNA-PK inhibitor at EC50.

In FIG. 7 is a bar graph showing HDR levels for gene editing components delivered to BEC by lipid mediated transfection.

Detailed description

Unless otherwise defined, the scientific and technical terms used herein have the usual meanings as understood by those skilled in the art. In general, the nomenclatures used in relation to cell and tissue culture techniques, molecular biology, and protein and oligo- or polynucleotide chemistry and hybridization described herein are well known and widely used in the art. Standard techniques are used for DNA recombination, oligonucleotide synthesis, tissue culture and transformation (eg, electroporation, lipofection). Enzymatic reactions and purification methods are carried out in accordance with the reagent manufacturer's instructions, either as is commonly done in the art or as described herein. The techniques and procedures described are generally performed by conventional methods well known in the art, or as described in various general and more specific sources cited or discussed here (see, for example, Sambrook et al. Molecular Cloning: A Laboratory Manual (2d ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)).The nomenclature used in connection with the laboratory procedures and techniques of analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are known and widely used in the art Standard techniques are used for chemical syntheses, chemical analyses, preparation of pharmaceuticals, compositions, delivery and treatment of patients Generally, chemical elements are identified according to the Periodic Table of the Elements, CAS version and the Handbook of chemistry and Physics, 75th ed. In addition, the general principles of organic chemistry are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito: 1999, and March's Advanced Organic Chemistry, 5th Ed., Smith, M.B. and March, J., eds. John Wiley & Sons, New York: 2001, the entire contents of which are incorporated herein by reference. The terms used in this description, unless otherwise indicated, should be understood as having the meanings defined here.

In some embodiments, the efficiency of editing target genomic regions in one or more cells is increased compared to the efficiency in another identical cell or cells where the editing is performed without the use of a compound.

In some embodiments, the efficiency of DNA break repair in target genomic regions in one or more cells via the HDR pathway is increased compared to that in another identical cell or cells where editing is performed without the use of a compound.

In some embodiments, the effectiveness of inhibiting or suppressing DNA break repair in target genomic regions in one or more cells via the NHEJ pathway is increased compared to that in another identical cell or cells where editing is performed without the use of a compound.

In some embodiments, the effectiveness is increased by at least 2 times, 3 times, 4 times, 5 times, 10 times, 15 times, 20 times, 25 times, 30 times, 40 times, 50 times. times or 100 times more efficient than another identical cell or cells where the editing is performed without the use of a compound.

In some embodiments, the implementation of the effectiveness is measured by the frequency (probability of the event) of the target integration of the polynucleotide. In some embodiments, the implementation of the effectiveness is measured by the frequency (probability of the event) of site-directed mutagenesis. In some embodiments, site-directed mutagenesis includes point mutations, deletions, and/or insertions.

In some embodiments, expression of the downstream gene(s) and/or protein(s) associated with the target gene(s) is increased from baseline in one or more cells prior to administration. For example, said expression is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or the expression is 1-fold, 1.5-fold, 2-fold , 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, or 10-fold increase over baseline expression in one or more cells prior to administration.

In some embodiments, expression of the downstream gene(s) and/or protein

- 4 042641 (proteins) associated with the target gene(s) is reduced compared to the baseline expression level in one or more cells prior to administration. For example, gene expression is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% compared to the initial level of expression in one or more cells before the introduction.

In some embodiments, expression of the downstream gene(s) and/or protein(s) associated with the target gene(s) is substantially absent in one or more cells.

In some embodiments of the invention, the cell is synchronized in the S or G2 phase of the cell cycle.

In some embodiments of the invention, one or more cells that are injected with or that are in contact with the specified connection, have an increased survival compared to one or more cells that have not been introduced or that have not been brought into contact with the specified connection.

In some embodiments, the genome editing system and the compound are administered to one or more cells at the same time. In some embodiments, the genome editing system and the compound are administered sequentially to one or more cells. In some embodiments, a genome editing system is introduced into one or more cells prior to fusion. In some embodiments, the compound is introduced into one or more cells prior to the genome editing system.

In some embodiments, one or more cells are cultured cells. In some embodiments, one or more of the cells are in vivo cells in the body. In some embodiments, one or more cells are ex vivo cells from an organism.

In some embodiments, the organism is a mammal. In some embodiments, the organism is a human.

In some embodiments, the genome editing system and the compound are administered through the same route. In some embodiments, the genome editing system and the compound are administered via different routes. In some embodiments, the genome editing system is administered intravenously and the compound is administered orally.

In some embodiments, the genome editing system is selected from a meganuclease based system, a zinc finger nuclease (ZFN) based system, a transcription activator-like effector nuclease (TALEN) based system, a CRISPR based system, or an NgAgo based system.

In some embodiments, the genome editing system is a CRISPR-based system. In some embodiments, the CRISPR-based system is a CRISPR-Cas system or a CRISPR-Cpf system.

In some embodiments, the CRISPR-based system is a CRISPR-Cas system, and wherein the CRISPR-Cas system includes: (a) at least one targeting RNA element that includes: (i) a targeting RNA containing a nucleotide sequence substantially complementary to a nucleotide sequence in one or more target genomic regions, or a nucleic acid containing a nucleotide sequence(s) encoding a targeting RNA; and (ii) an activating RNA containing a nucleotide sequence capable of hybridizing with a target RNA, or a nucleic acid containing a nucleotide sequence(s) encoding an activating RNA; and (b) a Cas protein element that includes a Cas protein or a nucleic acid containing a nucleotide sequence(s) encoding a Cas protein.

In some embodiments, the targeting RNA and the activating RNA are fused into one molecule.

In some embodiments, the Cas protein is a type II casp9 protein. In some embodiments, the Cas9 protein is SaCas9, SpCas9, SpCas9n, Cas9HF, Cas9-H840A, FokI-dCas9, or D10A nickase, or any combinations thereof.

In some embodiments, the CRISPR-based system is a CRISPR-Cpf system, and the CRISPR-Cpf system includes: (a) at least one guide RNA element or nucleic acid that includes a nucleotide sequence(s) encoding the guide RNA element , a guide RNA that includes a target RNA that includes a nucleotide sequence substantially complementary to a nucleotide sequence in one or more target genomic regions; and (b) a Cpf protein element that includes a Cpf protein or a nucleic acid containing a nucleotide sequence encoding a Cpf protein.

In some embodiments, the genome editing system is delivered with one or more vectors.

In some embodiments, the one or more vectors are selected from viral vectors, plasmids, or single-stranded DNA (ssDNA).

In some embodiments, the viral vectors are selected from retroviral, lentiviral, adenovirus, adeno-associated, and herpes simplex vectors.

In some embodiments, the genome editing system is delivered with synthetic RNA.

In some embodiments, the genome editing system is delivered using a nanocomposition.

In some embodiments, a kit or composition is provided for editing one or more target genomic regions. In some embodiments, the kit or composition includes a genome editing system; and a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III), or formula ( III'), or a pharmaceutically acceptable salt or co-crystal thereof. In some embodiments, a compound in a kit or composition is represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III) or formula (III), or a pharmaceutically acceptable salt or co-crystal thereof, wherein R ¹ and R ² are each hydrogen or deuterium.

In some embodiments, the genome editing system is provided as a kit or composition, and said system is a meganuclease system, a zinc finger nuclease (ZFN) system, a transcription activator-like effector nuclease (TALEN) system, a based on CRISPR or NgAgo based system. In some embodiments, the genome editing system in the kit or composition is a CRISPR-based system. In some embodiments, the CRISPR-based system in a kit or composition is a CRISPR-Cas system or a CRISPR-Cpf system.

In some embodiments, the CRISPR-based system in the kit or composition is a CRISPR-Cas system, and wherein the CRISPR-Cas system includes: (a) at least one guide RNA element that includes: (i) a target RNA that includes a nucleotide sequence substantially complementary to a nucleotide sequence in one or more target genomic regions, or a nucleic acid that includes a nucleotide sequence(s) encoding a target RNA; (ii) and an activating RNA that includes a nucleotide sequence that is capable of hybridizing to a target RNA, or a nucleic acid that includes a nucleotide sequence(s) encoding an activating RNA; and (b) a Cas protein element that includes a Cas protein or a nucleic acid that includes a nucleotide sequence(s) encoding a Cas protein.

In some embodiments, the Cas protein in the kit or composition is a type II Casp9 protein. In some embodiments, the Cas9 protein in the kit or composition is SaCas9, SpCas9, SpCas9n, Cas9-HF, Cas9-H840A, FokIdCas9, or D10A nickase, or any combination thereof.

In some embodiments, the CRISPR-based system in the kit or composition is a CRISPR-Cpf system, and wherein the CRISPR-Cpf system includes: (a) a targeting RNA that includes a nucleotide sequence substantially complementary to a nucleotide sequence in one or more target genomic regions, or a nucleic acid that includes a nucleotide sequence(s) encoding a targeting RNA; and (b) a Cpf protein element that includes a Cpf protein or a nucleic acid that includes a nucleotide sequence(s) encoding a Cpf protein.

In some embodiments, the genome editing system in the kit or composition is included or packaged in one or more vectors. In some embodiments of the present invention, one or more vectors are selected from viral vectors, plasmids, or ssDNA. In some embodiments, the viral vectors are selected from the group consisting of retroviral, lentiviral, adenovirus, adeno-associated, and herpes simplex vectors.

In some embodiments, the implementation of the connection in the kit or composition includes a compound selected from the table. 1.

In some embodiments, the compound in the kit or composition is a co-crystal that includes a compound having the structure of formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III) , formula (III'), formula (III) or formula (III'), and the co-crystal is formed with an acid selected from adipic acid, citric acid, fumaric acid, maleic acid, succinic acid or benzoic acid.

In some embodiments, the implementation of the connection in the kit or composition is a co-crystal, which includes (a) a compound selected from the table. 1 and (b) adipic acid.

Other features, objects and advantages of the invention will become apparent from the detailed description that follows. However, it should be understood that the detailed description, along with indications of embodiments and aspects of the invention, is given by way of illustration only and not by way of limitation of the invention. Various changes and modifications within the scope of the invention will be apparent to those skilled in the art from the detailed description.

In some embodiments, the invention relates to methods, compositions, and kits for editing a target genome, for example, by correcting a mutation. Such methods, compositions and kits can increase the efficiency of genome editing through the use of a DNA-PK inhibitor.

The genome editing system can stimulate or induce DNA break(s), such as a DSB, at a desired genomic locus (or target genomic region). The creation of a DNA break involves the use of cellular enzymes to repair the break site either through the error-prone NHEJ pathway or through the error-free HDR pathway. In the case of NHEJ, the DNA break is repaired by fusing the two ends of the DNA break in a series of enzymatic processes involving the Ku70/80 heterodimer and DNA-dependent protein kinase (DNKK) dependent enzymes. The repair mechanism includes attachment and alignment of the two ends of DNA, resection, lengthening and ligation ((Rouet et al.; Dexheimer T. DNA repair pathways and mechanisms. B: Mathews L, Cabarcas S, Hurt E, editors. . Dordrecht: Springer; 2013, pp. 19-32.), which leads to the formation of small mutations such as insertion or deletion at the break point. Insertions or deletions introduced into the coding sequence of a gene can cause the formation of either a premature stop codon or a mutation in-frame, resulting in the production of non-functional, truncated proteins.The mechanism of the HDR pathway is less understood and involves a different set of repair proteins, such as Rad51, that promote strand invasion via a donor-repair template based on insertions or gene replacement.Therefore, HDR allows the introduction of an exogenous DNA template to obtain the desired DNA editing result in the genome, and HDR can be a powerful strategy for modeling translational disease and editing the therapeutic genome to restore gene function.

Of the two DNA repair pathways, the NHEJ pathway occurs at a much higher frequency (high event probability) and it has been reported that over 70% efficiency can be achieved even in neurons (Swiech et al., In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9, Nat Biotechnol 2015 Jan 33(1): 102-62014). However, HDR gene repair occurs at a very low frequency (low event probability), both during S and G2 phases when DNA replication occurs and when sister chromatids are available to act as templates for repair (Heyer et al., Regulation of homologous recombination in eukaryotes Annual Review of Genetics 44:113-139, 2010). Since repair by the NHEJ pathway occurs throughout the cell cycle, competing with and outperforming the HDR repair pathway during S and G2 phases, targeted insertion along the HDR pathway remains a challenge and is the subject of ongoing research.

DNA protein kinase (DNA-RK) plays an important role in various DNA repair processes. DNRK is involved in double-stranded DNA repair by activating the non-homologous end joining (NHEJ) pathway. NHEJ is thought to proceed through three stages: DSB recognition, DNA processing to remove non-ligated ends or other forms of end damage, and finally DNA end ligation. DSB recognition is accomplished by binding a Ku heterodimer with truncated DNA ends, followed by recruitment of two molecules of DNA-dependent catalytic protein kinase (DNA-PKcs or DNA-PK) subunits to adjacent sides of the DSB; this serves to protect the broken ends until additional processing enzymes are recruited. Recent evidence supports the hypothesis that DNA-PKcs phosphorylates a processing enzyme such as Artemis and also prepares the DNA ends itself for further processing. In some cases, DNA polymerase may be required to synthesize new ends prior to the ligation step. Autophosphorylation of DNA-PKcs is believed to induce a conformational change that opens the central DNA-binding cavity, releases DNA-PKcs from DNA, and promotes eventual ligation of DNA ends.

In some embodiments, the invention relates to methods, compositions and kits for enhancing gene editing, in particular for increasing the efficiency of DNA break(s) repair via the HDR pathway, or for enhancing the efficiency of inhibiting or suppressing DNA break(s) repair via the NHEJ pathway, in genome editing systems, including CRISPR-based HDR repair, in cells. Without being bound by any particular theory, it is believed that the genome editing system introduced into the cell(s) interacts with the nucleic acid(s) of the target gene, resulting in DNA breakage or causing DNA breakage; such DNA break is repaired by several repair pathways, such as HDR, and a DNA-PK inhibitor administered to the cell(s) inhibits, blocks, or suppresses the NHEJ repair pathway, and the frequency (probability of event) or efficiency of the HDR DNA repair pathway can be increased or promoted.

The interaction between the genome editing system with the target gene nucleic acid(s) may be hybridization of at least a portion of the genome editing system with the target gene nucleic acid(s) or any other recognition of the target gene nucleic acid(s) by the system. genome editing. In some embodiments, such an interaction is a protein-DNA interaction or hybridization between base pairs.

In some embodiments, the invention relates to methods for editing one or more target genomic regions in a cell(s) by introducing a genome editing system and a PKDNA inhibitor into the cell(s). Editing can occur simultaneously or sequentially. Editing one or more target genomic regions includes any kind of genetic manipulation or construction of the genome of a cell. In some embodiments, editing one or more target genomic regions may include insertions, deletions, or substitutions of genomic regions in the cell(s). Genomic regions contain the genetic material in the cell(s), such as DNA, RNA, polynucleotides, and oligonucleotides. The genomic regions in the cell(s) also contain the genomes of the mitochondria or chloroplasts contained in the cell(s).

In some embodiments, insertions, deletions, or substitutions may be either in the coding or non-coding genomic region, in intron or exon regions, or any combination thereof, including their overlapping or non-overlapping segments. As used herein, the term non-coding region refers to genomic regions that do not encode an amino acid sequence. For example, non-coding regions include introns. Coding regions refer to genomic regions encoding an amino acid sequence. For example, coding regions include exons.

In some embodiments, editing of one or more target genomic regions may occur in any one or more target regions in the genome of the cell(s). In some embodiments, editing of one or more target genomic regions may occur, for example, in an exon, intron, transcription start site, promoter region, enhancer region, silencer region, decoupling region, antirepressor, post-translational regulatory element, polyadenylation signal (e.g., minimal poly A), a conserved region, a transcription factor binding site, or any combination thereof.

In some embodiments, administration of the PKDNA inhibitor and genome editing system to the cell(s) results in an increase in the editing efficiency of the target genome compared to conditions where the PKDNA inhibitor and genome editing system are not administered to the cell(s). In some embodiments, the increased editing efficiency is approximately 1x, 2x, 3x, 4x, 5x, 10x, 15x, 20x, 25x, 30x, 40x -fold, 50-fold or 100-fold increase compared to the state when the DNA-PK inhibitor and the genome editing system are not introduced into the cell (cells) or compared to the state when only the genome editing system is introduced into the cell (cells) without DNA-RK inhibitor. The efficiency of genome editing can be measured using any method known in the art, for example, any method that establishes the frequency (probability of event) of targeted integration of polynucleotides or by measuring the frequency (probability of event) of site-directed mutagenesis. Targeted integration of a polynucleotide can also result in a change or replacement of a sequence in the genome, chromosome or region of interest in the cellular chromatin. Targeted integrations of a polynucleotide can result in targeted mutations, including, but not limited to, point mutations (i.e., conversions from one base pair to another base pair), substitutions (i.e., conversions of multiple base pairs to another sequence of the same length), insertions of a single or more base pairs, deletions of one or more base pairs, and any combination of the above sequence changes.

In some embodiments, methods for editing one or more target genomic regions in a cell(s) comprise administering a genome editing system and a PKDNA inhibitor to the cell(s). In some embodiments of the invention, the cell(s) are synchronized in the S or G2 phase of the cell cycle. Synchronization of the cell(s) in the S or G2 phase of the cell cycle can be achieved by any method known in the art. As a non-limiting example, agents that can be used to synchronize cell(s) in the S or G2 phase of the cell cycle include afidoline, diroxiurea, lovastatin, mimeotosin, nosodazole, thymidine, or any combination thereof (see Lin et al. Enhanced homology- directed human genome engineering by controlled timing of CRISPR/Cas9 delivery, Elife.2014 Dec 15;3). In some embodiments, cell synchronization agents may be administered at any time during the gene editing process. In some embodiments, the cell(s) may be synchronized to the S or G2 phase of the cell cycle before, during, or after administration of the genome editing system and/or PK DNA inhibitor to the cell(s).

In some embodiments, methods for editing one or more target genomic regions in a cell(s) by introducing a genome editing system and a PKDNA inhibitor into the cell(s) result in increased cell survival compared to conditions where the genome editing system and the PKDNA inhibitor was not introduced into the cell(s), or compared to conditions where only the gene editing system is contacted or introduced into the cell(s) but without the PKDNA inhibitor.

In some embodiments, the present invention provides methods for repairing a DNA break in one or more target genomic regions via the HDR pathway. Introduction to the cell(s) of the genome editing system and the DNA-PK inhibitor results in DNA breakage of the target region of the genome, and then the DNA break is repaired, at least in part, via the HDR pathway. These methods result in increased HDR-mediated repairs (e.g., via the HDR pathway) in one or more target genomic regions, resulting in greater HDR-mediated repair efficiency compared to conditions where the DNA-PK inhibitor and genome-editing system are not administered to the cell(s). In some embodiments, the increased efficiency of HDR-mediated DNA repair is approximately 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30 - fold, 40-fold, 50-fold or 100-fold increase compared to the state when the DNA-PK inhibitor and the genome editing system are not introduced into the cell (s) or compared to the state when only a genome editing system without a DNA-PK inhibitor. The efficiency of genome editing can be measured using any method known in the art, for example, any method that establishes the frequency (probability of event) of targeted integration of polynucleotides or by measuring the frequency (probability of event) of site-directed mutagenesis.

In some embodiments, the methods described herein provide repair of a DNA break by increasing the efficiency of the HDR pathway.

The HDR path can be canonical or alternate. HDR (homologous targeted repair) refers to a specialized form of DNA repair that occurs, for example, during the repair of double-strand breaks or DNA nicks in the cell(s). The HDR of double strand breaks is usually based on nucleotide sequence homology using a donor molecule to repair the target template (eg double strand break) and can result in the transfer of genetic information from the donor to the target. The canonical HDR of double strand breaks is usually based on BRCA2 and RAD51, and a dsDNA donor molecule is usually used. Non-canonical or alternative HDR is an HDR mechanism that is repressed by BRCA2, RAD51 and/or operably related genes. In an alternative HDR, ssDNA or dsDNA with a nickname can be used as a donor molecule (see, for example, WO 2014/172458).

In some embodiments, methods for repairing a DNA break in one or more target genomic regions via the HDR pathway by introducing a genome editing system and a DNA-PK inhibitor into the cell(s) result in increased cell survival compared to conditions where the genome editing system and the DNA inhibitor α-RA is not introduced into the cell(s), or as compared to conditions where only the gene editing system is introduced into the cell(s), without a DNA-PK inhibitor.

Some embodiments provide methods for inhibiting or suppressing NHEJ-mediated DNA break repair at one or more target genomic regions in a cell(s). In some embodiments, inhibition or suppression of NHEJ-mediated DNA break repair is accomplished by inhibition or suppression of the NHEJ pathway. The NHEJ pathway can be either the classical (canonical) or alternative NHEJ pathway (alt-NHEJ, or microhomology-mediated end joining (MMEJ)). Let NHEJ or alt-NHEJ be suppressed in the cell(s) by introducing into the cell(s) a genome editing system and a DNA-PK inhibitor.

The classical NHEJ repair pathway is a double-stranded DNA repair pathway in which the ends of a double-strand break are ligated without extensive homology. Classical NHEJ repair involves the use of several factors, including the KU70/80 (KU) heterodimer, XRCC4, ligase IV, and DNA protein kinase catalytic subunit (DNA-PKcs). Alt-NHEJ is another double strand break repair pathway. alt-NHEJ uses a 5-25 bp microhomologous sequence during break-end alignment prior to breaking-end joining. Alt-NHEJ is largely independent of the KU70/80 (KU) heterodimer, XRCC4, ligase IV, DNA protein kinase catalytic subunit (DNA-PKcs), RAD52, and ERCC1 (see Bennardo et al., Alternative-NHEJ is a Mechanistically Distinct Pathway of Mammalian Chromosome Break Repair, PLOS Genetics, June 27, 2008).

In some embodiments, methods for inhibiting or suppressing NHEJ-mediated DNA repair at one or more target genomic regions in a cell(s) by inhibiting or suppressing the NHEJ pathway, although administration of a genome editing system and a DNA-PK inhibitor to the cell(s) results in improved efficacy. inhibition or suppression of NHEJ-mediated DNA break repair, as compared to cell(s) in which the genome editing system and DNA-PK inhibitor were not administered, or as compared to the state where

- 9 042641 (cells) were injected with a genome editing system without a DNA-PK inhibitor. In some embodiments, the increased potency of inhibiting or suppressing DNA break repair via the NHEJ pathway by contacting cell(s) with a DNA-PK inhibitor and a genome editing system is approximately 1-fold, 2-fold, 3-fold, 4-fold, 5 - fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or 100-fold increase in comparison with the state when the DNA-PK inhibitor and the genome editing system are not introduced into the cell ( cells) or compared to the state where only the genome editing system without the DNA-PK inhibitor is introduced into the cell(s). The effectiveness of inhibiting or suppressing DNA breakage repair via the NHEJ pathway can be measured by any method known in the art, for example, by determining the frequency (probability of event) of targeted integration of polynucleotides or by measuring the frequency (probability of event) of site-directed mutagenesis.

In some embodiments, methods for inhibiting or suppressing NHEJ-mediated DNA repair disrupt one or more target genomic regions in a cell(s) by inhibiting or suppressing the NHEJ pathway, although administration of a genome-editing system and a DNA-PK inhibitor to the cell(s) results in increased cell survival compared to conditions where the genome editing system and the DNA-PK inhibitor were not contacted or introduced into the cell(s), or compared to conditions where only the gene editing system was contacted or introduced into the cell(s) without DNA-RK inhibitor.

The DNA break can be a double strand break (DSB, double strand break) or two single strand breaks (eg double nick DNA). The DSB can be blunt or have 5' or 3' sticky ends if the chains are split too far apart and the sticky ends will anneal separately and exist as two nicks rather than one DSB.

In some embodiments, the present invention provides methods for modifying the expression of one or more genes (target gene(s)) and/or corresponding proteins or subsequent proteins by introducing a genome editing system and a PK DNA inhibitor into the cell(s). In some embodiments, the genome editing system may create, for example, insertions, deletions, substitutions, modifications, or disruptions in the target genomic region(s) of the target gene(s) of the cell(s), resulting in modified expression of the target gene(s). targets). In some embodiments, an insertion, deletion, substitution, modification, or disruption may result in targeted expression of a particular protein or group of proteins or subsequent proteins. In some embodiments, the genome editing system may create insertions, deletions, or substitutions in non-coding regions or coding regions. In some embodiments, the genome editing system may create insertions, deletions, substitutions, modifications, or disruptions in the promoter region, enhancer region, and/or any other gene regulatory element, including exon, intron, transcription start site, silencer region, delimiter region, antirepressor, a post-translational regulatory element, a polyadenylation signal (eg, minimal poly A), a conserved region, a transcription factor binding site, or any combination thereof. In some embodiments, the genome editing system may create insertions, deletions, substitutions, modifications, or disruptions in more than one target region simultaneously or sequentially. In some embodiments, administration of a genome editing system and a PKDNA inhibitor to the cell(s) may allow targeted expression of the modified gene in the cell(s). Such targeted expression of a modified gene may result in the expression of specific proteins and subsequent proteins.

In some embodiments, the expression of the downstream gene and/or subsequent protein is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or the expression is 1 -x, 1.5x, 2x, 2.5x, 3x, 3.5x, 4x, 4.5x, 5x, or 10x magnification compared to state when the DNA-PK inhibitor and the genome editing system are not introduced into the cell(s), or compared to the state where only the genome editing system without the DNA-PK inhibitor is introduced into the cell(s).

In some embodiments, the expression of the downstream gene and/or subsequent protein is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96% , 97%, 98%, or 99% compared to the state where the DNA-PK inhibitor and the genome editing system are not introduced into the cell(s), or compared to the state when only the genome editing system is introduced into the cell(s) without the inhibitor DNA-RK.

The cage for the methods described here can be any cage. In some embodiments, the cell is a vertebrate cell. In some embodiments, the vertebrate cell is a mammalian cell. In some embodiments, the vertebrate cell is a human cell.

The cell may be any kind of cell at any stage of development. In some embodiments, the cell may be a differentiated cell, a totipotent stem cell, a pluripotent stem cell, an embryonic stem cell, an embryonic germ cell, a mature stem cell, a progenitor cell, an induced pluripotent stem cell.

- 10 042641 or any combination thereof. A differentiated cell is a specialized cell that performs a specific function in a tissue. A totipotent stem cell is an undifferentiated embryonic, fetal or adult cell that can divide for long periods and has the ability to differentiate into any cell type in the body from any of the three germ layers. A pluripotent stem cell is an undifferentiated embryonic, fetal or adult cell that can divide over long periods and has the ability to differentiate into any cell type in the body except extraembryonic tissue or the placenta. The embryonic stem cell is an undifferentiated stem cell that resides in the inner cell mass of the embryo and has the ability to differentiate into any cell type from any of the three germ layers. An embryonic germ cell is an embryonic cell that can give rise to the growth of reproductive cells such as sperm or egg cells. A mature stem cell is an undifferentiated cell that resides in a differentiated tissue, is capable of self-repair, and can differentiate into any of the cells in the tissue in which it resides. A progenitor or progenitor cell is a partially differentiated cell that can usually differentiate into only one kind of cell (eg, a unipotent cell). An induced pluripotent stem cell is a type of pluripotent stem cell that is derived from adult differentiated or partially differentiated cells (see, for example, WO/2010/017562).

The singular forms used here also include the plural unless the context clearly indicates otherwise. For example, the term cell also includes a plurality of cells, including mixtures thereof. For example, the designations one or more cells and the cell as used herein are interchangeable. Likewise, indications of one or more target genomic regions and target genomic region(s) are also used interchangeably herein.

Terms that are equivalent are used interchangeably herein. The term about or about, applied to one or more values of interest, refers to a value that is similar to a specified reference value. In some embodiments, the term approximately or approximately refers to a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10 %, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in any direction (more or less) from the specified base value, unless otherwise indicated or obvious from the context (except when such a number would exceed 100% of the possible value).

The terms polynucleotide, nucleotide, nucleotide sequence, nucleic acid, and oligonucleotide are used interchangeably. They refer to the polymeric form of nucleotides of any length, such as deoxyribonucleotides (DNA), or ribonucleotides (RNA), or their analogues. Polynucleotides can have any three-dimensional structure and can perform any function, known or not yet known. The following examples are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locuses) determined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. The polynucleotide may contain one or more modified nucleotides such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be made before or after polymer assembly. The sequence of nucleotides may be interrupted by non-nucleotide components. The polynucleotide can be further modified after polymerization, for example by conjugation with a label component. The term ssDNA means a single-stranded DNA molecule. The term ssODN refers to single stranded oligodeoxynucleotides.

The term naturally occurring nucleotide as used herein includes deoxyribonucleotides and ribonucleotides. The term modified nucleotides includes nucleotides with modified or substituted sugar groups and the like. The term oligonucleotide linkages as used herein includes oligonucleotide linkages such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranyladylate, phosphonamidate, and the like. The oligonucleotide may include a detection label, if desired.

The term synthetic RNA refers to RNA that is engineered or not naturally occurring.

The term wild type as used herein is a term known to those skilled in the art and means the normal form of an organism, strain, gene or characteristic that occurs naturally, as opposed to mutated or variant forms.

- 11 042641

The terms non-naturally occurring or genetically engineered are used interchangeably and indicate human involvement. These terms, when referring to nucleic acid molecules or polypeptides, mean that the nucleic acid molecule or polypeptide is at least substantially free of at least one component to which it is not naturally associated and is not present in forms found in nature.

Complementarity refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid using the traditional Watson-Crick mechanism or other unconventional types of binding. The percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 residues, which is 50%, 60%, 70%, 80%, 90% and 100% complementarity). A fully complementary sequence means that all contiguous residues of the nucleic acid sequence form hydrogen bonds with the same number of contiguous residues in the second nucleic acid sequence. The term substantially complementary as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%. 95%, 97%, 98%, 99% or 100% in the area of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 30, 35, 40, 45, 50 or more nucleotides, or refers to two nucleic acids that hybridize under stringent/stringent conditions.

The term expression as used herein refers to the process by which a polynucleotide is transcribed from a DNA template (such as mRNA or other RNA transcript) and/or the process by which the transcribed mRNA is then translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as a gene product. If the polynucleotide is derived from genomic DNA, then expression may involve mRNA splicing in a eukaryotic cell.

The terms polypeptide, peptide, and protein are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, and it may contain modified amino acids, or it may be interrupted by non-amino acids. These terms also cover an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation such as conjugation with a label component. As used herein, the term amino acid includes natural and/or non-natural or synthetic amino acids, including glycine, as well as D and L optical isomers, and amino acid analogs and peptidomimetics.

The term agent is used here to refer to a chemical compound, a small molecule, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological materials.

The terms subject, individual, and patient are used interchangeably herein to refer to a vertebrate, such as a mammal, or a human. Mammals include, without limitation, mice, monkeys, humans, farm animals, sport animals, and pets.

The terms treatment, relief, or amelioration are used interchangeably herein. These terms refer to a method of obtaining beneficial or desirable results, including, without limitation, a therapeutic effect and/or a prophylactic effect. By therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions or symptoms when treated. For a prophylactic effect, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to an individual who has reported one or more physiological symptoms of a disease, even though the disease, condition, or symptom may not yet be present. These terms also mean the treatment of a disease in a mammal, such as a human, including: (a) inhibition of the disease, ie. stopping or preventing its development; (b) amelioration of the disease, i.e. regression of the disease state; or (c) treating the disease.

The term effective amount or therapeutically effective amount refers to an amount of an agent that is sufficient to achieve beneficial or desirable results. A therapeutically effective amount may vary depending on one or more of: the subject and the disease being treated, the weight and age of the subject, the severity of the disease, the route of administration, and the like, which can be readily determined by a person skilled in the art. The term also refers to a dose that will produce an image for detection by any of the imaging modalities described herein. The specific dose may vary depending on one or more of: the particular agent chosen, the dosage regimen to be followed, whether administered in combination with other compounds, the time of administration, the tissue to be imaged, and the physical delivery system that carried by the agent.

The term administration as used herein refers to contacting, injecting, distributing, delivering, or directing a genomic editing system and/or PK DNA inhibitor into a cell or subject. In some embodiments, the administration is contact of the cell(s) with a genomic editing system and/or a DNA-PK inhibitor. In some embodiments, the administration is the delivery of the genomic editing system and/or the DNA-PK inhibitor to the cell(s). In some embodiments, the administration is directing the genomic editing system and/or PK DNA inhibitor into the cell(s). In some embodiments, the administration is the injection of the genome editing system and/or the DNA-PK inhibitor into the cell(s). Administration can take place under in vivo, ex vivo or in vitro conditions. The introduction of the genomic editing system and the DNA-PK inhibitor into the cell(s) can be carried out simultaneously or sequentially.

The term acquired in relation to a condition or disease, as used herein, means a disorder or condition that develops post-fetal, as opposed to a congenital disorder that is present at birth. A congenital disorder may precede an acquired disorder.

The term congenital or inherited condition or disease is a genetic disorder found in the genome of a subject that is present in the subject from birth. As used herein, the term genome includes all genetic material in the nucleus and cytoplasm, and also includes the mitochondrial genome and the ribosomal genome. A congenital or inherited condition/disease may manifest at any time during the life of the subject, such as from birth or into adulthood.

The term genetic disease or genetic disorder includes inherited or acquired mutations in a subject's genome that cause or may cause a disease.

The terms polymorphisms or genetic variations refer to different forms of a gene at a genetic locus.

A viral vector is a recombinantly produced virus or viral particle containing a polynucleotide to be delivered to a host cell under in vivo, ex vivo or in vitro conditions. Examples of viral vectors include retroviral vectors, adenoviral vectors, adeno-associated viral vectors, adenoviral vectors, lentiviral vectors, herpes simplex vectors, chimeric viral vectors, and the like. In some embodiments where gene transfer is mediated by a retroviral vector, the vector construct refers to a polynucleotide containing the retroviral genome or a portion thereof.

Some embodiments of the present invention relate to vector systems containing one or more vectors or vectors as such. Vectors can be designed to express CRISPR transcripts (eg, nucleic acid, protein, or enzyme transcripts) in prokaryotic or eukaryotic cells. For example, CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells.

The cells may be primary cells, induced pluripotent stem cells (iPSC), embryonic stem cells (hES), adult stem cells, progenitor cells or cell lines. Primary cells are cells taken directly from living tissue and placed under in vitro conditions for growth. Primary cells have few population doublings and have a limited lifetime for population doublings under in vitro conditions. Stem cells, mature embryonic stem cells, and induced pluripotent stem cells are non-specialized and undifferentiated cells that are capable of self-renewal and have the potential to differentiate into various cell types with a specialized function. Cell lines may include cell cultures derived from a single cell type or from a set of cells of a single type that can proliferate indefinitely. Non-limiting examples of mammalian cell lines can include CD34 cells, 293 cells, HEK cells, CHO cells, BHK cells, CV-1 cells, Jurkat cells, HeLa cells, or any variants thereof.

In some embodiments, the vector is capable of directing the expression of one or more sequences in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 and pMT2PC. The control functions of expression vectors when used in mammalian cells are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. Other promoters may include, for example, the EF1 promoter or the EF1 alpha promoter. For other suitable expression systems for both prokaryotic and eukaryotic cells: see, for example, chapters 16 and 17 in Sambrook, et al. MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed. Cold Spring Harbor laboratory, Cold Spring Harbor laboratory Press, Cold Spring Harbor, NY, 1989.

The term labeled or labeled as used herein refers to the incorporation of a detectable marker, such as by incorporating a radioactive amino acid or attaching biothienyl residues to the polypeptide, which can be detected by labeled avidin (eg, streptavi

- 13 042641 dyne containing a fluorescent marker or enzymatic activity that can be detected by optical or colorimetric methods). In some cases, the label or marker may also be therapeutic. Various methods for labeling polypeptides and glycoproteins are known in the art and can be used here. Examples of labels for polypeptides include, without limitation, the following: radioisotopes or radionuclides (e.g. ³ H, ¹⁴ C, ¹⁵ N, ³⁵ S, ⁹⁰ Y, ⁹⁹ Tc, ¹ⁿ In, ¹²⁵ I, ¹³¹ I), FITC, rhodamine, lanthanide phosphors), enzyme labels (eg, horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, predefined polypeptide epitopes recognized by the secondary reporter (eg, leucine zipper pair sequences, binding sites of secondary antibodies, metal binding domains, epitope tags). To reduce potential steric hindrance, in some embodiments, the labels are attached using spacers of various lengths. The term pharmaceutical agent or drug as used herein refers to a chemical compound or composition capable of inducing a desired therapeutic effect when properly administered to a patient.

As used herein, the term substantially pure means that the specified entity is predominantly present (ie, on a molar basis, it is more abundant than any other single species in the composition). In some embodiments, the substantially purified fraction is a composition in which the target is present in an amount of at least about 50% (on a molar basis) of all macromolecular compounds present.

Typically, a substantially pure composition contains more than about 80% of all macromolecular compounds present in the composition. In some embodiments, a substantially pure composition contains more than about 85%, 90%, 95%, and 99% of all macromolecular compounds from among the components present in the composition. In some embodiments, the target compound is purified to substantially complete homogeneity (impurity particles are not detected in the composition by conventional detection methods), and the composition consists essentially of a single macromolecular compound.

Genome editing system.

Various types of genomic engineering systems can be used. The terms genome editing system, gene editing system, and the like, which are used interchangeably herein, refer to a system or technology that edits a target gene or its function or its expression. The genome editing system comprises at least one endonuclease component that cleaves the target genomic region(s) or target sequence(s); and at least one genome targeting element that introduces or targets the endonuclease component to the target genomic region(s). Examples of a DNA targeting element include a DNA binding domain (eg, Zincfinger DNA binding protein or TALE DNA binding domain), targeting RNA elements (eg, CRISPR targeting RNA), and targeting DNA elements (eg, NgAgo targeting DNA). Programmable genome targeting elements and endonucleases enable precise genome editing by introducing DNA breaks such as double-strand breaks (DSBs) at specific genomic loci. The DSBs subsequently engage the endogenous non-homologous end joining (NHEJ) or homologously targeted repair (HDR) machinery in the DSB region to mediate genome editing. The endonuclease component includes an endonuclease or a nucleic acid containing a nucleotide sequence(s) encoding such an endonuclease.

The term endonuclease refers to any mutant, variant or engineered enzyme capable of catalyzing the hydrolysis (cleavage) of a bond between nucleic acids in a DNA or RNA molecule. Endonucleases can recognize and cleave a DNA or RNA molecule at target genomic regions. Examples of endonuclease include homing endonuclease; a restriction enzyme such as FokI; a chimeric zinc finger nuclease (ZFN) obtained by fusion of engineered zinc finger domains with the catalytic domain of a restriction enzyme such as FokI; Cas enzymes and Cpf enzymes. Chemical endonucleases in which a chemical or peptide cleavage agent is conjugated to either a nucleic acid polymer or other DNA that recognizes a particular target sequence, thereby targeting the cleavage activity to a particular sequence, are included within the term endonuclease. Examples of chemical endonucleases include synthetic nucleases such as orthophenanthroline conjugates, DNA-cleaving molecules, and triplex-forming oligonucleotides (TFOs).

By variant is meant a recombinant protein obtained by replacing at least one residue in the amino acid sequence of the parent protein with another amino acid.

In some embodiments, endonucleases such as ZFN, TALEN, and/or meganucleases contain a cleavage domain and/or a cleavage half-domain. The cleavage domain may be homologous or heterologous to the DNA binding domain, for example, a zinc finger DNA binding domain and a nuclease or DNA cleavage domain may be used.

- 14 042641 binding domain of a meganuclease and a cleavage domain from another nuclease. Heterologous cleavage domains can be derived from any endonuclease or exonuclease. Examples of endonucleases from which a cleavage domain can be derived are, without limitation, restriction endonucleases and homing endonucleases (see, for example, WO 2013/130824). Additional enzymes are known that cleave DNA (eg, nuclease S1; golden bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast endonuclease (see also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains and cleavage half-domains.

The cleavage half-domain can be derived from any nuclease, or portion thereof, as defined above, that requires dimerization for cleavage activity. In some embodiments, two fusion proteins are needed for cleavage if the fusion proteins contain cleavage half-domains. In some embodiments, a single protein containing two cleavage half-domains can be used. In some embodiments, the two cleavage half-domains may be from the same endonuclease (or functional fragments thereof). In some embodiments, each cleavage half-domain may be from different endonucleases (or functional fragments thereof). In addition, the target sites for the two fusion proteins are preferably arranged with respect to each other such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation with respect to each other such that the cleavage half-domains form a functional domain. cleavage, for example, by dimerization. Thus, in some embodiments, the near edges of the target sites are separated by 5-50 nucleotides, 5-8 nucleotides, or 15-18 nucleotides. It should be noted that any integer number of nucleotides or base pairs (eg, from 2 to 50 base pairs or more) can be between the two target sites. In some embodiments, the cleavage site is between the target sites.

Restriction endonucleases (restriction enzymes) are present in many species and are able to specifically bind to DNA (at the recognition site) and cleave DNA at or near the binding site. Some restriction enzymes (eg, type IIS) cleave DNA at sites remote from the recognition site and have separate binding and cleavage domains. For example, the type IIS FokI enzyme catalyzes double-stranded DNA cleavage; see, for example, US Pat. Nos. 5,356,802; 5436150 and 5487994; and Li et al. (1992) Proc. Natl. Acad. sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269:31, 978-31, 982.

In some embodiments, the endonuclease component comprises a fusion protein(s) that includes a cleavage domain (or cleavage half-domain) of at least one IIS type restriction enzyme and one or more zinc finger binding domains that can be engineered by genetic engineering. An example of a type IIS restriction enzyme whose cleavage domain is separated from its binding domain is FokI. This particular enzyme is active as a dimer (Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10570-10575). The portion of the FokI enzyme used in such fusion proteins is considered to be the cleavage half-domain. Thus, for targeted double-strand cleavage and/or targeted replacement of cellular sequences using zinc finger fusion or TALE-FokI, two fusion proteins can be used to restore the catalytically active cleavage domain, each containing a FokI cleavage half-domain. Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two FokI cleavage half-domains may also be used.

Examples of type IIS restriction enzymes are described in international publication WO 07/014275, incorporated herein by reference. Additional restriction enzymes also contain separate binding and cleavage domains and are also contemplated within the scope of the invention; see, for example, Roberts et al. (2003) Nucleic Acids Res 31: 418-420.

In some embodiments, the cleavage domain comprises one or more engineered cleavage half-domains (also referred to as mutant dimerization domains) that minimize or prevent homodimerization, as described, for example, in US Patent Publications Nos. Examples of engineered FokI cleavage half-domains that form obligate heterodimers include a pair in which the first cleavage half-domain includes mutations at amino acid residues at positions 490 and 538 of the FokI gene, and the second cleavage half-domain includes mutations at amino acid residues 486 and 499 (see, for example, U.S. Patent Publication Nos. 2008/0131962 and 2011/0201055). The engineered cleavage half-domains described herein can be generated using any suitable method, for example, site-directed mutagenesis of wild-type (FokI) cleavage half-domains as described in U.S. Patent Publication Nos. 20050064474 and 20080131962.

The term editing, editing, correction, and the like, refers to any type of engineering design, altering, modifying, or modulating design (which in each case includes, without limitation, gene knockout, gene tagging, gene disruption, gene mutation, etc.).

- 15 042641 gene series, gene deletion, gene activation, gene silencing or gene knocking).

As used herein, genetic modification, genome editing, genome modification, gene modification, and gene editing refer to any gene addition, deletion, knockout, knockin, tagging, mutation, activation, gene silencing, gene modification, and/or disruption of cell nucleotides. A cell in this context may be in vitro, in vivo, or ex vivo.

The terms target genomic region, target gene, target DNA, target DNA sequence, target sequence, target nucleotide sequence, target site, target, site of interest, recognition site, polynucleotide recognition site, recognition sequence, cleavage site, and the like. means a polynucleotide sequence that is recognized and cleaved by the genome editing system. These terms refer to a single region of DNA, preferably a region of the genome, in which a DNA break (cleavage) is to be induced by a genome editing system.

The above editing, including genetic engineering, alteration, modification and modulation, may occur simultaneously or sequentially, any genome editing system known in the art may be used. In some embodiments, the genome editing system is a meganuclease-based system, a zinc finger nuclease (ZFN)-based system, a transcriptional activator-like effector nuclease (TALEN)-based system, a CRISPR-based system, or an NgAgo-based system.

Each of the meganuclease-based, ZFN-based, and TALEN-based systems contains at least one DNA binding domain or nucleic acid containing a nucleic acid sequence (acids) encoding a DNA binding domain and provides specific targeting or recognition of a target genomic region(s) through protein-DNA interactions. The CRISPR-based system contains at least one guide RNA element or nucleic acid containing a sequence of nucleic acid(s) encoding the guide RNA element and provides specific targeting or recognition of the target genomic region(s) by base pairing directly with DNA target genomic region(s). The NgAgo-based system contains at least one targeting DNA element or nucleic acid containing a nucleic acid sequence(s) encoding the targeting DNA element and provides specific targeting or recognition of the target genomic region(s) by base pairing directly with the DNA target genomic region(s).

In some embodiments, the genome editing system is a meganuclease based system. The meganuclease-based system uses meganucleases, which are endonucleases with large (>14 bp) recognition sites, and their DNA binding domains are also responsible for cleaving target sequences. The DNA binding domain of meganucleases can have a double-stranded target DNA sequence between 12 and 45 bp in length. In some embodiments, the meganuclease is either a dimeric enzyme, where each meganuclease domain is on a monomer, or a monomeric enzyme containing two domains on a single polypeptide. Not only wild-type meganucleases, but also various meganuclease variants have been protein engineered to cover many unique sequence combinations. In some embodiments, chimeric meganucleases with a recognition site consisting of a meganuclease A half site and a protein B half site can also be used. Specific examples of such chimeric meganucleases are the domains of the IDmoI and I-CreI proteins. Examples of meganucleases include homing endonucleases from the LAGLIDADG family.

The LAGLIDADG meganuclease can be I-Scel, i-Chui, i-Crei, I-CsmI, PI-SceI, PI-Tlil, PI-MtuI, I-Ceul, I-SceII, I-SceIII, HO, PI-CivI , PI-CtrI, PI-Aael, PI-BsuI, PI-Dhal, PI-Dral, PI-MavI, PI-Mchl, PI-Mful, PI-Mfll, PI-Mgal, PI-MgoI, PI-MinI, PI -Mkal, PIMlel, PI-Mmal, PI-MshI, PI-MsmI, PI-MthI, PI-MtuI, PI-Mxel, PI-Npul, PI-PfuI, PI-Rmal, PISpbl, PI-SspI, PI-FacI , PI-Mjal, PI-PhoI, PI-TagI, PI-Thyl, PI-TkoI, PI-TspI or I-Msol; or may be a functional mutant or variant thereof, homodimeric, heterodimeric or monomeric. In some embodiments, the LAGLIDADG meganuclease is an I-CreI derivative. In some embodiments, the LAGLIDADG meganuclease has at least 80% similarity to the naturally occurring LAGLIDADG I-CreI meganuclease. In some embodiments, the LAGLIDADG meganuclease has at least 80% similarity to residues 1-152 of the naturally occurring LAGLIDADG I-CreI meganuclease. In some embodiments, the LAGLIDADG meganuclease may consist of two monomers having at least 80% similarity to residues 1-152 of the natural LAGLIDADG I-CreI meganuclease linked together with or without a linker peptide.

LAGLIDADG meganuclease refers to a homing endonuclease from the LAGLIDADG family as defined by Stoddard et al (Stoddard, 2005) or an engineered variant containing a polypeptide having at least 80%, 85%, 90%, 95%, 97.5 %, 99% or greater identity or similarity to the specified natural homing endonuclease. Such engineered LAGLI-16 042641 polypeptides

DADGs can be derived from monomeric or dimeric meganucleases. When derived from dimeric megaonucleases, such engineered LAGLIDADG meganucleases can be single stranded or dimeric endonucleases.

The designation I-CreI refers to the natural wild-type meganuclease I-CreI having the sequence accession number lg9y in the PDB database.

Functions of DNA recognition and cleavage of meganucleases are usually presented in one domain. Unlike meganucleases, the DNA-binding domains of ZFN and TALEN-based systems differ from endonucleases in their cleavage function. The ZFN-based system comprises at least one zinc finger protein or variant thereof, or a nucleic acid comprising a nucleotide sequence(s) encoding a zinc finger protein or variant thereof as a DNA-binding domain; and an endonuclease element such as zinc finger nuclease (ZFN) or a Fok1 cleavage domain. Zinc finger protein (ZFP) is a non-naturally occurring protein and is engineered to bind to a chosen target site (see, e.g., Beerli et al. (2002) Nature Biotechnol. 20: 135-141; Pabo et al. (2001 ) Ann Rev Biochem 70:313-340 Isalan ei al (2001) Nature Biotechnol 19:656-660 Segal et al (2001) Curr Opin Biotechnol 12:632-637 Choo et Al. (2000) Curr. Opin. Struct Biol. 10: 411-416; US Patents No. 6453242; 6534261; 6599692; 6503717; 6689558; 7030215; 6794136; 7067317; 7262054; 7070934; 7361634; 732; Nos. 2005/0064474; 2007/0218528; 2005/0267061).

The engineered zinc finger binding domain may have novel binding specificity compared to natural zinc finger protein. Design methods include, without limitation, rational design and various types of selection. Rational design includes, for example, the use of databases containing triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadrupole nucleotide sequence is associated with one or more zinc finger amino acid sequences that bind to a particular triplet or quadrupole sequence. (See, for example, US Pat. Nos. 6,453,242 and 6,534,261, incorporated herein in their entirety by reference).

Various kinds of selection methods can be used for the methods described here. Examples of selection methods, including phage display and two-hybrid systems, are described in US Pat. Nos. 5,789,538; 59255523; 6007988; 6013453; 6410248; 6140466; 6200759 and 6242568; and also in WO 98/37186; W098/53057; WO00/27878; WO 01/88197 and GB 238237. In addition, as disclosed in these and other references, zinc finger domains and/or proteins containing multiple zinc fingers (multifinger proteins) can be linked together using any suitable linker sequences, including, for example, linkers of 5 or more amino acids in length; see also U.S. Patent Nos. 6,479,626; 6,903,185 and 7,153,949 for examples of linker sequences of 6 or more amino acids in length. The proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein. Selection of target sites; ZFPs and methods for constructing and producing fusion proteins (and polynucleotides encoding them) are known to those skilled in the art and are detailed in US Pat. Nos. 6,1400,815; 789538; 6453242; 6534261; 5925523; 6007988; 6013453; 6200759; in the application publications WO 95/19431; W096/06166; W098/53057; W098/54311; WO00/27878; WO 01/60970 WO 01/88197; WO 02/099084; W098/53058; W098/53059; W098/53060; WO 02/016536 and WO 03/016496.

In addition, as disclosed in these and other references, zinc finger domains and/or multifinger proteins can be linked together using any suitable linker sequences, including, for example, linkers of 5 or more amino acids in length; see also U.S. Patent Nos. 6,479,626; 6,903,185 and 7,153,949 for examples of linker sequences of 6 or more amino acids in length. The proteins described herein may include any combination of suitable linkers between individual zinc finger proteins.

Transcription activator-like effector nuclease (TALEN) system refers to a genome editing system that uses one or more transcription-activating effector (TALE) DNA-binding domains and an endonuclease element such as a Fok1 cleavage domain. The TALE-DNA-binding domain contains one or more TLE repeat units, each of which is 30-38 (eg, 31, 32, 33, 34, 35, or 36) amino acids in length. The TALE-DNA-binding domain may use the full-length TALE protein, a fragment or variant thereof. The TALE-DNA-binding domain can be fused or linked to the endonuclease domain via a linker.

Terms CRISPR based system, CRISPR based genome editing system, CRISPR genome editing, CRISPR gene editing, CRISPR endonuclease based genome editing, etc. the expressions are used interchangeably herein and all refer to a genome editing system that contains one or more guide RNA elements and one or more RNA-guided endonuclease elements. The targeting RNA element comprises a targeting RNA containing a nucleotide sequence substantially complementary to a nucleotide sequence in one or more target genomic regions, or a nucleic acid containing a nucleotide sequence(s) encoding the targeting RNA. The RNA targeting endonuclease element comprises an endonuclease that is directed or introduced into the target genomic region(s) by the targeting RNA element; or a nucleic acid containing a nucleotide sequence(s) encoding such an endonuclease. Examples of such a CRISPR-based system are the CRISPR-Cas system or the CRISPR-Cpf system.

As used herein, the terms guide RNA element, guide RNA, guide RNA molecule, and artificial guide RNA (English designation gRNA) are used interchangeably and refer to a polynucleotide sequence containing a guide to a target RNA that hybridizes to a target nucleic sequence, or a nucleic acid containing a nucleotide sequence(s) encoding a guide RNA. The guide RNA contains a guide domain that includes a nucleotide sequence substantially complementary to the nucleotide sequence in the target genomic region of the target. The term substantially complementary means a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%. 95%, 97%, 98%, 99% or 100% in the area of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 30, 35, 40, 45, 50 or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

The targeting RNA element may further comprise an activating RNA that is capable of hybridizing with the targeting RNA, or a nucleic acid containing a nucleotide sequence(s) encoding an activating RNA (activator RNA). The activating RNA and targeting RNA may be separate entities, or they may be fused into a single nucleic acid via a linker loop sequence to form a single guide RNA molecule. A guide RNA molecule may contain several domains. In particular, such RNA may contain in the 5':3' direction: a targeting domain (which is complementary to the target nucleic acid); the first domain of complementarity; binding domain; linker domain; a second complementarity domain (which is complementary to the first complementarity domain); proximal domain; and optionally a tail domain (see WO 2015/048557).

The first complementarity domain, which has significant complementarity to the second complementarity domain, may form a duplex region under at least some physiological conditions.

The linker domain serves to link the first complementarity domain to the second complementarity domain in the monomolecular guide RNA. The linker domain may link the first and second complementarity domains covalently or non-covalently.

The proximal domain may be 3-25 or 5-20 nucleotides in length. The proximal domain may have homology to or be derived from a naturally occurring proximal domain.

The tail domain may be absent or may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. The tail domain may include sequences that are complementary to each other and that, under at least some physiological conditions, may form a duplex region.

The guide RNA element can complex with the guide RNA endonuclease of an endonuclease element such as Cas endonuclease (guide RNA/nuclease complex). An example of a guide RNA/nuclease complex is the CRISPR complex described below in relation to the CRISR based system. In some embodiments, the CRISPR complex includes an RNA-guided endonuclease endonuclease system that forms a complex with the target RNA. In some embodiments, the CRISPR complex includes an RNA-guided endonuclease of the endonuclease system that forms a complex with a targeting RNA and an activating RNA.

The targeting domain of the targeting RNA facilitates the specific targeting or homing of the targeting RNA/nuclease complex to the target nucleotide sequence. In some embodiments, the targeting domain may be 10-30 bp, such as 15-25, 18-22 or 20 bp.

Methods for constructing a targeting RNA are known in the art, including methods for selecting, designing the structure, and validating the targeting domain; see, for example, WO 2015/048577, Mali et al., 2013 SCIENCE 339(6121): 823-826; Hsu et al., 2013 NATBIOTECHNOL, 31(9): 827-32; Fu et al., 2014 NATBTOTECHNOL, doi: 10.1038/nbt.2808. PubMed PMID: 24463574; Heigwer et al., 2014 NAT METHODS 11(2): 122-3. doi: 10.1038/nmeth.2812. PubMed PMID: 24481216; Bae et al., 2014 BIOTNFORMATICS PubMed PMID: 24463181; Xiao A et al., 2014 BIOINFORMATICS Pub Med PMID: 24389662.

In some embodiments, RNA-directed endonucleases can be used, such as a Cas enzyme or protein (e.g., type II Casp9 protein) or a Cpf enzyme or protein (e.g.,

- 18 042641 Cpf1 protein). In some embodiments, a modified version of such a Cas or Cpf enzyme or protein may also be used.

In some embodiments, the CRISPR-based system is a CRISPR-Cas system. The CRISPR-Cas system includes: (a) at least one guide RNA element or nucleic acid containing a nucleotide sequence(s) encoding a guide RNA element, where the guide RNA element contains a target RNA that includes a nucleotide sequence essentially a complementary nucleotide sequence in one or more target genomic regions and an activating RNA comprising a nucleotide sequence that is capable of hybridizing to the target RNA; and (b) a Cas protein element containing a Cas protein or a nucleic acid containing a nucleotide sequence encoding a Cas protein. Targeting RNA and activating RNA can be presented separately or fused into one RNA.

In some embodiments, the CRISPR-based system includes CRISPR class 1 and/or CRISPR class 2 systems. To generate a functional endonuclease, CRISPR class 1 systems use multiple Cas proteins along with CRISPR RNA (crPHK) as target RNA. Class 2 CRISPR systems use a single Cas protein and ssRNA as the target RNA. Class 2 CRISPR systems, including the type II Cas9-based system, contain a single Cas protein to mediate cleavage, rather than the multiple subunit complex used in class 1 systems. The CRISPR-based system also includes a class II, type V, CRISPR system in which uses the Cpf1 protein and sgRNA as the target RNA.

The Cas protein is a double-stranded CRISPR nuclease (Cas). In some embodiments, the CRMSPR-Cas system comprises the Cas9 protein. In some embodiments, the Cas9 protein is SaCas9, SpCas9, SpCas9n, Cas9-HF, Cas9-H840A, FokI-dCas9, or D10A nickase. The term Cas protein, as well as Cas9 protein, includes wild-type Cas protein or functional derivatives thereof (such as truncated or wild-type variants of Cas protein with nuclease activity).

In some embodiments, Cas9 proteins from species other than S. pyogenes and S. thermophiles may be used. Additional types of Cas9 protein used in the present invention can be obtained from many microorganisms, including: Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus; Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp., Brevibacillus laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus Puniceispirillum, Clostridium cellulolyticum, Clostridium perfingens, Corynebacterium accolens, Corynebacterium dolichum, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, gamma-proteobacterium, Gluconacetobacter diazotrophicus, Haemoplzilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicohacter cinaedi, Helicobacter mustelae, llyobacter polytropus, Kingella kingae, lactobacillus crispatus, listeria ivanovii, listeria monocytogenes, listeriaceae bacterium, Methylocystis sp.,Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutells, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp ., Sporolactobacillus vineae, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tistrella mobilis, Treponema sp. or Verminephrobacter eiseniae.

In some embodiments, one or more elements of a CRISPR-based system are derived from a Type I, Type II, or Type III CRISPR system.

In some embodiments, one or more elements of the CRISPR-based system is derived from a particular organism containing the endogenous CRCRR system, such as Streptococcus pyogenes, Staphylococcus aureus, Francisella tularensis, Prevotella sp., Acidaminococcus sp. and Lachnospiraceae sp. In general, a CRISPR-based system is characterized by elements that promote the formation of a CRISPR complex at target genomic regions or a target sequence site (also called a protospacer in the context of an endogenous CRISPR system). In the context of CRISPR complex formation, a target sequence is a sequence against which a target sequence having substantial complementarity is designed, wherein hybridization between the target sequence and the target sequence promotes the formation of the CRISPR complex. Complete complementarity is not necessarily necessary as long as there is sufficient complementarity to induce hybridization and promote the formation of the CRISPR complex. The target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, the target sequence is located in the nucleus or cytoplasm of the cell(s). In some embodiments, the target sequence may be located in the organelle of the eukaryotic cell(s), such as in the mitochondria or chloroplast.

A sequence or template that can be used for recombination to a targeting locus, including target sequences, is called an edit template, edit lynucleotide, or edit sequence. An exogenous template polynucleotide may be referred to as an editing template or a donor template. In some embodiments, artificial single-stranded DNA and double-stranded DNA, or of biological origin, can be used. By way of non-limiting example, suitable editing matrices include ssODN, dsODN, PCR products, plasmids, and viruses including AAV, adenovirus, retrovirus, lentivirus, and the like. You can also use additional editing matrices. In some embodiments, the recombination is homologous recombination.

In some embodiments, the CRISPR-based system is a CRISPR-Cas9 system. The targeting RNA of the CRISPR-Cas9 system contains the targeting CRISPR RNA (CrPHK), and the activating RNA of the CRISPR-Cas9 system includes the transactivating CRISPR RNA (tRNA). The Cas-protein element of the CRISPR-Cas9 system uses the Cas9 protein. CrRNA and tRNA may be separate, or they may be combined into one RNA construct by a linker loop sequence. This combined RNA construct is called unidirectional RNA (sgPHK; or guide RNA).

With regard to general information regarding CRISPR-Cas systems, their components and the delivery of such components, including methods, materials, delivery vehicles, vectors, particles, AAVs, their preparation and use, including quantitative indicators and methods for preparing compositions / preparations, can be found in U.S. Patent Nos. 8999641, 8993233, 8945839, 8932814, 8906616, 8895308, 8889418, 8889356, 8871445, 8865406, 8795965, 8771945 and 8697359; in US Patent Publications US 2014-0310830, US 2014-0287938 A1, US 2014-0273234 A1, US2014-0273232 A1, US 20140273231, US 2014-0256046 A1, US 2014-0248702 A1, US 2014-2702 0242699 A1, US 20140242664 A1, US 2014-0234972 A1, US 2014-0227787 A1, US 2014-0189896 A1, US 2014-0186958, US 20140186919 A1, US 2014-0186843, US 2014-017970 A1, US A1 and US 2014-0170753; in European patents EP 2784162 B1 and EP 2771468 B1; in European patent applications EP 2771468 (EP 13818570.7), EP 2764103 (EP 13824232.6) and EP 2784162 (EP 14170383.5); and in PCT Publications WO 2014/093661, WO 2014/093694, WO 2014/093595, WO 2014/093718, WO 2014/093709, WO 2014/093622, WO 2014/093635, WO 2014/0932025, WO 2014/0932025 /093701, WO2014/018423, WO 2014/204723, WO 2014/204724, WO 2014/204725, WO 2014/204726, WO 2014/204727, WO 2014/204728, WO 2014/204729 and WO 2014/204729 and WO 2014/204729

In some embodiments, the CRISPR-based system is a CRISPR-Cpf system. The CRISPR-Cpf system includes: (a) at least one guide RNA element or nucleic acid containing a nucleotide sequence(s) encoding the guide RNA element, where the guide RNA contains a target RNA having a nucleotide sequence complementary to the nucleotide sequence at the locus target nucleic acid; and (b) a Cpf protein element or a nucleic acid containing a nucleotide sequence encoding a Cpf protein element.

An example of a Cpf protein element includes Cpf1 nucleases such as Cpf1 from Francisella (FnCpf1) and any variants thereof; see, for example, Zetsche et al., Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system, Cell, 163(3): p. 759-71; and Fonfara et al., The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes CRISPR RNA precursor, Nature 532 (7600): p. 517-21. The preferred PAM for Cpf1 is 5'-TTN, which differs from that of Cas9 (3'-NGG) in both genomic position and GC content. The CRISPR-Cpf system may not use activating RNA (tRNA). Both Cpf1 and its guide RNAs are typically smaller than their SpCas9 counterparts. The Cpf1 locus contains a mixed alpha/beta domain, RuvC-I, followed by a helical region, RuvC-II, and a zinc finger-like domain. The Cpf1 protein has a RuvC-like endonuclease domain that is similar to the RuvC domain of Cas9. Moreover, Cpf1 lacks the HNH endonuclease domain, and the N-terminus of Cpf1 lacks the alpha helix protrusion for Cas9 recognition. The Cpf1 loci encode the Cas1, Cas2, and Cas4 proteins, which are more similar to the proteins of the type I and III systems than to the proteins of the type II system. Proteins of the Cpf1 family can be found in many bacterial species.

Without wishing to be bound by a particular theory, it is believed that the CRISPR-Cpf system uses the Cpf1crPHK complex, which cleaves the target DNA or RNA by identifying the 5'-YTN-3' protospacer contiguous motif (where Y is a pyrimidine and N is any base ) or 5'-TTN-3', in contrast to the G-rich PAM directed to Cas9. After PAM identification, Cpf1 introduces a double-strand break at a 4- or 5-nucleotide overhang of DNA with sticky ends.

In some embodiments, the genome editing system is an NgAgo based system. The NgAgo-based system comprises at least one guide DNA element or nucleic acid comprising a nucleic acid sequence(s) encoding a guide DNA element; and DNA-directed endonuclease. The NgAgo based system uses DNA as a guide. It works in a similar way to the CRISPR-Cas9 system, but the guide element is a guide DNA segment rather than the guide RNA used in the CRISPR-Cas9 system. An example of a DNA-guided endonuclease

- 20 042641 is the Argonaute (NgAgo) endonuclease from Natronobacterium gregoryi; see, for example, Feng Gao et al.

DNA-guided genome editing using the Natronobacterium gregoryi Argonaute, Nature Biotechnology, (2016):

doi:10.1038/nbt.3547.

By the terms linker, peptide linker, or peptide spacer is meant a peptide sequence that allows different monomers to be linked together in a fusion protein and assume the correct conformation to maintain the activity of the fusion protein without altering the activity of any of the monomers. Peptide linkers can be of various sizes ranging from 1, 2, 3, 4, 5, 10, 15, 20, 30, 40 and up to 50 amino acids as a non-limiting illustrative range, or any intermediate value in this range.

DNA-RK inhibitors.

In some embodiments, a compound represented by the structural formula (I) is used

or a pharmaceutically acceptable salt thereof, or a co-crystal thereof, wherein m and n are independently 1 or 2;

X is O or NR; where R is H or C1- _C4 alkyl. R may also be ² H (D or deuterium). As used herein, the terms deuterium, ² H, and D are used interchangeably;

R ¹ is C _g C ₄ alkyl.

R ² is a 5- or 6-membered aromatic or heteroaromatic ring containing one or two heteroatoms selected from the group consisting of N, O and S, where the aromatic or heteroaromatic ring may be substituted with 0, 1 or 2 R ³ substituents, independently selected from the group consisting of CN, halo, NO2, C1-C4 alkyl, C1-C4 haloalkyl, CrC4 alkoxy, C1-C4 haloalkoxy and C(=O)NHR1, where R ¹ is CrC ₄ alkyl; or where two R ³ groups attached to adjacent carbon atoms of an aromatic or heteroaromatic ring may form a fused 5-membered ring which may contain a heteroatom selected from O, N and S.

Alternatively, R ² may be COOR ⁴ where R ⁴ is C _g C ₄ alkyl or benzyl. Ring A is selected from the group consisting of

W is N or CR ³ ; Z is O or S and R ³ is H (or ² H) or C ₁ -C ₄ alkyl.

In some embodiments, A is

In some embodiments, R ¹ is methyl.

In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (I); and o is 0, 1, or 2.

In some embodiments, m and n are each 2.

In some embodiments, R ² is

- 21 042641

In some embodiments, R ² is

In some embodiments, m and n are each 2, R ¹ is methyl, R ² is COOR ⁴ and R ⁴ is C 1 -C ₄ alkyl or benzyl.

In some embodiments, o is 0, 1, or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, C1-C2 alkyl, C1-C4 haloalkyl, C1-C2 alkoxy, C1-C2 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C2 alkyl.

In some embodiments, two R ³ groups attached to adjacent carbon atoms of a heteroaromatic ring may form a fused 5-membered ring, which may contain a heteroatom selected from O, N, and S.

In some embodiments, a pharmaceutically acceptable salt of a compound of structural formula (I) is used.

In some embodiments, a co-crystal is used that includes a compound of structural formula (I).

In some embodiments, a co-crystal is used that includes a compound of structural formula (I) and a co-crystal maker (CCF). In some embodiments, the CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

In some embodiments, the ratio of co-crystal forming agent (CCF) to compound of structural formula (I) is approximately 2:1. In some embodiments, the ratio of co-crystal former (CCF) to compound of structural formula (I) is about 1:2. In some embodiments, the co-crystal comprises a compound of structural formula (I) and CCF in a ratio defined by the formula: (compound of structural formula (I))p:(CCF)q. In some embodiments, p is about 1 and q is about 0.4 to about 2.1. In some embodiments, p is about 1 and q is about 0.9 to about 3.1. In some embodiments, p is about 2 and q is about 1. In some embodiments, p is about 1 and q is about 2. In some embodiments, CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

In some embodiments, a compound of formula (II) represented by the structural formula (II) is used

or a pharmaceutically acceptable salt thereof, or a co-crystal thereof.

In some embodiments, R ¹ is methyl.

In some embodiments, Y is O or NR; where R is H or C1- _C4 alkyl.

In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (II); and o is 0, 1 or 2

In some embodiments, m and n are each 2.

- 22 042641

In some embodiments, m and n are each 2 and R ² is #<R ³ >.

In some embodiments, m and n are each 2 and R ² is #

II

In some embodiments, m and n are each 2, R ¹ is methyl, R ² is COOR ⁴ and R ⁴ is C ₁ -C 4 alkyl or benzyl.

In some embodiments, o is 0, 1, or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, C1-C2 alkyl, C1-C4 haloalkyl, C1-C2 alkoxy, C1-C2 haloalkoxy and C(=O)NHR ¹ where R ¹ is C1-C ₂ alkyl.

In some embodiments, Ring A is selected from the group consisting of

In other embodiments, Ring A is

ABOUT

In some embodiments, ring A is ή

In some embodiments, Ring A is

In some embodiments, Ring A is

0.

In some embodiments, two R ³ groups attached to adjacent carbon atoms of a heteroaromatic ring may form a fused 5-membered ring, which may contain a heteroatom selected from O, N, and S.

In some embodiments, a pharmaceutically acceptable salt of a compound of structural formula (II) is used.

In some embodiments, a co-crystal is used that includes a compound of structural formula (II).

In some embodiments, a co-crystal is used that includes a compound of structural formula (II) and a co-crystal maker (CCF). In some embodiments, the CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

In some embodiments of the invention for the formation of co-crystals (CCF) and compounds of structural formula (II) is approximately 2:1. In some embodiments, the ratio of co-crystal forming agent (CCF) to compound of structural formula (II) is approximately 1:2. In some embodiments, the co-crystal includes a compound of structural formula (II) and CCF in a ratio. In some embodiments, the co-crystal includes a compound of structural formula (II) and CCF in a ratio defined by the formula: q. In some embodiments, p is about 1 and q is about 0.4 to about 2.1. In some embodiments, p is about 1 and q is about 0.9 to about 3.1. In some embodiments, p is about 2 and q is about 1. In some embodiments, p is about 1 and q is about 2. In some embodiments, CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

In some embodiments of the invention, a compound of formula (I) represented by the structural formula (II') is used

- 23 042641 its pharmaceutically acceptable salt, or its co-crystal.

In some embodiments, R ¹ is methyl.

In some embodiments, Y is O or NR; where R is

H or C _g C ₄ -alkyl.

In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (II'); and o is 0, 1, or 2.

In some embodiments, m and n are each 2.

In some embodiments, m and n are each 2 and R ² is

In some embodiments, m and n are each 2 and R ² is

In some embodiments, m and n are each 2, R ¹ is methyl, R ² is COOR ⁴ and R ⁴ is C _g C ₄ alkyl or benzyl.

In some embodiments, o is 0, 1, or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, C1-C2 alkyl, C1-C4 haloalkyl, C1-C2 alkoxy, C1-C2 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C2 alkyl.

In some embodiments, Ring A is selected from the group consisting of

In other embodiments, ring A is L

Z

In some embodiments, Ring A is

In some embodiments, Ring A is

In some embodiments, ring A is o

In some embodiments, two R ³ groups attached to adjacent carbon atoms of a heteroaromatic ring may form a fused 5-membered ring, which may contain a heteroatom selected from O, N, and S.

In some embodiments, a pharmaceutically acceptable salt of a compound of structural formula (II') is used.

In some embodiments, a co-crystal is used that includes a compound of structural formula (II').

- 24 042641

In some embodiments, a co-crystal is used that includes a compound of structural formula (II') and a co-crystal maker (CCF).

In some embodiments, the ratio of co-crystal forming agent (CCF) to compound II' is approximately 2:1. In some embodiments, the co-crystal includes compound II' and CCF in a ratio defined by the formula: (compound II')p:(CCF)q. In some embodiments, p is about 1 and q is about 0.4 to about 2.1. In some embodiments, p is about 1 and q is about 0.9 to about 3.1. In some embodiments, p is about 2 and q is about 1. In some embodiments, p is about 1 and q is about 2. In some embodiments, CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

In some embodiments, a compound of formula (I) represented by structural formula (II) is used

or a pharmaceutically acceptable salt thereof, or a co-crystal thereof.

In some embodiments, R ¹ is methyl.

In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (II'); and o is 0, 1, or 2.

In some embodiments, m and n are each 2.

In some embodiments, m and n are each 2 and R ² is:

In some embodiments, m and n are each 2 and R ² is

In some embodiments, m and n are each 2, R ¹ is methyl, R ² is COOR ⁴ and R ⁴ is C 1 -C ₄ alkyl or benzyl.

In some embodiments, o is 0, 1, or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, C1-C2 alkyl, C1-C4 haloalkyl, C1-C2 alkoxy, C1-C2 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C2 alkyl.

In some embodiments, two R ³ groups attached to adjacent carbon atoms of a heteroaromatic ring may form a fused 5-membered ring, which may contain a heteroatom selected from O, N, and S.

In some embodiments, Ring A is selected from the group consisting of

In other embodiments, Ring A is

- 25 042641

In some embodiments, Ring A is

In some embodiments, Ring A is

In some embodiments, Ring A is

In some embodiments of the present invention, a pharmaceutically acceptable salt of a compound of structural formula (II) is used.

In some embodiments, a co-crystal is used that includes a compound of structural formula (II).

In some embodiments, a co-crystal is used that includes a compound of structural formula (II) and a co-crystal maker (CCF).

In some embodiments, the ratio of co-crystal forming agent (CCF) to compound II is approximately 2:1. In some embodiments, the ratio of co-crystal former (CCF) to Compound II is approximately 1:2. In some embodiments, the co-crystal comprises compound II and CCF in a ratio defined by the formula: (compound II)p:(CCF)q. In some embodiments, p is about 1 and q is about 0.4 to about 2.1. In some embodiments, p is about 1 and q is about 0.9 to about 3.1. In some embodiments, p is about 2 and q is about 1. In some embodiments, p is about 1 and q is about 2. In some embodiments, CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

In some embodiments, a compound of formula (I) represented by the structural formula (II') is used

or a pharmaceutically acceptable salt thereof, or a co-crystal thereof.

In some embodiments, R ¹ is methyl.

In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (II'); and o is 0, 1, or 2.

In some embodiments, m and n are each 2.

In some embodiments, m and n are each 2 and R ² is

In some embodiments, m and n are each 2 and R ² is

- 26 042641

In some embodiments, m and n are each 2, R ¹ is methyl, R ² is COOR ⁴ and R ⁴ is C1- _C4 alkyl or benzyl.

In some embodiments, m and n are each 2, Y is a bond, R ¹ is methyl, R ² is COOR ⁴ , and R ⁴ is C1- _C4 alkyl or benzyl.

In some embodiments, o is 0, 1, or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, C1-C2 alkyl, C1-C4 haloalkyl, C1-C2 alkoxy, C1-C2 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C2 alkyl.

In some embodiments, two R ³ groups attached to adjacent carbon atoms of a heteroaromatic ring may form a fused 5-membered ring, which may contain a heteroatom selected from O, N, and S.

In some embodiments, Ring A is selected from the group consisting of

In other embodiments, Ring A is

In some embodiments, Ring A is

In some embodiments, Ring A is

In some embodiments, Ring A is

In some embodiments of the invention, a pharmaceutically acceptable salt of a compound of structural formula (II') is used.

In some embodiments, a co-crystal is used that includes a compound of structural formula (II').

In some embodiments, a co-crystal is used that includes a compound of structural formula (II') and a co-crystal maker (CCF).

In some embodiments, the ratio between co-crystal forming agent (CCF) and compound II is approximately 2:1. In some embodiments, the ratio of co-crystal former (CCF) to compound II' is approximately 1:2. In some embodiments, the implementation of the co-crystal includes the compound II' and CCF in the ratio defined by the formula: (compound II')p:(CCF)q. In some embodiments, p is about 1 and q is about 0.4 to about 2.1. In some embodiments, p is about 1 and q is about 0.9 to about 3.1. In some embodiments, p is about 2 and q is about 1. In some embodiments, p is about 1 and q is about 2. In some embodiments, CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

In some embodiments, a compound of formula (I) represented by structural formula (III) is used ^Me \ii

or a pharmaceutically acceptable salt thereof, or a co-crystal thereof.

- 27 042641

In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (III); and o is 0, 1, or 2.

In some embodiments, Y is a bond, X is O, and R ² is

In some embodiments, Y is a bond, X is O, and R ² is

In some embodiments, Y is NH, X is O, and R ² is

In some embodiments, Y is NH, X is O, and R ² is

In some embodiments, Y is a bond, X is O, R ² is COOR ⁴ and R ⁴ is C ₁ -C ₄ alkyl or benzyl.

In some embodiments, Y is NH, X is O, R ² is COOR ⁴ , and R ⁴ is C1- _C4 alkyl or benzyl.

In some embodiments, o is 0, 1, or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, C1-C2 alkyl, C1-C4 haloalkyl, C1-C2 alkoxy, C1-C2 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C2 alkyl.

In some embodiments, two R ³ groups attached to adjacent carbon atoms of a heteroaromatic ring may form a fused 5-membered ring, which may contain a heteroatom selected from O, N, and S.

In some embodiments, a pharmaceutically acceptable salt of a compound of structural formula (III) is used.

In some embodiments, a co-crystal is used that includes a compound of structural formula (III).

In some embodiments, a co-crystal is used that includes a compound of structural formula (III) and a co-crystal maker (CCF).

In some embodiments, the ratio between co-crystal forming agent (CCF) and compound III is approximately 2:1. In some embodiments, the ratio between co-crystal forming agent (CCF) and compound III is approximately 1:2. In some embodiments, the co-crystal comprises compound III and CCF in a ratio defined by the formula: (compound III)p:(CCF)q. In some embodiments, p is about 1 and q is about 0.4 to about 2.1. In some embodiments, p is about 1 and q is about 0.9 to about 3.1. In some embodiments, p is about 2 and q is about 1. In some embodiments, p is about 1 and q is about 2. In some embodiments, CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

- 28 042641

In some embodiments of the invention, a compound of formula (I) represented by the structural formula (III') is used

or a pharmaceutically acceptable salt thereof or a co-crystal thereof. In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (III'); and o is 0, 1 or 2

In some embodiments, Y is a bond, X is O, and R ² is

In some embodiments, Y is a bond, X is O, and R ² is

In some embodiments, Y is NH, X is O, and R ² is

In some embodiments, Y is NH, X is O, and R ² is

In some embodiments, Y is a bond, X is O, R ² is COOR ⁴ , and R ⁴ is C1- _C4 alkyl or benzyl.

In some embodiments, Y is NH, X is O, R ² is COOR ⁴ and R ⁴ is C1- _C4 alkyl or benzyl.

In some embodiments, o is 0, 1, or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, C1-C2 alkyl, C1-C4 haloalkyl, C1-C2 alkoxy, C1-C2 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C2 alkyl.

In some embodiments, two R ³ groups attached to adjacent carbon atoms of a heteroaromatic ring may form a fused 5-membered ring, which may contain a heteroatom selected from O, N, and S.

In some embodiments, a pharmaceutically acceptable salt of a compound of structural formula (III') is used.

In some embodiments, a co-crystal is used that includes a compound of structural formula (III').

In some embodiments, a co-crystal is used that includes a compound of structural formula (III') and a co-crystal maker (CCF).

In some embodiments, the ratio between co-crystal forming agent (CCF) and compound III' is approximately 2:1. In some embodiments, the ratio between co-crystal forming agent (CCF) and compound III' is approximately 1:2. In some embodiments, the co-crystal comprises Compound III' and

- 29 042641

CCF in the ratio defined by the formula: (compound III')p:(CCF)q. In some embodiments, p is about 1 and q is about 0.4 to about 2.1. In some embodiments, p is about 1 and q is about 0.9 to about 3.1. In some embodiments, p is about 2 and q is about 1. In some embodiments, p is about 1 and q is about 2. In some embodiments, CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

In some embodiments of the invention, a compound of formula (I) represented by the structural formula (III) is used

or a pharmaceutically acceptable salt thereof or a co-crystal thereof. In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (III); and o is 0, 1, or 2.

In some embodiments, Y is a bond, X is O, and R ² is

In some embodiments, Y is a bond, X is O, and R ² is

In some embodiments, Y is NH, X is O, and R ² is

In some embodiments, Y is NH, X is O, and R ² is

In some embodiments, Y is a bond, X is O, R ² is COOR ⁴ , and R ⁴ is C1- _C4 alkyl or benzyl.

In some embodiments, Y is NH, X is O, R ² is COOR ⁴ , and R ⁴ is C1- _C4 alkyl or benzyl.

In some embodiments, o is 0, 1, or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, C1-C2 alkyl, C1-C4 haloalkyl, C1-C2 alkoxy, C1-C2 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C2 alkyl.

In some embodiments, two R ³ groups attached to adjacent carbon atoms of a heteroaromatic ring may form a fused 5-membered ring, which may contain a heteroatom selected from O, N, and S.

In some embodiments, a pharmaceutically acceptable salt of a compound of structural formula (III) is used.

In some embodiments, a co-crystal is used that includes a compound of structural formula (III).

In some embodiments, a co-crystal is used that includes a compound of structural formula (III) and a co-crystal maker (CCF).

In some embodiments of the invention, a compound of formula (I) represented by the structural formula (III') is used

or a pharmaceutically acceptable salt thereof, or a co-crystal thereof. In some embodiments, R ² is

where # means the position where R ² attached to the rest of the compounds of formula (III'); and o is 0, 1, or 2.

In some embodiments, Y is a bond, X is O, and R ² is

In some embodiments, Y is a bond, X is O, and R ² is

In some embodiments, Y is NH, X is O, and R ² is

In some embodiments, Y is NH, X is O, and R ² is

In some embodiments, Y is a bond, X is O, R ² is COOR ⁴ , and R ⁴ is C1- _C4 alkyl or benzyl.

In some embodiments, Y is NH, X is O, R ² is COOR ⁴ , and R ⁴ is C1- _C4 alkyl or benzyl.

In some embodiments, o is 0, 1, or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, C1-C2 alkyl, C1-C4 haloalkyl, C1-C2 alkoxy, C1-C2 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C2 alkyl.

In some embodiments, two R ³ groups attached to adjacent carbon atoms of a heteroaromatic ring may form a fused 5-membered ring, which may contain a heteroatom selected from O, N, and S.

In some embodiments, a pharmaceutically acceptable salt of a compound of structural formula (III') is used.

In some embodiments, a co-crystal is used that includes a compound of structural formula (III').

In some embodiments, a co-crystal is used that includes the compound

- 31 042641 structural formula (III') and means for the formation of co-crystals (CCF).

In some embodiments, the implementation of the compound of formula (I) is selected from compounds Nos. 1-37 presented in table. 1, or a pharmaceutically acceptable salt thereof, or a co-crystal thereof.

In some embodiments, a pharmaceutically acceptable salt of any of Compounds Nos. 1-37 is used.

In some embodiments, a co-crystal is used that includes any of Compound Nos. 1-37.

In some embodiments, a co-crystal is used, including any of Compound Nos. 1-37 and a co-crystal maker (CCF). In some embodiments, the CCF is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid. In some embodiments, the CCF is adipic acid.

In some embodiments of the invention, the compound is a compound selected from Table. 1, or a pharmaceutically acceptable salt or co-crystal thereof.

Table 1

- 32 042641

7 0 0 ⁴⁵ tr Η 8 ΝγΝ bAo < 9 Ν^Ν F , 10 ΝγΝ ΛΤ & · eleven ^ζ \\ / ^ζ ο 12 Ο ΝγΝ Г 1 0*0 j Λ7° 13 Η Ύ ιί F 1 ¹ ° Uo , ΛΤ θχ/ ¹ 14 Ν^Ν W , ,τΧί° Oj

- 33 042641

15 ^HN n m&X 16 ΛΥ 19 θγ° O^J 20 0 YY^'H'' N^N ^H MM ©Y 21 °γ° HN./\ r> 1 L t>yL_ ^>o , &Ύ 22 ^0 “a., mm 23 -O-Q ίλο Ay Wu'” 24 lt ι$ς Lu 25 F , A ^N y

- 34 042641

26 δ4 OFE 27 already, cA 28 ⁿ well, Α^ ^Ν γ° 29 already, &Ύ _ο α ^ν thirty V Γ dL ι Αα° A ⁷ 31 ^v ° 32 ''o N^N W , Λ ^Ν Υ° _σ 7υ 33 Ji and ¹

- 35 042641

The compounds disclosed herein may optionally be substituted with one or more substituents shown above as illustrative, or substituents belonging to the illustrated classes, subclasses and species. It should be understood that the designation optionally substituted is used interchangeably with the term substituted or unsubstituted. In general, the term substituted, whether preceded optionally or not, refers to the substitution of one or more hydrogen radicals in a given structure by a radical of the indicated substituent. Unless otherwise indicated, an optionally substituted group may have a substituent at each substitutable position of the group. When more than one position in a given structure can be substituted with more than one substituent selected from the specified group, then at each position the substituent may be either the same or different.

If chemically possible or chemically stable, the molecular group described herein is unsubstituted or substituted (ie, optionally substituted). As described herein, when the term optionally substituted precedes a list, that term refers to all substitutable groups in that list. For example, if the group X is halogen; optionally substituted alkyl or phenyl; then X can be either optionally substituted alkyl or optionally substituted phenyl. Similarly, when the term optionally substituted follows a list, that term also refers to all substituted groups in the preceding list, unless otherwise indicated. For example: if X is halogen, C _1-4 alkyl, or phenyl, where X is optionally substituted with J ^x , then in both cases C 1-4 alkyl and phenyl may be optionally substituted with J ^x . Those skilled in the art will appreciate that groups such as H, halogen, NO2, CN, NH2, OH, or OCF ₃ are not substitutable groups. It will also be apparent to those skilled in the art that a heteroaryl or heterocyclic ring containing an NH group may optionally be substituted by replacing a hydrogen atom with a substituent.

In some embodiments, the group (eg, C _1-4 alkyl, C ₃ - ₅ cycloalkyl; heterocyclyl, such as oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, or morpholinyl; aryl, such as phenyl, or heteroaryl) is unsubstituted.

In some embodiments, the group (eg, C _1-4 alkyl, C _3-5 cycloalkyl; heterocyclyl, such as oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, or morpholinyl; aryl, such as phenyl, or heteroaryl) is substituted. In some embodiments, the group includes 1, 2, 3, 4, 5, or 6 substituents as valence and chemical stability permit.

The combinations of substituents mentioned in this specification are preferably those that result in the formation of stable or chemically feasible compounds. The term stable, as used herein, refers to compounds that are essentially unchanged under the conditions of their preparation, detection, and, preferably, their isolation, purification, and use for one or more of the purposes disclosed here. In some embodiments, a stable compound or chemically feasible compound is a compound that does not change substantially when stored at or below 40° C. in the absence of moisture or other reactive conditions for at least one week.

The term approximately in relation to the numerical value of X means, for example, X +/-10%.

The term alkyl or alkyl group as used herein means a straight (ie, straight) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated. Unless otherwise indicated, alkyl groups contain 1-8 carbon atoms (groups represented as _{C1_8} alkyl). In some embodiments, the alkyl groups contain 1-4 carbon atoms (groups represented as _{C1_4} alkyl). In some embodiments of the invention, the molecular group described as C _0-4 alkyl includes a covalent bond (for example, C ₀ -alkyl) or C 1_ ₄ alkyl chain, as described here. Examples of alkyl groups include methyl, ethyl, propyl, butyl, isopropyl, isobutyl, sec-butyl and tert-butyl.

The term heterocycle, heterocyclyl, heterocycloalkyl or heterocyclic as used herein refers to a monocyclic, bicyclic or tricyclic ring system in which at least one ring in the system contains one or more heteroatoms that are the same or different and that are fully saturated or they are contains one or more unsaturated units, but are not aromatic, and they have a single point of attachment to the rest of the molecule. In some embodiments, a heterocycle, heterocyclyl, heterocycloalkyl, or heterocyclic group has three to fourteen ring atoms, where one or more ring atoms is a heteroatom independently selected from oxygen, sulfur, nitrogen, or phosphorus, and each ring in the system contains 3 to 8 atoms. Examples of heterocyclic rings include, without limitation, the following monocycles: 2-tetrahydrofuranyl, 3-tetrahydrofuranyl, 2-tetrahydrothiophenyl, 3-tetrahydrothiophenyl, 2morpholino, 3-morpholino, 4-morpholino, 2-thiomorpholino, 3-thiomorpholino, 4-thiomorpholino, 1pyrrolidinyl , 2-pyrrolidinyl, 3-pyrrolidinyl, 1-tetrahydropiperazinyl, 2-tetrahydropiperazinyl, 3-tetrahydropiperazinyl, 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 1-pyrazolinyl, 3pyrazolinyl, 4-pyrazolinyl, 5-pyrazolinyl, 1-piperidinyl , 2-piperidinyl, 3-piperidinyl, 4-piperidinyl, 2-thiazolidinyl, 3-thiazolidinyl, 4-thiazolidinyl, 1-imidazolidinyl, 2-imidazolidinyl, 4-imidazolidinyl, 5-imidazolidinyl and the following bicycles: 3-1H-benzimidazole-2- he, 3-(1-alkyl)benzimidazol-2-one, indolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, benzothiolane, benzodithian and 1,3-dihydroimidazol-2-one.

The term heteroatom as used herein means one or more oxygen, sulfur, nitrogen, or phosphorus atoms, including any oxidized form of nitrogen, sulfur, or phosphorus; the quaternized form of any basic nitrogen; or a displaceable heterocyclic ring nitrogen, for example N (as in 3,4dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR+ (as in N-substituted pyrrolidine).

The term unsaturated as used herein means that the residue has one or more unsaturated units.

The term alkoxy, cycloalkyl or thioalkyl as used herein refers to an alkyl group as defined above attached to the main carbon chain via an oxygen atom (alkoxy) or sulfur atom (thioalkyl).

The terms haloalkyl, haloalkenyl or haloalkoxy as used herein means alkyl, alkenyl or alkoxy, in some cases they may be substituted by one or more halogen atoms. The term halogen means F, Cl, Br or I.

The term aryl, used here alone or as part of a larger moiety, such as aralkyl, aralkoxy, or aryloxyalkyl, refers to a monocyclic, bicyclic, or tricyclic carbocyclic ring system containing a total of six to fourteen ring atoms, said ring system has a single point of attachment to the rest of the molecule, and at least one ring in the system is aromatic, and yet

- 37 042641 each ring in the system contains from 4 to 7 atoms in the ring. The term aryl may be used interchangeably with the term aryl ring. Examples of aryl rings include phenyl, naphthyl and anthracene.

As used herein, the term heteroaryl, whether used alone or as part of a larger moiety such as heteroaralkyl or heteroarylalkoxy, refers to a monocyclic, bicyclic, and tricyclic ring system having a total of five to fourteen ring atoms, said ring system having a single point of attachment to the rest of the molecule, at least one ring in the system is aromatic, at least one ring in the system contains one or more heteroatoms independently selected from nitrogen, oxygen, sulfur or phosphorus, and each ring in the system contains from 4 to 7 atoms in a ring. The term heteroaryl may be used interchangeably with the term heteroaryl ring or the term heteroaromatic. Additional examples of heteroaryl rings include the following monocycles: 2-furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxazolyl, 4- oxazolyl, 5-oxazolyl, N-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, pyridazinyl (e.g., 3-pyridazinyl), 2 -thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (eg 5-tetrazolyl), triazolyl (eg 2-triazolyl and 5-triazolyl), 2-thienyl, 3-thienyl, pyrazolyl (eg 2-pyrazolyl), isothiazolyl, 1,2,3-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4oxadiazolyl, 1,2,3-triazolyl, 1,2,3-thiadiazolyl, 1,3,4-thiadiazolyl, 1, 2,5-thiadiazolyl, pyrazinyl, 1,3,5-triazinyl and the following bicycles: benzimidazolyl, benzofuryl, benzothiophenyl, indolyl (e.g. 2indolyl), purinyl, quinolinyl (e.g. 2-quinolinyl, 3-quinolinyl, 4-quinolinyl) and isoquinolinyl (for example, 1-isoquinolinyl, 3-isoquinolinyl or 4-isoquinolinyl).

Unless otherwise shown or indicated, the structures herein may include all isomeric (eg, enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structures; for example, R and S configurations for each asymmetric center, (Z) and (E) double bond isomers, and (Z) and (E) conformational isomers. Individual stereochemical isomers as well as enantiomeric, diastereomeric and geometric (or conformational) mixtures of compounds are within the scope of this specification. Compounds that are depicted with specific stereochemical centers, usually using a shaded or bold bond, are stereochemically pure, but their absolute stereochemistry is not specified. Such compounds may have an R or S configuration. Where an absolute configuration is defined, the chiral center(s) are labeled in the image as (R) or (S).

Unless otherwise indicated, all tautomeric forms of the compounds disclosed herein are within the scope of this specification. In addition, unless otherwise indicated, structures depicted herein also include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having these structures, except for the replacement of hydrogen with deuterium or tritium, or the replacement of carbon with carbon enriched in 13C or 14C carbon, are within the scope of the present disclosure. Such compounds are useful, for example, as analytical tools, probes in biological assays, or as DNA-PK inhibitors with an improved therapeutic profile.

Pharmaceutically acceptable salts.

It is also understood that some of the compounds disclosed herein may exist in free form or, if appropriate, as a pharmaceutically acceptable derivative. A pharmaceutically acceptable derivative includes, without limitation, pharmaceutically acceptable prodrugs, salts, esters, salts of such esters, or any other adduct or derivative which, when administered to a patient in need of treatment, is capable of providing, directly or indirectly, the compound described herein, or its metabolite or residue.

The term "pharmaceutically acceptable salt" as used herein refers to salts which, under sound medical judgment, are suitable for use in contact with human and lower animal tissues without undue toxicity, irritation, allergic reaction, or the like.

Pharmaceutically acceptable salts are well known in the art. For example, in SM Berge et al. J. Pharmaceutical Sciences, 66:1-19, 1977, pharmaceutically acceptable salts are described in detail. With regard to pharmaceutically acceptable salts, this publication is incorporated into the description by reference. Pharmaceutically acceptable salts of the compounds disclosed herein include salts derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are amino salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid, or formed using other methods known in the art such as ion exchange. Other pharmaceutically acceptable salts include alginate, ascorbate, aspartate, benzenesulfonate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, cyclopentane pro-pionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hydrodianoate , 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate , stearate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate and the like. Other examples of salts include adipate, benzoate, citrate, fumarate, maleate or succinate. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N ⁺ (C ₁ . ₄ alkyl) _{4 salts} .

This specification also includes quaternized forms of any of the basic nitrogen-containing groups of the compounds described herein. By quaternization, products soluble or dispersible in water or oil can be obtained. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Additional pharmaceutically acceptable salts include, if necessary, salts with non-toxic ammonium, quaternary ammonium and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, C^ sulfonate and arylsulfonate.

Socrystals.

In some embodiments, a co-crystal is used that includes a compound described herein (e.g., a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III) or formula (III')), and a crystal forming agent (CCF).

In some embodiments, a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III) or formula (III') and the CCFs are in a solid state (eg crystalline). In some embodiments, a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III) or formula (III') and the CCFs are non-covalently bonded (eg via hydrogen bonds).

In some embodiments, a co-crystal of a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III ) or formula (III') and CCF (eg adipic acid, citric acid, fumaric acid, maleic acid, succinic acid or benzoic acid) is solid at room temperature. In some embodiments, a co-crystal of a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III ) or formula (III') and CCF (eg, adipic acid, citric acid, fumaric acid, maleic acid, succinic acid or benzoic acid) are non-covalently bonded. In some embodiments, non-covalent bonds between a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III) or formula (III'), and CCF (eg, adipic acid, citric acid, fumaric acid, maleic acid, succinic acid or benzoic acid) include hydrogen bonds and/or van der Waals interactions.

In some embodiments, the crystal forming agent (CCF) is adipic acid, citric acid, fumaric acid, maleic acid, succinic acid, or benzoic acid.

In some embodiments, the implementation of the co-crystal is a co-crystal, which is described in international publication WO 2015/058067, the contents of which are fully incorporated into this application by reference.

In some embodiments, the co-crystal comprises (5)-H-methyl-8-(1-(2'-methyl-[4,5'bipyrimidin]-6-yl)amino)propan-2-yl)quinoline-4-carboxamide . In some embodiments, the compound is the (+) enantiomer. In some embodiments, the compound is the (-) enantiomer.

In some embodiments, the co-crystal comprises (5)-N-methyl-8-(1-(2'-methyl-4,6'dideutero-[4,5'-bipyrimidin]-6-yl)amino)propan-2- yl) quinoline-4-carboxamide. In some embodiments, the compound is the (+) enantiomer. In some embodiments, the compound is the (-) enantiomer.

In some embodiments, a co-crystal is used that includes a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III') , formula (III) or formula (III'), (ie, for example, any of compounds 1-37), and citric acid as CCF.

In some embodiments, the invention relates to a co-crystal that includes a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III '), formula (III) or formula (III'), (ie, for example, any of compounds 1-37), and fumaric acid as CCF.

In some embodiments, a co-crystal is used that includes a compound

- 39 042641 represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III') or formula (III') (eg any of compounds 1-37) and maleic acid as CCF.

In some embodiments, a co-crystal is used that includes a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III') , formula (III') or formula (III') (ie, for example, any of the compounds 137), and succinic acid as CCF.

In some embodiments, a co-crystal is used that includes a compound represented by structural formula (I), formula (II), formula (II'), formula (II'), formula (II'), formula (III), formula (III' ), formula (III) or formula (III') (ie, for example, any of compounds 1-37), and benzoic acid as CCF.

In some embodiments, a co-crystal is used that includes a compound represented by structural formula (I), formula (II), formula (II'), formula (II'), formula (II'), formula (III), formula (III' ), formula (III) or formula (III') (ie, for example, any of compounds 1-37), and adipic acid as CCF.

In some embodiments, a co-crystal is used that includes a compound represented by structural formula (I), formula (II), formula (II'), formula (II'), formula (II'), formula (III), formula (III' ), formula (III) or formula (III') (i.e., for example, any of compounds 1-37), and the CCF described above in isolated pure form, or as a mixture, such as a solid composition obtained when mixed with other materials, for example, compounds represented by the structural formula (I), formula (II), formula (II'), formula (II'), formula (II'), formula (III), formula (III') , formula (III) or formula (III') (ie, for example, any of compounds 1-37), in free form, or free CCF.

In some embodiments, pharmaceutically acceptable compositions comprising a co-crystal of a compound represented by structural formula (I), formula (II), formula (II'), formula (II'), formula (II'), formula (III), formula ( III'), formula (III) or formula (III') (i.e., for example, any of compounds 1-37), and the first CCF (for example, described here) and one or more additional free CCFs, which may be the same or different from the first CCF. In some embodiments, the composition comprises a co-crystal of a compound represented by structural formula (I), formula (II), formula (II'), formula (II'), formula (II'), formula (III), formula (III'), formula (III) or formula (III') (ie, for example, any of compounds 1-37), the first CCF, which is adipic acid, and additional adipic acid. In some embodiments, the total molar ratio of a compound represented by structural formula (I), formula (II), formula (II'), formula (II'), formula (II'), formula (III), formula (III'), formula (III) or formula (III') (i.e., for example, any of compounds 1-37), and CCF (for example, all CCFs, including the first CCF (for example, as described here, and one or more additional free CCF) in such compositions ranges from about 1:0.55 to about 1:100. In some embodiments, the total molar ratio of a compound represented by structural formula (I), formula (II), formula (II'), formula ( II'), formula (II'), formula (III), formula (III'), formula (III), or formula (III') (i.e., for example, any of compounds 1-37), and CCF in such compositions range from about 1:0.55 to about 1:50.In some embodiments, the total molar ratio of the compound represented by structural formula (I), formula (II), formula (II'), formula (II') , formula (II'), formula (III), formula (III'), formula (III) or formula (III') (i.e., for example, any of compounds 1-37), and CCF in such compositions is in the range from about 1:0.55 to about 1:10. In some embodiments, the total weight ratio of the compound of formula I and CCF in such compositions is in the range from about 85:15 wt.% to about 60:40 wt.%. In some embodiments, the total weight ratio of a compound represented by structural formula (I), formula (II), formula (II'), formula (II'), formula (II'), formula (III), formula (III'), formula (III) or formula (III') (ie, for example, any of compounds 1-37), and CCF is approximately 65:35 wt.%.

DNA-RK inhibitors to improve the efficiency of genome editing.

The efficiency of targeted genome editing can be increased by introducing into the cell(s) one or more of the compounds (eg, PK DNA inhibitors) described herein and the genome editing system. Genome editing systems suitable for use include, for example, a meganuclease based system, a zinc finger nuclease (ZFN) based system, a transcriptional activator-like effector nuclease (TALEN) based system, a CRISPR based system, or an NgAgo based system. The methods, compositions and kits of the present invention provide DNA-PK inhibitors and/or a genome editing system with improved genome editing efficiency. In some embodiments, the efficiency of editing the HDR genome is increased after the introduction of a DNA-PK inhibitor into the cell(s).

In some embodiments, the genome editing system is a system

- 40 042641 genome editing based on CRISPR. The CRISPR-based genome editing system may be the CRISPR-Cas system or variants thereof. The CRISPR-Cas system can use any Cas endonucleases such as Cas9 endonucleases and variants thereof. Examples of Cas9 endonucleases include Cas9 endonucleases or variants thereof such as SaCas9, SpCas9, SpCas9n, Cas9-HF, Cas9H840A, FokI-dCas9 or CasD10A nickase. The Cas endonuclease can be wild-type, engineered, mutated nickase, or any of their variants.

In some embodiments, a CRISPR-based genome editing system includes a CRISPR sequence, a transactivation (ta) sequence, a targeting sequence, and a Cas endonuclease, or any combination thereof.

In some embodiments, a CRISPR-based genome editing system includes an RNA containing a CRISPR sequence (crPHK), an RNA containing a transactivating (ta) sequence (taRNA), and a Cas endonuclease, or any combination thereof.

In some embodiments, a CRISPR-based genome editing system includes a CRISPR sequence, a targeting sequence, and a Cas endonuclease or Cpf endonuclease, or any combination thereof.

In some embodiments, the CRISPR-based genome editing system is a CRISPR-Cpf system. The Cpf nuclease is a class 2 endonuclease of the CRISPR-Cas system. Cpf is a single-stranded RNA-directed endonuclease. The Cpf nuclease may be a wild-type endonuclease, an engineered endonuclease, or a nickase mutant, or any variant thereof; see, for example, Zetsche et al., CPF1 is a single RNA-guided endonuclease of a Class 2 CRISPR-Cas System, Cell, 163(3): 759-71. In some embodiments, the Cpf nuclease is a Cpf 1 endonuclease.

In some embodiments, the genome editing system is a meganuclease based system. For genome editing, the meganuclease-based system uses sequence-specific endonucleases that recognize large sites on the target DNA (eg, typically approximately >12 base pairs); see, for example, US Pat. No. 9,365,964. Meganucleases can cleave unique chromosomal sequences without affecting the overall integrity of the genome. In some embodiments, the meganuclease may be a homing endonuclease. In some embodiments, the meganuclease may be an intron endonuclease or an intein endonuclease. Homingendonucleases may belong to the LAGLIDADG family. The meganucleases can be wild-type, engineered meganucleases, or nickase mutants.

In some embodiments, the gene editing system is a zinc finger nuclease (ZFN) based system. ZFN is an artificial restriction enzyme constructed by fusion of a zinc finger DNA binding domain and a DNA cleavage domain (see, for example, US Pat. No. 9,145,565).

In some embodiments, the gene editing system is a transcription activator-like effector nuclease (TALEN) activator. TALEN systems are engineered restriction enzymes that are prepared by fusing the effector DNA DNA binding domain with the DNA cleavage domain (see, for example, US Pat. No. 5,918,535).

In some embodiments, the gene editing system is an Argonaute based system. Argonaute based gene editing systems include Argonaute derived endonuclease and 5'-phosphorylated ssDNA. In some embodiments, the phosphorylated ssDNA may be 10-40 nucleotides, 15-30 nucleotides, or 1830 nucleotides in length (eg, about 24 nucleotides). In some embodiments, the Argonaute endonuclease may be any endonuclease. In some embodiments, the Argonaute endonuclease is derived from Thermus thermophiles (TttAgo), Pyrococcus Furiosus (PfAgo), or Natrobacterium gregoryi (NgAgo). In some embodiments, Natrobacterium gregoryi (NgAgo) is strain 2 (i.e., N. gregoryi SP2). In some embodiments, the Argonaute endonuclease is NgAgo; see, for example, Gao et al. DNA-guided genome editing using the Natronobacterium gregoryi Argonaute, Nature Biotechnology, May 2016.

The DNA-RK inhibitors can be any DNA-RK inhibitor. A PK-DNA inhibitor can be any compound or substance that causes PK-DNA inhibition. The DNA-PK inhibitor can be a compound, a small molecule, an antibody, or a nucleotide sequence. In some embodiments, the PK DNA inhibitors are compounds represented by structural formula I or structural formula II. In some embodiments, the PK DNA inhibitors are compounds represented by structural formula I' or structural formula II'. In some embodiments, the PK DNA inhibitor is any of compounds 1-37. In some embodiments, the DNA-PK inhibitor is a co-crystal that includes any of Compounds #1-37 and adipic acid.

In some embodiments, the PKDNA inhibitor is any of Compound Nos. 1-37, or combinations thereof.

In some embodiments, any NHEJ inhibitor can be used to increase the efficiency of HDR genome editing. In some embodiments, the inhibitor

NHEJ is any of compounds #1-37 or a combination thereof.

In some embodiments, the implementation of the NHEJ inhibitor can be any compound or substance that causes inhibition of NHEJ. Examples of an NHEJ inhibitor include DNA-PK inhibitors. The NHEJ inhibitor may be a compound, a small molecule, an antibody, or a nucleotide sequence. In some embodiments, NHEJ inhibitors are compounds represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III), or formula (III'), or their pharmaceutically acceptable salts, or their co-crystals. In some embodiments, the implementation of the NHEJ inhibitor is any of the compounds No. 1-37 or a combination thereof.

In some embodiments, the increased genome editing efficiency is about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold fold, 50-fold, or 100-fold increase compared to the state when the cell(s) are not injected with a DNA-PK inhibitor and the genome editing system, or compared to the state when only the genome editing system is introduced into the cell(s) without DNA-RK inhibitor.

The use of DNA-RK inhibitors, compositions and kits containing them.

In some embodiments, the present invention provides methods for sensitizing a cell to a therapeutic agent or sensitizing a disease state that induces DNA damage, comprising the step of contacting the cell with one or more DNA-PK inhibitors described herein, such as compounds represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III) or formula (III'), or their pharmaceutically acceptable salts, or their co-crystals.

In some embodiments, the invention provides methods for increasing the effectiveness of a therapeutic regimen for treating cancer, comprising the step of administering to an individual in need thereof an effective amount of a PK DNA inhibitor described herein, such as a compound represented by structural formula (I), formula (II), formula ( II'), formula (II), formula (II'), formula (III), formula (III) or formula (III'), or a pharmaceutically acceptable salt or co-crystal thereof. In one aspect, the therapeutic regimen for cancer treatment includes radiation therapy.

The DNA-PK inhibitors described herein are useful when radiation therapy is used to enhance the therapeutic effect of such treatment. In addition, radiation therapy is often prescribed as an adjuvant therapy in the surgical treatment of cancer. The goal of radiotherapy in adjuvant therapy is to reduce the risk of recurrence and increase survival while controlling the primary tumor. Adjuvant radiotherapy is indicated for a number of conditions including colon cancer, rectal cancer, lung cancer, gastroesophageal cancer, and breast cancer, as described below.

Another anti-cancer chemotherapeutic agent may be used with the DNRC inhibitor described herein as part of a cancer therapeutic regimen, with or without radiation therapy. The combination of the DNA-PK inhibitor disclosed herein with other agents may enhance the chemotherapeutic effect. For example, etoposide or bleomycin can be administered together with the PKDNA inhibitor described herein, i. e. agents known to cause DNA strand breakage.

In addition, radiosensitizing tumor cells that use DNA-PK inhibitors are described here. A DNA-PK inhibitor that can radiosensitize a cell as used herein is defined as a molecule, preferably a low molecular weight molecule, administered to animals in a therapeutically effective amount to increase the sensitivity of cells to electromagnetic radiation and/or to aid in the treatment of electromagnetically treatable diseases. radiation (for example, x-rays). Diseases that can be treated with electromagnetic radiation include neoplastic diseases, benign and malignant tumors, and cancer cells.

Also provided are methods of treating cancer in an animal comprising administering to the animal an effective amount of a PK DNA inhibitor as described herein, such as, for example, a compound of the invention. The invention also relates to methods for inhibiting the growth of cancer cells, including the processes of cell proliferation, invasiveness and metastasis in biological systems. The methods include using a compound of the invention as a cancer cell growth inhibitor. The methods are preferably used to inhibit or reduce cancer cell growth, invasiveness, metastasis, or tumor initiation in living animals such as mammals. the compounds of the invention may be used either alone or in combination using an IR or one or more chemotherapeutic agents to treat cancer or inhibit the growth of cancer cells. The methods of the invention are also readily adaptable for use in assay systems, for example, assaying cancer cell growth and characterization, as well as identifying compounds that affect cancer cell growth.

Tumors or neoplasms involve the growth of tissue cells where cell reproduction is uncontrolled and progressive. Some of these growths are benign, but others are called malignant, and they can lead to the death of the body. Malignant neoplasms or cancers differ from benign neoplasms in that, in addition to exhibiting aggressive cell proliferation, they can invade surrounding tissues and metastasize. In addition, malignant neoplasms differ in that they exhibit a higher loss of differentiation (higher differentiation) and organization in relation to each other and their surrounding tissues. This property is also called anaplasia.

Neoplasms treatable according to the present invention also include solid tumors, ie carcinomas and sarcomas. Carcinomas include malignant neoplasms derived from epithelial cells that infiltrate (invade) surrounding tissues and cause metastases. Adenocarcinomas are carcinomas derived from glandular tissue or from tissues that form glandular structures. Another broad category of malignant tumors includes sarcomas, which are tumors whose cells are encased in a fibrillar or homogeneous substance such as fetal connective tissue. The invention also makes it possible to treat malignant tumors of the myeloid or lymphoid systems, including leukemias, lymphomas and other malignant tumors, which are not usually present as a tumor mass but are distributed in the vascular or lymphoreticular systems.

DNA-RK activity may be associated with effects on various forms and types of cancer, for example, in oncology of adults and children, with the growth of solid tumors / malignant neoplasms, with myxoid and round cell carcinoma, locally advanced tumors, metastatic cancer, human soft tissue sarcomas including Ewing's sarcoma, cancer metastases, including lymphatic metastases, squamous cell carcinoma, in particular head and neck cancer, esophageal squamous cell carcinoma, oral cavity cancer, malignant neoplasms of blood cells, including multiple myeloma, leukemia, including acute lymphocytic leukemia, acute non-lymphocytic leukemia , lymphocytic leukemia, chronic myelocytic leukemia and hairy cell leukemia, effusion lymphomas (lymphomas in body cavities), thymic lymphoma, lung cancer including small cell lung carcinoma, cutaneous T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, adrenal cortex cancer, ACTH -producing tumors, non-small cell carcinoma, breast cancer including small cell carcinoma and ductal carcinoma, gastrointestinal cancers including gastric cancer, colon cancer, colorectal cancer, polyps associated with colorectal neoplasia, pancreatic cancer, liver cancer, urological types cancer, including bladder cancer, including primary superficial bladder tumors, invasive transitional cell carcinoma of the bladder and invasive bladder muscle cancer, prostate cancer, malignant neoplasms of the female genital tract, including ovarian carcinoma, primary peritoneal epithelial neoplasms, carcinoma of the cervix, uterine endometrial cancer, vaginal cancer, vulvar cancer, uterine cancer and solid tumors in the ovarian follicle, malignant neoplasms of the male reproductive tract, including testicular cancer and penile cancer, kidney cancer, including renal cell carcinoma, brain cancer, including internal brain tumors , neuroblastoma, astrocytic brain tumors, gliomas, invasion of metastatic tumor cells into the central nervous system, bone cancer, including osteomas and osteosarcomas, skin cancer, including malignant melanoma, tumor growth of human skin keratinocytes, squamous cell carcinoma, thyroid cancer, retinoblastoma, neuroblastoma , peritoneal effusion, malignant pleural effusion, mesothelioma, Wilms tumor, gallbladder cancer, trophoblastic neoplasms, hemangiopericytoma, and Kaposi's sarcoma. Methods for improving the effectiveness of the treatment of these and other forms of cancer are covered by the present invention.

The invention also relates to a method for inhibiting PK DNA activity in a biological sample, wherein the method comprises contacting the biological sample with a compound or composition of the invention. The term biological sample as used herein means a sample outside of a living organism and includes, without limitation, cell cultures or extracts thereof; biopsy material obtained from a mammal or their extracts; as well as blood, saliva, urine, feces, semen, tears or other body fluids or their extracts. Inhibition of kinase activity, in particular DNA-RK activity, in a biological sample is useful for a variety of purposes known to those skilled in the art. Examples of such purposes include, without limitation, storage of biological samples and biological assays. In one embodiment, the method of inhibiting PK DNA activity in a biological sample is limited to non-therapeutic methods.

Application for genome editing.

Genome editing, which precisely modifies specific genomic regions, has great therapeutic potential.

In some embodiments, the present invention provides methods for editing one or more target genomic regions to repair a DNA break. In one or more target genomic regions using the HDR pathway to inhibit or repress NHEJ-mediated DNA break repair in one or more target genomic cells, and to modify the expression of one or more genes or proteins by introducing into the cell(s) the system genome editing and DNA-PK inhibitor.

In some embodiments, the present invention provides methods for modifying the expression of one or more genes or proteins, including introducing into one or more cells that contain one or more target genomic regions, genome editing systems, and a DNA-PK inhibitor described herein, where the genome editing system interacts with the nucleic acid(s) of one or more target genomic regions of the target gene(s), resulting in editing of one or more target genomic regions, and where the editing modifies the expression of the downstream gene(s) and/or protein(s) associated with the target genome(s).

The genome editing system can be any genome editing system that can edit a target genomic region in a cell(s). Exemplary genome editing systems are detailed above and may include, for example, a meganuclease-based system, a zinc finger nuclease (ZFN) system, a transcription activator-like effector nuclease (TALEN) system, a CRISPR-based system, or an NgAgo-based system. . Editing one or more target genomic regions includes any kind of genetic manipulation or genetic engineering of a cell's genome. Editing one or more target genomic regions may include insertions, deletions, or substitutions of genomic regions in the cell(s) performed by one or more endonucleases. Genomic regions include the genetic material in the cell(s), such as DNA, RNA, polynucleotides, and oligonucleotides. Genomic regions within a cell(s) also include the genomes of the mitochondria or chloroplasts contained within the cell(s).

The DNA-RK inhibitor can be any DNA-RK inhibitor. A PK-DNA inhibitor can be any compound or substance that causes PK-DNA inhibition. The DNA-PK inhibitor can be a compound, a small molecule, an antibody, or a nucleotide sequence. In some embodiments, the DNA-PK inhibitors are compounds represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III') , formula (III) or formula (III'). In some embodiments, the implementation of the DNA-PK inhibitor is any of the compounds No. 1-37. In some embodiments, the DNA-PK inhibitor is a co-crystal that includes any of Compounds #1-37 and adipic acid. In some embodiments, the implementation of the ratio of adipic acid and any of the compounds No. 1-37 is from about 5 to 0.5, or has any value within this range. In some embodiments, the implementation of the ratio of adipic acid and any of the compounds No. 1-37 is from about 4 to 0.5, or has any value within this range. In some embodiments, the implementation of the ratio of adipic acid and any of the compounds No. 1-37 is from about 3 to 0.5, or has any value within this range. In some embodiments, the ratio of adipic acid and any of the compounds No. 1-37 is from 2 to 0.5, or has any value within this interval. In some embodiments, the implementation of the ratio of adipic acid and any of the compounds Nos. 1-37 is from about 2 to 1.0, or has any value within this interval. In some embodiments, the NHEJ inhibitor is a compound represented by structural formula (I), formula (II), formula (II'), formula (II), formula (II'), formula (III), formula (III'), formula (III) or formula (III'), or any combination thereof.

In some embodiments, methods of treating a subject having a disease or condition in need of editing one or more target genomic regions in the subject's cell(s) are provided, comprising administering a genomic editing system and a DNA-PK inhibitor to one or more cells.

In some embodiments, the methods provided herein are used to modify the expression of a gene, RNA molecule, protein, group of proteins, or downstream proteins. Such a modification can be used to treat disease, dysfunction, abnormal body homeostasis, acquired or inherited, or caused by the aging process. The term modify or modification as used herein includes modulation, amplification, reduction, increase, insertion, deletion, knockout, knocking, and the like.

Those skilled in the art will appreciate that diseases, whether acquired or inherited or otherwise, involve dysregulation of homeostatic mechanisms, including gene involvement or protein function. To this end, one of skill in the art may use the methods provided herein to modulate, modify, enhance, reduce, or otherwise provide a gene function in a subject.

Modifying gene expression and subsequent protein expression in the cell(s) can be achieved by the methods described herein, for example by specific editing (for example,

- 44 042641 substitutions, insertions, deletions, or any combination thereof) of a nucleic acid sequence at any location, including exon, intron, transcription initiation site, promoter region, enhancer region, silencer region, separation region, antirepressor, post-translational regulatory element, polyadenylation signal ( eg, minimal poly A), a conserved region, a transcription factor binding site, or any combination thereof.

In some embodiments, the methods, kits, and compositions provided herein are used to treat a subject who has cancer. A method of treating a subject having cancer or a cancer-related condition comprises administering to the subject's cell(s) a PKDNA inhibitor and a genome editing system. The administration of the DNA-PK inhibitor and the genome editing system can be performed in vivo or ex vivo.

Cancer can refer to any type of cancer. Cancer includes solid tumors such as breast, ovarian, prostate, lung, kidney, stomach, colon, testicle, head and neck, pancreas, brain, melanoma and other tumors of tissue organs and blood cell malignancies such as lymphomas and leukemias, including acute myelogenous leukemia, chronic lymphocytic leukemia, T-cell lymphocytic leukemia, and B-cell lymphomas. Malignancies may include melanoma, leukemia, astocytoma, glioblastoma, lymphoma, glioma, Hodgkin's lymphoma, chronic lymphocytic leukemia, and cancer of the pancreas, breast, thyroid, ovary, uterus, testicle, pituitary, kidney, stomach, esophagus, and rectum.

In some embodiments, the methods, kits, and compositions provided herein are used to treat a subject suffering from one or more of the following cancers: acute lymphoblastic leukemia (ALL), acute myeloid leukemia, adrenocortical carcinoma, AIDS-associated cancer, lymphoma AIDS-related, anal cancer, appendix cancer, astrocytoma, childhood cerebellum or cerebral cancer, basal cell carcinoma, bile duct cancer, extrahepatic carcinoma (cholangiocarcinoma), bladder cancer, bone tumor, osteosarcoma/malignant fibrous histiocytoma, brainstem glioma , brain tumor, cerebellar astrocytoma, brain tumor, cerebral astrocytoma/malignant glioma, brain tumor, ependymoma, brain tumor, medulloblastoma, brain tumor, supratentorial primitive neuroectodermal tumors, brain tumor, optic pathway glioma and hypothalamic glioma/ carcinoid, breast cancer, Burkitt's lymphoma, carcinoid tumor, tumors of childhood, carcinoid tumor, tumors of the gastrointestinal tract, primary carcinoma of unknown origin, primary lymphoma of the central nervous system, cerebellar astrocytoma, tumors of childhood, cerebral astrocytoma/malignant glioma, tumors of childhood age, cervical cancer, childhood cancers, chondrosarcoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disease, colon cancer, cutaneous T-cell lymphoplastic tumour, endometrial cancer, ependymoma, epithelioid hemangioendothelioma (EHE), esophageal cancer, sarcoma Ewing in the Ewing tumor family, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, eye cancer, retinoblastoma, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor: extracranial, extragonadal or ovarian, gestational trophoblastic tumor, brainstem glioma, glioma, pediatric brain astrocytoma, glioma, tumors of the visual pathways and hypothalamus in children, gastric carcinoid, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular carcinoma (liver cancer), Hodgkin's lymphoma, laryngeal cancer, glioma of the hypothalamic and visual pathways in children, intraocular melanoma, islet cell carcinoma (endocrine tumor of the pancreas), Kaposi's sarcoma, kidney cancer (renal cell carcinoma), laryngeal cancer , leukemias, leukemias, acute lymphoblastic leukemia (also called acute lymphocytic leukemia), acute myeloid leukemia (also called acute myelogenous leukemia), leukemia, chronic lymphocytic leukemia (also called chronic lymphocytic leukemia), chronic myelogenous leukemia (also called chronic myeloid leukemia) hairy cell, lip and mouth cancer, liposarcoma, liver cancer (primary), lung cancer, non-small cell lung cancer, small cell lung cancer, lymphomas, AIDS-related leukemias, Burkitt's lymphoma, cutaneous T-cell lymphoma, Hodgkin's lymphomas, non-Hodgkin's lymphoma ( old classification of all lymphomas except Hodgkin's lymphoma), primary central nervous system macroglobulinemia, Waldenstrom macroglobulinemia, male breast cancer, malignant fibrous bone histiocytoma/osteosarcoma, medulloblastoma, childhood melanoma, melanoma, intraocular (eye) cancer, Merkel cell cancer, mesothelioma , malignant mesothelioma in adults, malignant mesothelioma in children, metastatic squamous cell carcinoma of the neck with a latent primary form, cancer of the mouth, multiple endocrine neoplasia syndrome, multiple myeloma/plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes, myelodysplastic/myeloproliferative diseases, myelogenous leukemia, chronic myeloid leukemia, acute myeloid leukemia in adults, acute myeloma in children, multiple myeloma (cancer of the bone marrow), myeloproliferative diseases of the nasal sinuses, chronic paranasal myxo

- 45 042641 ma, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oligodendroglioma, oral cavity cancer, oropharyngeal cancer, osteosarcoma/malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer (ovarian surface epithelium cancer), embryonic cell tumor ovarian tumor, low potential ovarian tumor, pancreatic cancer, pancreatic islet cell cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary adenoma, plasma cell neoplasia/multiple myeloma, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (kidney cancer), pelvis and ureter cancer, transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, Ewing family tumors, Kaposi's sarcoma, soft tissue sarcoma, uterine sarcoma, Cesari syndrome, skin cancer (non-melanoma), skin cancer (melanoma), skin carcinoma, Merkel cell, small cell lung cancer, small intestine cancer , soft tissue sarcoma, squamous cell carcinoma (non-melanoma skin cancer), neck squamous cell carcinoma with occult primary metastatic tumor, gastric cancer, supratentorial primitive neuroectodermal tumor, T-cell lymphoma, skin cancer (fungal mycosis and Cesari syndrome), cancer testicular cancer, throat cancer, thymoma, thymoma and carcinoma of the thymus, thyroid cancer, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, gestational trophoblastic tumor, unknown primary site carcinoma in adults, unknown primary site cancer, tumors of childhood, cancer ureter and renal pelvis, transitional cell carcinoma, urethral cancer, uterine cancer, endometrial cancer, uterine sarcoma, vaginal cancer, glioma of the optic pathway and hypothalamus, vulvar cancer, Waldenström macroglobulinemia, or Wilms' tumor (kidney cancer).

In some embodiments, illustrative target genes associated with cancer include the following genes:

AVA, ABL2, ACSL3, AF15Q14, AF1Q, AF3p21, AF5q31, AKAR9, A ΤΙ, ACT2, ALDH2, AL, AL017, APC, ARHGEF12, ARHH, ARID1A, ARID2, ARNT, ASPSCR1, ASXL1, ATF1, ATIC, ATM, ATRX BCL11A BUB1B, C12orf9, C15orf21, C15orf55, C16orf75, C2orf44, CAMTAI, CANT1, CARD11, CARS, CBFA2T1, CBFA2T3, C BFB, CBL, CBLB, CBLC, CCDC6, CCNB1IP1, CCND1, CCND2, CCND3, CCNE1,7 , CD79A, CD79B, CDH1, CDH11, CDK12, CDK4, CDK6, CD N2A, CD N2a(pl4), CD N2C, CDX2, SEVRA, CEP1, CHCHD7, CHEK2, CHIC2, CHN1, CIC, Cin A, CLTC, CLTCL1, CMKOR1, CNOT3, COLI Al, COREV, COX6C, CREB1, CREB3L1, CREB3L2, CREBBP, CRLF2, CRTC3, CTNNB1, CYLD, D10S170, DAXX, DDB2, DDIT3, DDX10, DDX5, DDX6, DEK, D1CER1, DNM2, DNMT3A, DUX4 , EBFI, ECT2L, EGFR, E1F4A2, ELF4, ELK4, ELKS, ELL, ELN, EML4, EP300, EPS 15, ERBB2, ERCC2, ERCC3, ERCC4, ERCC5, ERG, ETV1, ETV4, ETV5, ETV6, EVI1, EWSR1, EXT1, EXT2, EZH2, EZR, FACL6, FAM22A, FAM22B, FAM46C, 1ANCA, EANCC, FANCD2, FANCE, FANCF, FANCG, FBXO1 1, FBXW7, FCGR2B, FEV, FGFR1, FGFRIOP, FGFR2, FGFR3, FTI, FIIIT, FIP1L1 , FLU, FLJ27352, FLT3, FNBP1, FOXL2, FOXOIA, FOX03A, FOXP1, FSTL3, FUBP1, FUS, FVT1, GAS7, GATA1, GATA2, GATA3, GMPS, GNA11, GNAQ, GNAS, GOLGA5, GOPC, GPC3, GPHN, GRAF , H3F3A, IICMOGT-1, IIEAB, HERPUD1, IIEY1, IIIP1, HIST1IT3B, IIIST1II4I, IILF, HLXB9, HMGA1, HMGA2, HNRNPA2BI, NPPO, HOXA11, HOXA13, HOXA9, HOXC11, HOXC13, HOXD11, HOXD13, HRAS, ICAIRPT2 , HSPCB, IDH1, SHN2, IGH, IGK, IGL, IKZF1, IL2, TL21R, IL6ST, IL7R, IRF4, IRTA1, ITK, JAKI, JAK2, JAK3, JAZF1, JUN, KCNJ5, KDM5A, KDM5C, KDM6A, KDR, KIAA1549 , KIF5B, KIT, KLF4, KLK2, KRAS, KTN1, LAF4, LASPI, LCK, LCP1, LCX, LHFP, LIFR, LMO1, LM02, LPP, LRIG3, LYL1, MADH4, MAF, MAFB, MALT1, MAML2, MAP2KL MAP2K2, ΜλΡ2Κ4, MAX, MDM2, MDM4, MDS1, MDS2, MECT1, MED12, MEN1, MET, MITF, MKL1, MLF1, MLII1, MLL, MLL2, MLL3, MLLT1, MLLT10, MLLT2, MLLT3, MLLT4, MLLT6, MLLT7, MN1, MPL, MSF, MSH2, MSH6, MSI2, MSN, MTCP1, MUC1, MUTYH, MYB, MYC, MYCL1, MYCN, MYD88, MYH11, MYH9, MYST4, NACA, NBS1, NCOA1, NCOA2, NCOA4, NDRG1, NF1, NF2, NFE2L2, NFIB, NFKB2, NIN, NKX2-1, NONO, NOTCH I, NOTCH2, NPM1, NR4A3, NRAS, NSD1, NT5C2, NTRK1, NTRK3, NUMA1, NUP214, NUP98, OLIG2, OMD, P2RY8, PAFAH1B2, PALB 2, PAX3, PAX5, PAX7, PAX8, PBRM1, PBX1, PCM1, PCSK7, PDE4DIP, PDGFB, PDGFRA, PDGFRB, PERI, PIIF6, PHOX2B, PICALM, PIK3CA, PIK3R1, PIM1, PLAG 1, PML, PMS1, PMS2, PMX1, PNUTL1 , POTI, POU2AF1,

- 46 042641

POU5F1, PPARG, PPP2R1A, PRCC, PRDM1, PRDM16, PRF1, PRKAR1 A, PRO1073, PSIP2, PTCH, PTEN, PTPN11, RAB5EP, RAC1, RAD51L1, RAFI, RALGDS, RANBP17, RAPIGDSI, RARA, RBI, RBM15, RECQL4, REL , RET, RNF43, ROS1, RPL10, RPL22, RPL5, RPN1, RUNDC2A, RUNX1, RUNXBP2, SBDS, SDC4, SDH5, SDHB, SDHC, SDHD, SEPT6, SET, SETBP1, SETD2, SF3B1, SFPQ, SFRS3, SH2B3, SH3GL1 , SIL, SLC34A2, SLC45A3, SMARCA4, SMARCB1, SMARCE1, SMO, S0CS1, SOX2, SRGAP3, SRSF2, SSI8, SS18L1, SSH3BP1, SSX1, SSX2, SSX4, STAT3, STK11, STL, SUFU, SUZ12, SYK, TAF15, TALI , TAL2, TCEA1, TCF1, TCF12, TCF3, TCF7L2, TCL1A, TCL6, TERT, TET2, TFE3, TFEB, TFG, TFPT, TFRC, THRAP3, TIF1, TLX1, TLX 3, TMPRSS2, TNFAIP3, TNFRSF14, TNFRSF17, TNFRSF6, TOPI, TP53, TRMZ, TPM4, TPR, TRA, TRAF7, TRB, TRD, TRIM27, TRIM33, TRIP11, TSC1, TSC2, TSHR, TTL, U2AF1, USP6, VHL, VTUA, WAS, WHSCI, WHSC1L1, WIFI, WRN, WT1, WTX, WWTR1, XPA, XPC, XPO1, YWHAE, ZNF145, ZNF198, ZNF278,

ZNF331, ZNF384, ZNF521, ZNF9, ZRSR2 or any combination thereof.

In some embodiments, the methods provided herein are used to treat a subject who has a hereditary disorder. A method of treating a subject having a genetic disease or condition or hereditary disorder comprises administering to the subject's cell(s) a DNA-PK inhibitor and a genome editing system. Administration of the DNA-PK inhibitor and the genome editing system can be done in vivo or ex vivo.

An inherited disorder may result from mutations or duplications in chromosomal regions (eg, from point mutations, deletions, insertions, frameshifts, duplications or deletions of chromosomes). The hereditary disease can be any hereditary disease.

In some embodiments, the hereditary disease is 22q11.2 deletion syndrome, Angelman syndrome, Canavan disease, Charcot-Marie-Tooth disease, color blindness, crying cat syndrome, Down syndrome, Duchenne muscular dystrophy, hemochromatosis, hemophilia, Klinefelter syndrome, neurofibromatosis, phenylketonuria, polycystic kidney disease, Prader-Willi syndrome, sickle cell anemia, spinal muscular atrophy, spinal atrophy, Tay-Sachs disease, Turner syndrome, hemoglobinopathy, or any combination thereof.

In some embodiments, the inherited disorder is 1p36 deletion syndrome, 18p deletion syndrome, 21-hydroxylase deficiency, 47-XXX (triple X syndrome), 47XXY (Klinefelter syndrome), 5-ALA dehydratase-deficient porphyria, ALA dehydratase deficiency, porphyria with 5-aminolevulinic dehydratase deficiency, 5p deletion syndrome, crying cat syndrome (AKA 5p syndrome), telangiectatic ataxia (AKA A-T), alpha 1-antitrypsin deficiency (AAT), aceruloplasminemia, type II adrogenesis (ACG2), chondroplasia ( ACH), acid beta-glucosidase deficiency, Gaucher disease (any type, e.g. type 1, type 2, type 3), acrocephalosyndactyly (Apert's disease), Apert syndrome, acrocephalosyndactyly (any type, e.g. type 1, type 2, type 3, type 5), Pfeiffer syndrome, acrocephaly, acute cerebral Gaucher disease, acute intermittent porphyria, (AIP) ACY2 deficiency, Alzheimer's disease (AD), Muencke's syndrome, adenomatous colipolyposis, familial adenomatous polyposis, adenomatous colon polyposis, familial adenomatous polyposis (ADP), adenylsuccinate lyase deficiency, adrenal disorders, adrenogenital syndrome, adrenoleukodystrophy, androgen insensitivity syndrome (AIS), alkaptonuria (AKU), ALA-dehydratase porphyria, ALA-D-porphyria, ALA-dehydratase deficiency, Alagille syndrome, albinism , alcaptonuria, Alexander disease, alkaptonuria, alkaptonuric ochronosis, alcaptonuria, alpha 1-proteinase inhibitor-associated disease, emphysema, alpha-galactosidase A deficiency, Fabry disease, Ahlström syndrome, Alexander disease (ALX), amelogenesis imperfecta, dehydratase deficiency aminolevulinic acid, aminoacylase 2 deficiency, Canavan disease, Anderson-Fabry disease, androgen insensitivity syndrome, anemia, hereditary sideroblastic anemia, X-linked sideroblastic anemia and/or familial anemia, diffuse angiokeratoma, angiokeratoma corporis diffusum, retinal angiomatosis, disease von HippelLindau, Leiden-type ARS resistance, Leiden-type factor V thrombophilia, Apert syndrome, AR insufficiency, androgen insensitivity syndrome, Charcot-MarieTooth disease (any type, eg, SMT1, CMTS, SMT2, SMT4, severe early onset of SMT) , arachnodactyly, Marfan's syndrome, ARNSHL, extrasyndromic deafness (autosomal recessive, autosomal dominant, x-linked, or mitochondrial), hereditary progressive arthrophthalmopathy, Stickler's syndrome (eg, COL2A1, COL11A1, COL11A2, COL9A1), congenital arthrochalasis multiplex, Ehlers-Danlos syndrome (eg, by type of hypermobility, by type of arthrochalasia, by type of vascular disease, by type of kyphoscoliosis, by type of dermatosparaxis) Asp deficiency, Aspa deficiency, aspartoacylase deficiency, ataxia-telangiectasia, autism-dementia-ataxia-loss of purposeful hand use syndrome, syndrome Rett, autosomal dominant juvenile ALS, autosomal velocardiofacial syndrome G/BBB, autosomal recessive juvenile ALS type 3, amyotrophic lateral sclerosis (any type, e.g., ALS1, ALS2, ALS3, ALS4, ALS5, ALS5, ALS6, ALS7, ALS8, ALS9, ALS10, ALS11, ALS12, ALS13, ALS14, ALS15, ALS16, ALS17, ALS18, ALS19, ALS20, ALS21, ALS22, FTDALS1, FTDALS2, FTDALS3,

- 47 042641

FTDALS4, FTDALS4, IBMPFD2), autosomal recessive non-syndromic hearing loss, autosomal recessive sensorineural hearing loss and goiter, Pendred syndrome, Alexander disease (AxD), Ayers syndrome, familial pulmonary arterial hypertension, B-variant hexosaminidase Gm2 gangliosidosis, BANF-associated Sandhoff disease disorder, neurofibromatosis (any type, eg, NF1, NF2, schwannomatosis), Beer-Stevenson folded skin syndrome, benign paroxysmal peritonitis, Benjamin's syndrome, beta thalassemia, BH4 deficiency, tetrahydrobiopterin deficiency, bilateral auditory neurofibromatosis, biotinidase deficiency, bladder cancer , bleeding disorders, factor V Leiden thrombophilia, Bloch-Sulzberger syndrome, pigment incontinence, Bloom syndrome, bone disease, Bourneville disease, tuberous sclerosis, brain disease, prion disease, breast cancer, Birt-Hogg-Dube syndrome, brittle bone disease, osteogenesis imperfecta, big toe syndrome, Rubinstein-Taibi syndrome, bronze diabetes, hemochromatosis, bronze cirrhosis, bulbospinal muscular atrophy, X-linked spinal atrophy and bulbar muscular atrophy, Burger-Grutz syndrome, lipoprotein lipase deficiency, familial CADASIL syndrome, chronic granulomatous disease CGD, campomelic dysplasia, familial cancer syndrome, hereditary nonpolyposis colorectal cancer, breast cancer, bladder cancer, carboxylase deficiency, multiple late biotinidase deficiency, feline cry syndrome, cardiofacial Keillor syndrome, ceramidetrihexosidase deficiency, cerebelloretinal angiomatosis, von Hippel-Lindau familial disease, cerebral arteriopathy , синдром CADASIL, церебральную аутосомнодоминантную атериопатию, синдром CADASIL, цереброатрофическую гипераммониемию, синдром Ретта, синдром цереброзидного липидоза, болезнь Шарко, синдром CHARGE, хондродистрофию, синдром хондродистрофии, хондродистрофию с нейросенсорной глухотой, отоспондиломегаэпифизарную дисплазию, несовершенный хондрогенез, синдром хореоатетозного членовредительства с гиперурикемией, синдром Lesch-Nyhan, classical galactosemia, galactosemia, cleft lip and palate, Stickler syndrome (type 1 or type 2), Coffin-Lowry syndrome (CLS), Cockayne syndrome, Coffin-Lowry syndrome, collagenopathy types II and XI, familial nonpolyposis, hereditary non-polyposis colorectal cancer, familial colon cancer, familial adenomatous polyposis, colorectal cancer, complete HPRT deficiency, Lesch-Nyhan syndrome, complete hypoxanthine guanine phosphoribosyltransferase deficiency, compression neuropathy, hereditary neuropathy with a tendency to pressure paralysis, connective tissue disease, conotruncal facial anomaly syndrome, Cooley anemia, beta thalassemia, copper storage disease, Wilson's disease, copper transport disease, Menkes' disease, coproporphyria, hereditary coproporphyria, coproporphyrinogen oxidase deficiency, Cowden's syndrome, SRS insufficiency, craniofacial dysarthrosis, Crouzon's syndrome, craniofacial dysostosis, Crouzon's syndrome, Crohn's disease, fibrostenosis, Crouzon's syndrome, Crouzon's syndrome with acanthokeratodermia, Crouzon's dermoskeletal syndrome, Crouzon's syndrome with acanthosis nigricans, Cockayne's syndrome (CS), Cowden's syndrome, Kurschmann-Batten-Steinert's syndrome, Beer-Stevenson's folded skin syndrome, Beer-Stevenson's folded skin syndrome, insufficiency D-glycerate dehydrogenase, primary hyperoxaluria, macular metaphysis syndrome, Strudwick type spondyloepimetaphyseal dysplasia, Alzheimer's type dementia (DAT), genetic hypercalciuria, Dent's disease, muscular dystrophy (eg, Duchenne and Becker types), deafness with goiter, Pendred's syndrome, retinitis pigmentosa, Usher syndrome, phenylalanine hydroxylase deficiency disease, degenerative nervous diseases, de Grushy syndrome 1, De Grushy syndrome, Dejerine-Sott syndrome, deltaaminolevulinate dehydratase deficiency porphyria, dementia, CADASIL syndrome, demyelinogenic leukodystrophy, Alexander disease, Ehlers-Danlos syndrome of dermatosparactic type , dermatosparaxis, hereditary developmental disorders, distal hereditary motor neuropathy (dHMN), distal hereditary motor neuropathy (eg, DHMN-V), DHTR deficiency, androgen insensitivity syndrome, diffuse globoid sclerosis of the body, Krabbe disease, Die George's syndrome, dihydrotestosterone receptor deficiency , androgen insensitivity syndrome, distal hereditary motor neuropathy, myotonic dystrophy (type 1 or type 2), distal spinal muscular atrophy (any type, including type 1, type 2, type 3, type 4, type 5, type 6), muscular Duchenne/Becker dystrophy, dwarfism (of any kind, e.g., chondroplastic dysplasia, achondroplasia, thanatophoric dysplasia), dwarfism syndrome, retinal atrophy and deafness, Cockayne's syndrome, dysmyelinogenic leukodystrophy, Alexander's disease, myotonia dystrophica, a combination of retinitis pigmentosa, deafness, mental retardation, and spinal ataxia, Usher syndrome, early-onset familial Alzheimer's disease (EOFAD), Alzheimer's disease (including, for example, type 1, type 2, type 3, or type 4), Ekman-Lobstein disease, osteogenesis imperfecta, tunnel neuralgia, neuropathy, hereditary neuropathy with a tendency to pressure palsy, erythropoietic protoporphyria (EPP), erythroblastic anemia, beta-thalassemia, erythrohepatic protoporphyria, erythroid 5-aminolevulinate synthetase deficiency, X-linked sideroblastic anemia, eye cancer, retinoblastoma FA Friedreich's ataxia, Friedreich's ataxia, FA, Fanconi's anemia , facial injuries and disorders, trom

- 48 042641 factor V Leiden type bophilia, FALS, amyotrophic lateral sclerosis, familial acoustic neuroma, familial adenomatous polyposis, familial Alzheimer's disease (FAD), familial amyotrophic lateral sclerosis, amyotrophic lateral sclerosis, familial autonomic dystonia, familial fat-induced hypertriglyceridemia, familial lipoprotein lipase deficiency, familial hemochromatosis, hemochromatosis, familial LPL deficiency, lipoprotein lipase deficiency, familial nonpolyposis colon cancer, hereditary nonpolyposis colorectal cancer, familial paroxysmal polyserositis, familial PCT, cutaneous porphyria tardive, familial pressure sensitive neuropathy, hereditary FP neuropathy with a tendency to paralysis from pressure, familial primary pulmonary hypertension, familial vascular leukoencephalopathy, CADASIL syndrome, FAP, familial adenomatous polyposis, FD, familial dysautonomia, ferrochelatase deficiency, ferroportin disease, hemochromatosis (any type, e.g. type 1, type 2A, type 2B, type 3 , type 4, neonatal hemoplasmoplasmosis, congenital atransferrinemia, GRACILE syndrome), periodic fever syndrome, familial Mediterranean fever (FMF), FG syndrome, FGFR3-related coronary synostosis, fibrinoid astrocyte degeneration, Alexander disease, pancreatic fibrocystic disease, disease Falling syndrome, fragile X syndrome, X syndrome, bone fragility, osteogenesis imperfecta, FRAXA syndrome, Friedreich's ataxia (FRDA), G6PD deficiency, galactokinase deficiency disease, galactosemia, galactose-1-phosphate uridyltransferase deficiency disease, galactosemia, galactosylceramidase deficiency disease , Krabbe's disease, galactosylceramide lipidosis, Krabbe's disease, galactosylceremidase deficiency, galactosyl-cerephatin deficiency, GALT deficiency, galactosemia, Gaucher's disease-like disease, pseudo Gaucher's disease, GBA deficiency, genetic disorders of the brain, genetic emphysema, genetic hemochromatosis, hemochromatosis, neonatal giant cell hepatitis, neonatal hemochromatosis, GLA deficiency, glioblastoma, retinal glioblastoma, retinoblastoma, globoid cell leukodystrophy (GCL, GLD), Krabbe disease, globoid cell leukoencephalopathy, glucocerebrosidase deficiency, glucocerebrosidosis, glucosylcerebrosidic lipidosis, glucosylcerebrosidase deficiency, glucoside-glucoside-beta-beta deficiency, glucoside-glucoside-beta-glucosiduricidosis, glucoside-glucoside-glucosidase deficiency, glycine encephalopathy, nonketotic hyperglycinemia, glycolic aciduria, primary hyperoxaluria, GM2 gangliosidosis, Tay-Sachs disease, goiter-deafness syndrome, Pendred syndrome, Graefe-Uscher syndrome, Usher syndrome , Gronblad-Strandberg syndrome, pseudochromatosis, hemoelastic chromosanthoma syndrome, Usher syndrome, harlequin-type ichthyosis, Hb S disease, hypochondroplasia (HCH), hereditary coproporphyria (HCP), malformations of the head and brain, hearing impairment and deafness, hearing problems in children, HEF2A, HEF2B, hematoporphyria, porphyria, hemesynthetase deficiency, hemochromatosis, hemoglobin M-related disease, beta-globin-type methemoglobinemia, hemoglobin S-related disease, hemophilia, hepatoerythropoietic porphyria (HEP), liver AGT deficiency, primary hyperoxaluria, hepatolenticular syndrome degeneration, Wilson's disease, hereditary arthro-ophthalmopathy, Stickler's syndrome, hereditary dystopic lipidosis, hereditary hemochromatosis (HHC), hemochromatosis, hereditary hemorrhagic telangiectasia (HHT), hereditary included body myopathy, skeletal muscle regeneration, hereditary iron anemia, X-linked sideroblastic anemia , hereditary motor and sensory neuropathy, hereditary motor neuronopathy type V, hereditary distal motor neuropathy, hereditary multiple exostoses, hereditary non-polyposis colorectal cancer, hereditary periodic fever syndrome, hereditary coli-polyposis, familial adenomatous polyposis, hereditary pulmonary emphysema, hereditary resistance to activated protein C, factor V Leiden type thrombophilia, type III hereditary sensory and autonomic neuropathy, hereditary dysautonomy, hereditary spastic paraplegia, infantile ascending hereditary spastic palsy, hereditary spinal ataxia, Friedreich's ataxia, hereditary spinal sclerosis, Friedreich's ataxia, Herrick's anemia, heterozygous OSMED, Weissenbacher-Zweimüller syndrome, heterozygous otospondylomegaepiphyseal dysplasia, Weissenbacher-Zweimüller syndrome, HexA deficiency, Tay-Sachs disease, hexosaminidase A deficiency, Tay-Sachs disease, hexosaminidase alpha subunit deficiency (any variant, e.g. variant A, variant B), Tay-Sachs disease Sachs, HFE-related hemochromatosis, hemochromatosis, HGPS, progeria, Hippel-Lindau disease, von Hippel-Lindau disease, hemochromatosis (HLAH), distal hereditary motor neuropathy (HMN V), hereditary nonpolyposis colorectal cancer (HNPCC), hereditary neuropathy with susceptibility pressure palsy (HNPP), homocystinuria, homogentisic acid oxidase deficiency, homogentisinuria, alkaptonuria, homozygous cutaneous porphyria tardive, hepatoerythropoietic porphyria, primary hyperoxaluria (HP1), hyperoxaluria (HP2), hyperphenylalaninemia (HPA), HPRT-hypoxanthine-guanine phosphoribosyltransferase deficiency , Lesch-Nyhan syndrome, HSAN type III, familial autonomic dystonia, familial dysautonomy, (HSAN3), hereditary sensory neuropathy (any type, e.g. HSN-1, HSN-II, HSN-III),

- 49 042641 familial dysautonomia, human dermatosparaxis, Huntington's disease, Hutchinson-Gilford progeria syndrome, progeria, non-classical type hyperandrogenism associated with 21hydroxylase deficiency, hyperchylomicronemia, familial lipoprotein lipase deficiency, familial hyperglycinemia with ketoacidosis and leukopenia, type I propionic acidoproteinemia, hyperlipoproteinemia lipoprotein lipases, familial hyperoxaluria, primary hyperphenylalaninemia, hyperphenylalaninemia, hyperphenylalaninemia, hypochondroplasia, hypochondrogenesis, hypochondroplasia, hypochromic anemia, X-linked sideroblastic anemia, hypoxanthine-guanine phosphoribosyltransferase deficiency (HPRT), Lesch-Nyhan syndrome, infantile ascending spastic palsy (IAH), ICF , immunodeficiency, centromere instability and facial anomaly syndrome, idiopathic hemochromatosis, hemochromatosis type 3, idiopathic neonatal hemochromatosis, neonatal hemochromatosis, idiopathic pulmonary hypertension, immune system disorders, X-linked severe combined immunodeficiency, pigment incontinence, infantile cerebral Gaucher disease, infantile Gaucher disease, infantile ascending hereditary spastic palsy, immunodeficiency, hereditary emphysema, hereditary predisposition to pressure palsies, hereditary neuropathy with predisposition to pressure palsies, Insley-Astley syndrome, otospondylomegaepiphyseal dysplasia, acute intermittent porphyria syndrome, acute intermittent porphyria, intestinal and skin polyposis syndrome pigmentation, Peutz-Jeghers syndrome, pigmentary urinary incontinence (IP), iron storage disorder, hemochromatosis, isodicentric chromosome 15 syndrome, isodicentrism-15, isolated deafness, extrasyndromic deafness, Jackson-Weiss syndrome, Joubert syndrome, juvenile primary lateral sclerosis (JPLS), juvenile amyotrophic lateral sclerosis, juvenile gout, choreoathetosis, mental retardation syndrome, Lesch-Nyhan syndrome, juvenile hyperuricemia syndrome, Lesch-Nyhan syndrome, Jackson-Weiss syndrome (JWS), spinal and bulbar atrophy, Kennedy disease, spinal and bulbar muscular atrophy, spinal and bulbar Kennedy muscular atrophy, spinal and bulbar muscular atrophy, kerazine histiocytosis, kerazine lipoidosis, kerazine thesaurismosis, ketotic glycinemia, propionic acidemia, ketotic hyperglycinemia, propionic acidemia, kidney disease, hyperoxaluria, Kugelberg-Welander disease, spinal muscular atrophy, lacquer CADIL , Langer-Saldino achondrogenesis, Langer-Saldino dysplasia, late-onset Alzheimer's disease, late-onset Krabbe disease (LOKD), Krabbe disease, learning disabilities, learning disability, perioral lentiginosis, Peutz-Jeghers syndrome, Lesch-Nyhan syndrome, leukodystrophy, leukodystrophy with Rosenthal fibers, Alexander disease, spongiform leukodystrophy, Li-Fraumeni syndrome (LFS), Li-Fraumeni syndrome, lipase D deficiency, lipoprotein lipase deficiency, LIPD deficiency, lipoprotein lipase deficiency, familial cerebrosidic lipidosis, ganglioside lipidosis, infantile lipidosis, Tau disease -Sachs, lipoid histiocytosis (kerazine type), lipoprotein lipase deficiency, familial liver disease, galactosemia, Lou Gehrig's disease, Louis Bar syndrome, ataxia-telangiectasia, Lynch syndrome, hereditary non-polyposis colorectal cancer, lysyl hydroxylase deficiency, Joseph Mahado disease, spinocerebellar ataxia (any type, e.g. SCA1, SCA2, SCA3, SCA 18, SCA20, SCA21, SCA23, SCA26, SCA28, SCA29), male breast cancer, breast cancer, male genital disorders, breast cancer, breast cancer, malignant breast tumors, breast cancer, bladder cancer, bladder cancer, breast cancer, breast cancer, Marfan syndrome, marker X syndrome, fragile X syndrome, Martin-Bell syndrome, fragile X syndrome, McCune-Albright syndrome, McLeod syndrome, MEDNIK syndrome, mediterranean anemia, beta thalassemia, megaepiphyseal dwarfism, otospondylomegaepiphyseal dysplasia, Menkes syndrome, Menkes disease, Menkes disease, mental retardation with osteochondral abnormalities, Coffin-Lowry syndrome, metabolic disorders, metatropic dwarfism type II, Knist dysplasia, metatropic dysplasia type II, Knist dysplasia, methemoglobinemia (any type, e.g. congenital, betaglobin type, congenital methemoglobinemia type II), methylmalonic acidemia syndrome (MFS), MHAM, Cowden syndrome, microsyndrome, microcephaly, MMA, methylmalonic acidemia, Menkes disease (AKA MK or MNK), monosomy 1p36 syndrome, motor neuron disease, amyotrophic lateral sclerosis, amyotrophic lateral sclerosis, movement disorders, Mowat-Wilson syndrome, mucopolysaccharidosis (MPS I), cystic fibrosis, multi-infarct dementia, CADASIL syndrome, late-onset multiple carboxylase deficiency, biotinidase deficiency , multiple hamartoma syndrome, Cowden syndrome, multiple neurofibromatosis, muscular dystrophy (any type, including Duchenne and Becker types), myotonia atrophic, myotonic dystrophy, myotonia dystrophic, Nance-Insley syndrome, otospondylomegaepiphyseal dysplasia, Nancy-Sweeney chondrodysplasia, otospondylomegaepiphysis, NBIA1, pantothenate kinase-associated neurodegeneration, Neil-Dingwall syndrome, Cockayne syndrome, retinal neuroblastoma, retinoblastoma, brain iron deposition type 1 neurodegeneration, pantothenate kinase-associated neurodegeneration, neurological disease, neuromuscular disease

- 50 042641 hereditary distal motor neuropathy, Niemann-Pick disease, Noack syndrome, non-ketotic hyperglycinemia, glycine encephalopathy, non-neuronopathic Gaucher disease, non-phenylketonuric hyperphenylalaninemia, tetrahydrobiopterin deficiency, extra-syndromic deafness, Noonan syndrome, Norrbotten variant of Gaucher disease, ochronosis, alkaptonuria Ogden, osteogenesis imperfecta (OI), Osler-Weber-Rendu disease, hereditary hemorrhagic telangiectasia, OSMED, otospondylomegaepiphyseal dysplasia, osteogenesis imperfecta, osteopsatirosis, osteogenesis imperfecta, congenital osteosclerosis, oto-spondylomegaepiphyseal dysplasia, otospondylomegaepiphyseal dysplasia, otospondylomegaepiphyseal dysplasia, peroxaloxalosis, hyperoxalosis primary oxaluria, primary hyperoxaluria, pantothenate kinase-associated neurodegeneration, Patau's syndrome (trisomy 13), PBGD deficiency, acute intermittent porphyria, PCC deficiency, propionic acidemia, cutaneous porphyria tardio (PCT), PDM disease, Pendred's syndrome, intermittent illness, Mediterranean fever, familial periodic peritonitis, periorithic lentiginosis syndrome, Peutz-Jeghers syndrome, peripheral nerve disease, familial dysautonomy, peripheral neurofibromatosis, peroneal muscular atrophy, peroxisomal alanine:glyoxylate aminotransferase deficiency, hyperoxaluria, primary Peutz-Jeghers syndrome, phenylalanine hydroxylase deficiency disease, pheochromocytoma, von Hippel-Lindau syndrome Pierre Robin with fetal chondrodysplasia, Weissenbacher-Zweimüller syndrome, pigmentary cirrhosis, hemochromatosis, Peutz-Jeghers syndrome (PJS), pantothenate kinase-associated neurodegeneration (PKAN), PKU, phenylketonuria, plumboporphyria, ALA porphyria insufficiency, PMA, polycystic kidney disease, polyostotic fibrosis dysplasia, McCune-Albright syndrome, familial adenomatous polyposis, hamartomatous polyposis syndrome, polyposis-intestinal syndrome, Peutz-Jeghers syndrome, porphobilinogen synthase deficiency, porphyria with ALA deficiency, porphyrin disease, RROH deficiency, porphyria motley, Prader-Labhart-Willi syndrome, Prader syndrome -Willi, presenile and senile dementia, primary ciliary dyskinesia (PCD), primary hemochromatosis, primary hyperuricemia syndrome, Lesch-Nyhan syndrome, primary senile degenerative dementia, procollagen type EDS VII mutation, progeria, progeria with Hutchinson-Gilford syndrome, progeria-like syndrome, Cockayne's syndrome, progeroid nanism, Cockayne's syndrome, progressive chorea, chronic hereditary diseases (according to Huntington), Huntington's disease, progressive deforming osteogenesis imperfecta with normal sclera, osteogenesis imperfecta (any type, for example, type I, type II, type III , type IV, type V, type VI, type VII, type VIII), proximal myotonic dystrophy (PROMM), propionic acidemia, propionyl-CoA carboxylase deficiency, protein C deficiency, protein S deficiency, protoporphyria, protoporphyrinogen oxidase deficiency, mixed porphyria, proximal myotonic dystrophy, myotonic dystrophy type 2, proximal myotonic myopathy, pseudo Gaucher disease, pseudoxanthoma elastica, psychosine hypertension, pulmonary arterial hypertension, pulmonary hypertension, pseudoxanthoma elastica (PXE), pseudoxanthoma elastica, retinoblastoma (Rb), Recklinghausen's disease, recurrent polyserositis, diseases retinal deafness syndrome with retinitis pigmentosa, Usher syndrome, retinoblastoma, Rett syndrome, RFALS type 3, Ricker syndrome, Ricker-Day syndrome, familial dysautonomia, Roussy-Levi syndrome, Rubinstein-Taibi syndrome (RSTS), Rett syndrome (RTS), Rubinstein-Taibi syndrome, Saka-Barabas syndrome, SADDAN disease, familial sarcoma with Lee and Fraumeni syndrome, Lee-Fraumeni syndrome, SBLA syndrome (sarcoma, breast, leukemia and adrenal syndrome), Li-Fraumeni syndrome, spinal and bulbar muscular atrophy ( SBMA), schwannomas, acoustic bilateral neurofibromatosis type II, Schwarz-Jampel syndrome, X-related severe combined immunodeficiency (SCIDX1), congenital SED, Strudwig type congenital spondyloepiphyseal dysplasia, Strudwig SED, Strudwig's spondyloepimetaphyseal dysplasia, congenital spondyloepiphyseal dysplasia (SEDc), spondyloepyphyseal dysplasia (SEMD), Strudwig-type SEMD, senile dementia, severe achondroplasia with developmental delay and acanthosis nigricans, SADDAN disease, Sprinzen syndrome, Siderius-type X-related mental retardation syndrome caused by mutations in the PHF8 gene, skeleton-skin-brain syndrome, disorders skin pigmentation, spinal muscular atrophy (SMA), spondylo-metaepiphyseal dysplasia (SMED) (any type, e.g., Strudwig type, type 1), Smith-Lemli-Opitz syndrome, Smith-Magenis syndrome, South African genetic porphyria, infantile ascending hereditary spastic paralysis, onset in infancy, ascending hereditary spastic palsy, speech and communication disorders, Tay-Sachs sphingolipidosis, Tay-Sachs disease, spinal and bulbar muscular atrophy, spinal muscular atrophy, type V distal spinal muscular atrophy, hereditary distal motor neuropathy, distal muscular upper limb-dominated spinal atrophy, hereditary distal motor neuropathy, spinocerebral ataxia, congenital spondyloepiphyseal dysplasia, spondyloepiphyseal dysplasia, collagenopathy (any type, e.g. types II and XI), spondyloepimetaphyseal dysplasia, spondylometaphyseal dysplasia (SMD), central spondyloepimetaphyseal dysplasia, spondyloepimetaphyseal dysplasia, spondyloepimetaphyseal dysplasia nervous system, spongy degeneration

- 51 042641 brain, spongy white matter degeneration in infancy, sporadic primary pulmonary hypertension, SSB syndrome, steel hair disease, Menkes disease, Steinert disease, myotonic dystrophy, Steinert myotonic dystrophy syndrome, myotonic dystrophy, Stickler syndrome, stroke, CADASIL syndrome, syndrome Strudwick, subacute neuronopathic Gaucher disease, Swedish genetic porphyria, acute intermittent porphyria, acute intermittent porphyria, Swiss cheese cartilage dysplasia, Kneist dysplasia, Tay-Sachs disease, TD thanatophoric dwarfism, thanatophoric dysplasia, TD with straight hips and trefoil skull, thanatophoric dysplasia type 2, cerebellar-cutaneous telangiectasia, ataxyuteleangiectasia, testicular feminization syndrome, androgen insensitivity syndrome, tetrahydrobiopterin deficiency, testicular feminization syndrome (TFM), androgen insensitivity syndrome, thalassemia intermedia, beta thalassemia, thalassemia major, beta thalassemia, thanatophoric dysplasia, Leiden-type thrombophilia due to activated protein C cofactor deficiency, factor V Leiden-type thrombophilia, thyroid disease, tomacular neuropathy, hereditary neuropathy with a tendency to pressure paralysis, complete HPRT deficiency, Lesch-Nyhan syndrome, complete hypoxanthine deficiency guanine phosphoribosyltransferase, Lesch-Nyhan syndrome, Treacher-Collins syndrome, osteogenesis imperfecta triad, triple X syndrome, triple X syndrome, trisomy 21, trisomy X, Troisier-Anot-Choffard syndrome, hemochromatosis, Tay-Sachs disease (TSD), tuberose complex sclerosis (TSC), tuberous sclerosis, Turner syndrome, Noonan syndrome, UDP-galactose-4-epimerase deficiency disease, galactosemia, UDP-glucose-4-epimerase deficiency disease, galactosemia, UDP-glucose-hexose-1-phosphate uridyltransferase deficiency, galactosemia , undifferentiated deafness, out-of-syndromic deafness, UPS deficiency, acute intermittent porphyria, bladder and urinary system cancer, bladder cancer, UROD deficiency, uroporphyrinogen decarboxylase deficiency, uroporphyrinogen synthase deficiency, acute intermittent porphyria, Usher syndrome, UDP-hexose-1-phosphate-deficiency uridyltransferases, galactosemia, Van Bogert-Bertrand syndrome, Van der Heev syndrome, velocardiofacial syndrome, VHL syndrome, von Hippel-Lindau disease, visual impairment and blindness, Alström syndrome, von Bogart-Bertrand disease, von Hippel-Lindau disease, von Recklenhausen disease -Appelbaum, hemochromatosis, von Recklinghaus disease, type I neurofibromatosis, Wrolick disease, osteogenesis imperfecta, Waardenburg syndrome, Warburg-Sho-Fedelius syndrome, microsyndrome, Wilson's disease (WV), Weissenbacher-Zweimüller syndrome, Werdnig-Hoffmann disease, spinal muscular atrophy , Wilson's syndrome, Wilson's disease, Wolff-Hirschhorn syndrome, periodic Wolff's disease, Weissenbacher-Zweimüller syndrome (WZS), xeroderma pigmentosa, X-linked mental retardation and macroorchidism, fragile X syndrome, X-linked primary hyperuricemia, Lesh's syndrome Nihan, X-linked severe combined immunodeficiency, X-linked sideroblastic anemia, X-linked spinal bulbar muscle atrophy, spinal and bulbar muscle atrophy, X-linked aciduria with fermentopathy, Lesch-Nyhan syndrome, X-SCID, X-linked severe combined immunodeficiency, X-linked sideroblastic anemia (XLSA), X-SCID, X-linked severe combined immunodeficiency, X-linked sideroblastic anemia (XLSA), XSCID, X-linked severe combined immunodeficiency, syndrome XXX, triple X syndrome, syndrome XXXX, XXXXX syndrome, XXXXX syndrome, XXY syndrome, XXY trisomy, Klinefelter's syndrome, XYY syndrome, triplet repeat disorders, or any combination thereof.

In some embodiments, a specific post-transcriptional control modulator is targeted to modulate, modify, increase or decrease activity by introducing a DNA-PK inhibitor and a genomic editing system. For example, post-transcriptional regulatory modulators may include PARN, PAN, CPSF, CstF, PAP, PABP, PAB2, CFI, CFII, RNA triphosphatase, RNA gluyltransferase, RNA methyltransferase, SAM synthase, ubiquitin conjugating enzyme E2R, SR proteins (SFRS1 - SFR11 ), hnRNP proteins (e.g., HNRNPA0, HNRNPA1, HNRNPA1L1, HNRNPA1L2, HNRNPA2, HNRNPA2B1, HNRNPAB, HNRNPB1, HNRNPC, HNRNPCL1, HNRNPD, HNRPDL, HNRNPF, HNRNHP1, HNRNPH2, HNRNPH3, HNRNPKPR, HNRNPL, HNRNPLL, HNRNPLL, HNRNPU, HNRNPUL1, HNRNPUL2, HNRNPUL3, ADAR, Mech 67, Mtr2, Nab2, Dead-box helicase, elF4A, elF4B, elF4E, elF4G, GEF, GCN2, PKR, HRI, PERK, eEF1, eEF2, GCN, eRF3, ARE- specific binding proteins, EXRN1, DCP1, DCP2, RCK/p54, CPEB, eIF4E, miRNA and siRNA, DICER, Ago proteins, antisense mRNA mediated degradation proteins, UPF3A, UPF3BeIF4A3, MLN51, Y14/MAGOH, MG-1, SMG -5, SMG-6, SMG-7 or any combination thereof.

In some embodiments, the activities of genetic pathways associated with the cell cycle are modulated, enhanced, or reduced by the administration of a DNA-PK inhibitor and a genomic editing system. Examples of cell cycle pathways and genes include ATM, PMS2, FAS-L, MRE11, MLH1, FasR, NBS1, MSH6, Trail-L, RAD50, MSH2, Trail-R, 53BP1, RFC, TNF-Ct, P53 , PCNA, TNF-R1, CHKE, MSH3, FADD, E2F1, MutS homolog, TRADD, PML, MutL homolog, R1P1, FANCD2, exonuclease, MyD88, SMC1, DNA, delta polymerase, IRAK, BLM1, (POLD1,

- 52 042641

POLD2, POLD3, NIL, BRCA1 and POLD4 genes, IKK, subunits encoding H2AX), NFKe, ATR, topoisomerase 1, Ikb ba, RPA, topoisomerase 2, IAP, ATRIP, RNAseH1, caspase 3, RAD9, ligase 1, caspase 6 , RAD1, DNA, polymerase 1, caspase 7, HUS, DNA, polymerase 3, caspase 8, RAD17, primase, caspase 10, RFC, helicase, HDAC1, CHK1 single strand binding, HDAC2, TLK1 proteins, cytochrome C, CDC25, Bx1- xL, STAT3, STAT5, DFF45, Vcl-2, ENDO-G, PI2K, Akt, calpain, Bad, Bax - ubiquitin-mediated proteolysis, hypoxia, cell proliferation, HIF-loc, MAPK, E1, HERC1, TRAF6, HIFIp, MAPKK, E2, UBE2Q, MEKK1, Refl, MAPKKK, E3, UBE2R, COP!, HSP90, c-Met, UBLE1A, UBE2S, PIFH2, VEGF, HGF, UBLE1B, UBE2U, cIAP, PAS, ER, S1/2, UBLEIC, UBE2W , PIAS, ARNT, ATK, UBE2A, UBE2Z, SYVN, VHL, PKCs, UBE2B, AFC, LLC, N, NHLRC1, HLF, paxilin, UBE2C, UBE1, AIRE, EPF, FAK, UBE2A, E6AP, MGRN1, VDU2, adducin , UBE2E, UBE3B, BRCA1, SUMORESUME, PYK1, UBE2F, Smurf, FANCL, SENP1, RB, UBE2G1, Itch, MIDI, calcineurin, A, RBI, UBE2G2, HERC2, Cdc20, RACK1, Raf-1, UBE2I, HERC3, Cdhl , PTB, A-Raf, UBE2J1, HERC4, Apcl, Hur, B-raf, UBE2J2, UBE4A, Apc2, PHD2, MEK1/2, UBE2L3, UBE4B, Aps3, SSAT2, ERK1/2, UBE2L6, CHIP, Apc4, SSAT1 , Ets, UBE2M, CYC4, Apc5, GSK3, Elkl, UBE2N, PPR19, Ars6, SVR, SAP1, UBE20, UIP5, Apc7, FOX04, cPLA2, WWPI, Mdm2, Apc8, FlH-1, WWP2, Parkin, Apc9, TRIP , 12, Trim32, Ape, 10, NEED4, Trim37, Ape, 11, ARF-BP1, SIAH-1, Ape, 12, EDD1, PML, cell survival pathway, cell cycle arrest pathway, SMADI, P21, SMAD5, BAX , SAMD8, MDR, LEF1, DRAIL, IGFBP3, TCF3, GADD45, TCF4, P300, HAT1, PI3, Akt, GF1, or any combination thereof.

In some embodiments, the activities of angiogenesis-related genes are modulated, enhanced, or reduced by introducing a PK DNA inhibitor and a genomic editing system into the cell(s). Illustrative genes and genetic pathways associated with angiogenesis, as well as conditions related to angiogenesis, include VEGF, VEGFR2, SHC, E2F7, VEGFB, VEGFR3, PI3, VEGFC, Nrp1, PIP3, EGFDIP3, DAG, GRB2, SOS, Akt, PB , PKC, Ras, RAF1, DAG, eNOS, NO, ERK1, ER2, cPLA2, ME1, MEK2, or any combination thereof.

In some embodiments, the activities of mitochondrial function-associated genetic pathways and/or genes are modulated, enhanced, or reduced by introducing a PK DNA inhibitor and a genomic editing system into the cell(s). Exemplary mitochondrial function-associated genes and genetic pathways include malate dehydrogenase aminotransferase, hydratase, deacylase, dehydrogenase, carboxylase, mutase, leucine oxidation of fatty acids by isoleucine oxidation reaction (enzymatic oxidation pathway), aminotransferase, chain branching OTM2, FATP1-6 aminotransferase 2, aminotransferase 2, mitochondrial CPT-1, HACT-isobutyl-CoA, 2-methylbutyl-CoA, CPT-P-dehydrogenase, SCAD (chain branching, MCAD-keto-acid, VLCAD-dehydrogenase, ETF-DH-complex), alpha- ETF hydratase, beta-ETF-HMGCoA lyase, 2-methyl-3-OH-SCHAD-butyryl-CoA, LCHAD dehydrogenase, MTP-3-oxothiolase, LKAT, DECR 1, HMGCS2, HMGCL, or any combination thereof.

In some embodiments, activities associated with DNA damage or genomic instability of genetic pathways and/or genes are modulated, enhanced, or reduced. Examples of genetic pathways and/or genes associated with DNA damage or genomic instability include 53BP1, BLM, MBD2, DNA ligase 4, MDC1, H2AX, XLF, SMC1, 53BP1, Rad50, P53, P53, Artemis, Rad27, TdT, APE1, PMS2 , APE2, UvrA, RecA, MLH1, NEIL1, UvrB, SSB, MSH6, NEIL2, UvrC, Mrell, MSH2, NEIL3, XPC, Rad50, RFC, XRCC1, Rad23B, Nbsl, PCNA, PNKP, CEN2, CtIP, MSH3, Tdpl , DDB1, RPA, MutS, APTX, XPE, Rad51, MutL, DNA polymerase β, CSA, Rad52, DNA polymerase 5, CSB, Rad54, DNA topoisomerase 1, TFT1H, BRCA1, topoisomerase 2, PCNA, XPB, BRCA2, RNAseHl, FEN1, XPD, Exol, ligase 1, RFC, XPA, BLM, DNA polymerase 1, PAR 1, RPA, Topllla, DNA, Ligl, XPG, GEN1, primase, Lig3, ERCC1, Yenl helicase, UNG, XPF, Slxl, SSBs , MUTY DNA polymerase δ, Slx4, SMUG DNA polymerase s, Mus8, MBD4, Emel, Dssl, ASH1L, SETD4, DQT1L, SETD5, EHMT1, SETD6, EHMT2, SETD7, EZH1, SETD8, EZH2, SETD9, MLL, SETDB1, MLL2 , SETDB2, MLL3, SETMAR, MLL4, SMYD, 1, MLL5, SMYD2,NSD, 1, SMYD3, PRDM2, SMYD4, SET, SMYD5, SETBP1, SUV39H1, SETD 1A, SUV39H2, SETD 1B, SUV420H1, SETD2, SUV420 H2, SETD3 or any combination thereof.

In some embodiments, genes encoding mammalian transcription factors are modulated, enhanced, reduced, or introduced into a cell. Examples of human transcription factors include

- 53 042641

AFF4 AFF3 AFF2 AFF1 AR TFAP2B TFAP2D TFAP2C TFAP2E TFAP2A JARID2 KDM5D ARID4A ARID4B KDM5A ARID3A KDM5B KDM5C ARID5B ARID3B ARID2 ARID5A ARID3C ARID1BA HIF1A, NPAS1, NPAS3, NPAS4, MLXIPL, ARNTL2, MXD1, AHRR, TFE3, HES2, MNT, TCF3, SREBF1, TFAP4, TCFL5, LYL1, USF2, TFEC, AHR, MLX, MYF6, MYF5, SIM1, TFEB, HANOI, HES1, ID2, MYCL1, ID3, TCF21, MXI1, SOHLH2, MYOG, TWIST1, NEUROG3, BHLHE41, NEUROD4, MXD4, BHLHE23, TCF15, MAX, ID1, MYODI, ARNTL, BHLHE40, MYCN, CLOCK, HEY2, MYC, ASCL1, TCF12, ARNT, HES6, FERD3L, MSGN1, USF1, TALI, NEURODI, TCF23, HEYL, HAND2, NEUROD6, HEY1, SOHLH1, MESP1, PTF1A, ATOH8, NPAS2, NEUROD2, NHLH1, ID4, ATOH1, ARNT2, HES3, MLXIP, ASCL3, KIAA2018, OLIG3, NHLH2, NEUROG2, MSC, HES7, ATOH7, BHLHA15, BHLHE22, NEUROG1, FIGLA, ASCL2, OLIG1, TAL2, MITF, SCXB, HELT, ASCL4, MESP2, HES4, SCXA, TCF4, HES5, SREBF2, BHLHA9, OLIG2, MXD3, TWIST2, LOC388553, C13orf38-SOHLH2, SEVRE, XBP1, BATF3, CREB5, CEBPG, ATF3, ATF7, CEBPB, CEBPD, SEVRA, CBFB, CAMTA2, CAMTAI, EBF4, EBF3, EBF1, EBF2, NR2F6, NR2F1, NR2F2, GRHL2, TFCP2L1, GRHL1, TFCP2, UBP1, GRHL3, YBX2, CSDE1, CSDA, YBX1, LIN28A, CARHSP1, CSDC2, LIN28B, NFIX, NFIC, NFIB, NFIA, CUX2, ONECUT2, CUX1, ONECUT1, SATB1, ONECUT3, SATB2, DMRT3, DMRT1, DMRTC2, DMRTA2, DMRTB1, DMRT2, DMRTA1, E2F2, E2F1, E2F3, TFDP2, E2F8, E2F5, E2F7, E2F6, TFDP3, TFDP1, E2F4, NR1H3, NR1H2, ETV1, ETV7, SPH, ELF4, ETV2, ERF, ELF2, ELK3, ETUZ, ELF1, SPDEF, ELK1, ETS1, EHF, ELF5, ETV6, SPIB, FLU, GABPA, ERG, ETS2, ELK4, ELF3, FEV, SPIC, ETV4, ETV5, FOXN3, FOXCI, FOXJ2, FOXF1, FOXN1, FOXM1, FOXP1, FOXO3, FOXA2, FOXP2, FOXJ1, FOXP4, FOXF2, FOXN4, FOXK2, FOXO1, FOXH1, FOXQ1, FOXK1, FOXH, FOXD4, FOXA3, FOXN2, FOXB1, FOXG1, FOXRI, FOXL1, FOXC2, FOXE1, FOXS1, FOXL2, FOXO4, FOXD4L1, FOXD4L4, FOXD2, FOXI2, FOXE3, FOXD3, FOXD4L3, FOXR2, FOXJ3, FOXO6, FOXB2, FOXD4L5, FOXD4L6, FOXD4L2, KIAA0415, FOXA1, GCM2 NR3C1, GTF2IRD1, GTF2I, GTF2IRD2B, GTF2IRD2, SOX8, SOX30, PMS1, CIC, TCF7, TOX4, SOX10, HMGXB4, HBP1, TFAM, UBTF, WHSCI, SOX6, HMGXB3, BBX, TOX2, SOX4, SOX21, SOX9, SOX15, SOX5, SOX3, LEF1, HMG20A, SOX13, TCF7L2, SSRP1, TCF7L1, SOX17, SOX14, PINX1, SOX7, SOX11, SOX12, SOX2, SOX1, SRY, SOX18, UBTFL1, UBTFL2, TOX, HMGB1, HMGB2, PBRM1, TOX3, SMARCE1, HMG20B, HMGB3, HMGA2, HMGA1, ARX, HOXA11, MEOX1, DLX6, ISL1, HOXC8, BARX2, ALX4, GSC2, DLX3, PITX1, HOXA9, HOXA10, LHX5, LASS4, ZFHX4, SIX4, VSX1, ADNP, RHOXF1, MEIS3 PBX4 DLX5 HOXA1 HOXA2 DBX1, NANOG, IRX4, CDX1, TLX2, DLX2, VAX2, PRRX1, TGIF2, VSX2, NKX2-3, HOXB8, HOXB5, HOXB7, HOXB3, HOXB1, MSX2, LHX4, HOXA7, HOXC13, HOXC11, HOXC12, ESX1, BARHL1, NKX2-4, NKX2-2, SIX1, HOXD1, HOXD3, HOXD9, HOXD10, HOXD11, HOXD13, MNX1, CDX4, BARX1, RHOXF2, LHX1, GSC, MEIS2, RAX, EMX1, NKX2-8, NKX2-1, HLX, LMX1B, SIX3, LBX1, PDX1, LASS5, ZFHX3, BARHL2, LHX9, LASS2, MEIS1, DLX1, HMBOX1, ZEB1, VAX1, NKX6-2, VENTX, HHEX, TGIF2LX, LASS3, ALX3, HOXB13, IRX6, ISL2, PKNOX1, LHX8, LMX1A, ENI, MSX1, NKX6-1, HESX1, PITX2, TLX3, EN2, UNCX, GBX1, NKX6-3, ZHX1, HDX, PHOX2A, PKNOX2, CDX2, DRGX, NKX3-1, PBX3, PRRX2, GBX2, SHOX2, GSX1, HOXD4, HOXD12, EMX2, IRX1, IRX2, SIX2, HOXB9, HOPX, OTP, LASS6, HOXC5, HOXB2, RAX2, EVX2, ZHX3, PROP1, ISX, HOXD8, TGIF2LY, IRX5, SIX5, TGIF1, IRX3, ZHX2, LBX2, NKX2-6, ALX1, GSX2, HOXC9, HOXC10, HOXB4, NKX2-5, SIX6, MIXL1, DBX2, PBX1, SHOX, ARGFX, HMHZ, HMX2, BSX, HOXA4, DMBX1, HOXC6, HOXC4, RHOXF2B, PBX2 DUXA DPRX LEUTX , IRF5, IRF4, IRF8, IRF2, IRF7, IRF9, MBD3, BAZ2B, MBD4, SETDB2, MBD1, MECP2, SETDB1, MBD2, BAZ2A, SMAD7, SMAD5, SMAD9, SMAD6, SMAD4, SMAD3, SMAD1, SMAD2, ZZZ3, RCOR1 , CDC5L, MYBL2, DNAJC2, TAD A2A, RCOR3, MYB, TERF2, DMTF1, DNAJC1, NCOR1, TERFI, MIER3, MYSM1, SNAPC4, RCOR2, TADA2B, MYBL1,

- 54 042641

TERF1P2, NCOR2, CCDC79, SMARCC1, SMARCC2, TTF1, Clolorf9, NFYA, NFYC, NFYB, NRF1, NR4A3, NR4A1, NR4A2, ESRI, NR0B2, NR0B1, PREB, EAF2, SPZ1, TP63, TP73, TP53, PAX6, PAX6 PAX2 PAX4 PAX8 PAX1 PPARA, PGR, PROXI, PROX2, NR2E1, NR5A2, NR2C1, NR5A1, NR6A1, ESRRA, NR2C2, RFX3, RFX2, RFX4, RFX1, RFX5, RFX7, RFX6, RFX8, NFATC3, NFKB2, NFATC4, NFATC2, NFAT5, RELB, NFKB1, NFATC1, REL, RELA, RORA, RORC, NR1D2, RORB, RUNX3, RUNX1, SP100, SP140, GMEB2, SP110, AIRE, GMEB1, DEAFI, SP140L, LOC729991-MEF2B, MEF2A, SRF, MEF2D, MEF2B, STAT1, STAT5A, STAT4, STAT6, STAT3, STAT2, STAT5B, TBX21, TBX5, TBX15, TBX18, TBX2, TBX4, TBX22, TBX3, TBR1, TBX19, TBX6, EOMES, T, TBX20, TBX10, MGA, TBX1, TEAD3, TEAD2, TEAD1, TEAD4, CREBL2, NFE2L3, CREB3L3, F0SL2, NFE2L1, CREM, DBP, CREB3, HLF, BACH2, ATF2, NFE2L2, ATF6, CREB1, ATF1, NFE2, FOSB, ATF4, NRL, JUND, JDP2, CREB3L4, BATF, BACH1, CREB3L1, NFIL3, TEF, BATF2, ATF5, FOS, JUNB, DDIT3, FOSL1, JUN, MAF, CREB3L2, MAFA, MAFF, MAFG, MAFK, MAFB, ATF6B, CRX, OTX1, OTX2, THAP3, THAP10, THAP1, PRKRIR, THAP8, THAP9, THAP11, THAP2, THAP6, THAP4, THAP5, THAP7, NR1H4, NR2E3, RARB, HNF4A, VDR, ESRRB, THRA, NR1D1, RARA, ESR2, NR1I3, NR1I2, THRB, NR3C2, HNF4G, RARG, RXRA, ESRRG, RXRB, TSC22D1, TSC22D3, TSC22D4, TSC22D2, TULP3, TULP2, TULP1, TULP4, TUB, ZBTB33, ZBTB32, ZBTB11, MYNN, ZBTB25, PATZ1, ZBTB16, ZBTB24, BCL6, ZBTB47, ZBTB15, GZFTB15, ZBTB15 ZBTB1 ZBTB46 ZBTB8A ZBTB6 ZBTB44 ZFP161 ZBTB12 ZBTB48 ZBTB10 ZBED4 ZBED3 ZNF800, PRDM1, PRDM6, ZFP112, ZNF275, ZNF76, ZFAT, KLF6, ZFY, ZXDC, GLI2, ZNF532, ZNF37A, ZNF510, ZNF506, ZNF324, ZNF671, ZNF416, ZNF586, ZNF446, ZNF8, ZNF264, REST, MECOM, ZNF213 ZNF343, ZNF302, ZNF268, ZNF10, HIVEP1, ZNF184, MZF1, SALL4, ZNF516, KLF8, KLF5, ZNF629, ZNF423, CTCF, ZNF500, ZNF174, SALL1, MAZ, ZNF419, OVOL3, ZNF175, ZNF14, ZNF574, ZNF85, SP4, ZKSCAN1, GLI3, GLIS3, KLF3, PRDM4, GLU, PRDM13, ZNF142, PRDM2, ZNF684, ZNF541, KLF7, PLAGL1, ZNF430, KLF12, KLF9, ZNF410, BCL11A, EGR1, ZFP30, TSHZ3, ZNF549, ZSCAN18, ZNF231, ZNF611, ZNF611 ZSCAN20 GTF3A ZNF205 ZNF644 EGR2 IKZF4 CTCFL ZNF831 SNAI1 ZNF576 ZNF45 TRERF1 ZNF391 RREB1 ZNF133 OVOL2 ZNF337 PRDM5, ZNF740, ZIC5, ZSCAN29, ZNF710, ZNF434, ZNF287, ZIM3, PRDM15, ZFP14, ZNF787, ZNF473, ZNF614, PRDM16, ZNF697, ZNF687, OSR1, ZNF514, ZNF660, ZNF300, RBAK, ZNF92, ZNF157,

- 55 042641

ZNF182 ZNF41 ZNF711 PRDM14 ZNF7 ZNF214 ZNF215 SALL3 ZNF827 ZNF547 ZNF773 ZNF776 ZNF256 ZSCAN1 ZNF837 PRDM8 ZNF117 ZIC1 FEZF2 ZNF599 ZNF18 KLF10 ZNF8SCAN2 ZNF19, ZSCAN12, ZNF276, ZNF283, ZNF221, ZNF225, ZNF230, ZNF222, ZNF234, ZNF233, ZNF235, ZNF362, ZNF208, ZNF714, ZNF394, ZNF333, ZNF382, IKZF3, ZNF577, ZNF653, ZNF75A, ZNF2, ZNF2 ZNF513,ZNF148,KLF15,ZNF691,ZNF589,PRDM9,ZNF12,SP8,0SR2,ZNF367,ZNF22,GFI1B,ZNF219,SALL2,ZNF319,ZNF202,ZNF143,ZNF3,ZSCAN21,ZNF606,SP2,ZNF91,ZNF23,ZNF226 ZNF180 ZNF668 ZNF646 ZNF641 ZNF610 ZNF528 ZNF701 ZNF526 ZNF146 ZNF444 ZNF83 ZNF558 ZNF232 E4F1 ZNF597 INSM2 ZNF30 ZNF507 ZNF354A ZEB2 ZNF35 ZNF778 ZNF212 ZNF282 PRDM10 SP7 SCRT1 ZNF16 ZNF296 ZNF160 ZNF415 ZNF672 ZNF692 ZNF439 ZNF440 ZNF581 ZNF524 ZNF562 ZNF561 ZNF584 ZNF274 ZNF217 ZNF57 ZNF556 ZNF554 KLF11 HINFP ZNF24 ZNF596 OVOL1 SP3 ZNF621 ZNF680 BNC2 ZNF483 ZNF449 INSMI ZNF417 ZNF791 ZNF80 GLIS1 ZNF497 KLF14 ZNF266 ZNF519, ZNF25, ZNF77, ZNF169, ZNF613, ZNF683, ZNF135, ZSCAN2, ZNF575, ZNF491, ZNF620, ZNF619, ZNF354C, ZNF114, ZNF366, ZNF454, ZNF543, ZNF354B, ZNF223, ZNF713, ZNF52, ZNF3 ZFPM1 ZNF784 ZNF648 FIZ1 ZNF771 TSHZ1 ZNF48 ZNF816 ZNF571 ZSCAN4 ZNF594 ZFP3 ZNF443 ZNF792 ZNF572 ZNF707 ZNF746 ZNF322A ZNF467 ZNF678 ZFP41 HK1 ZNF716 ZNF708 ZSCAN22 ZNF662 ZNF320 ZNF623 ZNF530 ZNF285 ZFP1 WT1 ZFP90 ZNF479 ZNF445 ZNF74 SP1 SNAI3 ZNF696 IKZF1 ZNF555 ZNF75D ZNF501 ZNF197 ZNF396 ZFP91 ZNF732 ZNF397 ZSCAN30 ZNF546 ZNF286A ZKSCAN4 ZNF70 ZNF643 ZNF642 ZSCAN23 ZNF490 ZNF626 ZNF793 ZNF383 ZNF1TF7 ZNF1TF7 ZNF322B ZNF563 ZNF292 ZNF567 SP6 ZNF573 ZNF527 ZNF33A ZNF600 ZKSCAN3 ZNF676 ZNF699 ZNF250 ZNF79 ZNF681 ZNF766 ZNF107 ZNF471 ZNF836 ZNF493 ZNF774, ZNF658, ZNF765, ZNF124, ZNF569, ZNF777, ZNF775, ZNF799, ZNF782, ZNF846, ZNF136, ZKSCAN5, ZNF502, ZFP62, ZNF33B, ZNF512B, ZNF431, ZNF418, ZNF700, ZNF239, ZSCAN16, ZFP28, ZNF705A, ZNF585A, ZNF138, ZNF429, ZNF470, ZNF100, ZNF398, ZNF498, ZNF441, ZNF420, ZNF763, ZNF679, ZNF682, ZNF772, ZNF257, ZNF785, ZSCAN5B, ZNF165, ZNF655, ZNF98, ZNF786, ZNF517, ZNF675, ZNF860, ZNF628, ZNF665, ZNF624, ZNF841, ZNF615, ZNF350, ZNF432, ZNF433, ZNF460, ZNF81, ZNF780A, ZNF461, ZNF181, LOC100287841, ZNF44, ZNF790, ZNF677, ZNF823, ZNF311, ZNF347, ZNF71, ZNF121, ZNF335, ZNF560, ZNF273, ZNF84, ZNF667, ZNF649, ZNF248, ZNF544 ZNF770 ZNF737 ZNF251 ZNF607 ZNF334 ZXDA ZNF485 ZIM2 PEG3 ZNF192 ZNF442 ZNF813 ZNF26 ZNF69 ZNF583 ZNF568 ZXDB ZNF480 ZNF587 ZNF808 ZNF43 ZNF7627 ZNF536 ZNF534 ZNF652 ZNF521 ZNF358 ZFP2 SP5 ZNF814 ZNF551 ZNF805 ZSCAN5C ZNF468 ZNF616 ZFP57 ZNF155 ZNF783 ZNF425 ZNF580 ZNF611 ZNF254 ZNF625 ZNF90, ZNF93, ZNF486, REPIN1, LOC100131539, ZNF705D, LOC100132396, ZNF705G, SCRT2, ZNF407, SP9, ZNF579, ZNF880, ZNF630, ZNF844, ZNF469, ZNF717, ZNF865, ZNF492, ZNF688, YY2, ZNF878, ZNF879, ZNF736, ZNF323, ZNF709 ZNF512 ZNF585B ZNF154 ZNF324B ZNF564 ZFP82 GLI4 ZNF674 ZNF345 ZNF550 KLF1 YY1 MYST2 ST18 L3MBTL4 MYT1L MYT1 L3MBTL1 MTA3 GATA1 TRPS1 GATA3 GATA5 GATA5 GATA6, GATAD2B, GATAD1, GATA2, MTA1, ZGLP1, MTA2, RERE, C16orf5, LITAF, PIAS1, PIAS2, PIAS4, ZMIZ1, ZMIZ2, PIAS3, RNF138, NFX1, NFXL1, or any combination thereof.

In some embodiments of the invention, cells are processed (eg, converted or differentiated) to transition cells from one cell type to another. In some embodiments, pancreatic cells are processed and converted into beta islet cells. In some embodiments, the fibroblasts are processed and converted into iPS cells. In some embodiments, the preadipocytes are processed and converted into brown fat cells. Other exemplary cells include, for example, muscle cells, nerve cells, leukocytes, and lymphocytes.

In some embodiments of the invention, the cell is a pathological or mutant cell. Such cells can be manipulated by treating them to treat a disease, for example, to correct a mutation, or to change the cell's phenotype, for example, to inhibit the growth of a cancer cell. For example, a cell may be associated with one or more of the diseases or conditions described herein.

In some embodiments, the cell being treated is a normal cell.

In some embodiments, the cell to be treated is stem or progenitor cells (eg, iPS, embryonic, hematopoietic, adipose, germline, lung, or neural stem or progenitor cells). In some embodiments, the cell to be treated may be any of the three germ layers (ie, mesodermal, endodermal, or ectodermal). In some embodiments, the cell to be treated may be from an extraembryonic tissue, such as the placenta.

In some embodiments, the cell to be treated is selected from fibroblasts, monocytic progenitors, B cells, exocrine cells, pancreatic progenitors, endocrine progenitors, hepatoblasts, myoblasts, or preadipocytes. In some embodiments, the cells are processed (e.g., transformed or differentiated) to become muscle cells, erythroid-megakaryocytic cells, eosinophils, iPS cells, macrophages, T cells, islet beta cells, neurons, cardiomyocytes, blood cells, endocrine progenitor cells, exocrine progenitor cells, ductal cells, acinar cells, alpha cells, beta cells, delta cells, PP cells, hepatocytes, cholangiocytes, angioblasts, mesoangioblasts or brown adipocytes.

In some embodiments, the cell is a muscle cell, an erythroid megakaryocyte cell, an eosinophil, an iPS cell, a macrophage, a T cell, an islet beta cell, a neuron, a cardiomyocyte, a blood cell, an endocrine precursor cell, an exocrine precursor cell, a ductal cell, acinar cell, alpha cell, beta cell, delta cell, PP cell, hepatocyte, cholangiocyte, or white or brown adipocyte.

In some embodiments, the cell is a progenitor cell, pluripotent cell, totipotent cell, mature stem cell, inner cell mass cell, embryonic stem cell, or iPS cell.

In some embodiments, the cell being treated is a cancer cell. In some embodiments, the cancer cell may be a lung cancer cell, a breast cancer cell, a skin cancer cell, a brain cancer cell, a pancreatic cancer cell, a hematopoietic cancer cell, a liver cancer cell, a kidney cancer cell, an ovarian cancer cell, a prostate cancer, skin cancer cell. In some embodiments, the cell is a muscle cell, an erythroid megakaryocyte cell, an eosinophil, an iPS cell, a macrophage, a T cell, an islet beta cell, a neuron, a cardiomyocyte, a blood cell, an endocrine progenitor cell, an exocrine progenitor cell, a prototar cell, an acinar cell , alpha cell, beta cell, delta cell, PP cell, hepatocyte, cholangiocyte, or white or brown adipocyte.

Introduction of DNA-PK inhibitors and gene editing system into the cell(s).

The introduction into the cell(s) of the genome editing system and the DNA-PK inhibitor can be carried out by any method known in the art. The introduction can be performed in vitro, ex vivo or in vivo. Introduction into the cell (cells) of the genome editing system and the DNA-PK inhibitor can occur simultaneously or sequentially. In some embodiments, the DNA-PK inhibitor and components of the genome editing system are incorporated into the cell membrane. In some embodiments, the DNA-PK inhibitor and components of the genome editing system are incorporated into the cell nucleus. In some embodiments, administration comprises incubating the cell in the presence of a PK-DNA inhibitor and a genome editing system.

The gene editing system can be introduced into the cell(s) by any method known in the art. For example, any nucleic acid or protein delivery methods known in the art may be used. The gene editing system is introduced (eg, delivered) into the cell via a nucleic acid encoding components of the gene editing system. The gene editing system can be introduced into the cell with a viral or non-viral vector. In some embodiments, viral vectors are used. Viral vectors can be retroviral vectors (eg murine leukemia virus, HIV or lentivirus) or DNA viruses (eg adenovirus, herpes simplex virus and adeno-associated virus). In some embodiments, transfection methods (eg, non-viral delivery methods) are used to introduce the genome editing system into the cell. Transfection methods include contacting the cell with DEAE-dextran, calcium phosphate, liposomes, or electroporation of the plasmid into the cell. Additional non-viral delivery methods include the use of electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycations, or lipid:nucleic acid conjugates, naked DNA, naked RNA, artificial virions, and agent-enhanced DNA uptake. Sonoporation can also be used to deliver nucleic acids using, for example, the Sonitron 2000 system (Rich-Mar). In some embodiments, one or more nucleic acids are delivered as mRNA. In some embodiments, blocked mRNAs are used to improve translation efficiency and/or mRNA stability. In some embodiments, capped ARCAs or variants thereof are used (see US Pat. Nos. 7,074,596 and 8,153,773).

In some embodiments, an endonuclease (eg, Cas, Cpf1, etc.) and gRNA (guide RNA) are transcribed from DNA.

In some embodiments, an endonuclease (eg, Cas, Cpf1, etc.) is transcribed from DNA and the gPHK is RNA.

In some embodiments, the endonuclease (eg, Cas, Cpf1, etc.) and gRNA are provided as RNA.

In some embodiments, the endonuclease (eg, Cas, Cpf1, etc.) is provided as a protein and the gRNA is provided as DNA.

- 57 042641

In some embodiments, the endonuclease (eg, Cas, Cpf1, etc.) is provided as a protein and the gRNA is provided as RNA.

Additional nucleic acid delivery systems include those supplied by Amaxa Biosystems (Cologne, Germany), Maxcyte Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA) and Copernicus Therapeutics Inc. (See, for example, US 6008336). Lipofection is described, for example, in US Pat. Cationic and neutral lipids that are suitable for efficient lipofection of polynucleotides by the receptor recognition method include the lipids proposed by Feigner, the lipids described in WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or to target tissues (in vivo administration).

The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to those skilled in the art (see, for example, Crystal, Science 270: 404-410 (1995); Blaese et al. Cancer Gene Ther. 2: 291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2: 710-722 (1995).

Additional delivery methods include the use of EnGeneIC Delivery Vehicles (EDV) in which the nucleic acids are packaged. These EDV-specific nucleic acids are delivered to target tissues through the use of bispecific antibodies, where one arm of the antibody is specific to the target target tissue and the other arm is specific to the EDV. The antibody carries the EDV to the surface of the targeted target cells, and then the EDV enters the cell via endocytosis. After EDV enters the cell, its contents are released (see Macdiarm et al. (2009) Nature Biotechnology 27 (7): 643) Ahmad et al. Cancer Res 52: 4817-4820 (1992); US Pat.

In some embodiments, the transfection may be transient, in which the transfecting genome editing system containing the plasmid enters the nucleus but is not incorporated into the cell's genome during replication. Transfection can be stable, in which the transfected plasmid integrates into the genomic region of the cell.

In some embodiments of the invention that use transient expression, adenovirus-based systems can be used. Adenovirus-based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titers and high levels of expression have been obtained. Such a vector can be obtained in large quantities in a relatively simple system. Adeno-associated virus (AAV)-associated vectors are also used for cell transduction with target nucleic acids, for example, in vitro production of nucleic acids and peptides, as well as for in vivo and ex vivo gene therapy methods (see, for example, West et al., Virology 160:38-47 (1987); US Patent No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J., Clin. Invest. 94: 1351 (1994)). The construction of recombinant AAV vectors has been described in a number of publications, including US Pat. No. 5,173,414; Tratschin et al., Mol. cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol 63:03822-3828 (1989).

In some embodiments of the invention, the introduction of a DNA-RK inhibitor into the cell(s) is carried out by culturing the isolated cell(s) in the presence of the DNA-RK inhibitor and any suitable medium that allows the DNA-RK inhibitor to penetrate the cell membrane and/or cell nucleus.

In some embodiments of the invention, DNA-PK inhibitors are administered to the cell(s) under in vitro, in vivo, or ex vivo conditions. In some embodiments, the PKDNA inhibitor is contacted with the cell(s) for about 5 hours, 10 hours, 15 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 30 hours, 35 hours. h, 40 h, 45 h, 50 h, 55 h, 60 h, 65 h, 70 h, 85 h, 90 h, 100 h, 125 h, 150 h, 200 h, or any time in between . In some embodiments, the PKDNA inhibitor is contacted with the cell(s) for approximately 1.5 weeks, 2.0 weeks, 2.5 weeks, 3.0 weeks, 3.5 weeks, 4 weeks, or for any time interval between the specified values. The DNA-PK inhibitor can be reintroduced when changing the cell culture medium. The DNA-PK inhibitor can be contacted with the cell before, during or after the administration of the components of the genome editing system.

In some embodiments, the PKDNA inhibitor is administered to the cell(s) at a concentration of approximately 0.1 μM, 0.25 μM, 0.5 μM, 0.75 μM, 1.0 μM, 1.25 μM, 1, 50 µM, 1.75 µM, 2.0 µM, 2.5 µM, 3.0 µM, 3.5 µM, 4.0 µM, 4.5 µM, 5.0 µM, 5.5 µM, 6, 0 µm, 6.5 µm, 7.0 µm, 7.5 µm, 8.0 µm, 8.5 µm, 9.0 µm, 9.5 µm, 10 µm, 10.5 µM, 11.0 µM , 11.5 μM, 12 μM, or any concentration between the indicated values. The concentration of the DNA-PK inhibitor can be changed during administration.

In some embodiments, the gene editing components are delivered to the cell(s) by one or more vectors, either in the form of RNA, mRNA, or, in the case of an en-donuclease component, a purified protein or mRNA (e.g., Cas9 protein) . One or more vectors may include viral vectors, plasmids, or ssDNA. Viral vectors may include retroviral, lentiviral, adenovirus, adeno-associated and herpes simplex vectors, or any combination thereof. In some embodiments, gene editing components are delivered via RNA or synthetic RNA.

In some embodiments of the invention, the introduction of DNA-PK inhibitors into the cell together with the gene editing system to increase the number of results of gene editing of homologous targeted repair compared to the initial state in which the DNA-PK inhibitor is not introduced into the cell. In some embodiments, the introduction of PK DNA inhibitors into the cell(s) together with the gene editing system results in suppression of insertions/insertions (from NHEJ) either on or off the target. In some embodiments of the invention, the introduction of PK DNA inhibitors into the cell(s) together with the gene editing system results in increased or decreased expression of the gene of interest. The introduction of PK DNA inhibitors into the cell(s) together with the gene editing system can result in the expression of a gene that is not endogenous in the cell. In some embodiments of the invention, the introduction of DNA-PK inhibitors into the cell (s), together with the gene editing system, results in the complete or partial removal or modification of the gene from the cell (s).

In some embodiments of the invention, the introduction of DNA-PK inhibitors into the cell (s) together with the gene editing system results in the complete or partial removal or modification of the intron and/or exon in the cell (s). In some embodiments of the invention, the introduction of DNA-PK inhibitors into the cell (s), together with the gene editing system, results in the complete or partial removal or modification of a non-coding region in the cell (s). In some embodiments of the invention, the introduction of DNA-PK inhibitors into a cell, together with a gene editing system, results in the simultaneous or sequential, complete or partial removal or modification of a coding and/or non-coding genetic region in the cell (s). In some embodiments of the invention, the introduction of DNA-PK inhibitors into the cell (s) together with the gene editing system results in the simultaneous or sequential, complete or partial removal or modification of the coding and/or non-coding genetic region in the cell (s), including extrachromosomal DNA or RNA. The extrachromosomal DNA may be mitochondrial DNA, chloroplast DNA, extrachromosomal circular DNA, or viral extrachromosomal DNA.

In some embodiments of the invention, the introduction of PK DNA inhibitors into a cell, together with a genome editing system, results in increased or decreased expression of a gene of interest. In some embodiments, the increase or decrease in the expression of a gene of interest may be approximately 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, including intermediate values, compared with the initial state, when the DNA-PK inhibitor was not introduced into the cell. In some embodiments, the increase or decrease in the gene of interest may be approximately 0.5-fold, 1.0-fold, 1.5-fold, 2.0-fold, 2.5-fold, 3.0-fold, 3 .5-fold, 4-fold, 4.5-fold, 5-fold, or 10-fold, including intermediate values, compared with the baseline expression level when the DNA-PK inhibitor was introduced into the cell.

In some embodiments of the invention, the introduction of DNA-PK inhibitors into the cell together with the genome editing system leads to an increase in the effect of genome editing. In some embodiments, the increase in the effect of genome editing may be approximately 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, including intermediate values, compared with the baseline when the DNA-PK inhibitor was not injected into the cell. In some embodiments, the increase in the effect of genome editing may be approximately 0.5-fold, 1.0-fold, 1.5-fold, 2.0-fold, 2.5-fold, 3.0-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, or 10-fold, including intermediate values, compared to baseline when the DNA-PK inhibitor was injected into the cell.

In some embodiments of the invention, the introduction of the DNA-PK inhibitor and the gene editing system into the cell population results in greater cell survival compared to the initial state when only the gene editing system was introduced into the cell population and no DNA-PK inhibitor was introduced. In some embodiments, the DNA-PK inhibitor that results in greater cell survival is a compound of structural formula I, structural formula II, or structural formula II.

In some embodiments of the invention, the cell is synchronized in the S or G2 phase of the cell cycle before, after, or during administration of the PK-DNA inhibitor. In some embodiments of the invention, the cell is synchronized in the S or G2 phase of the cell cycle before, after, or during the administration of gene editing components. Cell synchronization in the S or G2 phase of the cell cycle can be achieved by any method known in the art. As a non-limiting example, agents that can be used to synchronize a cell in the S or G2 phase of the cell cycle include afidoline, diroxiurea, lovastatin, mimeotosin, nosodazole, thymidine, or any

- 59 042641 their combinations (see Lin et al. Elife. 2014 Dec 15; 32014). In some embodiments, cell synchronization agents may be administered at any time during the gene editing process.

In some embodiments, the PK DNA inhibitor and/or genome editing system may be included in a container, package, or dispenser, along with instructions for use. In some embodiments, the DNA-PK inhibitor and/or genome editing system included in the container, bag or dispenser, along with instructions for use, is a kit.

In some embodiments, the PK DNA inhibitors and/or the genome editing system are included in a kit with instructions for use. The kit may contain any genome editing system and/or DNA-PK inhibitor and instructions for use. In some embodiments, the PKDNA inhibitor is any of the compounds represented by structural formulas I, II', II, II', II, II', III, III', or any combination thereof. In some embodiments, the genome editing system is a system selected from a meganuclease-based system, a zinc finger nuclease (ZFN)-based system, a transcription activator-like effector nuclease (TALEN)-based system, a CRISPR-based system, or an NgAgo-based system. . The genome editing system may be present in the kit in any form, such as a plasmid, vector, DNA or RNA construct.

In some embodiments, the PK DNA inhibitor and/or genome editing system is administered in vivo. DNA-PK inhibitors and gene editing systems are formulated to be compatible with the intended route of administration. Examples of routes of administration include parenteral, eg, intravenous, intradermal, subcutaneous, oral (eg, inhalation), transdermal (ie, topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous administration may include the following components: a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetate buffer, citrate buffer or phosphate buffer; and tonicity adjusting agents such as sodium chloride or dextrose. The pH value can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. The parenteral preparation may be enclosed in ampoules, disposable syringes or multi-dose vials made of glass or plastic.

Suitable carriers for injectable use include sterile aqueous solutions (when the components are water soluble) or dispersions, and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. For intravenous (IV) administration, suitable vehicles include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). For such injectable and intravenous forms, the composition is sterile and fluid to the extent that they can be easily administered using a syringe. They are stable under the conditions of production and storage and are protected from the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.), and suitable mixtures. Suitable fluidity can be maintained, for example, using a particle coating such as lecithin to maintain the desired particle size in the case of a dispersion, and through the use of surfactants. The action of microorganisms can be prevented by using various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In some embodiments, isotonic agents such as sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride are included in the composition. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, such as, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active agent in the required amount in a suitable solvent using one or a combination of the ingredients listed above, if necessary, followed by filtered sterilization. Typically, dispersions are prepared by incorporating the active agent into a sterile vehicle which includes a basic dispersion medium and the necessary other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation are vacuum drying and freeze drying, which yield a powder of the active ingredient plus any additional desired ingredient from its previously sterile filtered solution.

Oral compositions typically include an inert diluent or edible carrier. Their

- 60 042641 can be enclosed in gelatin capsules or compressed into tablets. For oral therapeutic administration, the active compound may be incorporated into excipients and formulated into tablets, lozenges or capsules. Oral compositions may also be prepared using a liquid carrier for use as a mouthwash, wherein the compound in the liquid carrier is administered orally and washed off, coughed up or swallowed. Pharmaceutically compatible binding agents and/or excipients may be included as part of the composition. Tablets, pills, capsules, lozenges, etc. may contain any of the following ingredients or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrant such as alginic acid, Primogel or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetener such as sucrose or saccharin; or a flavor such as peppermint, methyl salicylate, or orange flavor.

When administered by inhalation, the agents are delivered in the form of an aerosol spray from a pressurized container or dispenser containing a suitable propellant, for example a gas such as carbon dioxide, or from a nebulizer.

Systemic administration can also be through mucous membranes or through the skin. For transmucosal or transdermal administration, the compositions use penetrants appropriate to the barrier through which penetration occurs. Such penetrants are well known in the art and include, for example, transmucosal agents, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration may be via nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, ointments, gels or creams, as is known in the art.

The agents may also be formulated in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal administration.

In some embodiments, the agents are formulated with carriers that protect the compound from rapid elimination from the body, such as a sustained/controlled release dosage form, including implants and microencapsulated delivery systems. Biodegradable biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid can be used. Methods for preparing such compositions are known to those skilled in the art.

For example, active agents can be included in microcapsules obtained, for example, by coacervation methods or by interfacial polymerization, for example, in capsules of hydroxymethylcellulose or gelatin, and, accordingly, in microcapsules of poly-(methyl methacrylate), included in colloidal drug delivery systems ( for example, in liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules) or macroemulsions.

Sustained release formulations can be obtained. Suitable examples of sustained release formulations include semi-permeable matrices of solid hydrophobic polymers containing the agent, where these matrices are in the form of molded articles such as films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl methacrylate) or poly(vinyl alcohol)), polylactides (see US Pat. No. 3,773,919), copolymers of L-glutamic acid and y-ethyl A-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic-glycolic acid copolymers such as LUPRON DEPOT™ (injectable microspheres consisting of a lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene vinyl acetate and lactic acid-glycolic acid allow molecules to be released for over 100 days, some hydrogels release proteins for shorter periods of time.

In some embodiments of the invention, the drug/composition may also contain more than one active compound that is necessary for the particular indication being treated, for example, compounds with additional activities that do not adversely affect each other. Alternatively or additionally, the composition may include an agent that enhances its function, such as, for example, a cytotoxic agent, a cytokine, a chemotherapeutic agent, or a growth inhibitory agent. Such molecules are suitably present in combination in amounts effective for the intended purpose.

In some embodiments, the PKDNA inhibitor and/or the genome editing system is administered as part of a combination therapy, i. in combination with other agents, such as therapeutic agents, which are useful in the treatment of pathological conditions or disorders such as various forms of cancer and inflammatory diseases. The term combined or in combination in this context means that the agents are administered substantially simultaneously, either simultaneously or sequentially. With sequential administration, at the time of the introduction of the second compound, the first of

- 61 042641 two compounds are preferably still found in effective concentrations at the site/area of treatment.

Screening methods for genome editing.

Any method known in the art can be used to screen cells for genome editing efficiency, including NHEJ and/or HDR efficiency. For example, screening methods may include PCR amplification of target regions followed by sequencing or deep sequencing of the amplified regions to confirm genome editing. PCR genotyping allows for the quantification and ranking of compounds upon HDR stimulation. Other screening methods may include next-generation sequencing (see, for example, Bell et al., A high-throughput screening strategy for detecting CRISPR-Cas9 induced mutations using next-generation sequencing, BMC Genomics, 15:1002 (2014)).

PCR primers can be designed to selectively amplify both unmodified and modified genetic regions, resulting in amplicons of varying lengths depending on the status of the genetic modification. Amplicons can then be separated on a gel and HDR performance assessed by densitometry using the Bio-Imager instrument. Alternatively, a new PCR technology, fast digital droplet PCR (DDPCR), can be used to simultaneously measure HDR and NHEJ results in genome-edited samples (see e.g. Miyaoka et al., Systematic quantification of HDR and NHEJ reveals effectrs of locus, nuclease, and cell type on genome-editin, Scientific Reports, 6, 2016). Other methods that can be used to screen cells for genome modifications include Sanger sequencing, deep sequencing, and RT-PCR.

In some embodiments, a traffic light reporter (TLR) construct is used to screen cells. TLR screening involves a reporter cell that is engineered to express a fluorescent marker upon targeted genome editing. After appropriate targeting, the fluorescent marker is expressed by the cell. Target cells can be quantified by any method known in the art, such as flow cytometry (see, for example, Certo et al. 2011, Tracking genome engineering outcome at individual DNA breakpoints, Nature Methods, 8, p. 671 -676 (2011)).

Relevant portions of all publications and patent documents cited herein are incorporated herein by reference, as if each such publication or document were specifically and individually indicated as being incorporated herein by reference. The citation of publications and patent documents does not purport to be any prior art, nor does it imply any acknowledgment of their content or the date of this document. The present invention has been disclosed and illustrated by means of the written description, and those skilled in the art will appreciate that many embodiments may be practiced, and that the above description and the examples below are for purposes of illustration only and not limitation of the following. invention formulas.

The use of DNA-RK inhibitors in the treatment/prevention of conditions.

In another embodiment, the invention relates to a pharmaceutical composition containing a compound of any of the formulas described herein and a pharmaceutically acceptable excipient. In an additional embodiment, the invention relates to a pharmaceutical composition containing a compound from table. 2. In a further embodiment of the invention, the compositions further comprise an additional therapeutic agent.

According to another embodiment, the present invention relates to a composition comprising a compound of the present invention, or a pharmaceutically acceptable derivative thereof, and a pharmaceutically acceptable carrier, excipient (adjuvant) or excipient. In one embodiment, the amount of a compound in a composition of the invention is such that it is effective to appreciably inhibit PK-DNA in a biological sample or patient. In another embodiment, the amount of the compound in the composition of the invention is such that it is effective to appreciably inhibit DNA-PK. In one embodiment, the composition of the invention is formulated for administration to a patient in need of administration of such a composition. In an additional embodiment, the composition of the present invention is formulated for oral administration to a patient.

Preparation of Compounds of the Invention

Section I. Training of hydroxyquinoxalinone intermediates.

Section I describes synthetic methods for preparing functionalized 8-hydroxy-1-methylquinoxalin-2(1H)-one intermediates. These intermediates are used in conjunction with an appropriate selection of the mesylate intermediate described in Section II to produce the compounds listed in Table 1. A.

- 62 042641

Synthesis of 8-hydroxy-1,3-dimethyl-6-morpholinoquinoxalin-2(1Н)-one.

Step 1 5-Bromo-1-fluoro-3-((4-methoxybenzyl)oxy)-2-nitrobenzene.

5-Bromo-1,3-difluoro-2-nitrobenzene (300 g, 1.261 mol) and p-methoxybenzyl alcohol (190 g, 1.375 mol) were dissolved in N,N-dimethylformamide (1.8 L). Cesium carbonate (611 g, 1.875 mol) was added to the resulting solution, the mixture was heated to 70° C. and stirred for 16 h. The mixture was cooled to room temperature and poured into cold water (2 L) to give a yellow solid precipitate. The precipitate was collected on a Buchner funnel and washed with water (2x500 ml). The precipitate was dissolved in dichloromethane (5 L), washed with water (2x1 L), brine (1 L), dried (Na ₂ SO ₄ ) and filtered through a silica gel plug (500 g). The silica gel pad was washed with dichloromethane (500 ml) and the combined filtrates were concentrated under reduced pressure. The residue was triturated with heptane (2 L) and dried in a vacuum oven at 50°C for 14 h to give 5-bromo-1-fluoro-3-((4-methoxybenzyl)oxy)2-nitrobenzene (350 g, 72% yield) as a yellow solid.

¹ H NMR (300 MHz, CDCl3) δ 7.35-7.27 (m, 2H), 7.08-6.99 (m, 2H), 6.97-6.87 (m, 2H), 5 .11(s, 2H), 3.82(s, 3H), 19F NMR (282 MHz, CDCb) δ -120.36.

Step 2 Methyl-(5-bromo-3-((4-methoxybenzyl)oxy)-2-nitrophenyl)glycinate.

To a mixture of 5-bromo-1-fluoro-3-[(4-methoxyphenyl)methoxy]-2-nitrobenzene (350 g, 0.914 mol) and methyl-2-aminoacetate (hydrochloride salt, 173 g, 1.364 mol) in N,N- dimethylformamide (2 L) was added triethylamine (350 ml, 2.511 mol). The resulting reaction mixture was heated to 50° C. and stirred at the same temperature for 54 hours. The reaction mixture was cooled to ambient temperature and poured into cold water (3 L) to give a light brown paste. The water was decanted and the light brown mass was dissolved in dichloromethane (5 L), washed with water (1 L), brine (1 L) and dried (Na ₂ SO ₄ ). The solution was filtered through a layer of silica gel and the layer was washed with dichloromethane (2x500 ml). The combined filtrate was concentrated under reduced pressure. The residue was triturated with methyl tert-butyl ether (2 L) and dried in a vacuum oven at 50° C. for 12 h to give methyl-(5-bromo-3-((4-methoxybenzyl)oxy)-2-nitrophenyl) glycinate (252 g, 62%) as a yellow solid.

1H NMR (300 MHz, CDCl ₃ ) δ 7.40-7.30 (m, 2H), 6.96-6.86 (m, 2H), 6.63 (t, J=4.9 Hz, 1H ), 6.58 (d, J=1.8 Hz, 1H), 6.40 (d, J=1.8 Hz, 1H), 5.07 (s, 2H), 3.96 (d, J = 5.2 Hz, 2H), 3.82 (s, 6H).

Step 3. 6-Bromo-8-((4-methoxybenzyl)oxy)-3,4-dihydroquinoxalin-2( 1 H)-one.

Platinum was added to a solution of methyl (5-bromo-3-((4-methoxybenzyl)oxy)-2-nitrophenyl)glycinate (52 g, 112.5 mmol) in tetrahydrofuran (700 ml) and methanol (400 ml) [7 g 3% May/May. on activated charcoal, reconstituted, 70% wet paste (ESCAT 2931), 1.076 mmol]. The reaction mixture was evacuated for 5 min, then placed under a hydrogen atmosphere (balloon feed) for 16 h. The reaction mixture was filtered through celite and the layer was washed with methanol (2x200 ml). The combined filtrates were concentrated under reduced pressure. The resulting residue was azeotropically distilled with dichloromethane (400 ml) and triturated with methyl tert-butyl ether to give 6-bromo-8-((4-methoxybenzyl)oxy)3,4-dihydroquinoxalin-2(1H)-one (39 g, 93%) as a tan solid.

1H NMR (300 MHz, DMSO-d6) δ 9.42 (s, 1H), 7.56-7.29 (m, 2H), 7.02-6.81 (m, 2H), 6.60 ( d, J=1.9 Hz, 1H), 6.49 (d, J=1.7 Hz, 1H), 6.19 (s, 1H), 5.05 (s, 2H), 3.75 ( s, 3H), 3.70 (s, 2H).

Step 4. 6-Bromo-8-((4-methoxybenzyl)oxy)quinoxalin-2(1H)-one.

6-Bromo-8-[(4-methoxyphenyl)methoxy]-3,4-dihydro-1H-quinoxalin-2-one (178 g, 0.485 mmol) was dissolved in chloroform (6.0 L). Manganese(IV) dioxide (400 g, 4.601 mol) was added to the resulting solution. The resulting reaction mixture was concentrated in vacuo, heated to 55° C. and stirred for 4 hours. The reaction mixture was cooled to ambient temperature and filtered through a plug of silica gel. The layer was washed with 40% ethyl acetate in dichloromethane (4x500 ml). The combined filtrates were concentrated under reduced pressure. The resulting residue was triturated with ethyl acetate/methyl tert-butyl ether (1:2, 3 L) and dried in a vacuum oven at 50°C for 14 h to give 6-bromo-8((4-methoxybenzyl)oxy)quinoxaline-2( 1H)-one (125 g, 71%) as a tan solid.

1H NMR (300 MHz, DMSO-d6) δ 12.06 (s, 1H), 8.19 (s, 1H), 7.67-7.33 (m, 4H), 7.03-6.85 ( m, 2H), 5.26 (s, 2H), 3.75 (s, 3H).

- 63 042641

Step 5 6-Bromo-8-((4-methoxybenzyl)oxy)-1-methylquinoxalin-2( 1 H)-one.

To a solution of 6-bromo-8-((4-methoxybenzyl)oxy)quinoxalin-2(1H)-one (125 g, 0.343 mmol) in N,NdimethylFormamide (4.0 L) was added methyl iodide (110 ml, 1.767 mol) . The resulting mixture was cooled to 0° C. in an ice bath and sodium hydride (35 g, 60% w/w 0.875 mmol) was added portionwise over 20 min. The resulting reaction mixture was stirred at <3° C. for 30 min, HPLC analysis showed that the ratio of N-methylation to O-methylation in the product was approximately 85:15. The reaction mixture was poured into cold water (4.0 L) to give a yellow precipitate. The solid was collected on a Buchner funnel, washed with water (2 x 1.0 L) and dried in a convection oven at 50° C. for 4 hours. The precipitate (85:15 ratio) was suspended in 20% ethyl acetate in methyl tert-butyl ether (3 0 L), refluxed for 1 hour and cooled to ambient temperature. The mixture was filtered through a medium frit funnel and dried in a vacuum oven at 50° C. for 5 hours to give the N-methylated product (120 g) with a purity of 96%. The product was resuspended in 20% ethyl acetate in methyl tert-butyl ether (3.0 L), refluxed for 1 h, filtered and dried in vacuo as described above to give 6-bromo-8-((4 -methoxybenzyl)oxy)-1-methylquinoxalin-2(1H)-one (90 g) 99% pure as a yellow solid. The filtrate was further concentrated under reduced pressure and the residue was purified by silica gel chromatography (330 g Isco gold column, linear gradient: 0%-60% ethyl acetate/dichloromethane) to give additional crop of desired product 3 (13 g, 99% pure).

1H NMR (300 MHz, CDCl ₃ ) δ 8.26 (s, 1H), 7.63 (d, J=2.2 Hz, 1H), 7.40-7.29 (m, 2H), 7, 26 (s, 1H), 7.056.83 (m, 2H), 5.05 (s, 2H), 3.84 (d, J=1.7 Hz, 6H).

ESI-MS m/z calculated 374.03, found 375.05 (M+1).

Step 6 8-((4-Methoxybenzyl)oxy)-1-methyl-6-morpholinoquinoxalin-2(1H)-one.

A mixture of 6-bromo-8-[(4-methoxyphenyl)methoxy]-1-methylquinoxalin-2-one (103 g, 270.9 mmol) and morpholine (36 ml, 412.8 mmol) in dioxane (2.0 L ) was deoxygenated by bubbling a stream of nitrogen gas through the solution for 10 minutes. Palladium(II) acetate (1.3 g, 5.790 mmol), RuPhos (5.5 g, 11.79 mmol) and cesium carbonate (200 g, 613.8 mmol) were added successively. The reaction mixture was deoxygenated with a stream of nitrogen for an additional 10 minutes. The resulting reaction mixture was heated to 80° C. and stirred for 14 hours. The reaction mixture was cooled to ambient temperature and concentrated under reduced pressure to remove dioxane. Cold water (2.5 L) was added and a yellow precipitate formed. The precipitate was collected on a Buchner funnel, washed with water (500 ml) and dried in a convection oven. The residue was purified by silica gel chromatography (4 x 330 g column, linear gradient, 0% - 10% methanol/dichloromethane) to give 8-((4-methoxybenzyl)oxy)-1methyl-6-morpholinoquinoxalin-2(1H)-one (68 g , 66%) as a yellow solid.

1H NMR (300 MHz, CDCl ₃ ) δ 8.25 (s, 1H), 7.41-7.28 (m, 2H), 7.03-6.89 (m, 3H), 6.82 (d , J=2.7 Hz, 1H), 5.05 (s, 2H), 3.93-3.87 (m, 4H), 3.86 (s, 3H), 3.84 (s, 3H) , 3.46-2.82 (m, 4H).

ESI-MS m/z calculated 381.17, found 382.21 (M+1).

Step 7 8-Hydroxy-1-methyl-6-morpholinoquinoxalin-2(1H)-one.

8-((4-Methoxybenzyl)oxy)-1-methyl-6-morpholinoquinoxalin-2(1H)-one (13.90 g, 36.44 mmol) was dissolved in dichloromethane (250 ml). Trifluoroacetic acid (31.0 ml, 402 mmol) was added and the resulting dark brown solution was stirred at room temperature for 3 hours. The solvent was evaporated in vacuo, the residue was dissolved in dichloromethane and filtered through a plug of silica gel. To elute the high Rf impurities, the silica gel layer was eluted first with dichloromethane and the impurity eluate was removed. The eluent was changed to acetone, which resulted in the elution of a yellow-orange band. This band was collected and concentrated to dryness to give 8-hydroxy-1-methyl-6-morpholinoquinoxalin-2(1H)-one (8.89 g, 50% yield).

¹ H NMR (300 MHz DMSO-d6) δ 10.23 (s, 1H), 8.11 (s, 1H), 6.77 (d, J=3.1 Hz, 2H), 3.84 (s , 3H), 3.813.70 (m, 4H), 3.19-2.99 (m, 4H).

Zn, _NH4CI

2% TPGS-750-M in water, room pace.

Synthesis of 8-hydroxy-1,3-dimethyl-6-morpholinoquinoxalin-2(1Н)-one.

Step 1 5-fluoro-3-[(4-methoxyphenyl)methoxy]-2-nitroaniline

To a solution of (4-methoxyphenyl)methanol (4.17 g, 30.18 mmol) in tetrahydrofuran (52.4 ml) was added

- 64 042641 sodium hydride (60% dispersion in mineral oil; 1.28 g, 32.00 mmol). The resulting mixture was stirred for 10 min, treated with 3,5-difluoro-2-nitroaniline (5 g, 28.72 mmol) and stirred for another 1 h. hydrochloric acid until the red color changes to yellow-orange. The organic layers were collected, dried (Na ₂ SO ₄ ), filtered and concentrated. The crude residue was purified by silica gel chromatography (330 g ISCO column, linear gradient 0-25% ethyl acetate/heptane) to give 5-fluoro3-[(4-methoxyphenyl)methoxy]-2-nitroaniline as a yellow-orange solid.

Step 2 3-[(4-Methoxyphenyl)methoxy]-5-morpholino-2-nitroaniline.

Solution of 5-fluoro-3-[(4-methoxyphenyl)methoxy]-2-nitroaniline (4.64 g, 15.88 mmol) and morpholine (7.0 ml, 80.27 mmol) in dimethyl sulfoxide (13.6 ml ) was heated to 100° C. for 2.5 hours. The mixture was partitioned between ethyl acetate and water. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic layers were dried (Na ₂ SO ₄ ), filtered and concentrated to give 3-[(4methoxyphenyl)methoxy]-5-morpholino-2-nitroaniline (5.70 g, 100%) yield) as an orange solid which used without further processing.

ESI-MS m/z calculated 359.15, found 360.17 (M+1).

Step 3 3-[(4-Methoxyphenyl)methoxy]-5-morpholino-benzene-1,2-diamine

A mixture of 3-[(4-methoxyphenyl)methoxy]-5-morpholino-2-nitroaniline (5.66 g, 15.75 mmol), ammonium chloride (1.53 g, 28.60 mmol), zinc (5.59 g, 85.46 mmol) and 2% TPGS-750-M in water (31 ml) were stirred overnight. Celite was added to absorb water, followed by ethyl acetate. The mixture was filtered and the Celite layer was further washed with ethyl acetate. The combined filtrate was concentrated and the crude residue was purified by silica gel chromatography (330 g, silica gel cartridge; linear gradient 0-5% methanol/dichloromethane) to give 3-[(4-methoxyphenyl)methoxy]-5-morpholino-benzene1,2-diamine (3.41 g, 66% yield) as a red solid.

ESI-MS m/z calculated 329.17, found 330.19 (M+1).

Step 4 8-[(4-Methoxyphenyl)methoxy]-3-methyl-6-morpholino-1H-quinoxalin-2-one.

A mixture of 3-[(4-methoxyphenyl)methoxy]-5-morpholino-benzene-1,2-diamine (315 mg, 0.956 mmol), ethyl pyruvate (212 μl, 1.908 mmol) and methanol (3.0 ml) was heated in an airtight closed vessel at 65° C. for 2 hours. A solid precipitated from the reaction mixture. The reaction mixture was cooled to room temperature, water was added and the mixture was stirred for 30 minutes. The solid was collected by filtration, washed with water and dried in vacuo overnight to give a regioisomeric mixture of products (365 mg, ratio 1.7:1, dominated by the title compound shown in the scheme). The resulting mixture was purified with SFC to give the desired isomer 8-((4-methoxyphenyl)methoxy)-3-methyl-6-morpholino-1H-quinoxalin-2-one (110 mg) and the unwanted isomer 5-((4-methoxybenzyl)oxy )-3-methyl-7-morpholinoquinoxalin-2(1 H)-one (64 mg).

Data for 8-((4-methoxybenzyl)oxy)-3-methyl-6-morpholinoquinoxalin-2(1H)-one:

¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.56 (s, 1H), 7.55-7.46 (m, 2H), 6.98 (d, J=2.3 Hz, 1H) , 6.95-6.89 (m, 2H), 6.72 (d, J=2.3 Hz, 1H), 5.21 (s, 2H), 3.74 (m, 7H), 3. 10 (m, 4H), 2.78 (q, J=7.4 Hz, 2H), 1.23-1.14 (t, 3H).

ESI-MS m/z calculated 381.17, found 382.17 (M+1).

Data for 5-((4-methoxybenzyl)oxy)-3-methyl-7-morpholinoquinoxalin-2(1H)-one:

1H NMR (400 MHz, DMSO-d ₆ ) δ 11.96 (s, 1H), 7.49-7.38 (m, 2H), 7.00-6.90 (m, 2H), 6.60 (d, J=2.4 Hz, 1H), 6.21 (d, J=2.4 Hz, 1H), 5.17 (s, 2H), 3.75 (m, 7H), 3.18 (m, 4H), 2.69 (q, J=7.4 Hz, 2H), 1.17 (t, J=7.4 Hz, 3H).

ESI-MS m/z calculated 381.17, found 382.17 (M+1).

Step 5 8-((4-Methoxybenzyl)oxy)-1,3-dimethyl-6-morpholinoquinoxalin-2(1H)-one.

A mixture of 8-[(4-methoxyphenyl)methoxy]-3-methyl-6-morpholino-1H-quinoxalin-2-one (110 mg, 0.274 mmol), potassium carbonate (183 mg, 1.324 mmol) and acetone (3.0 ml) was treated with methyl iodide (21 μl, 0.337 mmol). The resulting reaction mixture was sealed and stirred at 60° C. overnight. The mixture was partitioned between ethyl acetate and water. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic layers were dried (Na ₂ SO ₄ ), filtered and concentrated. The crude residue was purified by silica gel chromatography (4 g silica gel; linear gradient 0-10% methanol/dichloromethane) to give 8-((4-methoxybenzyl)oxy)-1,3-dimethyl-6-morpholinoquinoxalin2(1H)-one (94 mg, 82%).

1H NMR (400 MHz, DMSO-d ₆ ) δ 7.48-7.41 (m, 2H), 7.04 (d, J=2.7 Hz, 1H), 6.99-6.94 (m , 2H), 6.79 (d, J=2.6 Hz, 1H), 5.15 (s, 2H), 3.76 (m, 10H), 3.16 (m, 4H), 2.38 (s, 3H).

ESI-MS m/z calculated 395.18, found 396.26 (M+1).

Step 6 8-Hydroxy-1,3-dimethyl-6-morpholinoquinoxalin-2(1H)-one.

A solution of 8-[(4-methoxyphenyl)methoxy]-1,3-dimethyl-6-morpholinoquinoxalin-2-one (88 mg, 0.177 mmol) stirred in dichloromethane (5.0 mL) was treated with trifluoroacetic acid. The resulting solution was stirred at room temperature for 1 hour. The reaction mixture was concentrated and the crude residue was used without further purification.

ESI-MS m/z calculated 275.13, found 276.14 (M+1).

- 65 042641

Synthesis of 1-ethyl-8-hydroxy-6-morpholinoquinoxalin-2( 1 H)-one.

Step 1. 8-((4-Methoxybenzyl)oxy)-6-morpholinoquinoxalin-2(III)-one.

Ethylglyoxalate (9.3 ml 50% w/v in toluene, 45.55 mmol). The resulting solution was sealed in a flask and heated at 65°C for 2 h. A solid precipitated from the reaction mixture. The reaction mixture was cooled to room temperature and water was added. The solid was collected by filtration, washed with water, triturated with isopropanol and dried in vacuo to give a regioisomeric mixture of products (6.34 g). The resulting mixture was purified with SFC [IB prep column using 40% ethanol (5 mM ammonia)] to give the desired regioisomer, 8-[(4-methoxyphenyl)methoxy]-6-morpholino-1H-quinoxalin-2-one ( 3.48 g), as well as the unwanted regioisomer -5-[(4-methoxyphenyl)methoxy]-7-morpholino-1H-quinoxalin-2-one (2.35 g).

Data for 8-[(4-methoxyphenyl)methoxy]-6-morpholino-1H-quinoxalin-2-one:

1H NMR (400 MHz, DMSO-d6) δ 11.80 (s, 1H), 8.12 (s, 1H), 7.55-7.47 (m, 2H), 7.06 (d, J= 2.4 Hz, 1H), 6.96-6.89 (m, 2H), 6.76 (d, J=2.3 Hz, 1H), 5.23 (s, 2H), 3.76 ( m, 7H), 3.12 (m, 4H).

ESI-MS m/z calculated 367.15, found 368.09 (M+1).

Data for 5-[(4-methoxyphenyl)methoxy]-7-morpholino-1H-quinoxalin-2-one:

¹ H NMR (400 MHz, DMSO-d ₆ ) δ 12.08 (s, 1H), 7.72 (s, 1H), 7.46-7.37 (m, 2H), 7.02-6, 92 (m, 2H), 6.63 (d, J=2.3 Hz, 1H), 6.19 (d, J=2.3 Hz, 1H), 5.14 (s, 2H), 3. 77 (m, 7H), 3.24 (m, 4H).

ESI-MS m/z calculated 367.15, found 368.09 (M+1).

Step 2 1-Ethyl-8-[(4-methoxyphenyl)methoxy]-6-morpholinoquinoxalin-2-one.

To a solution of 8-[(4-methoxyphenyl)methoxy]-6-morpholino-1H-quinoxalin-2-one (150 mg, 0.408 mmol) in acetone (4.3 ml) was added potassium carbonate (273 mg, 1.975 mmol) and iodoethane (40 µl, 0.500 mmol). The resulting reaction mixture was sealed in a flask and stirred at 60° C. overnight. The mixture was partitioned between ethyl acetate and water. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic layers were dried (Na ₂ SO ₄ ), filtered and concentrated. The crude residue was purified by silica gel chromatography (4 g silica gel; linear gradient 0-10% methanol/dichloromethane) to give 1-ethyl-8-[(4-methoxyphenyl)methoxy]-6-morpholinoquinoxalin-2-one (55 mg, yield 32%).

1H NMR (400 MHz, DMSO-d6) δ 7.46 (d, J=8.7 Hz, 2H), 7.16 (d, J=2.5 Hz, 1H), 6.99-6.93 (m, 2H), 6.86 (d, J=2.5 Hz, 1H), 5.26 (s, 2H), 4.43 (q, J=7.0 Hz, 2H), 3.78 (m, 4H), 3.76 (s, 3H), 3.23 (m, 4H), 1.40 (t, J=7.1 Hz, 3H).

ESI-MS m/z calculated 395.18, found 396.23 (M+1).

Stage 3. 1-Ethyl-8-hydroxy-6-morpholinoquinoxalin-2-one.

Trifluoroacetic acid was added to a solution of 1-ethyl-8-[(4-methoxyphenyl)methoxy]-6-morpholinoquinoxalin-2-one (50 mg, 0.1264 mmol) in dichloromethane (approximately 1.0 ml). The resulting red reaction solution was concentrated and used without further processing.

ESI-MS m/z calculated 275.13, found 276.14 (M+1).

6-Bromo-8-hydroxy-1-methylquinoxalin-2( 1 H)-one.

A solution of 6-bromo-8-[(4-methoxyphenyl)methoxy]-1-methylquinoxalin-2-one (4 g, 10.66 mmol) in acetic acid (56 ml) was heated to 100°C for 5 h. the mixture was cooled to room temperature and left to stand overnight, obtaining a yellow precipitate. The solid was collected by vacuum filtration, washed with diethyl ether and dried in vacuo to give 6-bromo-8-hydroxy-1-methylquinoxalin-2-one (1.92 g, 69% yield).

1H NMR (400 MHz, DMSO-d ₆ ) δ 8.21 (s, 1H), 7.44 (d, J=2.3 Hz, 1H), 7.19 (d, J=2.3 Hz, 1H), 3.86 (s, 3H).

ESI-MS m/z calculated 253.97, found 254.97 (M+1).

8-Hydroxy-1-methyl-6-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)quinoxalin-2-one.

6-bromo-8-hydroxy-1-methylquinoxalin-2-one (312 mg, 1.223 mmol), 6-oxa-3-azabicyclo[3.1.1]heptane (hydrochloride; 201 mg, 1.482 mmol), RuPhos-G3- palladacycle (52 mg, 0.062 mmol) and RuPhos (29 mg, 0.062 mmol) were combined in a sealed vessel under nitrogen atmosphere. Added

- 66 042641 lithium bis-(trimethylsilyl)amide (3 ml of a 1.0 M solution in tetrahydrofuran, 3.000 mmol) and the vessel was heated to 65 °C overnight. The reaction mixture was cooled to room temperature, diluted with ethyl acetate and filtered. The filtrate was concentrated and the crude residue was purified by amino-functionalized silica gel chromatography (12 g cartridge, 0-10% methanol/dichloromethane linear gradient) to give 8-hydroxy-1-methyl-6-(6-oxa-3-azabicyclo[3.1.1 ]heptan-3-yl)quinoxalin-2-one (214 mg, 64% yield).

ESI-MS m/z calculated 273.11, found 274.24 (M+1).

Synthesis of 6-(3,6-dihydro-2H-pyran-4-yl)-8-hydroxy-1-methylquinoxalin-2-one.

Step 1. 6-(3,6-Dihydro-2H-pyran-4-yl)-8-((4-methoxybenzyl)oxy)-1-methylquinoxalin-2(1H)-one.

6-Bromo-8-[(4-methoxyphenyl)methoxy]-1-methylquinoxalin-2-one mixture (4.0 g, 10.66 mmol), 2-(3,6dihydro-2H-pyran-4-yl) -4,4,5,5-tetramethyl-1,3,2-dioxaborolane (2.72 g, 12.95 mmol), sodium carbonate (8 ml of 2.0 M aqueous solution, 16.00 mmol) and dioxane ( 40 ml) was degassed by bubbling nitrogen gas through the mixture for 10 minutes. [1,1'-bis-(diphenylphosphino)ferrocene]dichloropalladium(II) (dichloromethane complex; 881 mg, 1.079 mmol) was added. The resulting reaction mixture was degassed for an additional 5 minutes, then heated to 85° C. for 4 hours. The mixture was cooled to room temperature and partitioned between water and ethyl acetate. The layers were separated and the aqueous layer was further extracted with ethyl acetate. The combined organic layers were washed with brine, dried (MgSO ₄ ), filtered and concentrated. The crude residue was purified by silica gel chromatography (30 g silica gel, linear gradient 0-50% ethyl acetate/heptane) to give 6-(3,6-dihydro-2H-pyran-4-yl)-8-[(4-methoxyphenyl)methoxy ]-1-methylquinoxalin-2-one (2.81 g, 69% yield) as a yellow solid.

1H NMR (400 MHz, DMSO-d6) δ 8.21 (s, 1H), 7.52-7.42 (m, 4H), 7.02-6.94 (m, 2H), 6.48- 6.42 (m, 1H), 5.22 (s, 2H), 4.27 (kv, J=2.8 Hz, 2H), 3.85 (t, J=5.5 Hz, 2H), 3.78 (s, 3H), 3.77 (s, 3H).

ESI-MS m/z calculated 378.16, found 379.17 (M+1).

Step 2 6-(3,6-Dihydro-2H-pyran-4-yl)-8-hydroxy-1-methylquinoxalin-2-one.

To a solution of 6-(3,6-dihydro-2H-pyran-4-yl)-8-[(4-methoxyphenyl)methoxy]-1-methylquinoxalin-2-one (1.81 g, 4.783 mmol) in dichloromethane ( 20 ml) trifluoroacetic acid (5.0 ml, 64.90 mmol) was added. The resulting reaction solution was stirred for 2 hours and concentrated. The crude residue was partitioned between ethyl acetate and saturated aqueous sodium bicarbonate. The layers were separated and the aqueous layer was extracted with ethyl acetate. The combined organic extracts were washed with brine, dried (MgSO4), filtered and concentrated. Dichloromethane was added giving a brown precipitate which was collected by vacuum filtration to give 6-(3,6-dihydro-2H-pyran4-yl)-8-hydroxy-1-methylquinoxalin-2-one (1.10 g, 82% yield ).

1H NMR (400 MHz, DMSO-d6) δ 10.40 (s, 1H), 8.18 (s, 1H), 7.32 (d, J=2.1 Hz, 1H), 7.20 (d , J=2.2Hz, 1H), 6.26(dp, J=3.1, 1.5Hz, 1H), 5.76(s, 1H), 4.24(kv, J=2, 8 Hz, 2H), 3.88 (s, 3H), 3.83 (t, J=5.5 Hz, 2H), 2.48-2.40 (m, 2H).

ESI-MS m/z calculated 258.10, found 259.16 (M+1).

Section II. Preparation of intermediate mesylate compounds.

Section II describes synthetic methods for the preparation of intermediate mesylate compounds. These intermediates, together with the appropriate selection of 8-hydroxy-1-methylquinoxalin-2(1H)one (described in section I) lead to the compounds presented in table. And using the methods described in section III.

(1,4-trans)-4-(Pyrimidin-2-yloxy)cyclohexylmethanesulfonate.

Step 1: (1,4-trans)-4-((tert-Butyldimethylsilyl)oxy)cyclohexan-1-ol.

To a solution of (1,4-trans)cyclohexane-1,4-diol (70 g, 602.6 mmol) and imidazole (130 g, 1.910 mol) in dichloromethane (1.5 L) was added tert-butylchlorodimethylsilane (100 g, 663.5 mmol) in one serving. The resulting reaction mixture was allowed to warm to room temperature and stirred for 24 h, while TLC analysis revealed a mixture of starting material, desired product and bisaddition product. The reaction mixture was poured into water (300 ml). The organic layer was separated and the aqueous layer was extracted with dichloromethane (100 ml). The combined organic extracts were washed with water (100 ml) and brine (100 ml), dried (Na ₂ SO ₄ ), filtered and concentrated under reduced pressure. The crude residue was purified by silica gel chromatography (800 g, silica gel column, linear gradient 0-50% ethyl acetate in heptane) to give (1,4-trans)-4-[tert

- 67 042641 butyl(dimethyl)silyl]oxocyclohexanol (58 g, 41%) as a white solid.

1H NMR (400 MHz, DMSO-d ₆ ) δ 4.44 (d, J=4.1 Hz, 1H), 3.69-3.50 (m, 1H), 3.48-3.35 (m , 1H), 1.84-1.60 (m, 4H), 1.37-1.09 (m, 4H), 0.84 (s, 9H), 0.02 (s, 6H).

Step 2 2-((1,4-trans)-4-((tert-Butyldimethylsilyl)oxy)cyclohexyl)oxy)pyrimidine.

To a solution of (1,4-trans)-4-[tert-butyl(dimethyl)silyl]oxocyclohexanol (13.7 g, 58.86 mmol) and 2-chloropyrimidine (9 g, 74.65 mmol) in N,N-dimethylformamide (100 ml) sodium hydride (5 g 60% w/w, suspension in mineral oil, 125.0 mmol) was added in one portion. The resulting reaction mixture was allowed to warm to room temperature over 30 minutes and continued stirring for another 10 hours. The reaction mixture was poured into ice water (400 ml), resulting in a precipitate of a tan solid. The solid was collected by vacuum filtration, washed with water (3 x 100 ml) and dried in a vacuum oven at 50°C for 16 h to obtain (1,4-trans)-tert-butyldimethyl-(4-pyrimidin-2-yloxycyclohexoxy)silane ( 18.8 g, 95% purity, 98% yield, which was used further without further purification.

¹ H NMR (300 MHz, DMSO-d ₆ ) δ 8.57 (d, J=4.8 Hz, 2H), 7.08 (t, J=4.8 Hz, 1H), 5.04-4 .80 (m, 1H), 3.903.68 (m, 1H), 2.11-1.95 (m, 2H), 1.93-1.76 (m, 2H), 1.64-1.47 (m, 2H), 1.46-1.30 (m, 2H), 0.87 (s, 9H), 0.05 (s, 6H).

Step 3. (1,4-trans)-4-(Pyrimidin-2-yloxy)cyclohexan-1-ol.

Triethylamine trihydrofluoride ( 40 g, 248.1 mmol). The resulting reaction mixture was stirred at room temperature for 24 hours. The reaction mixture was cooled to 0° C. in an ice bath and aqueous ammonium hydroxide (30 g, 30% w/w, 256.8 mmol) was added followed by water (100 ml) and ethyl acetate (200 ml). The organic layer was separated and the aqueous layer was further extracted with ethyl acetate (100 ml). The combined organic extracts were washed with water (100 ml) and brine (100 ml), dried (Na ₂ SO ₄ ), filtered and concentrated under reduced pressure to give (1,4-trans)-4-pyrimidin-2yloxycyclohexanol (16, 2 g, 99%) as a pale yellow viscous oil.

1H NMR (300 MHz, CDCl ₃ ) δ 8.48 (d, J=4.8 Hz, 2H), 6.89 (t, J=4.8 Hz, 1H), 5.09-4.87 ( m, 1H), 3.91-3.62 (m, 1H), 2.29-2.10 (m, 2H), 2.10-1.95 (m, 2H), 1.68-1, 36 (m, 4H).

Step 4: (1,4-trans)-4-(Pyrimidin-2-yloxy)cyclohexylmethanesulfonate.

To a solution of (1,4-trans)-4-pyrimidin-2-yloxycyclohexanol (16.2 g, 82.6 mmol) and diisopropylethylamine (40 ml, 229.6 mmol) in dichloromethane was added dropwise a solution of methanesulfonyl chloride over 25 min. (8 ml, 103.4 mmol) in dichloromethane (50 ml). The resulting reaction mixture was stirred for 30 min at 0°C. The reaction mixture was quenched by adding saturated aqueous sodium bicarbonate (100 ml). The organic layer was separated and the aqueous layer was further extracted with dichloromethane (100 ml). The combined organic layers were dried over anhydrous sodium sulfate, washed with saturated aqueous sodium bicarbonate, dried (Na ₂ SO ₄ ), filtered and concentrated under reduced pressure. The crude residue was purified by silica gel chromatography (330 g, Isco gold column, linear gradient 0-50% ethyl acetate/dichloromethane) to give (1,4-trans)(4-pyrimidin-2-yloxy-cyclohexyl)methanesulfonate (19.4 g, 85% yield as a white solid.

1H NMR (400 MHz, CDCl ₃ ) δ 8.49 (d, J=4.8 Hz, 2H), 6.91 (t, J=4.8 Hz, 1H), 5.25-5.02 ( m, 1H), 4.98-4.77 (m, 1H), 3.03 (s, 3H), 2.33-2.04 (m, 4H), 1.95-1.72 (m, 4H).

SI-MS m/z calculated 272.32, found 273.07 (M+1).

But.

TBS-CI imidazole no.

NaH

2-chloro-5-methoxypyrimidine ^С1 ^ from 0° to room temperature, 'OTBS DMF, from 0“ to room temperature pace.

OTBS triethylamine hydrofluoride

CH ₃ SO _a CI r-Pr ₂ NEt

MeOH, THF'OH'OMs (1,4-trans)-4-((5-Methoxypyrimidin-2-yl)oxy)cyclohexylmethanesulfonate.

Obtained according to the above 4-step synthesis scheme for (1,4-trans)-4-(pyrimidin-2yloxy)cyclohexylmethanesulfonate.

1H NMR (400 MHz, CDCl ₃ ) δ 8.17 (s, 2H), 5.13-4.95 (m, 1H), 4.94-4.73 (m, 1H), 3.85 (s , 3H), 3.02 (s, 3H), 2.37-1.99 (m, 4H), 1.94-1.68 (m, 4H).

NaH

4-chloro-2-methylpyrimidine ’V’ HC

L J. ----------------** s JLJ _r ------------MM OTBS DMF, 60 ^r C OTBS r-PrOH, 20 C

_OM5

- 68 042641 (1,4-trans)-4-((2-methylpyrimidin-4-yl)oxy)cyclohexylmethanesulfonate.

Step 1 4-((1,4-trans)-4-((tert-Butyldimethylsilyl)oxy)cyclohexyl)oxy)-2-methylpyrimidine.

To a solution of (1,4-trans)cyclohexane-1,4-diol (2 g, 17.05 mmol) and 4-chloro-2-methylpyrimidine (1.5 g, 11.67 mmol) in N,N-dimethylformamide (10 ml) sodium hydride (950 mg, 60% w/w, suspension in mineral oil, 23.75 mmol) was added in one portion. The cooling bath was removed and the reaction mixture was heated to 60° C. for 2 hours. The reaction mixture was cooled to room temperature and poured into ice water (60 ml) to give a tan precipitate. The solid was collected by vacuum filtration, washed with water (2x10 ml) and dried in a vacuum oven at 60° C. for 14 h to give the unwanted bis-adduct, 2-methyl-4-[4-(2-methyl-pyrimidin-4-yl) oxocyclohexoxy]pyrimidine (1.1 g, 31%). The filtrate from the vacuum filtration was extracted with 2-methyltetrahydrofuran (4x60 ml), the combined filtrates were dried (Na ₂ SO ₄ ), filtered and concentrated under reduced pressure to give a yellow oil which was purified by silica gel chromatography (linear gradient 0-100% ethyl acetate/heptane) to give the title product, (1,4-trans)-4-(2methylpyrimidin-4-yl)oxohexanol (1.23 g, 95% purity, 48% yield) as a white solid.

¹ H NMR (300 MHz, CD3OD) δ 8.39-8.18 (m, 1H), 6.76-6.38 (m, 1H), 5.24-5.02 (m, 1H), 3 .81-3.62(m, 1H), 3.54(s, 1H), 2.66-2.39(m, 3H), 2.26-1.80(m, 4H), 1.69 -1.15 (m, 4H).

ESI-MS m/z calculated 208.26, found 209.13 (M+1).

Stage 2

A solution of tert-butyldimethyl-[4-(2-methylpyrimidin-4-yl)oxycyclohexoxy]silane (17.82 g, 54.70 mmol) in isopropyl alcohol (225 ml) was treated with concentrated hydrochloric acid (16 ml of a 12 M solution, 192 .0 mmol). The resulting reaction mixture was stirred for 2 hours at room temperature. The reaction mixture was concentrated under reduced pressure and the residue was azeotropically distilled with ethyl acetate (2x200 ml) to give a tan solid. The crude residue was further purified by trituration with methyl tert-butyl ether (100 ml) and dried in a vacuum oven at 50° C. for 14 h to give (1,4-trans)-4-(2-methylpyrimidin-4yl)oxocyclohexanol ( 11.57 g, 98%) as a tan solid, which was carried on without further purification.

1H NMR (300 MHz, DMSO-d6) δ 8.62 (d, J=6.6 Hz, 1H), 7.07 (d, J=6.6 Hz, 1H), 5.30-4.95 (m, 1H), 3.643.42 (m, 1H), 2.66 (s, 3H), 2.17-1.95 (m, 2H), 1.95-1.75 (m, 2H), 1.65-1.43 (m, 2H), 1.43-1.22 (m, 2H).

Step 3: (1,4-trans)-4-((2-Methylpyrimidin-4-yl)oxy)cyclohexylmethanesulfonate.

The preparation of the mesylate was carried out in accordance with the procedure described above for the preparation of (1,4-trans)-4-(pyrimidin-2-yloxy)cyclohexylmethanesulfonate. (1,4-trans)-4-(2methylpyrimidin-4-yl)oxocyclohexanol was used as the starting material for the preparation of (1,4-trans)-4((2-methylpyrimidin-4-yl)oxy)cyclohexylmethanesulfonate (yield 85 %) as a tan solid.

1H NMR (300 MHz, CDCl3) δ 8.31 (d, J=5.8 Hz, 1H), 6.47 (d, J=5.8 Hz, 1H), 5.35-5.13 (m , 1H), 5.00-4.75 (m, 1H), 3.04 (s, 3H), 2.59 (s, 3H), 2.28-2.03 (m, 4H), 1, 96-1.64 (m, 4H).

ESI-MS m/z calculated 286.35, found 287.07 (M+1).

But.

NaH 2-xpor-5-methyl-pyrimidine

OTBS DMF, 20 ^L S

BUT

OTBS (-PgOH. 20 ° C _g about.

GH ₃ SO ₂ GI r-Pr^NEt ^CH 'OH CH ₂ C1 _g . about yu _G O.

OMs (1,4-trans)-4-((5-Methylpyrimidin-2-yl)oxy)cyclohexylmethanesulfonate.

The preparation was carried out according to the synthesis scheme described above, using the reaction conditions described earlier in this section.

1H NMR (300 MHz, CDCl ₃ ) δ 8.31 (s, 2H), 5.17-4.99 (m, 1H), 4.97-4.74 (m, 1H), 3.02 (s , 3H), 2.22 (s, 3H), 2.20-2.01 (m, 4H), 1.94-1.71 (m, 4H).

ESI-MS m/z calculated 286.35, found 287.16 (M+1).

2-chloropyrimidine n CH.SOoCl H

Ι ^η 2 ^ν Ύ^ /-Pr ₂ NEl j-Pr ₂ NEt ^-^ΌΗ i-PrOH, _H CH 2¾ from 0° to room. pace.

(1,4-trans)-4-(Pyrimidin-2-ylamino)cyclohexylmethanesulfonate.

Step 1: (1,4-trans)-4-(Pyrimidin-2-ylamino)cyclohexan-1-ol.

2-chloropyridine (70.30 g, 613.8 mmol) and trans-1,4-aminocyclohexanol (71.77 g, 604.5 mmol) were dissolved in isopropanol (400 ml). N,N-diisopropylethylamine (120 mL, 689 mmol) was added and the resulting solution was refluxed overnight. The solvent was evaporated under reduced pressure, the remaining solid was suspended in dichloromethane and filtered through a plug of silica gel. The silica column was eluted first with dichloromethane to elute the residual starting material, then ethyl acetate was used to elute the desired product.

- 69 042641

The filtrate from the ethyl acetate eluate was evaporated under reduced pressure to give (1,4-trans)-4(pyrimidin-2-ylamino)cyclohexan-1-ol as a white solid.

1H NMR (300 MHz, CDCl3) δ 8.25 (d, J=4.8 Hz, 2H), 6.50 (t, J=4.8 Hz, 1H), 5.16 (d, J=7 .4 Hz, 1H), 3.953.54 (m, 2H), 2.25-1.91 (m, 5H), 1.60-1.13 (m, 4H).

Step 2: (1,4-trans)-4-(Pyrimidin-2-ylamino)cyclohexylmethanesulfonate.

Diisopropylethylamine (90 ml, 516 .7 mmol). Methansulfonyl chloride (35 mL, 452.2 mmol) was added via syringe at a rate that allowed the internal temperature to remain at 20°C or below 20°C. The reaction mixture was stirred for another 1 h, diluted with dichloromethane and washed with saturated aqueous sodium bicarbonate. The organic layer was dried (MgSO ₄ ) and filtered through a thin layer of silica gel. The silica gel layer was eluted with 20% ethyl acetate/dichloromethane and the filtrate was concentrated under reduced pressure to give a tan solid. The solid was dissolved in a minimum amount of dichloromethane. Pentane was added until the product began to crystallize. The mixture was cooled in a dry ice/acetone bath, the solid was collected by vacuum filtration, washed with pentane and dried in vacuo to give (1,4-trans)-4-(pyrimidin-2-ylamino)cyclohexylmethanesulfonate (59.72 g, 82% yield). %) as a light brown solid.

¹ H NMR (300 MHz, CDCl ₃ ) δ 8.27 (d, J=2H), 6.54 (t, J=4.8 Hz, 1H), 5.13 (d, J=7.6 Hz , 1H), 4.69 (tt, J=10.5, 4.0 Hz, 1H), 3.98-3.73 (m, 1H), 3.03 (s, 3H), 2.21 ( dd, J=9.3, 4.2 Hz, 4H), 1.91-1.67 (m, 2H), 1.51-1.25 (m, 2H).

OMs

Synthetic routes for the preparation of additional mesylates of the above type, where R is a substituted or unsubstituted aromatic ring, a substituted or unsubstituted heteroaromatic ring, or a carbamate, have been previously described (see US 20140275059 A1) and are therefore not described here.

Section III. Compounds prepared using mesylate substitution in the final step.

The compounds described in section III were prepared by appropriate selection of 8hydroxyquinoxalinone (described in section I) and intermediate mesylate (described in section II) using the methods shown below. Analytical data for compounds obtained by the methods described in section III are presented in table. A.

Method A-A.

-Methyl-6-morpholino-8-((1,4-cis)-4-(pyrimidin-2-ylamino)cyclohexyl)oxy)quinooxalin-2( 1H)one.

Trans-4-(pyrimidin-2-ylamino)cyclohexylmethanesulfonate ( 30.34 g, 111.8 mmol) and cesium carbonate (35.64 g, 109.4 mmol). The mixture was heated at 60° C. overnight. The reaction mixture was cooled to room temperature and filtered through celite. The Celite layer was washed with N,N-dimethylformamide and the filtrate was evaporated in vacuo to give a dark oil which was solidified under high vacuum. The solid was dissolved in dichloromethane, filtered through a plug of silica gel and eluted with a mixture of 5% methanol and ethyl acetate. The filtrate was evaporated to give a brownish yellow solid. The solid was dissolved in dichloromethane and purified by silica gel chromatography (330 g, silica gel cartridge; isocratic 3% methanol/ethyl acetate) to give a bright yellow solid. The solid was washed with a small amount of ethyl acetate, which was pre-cooled in a dry ice-acetone bath, followed by the addition of heptane. Finally, the material was dried under high vacuum at 60°C to give 1-methyl-6-morpholino-8-((1,4-cis)-4-(pyrimidin-2-ylamino)cyclohexyl)oxy)quinoxaline 2(1H)- she.

Method A-B.

OMs DMF, 90 °C

-Methyl-6-morpholino-8-((1,4-cis)-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)quinoxalin-2( 1H)one.

To a solution of 8-hydroxy-1-methyl-6-morpholinoquinoxalin-2-one (34.5 mg, 0.132 mmol) in N,N

- 70 042641 dimethylformamide (690 μl) was added trans-(4-pyrimidin-2-yloxycyclohexyl)methanesulfonate (68.0 mg, 0.247 mmol) and cesium carbonate (215 mg, 0.660 mmol). The mixture was heated at 90° C. for 5 hours. The reaction mixture was cooled to room temperature and partitioned between dichloromethane and water. The organic phase was collected and evaporated. The crude residue was dissolved in a minimum amount of DMSO and purified by preparative HPLC on a C 18 column (acetonitrile/water with trifluoroacetic modifier). The appropriate fractions were combined and concentrated to dryness. The material thus obtained was dissolved in dichloromethane and washed with saturated aqueous sodium bicarbonate. The organic phase was collected, dried (Na ₂ SO ₄ ), filtered and concentrated to give 1-methyl-6-morpholino-8-((1,4-cis)-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)quinoxaline -2(1H)-one (16.1 mg, 25% yield).

Note: The substances obtained by this method were also purified by silica gel chromatography (methanol/dichloromethane).

Method A-C.

1,3-Dimethyl-6-morpholino-8-((1,4-cis)-4-(pyrimidin-2-ylamino)cyclohexyl)oxy)quinazolin2(1H)-one.

To a mixture of 8-hydroxy-1,3-dimethyl-6-morpholinoquinoxalin-2-one (48.7 mg, 0.177 mmol) and cesium carbonate (572 mg, 1.756 mmol) in N,N-dimethylformamide (1.1 ml) (trans)-[4-(pyrimidin-2ylamino)cyclohexyl]methanesulfonate (147 mg, 0.542 mmol) was added. The resulting mixture was stirred at 100° C. overnight. The reaction mixture was cooled to room temperature and partitioned between methyl tert-butyl ether and water. The phases were separated and the aqueous phase was further extracted with methyl tert-butyl ether. The combined organic layers were washed with brine, dried (Na ₂ SO ₄ ), filtered and concentrated. The crude residue was purified by silica gel chromatography (4 g silica gel, using a linear gradient of 0-10% methanol/dichloromethane; then a second purification was carried out on silica gel using a linear gradient of 0-100% ethyl acetate/heptane) to give 1,3-dimethyl-6 -morpholino-8-(14-cis)-4-(pyrimidin-2-ylamino)cyclohexyl)oxy)quinoxalin-2(1H)-one (17.3 mg, 21% yield).

Note: Materials prepared by this method were also purified by reverse phase preparative HPLC (acetonitrile/water, using either trifluoroacetic acid or ammonium hydroxide as a modifier) or by reverse phase C18 derivatized silica gel chromatography (acetonitrile/water with using trifluoroacetic acid as a modifier).

Method A-D.

6-Bromo-1-methyl-8-[(1,4-cis)-4-(pyrimidin-2-ylamino)-cyclohexanoxy]quinoxalin-2-one.

To a solution of 6-bromo-8-hydroxy-1-methylquinoxalin-2-one (954 mg, 3.740 mmol) and [4-(pyrimidin-2ylamino)cyclohexyl]methanesulfonate (3.1 g, 11.42 mmol) in dimethyl sulfoxide ( 7.0 ml) rubidium carbonate (2.49 g, 10.78 mmol) was added. The resulting mixture was stirred at 80° C. overnight. The reaction mixture was cooled to room temperature and partitioned between dichloromethane and water. The phases were separated and the aqueous phase was extracted with dichloromethane. The organic layers were concentrated and dried overnight under vacuum. The crude residue was purified by silica gel chromatography (80 g silica gel, 0-5% methanol/dichloromethane linear gradient) to give 6-bromo-1-methyl-8-[4(pyrimidin-2-ylamino)cyclohexanoxy]quinoxalin-2-one ( 700 mg, 42% yield.

- 71 042641

Table A

Compounds prepared using mesylate substitution in the final step

Comm. No. Connection structure Way DNA-PK Ki rDNA-RK 1C ₅ o (A459) ES-MS (M+H) 1HNMR 1 ao. A-A 0.003 0.055 437.39 1H NMR (300 MHz, DMSO-ίΑ) δ 8.25 (d, >4.7 Hz, 2H), 8.17 (s, W), 7.26 (d, >8.1 Hz, 1H), 6.97 (d, >2.4 Hz, 1H), 6.82 (d, >2.5 Hz, 1H), 6.53 (t, >4.7 Hz, 1H), 5.77 (s , 1H), 4.83 (s, 1H), 3.94 (s, 3H), 3.89 (s, 1H), 3.80-3.70 (m, 4H), 3.19-3, 10 (m, 4H), 2.03 (dd, >12.2, 6.3 Hz, 2H), 1.81-1.55 (m, 6H), 1.18 (t, >7.1 Hz , 1Н) 2 συ..., DE O^J A-B 0.002 0.075 438.29 1H NMR (400 MHz, DMSO-i/ ₆ ) δ 8.60 (d, >4.8 Hz, 2H), 8.16 (s, 1H), 7.11 (t, >4.8 Hz, 1H ), 7.02 (d, J=2.7 Hz, 1H), 6.84 (d, >2.6 Hz, 1H), 5.15 (m, 1H), 4.76 (m, 1H) , 3.88 (s, 3H), 3.80-3.72 (m, 4H), 3.20-3.12 (m, 4H), 1.98-1.83 (m, 8H) ³ f _g .dt A-B 0.005 0.074 452.35 1H NMR (400 MHz, DMSO-t4) δ 8.37 (d, >5.8 Hz, 1H), 8.16 (s, W), 7.01 (d, >2.7 Hz, 1H), 6.84 (d, >2.7 Hz, 1H), 6.74 (dd, >5.9, 0.7 Hz, 1H), 5.26 (m, 1H), 4.74 (m, 1H ), 3.86 (s, 3H), 3.76 (m, 4H), 3.20-3.11 (m, 4H), 2.50 (s, 3H), 1.89 (m, 8H) 4 Χϊ“Ό, άτ 0,^ A-B 0.003 0.068 468.22 1H NMR (400 MHz, DMSO-ak) δ 8.36 (s, 2H), 8.16 (s, 1H), 7.01 (d, >2.7 Hz, 1H), 6.83 (d, >2.5 Hz, 1H), 5.04 (m, 1H), 4.75 (m, 1H), 3.87 (s, ZN), 3.83 (s, ZN), 3.77 (m , 4H), 3.16 (m, 4H), 1.91 (m, 8H) 5 Zϊ ⁸ 0, A-B <0.001 0.028 467.28 1H NMR (400 MHz, DMSO-Y) δ 8.16 (s, 1H), 8.10 (s, 2H), 6.96 (d, >2.7 Hz, 1H), 6.87 (d, >8.1 Hz, 1H), 6.82 (d, >2.6 Hz, 1H), 4.82 (m, 1H), 3.93 (s, 3H), 3.76 (m, 4H) , 3.73 (s, 3H), 3.173.11 (m, 4H), 2.02 (m, 2H), 1.68 (m, 6H) 6 O X z z— H A-B 0.003 0.075 452.28 1H NMR (300 MHz, DMSO-t7 ₆ ) δ 8.43 (d, >0.5 Hz, 2H), 8.16 (s, 1H), 7.01 (d, >2.4 Hz, 1H) , 6.83 (d, >2.4 Hz, 1H), 5.10 (s, 1H), 4.75 (s, 1H), 4.03 (dd, >14.2, 7.1 Hz, 1H), 3.87 (s, 3H), 3.833.68 (m, 4H), 3.25-3.08 (m, 4H), 1.18 (s, 1H) 7 Yes, _G do A-C 0.008 0.330 451.3 1H NMR (400 MHz, DMSO-t4) δ 8.25 (d, >4.7 Hz, 2H), 7.26 (d, >8.1 Hz, 1H), 6.89 (d, >2, 6 Hz, 1H), 6.76 (d, >2.6 Hz, 1H), 6.52 (t, >4.7 Hz, 1H), 4.81 (m, 1H), 3.94 (s , 3H), 3.87 (m, 1H), 3.76 (m, 4H), 3.14 (m, 4H), 2.40 (s, 3H), 2.01 (m, 2H), 1 .68 (m, 6H) 8 Before, _r dy 0,^ A-C 0.015 >1 451.29 1H NMR (400 MHz, DMSO-Y) δ 8.26 (d, >4.8 Hz, 2H), 7.17-7.10 (m, 2H), 6.91 (d, >2.5 Hz , 1H), 6.54 (t, >4.8 Hz, 1H), 4.87 (m, 1H), 4.48 (kv, >7.0 Hz, 2H), 3.79 (m, 5H ), 3.23 (m, 4H), 2.03 (m, 2H), 1.73 (m, 6H), 1.41 (t, >7.0 Hz, ZN) 9 Asu, "DU A-D >4 >1 430.19 1H NMR (300 MHz, DMSO-6/ ₆ ) δ 8.298.22 (m, 3H), 7.56 (d, >2.1 Hz, 1H), 7.44 (d, >2.2 Hz, 1H ), 7.21 (d, >8.0 Hz, 1H), 6.52 (t, >4.8 Hz, 1H), 4.83 (m, 1H), 3.94 (s, 3H), 3.89 (m, 1H), 2.02 (m, 2H), 1.81-1.55 (m, 6H),

- 72 042641

13 Η ΥΥυΥ ° ι Doo A-C 0.015 0.550 459.27 1H NMR (300 MHz, DMSO4) δ 8.16 (s, 1H), 6.95 (m 2H), 6.81 (m, 1H), 4.78 (m, IH), 3.89 (s, 3H), 3.76 (m, 4H), 3.40 (m, 1H), 3.14 (m, 4H), 1.95 (m, 2H), 1.72-1.47 (m, 6H ), 1.38 (s, 9H) 14 Η Λΐ> ώΥ 0^ Α-Α <0.001 0.097 450.29 1H NMR (300 MHz, DMSO4) δ 8.13 (d, >14.1 Hz, 2H), 8.11 (s, 1H), 6.96 (d, .1-7.0 Hz, 2H), 6.81 (d, >2.2 Hz, 1H), 4.81 (br s, 1H), 3.93 (s, 3H), 3.85 (br s, W), 3.80-3, 68 (m, 4H), 3.23-3.06 (m, 4H), 1.69 (di, >20.2, 10.1 Hz, 6H) 15 Η ^; ώΥ °Ύ Α-Β <0.001 0.061 451.39 1H NMR (300 MHz, DMSO-r/b) δ 8.17 (s, 1H), 7.91 (s, 1H), 7.27 (d, >8.0 Hz, 1H), 6.98 ( d, >2.6 Hz, 1H), 6.82 (d, >2.5 Hz, 1H), 6.28 (d, >6.0 Hz, 1H), 4.82 (m, 1H), 4.0 (m, 1H), 3.92 (s, 3H), 3.76 (m, 4H), 3.16 (m, 4H), 2.31 (s, 3H), 1.99 (m , 2H), 1.66 (m, 6H) 16 \ -π Ζ1 Υ^ ζ ζ— Α-Β <0.001 0.036 483.46 1H NMR (400 MHz, DMSO4) δ 8.18 (s, 1H), 8.17 (d, >2.3 Hz, 1H), 7.49 (d, >8.1 Hz, 1H), 6, 96 (d, >2.7 Hz, 1H), 6.82 (d, >2.5 Hz, 1H), 4.88 (m, 1H), 4.07 (m, 1H), 3.96 ( s, 3H), 3.80-3.72 (m, 4H), 3.16 (m, 4H), 2.60 (q, d, >7.5, 2.3 Hz, 2H), 2, 06 (m, 2H), 1.71 (m, 6H), 1.16 (t, >7.6 Hz, ZN) 19 _κ 9 ο ΙΖ γ° ^Ο ν-θ Α-Β 0.004 0.175 493.41 20 I - Ζ --- ο O - h ΣΙ ζ ζ - ^χ 4) Α-Β 0.003 494.40 1H NMR (400 MHz, DMSO<7 ₆ ) δ 8.84 (d, >5.3 Hz, 1H), 8.81 (d, >4.9 Hz, 1H), 8.16 (s, 1H) , 7.58 (d, >4.9 Hz, 1H), 7.02 (d, >2.7 Hz, 1H), 6.85 (d, >2.6 Hz, 1H), 5.33 ( m, 1H), 4.78 (m, 1H), 3.88 (s, 3H), 3.81-3.72 (m, 4H), 3.21-3.12 (m, 4H), 2 .82 (d, 1=4.8 Hz, ZN), 2.02-1.84 (m, 8H) 21 Ύ Ό Α-Β 0.006 0.760 417.33 1H NMR (400 MHz, DMSO-t/ ₆ ) δ 8.16 (s, 1H), 7.24 (d, >8.0 Hz, 1H), 6.95 (d, >2.6 Hz, 1H ), 6.81 (d, >2.6 Hz, 1H), 4.77 (m, 1H), 3.89 (s, 3H), 3.79-3.72 (m, 4H), 3, 52 (s, 3H), 3.47 (m, 1H), 3.18-3.11 (m, 4H), 2.02-1.91 (m, 2H), 1.62 (m, 6H) 22 9“U ώ Υ 0^ Α-Β 0.008 0.160 431.33 1H NMR (400 MHz, DMSO-Y,) δ 8.16 (s, 1H), 7.20 (d, >7.9 Hz, 1H), 6.95 (d, >2.6 Hz, 1H) , 6.81 (d, >2.6 Hz, 1H), 4.77 (m, 1H), 3.97 (q, >7.1 Hz, 2H), 3.89 (s, 3H), 3 .75(m, 4H), 3.46(m, 1H), 3.18-3.11(m, 4H), 1.97(m, 2H), 1.74-1.44( _m , 6H ), 1.16 (t, >7.1 Hz, ZN) 23 χρο, ΟχΡ A-C 0.003 0.097 480.31 1H NMR (400 MHz, DMSO-V,) δ 8.35 (s, 2H), 8.15 (s, 1H), 6.76 (d, >2.7 Hz, 1H), 6.69 (d , >2.7 Hz, 1H), 5.10-4.99 (m, 1H), 4.87-4.67 (m, ZN), 3.88 (s, ZN), 3.84 (s , ZN), 3.63 (d, >11.4 Hz, 2H), 3.45 (d, >11.3 Hz, 2H), 3.30 (s, 20H), 2.11-1.82 (m, 8H)

- 73 042641

24 N 'Doo A-C 0.003 0.074 464.33 1H NMR (400 MHz, DMSO-i/b) δ 8.43 (d, .1-0.9 Hz, 2H), 8.15 (s, 1H), 6.76 (d, >2.7 Hz, 1H ), 6.68 (d, >2.7 Hz, 1H), 5.17-5.04 (m, 1H), 4.84-4.68 (m, ZN), 3.63 (d, > 11.3 Hz, 2H), 3.45 (d, >11.3 Hz, 2H), 3.23-3.09 (u, 1H), 2.18 (s, 3H), 2.08-1 .82 (m, 8H) 25 m °7\ ° z-z.— n A-C 0.005 0.160 464.37 1H NMR (400 MHz, DMSO-<4) δ 8.38 (d, >5.8 Hz, 1H), 8.15 (s, 1H), 6.806.73 (m, 2H), 6.69 (d , >2.6 Hz, W), 5.33-5.18 (m, 1H), 4.81-4.68 (m, ZN), 3.87 (s, ZN), 3.63 (d , >11.3 Hz, 2H), 3.45 (d, >11.5 Hz, 2H), 3.19-3.07 (m, 1H), 2.01-1.85 (m, 8H) 28 n A-B 0.002 0.028 493.32 1H NMR (400 MHz, DMSO4) δ 8.17 (s, 1H), 6.94 (d, >2.7 Hz, 1H), 6.856.78 (m, 2H), 4.84 (m, 1H) , 4.52 (t, >9.1 Hz, 2H), 4.10-4.01 (m, 1H), 3.95 (s, ZN), 3.81-3.71 (m, 4H) , 3.15 (m, 4H), 3.06 (t, >9.0 Hz, 2H), 2.30 (s, 3H), 2.05 (m, 2H), 1.71 (m, 6H ) thirty 4 O—\o z z - n A-C 0.004 0.187 449.34 1H NMR (400 MHz, CDC1 ₃ ) δ 8.33 (d, >5.8 Hz, 1H), 8.29 (s, 1H), 7.47 (d, >2.0 Hz, 1H), 7.17 (d, >2.0 Hz, 1H), 6.54 (d, >5.9, 0.6 Hz, 1H), 6.22-6.17 (m, 1H), 5.39-5, 32 (m, 1H), 4.61-4.50 (m, 1H), 4.36 (q, >2.8 Hz, 2H), 4.04 (s, 3H), 3.97 (t, >5.5 Hz, 2H), 2.62.52 (m, 4H), 2.18-1.82 (m, 4H) 31 b O - y o η Ζ— n A-C 0.005 0.114 449.33 1H NMR (400 MHz, CDC1 ₃ ) δ 8.36 (s, 2H), 8.30 (s, 1H), 7.48 (d, >2.0 Hz, 1H), 7.18 (d, > 2.1 Hz, 1H), 6.26-6.16 (m, 1H), 5.28-5.12 (m, 1H), 4.63-4.49 (m, 1H), 4.39 (q, >2.8 Hz, 2H), 4.04 (s, ZN), 3.99 (t, >5.5 Hz, 2H), 2.642.54 (m, 1H), 2.26 (s , ZN), 2.25-2.08 (m, ZN), 2.08-1.85 (m, ZN) 32 dto, pdu A-C 0.005 0.52 465.36 1H NMR (400 MHz, CDCI3) δ 8.30 (s, 1H), 8.23 (s, 2H), 7.48 (d, >2.0 Hz, 1H), 7.18 (d, >2 .1 Hz, 1H), 6.24-6.17 (m, 1H), 5.18-5.10 (m, 1H), 4.60-4.51 (m, 1H), 4.38 ( q, >2.8 Hz, 2H), 4.04 (s, ZN), 3.99 (t, >5.5 Hz, 2H), 3.89 (s, ZN), 2.63-2, 55 (m, 1H), 2.25-2.09 (m, ZN), 2.06-1.85 (m, 2H) 33 at o— at ΖΤ Mr Mrs A-C <0.001 0.054 448.39 1H NMR (400 MHz, CDCU) δ 8.31 (s, 1H), 8.14 (d, >5.9 Hz, 1H), 7.49 (d, >2.0 Hz, 1H), 7, 16 (d, >2.0 Hz, 1H), 6.24-6.17 (m, 2H), 5.01-4.83 (m, 1H), 4.73-4.64 (m, 1H ), 4.38 (q, >2.8 Hz, 2H), 4.05 (s, ZN), 3.99 (t, >5.5 Hz, 2H), 2.63-2.55 (m , 1H), 2.52 (s, 3H), 2.22-2.09 (m, 1H), 2.07-1.87 (m, 3H), 1.84-1.67 (m, 1H ) 34 /GO, 0^ A-C <0.001 0.028 448.39 1HNMR (400 MHz, CDC1 ₃ ) δ 8.31 (s, 1H), 8.16 (d, >0.8 Hz, 2H), 7.47 (d, >2.0 Hz, 1H), 7, 16 (d, >2.0 Hz, 1H), 6.25-6.18 (m, 1H), 5.01 (d, >7.7 Hz, 1H), 4.71-4.61 (m , 1H), 4.38 (q, >2.8 Hz, 2H), 4.06 (s, ZN), 3.99 (t, >5.4 Hz, ZN), 2.63-2.54 (m, 2H), 2.20-2.07 (m, 4H), 2.07-1.87 (m, ZN), 1.84-1.66 (m, 2H) 35 -OU About ZT Z Z — n A-C <0.001 0.031 464.29 1HNMR (400 MHz, CDC1 ₃ ) δ 8.31 (s, 1H), 8.09 (s, 2H), 7.47 (d, >2.0 Hz, 1H), 7.16 (d, >2 .0 Hz, 1H), 6.25-6.17 (m, 1H), 4.94 (d, >7.6 Hz, 1H), 4.38 (q, >2.8 Hz, 2H), 4.06 (s, ZN), 4.033.89 (m, ZN), 3.83 (s, ZN), 2.63-2.54 (m, 1H), 2.20-2.07 (m, 1Н), 2.07-1.83 (m, ZN), 1.81-1.69 (m, 1Н) 36 D ΞΕΖ IX zH^ ^z \ A-C <0.001 0.073 480.31 1H NMR (400 MHz, CDCI3) δ 8.34 (d, >1.9 Hz, 1H), 8.32 (s, 1H), 7.49 (d, >2.0 Hz, 1H), 7, 17 (d, >2.0 Hz, 1H), 6.26-6.18 (m, 1H), 5.00-4.87 (m, 1H), 4.38 (q, >2.8 Hz , 2H), 4.08 (s, 3H), 3.99 (t, >5.4 Hz, 2H), 2.74 (q, d, >7.6, 2.3 Hz, 2H), 2 .65-2.54 (m, 2H), 2.27-2.15 (m, 2H), 2.13-2.01 (m, 2H), 2.01-1.87 (m, 2H) , 1.81-1.65 (m, 2H), 1.29 (t, >7.6 Hz, ZN)

Section IV. Preparation of intermediate bromquinoxalinone intermediates.

Section IV describes synthetic methods for preparing functionalized 6-bromo-1-methylquinoxalin-2(1H)-one intermediates that are not described elsewhere in this document. These intermediates are used in conjunction with an appropriate choice of amine compound or boronic acid ester to produce the compounds shown in Table 1. IN.

- 74 042641

6-Bromo-1-methyl-8-(4-pyrimidin-2-yloxy)quinoxalin-2-one.

Mixture of 6-bromo-8-hydroxy-1-methylquinoxalin-2-one (299 mg, 1.172 mmol), methanesulfonate (4pyrimidin-2-yloxycyclohexyl)methanesulfonate (517 mg, 1.899 mmol), cesium carbonate (501 mg, 1.538 mmol) and N,N-dimethylformamide (6.0 ml) was heated at 100°C for 4 hours, the Reaction mixture was cooled to room temperature and filtered. The filtrate was purified by reverse phase chromatography (100 g, C18-derivatized Isco RediSep Rf silica gel cartridge; 25-60% acetonitrile/water linear gradient using trifluoroacetic acid as modifier). Fractions containing product were partitioned between ethyl acetate and saturated sodium bicarbonate solution. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic layers were washed with brine, dried (MgSO ₄ ), filtered and concentrated to give 6-bromo-1-methyl-8-(4-pyrimidin-2-yloxy)quinoxalin-2-one (320.6 mg, yield 63%).

1H NMR (300 MHz, DMSO-d6) δ 8.60 (d, J=4.8 Hz, 2H), 8.25 (s, 1H), 7.58 (d, J=2.1 Hz, 1H ), 7.51 (d, J=2.2 Hz, 1H), 7.12 (t, J=4.8 Hz, 1H), 5.22-5.09 (m, 2H), 4.85 -4.72 (m, 2H), 3.88 (s, 3H), 2.03-1.85 (m, 8H).

ESI-MS m/z calculated 430.06, found 431.16 (M+1).

6-Bromo-8-((1,4-cis)-4-((5-methoxypyrimidin-2-yl)oxy)cyclohexyl)oxy)-1-methylquinoxalin2(1H)-one.

This compound was prepared by procedures analogous to those described above for 6-bromo-1-methyl-8-((1,4cis)-4-pyrimidin-2-yloxy)quinoxalin-2-one.

1H NMR (400 MHz, CDCl3) δ 8.30 (s, 1H), 8.22 (s, 2H), 7.63 (d, J=2.2 Hz, 1H), 7.19 (d, J =2.2 Hz, 1H), 5.20-5.10 (m, 1H), 4.58-4.47 (m, 1H), 4.01 (s, 3H), 3.89 (s, 3H), 2.26-1.85 (m, 8H). ESI-MS m/z calculated 460.07, found 461.13 (M+1).

6-Bromo-1-methyl-8-((1,4-cis)-4-((5-methylpyrimidin-2-yl)oxy)cyclohexyl)oxyquinoxalin-2(1H)one.

This compound was prepared in a manner analogous to that described above for 6-bromo-1-methyl-8-((1,4cis)-4-pyrimidin-2-yloxy)quinoxalin-2-one.

¹ H NMR (400 MHz, CDCl ₃ ) δ 8.21 (d, J=0.9 Hz, 2H), 8.14 (s, 1H), 7.48 (d, J=2.2 Hz, 1H ), 7.04 (d, J=2.2 Hz, 1H), 5.13-4.99 (m, 1H), 4.43-4.30 (m, 1H), 3.86 (s, 3H), 2.11 (s, 3H), 2.09-1.93 (m, 4H), 1.93-1.71 (m, 4H).

ESI-MS m/z calculated 444.08, found 445.11 (M+1).

6-Bromo-1-methyl-8-((1,4-cis)-4-((2-methylpyrimidin-4-yl)oxy)cyclohexyl)oxy)quinoxalin-2(1H)one.

This compound was prepared in a manner analogous to that described above for 6-bromo-1-methyl-8-((1,4cis)-4-pyrimidin-2-yloxy)quinoxalin-2-one.

1H NMR (400 MHz, CDCl3) δ 8.36 (d, J=5.8 Hz, 1H), 8.31 (s, 1H), 7.65 (d, J=2.1 Hz, 1H), 7.29 (s, 8H), 6.57 (d, J=5.8 Hz, 1H), 5.43-5.35 (m, 1H), 4.61-4.51 (m, 1H) , 4.03 (s, 3H), 2.62 (s, 3H), 2.18-1.86 (m, 8H).

ESI-MS m/z calculated 444.08, found 445.11 (M+1).

Section V. Compounds Prepared Using the Buchwald Coupling Reaction or the Suzuki Coupling Reaction in the Final Step.

The compounds described in this section were prepared by appropriate selection of functionalized 6-bromo-1-methylquinoxalin-2(1H)-one (described in Section IV) and an amine (in the case of a Buchwald coupling reaction) or a boronic acid ester (in the case of a Suzuki combinations), using the methods described below. Analytical data for compounds obtained by the methods described in this section are presented in table. IN.

- 75 042641

Method B-A.

6-(6-Oxa-3-azabicyclo[3.1.1]heptan-3-yl)-1-methyl-8-((1,4-cis)-4-(pyrimidin-2-ylamino)cyclohexyl)oxy) quinoxaline-2( 1 H)-one.

A mixture of 6-bromo-1-methyl-8-[4-(pyrimidin-2-ylamino)cyclohexyloxy]quinoxalin-2-one (74 mg, 0.167 mmol), 6-oxa-3-azabicyclo[3.1.1]heptane ( hydrochloride; 61 mg, 0.450 mmol), cesium carbonate (263 mg, 0.807 mmol), RuPhos-G3-palladacycyl (30 mg, 0.036 mmol), RuPhos (17 mg, 0.036 mmol) and dioxane (700 μl) were stirred at 100° C during the night. The reaction mixture was cooled to room temperature and partitioned between ethyl acetate and water. The phases were separated and the aqueous layer was further extracted with ethyl acetate. The combined organic layers were dried (Na ₂ SO ₄ ), filtered and concentrated. The crude residue was purified by silica gel chromatography (12 g silica gel, 0-5% methanol/dichloromethane linear gradient) to give 6-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)-1methyl-8-( (1,4-cis)-4-(pyrimidin-2-ylamino)cyclohexyl)oxy)quinoxalin-2(1H)-one (17.0 mg, 22% yield).

Note: compounds obtained by this method were also purified by preparative HPLC on a C18 column (acetonitrile/water using either trifluoroacetic acid or ammonium hydroxide as a modifier).

B-B method.

6-(3,6-Dihydro-2H-pyran-4-yl)-1-methyl-8-((1,4-cis)-4-(pyrimidin-2-ylamino)cyclohexyl)oxy)quinoxaline-2( 1H)-on.

To a mixture of 6-bromo-1-methyl-8-[4-(pyrimidin-2-ylamino)cyclohexanoxy]quinoxalin-2-one (62 mg, 0.140 mmol), 2-(3,6-dihydro-2H-pyran- 4-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (44 mg, 0.209 mmol), sodium carbonate (207 μl of 2 M aqueous solution, 0.414 mmol) and dioxane (1.1 ml ) [1,1'-bis-(diphenylphosphino)ferrocene]dichloropalladium(II) (dichloromethane complex; 10 mg, 0.014 mmol) was added. The resulting reaction mixture was stirred at 100° C. for 2 hours. The reaction mixture was filtered and the filtrate was directly purified by C-18 preparative HPLC (acetonitrile/water with trifluoroacetic acid as a modifier) and the appropriate fractions were combined and concentrated to dryness. The material thus obtained was dissolved in dichloromethane and washed with saturated aqueous sodium bicarbonate. The organic phase was collected, dried (Na ₂ SO ₄ ), filtered, concentrated and evaporated to give 6-(3,6-dihydro-2H-pyran-4-yl)-1-methyl8-((1,4-cis)- 4-(pyrimidin-2-ylamino)cyclohexyl)oxy)quinoxalin-2(1H)-one (30 mg, 47% yield).

Note: The compounds obtained by this method were also purified by silica gel chromatography (ethyl acetate/dichloromethane).

Method B-C.

-Methyl-6-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)-8-((1,4-cis)-4-pyrimidin-2-yloxy-cyclohexyloxy)quinoxalin-2- He.

Suspension of 6-bromo-1-methyl-8-(4-pyrimidin-2-yloxy)quinoxalin-2-one (80 mg, 0.186 mmol) and cesium carbonate (195 mg, 0.599 mmol) in dioxane (1.0 ml) degassed by bubbling nitrogen gas through the mixture for 5 minutes. RuPhos (9 mg, 0.019 mmol) and palladium(II) acetate (2 mg, 0.009 mmol) were added and then the reaction mixture was degassed for another 5 minutes. Finally, 6-oxa-3azabicyclo[3.1.1]heptane (31 mg, 0.313 mmol) was added, the vessel was sealed and heated at 100° C. for 3 hours. The reaction mixture was cooled to room temperature, filtered and concentrated. The crude residue was purified by silica gel chromatography (12 g silica using isocratic ethyl acetate) to give 1-methyl-6-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)-8-((1.4 -cis)-4-pyrimidin-2yloxycyclohexyl)quinoxalin-2-one (36.5 mg, 43% yield).

- 76 042641

Table B

Compounds prepared using the final stage Buchwald coupling reaction

Comm. No. Connection structure Way DNA-PK Ki rDNA-RK 1C _5P (A459) ES-MS (M+H) 1HNMR 10 ABOUT A \ / IZ Z y B-A <0.001 0.510 449.39 1H NMR (300 MHz, DMSO-64) δ 8.25 (d, >4.7 Hz, 2H), 8.16 (s, 1H), 7.22 (d, >8.1 Hz, 1H), 6.72 (m, 1H), 6.66 (m, 1H), 6.52 (t, >4.7 Hz, W), 4.83 (m, 1H), 4.73 (d, >6 .3 Hz, 2H), 3.94 (s, 3H), 3.88 (m, 1H), 3.62 (m, 2H), 3.45 (m, 2H), 3.13 (m, 1H ), 2.08 (m, 2H), 1.94 (m, 1H), 1.69 (m, 6H) AND — ZZ pH IZ Z / B-B <0.001 434.29 1H NMR (300 MHz, CDC1 ₃ ) δ 8.31 8.27 (m, 3H), 7.45 (d, >2.0 Hz, 1H), 7.14 (d, >2.0 Hz, 1H ), 6.55 (t, J=4.8 Hz, 1H), 6.20 (m, 1H), 5.19 (m, 1H), 4.65 (m, 1H), 4.36 (m , 2H), 4.04 (s, 3H), 3.97 (t, >5.5 Hz, 2H), 2.18-2.05 (m, 2H), 2.05-1.86 (m , 4H), 1.77 (m, 2H) 12 Doo B-A <0.001 0.250 463.37 1H NMR (400 MHz, DM 804) δ 8.25 (d, >4.7 Hz, 2H), 8.15 (s, 1H), 7.25 (d, >8.1 Hz, 1H), 6 .85 (d, >2.7 Hz, 1H), 6.71 (d, >2.6 Hz, 1H), 6.53 (t, >4.8 Hz, 1H), 4.82 (m, 1H), 4.44 (m, 2H), 3.93 (s, 3H), 3.88 (m, 1H), 3.47 (m, 2H), 2.82 (m, 2H), 2, 08-2.00 (m, 2H), 1.85 (m, 4H), 1.78-1.60 (m, 6H) 26 mm, mu A-C 0.002 0.120 450.37 1H NMR (400 MHz, DMS(W ₆ ) δ 8.60 (d, >4.8 Hz, 2H), 8.15 (s, 1H), 7.11 (t, >4.8 Hz, 1H) , 6.77 (d, >2.7 Hz, 1H), 6.69 (d, >2.7 Hz, 1H), 5.20-5.11 (m, 1H), 4.84-4, 70 (m, 2H), 3.88 (s, ZN), 3.63 (d, >11.3 Hz, 2H), 3.46 (d, >11.3 Hz, 2H), 3.21- 3.07 (m, 1H), 2.23-1.67 (m, 8H) 27 From 2 m r \ O ZZ— n B-B <0.001 0.085 435.38 1H NMR (400 MHz, DM SO Α) δ 8.60 (d, >4.8 Hz, 2H), 8.21 (s, 1H), 7.447.37 (m, 2H), 7.11 (t, >4.8 Hz, 1H), 6.47-6.40 (m, 1H), 5.20-5.10 (m, 1H), 4.86-4.76 (m, 1H), 4, 26 (kv, J=2.8 Hz, 2H), 3.85 (t, >5.5 Hz, 2H), 2.08-1.82 (m, 9H) 29 cox 0D1 A-C 0.002 0.056 464.29 1HNMR (400 MHz, CDC1 ₃ ) δ 8.54 (d, >4.8 Hz, 2H), 8.26 (s, 1H), 6.96 (t, >4.8 Hz, 1H), 6, 85 (d, >2.7 Hz, 1H), 6.68 (d, >2.8 Hz, 1H), 5.31-5.20 (m, 1H), 4.61-4.52 (m , 2H), 4.52-4.40 (m, 1H), 4.00 (s, ZN), 3.34 (d, >11.4 Hz, 1H), 3.08 (dd, >11, 3, 2.6 Hz, 2H), 2.27-2.11 (m, 4H), 2.11-1.85 (m, 6H) 40 _°N llA \ / o Ά q LF Ζ y o— A-C 0.004 0.050 494.31 1HNMR (400 MHz, CDCI3) δ 8.26 (s, 1H), 8.22 (s, 2H), 6.85 (d, >2.7 Hz, 1H), 6.67 (d, >2, 7 Hz, 1H), 5.14-5.07 (m, 1H), 4.60-4.52 (m, 2H), 4.51-4.53 (m, 1H), 4.00 (s , ZN), 3.89 (s, ZN), 3.38-3.30 (m, 2H), 3.08 (dd, >11.3, 2.6 Hz, 2H), 2.25-1 .82 (m, 8H) 38 Μτχ, Mu A-C 0.002 0.065 478.24 1H NMR (400 MHz, CDCh) δ 8.36 (d, >0.8 Hz, 2H), 8.26 (s, 1H), 6.87 (d, >2.7 Hz, 1H), 6, 74 (d, >2.7 Hz, 1H), 5.25-5.12 (m, 1H), 4.62-4.52 (m, 2H), 4.52-4.41 (m, 1H ), 4.00 (s, ZN), 3.35 (d, >11.1 Hz, 2H), 3.10 (dd, >11.3, 2.6 Hz, 2H), 2.26 (s , ZN), 2.24-1.85 (m, 8H) 39 HG С1, , Du A-C 0.003 0.058 478.24 1H NMR (400 MHz, DMSO-A) δ 8.38 (d, >5.8 Hz, 1H), 8.15 (s, 1H), 6.89 (d, >2.6 Hz, 1H), 6.79-6.71(m, 2H), 5.31-5.22(m, 1H), 4.80-4.68(m, 1H), 4.51-4.40(m, 2H ), 3.85 (s, 3H), 3.49 (d, >11.4 Hz, 2H), 3.31 (s, 3H), 2.50 (s, 127H), 1.96-1, 78 (m, 12H)

Gene Editing Examples

The following examples, including experiments and results, are provided for illustrative purposes only and should not be construed as limiting the present invention.

Example 1. Materials and methods.

Methods.

Cells and culture.

Bronchial epithelial cells (BECs) were obtained from human donors diagnosed with cystic fibrosis with the CFTR dF508/dF508 genotype.

Induced pluripotent stem cells (iPSC) were derived from human dermal fibroblasts after viral transduction performed with Yamanaka's, Oct4, Sox2, KLF4 and c-Myc reprogramming factors. The resulting iPSCs were able to differentiate into 3 germ layers and contained a normal karyotype with 23 chromosome pairs.

Primary human peripheral blood hematopoietic stem cells (mPB) CD34+, hematopoietic stem cells and progenitor cells (HSPCs) were purchased from Hemacare or AllCells. Cells were thawed, washed and resuspended in complete medium containing serum-free CellGro SCGM medium (CellGenix) and supplemented with a mixture of cytokines (300 ng/ml SCF, 300 ng/ml Flt3L, 100 ng/ml TPO, 60 ng/ml IL-3) at density 1-3 x10 ⁵ cells per ml and incubated at 37°C/5% CO ₂ for 48 h before electroporation.

DNA-RK inhibitors.

In the gene editing examples, Compound 1 was used as the PKDNA inhibitor. 10 mM stock solutions were prepared using anhydrous DMSO and stored at -80°C.

Electroporation.

The HPLC (high performance liquid chromatography) purified synthetic sgRNAs used were purchased from Synthego and contained chemically modified nucleotides (2'-O-methyl-3'-phosphorothioate) at three terminal positions at both 5' and 3' ends. The sgRNA sequences with modified nucleotides underlined are shown below AAVS1 sgRNA:

'ACCCAS AGUGGGGCC ACUAGUUUUAGAGCUAGAAAUAGC AAGUUAA

AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUU3' (SEQ ID NO: 3).

sgPHK NAVI.7:

’ GGCUGAGCGUCC AUCAACCAGUUUUAGAGCUAGAAAUAG

CAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCG

AGUCGGUGCUUUU 3' (SEQ ID NO: 4)

Cas9-MPHK was purchased from TriLink Biotechnologies (L-7206). These Cas9-MPHKs express a variant of the Streptococcus pyogenes SF370 Cas9 protein (associated with CRISPR protein 9) with nuclear localization signals. SpCas9-MPHK also contains the CAP1 structure, polyadenylation signal, and modified uridines for optimal expression levels in mammalian cells.

Donor VDOs were purchased from IDT. These ssODNs contain a 10 nt insertion sequence for measuring HDR results in the TIDE assay, flanked by 40 nt of homologous arms. These ssODNs contain a total of 90 nucleotides and phosphorothioate modified nucleotides at the three terminal positions at both the 5' and 3' ends. The sequences of donor ssODNs with underlined phosphorothioate modified nucleotides are shown below.

RAM AAVS1:

’ GGGTACTTTTATCTGTCCCCCTCCACCCCACAGTGGGGCC AG

AATTCTCAGCTAGGGACAGGATTGGTGACAGAAAAGCCCCATCCTTAGG3' (SEQ GO NO: 5)

Non-RAM AAVS1:

’ CCTAAGGATGGGGCTTTTTCTGTC ACC AATCCTGTCCCTAGC

TGAGAATTCTGGCCCCACTGTGGGGTGGAGGGGACAGATAAAAGTACCC3' (SEQ GO NO: 6)

RAM NAVE7:

’ AGCTGTCCATTGGGGAGCATGAGGGCTGAGCGTCCATCAA

CTGAGAATTCCCAGGGAGACCACACCGTTGCAGTCCACAGCACTGTGCAT3' (SEQ GO NO: 7)

Non-RAM NAVE 7

5'ATGCACAGTGCTGTGGACTGCAACGGTGTGGTCTCCCTGG

GAATTCTCAGTTGATGGACGCTCAGCCCTCATGCTCCCCAATGGACAGCT3' (SEQ ID NO: 8)

All electroporation operations were performed using the Lonza 4D-Nucleofector™ system.

For BEC, the following electroporation conditions were used: 1.8 x E5 cells, 250 ng CAS9MPHK, 500 ng sgPHK, and 0.66 μM ssODH in 20 μl P4 electroporation buffer using program CM-138. Cells after electroporation were transferred to a 96-well plate containing 100 μl of BEC culture medium supplemented with DNA-PK inhibitors or left untreated. Cells were incubated at 37°C in an incubator with 5% CO ₂ .

In the case of iPSC, the following electroporation conditions were used: 2.5 xE5 cells, 250 ng CAS9mPHK, 500 ng sgPHK, and 0.66 μM ssODN in 20 μl P3 electroporation buffer using the CA-137 program. Electroporated cells were transferred to a 96-well plate containing 100 µl of mTEsR1 medium (Stem Cell Technologies) supplemented with 10 µM ROCK inhibitor Y-27632 (Stem Cell Technologies) with or without DNA-PK inhibitors, and then incubated at 37°C for incubator with 5% CO2.

CD34+ cells were electroporated two days after thawing. The following conditions were used for electroporation: 2.0 x E6 cells, 15 µg of Cas9 protein (Feldan), 15 µg of sgRNA, 1 µM of ssODH in 100 µl of P3 electroporation buffer, using the CA-137 program. Cells after electroporation were transferred by dividing them evenly into eight wells of a 24-well plate, where each well contained different concentrations of DNA-PK inhibitors. Cells were incubated at 37°C in a 5% CO ₂ incubator for two days, and then cell viability and gene editing were assessed.

Lipid-mediated cell transfection.

One day prior to transfection, cells were seeded in a 96-well plate at a cell density of 1 x E4 cells per well in BEC culture medium. First, 0.15 µl MessengerMax (ThermoFisher, LMRNA 003) was diluted in 5 µl Opti-MEM and incubated for 10 min at room temperature. 80 ng Cas9-MPHK (Trlink, L-7206), 20 ng sgRNA (Synthego) and 1 picomole ssODH were added to 5 μl OptiMEM and then mixed with MessengerMAx solution. The mixture was incubated for 5 min before being added to the cells. The entire solution was added to the cells in the well of a 96-well plate with 100 μl of culture medium with or without DNA-PK inhibitors. Cells were incubated at 37°C in an incubator with 5% CO2.

Measurement of cell survival rates.

Cells were incubated with 5 μg/ml Hoechst 33342 (Life technologies: H3570) and 0.5 μg/ml propidium iodide (PI; Life Technologies: P3566) in culture medium for 1 hour at 37°C. Cells were imaged to measure Hoescht positive (live and dead cells) and PI positive (dead cells) using a High-Content Imaging System (Molecular devices). The relative level of cell survival was estimated using the equation

[(Hoescht ⁺ results - PI ⁺ results) in sample]/[(Hoescht ⁺ results - PI results) in control] x 100.

The controls were mock-transfected cells and the survival of these cells was arbitrarily set to 100%.

The survival of CD34 ⁺ HSPC cells was measured using the Cell Titer Glo (CTG) reagent (Promega). 100 µl of the cell suspension was mixed with 100 µl of complete CTG reagent. The chemiluminescent signal was measured using a luminometer and the % viable cells were calculated compared to control cells (cells not treated with PK-DNA inhibitors).

Measurement of gene editing levels.

Genomic DNA was isolated by incubating cells with DNA Quickextract solution (Epicentre) (50 µl per well) in a 96-well plate for 30 min at 37°C. The cell extract was mixed, transferred to a PNR plate, and then incubated for 6 min at 65°C and 2 min at 98°C. PCR reactions were performed with 1 µl of Genomic DNA containing solution using AccuPrime™ Pfx DNA polymerase (Thermofisher, 12344024). PCR conditions: 4 min at 94°C (1x), then 15 seconds at 94°C, 15 seconds at 60°C and 1 min at 60°C (40x). PCR products were purified and then Sanger sequenced using GENEWIZ. The following primer pairs were used for PCR, spanning the target site (FW - forward; RV - reverse). Primers used for Sanger sequencing are marked with an asterisk (*)

AAVS1FW: 5’ GGACAACCCCAAAGTACCCC 3’ (SEQ W NO: 9)

AAVS1_RV*: 5' aggatcagtgaaacgcacca 3' (SEQ ID NO: 10).

NAV1.7_FW*: 5' gccagtgggttcagtggtat 3' (SEQ ID NO: 11).

NAV1.7_RV: 5'tcagcattatccttgcattttctgt 3' (SEQ ID NO: 12).

Each sequence chromatogram was analyzed using TIDE (indole tracking by decomposition) software (http://tide.nki.nl) (see also Brinkman et al., Nucleic Acids Research, Volume 42, Issue 22, 16 December 2014, p.el68). Sham electroporated samples were used as a control sequence and the parameters were set to an insertion/deletion size of 30 nucleotides, the degradation window was set to cover the largest possible high tracking window. The total insertion and deletion levels were obtained directly from the TIDE plots. HDR levels represent the percentage of cases with a 10 nucleotide insertion. NHEJ levels were calculated as the total number of insertions/deletions minus the HDR level. GraphPad Prism 7 software was used to obtain the graphs and to calculate all statistical indicators.

Example 2 PK-DNA inhibitors improve HDR gene editing levels in BEC.

In FIG. 1 shows a schematic of the gene editing assays used in the examples below. To investigate the effect of PK DNA inhibitors on HDR gene editing levels, BECs were electroporated with spCAS9-MPHK, NAV1.7 sgRNA, and NAV1.7 non-PAM ssODNs and then incubated with various concentrations of compound 1 or left untreated (control). Gene editing levels were determined using TIDE analysis 72 h after electroporation. Gene editing levels were expressed as a percentage and classified as HDR and NHEJ. Cell viability is shown as a percentage, while the viability of control cells was taken as 100%.

As shown in FIG. 2, a DNA-PK inhibitor such as Compound 1 improves gene editing levels in BEC. For Compound 1, the IC50 NHEJ value was 0.4450 μM, the EC50 HDR value was 0.4448 μM, and the TOP HDR (%) was 69.37.

- 79 042641

Example 3 PK-DNA inhibitors improve HDR pathway gene editing levels in CD34+ cells.

To study the effect of PK DNA inhibitors on HDR gene editing levels, CD34+ mPB cells were electroporated with RNP (spCAS9+sgRNA protein NAV1.7) and non-PAM NAV1.7 ssODN. Cells were then incubated with various concentrations of Compound 1. Gene editing levels were determined using TIDE analysis 48 hours after electroporation. Gene editing levels were expressed as a percentage and classified as HDR and NHEJ as shown in FIG. 3A (donor B) and in FIG. 3B (donor C). Cell viability is shown as a percentage, while the viability of control cells was taken as 100%.

As shown in FIG. 3A and 3B, a DNA-PK inhibitor such as Compound 1 improves gene editing levels in CD34+ cells. The EC50 values for HDR and insertions/deletions for donor B were 0.29 and 0.35 µM, respectively.

Example 4 DNA-PK inhibitors improve gene editing levels along the HDR pathway in iPSC.

To investigate the effect of PK DNA inhibitors on HDR pathway gene editing levels, iPSCs were electroporated with spCAS9 mRNA, sgRNA aaVs1, and scODN PAM AaVs1 and then incubated with various concentrations of Compound 1 or left untreated (control). Gene editing levels were determined using TIDE analysis 72 h after electroporation. Gene editing levels were expressed as a percentage and classified as HDR and NHEJ. Cell viability is shown as a percentage, while the viability of control cells was taken as 100%.

As shown in FIG. 4, a DNA-PK inhibitor such as Compound 1 improves gene editing levels in iPSCs. For Compound 1, the IC50 value for NHEJ was 0.474 μM, the EC50 value for HDR was 0.3253 μM, and the TOP HDR (%) was 24.41.

Example 5 Determination of Gene Editing Kinetics at Ecmax.

To study gene editing kinetics at ECmax, BECs were electroporated with spCAS9 mRNA, AAVS1 sgPHK, and AAVS1 PAM scODH and then incubated for various time periods with 10 μM Compound 1 or left untreated (control). Gene editing levels were determined using TIDE analysis and expressed as a percentage for HDR and NHEJ. 10 µM is the maximum effective concentration (ECmax) for compound 1.

In FIG. 5 shows that there is a strong inverse correlation between HDR and NHEJ events.

Example 6. Determination of gene editing kinetics at EC50.

BEC was electroporated with spCAS9 mRNA, AAVS1 sgRNA and AAVS1 scODN PAM and then incubated for various time periods with 0.7 μM Compound 1 or left untreated (control). Gene editing levels were determined using TIDE analysis and expressed as a percentage of HDR and NHEJ. The concentration of 0.7 μM is the half maximum effective concentration (EC50) for Compound 1. FIG. 6 shows the dynamics of HDR and NHEJ inhibition of PK DNA in BEC.

Example 7 A DNA-PK inhibitor improves HDR levels when gene editing components are delivered to BEC by lipid-mediated transfection.

To study the effects of lipid-mediated transfection, BECs were transfected with spCAS9 mRNA, sgPHK AAVS1, and scODN PAM AAVS1, and then incubated with various concentrations of Compound 1 or left untreated (control). Gene editing levels were determined using TIDE analysis 72 h after transfection.

In FIG. 7 shows the increase in HDR efficiency with increasing concentrations of Compound 1 delivered by lipid-mediated transfection.

Brief summary of the invention

The results of adding DNA-PK inhibitors to various cell types and at various loci showed a significant increase in the efficiency of the HDR pathway. Increased levels of HDR gene editing have been shown in various cell types including BEC, iPSC, CD34 ⁺ HPSC (from 3 donors). An increase in gene editing levels along the HDR pathway has been shown for many loci, including AAVS1.1 and NaV1.7. The experimental results also confirmed that lipid delivery and electroporation delivery are effective methods. Examples using electroporation include BEC, iPSC, CD34 ⁺ HPSC, and the delivery efficiency of the lipid system is shown in BEC. A close inverse correlation between HDR and NHEJ events was observed across different loci, experimental conditions and cell types.

-

Claims (25)

Pivot table. DNA-PK Inhibitors Improve Gene Editing Mediated Through the HDR Pathway Compound 1 AAVS1 NaV1.7 Cells HDR EC50 (µM) and Max % WEIGHT 0.72 µM 0.72 µM 66% 69% iPSC* 0.33 µM Not defined 24% Not determined CD34 ⁺ Donor A 0.12 µM 0.39 µM 76% 82% Donor B Not determined 0.29 µM Not determined 86% Donor C 0.18 µM 0.11 µM 88% 67% Equivalents. Although the invention has been specifically described and disclosed in this specification with reference to preferred embodiments, it will be appreciated by those skilled in the art that various changes in form and detail may be made without departing from the spirit of the invention and the scope of its disclosure as defined in the appended claims. . Those skilled in the art will recognize many equivalents to the specific embodiments of the invention described herein, or they can ascertain them using no more than routine experimentation. Such equivalents are intended to be covered by the claims. CLAIM 1. Compound of formula (I) where m and n are independently 1 or 2; X is O or NR; where R represents H or C ₁ -C ₄ -alkyl; Y is a bond, O or NR; where R represents H or C1-C ₄ -alkyl; R ¹ is C1- _C4 alkyl; ^R2 is: a) a 5- or 6-membered aryl or heteroaryl ring containing one or two heteroatoms selected from the group consisting of N, O and S, where the aryl and heteroaryl ring may be substituted with 0, 1, 2 or 3 R ³ substituents, independently selected from the group consisting of CN, halogen, C1-C4 alkyl, C3-C6 cycloalkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, C(=O)NHR1 and 5- or 6- a membered heterocycloalkyl or heteroaryl ring, where each ring contains 1, 2 or 3 heteroatoms selected from N, O and S; where R ¹ represents C1-C4-alkyl; or where two R ³ groups connected to adjacent carbon atoms of the aryl or heteroaryl ring may form a fused 5- or 6-membered ring which may contain a heteroatom selected from O, N and S; or b) COOR ⁴ where R ⁴ represents C1-C ₄ -alkyl or benzyl; where each of C 1 -C ₄ alkyl, C ₁ -C ₄ haloalkyl, C 1 -C ₄ alkoxy and C ₁ -C ₄ haloalkoxy may be further substituted with OR ⁵ or NR ⁶ R ⁷ , where each of R ⁵ , R ⁶ and R ⁷ are independently - 81 042641 H, C1-C ₄ alkyl or C ₃ -C ₆ cycloalkyl; or where R ⁶ and R ⁷ and the nitrogen atom to which they are attached form a saturated 5- or 6-membered ring which may contain 0 or 1 additional heteroatom selected from N, O and S, and where the ring may be further substituted C _g C ₄ -alkyl; Ring A is selected from the group consisting of where W is N or CR ³ and Z is O or S; where R ³ represents H or C _g C ₄ -alkyl. 2. The compound according to claim 1, where R ² represents a 5 - or 6-membered aryl or heteroaryl ring containing one or two heteroatoms selected from the group consisting of N, O and S, where the aryl and heteroaryl ring can be substituted with 0 , 1 or 2 R ³ substituents independently selected from the group consisting of CN, halogen, CrC4 alkyl or C3-C6 cycloalkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy and C(=O) NHR1, where R ¹ represents CrC ₄ -alkyl; or where two R ³ groups attached to adjacent carbon atoms of an aromatic or heteroaromatic ring may form a fused 5-membered ring which may contain a heteroatom selected from O, N and S; and/or where # means the position where R ² attached to the rest of the compounds of formula (I); and o is 0, 1, or 2. 3. The compound according to claim 1 or 2, where the compound of formula (I) is represented by structural formula (II), structural formula (II'), structural formula (II) or structural formula (II') 4. Connection according to any one of claims 1-3, where: (i) m and n are each 2; and/or (ii) R ¹ is methyl; and/or (iii) R ² is 5. A compound according to claim 1 or 2, wherein m and n are each 2, Y is a bond, R ¹ is methyl, R ² is COOR ⁴ and R ⁴ is C _g C ₄ alkyl or benzyl. 6. A compound according to any one of claims 1 to 5, wherein A is - 82 042641 7. A compound according to any one of claims 1 to 5, wherein A is 8. A compound according to any one of claims 1 to 5, wherein the compound of formula (I) is represented by structural formula (III), structural formula (III'), structural formula (III), or structural formula (III') 9. A compound according to any one of claims 1-6 wherein o is 0, 1 or 2 and each R ³ is independently selected from the group consisting of CN, halo, NO2, CrC2 alkyl, C1-C4 haloalkyl, C1- C2-alkoxy, C1-C2 haloalkoxy and C(=O)NHR1, where R ¹ is C1-C2-alkyl. 10. Connection according to any one of claims 1-9, where: (i) two R ³ groups attached to adjacent carbon atoms of an aryl or heteroaryl ring may form a fused 5-membered ring which may contain a heteroatom selected from O, N and S; and/or - 83 042641 connection selected from the following connections: Connection No. Structure 1 ΝγΝ Uh OU 2 ΝγΝ F , M' OU 3 4e °U 4 Xx ° ~ O., , _O DU 5 ΖΛλ , ¹ ΑΎ by - 84 042641 - 85 042641 11 ΝγΝ ⁿ f, 12 3* ^z \ / ^z o 13 H >t°y ^n< A 1 o L <>L 14 A N^N F , 15 ^HN n ZMu ⁰ 0^7 16 Already, 0J° 19 o> O ^H %<\ CAo , R7 ⁰ 20 A- =^=o - 86 042641 - 87 042641 - 88 042641 11. A method for editing one or more target genomic regions, comprising introducing into one or more cells that contain one or more target genomic regions, a genome editing system and a compound according to any one of claims 1 to 10, or a pharmaceutically acceptable salt or co-crystal thereof , where one or more target genomic regions are being edited. 12. The method of claim 11, wherein the efficiency of editing target genomic regions in one or more cells is increased compared to that in another identical cell or cells when editing is performed without using said compound. 13. A method for repairing a DNA break in one or more target genomic regions using the homologous targeted repair (HDR) pathway, which includes introducing into one or more cells that contain one or more target genomic regions, genome editing systems and compounds according to any one of paragraphs. 1-10, or a pharmaceutically acceptable salt or co-crystal thereof, wherein the genome editing system interacts with nucleic acid(s) of target genomic regions resulting in DNA breakage, and where the DNA breakage is repaired, at least in part, via the HDR pathway. - 89 042641 14. The method according to claim 13, where: (a) DNA breakage repair efficiency in target genomic regions in one or more cells via the HDR pathway is increased compared to that in another identical cell or cells when editing is performed without using said compound; or (b) DNA break includes DNA double strand break (DSB). 15. A method for inhibiting the repair of a DNA break in one or more target genomic regions through the non-homologous end connection (NHEJ) pathway, which includes introducing into one or more cells that contain one or more target genomic regions, genome editing systems and compounds according to any one of paragraphs. 1-10 or a pharmaceutically acceptable salt or co-crystal thereof, wherein the genome editing system interacts with the nucleic acid(s) of one or more target genomic regions resulting in DNA breakage, and where repair of the DNA break via the NHEJ pathway is inhibited or suppressed. 16. The method according to claim 15, where: (a) the efficiency of DNA breakage repair inhibition in target genomic regions in one or more cells via the NHEJ pathway is increased compared to that in another identical cell or cells when the editing is performed without using said compound; (b) DNA break includes DNA double strand break (DSB). 17. A method for modifying the expression of one or more genes or proteins, comprising introducing into one or more cells that contain one or more target genomic regions, genome editing systems and compounds according to any one of claims 1-10, or a pharmaceutically acceptable salt or its co-crystal, where the genome editing system interacts with the nucleic acid(s) of one or more target genomic regions of the target gene(s), resulting in editing of one or more target genomic regions, and where the editing modifies the expression of the downstream gene(s) and/ or protein(s) associated with the target gene(s). 18. The method according to claim 17, where: (a) where the expression of the downstream gene(s) and/or protein(s) associated with the target gene(s) is increased from a baseline expression level in one or more cells prior to administration, further, optionally, where: expression is increased by at least 10, 20, 30, 40, 50, 60, 70, 80, 90%, or expression is 1-, 1.5-, 2-, 2.5-, 3-, 3.5 -, 4-, 4.5-, 5- or 10-fold increase in comparison with the initial level of expression in one or more cells before administration; or (b) the expression of the downstream gene(s) and/or protein(s) associated with the target gene(s) is reduced from baseline expression in one or more cells prior to administration, optionally wherein gene expression is reduced by at least measure by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% of baseline expression in one or more cells prior to administration; or (c) expression of the downstream gene(s) and/or protein(s) associated with the target gene(s) is substantially absent in one or more cells. 19. The method according to any one of claims 11-16, where: (i) said efficiency is increased by at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50 or 100 times the efficiency in another identical cell or cells when editing is performed without using said compound; or (ii) said potency is measured by the frequency of targeted integration of polynucleotides or the frequency of site-directed mutagenesis, optionally, where site-directed mutagenesis includes point mutations, deletions and/or insertions. 20. The method according to any one of claims 11-16, where: (i) the cell is synchronized in the S or G2 phase of the cell cycle; and/or (ii) one or more cells injected with or contacted with said compound have increased survival compared to one or more cells that were not injected with or were not brought into contact with said compound; and/or (iii) the genome editing system and said compound are administered to one or more cells at the same time; and/or (iv) a genome editing system and said compound are introduced into one or more cells sequentially; optional where: (a) the genome editing system is introduced into one or more cells prior to administration of said compound; or (b) the compound is introduced into one or more cells prior to the introduction of the genome editing system; and/or (v) one or more cells are: (a) cultured cells; or - 90 042641 (b) cells in vivo in the body; or (c) ex vivo cells from the body; optionally, where the organism is a mammal or a human; and/or (vi) wherein the genome editing system and said compound are administered: (a) by the same route of administration; or (b) different routes of administration, optionally, where the genome editing system is administered intravenously, and the specified compound is administered orally; and/or (vii) the genome editing system is selected from a meganuclease-based system, a zinc finger nuclease (ZFN)-based system, a transcription activator-like effector nuclease (TALEN)-based system, a CRISPR-based system, or an NgAgo-based system, optionally , systems based on CRISPR. 21. The method of claim 20, wherein the CRISPR-based system is a CRISPR-Cas system or a CRISPR-Cpf system, optionally, where: (i) the CRISPR-based system is a CRISPR-Cas system, and the CRISPR-Cas system includes: (a) at least one guide RNA element that includes: (i) a targeting RNA containing a nucleotide sequence substantially complementary to a nucleotide sequence in one or more target genomic regions, or a nucleic acid containing a nucleotide sequence(s) encoding targeting RNA; and (ii) an activating RNA containing a nucleotide sequence capable of hybridizing with a target RNA, or a nucleic acid containing a nucleotide sequence(s) encoding an activating RNA; and (b) a Cas protein element that includes a Cas protein or a nucleic acid containing a nucleotide sequence(s) encoding a Cas protein, further optionally, where: (a) said guide RNA and activating RNA are fused into one molecule; or (b) the Cas protein is a type II Cas9 protein, optionally wherein the Cas9 protein is SaCas9, SpCas9, SpCas9n, Cas9-HF, Cas9-H840A, FokI-dCas9, or nickase D10A, or any combinations thereof; or (ii) the CRISPR-based system is a CRISPR-Cpf system and the CRISPR-Cpf system includes: (a) at least one guide RNA element or nucleic acid that includes a nucleotide sequence(s) encoding a guide RNA element, a guide RNA that includes a target RNA that includes a nucleotide sequence substantially complementary to the nucleotide sequence in one or multiple targeted genomic regions; and (b) a Cpf protein element that includes a Cpf protein or a nucleic acid containing a nucleotide sequence encoding a Cpf protein. 22. The method according to any one of claims 15-21, where: (i) the genome editing system is delivered with one or more vectors, optionally, where one or more vectors are selected from viral vectors, plasmids, or single-stranded DNA (ssDNA), additionally, optionally, where the viral vectors are selected from the group consisting of retroviral, lentiviral, adenovirus , adeno-associated vectors and vectors based on herpes simplex virus; and/or (ii) the genome editing system is delivered by: (a) synthetic RNA; or (b) nanocomposition. 23. A kit for editing one or more target genomic regions, comprising a genome editing system and a compound according to any one of claims 1 to 10, or a pharmaceutically acceptable salt or co-crystal thereof. 24. The kit of claim 23, wherein the genome editing system is a meganuclease-based system, a zinc finger nuclease (ZFN)-based system, a transcription activator-like effector nuclease (TALEN)-based system, a CRISPR-based system, or a NgAgo, optionally, where the genome editing system is a CRISPR-based system. 25. The kit according to claim 23 or 24, where the CRISPR-based system is a CRISPR-Cas system or a CRISPR-Cpf system, optionally, where: (i) the CRISPR-based system is a CRISPR-Cas system, and the CRISPR-Cas system includes: (a) at least one targeting RNA element that includes: (i) a targeting RNA containing a nucleotide sequence substantially complementary to the nucleotide sequences in one or more target genomic regions, or a nucleic acid containing a nucleotide sequence(s) encoding a targeting -