EA042601B1 - HETERODIMERIC IMMUNOGLOBULIN CONSTRUCTS AND METHODS FOR THEIR PRODUCTION - Google Patents

Description

I. Cross-Reference to Related Applications

This application claims the priority of Chinese Patent Application No. CN 2016108638147, filed September 29, 2016, the disclosure of which is hereby incorporated by reference in its entirety.

II. Field of invention

The field of the invention is stable and highly specific immunoglobulin constructs that retain the desired properties of native IgG antibodies without undesirable mismatch between heavy and light chains.

III. Prior Art

Monoclonal antibodies (mAbs), which are monospecific and interact only with one epitope of the target antigen, are widely used to treat many diseases, including various types of cancer, inflammatory, autoimmune and infectious diseases. However, to date, none of these therapeutic molecules have demonstrated sufficiently high efficacy as a monotherapy, due to the complex nature of diseases such as cancer or inflammatory disorders, which are usually mediated by multiple pathogenic molecular pathways, as well as the cross-talk of signaling cascades. Because such mAbs interact with only one target antigen, optimal therapeutic effects are difficult to achieve. Simultaneous blockade of multiple targets or multiple sites on the same target should lead to an increase in the effectiveness of the treatment. In addition, targeting multiple antigens/epitopes with a single multispecific molecule simplifies the development of new drugs as therapy is limited to a single molecule. It is also easier for patients and healthcare professionals than using combinations of two or more monospecific molecules.

Bispecific antibodies (BsAbs) or multispecific molecules are well known in the art. Initial attempts at making bispecific antibodies involved chemical conjugation of two existing IgG molecules, two Fab' or two (Fab') ₂ fragments using bifunctional coupling reagents. However, such chemically conjugated BsAbs have their limitations, including the complexity of obtaining bispecific molecules, the difficulty of purifying heterodimers and removing homodimers and parent monoclonal antibodies, and low yield.

Another type of BsAb molecule is the hybridoma or quadroma, obtained by somatic hybridization of two hybridoma cells secreting different antibodies. Due to the random pairing of heavy and light chains of immunoglobulins, only about one tenth of the possible mixture of paired IgGs contains functional BsAbs, which complicates the purification and reduces the yield.

WO 2013/060867 describes a method for the large-scale production of heterodimeric bispecific antibodies by the reduction of two miscible homodimeric immunoglobulins, which results in an exchange of Fab fragments enhanced by the introduction of asymmetric mutations in the CH3 domains of the homodimers, followed by reverse oxidation of interchain disulfide bonds.

WO 2009/089004 discloses a method for producing a heterodimeric protein by introducing a mutation at one or more charged amino acids at the CH3-CH3 interface that electrostatically prevents the formation of homodimers, but electrostatically promotes the formation of heterodimers.

US 5,173,168 describes a method for producing heterodimeric IgGs using the knobs-into-holes method. First, a protrusion is created at the contact line of the CH3 domains of the first chain by replacing the amino acid with a smaller side chain with an amino acid with a larger side chain, and a depression is created at the contact line of the CH3 domains of the second chain by replacing the amino acid with a larger side chain with an amino acid with a smaller side chain. The interaction of the protrusion and the cavity promotes the formation of heterodimeric IgG and prevents the formation of homodimers.

WO 2012/058768 discloses a method for producing heterodimeric IgG from mutations introduced into the CH3 domain of IgG1, including negative and positive designs, as well as protein engineering techniques based on structural and computer modeling.

The neonatal Fc receptor, FcRn, contains one transmembrane heavy chain (P51 subunit, α-chain) and one soluble light chain (P14 subunit, β-chain) held side by side by non-covalent interactions and is structurally homologous to the heterodimeric receptor family of the main class I major histocompatibility complex (MHC). FcRn performs a number of important biological functions. As a carrier receptor, FcRn binds to IgG and albumin and crosses many cellular barriers. For example, FcRn mediates the transfer of maternal IgG antibodies to the fetus, providing neonatal humoral immunity during pregnancy. The pH-dependent interaction of FcRn with IgG and albumin is critical to increase serum half-life through recycling and less protein degradation, as disclosed in Adv Drug Deliv Rev. 2015 Aug 30; 91:109-24; J Immunol. 2015 May 15; 194(10):4595-603; and Nat Rev Immunol. 2007 Sep; 7(9):715-25. The FcRn and IgG binding site is located at the junction of the CH2 and CH3 domains and includes amino acid residues 253, 310 and 435 as disclosed in Immunol Rev. Nov 2015; 268(1):253-68 and Mol Immunol. 2015 Oct; 67 (2 Pt A): 131-41.

- 1 042601

IV. Brief summary of the invention

The present invention relates to heterodimeric immunoglobulin constructs, eg, bispecific antibodies, having modified constant regions to improve stability and specificity, as well as methods for their preparation and use.

Accordingly, in a first aspect, the present invention is directed to a heterodimer comprising an Fc receptor (FcR) binding element and one or more recognition moieties covalently linked to the FcR binding element. The FcR binding element comprises a first polypeptide and a second polypeptide linked to each other by one or more disulfide bonds. Each of the first polypeptide and the second polypeptide contains at least a portion of an immunoglobulin heavy chain constant region. The first polypeptide and the second polypeptide contain at least five amino acid substitutions at the following positions:

1) 366 and 399 in the first polypeptide and 351, 407 and 409 in the second polypeptide; or

2) 366 and 409 in the first polypeptide and 351, 399 and 407 in the second polypeptide; whereby the first and second polypeptides have a higher tendency to dimerize with each other than with themselves.

In some embodiments, at least five amino acid substitutions include at least one of the following substitutions:

a) glycine, tyrosine, valine, proline, aspartate, glutamate, lysine or tryptophan instead of L351 in the second polypeptide;

b) leucine, proline, tryptophan or valine instead of T366 in the first polypeptide;

c) cysteine, asparagine, isoleucine, glycine, arginine, threonine or alanine instead of D399 in the first polypeptide and/or the second polypeptide;

d) leucine, alanine, proline, phenylalanine, threonine or histidine instead of Y407 in the second polypeptide;

e) cysteine, proline, serine, phenylalanine, valine, glutamate or arginine instead of K409 in the first polypeptide and/or the second polypeptide.

In some embodiments, the at least five amino acid substitutions include any of the following combinations of any element from each of Group I (a)-(h) and Group II (a)-(h):

group I:

a) T366L in the first polypeptide and L351E, Y407L in the second polypeptide;

b) T366L in the first polypeptide and L351G, Y407L in the second polypeptide;

c) T366L in the first polypeptide and L351Y, Y407A in the second polypeptide;

d) T366P in the first polypeptide and L351V, Y407P in the second polypeptide;

e) T366W in the first polypeptide and L351D, Y407P in the second polypeptide;

f) T366P in the first polypeptide and L351P, Y407F in the second polypeptide;

g) T366V in the first polypeptide and L351K, Y407T in the second polypeptide; And

h) T366L in the first polypeptide and L351W, Y407H in the second polypeptide;

group II:

a) D399R in the first polypeptide and K409V in the second polypeptide;

b) D399C in the first polypeptide and K4O9C in the second polypeptide;

c) D399C in the first polypeptide and K4O9P in the second polypeptide;

d) D399N in the first polypeptide and K409S in the second polypeptide;

e) D399G in the first polypeptide and K409S in the second polypeptide;

f) D399I in the first polypeptide and K409F in the second polypeptide;

g) D399T in the first polypeptide and K409Q in the second polypeptide; And

h) D399A in the first polypeptide and K409R in the second polypeptide.

In some embodiments, the at least five amino acid substitutions include any of the following combinations of any element from each of Group III (a)-(h) and Group IV (a)-(h):

group III:

a) T366L in the first polypeptide and L351E, Y407L in the second polypeptide;

b) T366L in the first polypeptide and L351G, Y407L in the second polypeptide;

c) T366L in the first polypeptide and L351Y, Y407A in the second polypeptide;

d) T366P in the first polypeptide and L351V, Y407P in the second polypeptide;

e) T66W in the first polypeptide and L351D, Y407P in the second polypeptide;

f) T366P in the first polypeptide and L351P, Y407F in the second polypeptide;

g) T366V in the first polypeptide and L351K, Y407T in the second polypeptide; And

h) T366L in the first polypeptide and L351W, Y407H in the second polypeptide;

group IV:

a) K409V in the first polypeptide and D399R in the second polypeptide;

b) K409C in the first polypeptide and D399C in the second polypeptide;

c) K4O9P in the first polypeptide and D399C in the second polypeptide;

d) K409S in the first polypeptide and D399N in the second polypeptide;

e) K409S in the first polypeptide and D399G in the second polypeptide;

f) K409F in the first polypeptide and D399I in the second polypeptide;

- 2 042601

g) K409Q in the first polypeptide and D399T in the second polypeptide; And

h) K409R in the first polypeptide and D399A in the second polypeptide.

In some embodiments, at least five amino acid substitutions include any of the following elements of group V(a)-(h):

Group V:

a) T366L and D399R in the first polypeptide and L351E, Y407L and K409V in the second polypeptide;

b) T366L and D399C in the first polypeptide and L351G, Y407L and K4O9C in the second polypeptide;

c) T366L and D399C in the first polypeptide and L351Y, Y407A and K4O9P in the second polypeptide;

d) T366P and D399N in the first polypeptide and L351V, Y407P and K409S in the second polypeptide;

e) T366W and D399G in the first polypeptide and L351D, Y407P and K409S in the second polypeptide;

f) T366P and D399I in the first polypeptide and L351P, Y407F and K409F in the second polypeptide;

g) T366V and D399T in the first polypeptide and L351K, Y407T and K409Q in the second polypeptide; And

h) T366L and D399A in the first polypeptide and L351W, Y407H and K409R in the second polypeptide.

In some embodiments, at least five amino acid substitutions include any of the following elements of group VI(a)-(h):

group VI:

a) T366L and K409V in the first polypeptide and L351E, Y407L and D399R in the second polypeptide;

b) T366L and K4O9C in the first polypeptide and L351G, Y407L and D399C in the second polypeptide;

c) T366L and K4O9P in the first polypeptide and L351Y, Y407A and D399C in the second polypeptide;

d) T366P and K409S in the first polypeptide and L351V, Y407P and D399N in the second polypeptide;

e) T366W and K409S in the first polypeptide and L351D, Y407P and D399G in the second polypeptide;

f) T366P and K409F in the first polypeptide and L351P, Y407F and D399I in the second polypeptide;

g) T366V and K409Q in the first polypeptide and L351K, Y407T and D399T in the second polypeptide; And

h) T366L and K409R in the first polypeptide and L351W, Y407H and D399A in the second polypeptide.

In some embodiments, at least five amino acid substitutions include T366L and D399R in the first polypeptide. In some embodiments, at least five amino acid substitutions include L351E, Y407L and K409V in the second polypeptide. In some embodiments, the at least five amino acid substitutions include T366L and D399R in the first polypeptide and L351E, Y407L and K409V in the second polypeptide.

In some embodiments, the FcR binding element contains an Fc domain. In some embodiments, the Fc domain is derived from the Fc domain of IgG. In some embodiments, the Fc domain is derived from one of an IgG1 Fc domain, an IgG2 Fc domain, an IgG3 Fc domain, and an IgG4 Fc domain.

In some embodiments, the FcR binding element is capable of specifically binding to the Fc receptor. In some embodiments, the Fc receptor is a neonatal Fc receptor (FcRn). In some embodiments, the Fc receptor is one of FcyRI, FcyRIIA, FcyRIIB1, FcyRIIB2, FcyRIIIA, FcyRIIIB, FcεRI, FcεRII, FcaRI, Fcα/μR, FcRn, and combinations thereof. In some embodiments, binding to the Fc receptor triggers antibody-dependent cell-mediated cytotoxicity (antibody-dependent cell-mediated cytotoxicity, ADCC).

In some embodiments, the sequence of at least one of the first polypeptide and the second polypeptide comprises one of SEQ ID NOs: 16-31, 33, 35, 37, 39, 41, 43, 45, 48, 49, 51, 53, 55, 57 , 59, 61, 63, 68, 69, 70 and 71.

In some embodiments, one or more recognition moieties covalently linked to the FcR binding element comprises at least one of an antigen-binding (Fab) fragment or fragments, a single chain variable fragment or fragments (scFv), extracellular domains of membrane receptors, peptide ligands cell membrane receptors, cytokines and affinity tags. In some embodiments, the one or more recognition groupings comprise a Fab fragment and an scFv fragment. In some embodiments, one or more than one recognition grouping contains two scFv fragments. In some embodiments, the two scFv fragments are not identical. In some embodiments, one or more of the recognition groupings contains two Fab fragments. In some embodiments, the two Fab fragments are not identical. In some embodiments, the heterodimers comprise immunoglobulin-like (Ig-like) molecules having two non-identical Fab fragments.

In some embodiments, one or more recognition groups recognize HER2. In some embodiments, one or more recognition groups recognize PD-L1. In some embodiments, one or more recognition groups recognize Trop-2. In some embodiments, one or more recognition groups recognize CD3. In some embodiments, one or more recognition groups recognize CD20.

In some embodiments, recognition includes specific binding. In some embodiments, one or more recognition moieties specifically bind to HER2. In some embodiments, one or more recognition moieties specifically binds to PDL1. In some embodiments, one or more recognition moieties specifically bind to Trop-2. In some embodiments, one or more recognition moieties specifically binds to CD3. In some embodiments, one or more recognition moieties specifically binds to CD20.

In some embodiments, one or more than one recognition group contains a pair of recognition groups selected from group VII(a)-(d) below:

Group VII:

a) Fab specific to HER2 and scFv specific to CD3;

b) Trop-2 specific binding Fab and CD3 specific binding scFv;

c) Fab specific to CD20 and scFv specific to CD3; And

d) Fab specific to PD-L1 and scFv specific to CD3.

In some embodiments, the one or more recognition moieties comprise a HER2-specific Fab and a CD20-specific Fab.

In some embodiments, the heterodimers contain non-identical first heavy chains, non-identical second heavy chains, non-identical first light chains, and non-identical second light chains.

In another aspect, the present invention is directed to a method for producing a heterodimer. In some embodiments, the method includes the steps of: 1) expressing one or more nucleic acids encoding a first polypeptide in a first host cell and one or more nucleic acids encoding a second polypeptide in a second host cell, wherein the first cell the host and the second host cell are separated from each other; 2) recovery of the first polypeptide and the second polypeptide when separated; 3) mixing the first polypeptide and the second polypeptide to obtain a mixture; 4) oxidation of the resulting mixture; and 5) isolating the resulting heterodimer.

In another aspect, the present invention is directed to a method for preparing a heterodimer comprising a bivalent heterologous immunoglobulin having a non-identical first heavy chain and a second heavy chain and a non-identical first light chain and a second light chain. In some embodiments, the method includes the steps of: 1) expressing one or more nucleic acids encoding a first heavy chain and a first light chain in a first host cell and one or more nucleic acids encoding a second heavy chain and a second light chain , in the second host cell, where the first host cell and the second host cell are separated from each other; 2) reducing the first heavy chain and the first light chain together and the second heavy chain and the second light chain together; 3) combining the first heavy chain, the first light chain, the second heavy chain and the second light chain to form a mixture; 4) oxidation of the resulting mixture; and 5) isolating the resulting heterodimer. In some embodiments, the first heavy chain and the second heavy chain form the Fco region of a bivalent heterologous immunoglobulin.

In some embodiments, the Fc region contains at least five amino acid substitutions, including any of the following combinations of any element from each of Group VIII (a)-(h) and Group IX (a)-(h):

Group VIII:

a) T366L in the first heavy chain and L351E, Y407L in the second heavy chain;

b) T366L in the first heavy chain and L351G, Y407L in the second heavy chain;

c) T366L in the first heavy chain and L351Y, Y407A in the second heavy chain;

d) T366P in the first heavy chain and L351V, Y407P in the second heavy chain;

e) T366W in the first heavy chain and L351D, Y407P in the second heavy chain;

f) T366P in the first heavy chain and L351P, Y407F in the second heavy chain;

g) T366V in the first heavy chain and L351K, Y407T in the second heavy chain; And

h) T366L in the first heavy chain and L351W, Y407H in the second heavy chain;

group IX:

a) D399R in the first heavy chain and K409V in the second heavy chain;

b) D399C in the first heavy chain and K4O9C in the second heavy chain;

c) D399C in the first heavy chain and K4O9P in the second heavy chain;

d) D399N in the first heavy chain and K409S in the second heavy chain;

e) D399G in the first heavy chain and K409S in the second heavy chain;

f) D399I in the first heavy chain and K409F in the second heavy chain;

g) D399T in the first heavy chain and K409Q in the second heavy chain; And

h) D399A in the first heavy chain and K409R in the second heavy chain.

In some embodiments, at least five amino acid substitutions include any of the following elements of group X (a)-(h):

group X:

a) T366L and D399R in the first heavy chain and L351E, Y407L and K409V in the second heavy chain;

b) T366L and D399C in the first heavy chain and L351G, Y407L and K4O9C in the second heavy chain;

c) T366L and D399C in the first heavy chain and L351Y, Y407A and K4O9P in the second heavy chain;

d) T366P and D399N in the first heavy chain and L351V, Y407P and K409S in the second heavy chain;

e) T366W and D399G in the first polypeptide and L351D, Y407P and K409S in the second heavy chain;

- 4 042601

f) T366P and D399I in the first polypeptide and L351P, Y407F and K409F in the second heavy chain;

g) T366V and D399T in the first heavy chain and L351K, Y407T and K409Q in the second heavy chain; And

h) T366L and D399A in the first heavy chain and L351W, Y407H and K409R in the second heavy chain.

In some embodiments, at least five amino acid substitutions include any of the following Group XI elements (a)-(h):

group XI:

a) T366L and K409V in the first heavy chain and L351E, Y407L and D399R in the second heavy chain;

b) T366L and K4O9C in the first heavy chain and L351G, Y407L and D399C in the second heavy chain;

c) T366L and K4O9P in the first heavy chain and L351Y, Y407A and D399C in the second heavy chain;

d) T366P and K409S in the first heavy chain and L351V, Y407P and D399N in the second heavy chain;

e) T366W and K409S in the first heavy chain and L351D, Y407P and D399G in the second heavy chain;

f) T366P and K409F in the first heavy chain and L351P, Y407F and D399I in the second heavy chain;

g) T366V and K409Q in the first heavy chain and L351K, Y407T and D399T in the second heavy chain; And

h) T366L and K409R in the first heavy chain and L351W, Y407H and D399A in the second heavy chain.

In another aspect, the present invention is directed to a method for preparing a heterodimer comprising an immunoglobulin heterodimer containing a non-identical first heavy chain and a second heavy chain and a non-identical first light chain and a second light chain. In some embodiments, the method includes the steps of: 1) expressing one or more nucleic acids encoding a first heavy chain and a first light chain in a first host cell and one or more nucleic acids encoding a second heavy chain and a second light chain , in the second host cell, where the first host cell and the second host cell are separated from each other; 2) reducing the first heavy chain and the first light chain together and the second heavy chain and the second light chain together; 3) combining the first heavy chain, the first light chain, the second heavy chain and the second light chain to form a mixture; 4) oxidation of the resulting mixture; and 5) isolating the resulting heterodimer. In some embodiments, the first heavy chain and the second heavy chain form the Fc region of a bivalent heterologous immunoglobulin.

In some embodiments, the Fc domain contains at least five amino acid substitutions, including any of the following combinations of any element from each of Group XII (a)-(h) and Group XIII (a)-(h):

Group XII:

a) T366L in the first heavy chain and L351E, Y407L in the second heavy chain;

b) T366L in the first heavy chain and L351G, Y407L in the second heavy chain;

c) T366L in the first heavy chain and L351Y, Y407A in the second heavy chain;

d) T366P in the first heavy chain and L351V, Y407P in the second heavy chain;

e) T366W in the first heavy chain and L351D, Y407P in the second heavy chain;

f) T366P in the first heavy chain and L351P, Y407F in the second heavy chain;

g) T366V in the first heavy chain and L351K, Y407T in the second heavy chain; And

h) T366L in the first heavy chain and L351W, Y407H in the second heavy chain;

Group XIII:

a) K409V in the first heavy chain and D399R in the second heavy chain;

b) K409C in the first heavy chain and D399C in the second heavy chain;

c) K4O9P in the first heavy chain and D399C in the second heavy chain;

d) K409S in the first heavy chain and D399N in the second heavy chain;

e) K409S in the first heavy chain and D399G in the second heavy chain;

f) K409F in the first heavy chain and D399I in the second heavy chain;

g) K409Q in the first heavy chain and D399T in the second heavy chain; And

h) K409R in the first heavy chain and D399A in the second heavy chain.

In another aspect, the present invention is directed to a method for producing a heterodimer comprising a bivalent heterologous protein comprising a heavy chain, a light chain, and an Fc chain-linked scFv fragment, wherein the portion of the heavy chain and the Fc chain linked to the scFv fragment form an Fco region. . In some embodiments, the method includes the steps of: 1) expressing one or more nucleic acids encoding a heavy chain and a light chain and one or more nucleic acids encoding an Fc chain-related scFv fragment in a host cell ; and 2) isolating the resulting heterodimer.

In some embodiments, the Fc region contains at least five amino acid substitutions, including any of the following combinations of any element of each of group XIV (a)-(h) and group XV (a)-(h):

Group XIV:

a) T366L in the first heavy chain and L351E, Y407L in the second heavy chain;

b) T366L in the first heavy chain and L351G, Y407L in the second heavy chain;

c) T366L in the first heavy chain and L351Y, Y407A in the second heavy chain;

d) T366P in the first heavy chain and L351V, Y407P in the second heavy chain;

- 5 042601

e) T366W in the first heavy chain and L351D, Y407P in the second heavy chain;

f) T366P in the first heavy chain and L351P, Y407F in the second heavy chain;

g) T366V in the first heavy chain and L351K, Y407T in the second heavy chain; And

h) T366L in the first heavy chain and L351W, Y407H in the second heavy chain;

Group XV:

a) D399R in the first heavy chain and K409V in the second heavy chain;

b) D399C in the first heavy chain and K4O9C in the second heavy chain;

c) D399C in the first heavy chain and K4O9P in the second heavy chain;

d) D399N in the first heavy chain and K409S in the second heavy chain;

e) D399G in the first heavy chain and K409S in the second heavy chain;

f) D399I in the first heavy chain and K409F in the second heavy chain;

g) D399T in the first heavy chain and K409Q in the second heavy chain; And

h) D399A in the first heavy chain and K409R in the second heavy chain.

In some embodiments, the at least five amino acid substitutions include any of the following combinations of any element from each of Group XVI(a)-(h) and Group XVII(a)-(h):

group XVI:

a) T366L in the first heavy chain and L351E, Y407L in the second heavy chain;

b) T366L in the first heavy chain and L351G, Y407L in the second heavy chain;

c) T366L in the first heavy chain and L351Y, Y407A in the second heavy chain;

d) T366P in the first heavy chain and L351V, Y407P in the second heavy chain;

e) T366W in the first heavy chain and L351D, Y407P in the second heavy chain;

f) T366P in the first heavy chain and L351P, Y407F in the second heavy chain;

g) T366V in the first heavy chain and L351K, Y407T in the second heavy chain; or

h) T366L in the first heavy chain and L351W, Y407H in the second heavy chain;

Group XVII:

a) K409V in the first heavy chain and D399R in the second heavy chain;

b) K409C in the first heavy chain and D399C in the second heavy chain;

c) K4O9P in the first heavy chain and D399C in the second heavy chain;

d) K409S in the first heavy chain and D399N in the second heavy chain;

e) K409S in the first heavy chain and D399G in the second heavy chain;

f) K409F in the first heavy chain and D399I in the second heavy chain;

g) K409Q in the first heavy chain and D399T in the second heavy chain; And

h) K409R in the first heavy chain and D399A in the second heavy chain.

In some embodiments of aspects relating to methods for producing a heterodimer, the nucleic acids are located on a vector or in a system of vectors. In some embodiments, the vector or vector system includes the pX0GC plasmid vector(s) obtained by modifying the pCDNA vector(s).

In some embodiments of aspects related to methods for producing a heterodimer, the host cells include human embryonic kidney cells (HEK293) or HEK293T, HEK293E, HEK293F cells obtained by modifying HEK293 cells, Chinese hamster ovary (CHO) cells or CHO-S, CHO-dhfr ^- , CHO /DG44, ExpiCHO obtained by modification of CHO cells, and combinations thereof.

In some embodiments of the heterodimer processes, the reduction steps include one or more reducing agents comprising at least one of 2-aminoethanethiol, dithiothreitol, tris(2-carboxyethyl)phosphine hydrochloride, their chemical derivatives, and their combinations. In some embodiments, the methods further comprise restoring at about 2-8°C, such as 3-6°C and 4°C, possibly over a time period of at least about 3 hours (for example, 3-8 hours, 4- 7 hours and 5-6 hours). In other embodiments, the methods include removing one or more reducing agents. In some embodiments, the removal of one or more reducing agents includes a desalting method.

In some embodiments of aspects related to methods for producing a heterodimer, the stage, including oxidation, include one or more than one oxidant containing at least one of L-dehydroascorbic acid, its chemical derivatives, and combinations thereof. In some embodiments, the methods further include oxidizing at about 2-8°C, such as 3-6°C and 4°C, optionally over a time period of at least about 5 hours (for example, 5 hours to 4 days, from 5 hours to 3 days, from 5 hours to 1 day). In some embodiments, the method further includes isolation and/or purification.

In another aspect, the present invention is directed to nucleic acids encoding part of a heterodimer according to any aspect of the present invention. In some embodiments, the nucleic acid sequence comprises one of SEQ ID NOs: 32, 34, 36, 38, 40, 42, 44, 46, 47, 50, 52, 54, 56, 58, 60, 62, and 64-67, or sequence by at least 70%, for example at least 75,

- 6 042601

80, 85, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8% or as per at least 99.9% identical to one or more of SEQ ID NOs: 32, 34, 36, 38, 40, 42, 44, 46, 47, 50, 52, 54, 56, 58, 60, 62 and 6467 In some embodiments, the nucleic acid sequence contains a sequence that will hybridize to one or more of SEQ ID NOs: 32, 34, 36, 38, 40, 42, 44, 46, 47, 50, 52, 54, 56, 58, 60, 62 and 64-67 in tough conditions. In some embodiments, the nucleic acid sequence contains a sequence complementary to one or more of SEQ ID NOs: 32, 34, 36, 38, 40, 42, 44, 46, 47, 50, 52, 54, 56, 58, 60, 62 and 64-67.

In another aspect, the present invention is directed to a vector or vector system comprising at least one nucleic acid encoding a heterodimer portion of any aspect of the present invention. In some embodiments, the vector or vector system includes the pX0GC plasmid vector(s) obtained by modifying the pCDNA vector(s).

In another aspect, the present invention is directed to a host cell comprising a vector or vector system comprising any nucleic acid encoding a heterodimer portion of any aspect of the present invention. In some embodiments, the host cell is one of human embryonic kidney (HEK293) or HEK293T, HEK293E, HEK293F cells obtained by modifying HEK293 cells, Chinese Hamster Ovary (CHO) cells or CHO-S, CHO-dhfr ^- , CHO/DG44, ExpiCHO obtained by modifying CHO cells.

In another aspect, the present invention is directed to a method for recombinantly producing a heterodimer portion according to any aspect of the present invention. In some embodiments, the method includes providing a host cell containing a vector or vector system containing one or more nucleic acids encoding at least a first heavy chain and a second heavy chain of a heterodimer according to any aspect of the present invention, expressing the nucleic acids, and isolating the recombinantly produced heterodimer.

In another aspect, the present invention is directed to a composition containing the heterodimer described above and a pharmaceutically acceptable carrier, preservative or excipient.

In another aspect, the present invention is directed to a method of administering the heterodimer described above to a subject in need thereof. In some embodiments, the heterodimer is administered to a subject to treat a disease or condition. In other embodiments, the heterodimer is administered to a subject to prevent a disease or condition. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

In some embodiments, the disease or condition includes at least one of autoimmune diseases, immune response against transplants, allergic reactions, infections, neurodegenerative diseases, neoplastic diseases, and cell proliferative disorders, or combinations thereof. In some embodiments, the autoimmune diseases include at least one of arthritis, rheumatoid arthritis, psoriasis, multiple sclerosis (PC), ulcerative colitis, Crohn's disease, systemic lupus erythematosus (SLE), glomerulonephritis, diseases like dilated cardiomyopathy, Sjögren's syndrome, allergic contact dermatitis , polymyositis, scleroderma, periarteritis nodosa, rheumatism, vitiligo, insulin-dependent diabetes mellitus, Behçet's syndrome, chronic thyroiditis, and combinations thereof. In some embodiments, the neurodegenerative diseases include at least one of Parkinson's disease, Huntington's disease, Machado-Joseph's disease, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, and combinations thereof. In some embodiments, the neoplastic diseases and cell proliferative disorders include at least one of leukemia, lymphoma, myeloma, brain tumors, head and neck squamous cell carcinoma, non-small cell lung cancer (NSCLC), nasopharyngeal cancer, esophageal cancer, gastric cancer, pancreatic cancer , gallbladder cancer, liver cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, uterine sarcoma, prostate cancer, bladder cancer, renal cell cancer, melanoma, and combinations thereof.

In another aspect, the present invention is directed to a heterodimer as described above for use in medicine.

In another aspect, the present invention is directed to a heterodimer for use in the treatment of a disease or condition. In some embodiments, the disease or condition includes at least one of autoimmune diseases, immune response against transplants, allergic reactions, infections, neurodegenerative diseases, neoplastic diseases, and cell proliferative disorders, or combinations thereof.

In another aspect, the present invention is directed to the use of a heterodimer as described above for the manufacture of a medicament.

In another aspect, the present invention is directed to the use of a heterodimer as described above for the manufacture of a medicament for the treatment of a disease or condition. In some embodiments, the heterodimer is a heterodimer according to any aspect of the present invention. In some embodiments, the disease or condition includes at least one of autoimmune diseases, immune response against transplants, allergic reactions, infections, neurodegenerative diseases, neoplastic diseases, and cell proliferative disorders, or combinations thereof.

V. Brief description of graphic materials

In FIG. 1 shows a typical pDis3 vector. Cmv is a cytomegalovirus promoter, sp is a signal peptide, SUMO is a Small Ubiquitin-related Modifier tag, Fc is a crystallizable fragment, BGH is a bovine growth hormone polyadenylation signal (bgh-PolyA), HA is human influenza virus hemagglutinin, PUC ori is the pUC replicator, Hydro is the hygromycin B resistance gene, AmpR is the ampicillin resistance gene, oriP is the Epstein-Barr virus replicator.

In FIG. 2 shows the structure of the Fc heterodimer library.

In FIG. 3 shows pairing to form homodimers and a heterodimer.

In FIG. 4 shows the general structure of the anti-HER2/scFv anti-CD3 antibody heterodimer.

In FIG. 5 shows the elution peak of the anti-HER2/scFv anti-CD3 heterodimer.

In FIG. 6 shows SDS-PAGE analysis of an anti-HER2/scFv anti-CD3 antibody heterodimer.

In FIG. 7 shows the purity analysis of the anti-HER2/scFv anti-CD3 antibody heterodimer.

In FIG. 8A and B show heterodimer stability of anti-HER2/scFv anti-CD3 antibody at various concentrations: 10 mg/mL, 40°C (FIG. 8A), 1 mg/mL, 40°C (FIG. 8B).

In FIG. 9 shows the binding affinity of the anti-HER2/scFv anti-CD3 antibody heterodimer to FcRn.

In FIG. 10A, B, C and D show co-binding of anti-HER2/scFv anti-CD3 antibody heterodimer to SK-BR-3 and Jurkat cells: isotype control (FIG. 10A), anti-HER2 mAb (FIG. 10B), tetravalent homodimeric anti-HER2 BsAb /CD3 (Fig. 10C), bivalent heterodimeric BsAb against HER2/CD3 (Fig. 10D).

In FIG. 11A and B show the in vitro cytotoxicity of the anti-HER2/scFv anti-CD3 antibody heterodimer against various target cells: SK-BR-3 (FIG. 11A), BT-474 (FIG. 11B).

In FIG. 12 shows the pharmacokinetic (PK) profile of the anti-HER2/scFv anti-CD3 antibody heterodimer after a single intraperitoneal injection.

In FIG. 13 shows SDS-PAGE analysis of an anti-Trop-2/scFv anti-CD3 antibody heterodimer.

In FIG. 14 shows the binding affinity of the anti-Trop-2/scFv anti-CD3 antibody heterodimer to Trop-2.

In FIG. 15A, B, C, and D show co-binding of anti-Trop-2 antibody/scFv anti-CD3 heterodimer to BxPC-3 and Jurkat cells: isotype control (FIG. 15A), anti-CD3 mAb (FIG. 15B), anti-Trop-2 mAb (FIG. 15C), heterodimeric anti-Trop-2/CD3 BsAb (FIG. 15D).

In FIG. 16A and B show the cytotoxicity of anti-Trop-2/scFv anti-CD3 heterodimer in vitro: H1650 (FIG. 16A) and BxPC-3 (FIG. 16B).

In FIG. 17 shows the pharmacokinetic (PK) profile of the heterodimer anti-Trop2/scFv anti-CD3 antibody after a single intraperitoneal injection.

In FIG. 18 shows SDS-PAGE analysis of an anti-CD20/scFv anti-CD3 antibody heterodimer.

In FIG. 19A and B show heterodimer stability of anti-CD20/scFv anti-CD3 antibody at various concentrations: 10 mg/mL, 40°C (FIG. 19A), 1 mg/mL, 40°C (FIG. 19B).

In FIG. 20 shows SDS-PAGE analysis of an anti-PD-L1/scFv anti-CD3 antibody heterodimer.

In FIG. 21 shows the binding affinity of the anti-PD-L1/scFv anti-CD3 antibody heterodimer to PD-L1.

In FIG. 22A, B, C, and D show co-binding of anti-PDL1/scFv anti-CD3 antibody heterodimer to H460 and Jurkat cells: isotype control (Fig. 22A), anti-PD-L1 mAb (Fig. 22B), anti-CD3 mAb (Fig. 22C). ), a heterodimeric anti-PD-L1/CD3 BsAb (FIG. 22D).

In FIG. 23A and B show the in vitro cytotoxicity of the anti-PD-L1/scFv anti-CD3 antibody heterodimer against various cells: HCC827 (FIG. 23A), H1650 (FIG. 23B).

In FIG. 24 shows the elution peak of anti-CD20 antibody expression products.

In FIG. 25 shows the general structure of an anti-HER2 antibody/anti-CD20 heterodimer.

In FIG. 26 shows the general structure of a half measure.

In FIG. 27 shows SDS-PAGE analysis of the recovery product.

In FIG. 28 shows an analysis of the Size Exclusion-High Performance Liquid Chromatography (SEC-HPLC) reconstitution product.

In FIG. 29 shows SDS-PAGE analysis of the oxidation product.

In FIG. 30 shows the elution peak of the anti-HER2 antibody/anti-CD20 heterodimer.

- 8 042601

In FIG. 31 shows an SDS-PAGE analysis of an anti-HER2/anti-HER2 heterodimer.

CD20.

In FIG. 32 shows the results of the purity analysis of the anti-HER2 antibody/anti-CD20 heterodimer.

In FIG. 33 shows an anti-HER2 antibody/anti-CD20 heterodimer analysis.

In FIG. 34A and B show the mass spectrum of the anti-HER2 antibody/anti-CD20 heterodimer (FIG. 34A) and alignment of the corresponding sequences (FIG. 34B). The solid line indicates that the amino acids are identical to those expected on the second MS, the dotted line indicates that the peptides are identical to those expected on the first MS, and the unshaded amino acids correspond to those not found.

VI. Detailed description of the invention

The present invention relates to heterodimeric immunoglobulin-like constructs, for example, but not necessarily, bispecific antibodies, having modified heavy chain constant regions (eg, Fc region) that impart increased stability and therapeutic efficacy to the constructs. These constructs can be generated while retaining the beneficial properties of native IgG and free from light/heavy chain mismatch. In addition, the present invention relates to methods for preparing immunoglobulin constructs, typically by a reduction reaction followed by an oxidation reaction of two half-antibodies or half-mers to form a heterodimer. The heterodimer of the present invention can be considered as consisting of two such non-identical half-antibodies or half-mers connected to each other by one or more disulfide bonds. The half-mer contains one mutant immunoglobulin heavy chain chain or fragment thereof and an associated recognition moiety (called the cognate recognition moiety of the chain) that are covalently bonded under physiological conditions. These half-measures are designed to have modifications in their heavy chain constant regions that inhibit the formation of homodimers under reducing conditions, which, in the absence of such modifications, would normally promote or maintain homodimeric pairing under non-covalent forces, while at the same time promoting heterodimeric binding of two complementary designed half-measures under the same reducing conditions. Heterodimeric bonding implies both non-covalent and covalent bonding forces. As used here, a semi-antibody or half-mers can refer to a molecule or molecular complex that can be considered as containing only half of the full-length immunoglobulin heterotetramer or immunoglobulin derivatives (such as scFv), that is, it has only one polypeptide chain out of the usual two that normally make up the element, binding to the Fc receptor under typical physiological conditions, and one recognition group associated with the specified one polypeptide chain. For example, a semi-antibody or half-mer may consist of an immunoglobulin heavy chain (or fragment thereof) containing certain mutations and an immunoglobulin light chain (or fragment thereof) linked to each other by covalent bonds or non-covalent interactions such as hydrophobic forces and hydrogen bonds, and its can usually be considered as monovalent. Or, such a monovalent semi-antibody or half-mers may consist of a single chain containing the hinge region and the CH ₂ and _CH 3 regions of an immunoglobulin heavy chain with certain mutations, linked, for example, by a covalent bond, to a non-Fab recognition moiety, for example, with a single chain variable fragment (scFv) or receptor binding domain. A typical half-measure or half-body corresponding to the first case is shown in FIG. 26 where one immunoglobulin heavy chain and one light chain are present.

The output of obtaining a heterodimer according to the present invention is similar to the output of native antibodies, and the proposed method is simple to implement. In one embodiment, where the heterodimer consists of two different semi-antibodies, each of which consists of a full-length immunoglobulin heavy chain carrying certain mutations and a full-length immunoglobulin light chain, the semi-antibodies are usually expressed separately, for example, in two different cells, they are purified separately, separate reduction by adding a reducing agent, mixing them together and then carrying out their oxidation to form a heterodimer. In another embodiment, where the heterodimer consists of two different half-mers, one of which consists of a full-length heavy chain carrying certain mutations and a full-length light chain, while the other is an FcR-binding heavy chain fragment carrying certain mutations, bound with a non-Fab recognition moiety, the heterodimer of the present invention can be expressed and purified using a single cell line. Typical reducing agents include, for example, 2-aminoethanethiol, dithiothreitol, tris(2-carboxyethyl)phosphine hydrochloride, and other chemical derivatives, but the reducing agents are not limited to these options. Typical oxidizing agents include, for example, L-dehydroascorbic acid and other chemical derivatives, but oxidizing agents are not limited to these options.

The heterodimers of the present invention can be characterized by five specific non-cysteine mutations in the CH3 domains of the heterodimers. They are T366, D399, L351, Y407

- 9 042601 and K409. The numbering of amino acid residues used here follows the Kabat EU numbering system, for example, as described in Edelman et al., 1969, Proc Natl Acad Sci USA 63:78-8, incorporated herein by reference in its entirety. The Kabat EU numbering system can be used, for example, to compare the target antibody sequence with a consensus sequence determined by the Kabat EU numbering system. By way of example only, the five mutations may include T366L, D399R, L351E, Y407L and K409V. However, the invention is not limited to these mutations. For example, a mutation at position T366 may include any of the following non-limiting examples: T366L, T366P, T366C, T366V, T366S, T366R, and T366W. A mutation at position D399 may include any of the following non-limiting examples: D399R, D399C, D399H, D399V, D399T, D399A, D399P, D399N, D399I, D399H, D399S, D399G, D399M. A mutation at position L351 may include any of the following non-limiting examples: L351E, L351G, L351R, L351Y, L351T, L351K, L351W, L351V, L351P, and L351D. A mutation at position Y407 may include any of the following non-limiting examples: 407L, Y407P, Y407A, Y407R, Y407V, Y407T, Y407H, and Y407F. A mutation at position K409 may include any of the following non-limiting examples: K409V, K4O9C, K4O9P, K4O9A, K409F, K409Q, K409R, K409T, K409S, K409M, K409Y, and K409N.

In exemplary embodiments, mutations at positions T366 and D399 are present in the first polypeptide, i.e., the CH3 domain of the first heavy chain, and mutations at positions L351, Y407, and K409 are present in the second polypeptide, i.e., the CH3 domain of the second heavy chain. Although the invention is not expressly limited to this combination, it provides optimal spontaneous formation of heterodimers with good stability and binding activity. Each half-mer interacts much more actively with its complementary half-mer partner or partner chain, and much less actively with itself, which significantly promotes the formation of a heterodimer and significantly prevents the formation of homodimers. When only one of the two half-mers constituting the heterodimer is present in aqueous solution under physiological conditions that are sufficiently reducing, the polypeptidyl forms actually present may include the half-mer form, the homodimer form in which the two half-mers are held together by non-covalent forces, and the non-folded forms. In such a solution, the proportion of polypeptidyl forms in homodimer form is significantly reduced, provided that the aqueous solution is substantially free of any polypeptides other than the aforementioned half-mer, such as a complementary other half-mer. In other words, when only one of the first or second polypeptide chain and its associated recognition moiety (polypeptide chain cognate recognition moiety) is placed in an aqueous environment under physiological conditions containing a sufficient amount of a reducing agent, such a polypeptide chain and its cognate recognition moiety do not tend to the formation of homodimers, and preferably remain in aqueous solution in the form of a half-mer, provided that the specified aqueous solution is essentially free from any other polypeptides. Such an act of placement in an aquatic environment includes, for example, expression in a host cell. Similarly, when both of these two polypeptide chains with their cognate recognition moieties are placed in an aqueous environment under physiological conditions containing a sufficient amount of a reducing agent, the corresponding heterodimer and its constituent half-mers may be present, and the formation of homodimers is inhibited. The proportion of homodimer formed in the presence of a reducing agent is usually less than 50% by weight, based on the total weight of all polypeptidyl forms (half-mers, homodimers, heterodimers, unfolded forms, etc.) present in an aqueous solution when the aqueous solution is substantially free of other polypeptides. For example, in the presence of a reducing agent, the proportion (by weight) of homodimers formed by the first polypeptide, the second polypeptide, the first polypeptide covalently linked to the recognition moiety, or the second polypeptide covalently linked to the recognition moiety is less than 50%. For example, less than 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1% or even less.

In certain embodiments, the reducing agent is selected from the group consisting of glutathione, 2-mercaptoethanol, 2-mercaptoethylamine, tris(2-carboxyethyl)phosphine (TCEP), cysteine, cysteine hydrochloride, dithiothreitol (DTT), cysteine dithiotreitol, dithiobutylamine, dithioerythritol (DTE), sodium borohydride (NaBH ₄ ), sodium cyanoborohydride (NaCNBH ₃ ) and/or combinations thereof. In some embodiments, the molar concentration of the reducing agent may exceed the molar concentration of the protein by 1-100 times (eg, 20-50 times). In certain embodiments, the concentration of the reducing agent may be from about 0.1 mm to about 20 mm.

Typical reducing agents that can be used in sufficient amounts include dithiothreitol at a concentration of 1 mM or more, 2-mercaptoethylamine at a concentration of 50 mM or more, and cysteine at a concentration of 50 mM or more. In some embodiments, the reducing agent is removed after incubation with the protein prior to oxidation of the protein.

The first polypeptides and the second polypeptides can be individually linked to the recognition moiety by a covalent bond or flexible linker, where the recognition moiety includes, without limitation, an antigen binding fragment, a single chain antibody fragment (scFv), a receptor recognition ligand, or a ligand recognition receptor. Covalent bond includes chemical bond

- 10 042601 two or more atoms with the union of their outer electron shells. The stable chemical structure formed when these electrons reach a saturated state is known as a covalent bond. In other words, a covalent bond involves an interaction with the formation of common pairs of electrons in atoms that may belong to the same element or to different elements. The covalent bond between the first polypeptides and the second polypeptides in the present invention includes, without limitation, a non-amide bond synthesized by the interaction of the amino group of one amino acid with the carboxyl group of another amino acid, resulting in the release of a water molecule (H2O), or a non-amide bond or an amide bond synthesized by the interaction ethylene glycol, polyethylene glycol or an aldehyde group of other compounds and their polymers with an amino group of an amino acid molecule. The flexible liquor may contain a short amino acid sequence or a polymer. Such amino acid sequence includes, without limitation

GGGGSGGGGSGGGGS (SEQ ID NO:72).

The scope of the present invention expressly includes other combinations of mutations at positions T366, D399, L351, Y407 and K409. For example, any of the following combinations (a)-(h) from Group I and Group II:

group I:

a) T366L in the first polypeptide and L351E, Y407L in the second polypeptide;

b) T366L in the first polypeptide and L351G, Y407L in the second polypeptide;

c) T366L in the first polypeptide and L351Y, Y407A in the second polypeptide;

d) T366P in the first polypeptide and L351V, Y407P in the second polypeptide;

e) T366W in the first polypeptide and L351D, Y407P in the second polypeptide;

f) T366P in the first polypeptide and L351P, Y407F in the second polypeptide;

g) T366V in the first polypeptide and L351K, Y407T in the second polypeptide; And

h) T366L in the first polypeptide and L351W, Y407H in the second polypeptide;

group II:

a) D399R in the first polypeptide and K409V in the second polypeptide;

b) D399C in the first polypeptide and K4O9C in the second polypeptide;

c) D399C in the first polypeptide and K4O9P in the second polypeptide;

d) D399N in the first polypeptide and K409S in the second polypeptide;

e) D399G in the first polypeptide and K409S in the second polypeptide;

f) D399I in the first polypeptide and K409F in the second polypeptide;

g) D399T in the first polypeptide and K409Q in the second polypeptide; And

h) D399A in the first polypeptide and K409R in the second polypeptide.

Any of the following combinations (a)-(h) from Group III and Group IV:

group III:

a) T366L in the first polypeptide and L351E, Y407L in the second polypeptide;

b) T366L in the first polypeptide and L351G, Y407L in the second polypeptide;

c) T366L in the first polypeptide and L351Y, Y407A in the second polypeptide;

d) T366P in the first polypeptide and L351V, Y407P in the second polypeptide;

e) T66W in the first polypeptide and L351D, Y407P in the second polypeptide;

f) T366P in the first polypeptide and L351P, Y407F in the second polypeptide;

g) T366V in the first polypeptide and L351K, Y407T in the second polypeptide; And

h) T366L in the first polypeptide and L351W, Y407H in the second polypeptide;

group IV:

a) K409V in the first polypeptide and D399R in the second polypeptide;

b) K409C in the first polypeptide and D399C in the second polypeptide;

c) K4O9P in the first polypeptide and D399C in the second polypeptide;

d) K409S in the first polypeptide and D399N in the second polypeptide;

e) K409S in the first polypeptide and D399G in the second polypeptide;

f) K409F in the first polypeptide and D399I in the second polypeptide;

g) K409Q in the first polypeptide and D399T in the second polypeptide; And

h) K409R in the first polypeptide and D399A in the second polypeptide.

Any of the following elements (a)-(h) of group V:

Group V:

a) T366L and D399R in the first polypeptide and L351E, Y407L and K409V in the second polypeptide;

b) T366L and D399C in the first polypeptide and L351G, Y407L and K4O9C in the second polypeptide;

c) T366L and D399C in the first polypeptide and L351Y, Y407A and K4O9P in the second polypeptide;

d) T366P and D399N in the first polypeptide and L351V, Y407P and K409S in the second polypeptide;

e) T366W and D399G in the first polypeptide and L351D, Y407P and K409S in the second polypeptide;

f) T366P and D399I in the first polypeptide and L351P, Y407F and K409F in the second polypeptide;

g) T366V and D399T in the first polypeptide and L351K, Y407T and K409Q in the second polypeptide; And

h) T366L and D399A in the first polypeptide and L351W, Y407H and K409R in the second polypeptide.

- 11 042601

Any of the following elements (a)-(h) of Group VI:

group VI:

a) T366L and K409V in the first polypeptide and L351E, Y407L and D399R in the second polypeptide;

b) T366L and K4O9C in the first polypeptide and L351G, Y407L and D399C in the second polypeptide;

c) T366L and K4O9P in the first polypeptide and L351Y, Y407A and D399C in the second polypeptide;

d) T366P and K409S in the first polypeptide and L351V, Y407P and D399N in the second polypeptide;

e) T366W and K409S in the first polypeptide and L351D, Y407P and D399G in the second polypeptide;

f) T366P and K409F in the first polypeptide and L351P, Y407F and D399I in the second polypeptide;

g) T366V and K409Q in the first polypeptide and L351K, Y407T and D399T in the second polypeptide; And

h) T366L and K409R in the first polypeptide and L351W, Y407H and D399A in the second polypeptide.

Each of the first polypeptide and the second polypeptide may contain a heavy chain. The heterodimeric constructs of the present invention may contain, but are not expressly limited to, bispecific antibodies. For example, heterodimeric constructs may contain one or more scFv fragments, one or more Fab fragments, such as an scFv fragment and a Fab fragment, or two Fab fragments. Exemplary heterodimer polypeptide sequences include, without limitation, any of SEQ ID NOs: 16-31, 33, 35, 37, 39, 41, 43, 45, 48, 49, 51, 53, 55, 57, 59, 61, 63 , 68, 69, 70, and 71. Also included are sequence variants at least 70% identical (with retention of biological activity) to any of SEQ ID NOs: 16-31, 33, 35, 37, 39, 41, 43, 45 , 48, 49, 51, 53, 55, 57, 59, 61, 63, 68, 69, 70 and 71. For example, identical at least 75, 80, 85, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% or more. In addition, any of SEQ ID NOs: 16-31, 33, 35, 37, 39, 41, 43, 45, 48, 49, 51, 53, 55, 57, 59, 61, 63, 68, 69, 70 and 71 may have one or more conservative substitutions and still fall within the scope of the present invention.

In the bispecific heterodimeric antibodies of the present invention, one or more disulfide bonds are formed between the first and second heavy chain. The formation of disulfide bonds can occur either during expression in the same cell, or through an oxidation reaction with the addition of an oxidizing agent in vitro. Such disulfide bond formation occurs in those embodiments where the half-mers are expressed, purified, reduced by addition of a reducing agent, mixed with each other, and then oxidized to form a heterodimer.

The heterodimers of the present invention are capable of binding to Fc receptors, for example one or more of FcyRI, FcyRIIA, FcyRIIB1, FcyRIIB2, FcyRIIIA, FcyRIIIB, FcεRI, FcεRII, FcaRI, Fcα/μR and FcRn. In typical embodiments, heterodimers retain the ability to bind to FcRn. As used herein, FcRn refers to a receptor that is structurally homologous to the MHC class I family of heterodimeric receptors and contains a class I transmembrane heavy chain (p51 subunit, alpha chain) and a soluble light chain (p14 subunit, beta chain) linked together non-covalently. interaction. The FcRn binding site on IgG is located at the CH2-CH3 interface. The most important are amino acid positions 253, 310 and 435.

Due to their structural characteristics, the heterodimers of the present invention may (but need not) target one or more than one antigen at the same time. In typical embodiments, the antigens include one or more of HER2, PD-L1, TROP2, CD3 and/or CD20. However, the invention is not limited to these antigens. This is because the present invention relates to modifications to the constant region (CH3) of antibodies/immunoglobulin constructs to improve their stability, serum half-life and therapeutic efficacy. Thus, the technology underlying the present invention can be applied to monoclonal antibodies that bind to only one target antigen. This includes, for example, known therapeutic antibodies. Such antibodies can still be improved due to the increased stability provided by modified constant regions. In such cases, the recognition moieties on (or associated with) the first polypeptide and the second polypeptide will remain unchanged, and the half-antibodies or half-measures may differ only in the CH3 region.

Known therapeutic monoclonal antibodies that can be modified by the modifications disclosed in the present invention may include any of the following non-limiting antibodies: 3F8, 8H9, abagovomab, abciximab, abituzumab, abrilumab, actoxumab, adalimumab, adecatumumab, aducanumab, afacevicumab, afelimomab, afutuzumab, алацизумаб пегол, ALD518, алемтузумаб, алирокумаб, алтумомаб пентетат, аматуксимаб, анатумомаб мафенатокс, анетумаб равтансин, анифролумаб, анрукинзумаб, аполизумаб, арцитумомаб, аскринвакумаб, аселизумаб, атезолизумаб, атинумаб, атлизумаб, аторолимумаб, авелумаб, бапинейзумаб, базиликсимаб, бавитуксимаб, бектумомаб, бегеломаб, белимумаб, бенрализумаб, бертилимумаб, бесилесомаб, бевацизумаб, безлотоксумаб, бициромаб, бимагрумаб, бимекизумаб, биватузумаб мертансин, блеселумаб, блинатумомаб, блонтуветмаб, блосозумаб, бокоцизумаб, бразикумаб, брентуксимаб ведотин, бриакинумаб, бродалумаб, бролуцизумаб, бронтиктузумаб, буросумаб, кабирализумаб, canakinumab, cantuzumab mertansin, cantuzumab ravtansin, caplacizumab, capromab pendetide, carlumab, carotuximab, catumaxomab, cBR96 immunoconjugate doxorubicin, cedelizumab, cergutuzumab amunaleukin, certolizumab pegol, cetuximab, cituzumab

- 12 042601 богатокс, циксутумумаб, клазакизумаб, кленоликсимаб, кливатузумаб тетраксетан, кодритузумаб, колтуксимаб равтансин, конатумумаб, концизумаб, CR6261, кренезумаб, кротедумаб, дацетузумаб, даклизумаб, далотузумаб, дапиролизумаб пегол, даратумумаб, дектрекумаб, демцизумаб, денинтузумаб мафодотин, деносумаб, депатуксизумаб мафодотин, дерлотуксимаб биотин, детумомаб, динутуксимаб, диридавумаб, домагрозумаб, дорлимомаб аритокс, дрозитумаб, дулиготумаб, дупилумаб, дурвалумаб, дусигитумаб, экромексимаб, экулизумаб, эдобакомаб, эдреколомаб, эфализумаб, эфунгумаб, элделумаб, элгемтумаб, элотузумаб, элсилимомаб, эмактузумаб, эмибетузумаб, эмицизумаб, энаватузумаб, энфортумаб ведотин, энлимомаб пегол, эноблитузумаб, энокизумаб, энотикумаб, энситуксимаб, эпитумомаб цитуксетан, эпратузумаб, эренумаб, эрлизумаб, эртумаксомаб, этарацизумаб, этролизумаб, эвинакумаб, эволокумаб, эксбивирумаб, фанолесомаб, фаралимомаб, фарлетузумаб, фасинумаб, FBTA05, фелвизумаб , фезакинумаб, фибатузумаб, фиклатузумаб, фигитумумаб, фиривумаб, фланвотумаб, флетикумаб, фонтолизумаб, форалумаб, форавирумаб, фресолимумаб, фулранумаб, футуксимаб, галцанезумаб, галиксимаб, ганитумаб, гантенерумаб, гавилимомаб, гемтузумаб озогамицин, гевокизумаб, гирентуксимаб, глембатумумаб ведотин, голимумаб, гомиликсимаб , гуселькумаб, ибализумаб, ибритумомаб тиуксетан, икрукумаб, идаруцизумаб, иговомаб, IMAB362, ималумаб, имциромаб, имгатузумаб, инклакумаб, индатуксимаб равтансин, индусатумаб ведотин, инебилизумаб, инфликсимаб, инолимомаб, инотузумаб озогамицин, интетумумаб, ипилимумаб, иратумумаб, исатуксимаб, итолизумаб, иксекизумаб , келиксимаб, лабетузумаб, лампализумаб, ланаделумаб, ландогрозумаб, лапритуксимаб эмтанзин, лебрикизумаб, лемалесомаб, лендализумаб, лензилумаб, лерделимумаб, лексатумумаб, либивирумаб, лифастузумаб ведотин, лигелизумаб, лилотомаб сатетраксетан, линтузумаб, лирилумаб, лоделцизумаб, локиветмаб, лорвотузумаб мертансин, лукатумумаб, лулизумаб пегол, лумиликсимаб, лумретузумаб, MABp1, мапатумумаб, маргетуксимаб, маслимомаб, матузумаб, маврилимумаб, меполизумаб, метелимумаб, милатузумаб, минретумомаб, мирветуксимаб соравтансин, митумомаб, могамулизумаб, монализумаб, моролимумаб, мотавизумаб, моксетумомаб пасудотокс, муромонаб-CD3, наколомаб тафенатокс, намилумаб , наптумомаб эстафенатокс, наратуксимаб эмтанзин, нарнатумаб, натализумаб, навициксизумаб, навивумаб, небакумаб, нецитумумаб, немолизумаб, нерелимомаб, несвакумаб, нимотузумаб, ниволумаб, нофетумомаб мерпентан, обилтоксаксимаб, обинутузумаб, окаратузумаб, окрелизумаб, одулимомаб, офатумумаб, оларатумаб, олокизумаб, омализумаб, онартузумаб, онтуксизумаб, опицинумаб, опортузумаб монатокс, ореговомаб, ортикумаб, отеликсизумаб, отлертузумаб, окселумаб, озанезумаб, озорализумаб, пагибаксимаб, паливизумаб, памревлумаб, панитумумаб, панкомаб, панобакумаб, парсатузумаб, пасколизумаб, пасотуксизумаб, патеклизумаб, патритумаб, пембролизумаб, пемтумомаб, перакизумаб , пертузумаб, пекселизумаб, пидилизумаб, пинатузумаб ведотин, пинтумомаб, плакулумаб, плозализумаб, погализумаб, полатузумаб ведотин, понезумаб, презализумаб, приликсимаб, притоксаксимаб, притумумаб, PRO 140, квилизумаб, ракотумомаб, радретумаб, рафивирумаб, ралпанцизумаб, рамуцирумаб, ранибизумаб, раксибакумаб, рефанезумаб, регавирумаб, реслизумаб, рилотумумаб, ринукумаб, рисанкизумаб, ритуксимаб, ривабазумаб пегол, робатумумаб, роледумаб, ромосозумаб, ронтализумаб, ровалпитузумаб тесирин, ровелизумаб, руплизумаб, сакитузумаб говитекан, самализумаб, сапелизумаб, сарилумаб, сатумомаб пендетид, секукинумаб, серибантумаб, сетоксаксимаб, севирумаб, SGN-CD19A, SGN-CD33A, сибротузумаб, сифалимумаб, силтуксимаб, симтузумаб, сиплизумаб, сирукумаб, софитузумаб ведотин, соланезумаб, солитомаб, сонепцизумаб, сонтузумаб, стамулумаб, сулесомаб, сувизумаб, табалумаб, такатузумаб тетраксетан, тадоцизумаб, тализумаб, тамтуветмаб, танезумаб, таплитумомаб паптокс, тарекстумаб, тефибазумаб, телимомаб аритокс, тенатумомаб, тенеликсимаб, теплизумаб, тепротумумаб, тесидолумаб, тетуломаб, тезепелумаб, TGN1412, тицилимумаб, тигатузумаб, тилдракизумаб, тимолумаб, тисотумаб ведотин, TNX-650, тоцилизумаб, торализумаб, тосатоксумаб, тозитумомаб , товетумаб, тралокинумаб, трастузумаб, трастузумаб эмтанзин, TRBS07, трегализумаб, тремелимумаб, тревогрумаб, тукотузумаб целмолейкин, тувирумаб, ублитуксимаб, улоцуплумаб, урелумаб, уртоксазумаб, устекинумаб, утомилумаб, вадастуксимаб талирин, вандортузумаб ведотин, вантиктумаб, вануцизумаб, вапаликсимаб, варлилумаб, вателизумаб , vedolizumab, veltuzumab, vepalimumab, vesencezumab, visilizumab, vobarilizumab, volociximab, vorsetuzumab mafodotin, votumumab, xentuzumab, zalutumumab, zanolimumab, zatuximab, ziralimumab, zolimomab aritox, and combinations thereof.

Targets may include any of the following non-limiting targets: β-amyloid, 4-1BB, 5AC, 5T4, α-fetoprotein, angiopoietin, AOC3, B7-H3, BAFF, c-MET, c-MYC, C242 antigen, C5, CA- 125, CCL11, CCR2, CCR4, CCR5, CD4, CD8, CD11, CD18, CD125, CD140a, CD127, CD15, CD152, CD140, CD19, CD2, CD20, CD22, CD23, CD25, CD27, CD274, CD276, CD28, CD3, CD30, CD33, CD37, CD38, CD4, CD40, CD41, CD44, CD47, CD5, CD51, CD52, CD56, CD6, CD74, CD80, CEA, CFD, CGRP, CLDN, CSF1R, CSF2, CTGF, CTLA- 4, CXCR4, CXCR7, DKK1, DLL3, DLL4, DR5, EGFL7, EGFR, EPCM, ERBB2, ERBB3, FAP, FGF23, FGFR1, GD2, GD3, GDF-8, GPNMB, GUCY2C, HER1, HER2, HGF, HIV- 1, HSP90, ICAM-1, IFN-α, IFN-γ, IgE, CD221, IGF1, IGF2, IGHE, IL-1, IL-2, IL-4, IL-5, IL-6, IL-6R, IL-9, IL12, IL-15, IL-15R, IL-17, IL-13, IL-18, IL-1p, IL-22, IL-23, IL-23A, integrins, ITGA2, IGTB2, Lewis antigen Y, LFA-1, LOXL2, LTA, MCP-1, MIF, MS5A1, MUC1, MUC16, MSLN, myostatin, MMP superfamily, NCA-90, NFG, NOGO-A, Notch 1, NRP1, OX-40, OX- 40L, P2X superfamily, PCSK9, PD-1,

- 13 042601

PD-L1, PDCD1, PDGF-R, RANKL, RHD, RON, TRN4, serum albumin, SDC1, SLAMF7, SIRPa,

SOST, SHP1, SHP2, STEAP1, TAG-72, TEM1, TIGIT, TFPI, TGF-β, TNF-a, TNF superfamily, TRAIL superfamily, Toll-like receptors, WNT superfamilies, VEGF-A, VEGFR-1, VWF, cytomegalovirus (CMV), respiratory syncytial virus (RSV), hepatitis B virus, hepatitis C virus, influenza A virus hemagglutinin, rabies virus, HIV virus, herpes simplex virus, and combinations thereof.

The heterodimeric constructs of the present invention may have one or more substitutions, deletions, additions and/or insertions, in addition to the specific five CH3 domain amino acid substitutions disclosed herein. For example, certain amino acids of a protein structure can be replaced with other amino acids without significantly reducing the ability to bind to other polypeptides, such as antigens, or cells. Because the binding capacity and properties of a protein determine its biological activity, certain amino acids in the amino acid sequence of a protein can be changed without significantly reducing its biological utility or activity. In many cases, polypeptide variants contain one or more conservative substitutions.

The heterodimeric constructs of the present invention may be presented in the form of a pharmaceutical composition containing a pharmaceutically acceptable carrier, excipient or diluent. Optionally, the composition may contain one or more additional pharmaceutically active ingredients, such as another antibody or therapeutic agent. The pharmaceutical compositions of the invention may also be administered as part of a combination therapy, for example with another immunostimulatory agent, an anticancer agent, an antiviral agent, a vaccine, and so on. In certain embodiments, the composition contains a heterodimer at a concentration of at least 1, 5, 10, 50, 100, 150, or 200 mg/mL. In some embodiments, the concentration of the heterodimer may be 1-300 mg/ml or 100-300 mg/ml.

The pharmaceutical composition may contain any number of excipients. Excipients that may be used include carriers, surfactants, thickeners or emulsifiers, solid binders, dispersing or suspending agents, solubilizers, colorants, flavoring agents, coatings, disintegrants, lubricants, sweeteners, preservatives, isotonic agents, and combinations thereof. The selection and use of suitable excipients is described in Gennaro, ed., Remington: The Science and Practice of Pharmacy, 20 ^th Ed. (Lippincott Williams & Wilkins 2003), the contents of which are incorporated here by reference.

Preferably the pharmaceutical composition is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (eg injection or infusion). Depending on the route of administration, the active compound may be coated with a substance that protects it from acids and other natural conditions that can lead to its inactivation. As used herein, the phrase parenteral administration refers to routes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular , subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. Alternatively, an antibody of the present invention described herein may be administered by a non-parenteral route, such as a topical, epidermal, or mucosal route, such as intranasally, orally, vaginally, rectally, sublingually, or topically.

The pharmaceutical composition of the invention may be in the form of pharmaceutically acceptable salts. A pharmaceutically acceptable salt refers to a salt that retains the desired biological activity of the parent compound and does not produce any undesirable toxicological effects. Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from non-toxic inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like, as well as from non-toxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl- substituted alkanoic acids, hydroxyalkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids, and the like. Base addition salts include salts derived from alkali and alkaline earth metals such as sodium, potassium, magnesium, calcium and the like, as well as from non-toxic organic amines such as N,N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline. , diethanolamine, ethylenediamine, procaine and the like.

The pharmaceutically acceptable composition may be in liquid form or in solid form. The solid composition is usually, but not necessarily, lyophilized and a solution for single or multiple administration is made from it before administration. Exposure of compositions to extreme temperatures or pH must be avoided to prevent thermal denaturation. Thus, an antibody composition of the present invention must be formulated to have a biologically acceptable pH. Often a solution is needed that is buffered to maintain an appropriate pH range, especially in the case of liquid compositions stored for long periods of time from manufacture to administration. Typically, both liquid and solid compositions must be stored at lower temperatures (typically 2-8°C) to maintain stability over longer periods of time. Manufactured antibody compositions, especially liquid compositions, may contain a bacteriostatic agent to prevent or minimize proteolysis during storage, including, but not limited to, effective concentrations (typically less than 1% w/v) of benzyl alcohol, phenol, m-cresol, chlorobutanol, methylparaben and/or propylparaben. A bacteriostatic agent may be contraindicated in some patients. Thus, the lyophilized composition can be reconstituted in a solution containing or not containing such a component. Additional components may be added to the buffered liquid or solid antibody formulation, including, but not limited to, sugars as cryoprotectants (including, but not limited to, polyhydroxy hydrocarbons such as sorbitol, mannitol, glycerol, and dulcitol, and/or disaccharides such as sucrose, lactose , maltose or trehalose) and, in some cases, the corresponding salt (including, without limitation, NaCl, KCl or LiCl). An important property of such antibody compositions, especially liquid compositions intended for long-term storage, will be the range of total osmolarity, useful both in terms of improving stability during long-term storage at a temperature of 2-8 ° C or higher, and in terms of the possibility of their parenteral administration. . For example, but not necessarily, an effective range of total osmolarity (total number of molecules in solution) may be from about 200 mOsm/L to about 800 mOsm/L. Obviously, the amount of cryoprotectant, such as sucrose or sorbitol, will depend on the amount of salt in the composition so that the total osmolarity of the solution does not fall outside the appropriate range. Therefore, the salt-free composition may, but need not, contain from about 5% to about 25% sucrose.

Alternatively, the salt-free sorbitol-based composition may, but need not, contain sorbitol in the range of from about 3% to about 12%. Of course, in salt-free compositions, the appropriate cryoprotectant ranges must be larger in order to maintain effective osmolarity levels. These compositions may also contain a divalent cation (including, without limitation, MgCl ₂ , CaCl ₂ and MnCl ₂ ); non-ionic surfactant (including, without limitation, polysorbate-80 (Tween 80®), polysorbate-60 (Tween 60®), polysorbate-40 (Tween 40®) and polysorbate-20 (Tween 20®), polyoxyethylene alkyl esters including but not limited to Brij 58®, Brij 35® as well as others such as Triton X-100®, Triton X-114®, NP40®, Span 85 and the Pluronic series of non-ionic surfactants (e.g. Pluronic 121 )). In the compositions of the present invention containing antibodies, any combination of such components can be used, including, possibly, a bacteriostatic agent. The heterodimer of the present invention may also be a chemical derivative, by which is meant an antibody containing additional chemical moieties not normally part of the immunoglobulin molecule (eg, pegylation). Such moieties can improve solubility, half-life, absorption of the parent molecule, and so on. Alternatively, these moieties may reduce unwanted side effects of the parent molecule or reduce the toxicity of the parent molecule. The pharmaceutical composition of the present invention may be in the form of sterile aqueous solutions or dispersions. It may also be formulated into microemulsions, liposomes, or other predetermined structures suitable for high drug concentrations.

The heterodimeric constructs of the present invention are able to bind to multiple target molecules simultaneously and are therefore more effective in the treatment of complex diseases. The heterodimeric constructs of the present invention may be administered to a subject in need thereof for the treatment of a disease or disorder, such as a viral or bacterial infection, a metabolic or autoimmune disorder, or a cancer or other cell proliferative disorder. In some embodiments, the autoimmune diseases include at least one of arthritis, rheumatoid arthritis, psoriasis, multiple sclerosis (PC), ulcerative colitis, Crohn's disease, systemic lupus erythematosus (SLE), glomerulonephritis, diseases like dilated cardiomyopathy, Sjögren's syndrome, allergic contact dermatitis , polymyositis, scleroderma, periarteritis nodosa, rheumatism, vitiligo, insulin-dependent diabetes mellitus, Behçet's syndrome, chronic thyroiditis, and combinations thereof. In some embodiments, the neurodegenerative diseases include at least one of Parkinson's disease, Huntington's disease, Machado-Joseph's disease, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, and combinations thereof. In some embodiments, the neoplastic diseases and cell proliferative disorders include at least one of leukemia, lymphoma, myeloma, brain tumors, head and neck squamous cell carcinoma, non-small cell lung cancer (NSCLC), nasopharyngeal cancer, esophageal cancer, gastric cancer, pancreatic cancer , gallbladder cancer, liver cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, uterine sarcoma, prostate cancer, bladder cancer, renal cell cancer, melanoma, and combinations thereof.

- 15 042601

In addition, the present invention is directed to one or more than one nucleic acid encoding one or more than one polypeptide of the heterodimeric constructs of the present invention. Representative nucleic acids encode any of SEQ ID NOs: 16-31, 33, 35, 37, 39, 41, 43, 45, 48, 49, 51, 53, 55, 57, 59, 61, 63, 68, 69, 70 and 71. In some embodiments, the nucleic acids may comprise any of SEQ ID NOs: 32, 34, 36, 38, 40, 42, 44, 46, 47, 50, 52, 54, 56, 58, 60, 62, and 64 -67. Also included are sequence variants at least 70% identical to any of SEQ ID NOs: 32, 34, 36, 38, 40, 42, 44, 46, 47, 50, 52, 54, 56, 58, 60, 62 and 64-67. For example, at least 75, 80, 85, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99 identical .7, 99.8, 99.9% or more. Codons of variant nucleic acid sequences can be optimized. As used herein, codon optimization refers to the in vitro mutagenesis of a nucleic acid to increase or maximize the expression of a gene (e.g., transgenic relative to an unmodified nucleic acid without changing (or minimally changing) the amino acid sequence of the protein being synthesized), i.e., synonymous mutations. Codon optimization can increase protein expression levels up to 1000-fold and is particularly effective for soluble protein expression. In most cases, those codons that are not used by the host cell's translational system are replaced.

The scope of this invention includes nucleic acid sequences capable of hybridizing to a nucleic acid or fragment (or complementary sequence) of the present invention under conditions of moderate to high stringency. Hybridization techniques are well known in the field of molecular biology. For example, suitable assay conditions include a pre-wash in a solution of 5x SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0); overnight hybridization at 50-60°C, 5x SSC; followed by washing twice for 20 min using 2x, 0.5x and 0.2x SSC solution containing 0.1% SDS, respectively. Alternatively, suitable high stringency conditions for hybridization include those described above, except for raising the hybridization temperature to, for example, 60-65°C or 65-70°C.

The nucleic acids of the present invention may be contained in a vector or vector system. The vector may be, for example, but not necessarily, a plasmid. Other explicitly non-limiting recombinant vectors include shuttle vectors and expression vectors. Typically, the plasmid construct contains a replicator (eg ColE1 replicator) and selectable markers (eg ampicillin or tetracycline resistance). Expression vectors include vectors containing a control sequence or regulatory element necessary for the expression of, for example, a heterodimeric construct of the present invention. Other non-limiting recombinant vectors are known in the art and may include, for example, phage vectors such as the λ phage vector, other viral vectors such as the non-replicating adenovirus vector, the lentiviral vector, the pSV and pCMV series of plasmid vectors, vaccinia virus and retroviral vectors, baculovirus vectors, cosmids and artificial chromosomes. The expression vector may be a mammalian expression vector. For example, vectors can be used to transfect mammalian cells and, in the case of stable transfection, the DNA can be integrated into the genome by homologous recombination, or alternatively the cells can be transiently transfected. Most engineered vectors contain replicators, multiple cloning sites, and selectable markers, so vectors (including vector systems, such as multiple plasmids) containing such a system are considered to be within the scope of this invention. Promoters frequently used in mammalian cell expression vectors include the CMV and SV40 promoters. Non-viral promoters such as EF-1 are also known. Exemplary vectors include pX0GC plasmid vectors obtained by modifying pCDNA vectors.

The present invention also includes host cells containing the vector or vector system of any aspect of the present invention. One of skill in the art will recognize that the use of different cell types can lead to differences in the resulting heterodimeric constructs and may possibly affect their therapeutic efficacy. For example, host cells may (but need not) include any of the following cell types: human embryonic kidney (HEK293) cells or HEK293T, HEK293E, HEK293F derived from modification of HEK293 cells, Chinese hamster ovary (CHO) cells or CHO-S, CHO -dhfr, CHO/DG44, ExpiCHO obtained by modification of CHO cells, and related cell lines. Other cell lines known in the art include NS0 mouse myeloma cells, PER.C6 human cells, yeast cells such as S. cerevisiae, S. pombe and P. pastoris, and bacterial cells such as E. coli. Cell-free expression systems also exist, for example, based on E. coli cell lysates containing cell components necessary for transcription/translation. Cell-free systems derived from eukaryotic and mammalian cells are also known in the art, for example the cell-free expression system derived from wheat germ cells and the systems described in Brodel et al. (2015), Methods Mol Bio. 1261:129-40, incorporated herein by reference in its entirety. In some systems for producing recombinant antibodies, the expression of recombinant antibodies on the surface of host cells prior to their collection occurs, while in others, the resulting antibodies are simply released into the medium. It is implied that such options are included in the scope of the present invention.

As used herein, the term antibody (Ab) is used in its broadest sense and specifically may include any immunoglobulin, whether naturally occurring or partially or wholly synthetically produced, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies and polyreactive antibodies) and antibody fragments. Thus, when used in any context in this invention, the term antibody is intended to include, without limitation, any specific binding element, class, and/or isotype of an immunoglobulin (e.g., IgG1, IgG2a, IgG2b, IgG3, IgG4, IgM, IgA1, IgA2 , IgD and IgE) and their biologically significant fragments or specific binding elements, including, without limitation, Fab, F(ab') ₂ , scFv (single chain or related fragment) and (scFv) ₂ .

When used here, the term antibody fragments may include antibody fragments obtained using techniques well known and available to specialists in this field, as described here. Thus, in addition to the definition of antibody above, the term antibody can further include any polypeptide or protein containing a portion of an intact antibody, such as the antigen-binding or variable region of an intact antibody. They may be derived from natural sources or may be partially or wholly synthetically produced. Examples of antibody fragments include, without limitation, Fab-, Fab'-, F(ab') ₂ - and Fv fragments, diabodies, and linear antibodies.

As used herein, the term antibody-dependent cell-mediated cytotoxicity or ADCC may refer to a cell-mediated response in which FcR-expressing cytotoxic cells (eg, non-specific) (eg, natural killer (NK) cells, neutrophils, and macrophages) recognize bound antibody on target cell and then lead to lysis of the target cells. The major cells mediating ADCC, NK cells, express FcyRIII while monocytes express FcyRI, FcyRII and FcyRIII.

As used herein, the term bispecific antibody refers to an antibody capable of binding to two different epitopes on the same antigen or on two different antigens. Epitopes can be formed either by adjacent amino acids (linear epitopes) or by non-adjacent amino acids located next to each other when forming the tertiary structure of a protein (conformational epitopes). Epitopes formed by contiguous amino acids are usually retained upon exposure to denaturing solvents, while epitopes formed by the tertiary structure are usually lost upon exposure to denaturing solvents. An epitope usually contains at least 3, and more often at least 5 or 8-10 amino acids arranged in a unique spatial conformation. The bispecific antibody of the present invention may be bivalent, trivalent, or tetravalent. As used herein, valence, valency, valences, or other grammatical variants thereof denote the number of antigen-binding sites in an antibody molecule. These recognition sites may recognize the same epitope or different epitopes.

As used herein, the term carriers may include pharmaceutically acceptable carriers, excipients, or stabilizers that are non-toxic to the cell or mammal to which they are exposed at the doses and concentrations employed.

Often the pharmaceutically acceptable carrier is an aqueous pH buffer solution. Examples of physiologically acceptable carriers include, without limitation: buffers such as phosphate, citrate and other organic acids; antioxidants, including, without limitation, ascorbic acid; low molecular weight peptides (less than 10 residues); proteins such as, without limitation, serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as, without limitation, polyvinylpyrrolidone; amino acids such as, without limitation, glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including, without limitation, glucose, mannose, or dextrins; chelating agents such as, without limitation, EDTA; sugar alcohols such as, without limitation, mannitol or sorbitol; salt-forming counterions such as, without limitation, sodium; and/or non-ionic surfactants such as, without limitation, TWEEN, polyethylene glycol (PEG) and PLURONIC. Any combination of such components may be used in the compositions of the present invention, including possibly a bacteriostatic agent.

As used herein, the terms conservative sequence modifications or conservative substitutions may refer to amino acid modifications to the target epitope or antibodies and antigen-binding fragments of the invention that do not significantly affect or alter the binding characteristics of the heterodimeric immunoglobulin constructs of the invention. Such conservative modifications include amino acid substitutions, additions and deletions. An antibody of the invention may be modified by standard techniques known in the art such as site-directed mutagenesis and PCR-mediated

- 17 042601 mutagenesis. Conservative amino acid substitutions are amino acid substitutions in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Such substitutions are usually based on the relative similarity of the substituents in the amino acid side chains, for example, their hydrophobicity, hydrophilicity, charge, size, and so on. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylanine, methionine), beta-branched side chains (eg, threonine, valine, isoleucine), and aromatic side chains (eg, tyrosine, phenylalanine, tryptophan, histidine).

As used herein, the term extracellular domain or extracellular domain of a membrane receptor refers to the molecular recognition sequence(s), typically including extracellular regions located outside the cell, recognizing and binding the corresponding antigen or ligand, bound to the receptor in its transmembrane domain, and interacting with the intracellular domain. , possessing intracellular kinase activity, or with signaling pathways. A ligand may refer to a protein, small peptide, or compound that can be recognized and bound by the extracellular domain of a membrane receptor. Immunogenic, mitogenic or other stimuli can stimulate the formation of soluble small molecular weight proteins by various cells. They can modulate innate and adaptive immunity, hematopoiesis, cell growth, APSC pluripotent cells, and correct tissue repair after injury. Cytokines can be divided into interleukins, interferons, tumor necrosis factor super family, colony stimulating factors, chemokines, growth hormones. A label on an expressed protein refers to an amino acid sequence attached to the N-terminus or C-terminus of the target protein, which may be a small peptide or a long amino acid. Attachment of a label can promote proper protein folding and can be used to separate and purify the protein. It may be useful in reducing the degradation of proteins in the cell. Commonly used labels include, without limitation, HA, SUMO, His, GST, GFP, and Flag.

As used herein, the term Fab fragment may refer to a recognition moiety that is a fragment of an antigen-binding fragment (Fab) of either of the two halves of an antibody molecule containing the linked light chain and heavy chain VH and CH1 domains.

As used herein, the term Fc refers to the region of a crystallizable fragment that contains the CH2 and CH3 constant domains and is the region of an immunoglobulin that interacts with effector molecules or cells, such as Fc receptors.

As used herein, the term Fc receptor or FcR is used to describe a receptor that binds to an Fc region (eg, the Fc region of an antibody or antibody fragment). The term includes the neonatal receptor, FcRn, which mediates the transfer of maternal IgG to the fetus. Other Fc receptors include any of FcyRI, FcyRIIA, FcyRIIB1, FcyRIIB2, FcyRIIIA, FcyRIIIB, FcεRI, FcεRII, FcaRI, and Fcα/μR.

As used herein, the term homology may refer to two compositions having a common structure. In the context of proteins, the term homology can refer to the degree (eg, percentage) of two or more amino acid and/or peptide sequences that match. In the context of nucleic acids, the term homology can refer to the degree (eg, percentage) of sequence matching between two or more nucleic acids. As used herein, the percent (%) homology of two sequences is equivalent to the percent identity of the two sequences. The percent identity of two sequences is a function of the number of identical positions in those sequences (i.e., % homology is equal to the ratio of the number of identical positions to the total number of positions times 100), taking into account the number of breaks and the length of each break that must be entered to optimally align the two sequences. Comparing sequences and determining the percent identity of two sequences can be done using a mathematical algorithm. Such homology is well represented in local alignment tools and/or algorithms and may include pairwise alignment, multiple sequence alignment methods, structural alignment methods, and/or phylogenetic analysis methods. When sequences differ by conservative substitutions, the percent sequence identity may, but need not, be adjusted upward to account for the conservative nature of the substitutions. Techniques for such adjustments are well known to those skilled in the art. Usually, but not necessarily, they include accounting for a conservative substitution as a partial rather than a complete mismatch, which increases the percentage of sequence identity. So, for example, if an identical amino acid is assigned a value of 1, and a non-conservative substitution is assigned a value of zero, then a conservative substitution is assigned a value between zero and 1.

- 18 042601

As used herein, the term immunoglobulin refers to a symmetrical structure with four polypeptide chains, including two heavy chains with a longer sequence containing 450-550 amino acid residues and a larger relative molecular weight of 5500070000 Da and two light chains (L-chains) with a shorter sequence , containing approximately 210 amino acid residues, and a smaller relative molecular weight of approximately 24,000 Da. The 110 amino acids located closer to the N-terminus differ significantly in different heavy and light chains of immunoglobulins and are known as the variable region (variable region, V region), and the rest of the amino acid sequence located closer to the C-terminus is relatively constant and is called constant region (constant region, C-region). The heavy chain variable region is approximately one quarter of the entire heavy chain sequence and the constant region is approximately three quarters. IgGs have three heavy chain constant regions called CH1, CH2 and CH3. The constant region is both the backbone of the immunoglobulin molecule and one of the activation sites of the immune response. In the present invention, the constant region includes the region in which the first polypeptides interact with the second polypeptides, containing amino acids located in the CH3 domain. Эти аминокислоты включают, без ограничения, глутамин347, тирозин349, треонин350, лейцин351, серин354, аргинин355, аспарагиновую кислоту356, глутаминовую кислоту357, лизин360, серин364, треонин366, лейцин368, лизин370, аспарагин390, лизин392, треонин394, пролин395, валин397, аспарагиновую кислоту399, серин400, phenylalanine405, tyrosine407, lysine409 and lysine439.

As used herein, the terms purified or isolated antibody, peptide, polypeptide, or protein may refer to a peptide, polypeptide, or protein that has been separated from other proteins, lipids, and nucleic acids to which it is naturally associated. The polypeptide/protein may comprise at least 10% (i.e., any percentage from 10% to 100%, such as 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 99%) of the dry weight of the purified preparation. The degree of purity can be measured by any suitable standard method, such as column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

As used herein, the term scFv may refer to a single chain variable fragment. scFv is a fusion protein of immunoglobulin heavy (VH) and light chain (VL) variable regions connected by a linker peptide. The length of the linker peptide may be from about 5 to 40 amino acids, or from about 10 to 30 amino acids, or about 5, 10, 15, 20, 25, 30, 35, or 40 amino acids. A typical linker is

GGGGSGGGGSGGGGS (SEQ ID NO: 72).

The terms specific binding, selective binding, selectively binds, and specifically binds may refer to an antibody that binds to an epitope of a predetermined antigen, but not to other antigens. Typically, an antibody will bind to an equilibrium dissociation constant (KD) of less than about 10 ^-6 M, such as less than about 10 ^-7 M, 10 ^-8 M, 10 ^-9 M, or 10 ^-10 M or even less, when defined, for example, equilibrium dialysis or surface plasmon resonance (SPR) technology in the BIACORE® 2000 Surface Plasmon Resonance Instrument using a predefined antigen, such as Her2, PD-L1, Trop-2, CD3 and/or CD20 epitope, as analyte and an antibody as a ligand, or in a Scatchard binding assay of an antibody to antigen-positive cells, and (ii) binds to a predetermined antigen with an affinity at least twice that of its binding to a non-specific antigen (e.g., BSA, casein) , other than a predetermined antigen or a closely related antigen.

As used herein, the terms subject or patient may refer to the biological system being treated. A biological system may include, for example, a single cell, a group of cells (eg, a cell culture), an organ, a tissue, or a multicellular organism. The subject of the present invention may include birds, reptiles, mammals, and the like. Preferably, the mammal includes rodents and primates, including humans.

As used herein, the terms administering treatment or treating a disease may refer to the execution of a protocol, which may include administering one or more drugs to a patient (human or non-human) in an attempt to positively alter the signs or symptoms of a disease. A positive change is possible both before the appearance of signs or symptoms of the disease, and after their appearance. Thus, the implementation of treatment or treatment includes the implementation of the prevention or prevention of disease. In addition, the implementation of treatment or treatment does not require complete relief of signs or symptoms, does not require a cure, and expressly includes protocols that may have only a partial effect on the patient.

As used herein, the term Fc region variant refers to an amino acid sequence that differs from the native sequence of an Fc region (or portions thereof) by at least one amino acid modification (e.g., substitution, insertion, or deletion), including heterodimeric variants in which the heavy chain sequences -subunits may differ from each other.

- 19 042601

Representative amino acid modifications of the present invention include T366L, D399R,

L351E, Y407L and/or K409V in the CH3 region.

Unless the context clearly dictates otherwise, when used here and in the appended claims, the singular forms include the plural.

The term approximately refers to a range of values that a person skilled in the art would not consider to be substantially different from the original values. For example, the term approximately can refer to a value that differs from the declared value by no more than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5, 0.1, 0 .05 or 0.01%, and values that overlap with these declared values, as will be determined by the context.

As used herein, the term binding (binding) element refers to an agent, for example, a protein or protein complex (such as an antibody or fragment thereof), a small molecule, and the like, that specifically binds to a target, such as an Fc receptor. An Fc receptor specific binding element refers to an agent that specifically binds to an Fc receptor. The terms specific binding, specific binding, and the like refer to preferential binding to one molecule over other molecules or moieties in a solution or reaction mixture. In some embodiments, the affinity of the binding element for the target to which it specifically binds is characterized by a Kd (dissociation constant) of 10 ^-6 M or less, such as 10 ^-7 M, 10 ^-8 M, 10 ^-9 M, 10 ^-10 M or less.

As used herein, the term recognizing moieties refers to regions of an agent capable of specifically interacting with target molecules (eg, antigens, ligands, receptors, substrates) with a high degree of selectivity. Exemplary recognition moieties include an antibody variable region, a structural variant of an antibody variable region, a receptor binding domain, a ligand binding domain, or an enzyme binding domain. In the present invention, a recognition moiety is defined as the cognate recognition moiety of the strand to which it is associated. The nature of this bond may be covalent or non-covalent, depending on the context and environment. For example, a bispecific heterodimeric antibody of the present invention has recognition moieties covalently linked to their respective chains, while the association of the half-mer of such a bispecific antibody, under conditions that are sufficiently reducing, to the corresponding chain may be at least partially non-covalent.

As used herein, the term physiological condition or conditions refers to an environmental condition or conditions that may occur naturally in an organism or cellular system, or a condition in which certain characteristics (such as temperature) may be outside the range of values observed in living things. body, but still allow the bispecific heterodimeric antibody of the invention to perform its function to some extent. A non-limiting example of physiological conditions are temperature, ionic strength, pH, and ion concentration (eg, Ca ²⁺ or Mg ²⁺ ) commonly observed within or near a cell, such as a mammalian cell. Temperature in the range of approximately 2-40°C (for example, 20-40°C), atmospheric pressure of approximately 1, pH of approximately 6-8, glucose concentration of approximately 1-20 mM, oxygen concentration approximately corresponding to its concentration in the atmosphere, and terrestrial attraction are also examples of physiological conditions. When used here to describe conditions, the term may also be combined with other specific restrictions. It should be understood that in such cases the term must be correctly interpreted in the context of the conditions thus described. For example, the description of an aqueous solution as corresponding to physiological conditions and sufficiently reducing, for example, containing 1 mM dithiothreitol, such as phosphate buffered saline (PBS) at 2-4 ° C with 1 mM dithiothreitol, does not imply that all this solution allows the antibody to perform its functions even in the presence of a reducing agent, but implies that, in addition to dithiothreitol, other elements or characteristics of the solution allow this.

As used herein, the term substantially free refers to levels of a particular component, such as a polypeptide, that are not detectable using routine detection methods and protocols known to one of skill in the art, such as Western blot, ELISA, RIA, HPLC (including chiral HPLC, chiral HPLC/MS, LC/MS/MS and so on), thin layer chromatography, mass spectrometry, polarimetric measurements, gas chromatography - mass spectrometry or others.

The publications disclosed herein are given solely by virtue of their disclosure prior to the filing date of this application. Nothing herein should be construed as an admission that the present invention does not predate such publications. In addition, publication dates shown may differ from actual publication dates, which may need to be independently verified.

All publications and patents to which reference is made in this text, as well as all documents or reference materials, patent or non-patent literature referenced in each of these applications and patents (including when considering applications for each issued patent) 20 042601 tent; documents referred to in the application materials), and all international and local applications or patents corresponding to and/or claiming priority of any of these applications or patents, and all documents referred to in documents referred to reference in the application materials, expressly and incorporated herein by reference in their entirety. More generally, in this text, in the list of references before the claims or in the text itself, there are references to documents and sources, and all these documents or sources (sources referenced here), as well as all documents and sources, referenced sources referenced here (including any manufacturing specifications, instructions, and so on) are expressly incorporated here by reference.

To further describe the present invention, the following non-limiting examples are given.

VII. Examples

Example 1 Screening for mutation sites to obtain heterodimers.

In the region of the CH3 domain of the heavy chain of IgG1, mutations were introduced that stimulate the formation of heterodimers. Analysis of the amino acids most important in the interaction of two homologous IgG1 CH3 domains (hereinafter referred to as CH3-A and CH3-B) was performed as described in J. Biol. Chem. 2010, 285:19637-19646, incorporated herein by reference in its entirety. In the Protein Data Bank (PDB), 27 antibody sequences were found and amino acids were selected based on criteria based on the contact method, in which adjoining residues are defined as residues in which the heavy atoms of the side chains are located at a distance less than the established limit of 4.5 A (0.45 nm) from heavy atoms of any residues of the second chain.

An additional screening of amino acids located on the contact line of CH3 domains was carried out, replacing them with alanine, determining changes in the energy of dissociation and unfolding upon denaturation with guanidine hydrochloride to select the amino acids that had the greatest effect on this energy in comparison with the wild type. The results demonstrated that mutations at positions Thr366, Leu368, Phe405, Tyr407, Lys409 resulted in a free energy change of more than 2 kcal/mol (8.368 kJ/mol); see also Biochemistry. 1998 Jun 30;37(26):9266-73, incorporated herein by reference in its entirety. The distance between amino acids located on the line of contact was also analyzed by the PyMOL and DS software, the results are presented in table. 1. Italics and underlining indicate the presence of hydrogen bonds between residues. Based on the distance between amino acids at the contact line and the results of alanine mutation scanning, the following mutation sites were selected to stimulate the formation of heterodimers: Thr366, Asp399 in the first CH3 polypeptide/domain and Leu351, Tyr407 and Lys409 in the second CH3 polypeptide/domain.

Table 1

Distance between heavy atoms on the contact line of CH3 domains

Circuit A -------------------------------------------------- ---2--------10------------------------------- ---------------- Chain B (unit: A (10 m)) GLN 347 LYS 360 3.9 TYR349 SER354 3.7 ASP 356 3.9 GLU 357 3.6 LYS 360 4.1 THR350 SER 354 3.8 ARG355 5.9 LEU351 LEU 351 4.1 SER 354 3.6 THR 366 3.8 SER354 TYR349 4.1 THR 350 3.8 LEU 351 3.8 ARG355 THR 350 5.9 ASP 356 TYR349 3.9 LYS 439 2.8 GLU357 TYR349 3.7 LYS 370 4.2 LYS 360 GLN 347 3.8 TYR349 4.1 SER 364 LEU 368 3.9 LYS 370 3.9 THR 366 LEU 351 3.7 TYR407 2.9 LEU 368 SER 364 3.8 LYS 409 4.2 LYS 370 GLU 357 3.9 SER 364 4.1 ASN 390 SER 400 3.5 LYS 392 ASP 399 3.6 SER 400 4.0 PHE 405 3.7 THR 394 THR 394 3.7 VAL 397 4.1 PHE 405 4.0 TYR 407 4.3 PRO 395 VAL 397 3.9

- 21 042601

VAL 397 THR 394 4.0 PRO 395 4.0 A.S.P. 399 LYS 392 3.7 LYS 409 2.8 SER 400 ASN 390 3.2 LYS 392 4.1 RNE 405 LYS 392 3.5 THR 394 4.6 LYS 409 3.6 TYR 407 THR 366 2.7 THR 394 4.3 TYR 407 3.9 LYS 409 3.4 LYS 409 LEU 368 4.0 ASP 399 2.8 PHE 405 4.0 TYR 407 3.6 LYS 439 ASP 356 2.9

Example 2 Library Construction for Fc Heterodimer Display on Eukaryotic Cells

2.1. Construction of a display vector for an Fc heterodimer.

The display vector for the Fc heterodimer pDis3 was obtained by modifying the display vector pDisplay (Invitrogen, catalog number V66020). His PDGFR gene and myc gene were removed by NotI (NEB, cat. no. R-0189S)/SfiI (NEB, cat. no. R-0123S) cleavage. MCS (Multiple Cloning Site, multiple cloning site) was obtained by amplifying the pDisplay vector plasmid using the following primers:

TGGGGCCCAGCCGGCCAGATCT (SEQ ID NO: 1) and

ATAAGAATGCGGCCGCGTCGACCTGCA (SEQ ID NO: 2).

These primers have NotI/SfiI restriction sites, respectively. MCS was cleaved at the NotI/SfiI restriction sites and inserted into the above cleaved vector. This resulted in an intermediate product, the pDis vector.

The F1 ori gene was removed from pDis and the Orip gene was introduced using the following method. The Orip gene was amplified from the pTT5 vector (Biovetor, cat. no. 3574108) using the following primers containing the SspI restriction site (NEB, cat. no. R1032S):

5'-ATCGAGTCAATATTAGGGTTAGTAAAAGGGTCCTAAGGAAC (SEQ ID NO: 3), 5'-CAGTCGATAATATTAAGAATTAATTCTCATGTTTGACAGCTAT (SEQ ID NO: 4).

The Orip gene was then digested with SspI and ligated to the SspI digested pDis vector. This resulted in a pDis1 vector. The peo resistance gene was then removed from the pDis1 vector by digestion with AvrII (NEB, catalog number R0174S). The hygro resistance gene was introduced by amplification of pCEP4 (Invitrogen, catalog number V04450) with the following primers to incorporate the AvrII restriction site: forward primer

5'-TAGCCTCCCCCTAGGGTGGGCGAAGAACTCCAGCATG (SEQ ID NO: 5), 5'-TTTGGAGGCCTAGGCTTTTGCAAAGATCGATCAAGAGACAGGATGAGGA (SEQ ID NO: 6). After cleavage, the hygro gene was introduced into the pDis1 vector to obtain the pDis2 vector.

The DNA sequence (SEQ ID NO: 7) was synthesized by GENEWIZ, China. This sequence contains, from left to right, the SUMO gene (from the Champion™ pET SUMO vector, Invitrogen, catalog number K30001), the human Fc gene (hereinafter referred to as Fc1 containing the CH3-A domain), the bovine growth hormone (BGH) polyadenylation signal, the signaling gene peptide (from the pDisplay vector), the human influenza virus hemagglutinin (HA) gene (Genbank: NC_007362.1, amino acids Nos. 98-106), and the human Fc gene (hereinafter referred to as Fc2, containing the CH3-B domain). At opposite ends of the entire gene sequence, there are two restriction sites SfiI and PstI. The Fc sequence, the SUMO sequence and the HA sequence were optimized for the codons most common in mammals. The Fc1 domain has BgIII/SacII restriction sites and the Fc2 domain has BsrGI/SaII restriction sites. Restriction sites do not change the amino acid sequences of Fc. The DNA and pDis2 sequences were digested with SfiI/PstI and then ligated into pDis2 to obtain the final pDis3 vector as shown in FIG. 1.

2.2. Construction of a heterodimeric Fc library pUC57-TCZHC (GENEWIZ, China) contained natural human Fc sequences. The first site-directed random Fc sequences were generated by amplification of pUC57-TCZHC using degenerate primers in which the degenerate NNS codon encoding amino acids at position 366 and position 399 of Fc1 resulted in their random replacement with naturally occurring amino acids of 20 different types. The forward primer was

TCCCAGCCGGGATGAGCTGACCAAGAACCAAGTCTCCCTCNNSTGCCTGGTCAAGG

GATTTCTACCCTTC (SEQ ID NO: 8) and the reverse primer was GTCCACGGTGAGCTTGGAGTACAGGAAGAAGGATCCGTCGCTSNNCAGGACGGGGG GGGTTGTCTT (SEQ ID NO: 9).

The second Fc gene was amplified from pUC57-TCZHC using the following primers: the forward primer was

TACTCCAAGCTCACCGTGGACAAGAGC (SEQ ID NO: 10) and the reverse primer was

- 22 042601

CGATCCAATCGATGGAAGATCTTCATCATTTGCCGGGGCTGAGGCTCAGGCT (SEQ ID NO: 11).

The following overlapping primers were used to generate a full length site directed random Fcl fragment:

5'-CAAGGGCCAGCCGCGGGAACCTCAAGTGTATACCCTCCCTCCCAGCCGGGATGAGC

TGACCAAGAACCAA (SEQ ID NO: 12), 5'-CGATCCAATCGATGGAAGATCTTCATCATTTGCCGGGGCTGAGGCTCAGGCT (SEQ ID NO: 13). The Fc1 fragment was subcloned into the pDis3 vector using the BglII (NEB, catalog number R0144S) and SacII (NEB, catalog number R0157S) restriction sites. The resulting desalted construct was then transformed into an E. coli Top10 strain using a Bio-Rad Gene Pulser X cell electroporation apparatus.

The resulting transformants were seeded directly onto a selective agar medium containing 100 mg/l ampicillin. The size of the mutant library was calculated from the number of colonies. 20 colonies were randomly selected and the introduction of different mutations was verified by DNA sequencing. The construction of the library of site-directed random Fc1 mutants by repeated electroporation was continued until a size of 105 was reached.

A plasmid isolation kit (Qiagen, catalog number 27106) was used to isolate a library of site-directed random mutant Fc1's. The resulting library was used as a template for constructing a library of site-directed random mutant Fc1+Fc2. The site-directed random Fc2 fragment was cloned into the Fc1 library using degenerate primers, adding BsrGI and SalI restriction sites at the 5' and 3' ends, respectively:

5'-GGCCAGCCCAGGGAACCTCAAGTGTACACCNNSCCTCCCAGCCGGGATGA GCTG, (SEQ ID NO: 14),

5'-GCCCTGTTGCCACCGGCTCTTGTCGACGGTGAGSNNGGASNNCAGGAAGA

AGGATCCGTCGCT (SEQ ID NO: 15).

The BsrGI and SalI sites are present in these primers and this method resulted in the introduction of 20 amino acids at Fc positions 351, 407 and 409 using the NNS codon. E. coli strain Top10 Fc2 fragment and linearized Fc2 vector were co-transformed (BsrGI (NEB, ca. R3575L) and SalI (NEB, ca. R3138L) digestion using a Bio-Rad Gene Pulser X cell electroporation apparatus. .

The resulting transformants were seeded directly onto a selective agar medium containing 100 mg/l ampicillin. The construction of a library of site-directed random Fc1+Fc2 mutants by repeated electroporation was continued until a size of 3x108 was reached. The methodology for constructing a heterodimeric Fc library is shown in FIG. 2. Fc1+Fc2 library plasmids were isolated using QIAGEN Plasmid Plus 96 kits (Qiagen, cat. no. 16181) by randomly selecting colonies from the selective agar medium.

Purified plasmids were transfected into FreeStyle™ 293-F cells (Invitrogen, catalog number R79007) in a 96-well plate. On the day before transfection, 293-F cells were subcultured and expanded, allowing them to grow overnight. On the day of transfection, cells were harvested by centrifugation and resuspended using fresh FreeStyle™ 293 expression medium (Gibco, cat. no. 12338001) to a final density of 200x105 viable cells per ml. Transient co-transfection was carried out with the obtained plasmids (final concentration 36.67 μg/ml) in the indicated molar ratios with polyethyleneimine (25 kDa, final concentration 55 μg/ml, Alfa Aesar, catalog number 43896) with their mixing and incubation at 37°C within 1 hour Added fresh medium in the amount of 19 volumes of the transfection mixture and continued incubation. Cell culture supernatant was collected 5-6 days after transfection.

As shown in FIG. 3, 5 structural types of heterodimeric Fcs with two different labels were present in the supernatant. Heterodimers were detected by ELISA. Briefly, anti-HA antibody (Abcam, cat. no. ab181181) was adsorbed onto a 96-well plate in carbonate buffer, pH 9.6, and washed with PBST (Sigma, cat. no. P-3563). All non-specific binding sites on the surface of the plate were blocked with PBST containing 5% skimmed milk. The tablet was washed using PBST. The supernatant was diluted in PBST containing 1% BSA and added to the plate by incubation at 25° C. for 1 hour. The plate was washed with PBST to remove unbound sample. An anti-SUMO antibody (Abcam, catalog number ab179907) labeled with biotin was diluted in PBST containing 5% skimmed milk and added to the plate, followed by incubation at 25° C. for 1 hour. The plate was washed with PBST. The secondary antibody, streptomycin avidin labeled with horseradish peroxidase (Abcam, catalog number 59653), was then diluted in PBST containing 5% skimmed milk and added to the plate, followed by incubation at 25° C. for 1 hour. The plate was washed using PBST. TMB (BD OptEIA, cat. no. 555214) was added for enzyme staining for 10 minutes. To stop staining, 1 M H ₂ SO ₄ was added. Absorbance at 450 nm was determined using a microplate reader.

- 23 042601

In each round of screening, 20 clones with the highest OD values were selected and the corresponding cells were propagated in a 96-well plate. Proteins were purified from culture supernatants using protein A agarose chromatography (ACRO Biosystems, cat. no. MA0422-S1) and analyzed by SDS-PAGE. After many rounds of screening, a clone with the highest heterodimerization yield was obtained, which was verified by DNA sequencing. The results are shown in table. 2 below. The amino acid sequences of the positive clones are shown in SEQ ID NO:16-31.

table 2

Fc1 and Fc2 sequencing results

fcl Fc2 Proportion of heterodimer (SDS-PAGE, using Quantity One) 366 399 SEQ GO NO: 351 407 409 SEQID NO: #1 L WITH SEQIDNO:16 G L C SEQ ID NO: 17 61.45 #6 L WITH SEQ GO NO: 18 Y A P SEQ ID NO: 19 57.59 #23 V T SEQ GO NO:20 TO T Q SEQIDNO:21 52.13 #41 L A SEQ ID NO:22 W H R SEQ ID NO:23 52.33 #46 R N SEQ ID NO:24 V P S SEQ ID NO:25 47.77 #53 R I SEQ ID NO:26 P F F SEQ ID NO:27 42.97 #65 W G SEQ ID NO:28 D P S SEQ ID NO:29 47.30 #76 L R SEQ ID NO:30 E L V SEQIDNO:31 69.73

Example 3 Construction of a vector for the expression of heterodimeric antibodies.

X0GC expression vectors were constructed encoding the heavy chain and light chain of an anti-HER2 antibody whose variable region sequences were taken from http://www.drugbank.ca/drugs/DB00072. The human IgG1 heavy chain constant domain (Fc1) was used. The nucleotide sequence encoding the variable light chain (VL) was SEQ ID NO: 32 and the corresponding amino acid sequence was SEQ ID NO: 33. The nucleotide sequence encoding the light chain constant domain (C _L ) was SEQ ID NO: 34, and the corresponding amino acid sequence was SEQ ID NO: 35. The nucleotide sequence encoding the variable heavy chain (VH) was SEQ ID NO: 36, and the corresponding amino acid sequence was SEQ ID NO: 37. The nucleotide sequence encoding the constant heavy chain (CH) was SEQ ID NO: 38 and the corresponding amino acid sequence was SEQ ID NO: 39.

VL, CL, VH, CH were amplified by polymerase chain reaction (PCR) as described below. The reaction system was as follows: H ₂ O, 8.9 µl; 5x Phusion DNA polymerase buffer, 4 µl; 1 mM dNTP, 4 µl; forward primer, 1 µl; reverse primer, 1 µl; Phusion DNA polymerase (NEB, catalog number F-530L), 0.1 µl; and matrix, 1 µl. The PCR products of the variable and constant fragments were separated by 1.5% agarose gel electrophoresis and isolated using a DNA purification kit (Promega, catalog number A9282). The next round of PCR was performed using the isolated variable and constant fragments as templates in combination with variable fragment forward primers and constant fragment reverse primers. After isolation of the products, full-length fragments of the light chain or heavy chain were obtained. The resulting fragments and the X0GC vector were cleaved and linked to each other at the same restriction sites EcoRI (NEB, catalog number R3101L)/HindIII (NEB, catalog number R3104L). The digestion system was as follows: 10x reaction buffer, 32 μl; EcoRI and HindIII, 0.5 µl; cleavable fragments, 3 μl; H ₂ O, 14.5 µl. The interaction was carried out at 37° C. for 3 hours. The ligation system was as follows: 10x T4 DNA ligase buffer, 2 μl; T4 DNA ligase (New England Biolabs, catalog number M0202V), 0.5 µl; ligated fragments, 3 µl; ligated vector, 3 µl; H2O, 11.5 µl. The interaction was carried out at room temperature for 12 hours. E. coli DH5a strain (TIANGEN, catalog number CB104, China) was transformed with the resulting constructs, after which a plasmid with a heavy chain (Fc1) or a light chain of an antibody was obtained for expression in a eukaryotic cell.

X0GC expression vectors encoding the heavy chain of an anti-HER2 antibody were constructed. The heavy chain constant region sequence was an IgG1 (Fc2) sequence (SEQ ID NO: 40). The amino acid sequence was SEQ ID NO: 41. The antibody heavy chain expression plasmid was used to express the antibody heavy chain.

- 24 042601 (Fc2) in eukaryotes.

X0GC expression vectors were constructed encoding the heavy chain and light chain of the anti-CD20 antibody. The variable sequences of the antibody were taken from US 5,736,137, incorporated herein by reference in its entirety. Heavy chain constant region sequences were taken from human IgG1 (Fc1). The nucleotide sequence encoding the variable light chain (V _L ) was SEQ ID NO:42 and the corresponding amino acid sequence was SEQ ID NO: 43. The amino acid sequence of the constant light chain (C _L ) was SEQ ID NO: 35. the sequence encoding the variable heavy chain (VH) was SEQ ID NO: 44 and the corresponding amino acid sequence was SEQ ID NO: 45. The nucleotide sequence encoding the constant heavy chain (CH) was SEQ ID NO: 46 or 47 , the corresponding amino acid sequence was SEQ ID NO: 48 or 49. The expression vector was prepared as described above. An antibody heavy chain or light chain expression plasmid was used to express the heavy chain (Fc1 or Fc2) or light chain in eukaryotes.

X0GC expression vectors were constructed encoding the heavy chain and light chain of the anti-Trop-2 antibody as described above. The variable sequences of the antibody were taken from WO 2003/074566, incorporated herein by reference in its entirety. The heavy chain constant sequence was a human IgG1 (Fc1) sequence. The nucleotide sequence encoding the variable light chain (V _L ) was SEQ ID NO: 50 and the amino acid sequence was SEQ ID NO: 51. The amino acid sequence of the constant light chain (C _L ) was SEQ ID NO: 35. Nucleotide sequence variable heavy chain (VH) was SEQ ID NO: 52 and the corresponding amino acid sequence was SEQ ID NO: 53. The nucleotide sequence encoding the constant heavy chain (CH) was SEQ ID NO: 54, the amino acid sequence was SEQ ID NO: 55.

X0GC expression vectors were constructed encoding the heavy chain and light chain of the anti-PD-L1 antibody as described above. The variable sequences of the antibody were taken from US 2010/0203056, incorporated herein by reference in its entirety. Heavy chain constant region sequences were taken from human IgG1 (Fc1). The nucleotide sequence of the variable light chain was SEQ ID NO: 56, the amino acid sequence of the variable light chain was SEQ ID NO: 57, the amino acid sequence of the constant light chain was SEQ ID NO: 35, the nucleotide sequence of the variable heavy chain was SEQ ID NO: 58, the amino acid sequence of the variable heavy chain was SEQ ID NO: 59, the nucleotide sequence of the constant heavy chain was SEQ ID NO: 60, and the amino acid sequence of the constant heavy chain was SEQ ID NO: 61.

X0GC expression vectors were constructed encoding an anti-CD3/human IgG1 (Fc2) scFv fusion sequence as described above. The variable sequences of the antibody were taken from US Pat. No. 7,112,324, incorporated herein by reference in its entirety. The heavy chain constant region sequence was a human IgG1 (Fc2) sequence. The variable domain nucleotide sequence was SEQ ID NO: 62, the variable domain amino acid sequence was SEQ ID NO: 63, the constant domain nucleotide sequence was any of SEQ ID NO: 64-67, and the constant domain amino acid sequence was any of SEQ ID NO: 68-71. An anti-CD3/human IgG1 (Fc2) scFv fusion expression plasmid was used to express anti-CD3/human IgG1 (Fc2) scFv fusion sequences in eukaryotes.

Example 4 Expression of Heterodimeric Antibodies.

FreeStyle™ 293-F cells (FreeStyle™ 293-F Cells, catalog number R79007, Invitrogen) were transfected with two antibody heavy and light chain expression vectors. On the day before transfection, 293-F cells were subcultured and expanded, allowing them to grow overnight. On the day of transfection, cells were harvested by centrifugation and resuspended using fresh FreeStyle™ 293 expression medium (Gibco, cat. no. 12338001) to a final density of 200 x 10 viable cells per ml. Transient co-transfection was carried out with the obtained plasmids (final concentration 36.67 μg/ml) in the indicated molar ratios with polyethyleneimine (25 kDa, final concentration 55 μg/ml, Alfa Aesar, catalog number 43896) with their mixing and incubation at 37°C and 120 rpm for 1 hour. Then fresh medium was added in the amount of 19 volumes of the transfection mixture and the incubation continued. Cell culture supernatant was collected 5-6 days after transfection.

Cells were also transfected with three expression vectors. Antibody A heavy chain (Fc1 human IgG1), antibody A light chain, and scFv fusion sequences of antibody B' and human IgG1 Fc2 were co-transfected. The cell culture supernatant contained Fc1 homodimer, scFv-Fc2 homodimer, and Fc1/scFv-Fc2 heterodimer. The Fc1/scFv-Fc2 heterodimer was the main product due to the mutual repulsion effect between Fc1 and Fc2. In addition, Fc1 and Fc2 have a strong tendency to form heterodimers.

According to the results of ELISA, the yields of Fc1 against HER2 and Fc2 against CD3 were 70-100 mg/L. Before column purification, the supernatant was filtered through a 0.22 μm filter at 4° C. to remove cellular debris.

Example 5 Purification of a heterodimeric anti-HER2/scFv anti-CD3 antibody.

The general structure of the heterodimeric anti-HER2/scFv anti-CD3 antibody is shown in FIG. 4. Proteins were purified from culture supernatants using Protein-A Sepharose Fast Flow (16 mm ID, 22 ml, GE Healthcare). The obtained proteins were concentrated using an ultracentrifuge tube (molecular weight cutoff 10 kDa) and the buffer was replaced with a PBS solution.

Then was added 3 M (NH ₄ ) ₂ SO ₄ to a final concentration of 1 M and a half solution volume. Proteins were diluted with buffer A (20 mM sodium phosphate, 1 M (NH ₄ ) ₂ SO ₄ , pH 7.0).

The following purification was also used using the AKTA Explorer 100 protein purification system (GE Healthcare). Proteins were purified using Source Phenyl (16 mm ID, 22 ml, GE Healthcare). Protein samples were applied to a column previously equilibrated with buffer A (20 mM Na ₃ PO4, 1 M (NH ₄ )2SO ₄ , pH 7.0). The flow rate was 3 ml/min. The column was then equilibrated with buffer A and washed with 15 column volumes with a gradient from buffer A (0% B) to 100% buffer B (20 mM sodium phosphate, pH 7.0) for 180 minutes. The flow rate was 2 ml/min. The fractions shown in Fig. 5 were pooled, concentrated using an ultracentrifuge tube (molecular weight cutoff 10 kDa) and buffer exchanged with PBS solution. Proteins were filtered through 0.22 μm and stored at 4°C. The purified protein was analyzed by SDSPAGE. The result is shown in Fig. 6. Based on the results of size exclusion high performance liquid chromatography (SEC-HPLC), the purity was 97.65% (Fig. 7).

Example 6 Stability analysis of a heterodimeric bispecific anti-HER2/scFv anti-CD3 antibody.

Sealed heterodimer samples of anti-HER2/scFv anti-CD3 antibody (1 mg/ml and 10 mg/ml) were stored in an incubator at 40° C. (BINDER, KBF240). Stability was analyzed using 20 μl samples at different time points (baseline (day 0), day 1, day 2, day 5, day 7) using high performance size exclusion liquid chromatography (SECHPLC). SEC-HPLC conditions were as follows: (1) chromatographic column: TSKgel G3000SWxl (Tosoh Bioscience), 5 µm, 7.8 mm x 30 cm; (2) mobile phase: 5 mM PBS, 150 mM NaCl, pH 6.7; (3) flow rate: 0.6 ml/min; (4) UV detection wavelength: 280 nm; (5) exposure time: 30 min. The instrument used was an Agilent 1200 Infinity chromatograph, and an Agilent ChemStation was used for plotting and calculating residual monomer fraction. As shown in FIG. 8, under experimental conditions at 40° C., the anti-HER2/scFv anti-CD3 antibody heterodimer was not significantly aggregated. The data obtained demonstrated that the anti-HER2/scFv anti-CD3 heterodimer had good temperature stability. Example 7 - FcRn binding activity of a heterodimeric bispecific anti-HER2/scFv anti-CD3 antibody FcRn binding activity of an anti-HER2/scFv anti-CD3 antibody heterodimer was analyzed by ELISA. Briefly, an anti-HER2/scFv anti-CD3 heterodimer and controls were adsorbed onto an ELISA plate in carbonate/bicarbonate buffer (pH 9.6) overnight at 4°C. The tablet was washed 5 times using PBST (pH 6.0). 300 μl of PBST containing 0.5% BSA was added to each well to block the plate and the plate was incubated for at least 1 hour at 25°C. The plate was washed as described above, then 100 μl of his-tagged FcRn (Sino Biological, catalog number CT009-H08H), 1 μg/ml, diluted in 0.5% BSA in PBST, was added to each well, and the plate was incubated in for 2 h at 25°C. The plate was washed as described above, then 100 µl of mouse anti-his antibody (CWBIO, cat. no. CW0228) diluted 1:5000 in 0.5% BSA in PBST was added to each well and incubated for 1 hour at 25°C. WITH. The plate was washed as described above, then 100 μl of anti-mouse IgG antibody (Abcam, catalog number AB7068) labeled with horseradish peroxidase (HRP) was added to each well and incubated for 1 hour at 25°C. The plate was washed as described above, 100 µl of TMB was added to each well, and staining was performed for 10 min at room temperature. The reaction was stopped by adding 100 μl of 1 M H ₂ SO ₄ to each well. Optical density at 450 nm was determined using a microplate reader. As shown in FIG. 9, the anti-HER2/scFv anti-CD3 heterodimer binds to FcRn.

Example 8 Binding activity of a heterodimeric anti-CD3 HER2/scFv bispecific antibody in vitro.

The anti-HER2/scFv anti-CD3 antibody heterodimer was analyzed by flow cytometry (FACS) for binding activity against HER2 highly expressed SK-BR-3 cells.

- 26 042601 and Jurkat cells with high expression of CD3.

SK-BR-3 cells and Jurkat cells were harvested and washed once with cold assay buffer, cold PBS (GIBCO, cat. no. 14190-235) containing 2% FBS (Hyclone, cat. no. SH30084.03), respectively. Aliquots of SK-BR-3 cells (1 x 10 ⁶ per tube) were then resuspended in cold assay buffer (200 µl DPBS containing 2% FBS) and incubated with 0.5 nM anti-HER2/scFv anti-CD3 heterodimer or tetravalent homodimer anti-HER2/CD3 antibody or anti-HER2 antibody or isotype control (human immunoglobulin, Jiangxi Boya Bio-Pharmaceutical, Approval No. S19993012, China) on ice in the dark for 30 min. Aliquots of Jurkat cells were treated in a similar manner, except that the concentration of these samples was changed to 5 nM. At the end of the incubation, the cells were washed twice with cold assay buffer, then resuspended in cold assay buffer, and incubated with 50-fold diluted anti-human IgG-FITC conjugate (ZSGB-Bio, catalog number ZF0306, China) on ice in the dark for 30 min. . At the end of the incubation, the cells were washed twice with cold assay buffer and then resuspended in cold PBS. Flow cytometry was performed using FACS Calibur (Becton Dickinson). The results are shown in Tables 3 and 4. The results obtained demonstrated that the heterodimeric anti-HER2/anti-CD3 antibody construct bound its HER2 and CD3 antigens with good activity.

Table 3

Binding activity against SK-BR-3 cells with high expression of HER2

Average intensity

Fluorescence sample (Mean Fluorescence

Intensity, MFI)

Isotype control 2.88

Anti-HER2 antibody (Herceptin) 20.55

Heterodimer "antibody against

14.16

HER2/scFv vs. CD3"

Table 4

Binding activity against Jurkat cells with high expression of CD3

Sample MFI

Isotype control3,16

Anti-HER2 antibody (Herceptin)3,16

Heterodimer "antibody against

5.19

HER2/scFv vs. CD3"

Example 9 Binding activity of a heterodimeric bispecific anti-HER2/scFv anti-CD3 antibody against both HER2 and CD3 simultaneously.

Anti-HER2/scFv anti-CD3 antibody heterodimeric constructs were analyzed by FACS for HER2 and CD3 binding activity simultaneously using SK-BR-3 cells and Jurkat cells.

SK-BR-3 cells were stained following the instructions for use of the PKH26 kit (Sigma, catalog number SLBH4568V). Briefly, SK-BR-3 cells were harvested, washed once in serum-free medium, then SK-BR-3 cells were suspended at 2 x 10 ⁷ cells/mL, and PKH26 was diluted to 4 μM, respectively, using Diluent C from set PKH26. Then they were mixed 1:1 to obtain a mixture where the cell density was 1 x 10 ⁷ cells/ml and the PKH26 concentration was 2 μM. The mixture was then incubated at room temperature for 1 min and then incubated with an equal volume of FBS for 1 min to stop staining. The mixture was then centrifuged at 400 g for 10 min, washed twice with complete medium, and then resuspended in complete medium. Jurkat cells were stained following the instructions for use of the CFSE kit (Life Technology, catalog number C34554). Briefly, CFSE was diluted to a working concentration of 0.5 μM in PBS and preheated.

- 27 042601 to 37°C. Jurkat cells were centrifuged at 1000 rpm for 5 min, then resuspended in preheated CFSE working solution and incubated at 37°C for 15 min. Stained Jurkat cells were centrifuged at 1000 rpm for 5 min, then resuspended in complete medium and incubated for 30 min. After incubation, the cells were washed once with complete medium and then resuspended in complete medium.

The above-stained SK-BR-3 cells and Jurkat cells were harvested by centrifugation and washed once with cold assay buffer, cold PBS containing 2% FBS. Cells were resuspended at a cell density of 5x10 cells/ml in cold assay buffer. SK-BR-3 cells and Jurkat cells were mixed in a 1:1 ratio and 100 μl aliquots of the mixtures (specifically, 2.5x105 SK-BR-3 cells and 2.5x105 Jurkat cells) were pipetted into each tube. Then, 100 μl samples of heterodimer antibody against HER2/scFv against CD3 or isotype control (human immunoglobulin, Jiangxi Boya Bio-Pharmaceutical, S19993012) were added. Dilution in assay buffer, final concentration 5 nM. The tubes were incubated for 30 min on ice in the dark, washed twice with cold assay buffer, and then resuspended in 500 μl of cold PBS. Flow cytometry was performed using FACS Calibur.

As shown in FIG. 10, the heterodimer of anti-HER2/scFv anti-CD3 antibody can induce fusion of SK-BR-3 and Jurkat cells through simultaneous binding to HER2-high-expressing SK-BR-3 cells and CD3-high-expressing Jurkat cells, meaning that the heterodimer can attract T cells to tumor cells and lead to increased activity to kill cancer cells.

Example 10 Cytotoxicity of a heterodimeric bispecific anti-HER2/scFv anti-CD3 antibody against tumor cells in vitro.

Target cells (BT-474 and SK-BR-3) were harvested and resuspended in complete medium (RPMI 1640 containing 10% FBS) at a cell density of 2x105 cells/ml. Target cells BT-474 and SK-BR-3 were seeded in 96-well plates, 50 μl per well (1x104 cells per well), respectively, followed by serially diluted heterodimer samples of anti-HER2/scFv anti-CD3 antibody and controls with complete medium at 100 µl per well. According to a preliminary experiment, the ratio of effectors/targets (effect vs target, E/T) was determined to be 20:1. Effector cells (human PBMC, Lonza, catalog number CC-2702) were resuspended in complete medium at a cell density of 4x10 cells/ml and then plated at 50 μl per well (2x10 cells per well). The culture plate was incubated for 4 days in a CO ₂ incubator at 37°C. After incubation, the supernatant was collected and the cells were washed twice with 200 μl of DPBS to remove effector cells. 100 μl of complete medium and 20 μl of MTS were added and then incubated in a CO ₂ incubator at 37° C. for 2-3 hours. Absorbance at 490 nm (OD value) was determined using a microplate reader. Cytotoxicity was calculated as follows:

OOcontrol - OBexperiment cytotoxicity = --------—-----------------OVcontrol

As shown in FIG. 11, the heterodimeric anti-HER2/scFv anti-CD3 antibody construct killed SK-BR-3 and BT-474 highly expressed HER2 breast cancer cells in a concentration-dependent manner. The cytotoxicity of this construct was much higher than that of Herceptin (an anti-HER2 mAb), demonstrating high tumor cell killing activity.

Example 11 Phaumacokinetic study of a heteuodymean bispecific antibody anti-HER2/scFv anti-CD3 in mice.

The heterodimer pharmacokinetics of anti-HER2/scFv anti-CD3 antibody was studied in 8-week-old female BALB/c mice purchased from Beijing HFK Bioscience Co., Ltd. After one week of acclimatization, the mice were randomly assigned to two groups of 21 mice each. Mice received a single intraperitoneal injection of the Herceptin monoclonal antibody or the heterodimeric bispecific anti-HER2/scFv anti-CD3 antibody, respectively, at a dose of 20 nmol/kg. Blood samples were obtained from the retroorbital sinus into tubes without anticoagulant at the following time points: before administration, 1, 3, 6, 10, 24, 48, 72, 96, 120, 168, 216, 264, 312 hours after administration. Each mouse was bled at two time points. For each time point, 2 mice were used. Blood samples were allowed to clot for 30-60 min at room temperature and centrifuged at 3000 rpm for 10 min, after which serum samples were taken and stored at -80°C for further analysis.

Blood samples were analyzed by ELISA to determine the concentration of Herceptin and heterodimer against HER2/CD3. Briefly, recombinant human HER2 (Sino Biological, cat. no. 10004-H08H) was adsorbed to a 96-well NuncMaxisorp assay plate at 100 μl per well, 1 μg/ml in carbonate/bicarbonate buffer (pH 9.6) overnight at 4 °C. The plate was washed 5 times using PBST (Sigma, catalog number P-3563). 300 µl of 5% skimmed milk in PBST was added to each well to block the plate and the incubi plate.

- 28 042601 were washed for at least 1 hour at 25°C. The plate was washed as described above, then serum samples diluted in 10% pooled mouse serum, 1% BSA in PBST, 100 µl per well were added to each well, and the plate was incubated for 1 h at 25°C . The plate was washed as described above, then 100 μl of anti-human IgG antibody conjugated to HRP (Chemicon, catalog number AP309P), diluted 1:2000 in 5% skimmed milk in PBST, was added to each well and incubated for 1 hour at 25°C. The plate was washed as described above, then 100 μl of TMB (BD OptEIA, cat. no. 555214) was added to each well and stained for 10 minutes at room temperature. The reaction was stopped by adding 100 μl of 1 M H ₂ SO ₄ to each well. Optical density at 450 nm was determined using a microplate reader.

As shown in FIG. 12, the heterodimer anti-HER2/scFv anti-CD3 antibody showed a similar PK profile to Herceptin after a single intraperitoneal injection in mice (20 nmol/kg). Pharmacokinetic parameters of the heterodimer antibody against HER2/scFv against CD3 were as follows: half-life t _1/2 is 129 h; AUC _last is 30611 nM*h; T _max is 3 hours; C _max is 264 nM; Vd is 85 ml/kg; CL is 0.45 ml/h/kg; MRT _last is 88 hours. 5 below.

Table 5

Table 5 HER2/CD3

Purity 99.7%

Stability Stable for at least 7 days at 40°C

HER2 MFI = 14.16 (Herceptin: MFI = 20.55)

Binding activity MFI=5.19 (bivalent HER2/CD3:

CD3

MFI=8.17)

Cell pooling Validated by pooling SK-BR-3 and Jurkat cells

Example 12 Purification of a heterodimeric anti-CD3 anti-Trop-2/scFv bispecific antibody.

The resulting culture supernatant was purified as described in Example 5. The purified product was analyzed by SDS-PAGE. The result is shown in Fig. 13. The heterodimeric anti-Trop-2/scFv anti-CD3 product was over 95% pure.

Example 13 Stability and binding activity of a heterodimeric bispecific anti-Trop-2/scFv anti-CD3 antibody in vitro.

Trop-2 binding activity of heterodimeric anti-CD3 anti-Trop-2/scFv antibody constructs was analyzed by ELISA. Briefly, recombinant human Trop-2 (Sino Biological, catalog number 10428-H08H) was adsorbed onto a 96-well ELISA plate at 100 μl per well, 1 μg/ml in carbonate/bicarbonate buffer (pH 9.6) overnight at 4°C. The tablet was washed 5 times using PBST. 300 μl of 1% BSA in PBST was added to each well to block the plate and the plate was incubated for at least 1 hour at 25°C. The plate was washed as described above, then serum samples diluted in 1% BSA in PBST were added to each well at 100 μl per well, and the plate was incubated for 1 hour at 25°C. The plate was washed as described above, then 100 μl of anti-human IgG antibody conjugated to HRP (Chemicon, catalog number AP309P), diluted 1:2000 in 1% BSA in PBST, was added to each well and incubated for 1 h at 25°C. The plate was washed as described above, then 100 μl of TMB (BD OptEIA, cat. no. 555214) was added to each well and stained for 10 minutes at room temperature. The reaction was stopped by adding 100 μl of 1 M H ₂ SO ₄ to each well. Optical density at 450 nm was determined using a microplate reader. As shown in FIG. 14, the heterodimeric anti-Trop-2/anti-CD3 scFv construct has a high binding affinity for Trop-2. The CD3 binding activity of heterodimeric anti-Trop-2/scFv anti-CD3 constructs was analyzed by FACS using CD3-high-expressing Jurkat cells. FACS was performed as described in Example 8. As shown in table. 6, the heterodimeric anti-Trop-2/scFv anti-CD3 construct bound to Jurkat cells with high affinity, indicating good CD3 binding activity.

- 29 042601

Table 6

Cell Binding Activity

Jurkat with high CD3 expression

Sample MFI

Isotype control 3.34 mAb against Thor-2 3.10 Heterodimer "antibody against Trop-2/scFv against CD3" 17.51

Example 14 Binding activity of a heterodimeric anti-CD3 anti-Trop-2/scFv bispecific antibody against Trop-2 and CD3 simultaneously.

Anti-Trop-2/scFv anti-CD3 antibody heterodimer was analyzed by FACS for Trop-2 and CD3 binding activity simultaneously using BxPC-3 cells and Jurkat cells. FACS was performed as described in Example 9 above. BxPC-3 cells were stained following the instructions for use of the PKH26 kit, and Jurkat cells were stained using the CFSE kit. As shown in FIG. 15, by simultaneously binding to BxPC-3 cells with high Trop-2 expression and Jurkat cells with high CD3 expression, the heterodimer anti-Trop2/scFv anti-CD3 antibody can induce the association of BxPC-3 and Jurkat cells, which means that the heterodimer can recruit T -cells to tumor cells and lead to increased activity in the destruction of cancer cells.

Example 15 In vitro cytotoxicity of anti-Trop2/scFv anti-CD3 antibody heterodimeric bispecific antibody against tumor cells.

Target cells (H1650 and BxPC-3) were harvested and resuspended in complete medium (RPMI 1640 containing 10% FBS) at a cell density of 1x105 cells/ml. H1650 and BxPC-3 target cells were seeded in 96-well plates, 50 μl per well (5x103 cells per well), respectively, followed by serially diluted samples of anti-Trop-2/scFv anti-CD3 heterodimer and complete medium controls at 100 µl per well. Effector cells (human PBMC, Lonza, cat. no. CC-2702) were resuspended in complete medium at a cell density of 2x10 or 0.5x10 cells/ml and then plated at 50 μl per well (1x10 or 0.25x10 cells per well). The culture plate was incubated for 3 days in a CO ₂ incubator at 37°C. After incubation, the supernatant was collected and the cells were washed twice with 200 μl of DPBS to remove effector cells. 100 µl of complete medium and 20 µl of MTS were added and the resulting sample was incubated in a CO ₂ incubator at 37° C. for 2-3 hours. Absorbance at 490 nm (OD value) was determined using a microplate reader. Cytotoxicity was calculated as follows:

OOcontrol - OBexperiment cytotoxicity = ----------------------OBcontrol

As shown in FIG. 16 (with effector cells), anti-CD3 anti-Trop-2/scFv antibody heterodimer killed highly Trop-2-expressing cancer cells (H1650 non-small cell lung cancer cells and BxPC-3 human pancreatic cancer cells) in a concentration-dependent manner. The cell killing activity of the bispecific antibody was much higher than that of the anti-Trop-2 mAb, showing high tumor cell killing activity.

Example 16 Pharmacokinetic study of anti-Trop-2/scFv anti-CD3 heterodimeric bispecific antibody in mice.

The pharmacokinetics of anti-CD3 anti-Trop-2/scFv antibody heterodimer was studied in 8-week-old female BALB/c mice purchased from Beijing HFK Bioscience Co., Ltd. Administration, blood sample collection and analytical method were the same as described in Example 11 above. Blood samples were analyzed by Trop-2 ELISA (Sino Biological, catalog number 10428-H08H) to determine the concentration of anti-Trop-2/scFv anti-CD3 heterodimer. As shown in FIG. 17, the anti-CD3 anti-Trop-2/scFv heterodimer showed a similar PK profile to anti-Trop-2 after a single intraperitoneal injection to mice (20 nmol/kg). The pharmacokinetic parameters of the anti-Trop-2/scFv anti-CD3 heterodimer were as follows: half-life t _1/2 is 165 h; AUC _last is 26072 nM*h; T _max is 6 h; C _max is 203 nM; Vd is 107 ml/kg; CL is 0.45 ml/h/kg; MRT _last is 92 hours.

Example 17 Purification of a heterodimeric anti-CD20/scFv anti-CD3 bispecific antibody.

The resulting culture supernatant was purified as described in Example 5 above. The purified product was analyzed by SDS-PAGE. The result is shown in Fig. 18. The purity of the heterodimeric anti-CD20/scFv anti-CD3 antibody product was greater than 95%.

- 30 042601

Example 18 Stability and binding activity of a heterodimeric anti-CD20/scFv anti-CD3 bispecific antibody in vitro.

Sealed samples of anti-CD20/scFv anti-CD3 heterodimer (1 mg/ml and 10 mg/ml) were stored in an incubator at 40° C. (BINDER, KBF240). Stability was analyzed using 20 μl samples at different time points (baseline (day 0), day 1, day 3, day 6) using high performance size exclusion liquid chromatography (SEC-HPLC). As shown in FIG. 19, under experimental conditions at 40° C., there was no significant aggregation of the anti-CD20/scFv anti-CD3 antibody heterodimer. The data obtained demonstrated that the heterodimeric anti-CD20/scFv anti-CD3 antibody construct had good temperature stability. The CD20 and CD3 binding activity of the anti-CD20/scFv anti-CD3 heterodimer was analyzed by FACS using Raji (high CD20) and Jurkat (high CD3) cells. FACS was performed as described in Example 8 above. As shown in Table. 7 and tab. 8, the heterodimeric anti-CD20/scFv anti-CD3 antibody construct bound to Raji cells and Jurkat cells, indicating binding of the construct to both the CD20 antigen and the CD3 antigen.

Table 7 Cell Binding Activity

Raji with high CD20 expression

Sample MFI

Isotype control2.77

Heterodimer "antibody against

28

CD20/scFv vs. CD3''

Table 8

Binding activity against Jurkat cells with high expression of CD3 Sample MFI

Isotype control2.75

Heterodimer "antibody against

5.61

CD20/scFv vs. CD3"

Example 19 Purification of a Heterodimeric Bispecific Anti-PD-L1/scFv Anti-CD3 Antibody.

The resulting culture supernatant was purified as described in Example 5 above. The purified product was analyzed by SDS-PAGE. The result is shown in Fig. 20. The purity of the heterodimeric anti-PD-L1/scFv anti-CD3 product exceeded 95%.

Example 20 Binding activity of a heterodimeric bispecific anti-PD-L1/scFv anti-CD3 antibody in vitro.

The PD-L1 binding activity of the heterodimeric anti-PD-L1/scFv anti-CD3 construct was analyzed by ELISA. ELISA was performed as described in Example 13 above. PD-L1 (Sino Biological, catalog number 10084-H08H) was adsorbed onto an ELISA plate. As shown in FIG. 21, the anti-PD-L1/scFv anti-CD3 heterodimer has a high binding affinity for PD-L1.

The CD3 binding activity of the anti-PD-L1/scFv anti-CD3 heterodimer was analyzed by FACS using Jurkat cells (highly CD3-expressing). FACS was performed as described in Example 8 above. As shown in Table. 9, the anti-PD-L1/scFv anti-CD3 heterodimer binds to Jurkat cells, indicating its binding to the CD3 antigen.

Table 9

Binding activity against Jurkat cells with high expression of CD3 Sample MFI

Isotype control 2.70

Heterodimer "antibody against

8.90

PD-Ll/scFv against CD3"

Example 21 Binding activity of a heterodimeric bispecific anti-PD-L1/scFv anti-CD3 antibody against both PD-L1 and CD3 simultaneously.

- 31 042601

The anti-PD-L1/scFv anti-CD3 antibody heterodimer was analyzed by FACS for PD-L1 and CD3 binding activity simultaneously using H460 cells and Jurkat cells. The analysis was carried out as described in Example 9 above. As shown in FIG. 22, a heterodimeric anti-PD-L1/scFv anti-CD3 construct can induce the association of H460 cells (highly expressing PD-L1) with Jurkat cells (highly expressing CD3), which means that the heterodimer can recruit T cells to tumor cells. and lead to increased activity to destroy cancer cells.

Example 22 Cytotoxicity of a heterodimeric anti-CD3 anti-PDL1/scFv bispecific antibody in vitro.

Target cells (H1650 and HCC827) were harvested and resuspended in RPMI 1640 complete medium (10% FBS) at a cell density of 1x10 cells/ml. H1650 and HCC827 target cells were seeded in 96-well plates at 50 μl per well (5x103 cells per well), after which serially diluted samples of the anti-PD-L1/scFv anti-CD3 heterodimer and 100 complete media controls were added. µl per well. Effector cells (human PBMC, Lonza, catalog number CC-2702) were resuspended in complete medium at a cell density of 2x10 cells/ml and then seeded at 50 μl per well (1x10 cells per well). The culture plate was incubated for 3 days in a CO ₂ incubator at 37°C. After incubation, the supernatant was collected and the cells were washed twice with 200 μl of DPBS to remove effector cells. 100 µl of complete medium and 20 µl of MTS were added to the sample and then incubated in a CO ₂ incubator at 37° C. for 2-3 hours. Absorbance at 490 nm (OD value) was determined using a microplate reader. Cytotoxicity was calculated as follows:

OBcontrol - OBexperiment cytotoxicity = ---------------------------OVcontrol

As shown in FIG. 23 (with effector cells), the heterodimeric anti-PD-L1/scFv anti-CD3 antibody construct killed highly PD-L1-expressing cancer cells (H1650 and HCC827 non-small cell lung cancer cells) in a concentration dependent manner, demonstrating high tumor cell killing activity.

Example 23 Purification of anti-HER2 and anti-CD20 antibody expression products to obtain a bispecific Fab-Fab antibody.

Purification was carried out using an AKTA Explorer 100 system (GE Healthcare) with a Protein A Sepharose Fast Flow affinity chromatography column (16 mm ID, 22 ml, GE Healthcare) at 4°C. The column was initially equilibrated using buffer A (20 mM PBST; 150 mM NaCl, pH 7.4), with cell supernatant added after baseline stabilization at a flow rate of 5 ml/min and then equilibrated using buffer A. Samples were expression products of anti-HER2 and anti-CD20 antibodies with amino acid mutations in the CH3 domains, expressed using the methods described in Example 4 above. This was followed by washing the column with 5 column volumes of buffer B1 (buffer A + 0.5 M Arg) and then eluting with 5 column volumes of buffer B2 (100 mM citric acid, pH 3.0) to obtain an elution peak representing the desired protein. The flow rate in the elution step was 5 ml/min. A typical chromatogram of an anti-CD20 antibody product is shown in FIG. 24; similar results were obtained for the anti-HER2 antibody product (not shown). The elution peak shown in gray was collected and 1M sodium acetate was added to adjust the pH to 5.0.

Example 24 Purification of a heterodimeric anti-HER2/anti-CD20 bispecific antibody like natural IgG.

The general structure of the anti-HER2 antibody/anti-CD20 heterodimer is shown in FIG. 25.

The purified products were recombined according to example 23 ex vivo with the formation of heterodimers. First, buffer exchange was carried out with phosphate buffered saline (PBS) using ultrafiltration concentration (molecular weight cutoff 10 kDa). The concentration of each of the anti-HER2 and anti-CD20 antibody products was adjusted to 1 mg/mL in PBS and 1/200 volume of 1 M dithiothreitol (DTT) was added (final DTT concentration was 0.1, 0.5, 1, 2, 5, 10 or 20 mM). Reduction was then carried out at 4° C. for 3-8 hours. During this reduction step, disulfide bonds, such as those at the hinge region of homodimers, which may be present in anti-HER2 and anti-CD20 antibody expression products, are broken, resulting in the formation half-antibodies (or half-mers) with one light chain and one heavy chain, as shown in FIG. 26. After the reduction step, the sample was analyzed by SDS-PAGE under denaturing conditions. Representative results for an anti-CD20 antibody product are shown in FIG. 27; similar results were obtained for the anti-HER2 antibody product (not shown). In FIG. 27, the four major bands present in lanes 2-4 are, from top to bottom, LC-HC-HC-LC homodimer, HC-LC half-mer, HC, and LC, respectively. As shown in FIG. 27, as the concentration of DTT increases, only two bands (HC and LC) remain visible, almost without homodimers. In FIG. 28 shows the results of SEC-HPLC analysis in the presence of 1 mM DTT in PBS,

- 32 042601 obtained for anti-HER2 semi-antibody (A) and anti-CD20 semi-antibody (B). As shown in FIG. 28, at a DTT concentration equal to or greater than 1 mM, the proportion of homodimers of each of the anti-HER2 and anti-CD20 antibody products was less than 10%, and the proportion of semi-antibody molecules (half-mers) was more than

90% by weight of all considered polypeptidyl forms.

The reconstituted anti-HER2 and anti-CD20 half-measures were then mixed 1:1 (molar ratio) and recombined at 4° C. for 0.5-24 hours. an anti-CD20 antibody containing both half-measures held side by side by predominantly non-covalent CH2/CH3 interactions. Buffer exchange was then carried out with PBS using ultrafiltration concentration (molecular weight cutoff 10 kDa). The reduction state was terminated by oxidation with air or an oxidizing agent to form interchain disulfide bonds in the heterodimeric bispecific antibody. Oxidation conditions included exposure to air for 1 day, 3 days, 4 days, or addition of 100 mM L-dehydroascorbic acid oxidizing agent (final protein concentration was 1 mg/mL and final oxidant concentration 0.5, 1, 5, or 10 mM) at 4 °C and incubation for 5 or 24 hours. After oxidation, the product was analyzed by SDS-PAGE. The result is shown in Fig. 29.

Using concentration by ultrafiltration (10 kDa molecular weight cutoff), the above anti-HER2 antibody/anti-CD20 heterodimer obtained by reduction-oxidation of anti-HER2 and anti-CD20 half-mers was concentrated and buffer exchanged with 10 mM PBST, pH 5.8. Samples were purified using an AKTA Explorer 100 system (GE Healthcare) with a Source 15S ion exchange chromatography column (ID 16 mm, 17 mL, GE Healthcare) at 4°C. The column was initially equilibrated using buffer A (10 mM Na ₃ PO ₄ , pH 7.0), while the protein solution treated as above was added after baseline stabilization at a flow rate of 3 ml/min and then equilibrated using buffer A. Thereafter, using a gradient from buffer A (10 mM Na ₃ PO ₄ , pH 7.0) to buffer B (10 mM Na ₃ PO ₄ , pH 5.8), the column was washed with 20 column volumes (0% B - 100% B in 170 min, flow rate 2 ml/min). Collected the main marked elution peak (shown in Fig. 30). The collected protein solution was concentrated by once again changing the buffer to PBS (pH 7.4) and using an ultrafiltration tube (molecular weight cutoff 10 kDa) and sterilized by filtration at 4° C. for storage. The purified product was analyzed by SDS-PAGE. The result is shown in Fig. 31. The product was also analyzed by SEC-HPLC, the result is shown in FIG. 32. The degree of purity was 97.3%.

Example 25 Development of an assay method for determining the anti-HER2 antibody/anti-CD20 heterodimer.

HPLC analysis was performed on the following five samples: anti-HER2 semi-antibody, anti-HER2 homodimer, anti-CD20 semi-antibody, anti-CD20 homodimer, and anti-HER2 antibody/anti-CD20 heterodimer. The experiment was carried out as follows: (1) hydrophobic interaction chromatography column (TSK-GEL Phenyl-5PW, 7.5 mm (inner diameter) x 7.5 cm, 10 µm); (2) mobile phase and gradient: buffer A: 20 mM PBS, pH 7.0, 1 M (Nh ₄ ) ₂ SO ₄ ; buffer B: 20 mM PBS, pH 7.0; gradient from 40% buffer B to 100% buffer B in 40 min; (3) flow rate: 0.5 ml/min; (4) temperature: 25°C; (5) detection wavelength: 280 nm. As can be clearly seen from the results shown in Fig. 33, this method effectively distinguishes between the anti-CD20 Fc1 homodimer (peak 1 in FIG. 33), the anti-HER2 Fc2 homodimer (peak 5 in FIG. 33), and the anti-HER2 antibody/anti-CD20 heterodimer (peak 3 in FIG. 33) by different retention times. These results confirmed that the product obtained in Example 24 is a heterodimer and not a homodimer.

Example 26 Determination of anti-HER2 antibody/anti-CD20 heterodimer by mass spectra.

The following three samples, anti-HER2 homodimer, anti-CD20 homodimer, and anti-HER2/anti-CD20 heterodimer were analyzed by LC-MS to calculate the proportion of detectable amino acids. The above samples were trypsinized and incubated at 37° C. for 18 hours. LC-MS conditions were as follows. Column: Waters ACQUITY UPLC VEN C18, 300A, 1.7 µm, 2.1 mm x 100 mm. Column temperature: 50°C. Flow rate: 0.2 ml/min. Buffer A: 0.1% formic acid. Buffer B: 0.1% formic acid/100% acetonitrile. Elution gradient: 2-35% buffer B over 90 min; 35-45% buffer B in 20 min. ESI source: positive ion mode. Capillary voltage: 2.5 kV. Cone voltage: 25 V. Scanning range: 100-2500 Da. MS ^e voltage: 20-40 V.

In FIG. 34 shows the base peak ion chromatogram (BPI) of anti-HER2 homodimer, anti-CD20 homodimer, and anti-HER2 antibody/anti-CD20 heterodimer (FIG. 34A), as well as the percentage of detectable amino acids for each sample (FIG. 34B). For the anti-CD20 homodimer, this proportion was 99.7%, for the anti-HER2 homodimer it was 100%, for the anti-HER2 antibody/anti-CD20 heterodimer it was 99.4%. Amino acids

Claims (5)

Specific light chain and heavy chain sequences of the anti-CD20 homodimer containing two characteristic amino acid substitutions determined by LC-MS are shown in SEQ ID NOS: 73 and 74, respectively. The light chain and heavy chain amino acid sequences of the anti-HER2 homodimer containing three characteristic amino acid substitutions determined by LC-MS are shown in SEQ ID NOS: 75 and 76, respectively. The light chain and heavy chain amino acid sequences of the anti-CD20 anti-CD20/HER2 heterodimer containing two characteristic amino acid substitutions determined by LC-MS are shown in SEQ ID NOs: 77 and 78, respectively. The amino acid sequences of the anti-HER2 light chain and heavy chain of the anti-CD20/HER2 heterodimer containing the three characteristic amino acid substitutions determined by LC-MS are shown in SEQ ID NOS: 79 and 80, respectively. The amino acids glycine at position 66 and lysine at position 67 of SEQ ID NO: 74, the amino acids glycine at position 66, lysine at position 67, lysine at position 218, alanine at position 343, lysine at position 344 of SEQ ID NO: 78, and amino acids lysine at position 217, alanine at position 342, lysine at position 343 in SEQ ID NO: 80 were not detected by LC-MS analysis. The results showed that the anti-HER2 antibody/anti-CD20 heterodimer had the expected sequence. Specialists in this field will be clear the possibility of making many different modifications and changes without going beyond the scope and spirit of the present invention. Thus, it should be understood that the various embodiments of the invention described herein are for illustrative purposes only and do not limit the scope of the invention. All references herein are incorporated herein by reference in their entirety. CLAIM 1. A heterodimer containing an Fc receptor (FcR) binding element and one or more recognition moieties covalently linked to an FcR binding element, where said FcR binding element contains a first polypeptide and a second polypeptide linked with each other one or more disulfide bonds, each of which contains at least part of the constant region of the heavy chain of the immunoglobulin; and wherein said first polypeptide and second polypeptide contain at least five amino acid substitutions at the following positions in the Kabat EU numbering: a) T366 and D399 in the first polypeptide and L351, Y407 and K409 in the second polypeptide; or b) T366 and K409 in the first polypeptide and L351, D399 and Y407 in the second polypeptide; whereby the first and second polypeptides have a higher propensity to dimerize with each other than with themselves, wherein the five amino acid substitutions are present in the two CH3 domains of the immunoglobulin heavy chain constant region of both the first polypeptide and the second polypeptide and include any of the following group members I (a)-(h) and Group II (a)-(h): group I: a) T366L and D399R in the first polypeptide and L351E, Y407L and K409V in the second polypeptide; b) T366L and D399C in the first polypeptide and L351G, Y407L and K4O9C in the second polypeptide; c) T366L and D399C in the first polypeptide and L351Y, Y407A and K4O9P in the second polypeptide; d) T366P and D399N in the first polypeptide and L351V, Y407P and K409S in the second polypeptide; e) T366W and D399G in the first polypeptide and L351D, Y407P and K409S in the second polypeptide; f) T366P and D399I in the first polypeptide and L351P, Y407F and K409F in the second polypeptide; g) T366V and D399T in the first polypeptide and L351K, Y407T and K409Q in the second polypeptide; and h) T366L and D399A in the first polypeptide and L351W, Y407H and K409R in the second polypeptide, group II: a) T366L and K409V in the first polypeptide and L351E, Y407L and D399R in the second polypeptide; b) T366L and K4O9C in the first polypeptide and L351G, Y407L and D399C in the second polypeptide; c) T366L and K4O9P in the first polypeptide and L351Y, Y407A and D399C in the second polypeptide; d) T366P and K409S in the first polypeptide and L351V, Y407P and D399N in the second polypeptide; e) T366W and K409S in the first polypeptide and L351D, Y407P and D399G in the second polypeptide; f) T366P and K409F in the first polypeptide and L351P, Y407F and D399I in the second polypeptide; g) T366V and K409Q in the first polypeptide and L351K, Y407T and D399T in the second polypeptide; And h) T366L and K409R in the first polypeptide and L351W, Y407H and D399A in the second polypeptide, where the Fc receptor is an Fc receptor selected from the group consisting of FcyRI, FcyRIIA, FcyRIIB1, FcyRIIB2, FcyRIIIA, FcyRIIIB, FcεRI, FcεRII, FcaRI, Fcα/μR and FcRn, where the FcR binding element contains an Fc domain, and the Fc domain is derived from an IgG Fc domain, which includes an Fc domain selected from the group consisting of an IgG1 Fc domain, an IgG2 Fc domain, Fc-domain of IgG3 and Fc-domain of IgG4, where one or more than one recognition group contains at least one of antigen-binding (Fab) fragments, single-chain variable (scFv) fragments, extracellular - 34 042601 domains of membrane receptors, peptide ligands of cell membrane receptors, cytokines, coagulation factors, affinity tags and combinations thereof. 2. Heterodimer according to claim 1, wherein one or more than one recognition group contains two recognition groups, each of which contains Fab-fragments. 3. Heterodimer according to claim 2, wherein the two Fab fragments are not identical. 4. Heterodimer according to claim 3 containing an immunoglobulin-like molecule. 5. Heterodimer according to any one of claims 3, 4, which is a bispecific antibody. 6. The heterodimer according to claim 1, wherein the one or more recognition moieties comprise two recognition moieties containing a Fab fragment and a scFv fragment. 7. A heterodimer according to any one of claims 1 to 6, wherein under physiological conditions in an aqueous solution containing 1 mM dithiothreitol, less than 50% by weight of each of the first and second polypeptides and a cognate recognition group of said first or second polypeptide exist in homodimeric form. based on the weight of all polypeptidyl forms in solution, provided that said solution is substantially free of polypeptides other than said first or second polypeptide and its cognate recognition moiety. 8. A heterodimer according to any one of claims 1 to 7, wherein the at least five amino acid substitutions include T366L and D399R in the first polypeptide and L351E, Y407L and K409V in the second polypeptide. 9. A heterodimer according to claim 3, comprising a first heavy chain and a second heavy chain, a first light chain and a second light chain, wherein the first heavy chain and the second heavy chain are not identical, and wherein the first light chain and the second light chain are not identical. 10. Heterodimer according to claim 6, where the Fab fragment and the scFv fragment are selected from a pair of recognition groups selected from group III (a)-(d): group III: a) Fab specific to HER2 and scFv specific to CD3; b) Trop-2 specific binding Fab and CD3 specific binding scFv; c) Fab specific to CD20 and scFv specific to CD3; And d) Fab specific to PD-L1 and scFv specific to CD3. 11. The heterodimer of claim 3, wherein the two non-identical Fab fragments comprise a first Fab fragment that specifically binds to HER2 and a second Fab fragment that specifically binds to CD20. 12. A heterodimer according to any one of claims 1-11, wherein at least one of the first polypeptide and the second polypeptide comprises the amino acid sequences shown in SEQ ID NOs: 16, 18, 20, 22, 24, 26, 28, or 30, and the other polypeptide comprises the amino acid sequence shown in SEQ ID NO: 17, 19, 21, 23, 25, 27, 29, or 31. 13. A heterodimer according to any one of claims 1 to 12, wherein the FcR binding element is capable of binding to an Fc receptor selected from the group consisting of FcyRI, FcyRIIA, FcyRIIB1, FcyRIIB2, FcyRIIIA, FcyRIIIB, FcεRI, FcεRII, FcaRI, Fcα/μR and FcRn. 14. The heterodimer of claim 13, wherein the FcR binding element is capable of binding to FcRn. 15. The heterodimer of claim 13, wherein binding to the Fc receptor triggers ADCC (antibody dependent cell mediated cytotoxicity). 16. The method of obtaining a heterodimer according to any one of paragraphs. 1-15, including: 1) expression of one or more nucleic acids encoding a first polypeptide as defined in claim 1 in a first host cell and one or more nucleic acids encoding a second polypeptide as defined in claim 1, in a second host cell, wherein the first host cell and the second host cell are separated from each other; 2) recovery of the first polypeptide, as defined in claim 1, and the second polypeptide, as defined in claim 1, when they are separated; 3) combining the first polypeptide, as defined in claim 1, and the second polypeptide, as defined in claim 1, to obtain a mixture; 4) oxidation of the resulting mixture; And 5) isolation of the formed heterodimer. 17. A method for producing a heterodimer according to claim 1, containing a bivalent heterologous immunoglobulin having a first heavy chain, a second heavy chain, a first light chain and a second light chain, where the first heavy chain and the second heavy chain are not identical, where the first light chain and the second light chain are not identical, where part of the first heavy chain and the second heavy chain form the Fc region of a bivalent heterologous immunoglobulin, comprising 1) expression of one or more nucleic acids encoding a first heavy chain and a first light chain in a first host cell and one or more nucleic acids encoding a second heavy chain and a second light chain in a second host cell, wherein the first host cell and the second host cell are separated from each other; 2) reducing the first heavy chain and the first light chain together and the second heavy chain and the second light chain together; - 35 042601 3) combining the first heavy chain, the first light chain, the second heavy chain and the second light chain to form a mixture; 4) oxidation of the resulting mixture; And 5) isolation of the formed heterodimer; where the Fc region contains at least five amino acid substitutions, including any of the following elements of group IV (a)-(h): group IV: a) T366L and D399R in the first heavy chain and L351E, Y407L and K409V in the second heavy chain; b) T366L and D399C in the first heavy chain and L351G, Y407L and K4O9C in the second heavy chain; c) T366L and D399C in the first heavy chain and L351Y, Y407A and K4O9P in the second heavy chain; d) T366P and D399N in the first heavy chain and L351V, Y407P and K409S in the second heavy chain; e) T366W and D399G in the first polypeptide and L351D, Y407P and K409S in the second heavy chain; f) T366P and D399I in the first polypeptide and L351P, Y407F and K409F in the second heavy chain; g) T366V and D399T in the first heavy chain and L351K, Y407T and K409Q in the second heavy chain; And h) T366L and D399A in the first heavy chain and L351W, Y407H and K409R in the second heavy chain. 18. A method for producing a heterodimer according to claim 1, containing a bivalent heterologous immunoglobulin having a first heavy chain, a second heavy chain, a first light chain and a second light chain, where the first heavy chain and the second heavy chain are not identical, where the first light chain and the second light chain are not identical, where part of the first heavy chain and the second heavy chain form the Fc region of a bivalent heterologous immunoglobulin, comprising 1) expression of one or more nucleic acids encoding a first heavy chain and a first light chain in a first host cell and one or more nucleic acids encoding a second heavy chain and a second light chain in a second host cell, wherein the first host cell and the second host cell are separated from each other; 2) reducing the first heavy chain and the first light chain together and the second heavy chain and the second light chain together; 3) combining the first heavy chain, the first light chain, the second heavy chain and the second light chain to form a mixture; 4) oxidation of the resulting mixture; And 5) isolation of the formed heterodimer; where the Fc region contains at least five amino acid substitutions, including any of the following elements of group V (a)-(h): Group V: a) T366L and K409V in the first heavy chain and L351E, Y407L and D399R in the second heavy chain; b) T366L and K4O9C in the first heavy chain and L351G, Y407L and D399C in the second heavy chain; c) T366L and K4O9P in the first heavy chain and L351Y, Y407A and D399C in the second heavy chain; d) T366P and K409S in the first heavy chain and L351V, Y407P and D399N in the second heavy chain; e) T366W and K409S in the first heavy chain and L351D, Y407P and D399G in the second heavy chain; f) T366P and K409F in the first heavy chain and L351P, Y407F and D399I in the second heavy chain; g) T366V and K409Q in the first heavy chain and L351K, Y407T and D399T in the second heavy chain; And h) T366L and K409R in the first heavy chain and L351W, Y407H and D399A in the second heavy chain. 19. The method according to any one of claims 16-18, wherein one or more nucleic acids are contained in the vector. 20. The method of claim 19, wherein the vector comprises pX0GC plasmid vectors obtained by modifying pCDNA vectors. 21. The method of claim 20 wherein the vector is introduced into the cell or cells. 22. The method of claim 21, wherein the cell or cells comprise one of HEK293, HEK293T, HEK293F, or CHO, CHO-S, CHO-dhfr, CHO/DG44, and ExpiCHO cells. 23. The method according to any one of claims 16-18, where the stage of recovery includes 1) adding a reducing agent containing one of 2-aminoethanethiol, dithiothreitol (DTT), tris(2-carboxyethyl)phosphine, their derivatives and combinations thereof; 2) recovery for at least about 3 hours at about 4°C; 3) removal of the reducing agent. 24. The method of claim 23 wherein the reducing agent contains DTT at a concentration of about 0.1 mM or greater. 25. The method according to any one of claims 23, 24, wherein the reducing agent is removed using a desalting column. 26. The method of any one of claims 16-18 and 23-25, wherein the oxidizing step comprises oxidizing with air for at least about 5 hours. 27. The method according to any one of claims 16-18 and 23-25, where the oxidation step comprises 1) adding an oxidizing agent containing L-dehydroascorbic acid, its derivatives or combinations thereof; -