EA042506B1 - METHODS FOR SCREENING BACTERIA, ARCHAEA, ALGAE AND YEAST USING CRISPR NUCLEIC ACIDS - Google Patents

Description

Priority Claims

This application claims priority under 35 U.S.C. 119(e), U.S. Provisional Application No. 62/168355, filed May 29, 2015, and U.S. Provisional Application No. 62/296,853, filed February 18, 2016, the contents of which are incorporated herein in their entirety by reference .

The technical field to which the invention belongs

The present invention relates to CRISPR nucleic acids for screening for vital and non-essential genes and foreign genomic islands in bacteria, archaea, algae and/or yeast to kill bacteria, archaea, algae and/or yeast, to identify the phenotype of a gene or genes, and /or to screen for reduced genome size and/or gene deletion in bacteria, archaea, algae and/or yeast.

State of the art

Regularly arranged short palindromic repeats (CRISPR), in combination with associated sequences (cas), constitute the CRISPR-Cas system, which provides many bacteria with adaptive immunity. CRISPR-mediated immunization is accomplished by uptake of DNA from invasive genetic elements such as plasmids and phages into novel spacers.

CRISPR-Cas systems consist of an array of short DNA repeats separated by hypervariable sequences flanked by cas genes that confer adaptive immunity to invasive genetic elements such as phages and plasmids by targeting specific sequences and interferences (Barrangou et al., 2007, Science , 315:1709-1712; Brouns et al., 2008, Science, 321:960-4; Horvath and Barrangou, 2010, Science, 327:167-70; Marraffini and Southerner, 2008, Science, 322:1843-1845; Bhaya et al., 2011, Annu Rev. Genet., 45:273-297; Terns and Terns, 2011, Curr. Opin. Microbiol., 14:321-327; Westra et al., 2012, Annu. Rev. Genet., 46:311-339; Barrangou R., 2013, RNA, 4:267-278). Typically, invasive DNA sequences are acquired as new spacers (Barrangou et al., 2007, Science, 315:1709-1712), where each sequence is paired with a CRISPR repeat and inserted as a new repeat-spacer unit into the CRISPR locus. Subsequently, the repeat-spacer array is transcribed as long pre-CRISPR RNA (pre-crRNA) (Brouns et al., 2008, Science, 321:960-4), which is processed to produce short CRISPR interfering RNA (crRNA) that drive recognition specific sequences. Essentially, strRNAs target nucleases to complementary targets for Cas endonuclease-mediated cleavage of a sequence-specific nucleic acid (Garneau et al., 2010, Nature, 468:67-71; Haurwitz et al., 2010, Science, 329:1355-1358; Sapranauskas et al., 2011, Nucleic Acid Res., 39:9275-9282; Jinek et al., 2012, Science, 337:816-821; Gasiunas et al., 2012, Proc. Natl. Acad. Sci., 109: E2579-E2586; Magadan et al., 2012, PLoS One, 7:e40913; Karvelis et al., 2013, RNA Biol., 10:841-851). These widespread systems are found in almost half of bacteria (~46%) and in most archaea (~90%).

Broadly speaking, there are two classes (Makarova et al., Nat. Rev. Microbiol., 13:722-736 (2015)) of CRISPR-Cas systems, which cover five large types and 16 different subtypes, based on the content of cas genes, cas operon structure, Cas protein sequences, and process steps (Makarova et al., Biol. Direct., 6:38 (2011); Makarova and Koonin, Methods Mol. Biol., 1311:47-75 (2015); Barrangou, R ., Genome Biology, 16:247 (2015)). In types I and III, specialized Cas endonucleases process pre-crRNAs, which subsequently form a large complex of multi-Cas proteins capable of recognizing and cleaving nucleic acids complementary to crRNAs. Type I systems are the most common and widespread systems that target DNA in a Cascade-driven and PAM-dependent manner, degrading the target nucleic acids via the signature Cas3 protein. The CRISPR-Cas type II system has a different process. In this case, pre-CRNA processing occurs by a mechanism in which trans-activating crRNA (tracrRNA) hybridizes with crRNA repeat regions. The hybridized crRNA-tracrRNAs are cleaved with RNase III, and after a second event in which the 5' end of each spacer is removed, mature crRNAs are produced that remain associated with both tracrRNA and Cas9. The mature complex is then located on a dsDNA target sequence ('protospacer' sequence) that is complementary to the spacer sequence in the complex and cuts both strands. Recognition and cleavage by this complex in a type II system not only requires the presence of a complementary sequence between the spacer sequence of the crRNA-tracrRNA complex and the 'protospacer' target sequence, but also requires a protospacer adjacent motif (PAM) sequence located at the 3' end of the protospacer sequences.

The essence of the invention

In one aspect of the invention, a method is provided for screening a bacterial cell population for vital genes, non-essential genes, and/or foreign genomic islands, comprising introducing into said bacterial cell population a heterologous nucleic acid construct comprising a CRISPR array containing (in 5'- 3' direction) a repeat-spacer sequence or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary target regions in the bacterial cell genome of said population, thereby creating a population of transformed bacterial cells;

determining the presence or absence of a deletion in a population of transformed bacterial, archaeal, algal or yeast cells, wherein the presence of a deletion in a population of transformed bacterial, archaeal, algal or yeast cells means that the target region is contained in a non-vital gene and/or a foreign genomic island, and the absence of a deletion in a population of transformed bacterial, archaeal, algal, or yeast cells indicates that the target region is contained in a vital gene.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In a second aspect of the invention, a method is provided for screening a population of bacterial, archaeal, algal, or yeast cells for vital genes, non-essential genes, and/or foreign genomic islands, comprising introducing into the population of bacterial, archaeal, algal, or yeast cells (a) a heterologous nucleic acid construct acid containing a trans-encoded CRISPR (tracr) nucleic acid, (b) a heterologous nucleic acid construct containing a CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome (chromosomal and/or plasmid) of the bacterial, archaeal, algal or yeast cells of said populations, and (c ) a Cas9 polypeptide or a heterologous nucleic acid construct containing a polynucleotide encoding a Cas9 polypeptide, thereby creating a population of transformed bacterial, archaeal, algal or yeast cells; and determining the presence or absence of a deletion in a population of transformed bacterial, archaeal, algal, or yeast cells, wherein the presence of a deletion in a population of bacterial, archaeal, algal, or yeast cells means that the target region is contained in a non-essential gene and/or a foreign genomic island, and the absence of a deletion in a population of bacterial, archaeal, algal, or yeast cells means that the target region is contained in a vital gene.

In a third aspect of the invention, a method is provided for killing one or more bacterial cells in a population of bacterial cells, comprising introducing into said population of bacterial cells a heterologous nucleic acid construct containing a CRISPR (sgRNA, ssDNA) array containing (in the 5' to 3' direction) a repeat sequence a spacer-repeat or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of the bacterial cells of said population, thereby destroying one or more bacterial cells in the population of bacterial cells that contain the target region. The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In a fourth aspect of the invention, there is provided a method for killing one or more cells in a population of bacterial, achaean, algal, or yeast cells, comprising introducing into the population of bacterial, achaean, algal, or yeast cells (a) a heterologous nucleic acid construct comprising a trans-encoded CRISPR (tracr) nucleic acid, (b) a heterologous nucleic acid construct comprising a CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence in which the spacer of said repeat-spacer sequence is a repeat or said at least one repeat-spacer sequence contains a nucleotide sequence that is essentially complementary to a target region in the genome (chromosomal and/or plasmid) of bacterial, achaean, algal or yeast cells of the indicated population, and (c) a Cas9 polypeptide and/ or heterologous nucleic acid constructs lots containing a polynucleotide encoding a Cas9 polypeptide, thereby destroying one or more cells that contain the target region in their genome in a population of bacterial, achaean, algal or yeast cells.

In a fifth aspect of the invention, there is provided a method for identifying a phenotype associated with a bacterial gene, comprising introducing into a population of bacterial cells a heterologous nucleic acid construct,

- 2 042506 containing a CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, in which the spacer of the specified at least one repeat-spacer sequence and repeat-spacer-repeat sequences contains a nucleotide sequence that is essentially complementary to a target region in the genome of the bacterial cells of the specified population, and this target region contains at least part of the open reading frame encoding the polypeptide, or functional nucleic acid, thereby destroying cells containing this target region , and creating a population of transformed bacterial cells that do not contain the target region; and analysis of the phenotype of the population.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In a sixth aspect of the invention, there is provided a method for identifying a phenotype associated with a bacterial, achaean, algal, or yeast gene, comprising introducing into a population of bacterial, achaean, algal, or yeast cells (a) a heterologous nucleic acid construct comprising a trans-encoded CRISPR (tracr) nucleic acid , (b) a heterologous nucleic acid construct comprising a CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence, or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome (chromosomal and/or plasmid) of bacterial, achaean, algal or yeast cells of said population, and (c) a Cas9 polypeptide or heterologous nucleic acid construct acid containing a polynucleotide encoding a Cas9 polypeptide, thereby killing bacterial, achaean, algal, or yeast cells containing the target region and creating a population of transformed bacterial, achaean, algal, or yeast cells lacking the target region; and analysis of the phenotype of a population of transformed bacterial, achaean, algal or yeast cells, and/or (i) growing individual bacterial, achaean, algal or yeast colonies from a population of transformed bacterial, achaean, algal or yeast cells, and (ii) analysis of the phenotype of individual colonies .

In a seventh aspect of the invention, a method is provided for selecting one or more bacterial cells having a reduced genome size from a population of bacterial cells, comprising introducing into the population of bacterial cells a heterologous nucleic acid construct comprising a CRISPR array containing (in the 5'-3' direction) a repeat sequence a spacer-repeat or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial cells in said population, wherein cells containing the target region are killed, thereby selecting one or more bacterial cells lacking the target region and having a reduced genome size from the population of bacterial cells. The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In an eighth aspect of the invention, there is provided a method for selecting one or more bacterial cells having a reduced genome size from a population of bacterial cells, comprising introducing into the population of bacterial cells (a) (i) one or more heterologous nucleic acid constructs comprising a nucleotide sequence having at least at least 80% identity to at least 300 consecutive nucleotides present in the genome of said bacterial cells, or (ii) two or more heterologous nucleic acid constructs containing at least one transposon, thereby creating a population of transgenic bacterial cells containing a non-natural site for a homologous recombination between one or more heterologous nucleic acid constructs integrated into the genome and at least 300 consecutive nucleotides present in the genome, or between the first and second transposons integrated into the genome; and (b) a heterologous nucleic acid construct comprising a CRISPR array comprising (in the 5'-3' direction) a repeat-spacer-repeat sequence, or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial cells in said population, this target region being located between one or more heterologous nucleic acid constructs introduced into the genome, and at least

- 3 042506

300 consecutive nucleotides present in the genome and/or between the first transposon and the second transposon, and cells containing the target region are eliminated, thus selecting one or more bacterial cells lacking the target region and having a reduced genome size from the population transgenic bacterial cells.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In a ninth aspect of the invention, a method is provided for selecting one or more bacterial, archaeal, algal, or yeast cells having a reduced genome size from a population of bacterial, archaeal, algal, or yeast cells, comprising introducing into the population of bacterial, archaeal, algal, or yeast cells (a) a heterologous nucleic acid construct comprising a trans-encoded CRISPR (tracr) nucleic acid, (b) a heterologous nucleic acid construct comprising a CRISPR array containing a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, wherein the spacer is at least one sequence and at least a repeat-spacer-repeat sequence contains a nucleotide sequence that is essentially complementary to a target region in the genome (chromosomal and/or plasmid) of bacterial, archaeal, algal or yeast cells of the indicated population, and (c) a Cas9 polypeptide yes, and the cells containing this target region are destroyed, thus selecting one or more bacterial, archaeal, algal or yeast cells that do not contain the target region and have a reduced genome size from a population of bacterial, archaeal, algal or yeast cells.

In a tenth aspect of the invention, a method is provided for selecting one or more bacterial, archaeal, algal, or yeast cells having a reduced genome size from a population of bacterial, archaeal, algal, or yeast cells, comprising introducing into the population of bacterial, archaeal, algal, or yeast cells (a) (i) one or more heterologous nucleic acid constructs containing a nucleotide sequence having at least 80% identity to at least 300 consecutive nucleotides present in the genome of said bacterial, archaeal, algal, or yeast cells, or (ii) two or more constructs heterologous nucleic acid containing at least one transposon, thereby creating a population of transgenic bacterial, archaeal, algal, or yeast cells containing a non-natural site for homologous recombination between one or more heterologous nucleic acid constructs integrated genome-integrated and at least 300 consecutive nucleotides present in the genome or between the first and second transposons integrated into the genome; and (b) (i) a heterologous nucleic acid construct comprising a trans-encoded CRISPR (tracr) nucleic acid, (ii) a heterologous nucleic acid construct comprising a CRISPR array containing a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, wherein the spacer of said at least one repeat-spacer sequence and at least one repeat-spacer-repeat sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome (chromosomal and/or plasmid) of one or more bacterial, archaeal, algal or yeast cells of said population, and (iii) a Cas9 polypeptide and/or a heterologous nucleic acid construct comprising a polynucleotide encoding a Cas9 polypeptide, wherein the target region is located between one or more heterologous nucleic acid constructs introduced into the genome and at least at least 300 consecutive nucleotides dams present in the genome and/or between the first transposon and the second transposon, and cells containing the target region are destroyed, thus selecting one or more bacterial, archaeal, algal or yeast cells that do not contain the target region and have a reduced size genome, from a population of transgenic bacterial, archaeal, algal or yeast cells.

In the eleventh aspect of the invention, a method is provided for identifying at least one isolate in a population of bacteria having a deletion in its genome, comprising introducing into the population of bacterial cells a heterologous nucleic acid construct containing a CRISPR array containing (in the 5'-3' direction) a repeat sequence a spacer repeat or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial cells of said populations, and the cells containing the target region are destroyed, thus creating a population of transformed

- 4 042506 bacterial cells that do not contain the target area; and growing individual bacterial colonies from the population of transformed bacterial cells, thereby identifying at least one isolate from the population of transformed bacteria having a deletion in its genome.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In a twelfth aspect of the invention, a method is provided for identifying in a bacterial population at least one isolate having a deletion in its genome, comprising introducing into the bacterial cell population (a) (i) one or more heterologous nucleic acid constructs containing a nucleotide sequence having at least 80% identity to at least 300 consecutive nucleotides present in the genome of said bacterial cells, or (ii) two or more heterologous nucleic acid constructs containing at least one transposon, thereby creating a population of transgenic bacterial cells containing a non-natural site for homologous recombination between one or more heterologous nucleic acid constructs integrated into the genome and at least 300 consecutive nucleotides present in the genome, or between the first and second transposons integrated into the genome; and (b) a heterologous nucleic acid construct comprising a CRISPR array comprising (in the 5'-3' direction) a repeat-spacer-repeat sequence, or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial cells in said population, this target region being located between one or more heterologous nucleic acid constructs introduced into the genome, and at least 300 consecutive nucleotides present in the genome and/or between the first transposon and the second transposon, and cells containing the target region are destroyed, thereby creating a population of transformed bacterial cells not containing the target region; and growing individual bacterial colonies from the population of transformed bacterial cells, thereby identifying at least one isolate from the population of bacteria having a deletion in its genome.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In the thirteenth aspect of the invention, a method is provided for identifying in a population of bacterial, archaeal, algal or yeast cells at least one isolate having a deletion in its genome, comprising introducing into the population of bacterial, archaeal, algal or yeast cells (a) a heterologous nucleic acid construct containing a trans-encoded CRISPR (tracr) nucleic acid, (b) a heterologous nucleic acid construct comprising a CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, in which the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome (chromosomal and/or plasmid) of bacterial, archaeal, algal or yeast cells of said population, and (c) Cas9 polypeptide or a heterologous nucleic acid construct comprising a polynucleotide encoding a Cas9 polypeptide, wherein cells containing the target region are killed, thereby creating a population of transformed bacterial, archaeal, algal, or yeast cells lacking the target region; and growing single bacterial, archaeal, algal, or yeast colonies from the population of transformed bacterial, archaeal, algal, or yeast cells, thereby identifying at least one isolate from the population of transformed bacterial, archaeal, algal, or yeast cells having a deletion in its genome.

In a fourteenth aspect of the invention, a method is provided for determining in a population of bacterial, archaeal, algal or yeast cells at least one isolate having a deletion in its genome, comprising introducing into the population of bacterial, archaeal, algal or yeast cells (a) (i) one or more a heterologous nucleic acid construct comprising a nucleotide sequence having at least 80% identity to at least 300 consecutive nucleotides present in the genome of said bacterial, archaeal, algal or yeast cells, or (ii) two or more heterologous nucleic acid constructs containing lesser

- 5 042506 at least one transposon, thus creating a population of transgenic bacterial, archaeal, algal or yeast cells containing a non-natural site for homologous recombination between one or more heterologous nucleic acid constructs integrated into the genome and at least 300 consecutive nucleotides present in genome, or between the first and second transposons integrated into the genome; and (b) (i) a heterologous nucleic acid construct comprising a trans-encoded CRISPR (tracr) nucleic acid, (ii) a heterologous nucleic acid construct comprising a CRISPR array containing (5' to 3' direction) the sequence repeat-spacer-repeat or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome (chromosomal and/or or plasmid) of one or more bacterial, archaeal, algal or yeast cells of the indicated population, and (iii) a Cas9 polypeptide and/or a heterologous nucleic acid construct containing a polynucleotide encoding a Cas9 polypeptide, this target region being located between one or more constructs of the heterologous nucleic acids introduced into the genome, and at least 300 consecutive nucleotides present in the genome and/or between the first transposon and the second transposon, and cells containing the target region are destroyed, thus creating a population of transformed bacterial, archaeal, algal or yeast cells that do not contain the target region; and growing individual bacterial, archaeal, algal, or yeast colonies from the population of transformed bacterial, archaeal, algal, or yeast cells, thereby identifying at least one isolate from the population having the deletion in its genome.

The present invention also relates to expression cassettes, cells and kits containing nucleic acid constructs, nucleic acid arrays, nucleic acid molecules and/or nucleotide sequences of the invention.

These and other aspects of the invention are set forth in more detail below in the description of the invention.

Brief description of the figures

In FIG. 1 shows the sequence of SthCRISPR1 and SthCRISPR3 arrays for targeting (targeting) each composite transposon.

In FIG. 2 shows a schematic diagram of the overlapping extension (SOE) splicing method for a plasmid targeting construct.

In FIG. 3 shows a map of vital genes, insertion sequences and genomic islands. (A) Location and distribution of putative ORFs (ORFs) of vital genes [vital ORFs] (top row), insertion sequences (2nd row) and putative genomic islands (3rd row). Potential targets for CRISPR-Cas (4th row) mediated deletions were identified by mapping transposable elements of different families in the genome of Streptococcus thermophilus LMD-9. Genetic structure of putative genomic islands and their corresponding protospacer/PAM combinations. (B) Genomic island 1 encoding a system for the transport of oligopeptides. (C) Genomic island 2 containing the cell wall proteinase PrtS. (D) Genomic island 3 encoding the copper ion ATPase pump protein. (E) Genomic island encoding selected ORFs including the Lac operon.

In FIG. 4 shows a dendrogram of the coding sequences of transposons distributed in the genome of S. thermophilus LMD-9. Alignment was performed using the Geneious® computer program. The final designations were assigned using www-is.biotoul.fr. The letters correspond to the sequence alignment shown in FIG. 5 for each family.

In FIG. 5A-5D show transpose sequence alignments (using the Geneious® software program) for each major IS family found in the S. thermophilus LMD-9 genome. Different families have different degrees of conservation of length and nucleotide identity. (A) Sth6 transposons were highly polymorphic and apparently degenerate due to internal deletions in some copies. IS1167 (B) and IS1191 (C), on the contrary, had several copies, but retained a high degree of match in length and identity. S1193(D) had high-fidelity replicas, but showed the highest intra-family variation in length.

In FIG. 6A-6C show the structural basis of CRISPRCas9 DNA targeting system and the apparent cytotoxicity of this process. Spacer sequences in SthCRISPR1 (A) and SthCRISPR3 (B) for lacZ targeting. Cas9 recognizes DNA and reversibly binds to PAM sequences, and Cas9 is stabilized on the target due to the formation of the tracrRNA::crRNA duplex. Activation of Cas9 causes simultaneous cleavage of each strand into RuvC and HNH domains, indicated by black arrows. Transformants isolated after electroporation of control and self-targeted plasmids (C). Average clone sizes ±SD screened in independent transformation experiments (n=4) for each of the test plasmids.

In FIG. 7 shows genome sequencing and phenotypic analysis of Lac clones. Sequence data revealed the absence of a chromosomal segment encoding lacZ in two mutants generated independently by targeting lacZ sequences encoding the (A) 5' end and (B) cation-binding fragment using the CRISPR3 system. The size of the deletions ranged from 101865 to 102146 base pairs, which is approximately 5.5% of the S. thermophilus genome. (C) Growth of large deletion strains compared to wild type in Elliker's semi-synthetic medium, presented as mean ± SD OD 600 nm for three independent biological repeats. (D) The ability of S. thermophilus strains to ferment skimmed milk.

In FIG. 8 shows recombination events between insertion sequences (IS). (A) Electrophoresis gel image of large deletion amplicons obtained by PCR analysis of gDNA isolated from transformants. Screening was performed using primers flanking the IS1193 elements above and below the putative deletion site. Lines marked with Δ were amplified from gDNA Lac clones obtained after targeting lacZ mediated by the CRISPR-Cas system, with WT derived from the wild type. (B) Predicted recombination site sequences were determined by mapping single nucleotide polymorphism events corresponding to either upstream (gray) or downstream (black) IS elements. Three sites were predicted based on sequences conserved in both IS elements (light grey). The sites depicted are genotypes from independent clones and are representative of the Lax phenomenon observed at nine different recombination sites. Traces of chimeric IS elements were found similarly at each genomic island locus at the deletion boundary. (C) Schematic representation of IS elements predicted to undergo recombination during a chromosome deletion of the island encoding lacZ. (D) Amplicons derived from primers flanking genomic islands 1, 2, and 3 to confirm the deletion. (E) Amplicons derived from internal primers to confirm the absence of wild-type sequences in each culture with CRISPR-induced deletions. Lines marked with Δ were amplified from gDNA clones obtained after a CRISPR-Cas mediated targeting system, with WT derived from the wild type.

In FIG. 9 shows lethality targets, as well as the use of specific genetic loci to assess lethality mediated by the type II CRISPR-Cas system by targeting the genome of Streptococcus thermophilus LMD-9. Both type II orthogonal systems (CRISPR1 and CRISPR3) were tested; CRISPR1 targets are shown in dark gray and CRISPR3 targets in light gray. Specific genetic traits were selected for testing (i) intergenic regions (INT), (ii) transposable genetic elements (ISSth7, oppC-GEI1, prtS-GEI2, copA-GEI3, cI, lacZGEI4, epsU), (iii) vital genes ( dltA, ltaS), (iv) replichore poles (OriC, xerS) and forward or reverse DNA strands (external targets relative to internal targets).

In FIG. 10 shows CRISPR-mediated lethality by targeting the regions shown in FIG. 9. The logarithmic reduction in CFU (colony forming units) was calculated in relation to the transformation of the control non-self-targeted plasmid; pORI28. Lethality was within the 2-3 log reduction for all tested targets regardless of chromosomal location of the coding sequence or importance. ISSth7 - insertion sequence element, ltaS lipoteichoic acid synthase; prtS, genomic island 2; INT - intergenic region; dltA - D-alanine ligase; rheB - locus with missing chi site; oppC, genomic island 1; comS, dense locus of the chi site; xerS - end of replication; copA - genomic island 3; cI - prophage residue; OriC - start of replication; Cas9 - Cas9 coding sequence of the CRISPR3 system; epsU - exopolysaccharide cassette.

In FIG. 11 shows the transcription profiles of strains with CRISPR-mediated genomic island deletions.

In FIG. 12 shows log ₂ read coverage when sequencing transformed RNA of strains with genome island deletions, GEI1, GEI2, GEI3 and GEI4.

In FIG. 13 shows XY plots of expression values of strains with genomic island deletions (X-axes) compared to wild-type expression values (Y-axes). For each of the strains with deletions of the genomic islands (GEI1-GEI4), expression of the genes encoded on each of the target islands (black) was minimal. GEI1 encoded genes are shown in the upper left panel, GEI2 encoded genes are shown in the upper right panel, GEI3 encoded genes are shown in the lower left panel, and GEI4 encoded genes are shown in the lower right panel.

In FIG. 14A, 14B show the introduction of an exogenous phage, plasmid or phagemid encoding a CRISPR array (type II system) for co-opt endogenous systems for programmed cell death in Streptococcus thermophiles.

Fig. 15. Guides type II Lactobacillus casei. The top frame is the predicted guide. The lower left figure represents the correct crRNA:tracrRNA double guide, as confirmed by sequencing.

- 7 042506

RNA. The lower right figure is an example of a predicted artificial single strand guide.

In FIG. 16 shows exemplary type II Lactobacillus casei guides. The top frame is the predicted guide. The lower left figure represents the correct crRNA:tracrRNA double guide, as confirmed by RNA sequencing. The lower right figure is an example of a predicted artificial single strand guide.

In FIG. 17 shows exemplary type II Lactobacillus pentosus guides. The top structure is a predicted guide. The lower left figure represents the correct crRNA:tracrRNA double guide, as confirmed by RNA sequencing. The lower right figure is an example of a predicted artificial single strand guide.

In FIG. 18 shows exemplary type II Lactobacillus jensenii guides. The left panel is the correct crRNA:tracrRNA double guide, as confirmed by RNA sequencing. The right panel is an example of a predicted artificial single strand guide.

In FIG. 19 shows the results of transformation of plasmids containing a protospacer that corresponds to the highest transcribed sgRNA in a native L. gasseri type II CRISPSR array. Four different plasmids were transformed into L. gasseri (from left to right): an empty pTRK563 vector, a construct with a correct protospacer but incorrect PAM, a correct PAM but a protospacer that is not in the array, and a correct protospacer and PAM which demonstrated the highest degree of directionality of interference and cell death. Values shown are the mean ±SEM of three independent replicas.

In FIG. 20 shows the results of transformation of plasmids containing a protospacer that corresponds to the highest transcribed sgRNA in a native L. pentosus type II CRISPSR array. Four different plasmids were transformed into L. pentosus (from left to right): a construct with the correct protospacer but the wrong PAM (Lpe4 ctGttt), with the correct PAM but with a protospacer that is not in the array (Lpe8 noSPCR), an empty pTRK563 vector (pTRK563 ) and a plasmid with the correct protospacer and correct PAM (Lpe1 gttaat). Values shown are the mean ±SEM of three independent replicas.

In FIG. 21 is an exemplary CRISPR-Cas type I Lactobacillus casei guide. The sequence shown is the native type I leader and repeat found in Lactobacillus casei NCK 125. This artificial array contains a spacer that targets the 16s rDNA gene in the host genome.

In FIG. 22 shows the transformation of plasmids containing a protospacer that corresponds to the highest transcribed sgRNA in a native L. jensenii type II CRISPSR array. Four different plasmids were transformed into L. jensenii (from left to right): an empty pTRK563 vector, a construct with a correct protospacer but incorrect PAM, a correct PAM but a protospacer that is not in the array, and a correct protospacer and PAM which demonstrated the highest degree of interference targeting and cell death.

In FIG. 23 shows targeted self-destruction using a native type I system in Lactobacillus casei NCK 125. Two targets were constructed in the 16s rDNA gene. PAM 5'-YAA-3' was predicted using native spacer sequences in the body. An artificial array containing the native type I leader sequence, repeats and selected spacers was cloned into pTRK870. The constructs introduced included an empty vector (pTRK563) and two different artificial arrays: one containing one spacer targeting the +strand in the 16s gene (1-2 alt), and the other array containing the original spacer targeting the +strand, as well as an additional spacer, targeting -chain in the 16s gene (1, 2-3). Values shown are the mean ±SEM of three independent replicas.

Detailed description of the invention

The present invention is described below with reference to the accompanying drawings and examples showing embodiments of the invention. This description is not intended as a detailed description of all the different ways of implementing the invention or all the functions that can be added to the present invention. For example, features illustrated in relation to one embodiment may be included in other embodiments, and functions illustrated in relation to a particular embodiment may be removed from that embodiment. Thus, the invention contemplates that, in some embodiments, any feature or combination of features set forth herein may be omitted or omitted. Moreover, numerous variations and additions to the various embodiments provided herein will be apparent to those skilled in the art from the foregoing disclosure, and do not depart from the scope of the present invention. Therefore, the following description is intended to illustrate certain specific embodiments of the invention, and not to exhaustively define all permutations, combinations, and variations thereof.

- 8 042506

Unless otherwise defined, all technical and scientific terms used in the present description have the same meanings as they are usually understood by a person skilled in the relevant field of technology to which this invention pertains. The terminology used in the description of the present invention is only intended to describe specific embodiments and is not intended to limit the invention.

All publications, patent applications, patents and other referenced documents cited in this specification are incorporated by reference in their entirety with respect to information relating to the sentence and/or paragraph in which the reference is made.

Unless the context dictates otherwise, it is specifically contemplated that the various features of the invention described herein may be used in any combination. Moreover, the present invention also provides that in some embodiments of the invention, any feature or combination of features set forth in the present description may be excluded or omitted. For the purpose of illustration, if the description indicates that the composition contains components A, B and C, then it is specifically contemplated that any component of A, B or C or a combination thereof may be omitted and excluded individually or in any combination.

As used in the specification and the appended claims, the singular also includes the plural unless the context clearly dictates otherwise.

Also, as used herein and/or refers to any and all possible combinations of one or more related listed elements, as well as the absence of their combinations when interpreted in the alternative (or).

The term used in the present description approximately, if it refers to a measurable quantity such as a dose or a period of time, etc., refers to deviations of ±20, ±10, ±5, ±1, ±0.5%, or even ±0 .1% of the indicated amount.

As used herein, phrases such as between about X and Y and between about X and Y should be interpreted to include X and Y. As used herein, phrases such as between about X and Y mean between about X and about Y, and phrases like about X to Y mean about X to about Y.

The term contain, contains and containing, as used in the present description, defines the presence of the specified features, integers, steps, operations, elements and/or components, but does not exclude the presence or addition of one or more other functions, integers, steps, operations, elements, components and/or their groups.

As used herein, the transitional phrase consisting essentially of means that the scope of the claim is to be interpreted as covering the specified materials or steps listed in that claim, as well as those that do not significantly affect the essential and new feature( i) the claimed invention. Thus, the term consisting essentially of when used in a claim of the present invention should not be interpreted as equivalent to the term containing.

Cas9 nuclease belongs to a large group of endonucleases that catalyze the cleavage of double-stranded DNA in the CRISPR-Cas system. These polypeptides are well known in the art and many of their structures (sequences) have been characterized (see, for example, WO 2013/176772; WO 2013/188638). The domains for catalytic cleavage of double-stranded DNA are the RuvC domain and the HNH domain. The RuvC domain is responsible for breaking the (-) strand, and the HNH domain is responsible for breaking the (+) strand (see, for example, Gasiunas et al., PNAS, 109(36):E2579-E2586 (September 4, 2012)) .

As used herein, the term chimeric refers to a nucleic acid molecule or polypeptide in which at least two components are derived from different sources (eg, different organisms, different coding regions).

Complement, as used herein, may mean 100% complementarity or identity of a reference nucleotide sequence, or may mean less than 100% complementarity (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, etc. complementarity).

The terms complementary or complementarity as used herein refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base pairing. For example, the sequence A-G-T binds to the complementary sequence T-C-A. Complementarity between two single-stranded molecules may be partial, in which only some of the nucleotides bind, or may be complete, in which there is complete complementarity between single-stranded molecules. The degree of complementarity between nucleic acid strands has a significant impact on the efficiency and strength of hybridization between nucleic acid strands.

As used herein, the term contact, contacting, contacted, and its grammatical variations refers to placing the components of a desired reaction under conditions suitable for carrying out that desired reaction (e.g., integration, transformation, screening,

- 9 042506 selection, destruction, identification, amplification, etc.). Methods and conditions for carrying out such reactions are well known in the art (see, for example, Gasiunas et al. (2012), Proc. Natl. Acad. Sci.,

109:E2579-E2586; M.R. Green and J. Sambrook (2012), Molecular Cloning: A Laboratory Manual., 4th ed.,

Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

A deletion, as used herein, may include loss or deletion of genetic material, including, without limitation, deletion of a portion of a chromosome or plasmid, deletion of a gene or portion of a gene from a chromosome or plasmid. In some embodiments, the implementation of the deletion may contain one gene or more than one gene. In some embodiments, the implementation of the deletion may also contain the loss of non-coding regions of the protein, which can encode small non-coding RNA. In some embodiments, the implementation of the deletion may include the loss of the entire plasmid or the entire transposable genetic element. In some embodiments, the loss of a transposable genetic element can be defined as, for example, the lack of the ability to replicate or persist.

In some embodiments, a phasmid of the invention may comprise a CRISPR array of CRISPR-Cas system type I, CRISPR-Cas system type II, CRISPR-Cas system type III, CRISPR-Cas system type IV, and/or CRISPR-Cas system type V (see ., Makarova et al., Nature Reviews Biotechnology, 13:722736 (2015)).

Thus, in some embodiments, in addition to the type I sgRNA, the phasmid of the invention may contain type I polypeptides and/or type I Cascade polypeptides (ie, type I CRISPR-Cas system).

As used herein, the term type I polypeptide refers to any of a Cas3 polypeptide, a Cas3' polypeptide, a Cas3 polypeptide, recombinant variants thereof, and any one or more of the antiviral polypeptide complex (Cascade) associated with type I short palindromic repeats (CRISPR) . Thus, the term type I polypeptide refers to polypeptides that make up the CRISPR-Cas system type I-A, CRISPR-Cas system type I-B, CRISPR-Cas system type I-C, CRISPR-Cas system type I-D, CRISPR-Cas system type I-E, CRISPR-Cas system type I-F and/or CRISPR-Cas system type I-U. Each type I CRISPR-Cas system contains at least one Cas3 polypeptide. Cas3 polypeptides typically contain both a helicase domain and an HD domain. However, in some type I CRISPR-Cas systems, the helicase and the HD domain reside in separate polypeptides, Cas3' and Cas3. In particular, Cas3' encodes a helicase domain while Cas3 encodes an HD domain. Therefore, since both regions are required for Cas3 to function, type I subtypes either encode Cas3 (I-C, I-D, I-E, I-F, I-U) or Cas3' and Cas3 (I-A, I-B).

As used herein, the term Cascade type I polypeptides refers to a complex of polypeptides involved in pre-crRNA processing and subsequent binding to a target DNA in Type I CRISPR-Cas systems. These polypeptides include, without limitation, Cascade polypeptides of subtypes I-A, I-B, I-C, I-D , I-E and I-F type I. Non-limiting examples of Cascade type I-A polypeptides include Cas7 (Csa2), Cas8al (Csx13), Cas8a2 (Csx9), Cas5, Csa5, Cas6a, Cas3' and/or Cas3. Non-limiting examples of Cascade type I-B polypeptides include Cas6b, Cas8b (Csh1), Cas7 (Csh2), and/or Cas5. Non-limiting examples of Cascade type I-C cascade polypeptides include Cas5d, Cas8c (Csd1) and/or Cas7 (Csd2). Non-limiting examples of Cascade type I-D cascade polypeptides include Cas10d (Csc3), Csc2, Csc1 and/or Cas6d. Non-limiting examples of Cascade type I-E polypeptides include Cse1 (CasA), Cse2 (CasB), Cas7 (CasC), Cas5 (CasD), and/or Cas6e (CasE). Non-limiting examples of Cascade type I-F polypeptides include Cys1, Cys2, Cas7 (Cys3) and/or Cas6f (Csy4). Non-limiting examples of Cascade type I-U polypeptides include Cas8c, Cas7, Cas5, Cas6 and/or Cas4.

In some embodiments, the phasmid of the invention may contain a type II CRISPR-Cas system in addition to type II sgRNA. Type II CRISPR-Cas systems contain three subtypes: type II-A, type II-B and type II-C, each of which contains the Cas9 multidomain protein in addition to the adaptive Cas1, Cas2 and optionally Csn2 and/or Cas4 polypeptides. Most type II loci also encode for esgRNA. Organisms containing typical type II CRISPR-Cas systems include strains of Legionella pneumophila Paris, Streptococcus thermophilus CNRZ1066 and Neisseria lactamica 020-06.

In further embodiments, the phasmid of the invention may comprise a type III CRISPR-Cas system in addition to type III sgRNA. Like CRISPR-Cas systems of type I, in systems of type III, processing and interference are carried out with the participation of multiprotein effector complexes CRISPR RNA (sgRNA) (Makarova et al., Nature Reviews Biotechnology, 13:722736 (2015)) - CASCADE in type I and Csm or Cmr in type III. Thus, in some embodiments, a type III CRISPR-Cas system may comprise a Csm complex (eg, type III-A Csm) and/or a Cmr complex (eg, type III-B Cmr) and optionally a Cas6 polypeptide. In exemplary embodiments, the Csm complex may comprise the Cas10 (or Csm1), Csm2, Csm3, Csm4, Csm5, and Csm6 polypeptides, and the Cmr complex may comprise the Cmr1, Cas10 (or Cmr2), Cmr3, Cmr4, Cmr5, and Cmr6 polypeptides. In addition to the Csm complex or the CRISPR-Cas Cmr complex, the type III system may also contain a Cas7 polypeptide. Four subtypes of the type III CRISPR-Cas system have been characterized: III-A, III-B, III-C, III-D. In some embodiments, the Type III-A CRISPR-Cas system contains polypeptides

- 10 042506

Cas6, Cas10, Csm2, Cas7 (Csm3), Cas5 (Csm4), Cas7 (Csm5), and Csm6. In some embodiments, the Type III-B CRISPR-Cas system comprises the Cas7 (Cmr1), Cas10, Cas5 (Cmr3), Cas7 (Cmr4), Cmr5, Cas6, and Cas7 (Cmr6) polypeptides. In some embodiments, the Type III-C CRISPR-Cas system comprises the Cas7 (Cmr1), Cas7 (Cmr6), Cas10, Cas7 (Cmr4), Cmr5, and Cas5 (Cmr3) polypeptides. In some embodiments, the Type III-D CRISPR-Cas system comprises the Cas10, Cas7 (Csm3), Cas5 (CsxlO), Csm2, Cas7 (Csm3), and all1473 polypeptides.

In some embodiments, the phasmid of the invention may comprise a type IV CRISPR-Cas system in addition to type IV sgRNA. Type IV CRISPR-Cas systems may contain a Csf4 (dinG) polypeptide and/or a Csf1, Cas7 (Csf2) and/or Cas5 (csf3) polypeptide. (Makarova et al., Nature Reviews Microbiology, 13:722-736 (2015)).

In some embodiments, the phasmid of the invention may further comprise a type V CRISPR-Cas system in addition to type V sgRNA. The type V CRISPR-Cas systems may comprise a Cpf1 polypeptide and/or a Cas1, Cas2 and/or Cas4 polypeptide. (Makarova et al., Nature Reviews Microbiology, 13:722-736 (2015)).

A fragment or part of a nucleotide sequence according to the invention should be understood as a nucleotide sequence of reduced length (for example, reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20 or more nucleotides) relative to a reference nucleic acid sequence or a nucleotide sequence containing, essentially consisting of and/or consisting of a nucleotide sequence of adjacent nucleotides that are identical or substantially identical (e.g., 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%) of the reference nucleic acid or nucleotide sequence. Such a fragment or portion of a nucleic acid according to the invention may optionally be included in a larger polynucleotide of which said fragment or portion is a part. Thus, hybridizing with (or hybridizing with, and other grammatical variations of this expression), for example, at least part of the target DNA (for example, a target region in the genome) refers to hybridization with a nucleotide sequence that is identical or substantially identical in length of adjacent nucleotides of the target DNA. In some embodiments, a repeat of a spacer-repeat sequence or a repeat-spacer-repeat sequence may comprise a wild-type CRISPR locus repeat sequence fragment or a synthetic CRISPR array repeat sequence fragment, wherein the repeat fragment retains the function of the repeat in the CRISPR array - hybridization to the tracr nucleic acid.

In some embodiments, the implementation of the invention may contain a functional fragment of the nuclease Cas9, Cas3, Cas3', Cas3 or Cpf1. A functional Cas9 fragment retains one or more native Cas9 nuclease activities, including, but not limited to, HNH nuclease activity, RuvC nuclease activity, DNA, RNA, and/or PAM recognition and binding activities. A functional Cas9 nuclease fragment may be encoded by a Cas9 polynucleotide fragment. A functional fragment of Cas3, Cas3', or Cas3 retains one or more of the activities of the native Cas9 nuclease, including, without limitation, nickase activity, exonuclease activity, DNA binding, and/or RNA binding. A functional Cas3, Cas3' or Cas3 nuclease fragment may be encoded by a Cas3, Cas3' or Cas3 polynucleotide fragment, respectively.

As used herein, the term gene refers to a nucleic acid molecule that can be used to produce mRNA, antisense RNA, RNA1 (miRNA, siRNA, shRNA), anti-miRNA, antisense oligodeoxyribonucleotide (AMO), and the like. Genes may or may not be used to produce a functional protein or gene product. Genes may include both coding and non-coding regions (eg, introns, regulatory elements, promoters, enhancers, terminal sequences, and/or 5' and 3' untranslated regions). A gene may be isolated, which means a nucleic acid that contains substantially or substantially no components that are normally associated with that nucleic acid in its natural state. Such components include other cellular material, culture medium from recombinant production, and/or various chemicals used in the chemical synthesis of the nucleic acid.

As used herein, the term genome includes the chromosomal/nuclear genome of an organism, as well as any mitochondrial and/or plasmid genome.

As used herein, the term hairpin sequence is a nucleotide sequence containing hairpins (eg, which forms one or more hairpin structures). A hairpin (eg, stem-loop, in-self conjugation) refers to a nucleic acid molecule having a secondary structure that includes a region of complementary nucleotides forming a double strand, which is further flanked on both sides by single-stranded regions. Such structures are well known in the art. As is known in the art, a double-stranded region may contain some mismatch in base pairing or may be perfectly complementary. In some embodiments of the present

The hairpin sequence of the nucleic acid construct may be located at the 3' end of the tracr nucleic acid.

A heterologous or recombinant nucleotide sequence is a nucleotide sequence not naturally associated with the host cell into which it is introduced, including unnaturally numerous copies of the natural nucleotide sequence.

Various nucleic acids or proteins having homology are referred to herein as homologues. The term homologue includes homologous sequences from the same and other species and orthologous sequences from the same and other species. Homology refers to the level of similarity between two or more nucleic acid and/or amino acid sequences, expressed as a percentage of positional identity (ie sequence similarity or identity). Homology also refers to the concept of similar functional properties between different nucleic acids or proteins. Thus, the compositions and methods of the invention further include homologues of the nucleotide sequences and polypeptide sequences of the invention. Orthologous, as used herein, refers to homologous nucleotide sequences and/or amino acid sequences across species that arose from a common ancestor gene during speciation. A nucleotide sequence homologue of the present invention has significant sequence identity (e.g., at least about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86 , 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and/or 100%) with the specified nucleotide sequence according to the invention. For example, a homologue of a type I, type II, type III, type IV, or type V polynucleotide or polypeptide may be about 70% or more homologous to any known or later identified type I, type II, type III, type IV polynucleotide or polypeptide. or type V.

As used herein, hybridization, hybridize, hybridize, and grammatical variants thereof refer to the linking of two fully complementary nucleotide sequences, or substantially complementary sequences, in which some mismatched base pairs may be present. Hybridization conditions are well known in the art and vary depending on the length of the nucleotide sequences and the degree of complementarity between the nucleotide sequences. In some embodiments, hybridization conditions may be very stringent, or they may be of medium stringency or low stringency, depending on the degree of complementarity and the length of the sequences to be hybridized. Conditions that refer to conditions of low, medium, and high stringency of hybridization of nucleotide sequences are well known in the art (see, e.g., Gasiunas et al. (2012), Proc. Natl. Acad. Sci., 109:E2579-E2586; M.R. Green and J. Sambrook (2012), Molecular Cloning: A Laboratory Manual., 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

As used herein, increase, increase, increase, enhance, increase, enhance, and improve (and their grammatical variants) describe an increase of at least about 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500%, or more than control.

A native or wild-type nucleic acid, nucleotide sequence, polypeptide or amino acid sequence refers to a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide or amino acid sequence. For example, wild-type mRNA is mRNA that occurs naturally in the body or is endogenous. A homologous nucleic acid sequence is a nucleotide sequence naturally associated with the host cell into which it is introduced.

Also used herein, the terms nucleic acid, nucleic acid molecule, nucleic acid construct, nucleotide sequence, and polynucleotide refer to RNA or DNA that is linear or branched, single or double stranded, or hybrid. This term also includes RNA/DNA hybrids. When dsRNA is produced synthetically, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, and others can also be used for antisense dsRNA and ribozyme pairing. For example, polynucleotides containing C-5-propyne analogs of uridine and cytidine have been shown to bind to RNA with high affinity and are potent antisense inhibitors of gene expression. Other modifications, such as modification of the phosphodiester backbone, or the 2'-hydroxy in the RNA ribose sugar group, are also possible. The nucleic acid constructs of the present invention may be DNA or RNA, but are preferably DNA. Thus, while the nucleic acid constructs of the present invention may be described and used in the form of DNA, depending on the intended use, they may also be described and used in the form of RNA.

As used herein, the term nucleotide sequence refers to a heteropolymer of nucleotides or a sequence of these nucleotides in the direction from the 5' to the 3' end of a nucleic acid molecule and includes DNA or RNA molecules, including cDNA, fragment or portion of DNA, genomic DNA, synthetic (eg, chemically synthesized) DNA, plasmid DNA, mRNA, and antisense RNA, any of which may be single-stranded or double-stranded. The terms nucleotide sequence, nucleic acid, nucleic acid molecule, oligonucleotide, and polynucleotide are also used interchangeably herein to refer to a heteropolymer of nucleotides. Unless otherwise indicated, the nucleic acid molecules and/or nucleotide sequences provided herein are given in the 5'-3' direction from left to right and are presented as a standard code for representing nucleotides as symbols as specified in the US Sequence Rules. 37 CFR 1.821-1.825 and ST.25 of the World Intellectual Property Organization (WIPO).

As used herein, the term percent sequence identity or percent identity refers to the percentage of identical nucleotides in the linear polynucleotide sequence of a reference (query) polynucleotide molecule (or its complementary strand) compared to a test (test) polynucleotide molecule (or its complementary strand) when two sequences are aligned optimally. In some embodiments, percent identity may refer to the percentage of identical amino acids in an amino acid sequence.

A protospacer sequence refers to a double-stranded target DNA, and more specifically, a portion of a target DNA (e.g., a target region in the genome) that is wholly or substantially complementary to (and hybridizes with) a repeat-spacer spacer sequence of CRISPR repeat-spacer sequences , CRISPR repeat-spacer-repeat sequences and/or CRISPR array.

As used herein, the terms reduce, diminish, reduce, decrease, decrease, suppress, and reduce (and their grammatical variants) describe, for example, a decrease of at least about 5, 10, 15, 20, 25, 35, 50, 75, 80, 85, 90, 95, 97, 98, 99 or 100% compared to control. In specific embodiments, the reduction may result in no or substantially no (i.e., negligible amount, e.g., less than about 10% or even 5%) of detectable activity or amount of measurable component (e.g., cell population or genome size). Thus, for example, a reduced genome size may mean a reduction in genome size of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. compared with control.

As used herein, a control may be, for example, a population of bacterial, archaeal, algal, or yeast cells that have not been transformed with the heterologous nucleic acid construct of the present invention. In some embodiments, the control may be a wild-type population of bacterial, archaeal, algal, or yeast cells, or it may be a population of bacterial, archaeal, or yeast cells transformed with a heterologous construct containing a CRISPR array that contains a repeat-spacer-repeat sequence or at least at least one repeat-spacer sequence, wherein the spacer contains a nucleotide sequence that is not a complementary target region in the genome of the bacterial, archaeal, or yeast cells of said population (i.e., a non-self-targeted/scrambled spacer). In additional aspects, the control may be, for example, a population of wild-type bacterial, archaeal, algal, or yeast cells, or a population of bacterial, archaeal, algal, or yeast cells transformed with a heterologous construct containing a CRISPR array that contains a repeat-spacer-repeat sequence, or at least one repeat-spacer sequence, wherein the spacer contains a nucleotide sequence that is substantially complementary to a target region in the genome of said population of bacterial, archaeal, algal, or yeast cells that is not located in close proximity to the protospacer adjacent motif (PAM) .

As used herein, a repeat sequence refers to, for example, any wild-type CRISPR locus repeat sequence or a synthetic CRISPR array repeat sequence that is separated by a spacer sequence (e.g., repeat-spacer sequence or repeat-spacer-repeat sequence of the invention). The repeat sequence used in the present invention may be any known or later identified repeat sequence of the CRISPR locus. Accordingly, in some embodiments, the repeat-spacer or repeat-spacer-repeat sequence comprises a repeat that is substantially identical (e.g., at least about 70% identical (e.g., at least about 70, 71, 72, 73, 74 identical). , 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 % or more)) repeat from wild-type type II CRISPR array. In some embodiments, the repeat sequence is 100% identical to a repeat from a wild-type CRISPR type I array, a wild-type CRISPR type II array, a wild-type CRISPR type III array, a wild-type CRISPR type IV array, or a wild-type CRISPR type V array. In additional embodiments, the repeat sequence used in the present invention may comprise a nucleotide sequence comprising a partial repeat, which is a fragment or portion of consecutive nucleotides of the repeat sequence of the CRISPR locus or synthetic CRISPR array of any of type I sgRNA, type II sgRNA , type III ssRNA, type IV ssRNA, or type V ssRNA.

As used herein, the term CRISPR array CRISPR-Cas system type I, type II, type III, type IV, or type V refers to a nucleic acid construct that contains a repeat-spacer-repeat sequence in the 5'-3' direction or contains a 5 '-3' direction of at least one repeat-spacer sequence (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, or 25 repeat-spacer sequences and any range or number within that range). When a CRISPR array contains more than one repeat-spacer, the spacer of the previous (5'-3') sequence repeat-spacer may be associated with the repeat of the subsequent repeat-spacer (e.g., the spacer of the first repeat-spacer sequence is associated with the repeat of the second repeat-spacer sequence ). In some embodiments, the CRISPR array may contain two repeats (or two partial repeats) separated by a spacer (eg, a repeat-spacer-repeat sequence).

As used herein, the term sequence identity refers to the degree to which two optimally aligned polynucleotide or peptide sequences are invariant across the window of component alignment, eg, nucleotides or amino acids. Identity can be easily calculated by known methods, including, without limitation, those described in Computational Molecular Biology [Computational Molecular Biology] (Lesk, A.M., ed.), Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D.W., ed.), Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A.M., Griffin, H.G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology Sequence [Analysis in Molecular Biology] (von Heinje, G., ed.) Academic Press (1987); and Introduction to Sequence Analysis Primer (Gribskov, M., Devereux, J., eds.), Stockton Press, New York (1991).

A spacer sequence, as used herein, is a nucleotide sequence that is complementary to a target DNA (ie, a target region in the genome or a protospacer sequence) that is adjacent to a protospacer adjacent motif (PAM) sequence. The spacer sequence may be fully complementary or substantially complementary (e.g., at least about 70% complementary (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more)) DNA targets. In typical embodiments, the spacer sequence has 100% complementarity to the target DNA. In additional embodiments, the complementarity of the 3' region of the spacer sequence with the target DNA is 100%, but less than 100% with the 5' region of the spacer, and therefore the total complementarity of the spacer sequence with the target DNA is less than 100%. So, for example, the first 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, etc. nucleotides in the 3' region of a 20 nucleotide spacer sequence (seed sequence) may be 100% complementary to the target DNA, while the remaining nucleotides in the 5' region of the spacer sequence are substantially complementary (e.g., at least , approximately 70% complementary) target DNA. In some embodiments, the first 7-12 nucleotides of the spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 5' region of the spacer sequence are substantially complementary (e.g., at least about 70% complementary). ) target DNA. In other embodiments, the first 7-10 nucleotides of the spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 5' region of the spacer sequence are substantially complementary (e.g., at least about 70% complementary) target DNA. In typical embodiments, the first 7 nucleotides (within the seed) of the spacer sequence may be 100% complementary with the target DNA, while the remaining nucleotides in the 5' region of the spacer sequence are substantially complementary (e.g., at least about 70% complementary). complementary) target DNA.

As used herein, the term DNA target, target region, or target region in the genome refers to a region of the genome in an organism that is fully complementary or substantially complementary (e.g., at least 70% complementary (e.g., 70, 71, 72 , 73, 74, 75, 76, 77, 78, 79, 80, 81, 82%, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more)) of a spacer sequence in a repeat-spacer or repeat-spacer-repeat sequence. In some embodiments, the target region may be from about 10 to about 40 consecutive nucleotides in length immediately adjacent to a PAM sequence (the PAM sequence located immediately after the 3' target region) in the genome of an organism (e.g., CRISPR-Cas systems type I and CRISPR-Cas type II). In some

- 14 042506 embodiments, for example, in type I systems, the PAM is on the opposite side of the protospacer (5' end). For Type III systems, PAM is not known. Makarova et al. describe the nomenclature for all classes, types and subtypes of CRISPR systems (Nature Reviews Microbiology, 13:722-736 (2015)).

Guide and PAM structures are described in R. Barrangou (Genome Biol., 16:247 (2015)).

In some embodiments, the target region used in the present invention is within a vital gene or a non-essential gene.

In exemplary embodiments, the target region may be randomly selected or may be specifically selected. In some embodiments, a randomly selected target region can be selected from any of at least 10 consecutive nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 , 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 , 49, 50, etc., and any range or value within this range) located in close proximity to a PAM sequence in the genome of bacteria, archaea, algae, or yeast. In some embodiments, the target region may be from about 10 to about 20 contiguous nucleotides, from about 10 to about 30 contiguous nucleotides, and/or from about 10 to about 40 contiguous nucleotides, and the like. or in any range or at any value within this range, located in close proximity to the protospacer adjacent motif (PAM) sequence in the genome of bacteria, archaea, algae or yeast. In some embodiments, a particular selection of a target region may include selecting two or more target regions that are spaced apart from each other by about every 100 nucleotides to about every 1000 nucleotides, from about every 100 nucleotides to about every 2000, from about every 100 nucleotides to about every 3000, from about every 100 nucleotides to about every 4000 and/or from about every 100 nucleotides to about every 5000 nucleotides, and the like. in the genome of one or more bacteria, archaea, algae, or yeast cells. In specific embodiments, the specific selection of a target region comprises a specific selection of a target region from a gene, an open reading frame, a putative open reading frame, or an intergenic region containing at least about 10 to about 40 contiguous nucleotides immediately adjacent to a PAM sequence in the genome. bacteria, archaea, algae or yeast.

A trans-activating CRISPR (tracr) nucleic acid or tracr nucleic acid as used herein refers to any tracr RNA (or DNA encoding it). The Tracr nucleic acid contains in the 5'-3' direction a lower stem, an upper stem, a bulge, a central hairpin, and terminal hairpins (see Briner et al. (2014), Molecular Cell., 56(2):333-339). A CRISPR transactivating (tracr) nucleic acid functions by hybridizing to a repetitive portion of mature or immature ssRNAs, recruits the Cas9 protein to the target site, and can promote Cas9 catalytic activity by inducing a structural rearrangement. The functional composition of tracrRNA molecules is given above. The tracrRNA sequences are specific to the CRISPR-Cas system and may vary. Any known or later identified nucleic acid can be used in the present invention.

As used herein, the term substantially identical or substantial identity, in the context of two nucleic acid molecules, nucleotide sequences, or protein sequences, refers to two or more sequences or subsequences that are at least about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and/or 100% nucleotide or amino acid residue identity when compared and aligned for maximum match, as measured by one of the following sequence comparison algorithms or by visual inspection. In some embodiments of the invention, significant identity exists in a region of sequences that is at least about 50 residues to about 150 residues in length. Thus, in some embodiments of the invention, significant identity exists in a sequence range that is at least 3 to 15 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 , 15 residues in length, etc., or any value or any range of these values), from at least about 5 to about 30, from at least about 10 to about 30, from at least about 16 to about 30, at least about 18 to about 25, at least about 18, at least about 22, at least about 25, at least about 30, at least about 40, at least about 50, about 60, about 70 , about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150 or more residues in length and in any specified range. In typical embodiments, the sequences may be substantially identical within at least about 22 nucleotides. In some specific embodiments, the sequences are substantially identical within at least about 150 residues. In some embodiments, the sequences of the invention may be from about 70% to about 100% identical within at least about 16 nucleotides to about 25 nucleotides. In some embodiments, the sequences of the invention may be from about 75% to about 100% identical within the range of at least about 16 nucleotides to about 25 nucleotides. In some embodiments, the sequences of the invention may be from about 80% to about 100% identical within at least about 16 nucleotides to about 25 nucleotides. In some embodiments, the sequences of the invention may be from about 80% to about 100% identical within the range of at least about 7 nucleotides to about 25 nucleotides. In some embodiments, the sequences of the invention may be about 70% identical within at least about 16 nucleotides. In other embodiments, the sequences may be about 85% identical within about 22 nucleotides. In other embodiments, the sequences may be about 100% identical within about 16 nucleotides. In another embodiment, the sequences are substantially identical throughout the length of the coding region. In addition, in exemplary embodiments, substantially identical nucleotide or polypeptide sequences perform essentially the same function (e.g., function or activity of ssRNA, tracr nucleic acid, repeat sequence, Cas9 nuclease (nickase, recognition and binding of DNA, RNA, and/ or PAM), Cas3, Cas3', Cas3 or any other CRISPR-Cas polynucleotide or polypeptide).

When comparing sequences, typically one sequence acts as a reference sequence against which test sequences are compared. When a sequence comparison algorithm is used, test and reference sequences are entered into a computer, subsequence coordinates are designated if necessary, and program parameters for the sequence comparison algorithm are set. Then, using this sequence comparison algorithm, the percent identity of the test sequence(s) relative to the reference sequence is calculated based on the given program parameters.

Optimal sequence alignment, the comparison window for alignment is well known to those skilled in the art and can be performed using tools such as the Smith and Waterman local homology algorithm, the Needleman and Wunsch homology region alignment algorithm, the Pearson and Lipman similarity search method, and optionally help implement these algorithms in computer programs such as GAP, BESTFIT, FASTA, and TFASTA, which are available as part of the GCG® Wisconsin Package® (Accelrys Inc., San Diego, CA). The proportion of identity for aligned segments of a test sequence and a reference sequence is the number of identical components that are common to two aligned sequences divided by the total number of components in the segment of the reference sequence, i.e. the entire reference sequence or less than a certain part of the reference sequence. Percent sequence identification is expressed as fraction of identity multiplied by 100. Comparison of one or more polynucleotide sequences can be performed against the full length polynucleotide sequence or a portion thereof, or a longer polynucleotide sequence. For the purposes of the present invention, percent identity can also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.

Software for performing BLAST analyzes is publicly available at the National Center for Biotechnology Information. This algorithm involves first identifying high score sequence pairs (HSPs) by identifying short words of length W in the requested sequence that either match or satisfy some positive threshold T when aligned with a word of the same length in the database sequence. T is called the word similarity score threshold (Altschul et al., 1990). These initial matches of the original words act as seeds to start searching for longer HSPs containing them. The word hits are then expanded in both directions along each sequence to the extent that the overall alignment score can be increased. The cumulative score is calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues, always >0) and N (penalty score for mismatched residues, always <0). For amino acid sequences, a score matrix is used to calculate the cumulative score. The expansion of word hits in each direction stops when the cumulative alignment score decreases by X from its maximum achieved value, the cumulative score is reduced to zero or falls below due to the accumulation of one or more negative-scoring residual alignments, or when the end of any sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) defaults to word length (W) 11, expectation (E) 10, cutoff 100, M=5, N=4, and comparison of both strands. For amino acid sequences, the BLASTP program defaults to a word length (W) of 3, an expectation value (E) of 10, and a scoring matrix of BLOSUM62 (see Henikoff & Henikoff, Proc. Natl.

Acad. Sci., USA, 89:10915 (1989)).

In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, for example, Karlin & Altschul, Proc. Nat'l. Acad. Sci., USA, 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum of probabilities (P(N)), which indicates the probability that two nucleotide or amino acid sequences can match by chance. For example, a test nucleic acid sequence is considered a match with a reference sequence if the smallest sum of probabilities when comparing the test nucleotide sequence with the reference nucleotide sequence is less than about 0.1 to less than about 0.001. Thus, in some embodiments of the invention, the smallest sum of probabilities when comparing a test nucleotide sequence with a reference nucleotide sequence is less than about 0.001.

Two nucleotide sequences can also be considered substantially complementary when the two sequences hybridize to each other under stringent conditions. In some exemplary embodiments, two nucleotide sequences that are substantially complementary hybridize to each other under very stringent conditions.

Stringent hybridization conditions and stringent hybridization wash conditions in the context of nucleic acid hybridization experiments such as Northern hybridization and Southern hybridization are sequence dependent and differ in various environmental parameters. A detailed guide to nucleic acid hybridization can be found in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, part I, chapter 2, Overview of principles of hybridization and the strategy of nucleic acid probe assays, Elsevier, New York (1993 ). Typically, very stringent hybridization and washing conditions are chosen such that the temperature is about 5° C. lower than the melting point (T _m ) for a particular sequence at a particular ionic strength and pH.

_Tm is the temperature (at a given ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are chosen equal to the value of T _m for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleotide sequences that have more than 100 complementary filter residues in Southern or Northern blot analysis is 50% formamide with 1 mg heparin at 42°C, with hybridization carried out overnight. An example of very stringent washing conditions is 0.15 M NaCl at 72° C. for about 15 minutes. An example of stringent washing conditions is washing with 0.2x SSC at 65° C. for 15 min (see Sambrook, infra, description of SSC buffer). Often, before washing under very severe conditions, a wash under conditions of low severity is performed to remove the background signal of the probe. An example of a medium stringency wash for a duplex of, for example, over 100 nucleotides is 1xSSC at 45°C for 15 minutes. An example of a low stringency wash for a duplex of eg over 100 nucleotides is 4-6xSSC at 40°C for 15 minutes. For short probes (eg, about 10 to 50 nucleotides), stringent conditions typically include salt concentrations of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ions (or other salts) at pH 7.0-8.3, and the temperature is usually at least about 30°C. Stringent conditions can also be achieved by adding destabilizing agents such as formamide. In general, a signal-to-noise ratio greater than 2 (or more) times that observed for an unbound probe in a particular hybridization assay indicates the detection of specific hybridization. Nucleotide sequences that do not hybridize to each other under stringent conditions are substantially identical if the proteins they encode are substantially identical. This is possible, for example, when a copy of the nucleotide sequence is created using the maximum number of degenerate codons allowed by the genetic code.

The following are examples of hybridization/wash condition sets that can be used to clone homologous nucleotide sequences that are substantially identical to the reference nucleotide sequences of the invention. In one embodiment, a reference nucleotide sequence is hybridized to a test nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50°C with a wash in 2x SSC, 0.1% SDS at 50° WITH. Alternatively, the reference nucleotide sequence is hybridized to a test nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50° C. with a wash in 1x SSC, 0.1% SDS at 50° C. or in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50°C with a wash in 0.5x SSC, 0.1% SDS at 50°C. In another embodiment, the reference nucleotide sequence is hybridized to a test nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50° C. with a wash in 0.1x SSC, 0.1% SDS at 50° C. or in 7% sodium dodecyl sulfate (SDS),

- 17 042506

0.5 M NaPO ₄ , 1 mM EDTA at 50°C with washing in 0.1x SSC, 0.1% SDS at 65°C.

Any nucleotide sequence and/or heterologous nucleic acid construct of the present invention can be codon optimized for expression in any species of interest. Codon optimization is well known in the art and involves modifying a nucleotide sequence to bias codon usage using species-specific codon usage tables. Codon usage tables are generated based on sequence analysis of the highest expressed genes for the species of interest. If nucleotide sequences are to be expressed in the nucleus, codon usage tables are generated based on analysis of the highest expressed nuclear gene sequences for the species of interest. Nucleotide sequence modifications are determined by comparing the species-specific codon usage table with codons present in native polynucleotide sequences. As is understood in the art, codon optimization of a nucleotide sequence results in a nucleotide sequence having less than 100% identity (e.g., 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, etc.) with a native nucleotide sequence, but which is still encodes a polypeptide having the same function as the polypeptide encoded by the original native nucleotide sequence. Thus, in exemplary embodiments of the invention, the nucleotide sequence and/or heterologous nucleic acid construct of the present invention can be codon-optimized for expression in particular species of interest.

In some embodiments, heterologous or recombinant nucleic acid molecules, nucleotide sequences and/or polypeptides of the invention are isolated. An isolated nucleic acid molecule, an isolated nucleotide sequence, or an isolated polypeptide is a nucleic acid molecule, nucleotide sequence, or polypeptide that, as a result of human intervention, exists separately from its native environment and, therefore, is not a product of nature.

An isolated nucleic acid molecule, nucleotide sequence, or polypeptide may exist in a purified form that is at least partially separated from at least some other components of a naturally occurring organism or virus, such as cellular or viral building blocks or other polypeptides or nucleic acids that are normally associated with this polynucleotide. In typical embodiments, the isolated nucleic acid molecule, the purity of the isolated nucleotide sequence and/or the isolated polypeptide is at least about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95% or greater.

In other embodiments, the isolated nucleic acid molecule, nucleotide sequence, or polypeptide may exist in a non-natural environment, such as, for example, a recombinant host cell. Thus, for example, in relation to nucleotide sequences, the term isolated means that the nucleotide sequence is separated from the chromosome and/or cell in which it occurs naturally. A polynucleotide is also isolated if it has been separated from the chromosome and/or cell in which it occurs naturally and then inserted into a genetic context, chromosome and/or cell in which it does not occur naturally (for example, another cell- host, different regulatory sequences, and/or different position in the genome from the natural position). Accordingly, heterologous nucleic acid constructs, nucleotide sequences, and the polypeptides they encode are human-derived in the sense that they exist apart from their native habitat and therefore are not products of nature, however, in some embodiments, they can be introduced and exist in recombinant host cell.

In some embodiments, the heterologous or recombinant nucleic acid constructs of the invention are synthetic. A synthetic nucleic acid molecule, synthetic nucleotide sequence, or synthetic polypeptide is a nucleic acid molecule, nucleotide sequence, or polypeptide that does not occur in nature but is man-made and therefore is not a product of nature.

In any of the embodiments disclosed herein, the nucleotide sequences and/or heterologous nucleic acid constructs of the invention may be operably linked to various promoters and other regulatory elements for expression in various cells of organisms. Thus, in exemplary embodiments, the nucleic acid construct of the present invention may further comprise one or more promoters operably linked to one or more nucleotide sequences.

By operably linked or operably associated, as used herein, is meant that these elements are operably linked to one another, and also typically physically linked. Thus, the term operably linked or operably associated, as used herein, refers to nucleotide sequences

- 18 042506 values in one nucleic acid molecule that are functionally linked. Thus, a first nucleotide sequence that is operably linked to a second nucleotide sequence means the situation where the first nucleotide sequence is placed in a functional relationship with the second nucleotide sequence. For example, a promoter is operably linked to a nucleotide sequence if the promoter affects the transcription or expression of said nucleotide sequence. Those skilled in the art will appreciate that regulatory sequences (eg, a promoter) need not be contiguous with the nucleotide sequence to which they are operably linked, as long as those regulatory sequences function to direct its expression. For example, between the promoter and the nucleotide sequence there may be intermediate untranslated but transcribed sequences, and the promoter can be considered to be operably linked to the nucleotide sequence.

A promoter is a nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (ie, a coding sequence) that is operably linked to a promoter. The coding sequence may encode a polypeptide and/or a functional RNA. Typically, a promoter refers to a nucleotide sequence that contains a binding site for RNA polymerase II and controls the initiation of transcription. Generally, promoters are located 5' or upstream of the start of the coding region of the respective coding sequence. The promoter region may contain other elements that function as regulators of gene expression. These include the TATA-box consensus sequence and often the CAAT-box consensus sequence (Breathnach and Chambon, (1981) Annu. Rev. Biochem., 50:349). In plants, the CAAT box can be replaced by an AGGA box (Messing et al. (1983), in Genetic Engineering of Plants, T. Kosuge, C. Meredith and A. Hollaender (eds.), Plenum Press, p. 211-227 ).

Promoters may include, for example, constitutive, inducible, transiently regulated, developmentally regulated, chemically regulated, tissue-preferred and/or tissue-specific promoters that are used in constructing heterologous nucleic acid constructs, i.e. chimeric genes; or chimeric polynucleotides. These various types of promoters are known in the art.

The choice of promoter will depend on the temporal and spatial requirements for expression as well as the host cell to be transformed. Promoters for many different organisms are well known in the art. Based on the extensive knowledge in the art, an appropriate promoter can be selected for a particular host organism of interest. Thus, for example, a great deal of knowledge is available about promoters upstream of highly constitutively expressed genes in model organisms, and such knowledge is readily available and can be applied to other systems if desired.

In some embodiments, a nucleic acid construct of the invention may be an expression cassette or may be included in an expression cassette. As used herein, the term expression cassette means a heterologous nucleic acid construct comprising a nucleotide sequence of interest (e.g., nucleic acid constructs of the invention (e.g., synthetic tracr nucleic acid construct, CRISPR synthetic nucleic acid construct, CRISPR synthetic array, chimeric nucleic acid construct, a nucleotide sequence encoding a polypeptide of interest, a type I polypeptide, a type II polypeptide, a type III polypeptide, a type IV polypeptide, and/or a type V polypeptide)) wherein said nucleotide sequence is operably linked to at least a regulatory sequence (e.g., a promoter) . Thus, certain aspects of the invention provide expression cassettes for expressing the nucleotide sequences of the invention.

The expression cassette containing the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cassette can also be one that occurs naturally but has been made in a recombinant form suitable for heterologous expression.

The expression cassette may also optionally include a transcription and/or translation termination region (ie, a termination region) that is functional in the selected host cell. Various transcription terminators are available for use in expression cassettes and are responsible for terminating transcription beyond the heterologous nucleotide sequence of interest and correct mRNA polyadenylation. The termination region may be native to the transcriptional initiation region, may be native to the operably linked nucleotide sequence of interest, may be native to the host cell, or may be derived from another source (i.e., foreign or heterologous to the promoter of interest). nucleotide sequence, host, or any combination thereof

- 19 042506 nation).

The expression cassette may also include a nucleotide sequence for a selectable marker that can be used to select a transformed host cell. As used herein, the term selective marker means a nucleotide sequence which, when expressed, confers a particular phenotype on the host cell expressing the marker and thus distinguishes such transformed cells from those that do not have the marker. Such a nucleotide sequence may encode either a selectable or a shieldable marker, depending on whether the marker represents a trait that can be selected by chemical means, such as with a selective agent (eg, an antibiotic, etc.), or whether the marker is simply a feature that can be identified through observation or testing, such as by screening (eg, fluorescence). Of course, many examples of suitable selectable markers are known in the art and can be used in the expression cassettes described herein.

In addition to expression cassettes, the nucleic acid molecules and nucleotide sequences disclosed herein can be used in relation to vectors. The term vector refers to a composition for transferring, delivering, or introducing a nucleic acid (or nucleic acids) into a cell. The vector contains a nucleic acid molecule containing the nucleotide sequence(s) to be transferred, delivered or administered. Vectors for use in the transformation of host organisms are well known in the art. Non-limiting examples of general classes of vectors include, without limitation, a viral vector, a plasmid vector, a phage vector, a phagemid vector, a cosmid vector, a fosmid vector, a bacteriophage, an artificial chromosome, or an Agrobacterium binary vector in a double-stranded or single-stranded linear or circular form, which may or may not be self-transmissible or mobilizable. The vector defined herein can transform a prokaryotic or eukaryotic host, either by integration into the cellular genome or by extrachromosomal existence (eg, as an autonomously replicating plasmid with an origin of replication). Shuttle vectors are also included, by which is meant a DNA carrier capable of replicating naturally or by engineered structure in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotes (e.g., cells of higher plants, mammals, yeasts). or mushrooms). In some exemplary embodiments, the implementation of the nucleic acid in the vector is controlled and operably linked to the appropriate promoter or other regulatory elements for transcription in the host cell. The vector may be a bifunctional expression vector that functions in multiple hosts. In the case of genomic DNA, it may contain its own promoter or other regulatory elements, and in the case of cDNA, it may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell. Accordingly, the nucleic acid molecules of the present invention and/or expression cassettes can be incorporated into vectors as described herein and as known in the art.

Introduction, introduce, introduced (and their grammatical variants) in the context of a polynucleotide of interest means the presentation of a polynucleotide of interest in a host organism or a cell of said organism (for example, a host cell) in such a way that the polynucleotide gains access to the interior of the cell. When more than one polynucleotide is introduced, the polynucleotides may be assembled as part of a single polynucleotide construct or nucleic acid construct, or as separate polynucleotide constructs or nucleic acid constructs, and may be located on the same or different expression constructs or transformation vectors. Accordingly, these polynucleotides can be introduced into cells by a single transformation event, by separate transformation/transfection events, or, for example, they can be incorporated into the body using conventional propagation protocols. Thus, in some aspects, one or more nucleic acid constructs of the present invention may be introduced into a host organism or a cell of said host organism, either alone or in combination. In the context of a cell population, administration means contacting the population with the heterologous nucleic acid constructs of the invention under conditions where the heterologous nucleic acid constructs of the invention gain access to the interior of one or more cells in the population, thereby transforming that one or more cells in the population.

As used herein, the term transformation or transfection refers to the introduction of a heterologous nucleic acid into a cell. Cell transformation can be permanent or temporary. Thus, in some embodiments, the host cell or organism is transformed with the nucleic acid construct of the invention in a stable manner. In other embodiments, a host cell or organism is transiently transformed with a nucleic acid construct of the invention. Thus, in exemplary embodiments, the heterologous nucleic acid construct of the invention may be introduced into a cell stably and/or transiently.

Temporal transformation in the context of a polynucleotide means that the polynucleotide is introduced into a cell and does not integrate into the cell's genome.

By stable introduction or stably introduced in the context of a polynucleotide, it is to be understood that the introduced polynucleotide is stably incorporated into the genome of the cell and thus the cell is stably transformed by the polynucleotide.

Stable transformation or stably transformed as used herein means that a nucleic acid construct is introduced into a cell and integrated into the cell's genome. Thus, an integrated nucleic acid construct is capable of being inherited by offspring, in particular the offspring of several successive generations. The genome used herein includes the nuclear, mitochondrial, and plasmid genome, and therefore may include the integration of a nucleic acid construct into, for example, a plasmid or mitochondrial genome. Stable transformation as used herein can also refer to a transgene that is maintained extrachromosomally, eg as a minichromosome or plasmid.

Temporal transformation can be detected, for example, using enzyme-linked immunosorbent assay (ELISA) or Western blot analysis, which detects the presence of a peptide or polypeptide encoded by one or more transgenes introduced into the body. Stable transformation of a cell can be detected, for example, by Southern blot hybridization of the cell's genomic DNA with nucleic acid sequences that specifically hybridize with the nucleotide sequence of the transgene introduced into the body (for example, bacteria, archaea, yeast, algae, etc.). Stable transformation of a cell can be detected, for example, by Northern blot analysis of the cell's RNA hybridization with nucleic acid sequences that specifically hybridize to the nucleotide sequence of the transgene introduced into a plant or other organism. Stable cell transformation can also be detected, for example, by polymerase chain reaction (PCR) or other amplification reactions well known in the art, using specific primer sequences that hybridize to the target sequence(s) of the transgene, resulting in amplification. transgene sequence that can be detected by standard methods. Transformation can also be detected using direct sequencing and/or hybridization protocols well known in the art.

Accordingly, in some embodiments, nucleotide sequences, constructs, expression cassettes may be transiently expressed and/or may be stably incorporated into the genome of the host organism.

The heterologous nucleic acid construct of the invention may be introduced into a cell by any method known to those skilled in the art. In some embodiments of the invention, the transformation of the cell includes the transformation of the nucleus. In other embodiments, the heterologous nucleic acid construct(s) of the invention may be introduced into a cell by conventional propagation methods.

Methods for transforming both eukaryotic and prokaryotic organisms are well known and common in the art and are described in any literature (see, for example, Jiang et al., 2013, Nat. Biotechnol., 31:233-239; Ran et al. ., Nature Protocols, 8:2281-2308 (2013)).

Thus, a nucleotide sequence can be introduced into a host organism or its cell by any number of methods that are well known in the art. The methods of the invention are independent of the particular manner in which one or more nucleotide sequences are introduced into an organism, except that they gain access to the interior of at least one cell of the organism. When more than one nucleotide sequence is introduced, they may be assembled as part of a single nucleic acid construct or as separate nucleic acid constructs and may be located on the same or different nucleic acid constructs. Accordingly, the nucleotide sequences may be introduced into the cell of interest in a single transformation event or in separate transformation events, or if necessary, the nucleotide sequence may be incorporated into the organism as part of a propagation protocol.

Transposable genetic elements (MGEs) present persistent genomic stability problems to bacteria, promoting evolution through horizontal gene transfer. The term MGE covers plasmids, bacteriophages, transposable elements, genomic islands, and many other specialized genetic elements (1). MGEs encompass genes that provide the host with a high propagation rate, adaptive advantages, and genomic stability, leading to their almost universal presence in bacterial genomes. To cope with the constant threat of predatory bacteriophages and selfish genetic elements, bacteria have evolved both innate and adaptive immune systems that target exogenous genetic elements. Innate immunity includes cell wall modification, restriction/modification systems, and abortive phage infection (2). Short palindromic repeats regularly spaced in groups

- 21 042506 pami (CRISPR) and CRISPR-associated genes (Cas) are adaptive immune systems directed against invasive genetic elements in bacteria (3). CRISPR-Cas-mediated immunity is based on different molecular processes classified as acquisition, expression and interference (3). The acquisition is carried out through molecular sampling (sampling) of foreign genetic elements, from which short sequences, called spacers, are integrated into the CRISPR array in a specific orientation (4). Expression of CRISPR arrays is constitutive and induced by promoter elements in the preceding leader sequence (5-6). The interference arises from the corresponding transcript, which is selectively processed at each repetitive sequence to form CRISPR RNAs (sgRNAs) that direct Cas proteins to recognize sequences and cleave the target DNA complementary to the spacer (7). CRISPR-Cas technology is applied for strain typing and detection (8-10), exploitation of natural/engineered immunity against mobile genetic elements (11), programmable genome editing under different conditions (12), transcription control (13-14) and manipulation of microbial populations in certain consortiums (15).

Various CRISPR systems are known in the art. For example, see Makarova et al. for a nomenclature of all classes, types, and subtypes of CRISPR systems (Nature Reviews Microbiology, 13:722-736 (2015)); see also R. Barrangou (Genome Biol., 16:247 (2015)).

Although sequence features corresponding to CRISPR arrays have been described previously in several organisms (16-17), Streptococcus thermophilus was the first microbe to elucidate the roles of specific cas genes and CRISPR array components (4). S. thermophilus is a non-pathogenic thermophilic Gram-positive bacterium used as a starter culture that catabolizes lactose to lactic acid in the syntrophic production of yogurt and various cheeses (18). S. thermophilus encodes up to four CRISPR-Cas systems, two of which (SthCRISPR1 and SthCRISPR3) are classified as type II-A systems that are naturally active in both acquisition and interference (4, 19). Accordingly, genomic analysis of S. thermophilus and its bacteriophages established the likely mechanism of CRISPR-Cas systems for phage/DNA protection. The study of CRISPR-Cas systems in S. thermophilus made it possible to carry out a bioinformatic analysis of the origin of the spacer (4, 20), to discover sequences of the motif adjacent to the protospacer (PAM) (19, 21), to understand the phage-host dynamics (22-23), to demonstrate the activities endonuclease Cas9 (7, 24-25) and (recently) to determine the tracrRNA structural motifs that regulate the function and orthogonality of type II systems (26). Genomic analysis of S. thermophilus revealed an evolutionary adaptation to milk through the loss of carbohydrate catabolism and virulence genes found in pathogenic streptococci (18). S. thermophilus has also acquired a significant number of genes related to this niche, such as genes encoding, among others, cold shock proteins, copper resistance proteins, proteinases, bacteriocins, and lactose catabolism proteins (18). Insertion sequences (IS) are widely distributed in the genomes of S. thermophilus and provide genetic heterogeneity of strains, facilitating the spread of islands associated with dairy adaptation genes (18). The concomitant presence of MGE and functional CRISPR-Cas systems in S. thermophilus suggests that genome homeostasis is determined, at least in part, by the interplay of these dynamic forces. Thus, S. thermophilus represents an ideal host to investigate the genetic outcomes of targeting genomic islands to CRISPR-Cas.

CRISPR-Cas systems have recently been the subject of intensive research for applications in genome editing (12), but the evolutionary roles of most endogenous microbial systems remain unknown (27). Even less is known about the evolutionary implications of the deployment of active CRISPR-Cas systems beyond their role in preventing foreign DNA uptake (7), spacer acquisition events (4) and chromosomal self-targeting mutation (28-32). Thus, the inventors sought to determine the results of targeting integrated MGEs with endogenous type II CRISPR-Cas systems. In S. thermophilus LMD-9, four islands have been identified ranging in length from 8 to 102 kb. and a total of approximately 132 kb, or 7% of the genome. To target the genomic islands, the plasmid used to express the engineered CRISPR arrays with self-targeted spacers was transformed into S. thermophilus LMD-9. Taken together, these results elucidate the results of fundamental genetic studies of self-targeting events and show that CRISPR-Cas systems can guide genome evolution at the bacterial population level.

Using these findings, the authors of the present invention have developed new methods of screening populations of bacterial, archaeal, algal or yeast cells for vital genes, non-essential genes and/or foreign genomic islands; to kill one or more cells in a population of bacterial, archaeal, algal, or yeast cells; to identify the phenotype of a bacterial, archaeal, algal or yeast gene; to select one or more bacterial, archaeal, algal or yeast cells having a reduced genome size from a population of bacterial, archaeal or yeast cells; and/or for identification in a population

- 22 042506 bacterial, archaeal, algal or yeast cells of at least one isolate having a mutation (eg deletion) in its genome.

Thus, in one aspect, the present inventors have developed methods for identifying genetic variants in a population that have altered the genetic content, allowing them to avoid targeting. In this case, the target sequence was modified and a search was made for surviving organisms having this modification. In some aspects, the modification (ie, mutation) is a deletion. In addition, if the target sequence has been modified, then the wild-type genotype is not significant.

Therefore, in one aspect of the invention, a method is provided for screening a bacterial cell population for vital genes, non-essential genes, and/or foreign genomic islands, comprising introducing into said bacterial cell population a heterologous nucleic acid construct comprising a CRISPR array containing (in 5' -3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to the target region in the bacterial cell genome of said population, thereby creating a population of transformed bacterial cells; and determining the presence or absence of a deletion in the population of transformed bacterial cells, wherein the presence of a deletion in the population of transformed bacterial cells indicates that the target region is contained in a non-vital gene and/or foreign genomic island, and the absence of a deletion in the population of bacterial cells means, that this target region is contained in a vital gene.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In additional aspects of the invention, a method is provided for screening a population of bacterial, archaeal, algal, and yeast cells for vital genes, non-essential genes, and/or foreign genomic islands, comprising introducing into the population of bacterial, archaeal, algal, and yeast cells (a) a heterologous nucleic acid construct acid containing a trans-activating CRISPR (tracr) nucleic acid, (b) a heterologous nucleic acid construct containing a CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence wherein the spacer contains a nucleotide sequence that is substantially complementary to a target region in the genome of said population of bacterial, archaeal, algal, and yeast cells, and (c) a Cas9 polypeptide or heterologous nucleic acid construct containing a polynucleotide encoding a Cas9 polypeptide, thereby creatinga population of transformed bacterial, archaeal, algal and yeast cells; and determining the presence or absence of a deletion in the population of transformed bacterial, archaeal, algal and yeast cells, wherein the presence of a deletion in the population of bacterial, archaeal, algal and yeast cells means that this target region is contained in a non-vital gene and/or a foreign genomic island, and the absence of a deletion in a population of bacterial, archaeal, algal, and yeast cells means that this target region is contained in a vital gene.

In other aspects, a method is provided for killing one or more bacterial cells in a bacterial cell population, comprising introducing into the bacterial cell population a heterologous nucleic acid construct comprising a CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the bacterial cell genome of said population, thereby eliminating one or more bacterial cells that contain the target area. The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In a further aspect, a method is provided for killing one or more cells in a population of bacterial, archaeal, algal, or yeast cells, comprising introducing into the population of bacterial, archaeal, algal, or yeast cells (a) a heterologous nucleic acid construct comprising a trans-activating CRISPR (tracr) nucleic acid acid, (b) a heterologous nucleic acid construct comprising a CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one

- 23 042506 a repeat-spacer identity, wherein the spacer of said at least one repeat-spacer sequence and repeat-spacer-repeat sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of the bacterial, archaeal, algal, or yeast cells of said population and (c) a Cas9 polypeptide or a heterologous nucleic acid construct comprising a polynucleotide encoding a Cas9 polypeptide, thereby eradicating a population of bacterial, archaeal, algal, or yeast cells.

Transformation of CRISPR RNA to target the bacterial genome can be used to selectively kill bacterial cells based on sequence specificity to remove genetically distinct subpopulations, thereby enriching bacterial populations lacking the target sequence. This difference may arise from the heterogeneous distribution of orthogonal CRISPR-Cas systems in genetically similar populations. Thus, in some embodiments, a CRISPR array that is introduced into a population of cells may be compatible (i.e., functional) with the CRISPR-Cas system in one or more bacterial cells to be killed, and incompatible (i.e., non-functional) with the CRISPR Cas system in at least one or more bacterial cells in the population. For example, Escherichia coli and Klebsiella pneumoniae may have type I-E or type I-F CRISPR-Cas systems; Clostridium difficile encodes type I-B systems, and various strains of S. thermophilus have both type II-A and type I-E systems, or only type II-A systems. Depending on the particular CRISPR RNA transformed into a mixture of bacteria, it may specifically target such a subset of the population based on its interoperability with its cognate system. This can be applied to various species containing endogenous CRISPR-Cas systems, such as, but not limited to, the following.

Pseudomonas spp. (for example: P. aeruginosa), Escherichia spp.

(for example: E. coli), Enterobacter spp. (for example: E. cloacae), Staphylococcus spp. (for example: S. aureus), Enterococcus spp.

(eg: E. faecalis, E. faecium), Streptomyces spp.

(for example: S. somaliensis), Streptococcus spp. (for example: S.

pyogenes), Vibrio spp. (for example: V. cholerae), Yersinia spp.

(for example: Y. pestis), Francisella spp. (for example: F.

tularensis, F. novicida), Bacillus spp. (for example: V. anthracis,

B. cereus), Lactobacillus spp. (eg: L. casei, L. reuteri, L. acidophilus, L. rhamnosis), Burkholderia spp. (for example: B. mallei, B. pseudomallei), Klebsiella spp. (eg: K.

pneumoniae), Shigella spp. (for example: S. dysenteriae, S.

sonnei), Salmonella spp. (for example: S. enterica), Borrelia spp.

(for example: B. burgdorfieri), Neisseria spp. (for example: N.

meningitidis), Fusobacterium spp. (for example: F. nucleatum), Helicobacter spp. (for example: H. pylori), Chlamydia spp. (eg: C. trachomatis), Bacteroides spp. (for example, in.

fragilis), Bartonella spp. (for example: B. quintana), Bordetella spp. (for example: B. pertussis), Brucella spp. (for example: B. abortus), Campylobacter spp. (for example: C. jejuni), Clostridium spp. (eg: C. difficile), Bifidobacterium spp. (For example:

B. infantis), Haemophilus spp. (for example: H. influenzae), Listeria spp. (for example: L. monocytogenes), Legionella spp. (eg: L. pneumophila), Mycobacterium spp. (for example: M. tuberculosis), Mycoplasma spp. (for example: M. pneumoniae), Rickettsia spp. (eg: R. rickettsii), Acinetobacter spp.

(for example: A. calcoaceticus, A. baumanii), Rumincoccus spp.

(for example: R. albus), Propionibacterium spp. (for example: P.

freudenreichii), Corynebacterium spp. (for example: C.

- 24 042506 diphtheriae), Propionibacterium spp. (eg: P. acnes) Brevibacterium spp. (eg: B. iodinum), Micrococcus spp (eg: M. luteus) and/or Prevotella spp. (for example: P histicola).

Targeting CRISPR can result in the removal of specific subsets of bacteria based on differing genetic content in mixed populations. Confirmation of this statement is presented in examples 4, 5, where Lac-bacteria are selected to complete extinction in the Lac ⁺ population. The genetic difference between Lac ⁺ and Lac- strains is shown in Examples 8 and 10, where sequencing of the surviving clones revealed up to 5.5% difference in genetic content compared to the wild-type reference S. thermophilus strain. Thus, CRISPR targeting spacers can be tuned to varying degrees of relatedness between bacteria by targeting conserved or divergent genetic sequences. Thus, in some embodiments, the bacterial cells in a population may contain the same CRISPR-Cas system, and the introduced CRISPR array may thus function as a unit in the bacterial population, but the genetic content of other strains or species that make up this bacterial population is sufficiently different that the target region for the injected CRISPR array is found in only one or more of the bacterial species targeted to kill in the population. This can be applied to various species containing endogenous CRISPR-Cas systems, such as, but not limited to, Pseudomonas spp. (for example, the following).

R. aeruginosa), Escherichia spp. (for example: E. coli), Enterobacter spp. (eg: E. cloacae), Staphylococcus spp. (for example: S. aureus), Enterococcus spp. (eg: E. faecalis, E. faecium), Streptomyces spp. (for example: S. somaliensis), Streptococcus spp. (eg: S. pyogenes), Vibrio spp. (for example: V. cholerae), Yersinia spp. (for example: Y. pestis), Francisella spp. (for example: F. tularensis, F. novicida), Bacillus spp. (for example: B. anthracis, B. cereus), Lactobacillus spp. (eg: L. casei, L. reuteri, L. acidophilus, L. rhamnosis), Burkholderia spp. (for example: B. mallei, B. pseudomallei), Klebsiella spp. (for example: K. pneumoniae), Shigella spp. (for example: S. dysenteriae, S. sonnei), Salmonella spp. (for example: S. enterica), Borrelia spp. (for example: B. burgdorfieri), Neisseria spp. (eg: N. meningitidis), Fusobacterium spp. (for example: F. nucleatum), Helicobacter spp. (for example: H. pylori), Chlamydia spp. (eg: C. trachomatis), Bacteroides spp. (for example: B. fragilis), Bartonella spp. (for example: B. quintana), Bordetella spp. (for example: B. pertussis), Brucella spp. (for example: B. abortus), Campylobacter spp. (eg: C. jejuni), Clostridium spp. (eg: C. difficile), Bifidobacterium spp. (for example: B. infantis), Haemophilus spp. (for example: H. influenzae), Listeria spp. (for example: L. monocytogenes), Legionella spp. (eg: L. pneumophila), Mycobacterium spp. (for example: M. tuberculosis), Mycoplasma spp. (for example: M. pneumoniae), Rickettsia spp. (eg: R. rickettsii), Acinetobacter spp. (for example: A. calcoaceticus, A. baumanii), Rumincoccus spp. (for example: R. albus), Propionibacterium spp. (for example: P. freudenreichii), Corynebacterium spp. (for example: C. diphtheriae),

Propionibacterium spp. (eg: P. acnes), Brevibacterium spp. (for example: B. iodinum), Micrococcus spp. (eg: M. luteus) and/or Prevotella spp. (for example: P. histicola).

The degree of eradication in a population by the method of the present invention may depend on the susceptibility of a particular population to transformation in addition to where the target region is in a non-essential gene, a vital gene, or a foreign island. degree of destruction

- 25 042506 ion in a population of bacterial, archaeal or yeast cells may vary, for example, depending on the organism, genus and species. Accordingly, as used herein, the term eradication means the removal of 2 log or more cells in a population (1% survival or less). Annihilation below 1 log would be a small population reduction; while a 2-3 log kill would result in a significant population reduction; and kills greater than 3 log indicate that the population is essentially wiped out.

In another aspect, a method for identifying a phenotype associated with a bacterial gene is provided, comprising introducing into a population of bacterial cells a heterologous nucleic acid construct comprising a CRISPR array containing (in the 5'-3' direction) a repeat-spacer repeat sequence or at least one repeat sequence. a spacer, wherein the spacer of said at least one repeat-spacer sequence and the repeat-spacer-repeat sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of said population of bacterial cells, wherein this target region contains at least a portion of the open a reading frame encoding a polypeptide or functional nucleic acid, thereby destroying cells containing this target region and creating a population of transformed bacterial cells that do not contain this target region (i.e., surviving cells do not contain the target region); and (i) analysis of the phenotype of the cell population; or (ii) growing individual bacterial colonies from the population of transformed bacterial cells and analyzing the phenotype of the individual colonies.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In another aspect, a method is provided for identifying the phenotype of a bacterial, archaeal, algal, or yeast gene, comprising introducing into a population of bacterial, archaeal, algal, or yeast cells (a) a heterologous nucleic acid construct comprising a trans-activating CRISPR (tracr) nucleic acid, (b) a heterologous nucleic acid construct comprising a CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence, or at least one repeat-spacer sequence, wherein the spacer contains a nucleotide sequence that is substantially complementary to the target region in the genome of the bacterial, archaeal, algal, or yeast cells of said population, and (c) a Cas9 polypeptide or heterologous nucleic acid construct containing a polynucleotide encoding a Cas9 polypeptide, thereby destroying the bacterial, archaeal, algal, or yeast cells containing the target region and creating ass lyation of transformed bacterial, archaeal, algal or yeast cells that do not contain the target region; and (i) analysis of the phenotype of the cell population; or (ii) growing single bacterial, archaeal, algal or yeast colonies from a population of transformed bacterial, archaeal, algal or yeast cells; and analysis of the phenotype of individual colonies.

In some embodiments, the analysis includes PCR, optical genome mapping, genome sequencing, restriction mapping and/or restriction analysis to identify and characterize a mutation, and complementarity and/or phenotypic assays to analyze the phenotype.

In some embodiments of the invention, determining the degree of destruction or reduction of the population may include any method of determining the size of the population, including (without limitation) (1) seeding cells and counting colonies, (2) determining optical density, (3) counting under a microscope, (4) determination of the most likely abundance, and/or (5) recovery of methylene blue.

In some embodiments, 16S rDNA sequencing may be used to determine the composition profile of mixed populations. This can be done, for example, by purifying the DNA from the sample as a whole, and performing either shotgun sequencing of the whole genome using high-performance technologies, or, for example, by PCR amplification of the 16S gene and sequencing the products in the same way. These sequences can then be assigned to specific bacterial taxa by computer calculations. In other embodiments, quantitative PCR methods can also be used to quantify bacteria. Such methods are well known in the art. For example, amplification primers for quantitative

- 26 042506

PCR can be constructed, in particular, from a species, genus or group of organisms that have this sequence. Thus, a threshold value (ct) can be used to quantify a specified organism or group of organisms. In additional embodiments, any bacterial activity (phenotype) specific to the target population can also be used as an indicator to determine population depletion.

In other embodiments, a method is provided for selecting one or more bacterial cells having a reduced genome size from a population of bacterial cells, comprising introducing into the population of bacterial cells a heterologous nucleic acid construct comprising a CRISPR array containing (in the 5'-3' direction) a repeat sequence a spacer-repeat or at least one repeat-spacer sequence, in which the spacer contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial cells in said population, wherein cells containing the target region are destroyed, thereby thus carrying out the selection of one or more bacterial cells that do not contain this target region and have a reduced genome size from a population of bacterial cells. The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In some embodiments, a method is provided for selecting one or more bacterial cells having a reduced genome size from a population of bacterial cells, comprising introducing into the population of bacterial cells (a) (i) one or more heterologous nucleic acid constructs comprising a nucleotide sequence having at least at least 80% identity to at least 300 consecutive nucleotides present in the genome of said bacterial cells, or (ii) two or more heterologous nucleic acid constructs containing at least one transposon, thereby creating a population of transgenic bacterial cells containing a non-natural site for a homologous recombination between one or more heterologous nucleic acid constructs integrated into the genome and at least 300 consecutive nucleotides present in the genome, or between the first and second transposons integrated into the genome; and (b) a heterologous nucleic acid construct comprising a CRISPR (ssRNA, ssDNA) array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence, or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer sequence is - a repeat or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial cells in said population, this target region being located between one or more heterologous nucleic acid constructs introduced into the genome, and at least 300 consecutive nucleotides present in the genome and/or between the first transposon and the second transposon, whereby cells containing the target region are killed and cells not containing the target region survive, thus selecting one or more bacterial cells not containing this target area and having a reduced genome size, from a population of transgenic bacterial cells.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

It is well known in the art that transposons can be generated by, for example, PCR amplification or generated DNA synthesis, and can be introduced by any transformation method.

In some embodiments, a method is provided for selecting one or more bacterial, archaeal, algal, or yeast cells having a reduced genome size from a population of bacterial, archaeal, algal, or yeast cells, comprising introducing into the population of bacterial, archaeal, algal, or yeast cells (a ) a heterologous nucleic acid construct comprising a trans-activating CRISPR (tracr) nucleic acid, (b) a heterologous nucleic acid construct comprising a CRISPR (sgRNA, sgDNA) array containing a repeat-spacer-repeat sequence or at least one repeat-spacer sequence wherein the spacer of at least one repeat-spacer and at least one repeat-spacer-repeat sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of said population of bacterial, archaeal, algal, or yeast cells, and (c) Cas9 polypeptide or heterologous nucleic acid construct containing a polynucleotide encoding a Cas9 polypeptide, wherein cells containing the target region are killed, thereby selecting one or more bacterial, archaeal, algal, or yeast cells that do not contain the target region and have a reduced genome size , from a population of bacterial, archaeal, algal, or yeast cells.

In other embodiments, a method is provided for selecting one or more bacterial, archaeal, algal, or yeast cells having a reduced genome size from a population

- 27 042506 bacterial, archaeal, algal or yeast cells, which includes introducing into the population of bacterial, archaeal, algal or yeast cells (a) (i) one or more heterologous nucleic acid constructs containing a nucleotide sequence having at least 80% identity in at least 300 consecutive nucleotides present in the genome of said bacterial cells, or (ii) two or more heterologous nucleic acid constructs containing at least one transposon, thereby creating a population of transgenic bacterial, archaeal, algal or yeast cells containing a non-natural site for homologous recombination between one or more heterologous nucleic acid constructs integrated into the genome and at least 300 consecutive nucleotides present in the genome, or between the first and second transposons integrated into the genome; and (b) (i) a heterologous nucleic acid construct comprising a trans-activating CRISPR (tracr) nucleic acid, (ii) a heterologous nucleic acid construct comprising a CRISPR (sgRNA, ssDNA) array containing a repeat-spacer-repeat sequence or at least at least one repeat-spacer sequence, wherein the spacer of said at least one repeat-spacer sequence and at least one repeat-spacer-repeat sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial, archaeal, algal or yeast cells in said population, and (iii) a Cas9 polypeptide and/or a heterologous nucleic acid construct comprising a polynucleotide encoding a Cas9 polypeptide, wherein the target region is located between one or more heterologous nucleic acid constructs introduced into the genome and at least at least 300 consecutive nucleotides, present within the genome and/or between the first transposon and the second transposon, wherein cells containing the target region are destroyed and cells not containing the target region survive, thus selecting one or more bacterial, archaeal, algal or yeast cells without containing the target region and having a reduced genome size, from a population of transgenic bacterial, archaeal, algal or yeast cells.

In some aspects, the reduced genome size can be reduced compared to the control. In some aspects, the control may be a wild-type population of bacterial, archaeal, algal, or yeast cells, or a population of bacterial, archaeal, algal, or yeast cells transformed with a heterologous construct containing a CRISPR array (e.g., CRISPR type I, type II, type III, type IV or type V) containing a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is not a complementary target region in the genome of the bacterial, archaeal, algal or yeast cells of the specified population (i.e. non-self-targeted/scrambled spacer). In another aspect, the control may be a population of bacterial, archaeal, algal, or yeast cells transformed with a heterologous nucleic acid construct comprising a CRISPR array containing a repeat-spacer-repeat sequence or at least one repeat-spacer sequence in which the spacer of said sequence is a repeat -spacer repeat or said at least one repeat-spacer sequence contains a nucleotide sequence that is essentially complementary to the target region in the genome of bacterial, archaeal, algal or yeast cells of the specified population, but does not contain a motif adjacent to the protospacer (PAM).

In some embodiments, a method is provided for identifying at least one isolate in a population of bacteria that contains a deletion in its genome (e.g., a chromosomal and/or plasmid deletion), comprising introducing into said population of bacterial cells a heterologous nucleic acid construct containing a CRISPR array (sgRNA, sgDNA) containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, wherein the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial cells of said population, and cells containing the target region are destroyed, thereby creating a population of transformed bacterial cells not containing the target region; and growing individual bacterial colonies from the population of transformed bacterial cells, thereby identifying at least one isolate from the population of transformed bacteria having a deletion in its genome.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

- 28 042506

In other embodiments, the invention provides a method for identifying in a population of bacteria at least one isolate containing a deletion in its genome, comprising introducing into the population of bacterial cells (a) (i) one or more heterologous nucleic acid constructs containing a nucleotide sequence having at least at least 80% identity to at least 300 consecutive nucleotides present in the genome of said bacterial cells, or (ii) two or more heterologous nucleic acid constructs containing at least one transposon, thereby creating a population of transgenic bacterial cells containing a non-natural site for a homologous recombination between one or more heterologous nucleic acid constructs integrated into the genome and at least 300 consecutive nucleotides present in the genome, or between the first and second transposons integrated into the genome; and (b) a heterologous nucleic acid construct comprising a CRISPR (sgRNA, ssDNA) array containing a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, wherein the spacer contains a nucleotide sequence that is substantially complementary to a target region in genome of one or more bacterial cells in a specified population, the target region being located between one or more heterologous nucleic acid constructs introduced into the genome and at least 300 contiguous nucleotides present in the genome and/or between a first transposon and a second transposon , and cells containing the target region are destroyed [and cells not containing the target region survive], thus creating a population of transformed bacterial cells not containing the target region; and growing individual bacterial colonies from the population of transformed bacterial cells, thereby identifying at least one isolate from the population of bacteria having a deletion in its genome.

The CRISPR array used in this invention may be a Type I, Type II, Type III, Type IV, or Type V CRISPR array.

In other embodiments, the invention provides a method for identifying in a population of bacteria, archaea, algae or yeast at least one isolate having a deletion in its genome, comprising introducing into the population of bacterial, archaeal, algal or yeast cells (a) a heterologous nucleic acid construct containing a trans-activating CRISPR (tracr) nucleic acid, (b) a heterologous nucleic acid construct comprising a CRISPR array (ssRNA, ssDNA) containing a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, in which the spacer of said sequence is a repeat - spacer-repeat or said at least one repeat-spacer sequence contains a nucleotide sequence that is essentially complementary to the target region in the genome (for example, chromosomal, mitochondrial and/or plasmid genome) of bacterial, archaeal, algal or yeast cells of the specified population, And (c) a Cas9 polypeptide, wherein cells containing the target region are killed, thereby creating a population of transformed bacterial, archaeal, algal, or yeast cells lacking the target region; and growing single bacterial, archaeal, algal, or yeast colonies from the population of transformed bacterial, archaeal, algal, or yeast cells, thereby identifying at least one isolate from the population of transformed bacterial, archaeal, algal, or yeast cells having a deletion in its genome.

In other embodiments, the invention provides a method for identifying in a population of bacteria, archaea, algae or yeast at least one isolate having a deletion in its genome, comprising introducing into the population of bacterial, archaeal, algal and yeast cells (a) (i) one or more a heterologous nucleic acid construct comprising a nucleotide sequence having at least 80% identity with at least 300 consecutive nucleotides present in the genome of said bacterial, archaeal, algal, and yeast cells, or (ii) two or more heterologous nucleic acid constructs containing at least one transposon, thereby creating a population of transgenic bacterial, archaeal, algal, and yeast cells containing a non-natural site for homologous recombination between one or more heterologous nucleic acid constructs integrated into the genome, and at least 300 sequences single nucleotides present in the genome or between the first and second transposons integrated into the genome; and (b) (i) a heterologous nucleic acid construct containing a trans-activating

- 29 042506

CRISPR (tracr) nucleic acid, (ii) a heterologous nucleic acid construct comprising a CRISPR (sgRNA, ssDNA) array containing a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, in which the spacer contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial, archaeal, algal or yeast cells in said population, and (iii) a Cas9 polypeptide and/or a heterologous nucleic acid construct comprising a polynucleotide encoding a Cas9 polypeptide, wherein the target region is located between one or more heterologous nucleic acid constructs introduced into the genome and at least 300 consecutive nucleotides present in the genome and/or between the first transposon and the second transposon, cells containing the target region are destroyed and cells not containing the target region survive, thus creating a population of transforms shaped bacterial, archaeal, algal or yeast cells that do not contain the target region; and growing individual bacterial, archaeal, algal, or yeast colonies from the population of transformed bacterial, archaeal, algal, or yeast cells, thereby identifying at least one isolate from the population having the deletion in its genome.

In some embodiments, fitness/growth rate can be increased by reducing the size of the genome, or by removing selected genes (coding for polypeptides or functional nucleic acids (e.g., transcriptional regulators)) that require a lot of energy for transcription and translation. Thus, in some embodiments, a method is provided for increasing the fitness or growth rate of a population of bacterial, archaeal, algal, or yeast cells, comprising selecting a reduced genome size (e.g., selecting for the absence of a portion of the genome) and/or deletions in the genomes of the bacterial, archaeal, algal, or yeast cell populations, as disclosed in the present description. In some embodiments, the implementation of the deletion may contain one gene or more than one gene. Therefore, by reducing the size of the genome or deleting a particular gene or genes, the cells of the population will no longer expend energy on transcription/translation of a portion of the missing genome or the deleted gene or genes; thereby reducing energy requirements and improving fitness compared to a control population still containing said part of the genome and/or said gene or genes.

In other embodiments, a method is provided for increasing the amount of a product derived from a population of bacterial, archaeal, algal, or yeast cells, including increasing the fitness or growth rate of a cell by selecting for a deletion in the bacterial, archaeal, algal, or yeast cell genomes, as disclosed herein. . In some embodiments, products may include, without limitation, antibiotics, secondary metabolites, vitamins, proteins, enzymes, acids, and pharmaceuticals.

In some embodiments, the array of CRISPR (sgRNA, ssDNA) used in this invention may be an array of any of CRISPR-Cas system type I, CRISPR-Cas system type II, CRISPR-Cas system type III, CRISPR-Cas system type IV or CRISPR-Cas Type V systems.

With respect to the foregoing embodiments, a heterologous nucleic acid construct comprising a tracr nucleic acid and a heterologous nucleic acid construct comprising a CRISPR array may be included and introduced into the same construct (e.g., an expression cassette or vector) or into different constructs. . In specific embodiments, a heterologous nucleic acid construct comprising a tracr nucleic acid and a heterologous nucleic acid construct comprising a CRISPR array may be included in a single construct (e.g., expression cassette and/or vector), which may optionally further comprise a polynucleotide encoding a polypeptide. Cas9. In some embodiments, a heterologous nucleic acid construct comprising a tracr nucleic acid and a heterologous nucleic acid construct comprising a CRISPR array may be operably linked to the same promoter and/or separate promoters.

In some embodiments, a heterologous nucleic acid construct comprising a trans-activating CRISPR (tracr) nucleic acid and a heterologous nucleic acid construct comprising a CRISPR array (sgRNA, ssDNA) may be included in a CRISPR guide (gRNA, gDNA). In some embodiments, a CRISPR guide may be operably linked to a promoter.

In some embodiments, the Cas9 polypeptide used in this invention has at least 70% identity (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 , 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, etc.) with the amino acid sequence of Cas9 nuclease. Examples of Cas9 nucleases useful in this invention are any Cas9 nucleases known to catalyze DNA cleavage in the CRISPR-Cas system. Such Cas9 nucleases are known in the art to contain an HNH motif and a RuvC motif.

- 30 042506 (see, for example, WO 0201/176772, WO 2013/188638). In some embodiments of the present invention, a functional fragment of the Cas9 nuclease can be used.

CRISPR-Cas systems and Cas9 nuclease groups are well known in the art and include, for example, Streptococcus thermophilus CRISPR1 (Sth CR1) Cas9 nuclease group, Streptococcus thermophilus CRISPR3 (Sth CR3) Cas9 nuclease group, Lactobacillus buchneri CD034 (Lb) Cas9 nuclease group, and Lactobacillus rhamnosus GG (Lrh) Cas9 nuclease group. Additional Cas9 nucleases include, without limitation, Lactobacillus curvatus CRL 705. In addition, Cas9 nucleases used in this invention include, without limitation, Cas9 from Lactobacillus animalis KCTC 3501 and Lactobacillus farciminis, WP 010018949.1.

In addition, in specific embodiments, the Cas9 nuclease may be encoded by a nucleotide sequence that is codon-optimized for the organism containing the target DNA. In other embodiments, the Cas9 nuclease may comprise at least one nuclear localization sequence.

In some embodiments, the type I polypeptide used in the present invention has at least 70% identity (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, etc.) with the amino acid sequence of Cas3, Cas3' nuclease, Cas3 nucleases, their recombinant variants. In some embodiments, the type I cascade polypeptide used in the present invention has at least 70% identity (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, etc.) with the amino acid sequence Cas7 (Csa2), Cas8a1 ( Csx13), Cas8a2 (Csx9), Cas5, Csa5, Cas6a, Cas6b, Cas8b (Csh1), Cas7 (Csh2), Cas5, Cas5d, Cas8c (Csd1l), Cas7 (Csd2), Cas10d (Csc3), Csc2, Csc1, Cas6d , Cse1 (CasA), Cse2 (CasB), Cas7 (CasC), Cas5 (CasD), Cas6e (CasE), Cys1, Cys2, Cas7 (Cys3), Cas6f (Csy4), Cas6 and/or Cas4.

Type I CRISPR-Cas systems are well known in the art and include, for example, Archaeoglobus fulgidus containing the exemplary Type I-A CRISPR-Cas system, Clostridium kluyveri DSM 555 containing the exemplary Type I-B CRISPR-Cas system, Bacillus halodurans C-125 containing the exemplary CRISPR-Cas type I-C system, Cyanothece sp. PCC 802 containing exemplary CRISPR-Cas system type I-D, Escherichia coli K-12 containing exemplary CRISPR-Cas system type I-E, Geobacter sulfurreducens containing exemplary CRISPR-Cas system type I-U, and Yersinia pseudotuberculosis YPIII containing the exemplary CRISPR-Cas type I-F system.

In some embodiments, a type II polypeptide useful in this invention has at least 70% identity (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, etc.) with the amino acid sequence Cas9. Type II CRISPR-Cas systems are well known in the art and include, for example, strains of Legionella pneumophila Paris, Streptococcus thermophilus CNRZ1066 and Neisseria lactamica 020-06.

In some embodiments, the type III polypeptide used in this invention has at least 70% identity (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, etc.) with the amino acid sequence Cas6, Cas10 (or Csm1) , Csm2, Csm3, Csm4, Csm5, and Csm6, Cmr1, Cas10 (or Cmr2), Cmr3, Cmr4, Cmr5, and Cmr6, Cas7, Cas10, Cas7 (Csm3), Cas5 (Csm4), Cas7 (Csm5), Csm6, Cas7 (Cmr1), Cas5 (Cmr3), Cas7 (Cmr4), Cas7 (Cmr6), Cas7 (Cmr6), Cmr5, Cas5 (Cmr3), Cas5 (Csx10), Csm2, Cas7 (Csm3) and all1473. Type III CRISPR-Cas systems are well known in the art and include, for example, Staphylococcus epidermidis RP62A containing the exemplary Type III-A CRISPR-Cas system, Pyrococcus furiosus DSM 3638 containing the exemplary Type III CRISPR-Cas system -B, a strain of Methanothermobacter thermautotrophicus Delta H containing the exemplary type III-C CRISPR-Cas system, and Roseiflexis sp. Rs-1 containing the exemplary CRISPR-Cas type III-D system.

In some embodiments, the type IV polypeptide used in the present invention has at least 70% identity (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, etc.) with the amino acid sequence Csf4 (dinG), Csf1, Cas7 (Csf2) and/or Cas5 (csf3). Type IV CRISPR-Cas systems are well known in the art, for example, Acidithiobacillus ferrooxidans ATCC 23270 contains the exemplary Type IV CRISPR-Cas system.

In some embodiments, a type V polypeptide useful in this invention has at least 70% identity (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, etc.) with the amino acid sequence Cpf1, Cas1, Cas2 or Cas4 . Type V CRISPR-Cas systems are well known in the art and include, for example, Francisella cf. novicida Fx1 containing the exemplary CRISPR-Cas type V system.

Also provided herein are expression cassettes and vectors containing the nucleic acid constructs, nucleic acid arrays, nucleic acid molecules and/or nucleotide sequences of the present invention that can be used with the methods disclosed herein.

In other aspects of the nucleic acid construct, the nucleic acid arrays, nucleic acid molecules and/or nucleotide sequences of the present invention may be introduced into a host cell. Any host cell/organism to which this invention is applicable can be used. Examples of host organisms include bacteria, archaea, algae and fungi (eg yeast).

The invention is further described with reference to the following examples. It should be understood that these examples are not intended to limit the scope of the claims, but rather are intended to illustrate certain embodiments. Any variations in the exemplary methods that occur to a person skilled in the art are within the scope of the present invention.

Examples

Example 1. Bacterial strains.

All bacterial strains are listed in Table. 1.

Bacterial cultures were cryopreserved in a suitable growth medium with 25% glycerol (v/v) and stored at -80°C. S. thermophilus was propagated in Elliker's medium (Difco) supplemented with 1% beef extract (w/v) and 1.9% (w/v) β-glycerophosphate (Sigma) under static aerobic conditions at 37°C or on solid medium with 1.5% (w/v) agar (Difco), incubated under anaerobic conditions at 37°C for 48 hours. If necessary, concentrations of 2 µg/ml erythromycin (Em) and 5 µg/ml chloramphenicol (Cm) (Sigma). E. coH EC1000 was propagated aerobically in Luria-Bertani broth (Difco) at 37° C. or on brain heart extract (BHI) solid medium (Difco) supplemented with 1.5% agar. If necessary, the selection of E. coli using an antibiotic was performed using 40 μg/ml kanamycin (K _n ) and 150 μg/ml Em for recombinant E. coli. Screening of S. thermophilus derivatives for β-galactosidase activity was qualitatively performed by supplementing Elliker Synthetic Medium with 1% lactose, 1.5% agar and 0.04% bromocresol as pH indicator.

Example 2 Isolation and cloning of DNA.

All kits, enzymes and reagents were used in accordance with the manufacturer's instructions. DNA purification and cloning was performed as previously described (41). Briefly, the ZR Fungal/Bacterial MiniPrep kit (Zymo) was used to purify genomic DNA from S. thermophilus. Plasmid DNA was isolated from E. coli using the Qiagen Spin miniprep kit (Qiagen). High-quality PCR amplification of DNA was performed using PFU HS II DNA polymerase (Stratagene). Conventional PCR methods were performed using Choice-Tag Blue polymerase (Denville). Primers for PCR amplification were purchased from Integrated DNA Technologies (Coralville, IA). Extraction of DNA from agarose gels was performed using the Zymoclean DNA gel recovery kit (Zymo). Restriction endonucleases were purchased from Roche Molecular Biochemicals. For ligation, T4 fast crosslinking ligase (New England Biolabs) was used. Sequencing was performed at Davis Sequencing Inc. (Davis, Calif.). Cryopreserved, rubidium chloride-treated competent E. coli cells were prepared as previously described (41). Plasmids were created with lacZ targeting arrays, each containing, in the following order:

(1) a native leader sequence specific for SthCRISPR1 or SthCRISPR3;

(2) native repeats specific for CRISPR1 or CRISPR3;

(3) a spacer sequence specific for the 5' end of lacZ; (4) another native repeat (FIG. 1). To create each plasmid, the sequence features listed above were sequenced as extended oligomers (Table 2), spliced together by extension of overlapping PCR products (42) and cloned into pORI28 (FIG. 2).

Example 3. Selection and development of CRISPR spacers.

The programmed specificity of the chromosomal cleavage depends on the choice of the desired spacer sequence, unique to the target allele. Specificity is further complicated by the required PAM, a short conserved sequence that must be in the target sequence in close proximity to the protospacer (21, 43). Thus, the location of PAM consensus sequences and random sequence identity with foreign genomic loci were strict criteria for the selection and design of spacers. The first constraint on putative protospacers was the location of all putative PAM sequences in the sense and antisense strands of lacZ. In the 3081 nucleotide long gene, 22 PAM sites for CRISPR1 (AGAAW) and 39 PAM sites for CRISPR3 (GGNG) were found, which turned out to be identical to their bioinformatics consensus sequences (21). After potential spacers were identified, BLAST analysis of the complete protospacer, primer, and PAM sequence against the S. thermophilus LMD-9 genome was performed to prevent additional targeting of non-specific loci. The spacers for CRISPR1 and CRISPR3 had different sequences and did not correspond to PAM sites, but were designed to target the lacZ 5' end, resulting in the predicted cleavage sites being 6 nt apart. Therefore, the leader sequences, repeats and spacers on each plasmid were orthogonal features unique to CRISPR1 or CRISPR3, respectively. To evaluate mutations dependent on target loci, an additional CRISPR3 plasmid was created with a spacer in the residue binding a metal cation, which is important for the activity of β-galactosidase. A CRISPR1 array plasmid containing a non-self-targeting spacer was used as a control to quantify self-targeting lethality.

Example 4. Transformation.

Plasmids were electroporated into competent S. thermophilus containing the temperature sensitive helper plasmid pTRK669 according to the methods described previously (44). Briefly, an overnight culture of S. thermophilus was inoculated at 1% (v/v) in 50 ml Elliker medium supplemented with 1% beef extract, 1.9% β-glycerophosphate and C _m for selection. When the culture reached an OD ₆₀₀ nm value of 0.3, penicillin G was added to a final concentration of 10 μg/mL to improve electroporation efficiency (45). Cells were harvested by centrifugation and washed 3 times in 10 ml cold electroporation buffer (1 M sucrose and 3.5 mM MgCl ₂ ). Cells were concentrated 100-fold in electroporation buffer and 40 μl of the suspension was aliquoted into 0.1 mm electroporation cuvettes. Each suspension was combined with 700 ng of plasmid. The electroporation conditions were as follows: 2500 V, capacitance - 25 μF and resistance - 200 ohms. Time constants were recorded; the variation interval of which was from 4.4 to 4.6 ms. Suspensions were immediately combined with 950 μl intended for extraction medium and incubated for 8 hours at 37°C. Cell suspensions were plated on selective medium, and electroporation cuvettes were washed with medium to ensure cell recovery.

Example 5 Confirmation of the phenotype of β-galactosidase.

Transformants derived from both CRISPR1 and CRISPR3 were first screened for the β-galactosidase deficient phenotype by streaking colonies on semi-synthetic Elliker medium supplemented with 1% lactose as a solid carbohydrate source. Loss of β-galactosidase activity was confirmed by performing Miller's assays (o-nitrophenyl-vI-galactoside (ONPG)) (46). Briefly, cultures were expanded to late logarithmic phase (OD ₆₀₀ nm=1.2) in 5 ml medium and harvested by centrifugation (4000xg for 10 min). Cells were washed and resuspended in 0.5 ml phosphate buffered saline (GibcoInvitrogen). Each suspension was combined with 100 μl of 0.1 mm thick glass microspheres (Biospec) and then subjected to five 60 s homogenization cycles in a Mini-Beadbeater (Biospec). Then the samples were centrifuged (15000xg for 5 min) to remove cellular debris and intact cells. Cell lysates (10 µl aliquots) were combined with 600 µl substrate solution (60 mM Na ₂ HPO ₄ , 40 mM NaH ₂ PO ₄ , 1 mg/ml ONPG, 2.7 µl/ml β-mercaptoethanol) and incubated for 5 min at room temperature, after which was added 700 μl of stop solution (1 M NaCO ₃ ). Absorbance was recorded at 420 nm and β-galactosidase activity was reported in Miller units calculated as described previously (46).

Example 6 Growth and activity assessment.

Cultures were pretreated for growth evaluation by subculturing for 12 generations in lactose-deficient semi-synthetic Elliker's medium. Fresh medium was inoculated with a 1% (v/v) overnight culture and incubated at 37° C. statically. OD ₆₀₀ was recorded every hour until the cultures reached stationary phase. Milk fermentation was assessed by inoculating an overnight culture into skim milk to a level of 10 ⁸ cfu/ml and incubating at 42°C. The pH was then monitored using a Mettler Toledo Seven Easy pH meter and an Accumet probe. Skimmed milk was purchased from the NCSU Dairy plant and pasteurized for 30 minutes at 80°C.

Example 7 Identification of foreign genomic regions.

In silico prediction of foreign mobile loci to target CRISPR-Cas was performed based on

i) the location, orientation and nucleotide identity of the IS elements, and ii) the location of the vital ORFs.

In Bacillus subtilis, the number of identified vital ORFs was 271, which was determined by the lethality of gene knockouts in the wild-type genome (33).

The S. thermophilus genome was examined for homologues for each vital gene in B. subtilis using the BLASTp search tool with default scoring matrix for amino acid sequences. In S. thermophilus, homologues were identified for about 239 vital ORFs, all of which were encoded by the chromosome (Table 4). Squirrels,

- 33 042506 involved in conserved cellular processes, including DNA replication/homeostasis, translation mechanisms and major metabolic pathways, were easily identified. No homologues were found corresponding to cytochrome biosynthesis/respiration, consistent with the metabolic profile of the fermentative bacteria. Each putative vital ORF was displayed on the reference genome using the SnapGene software, which facilitated the visualization of their location and distribution in S. thermophilus LMD-9 (FIG. 3A).

The IS elements in the S. thermophilus genome were grouped by aligning the transposon coding sequences using the Geneious® software (FIG. 4). Family designations were determined according to BLAST analysis in the scope of the IS element database (www-is.biotoul.fr//). To predict the efficiency of recombination-mediated excision of chromosomal segments, the relative positions of related IS elements were mapped onto the S. thermophilus genome (FIG. 3A). The IS1193 and Sth6 families of IS elements are the most common in the genome and are commonly found in Streptococcus pneumoniae and Streptococcus mutans (34). Despite the predominance of IS1193 elements, it was shown that many of these loci were small fragments, showing some degree of polymorphism and degeneracy, and there were also several copies with a high level of sequence identity (Fig. 5A). In contrast, the Sth6 family showed a significant degree of polymorphism and high degeneracy, with some copies containing significant internal deletions (FIG. 5B). Elements IS1167 and IS1191 were less frequent but showed near-perfect copy fidelity identified in the genome (FIGS. 5C and 5D). Based on the degree of conservation of the length and sequence of elements IS1167 and IS1191 in S. thermophilus and their relative proximity to milk adaptation genes, it was hypothesized that these conserved/highly accurate transposons were recently acquired by the genome.

Combining the locations of the predicted vital ORFs and IS elements, foreign islands flanked by highly reproducible IS elements were identified (FIG. 3A; Table 3). The first island contained an operon unique to S. thermophilus LMD-9 encoding a putative ATP-dependent oligonucleotide transport system with unknown specificity (Fig. 3B) (35). The second island contained the cell wall proteinase PrtS, which mediates the fast fermentation phenotype in S. thermophilus (Fig. 3C) (36).

Notably, although prtS is not widely distributed in S. thermophilus genomes, genomic islands encoding prtS have been shown to be transferred between strains through natural competence (36). The third island contained the putative ATP-dependent copper ion pump protein and was present in every sequenced S. thermophiles strain (Fig. 3D). The fourth island was the largest in length, equal to 102 kb, and in gene content with 102 predicted ORFs, including the lac operon (Fig. 3E). This island was found in all strains of S. thermophilus, with each strain differing in specific gene content and length. To determine the outcome of targeting both endogenous type II systems to the large genomic island, repeat-spacer arrays were generated for the lacZ coding sequence (FIG. 3E) and cloned into pORI28 (FIG. 2). The fourth island was chosen as a target for CRISPR-Cas because of its size, its high prevalence in S. thermophilus strains, and the possibility of screening for the presence of lacZ mutations in the negative phenotype of β-galactosidase.

Example 8 CRISPR-Cas targeting lacZ selects events with large deletions.

In type II systems, Cas9 recognizes DNA and reversibly binds to PAM sequences, which activates Cas9 on the target via the formation of a tracrRNA::crRNA duplex (37), which ultimately results in dsDNA cleavage (Figs. 6A and 6B) (25) . Fig. 14A and 14B are a schematic diagram of the general principle of the cooperative interaction of endogenous CRISPR systems for targeted killing. In particular, in FIG. 14A and 14B show how the type II endogenous systems in Streptococcus thermophilus work together for targeted killing. Thus, in S. thermophilus, programmed cell death was achieved by using the CRISPR-Sth1 (A) or CRISPR-Sth3 (B) type II system by designing a genome-targeted spacer sequence flanked by native repeats whose expression was driven by a native or synthetic promoter. The transcribed repeat-spacer array was processed with host-encoded RNase III and Cas9 to produce mature ssRNAs that recruit Cas9 into the genome to induce double-stranded DNA cleavage leading to cell death.

Transformation with plasmids inducing chromosomal self-targeting via CRISPR-Cas systems has been found to be cytotoxic as measured by the reduction in the number of surviving transformants compared to non-self-targeting plasmids (15, 29). Targeting the lacZ gene in S. thermophilus resulted in a 2.5 log reduction in the number of recovered transformants (FIG. 6C), thus reaching the limit of transformation efficiency. DNA double-strand breaks (DSBs) are a significant threat to the survival of organisms. Relevant repair pathways often require end resection to repair blunt-ended DNA. Cas9-induced endonucleolysis further exacerbates the pressure on DSB-induced mutations, as

- 34 042506 to restore the target locus in the wild type, subsequent CRISPR targeting cannot be avoided.

Determination of the origin of spacers in lactic acid bacteria showed that 22% of spacers have complementarity to themselves and that the corresponding genomic loci were altered, which likely contributed to the survival of naturally occurring self-targeting events (28).

To determine if the target locus had mutated in response to Cas9-induced cleavage, transformants were screened first for loss of β-galactosidase activity. Clones deficient in this activity were genotyped at the lacZ locus. None of the clones sequenced showed any mutations due to the classical or alternative end connection, nor spontaneous single nucleotide polymorphisms. The absence of single nucleotide polymorphisms may be associated with low transformation efficiency exacerbated by low point mutation rates, and the absence of Ku and LigaseIV homologues correlates with the absence of a nonhomologous terminal junction (38). PCR screening showed that wild-type lacZ was not present, but PCR amplicons did not match the native lacZ locus; most likely, amplification of the sequence flanked by IS elements occurred at a different genomic locus. To investigate the genotype responsible for the loss of β-galactosidase activity, single-molecule real-time sequencing was performed in two clones: one of which was obtained by CRISPR3 targeting of the lacZ 5' end and the other was obtained by CRISPR3 targeting of the sequence encoding the ion-binding pocket. required for catalysis of β-galactosidase (FIGS. 7A and 7B). This sequencing strategy was used due to the long read length to circumvent the difficulty of reliably displaying reads at the correct locus due to the large number of IS elements in the genome (35). The reads were mapped onto the reference genomic sequence using Geneious software and the absence of a large segment (approximately 102 kb) encoding the lacZ open reading frame was found (FIGS. 7A and 7B). Both sequenced strains confirmed the reproducibility of large deletion boundaries and showed that the deletion occurs independently of the lacZ spacer sequence or the CRISPR-Cas system used for targeting. However, the sequencing data did not provide a reliable representation of the exact boundaries of the deletion.

The removed segments are 102 kb in size. make up about 5.5% of 1.86 m. p. genome of S. thermophilus. The region contained 102 putative ORFs (STER_1278-1379) encoding ABC transporters, two-component regulatory systems, bacteriocin synthesis genes, phage-associated proteins, lactose catabolism genes, and several hidden genes with no annotated function (35). The effect of the deletion on growth phenotype was assessed in broth culture by measuring OD ₆₀₀ nm as a function of time (FIG. 7C). The deletion clones appeared to have a longer lag phase, lower terminal OD value (p<0.01) and showed significantly longer generation times during the logarithmic phase with a mean of 103 min, compared to 62 min for wild type (p<0.001). Although the deletion derivatives had a smaller genome to replicate (by 5.5%) per generation and did not waste resources on transcription or translation of the excluded ORFs, no clear improvement in their fitness relative to the wild type was observed. The activity of β-galactosidase is a hallmark for the industrial application of lactic acid bacteria and is essential for the preservation of food systems by fermentation. Thus, the ability of lacZ-deficient strains of S. thermophilus to ferment milk was assessed by monitoring the pH values (Fig. 7D). As expected, the deletion strain was not capable of fermenting milk during the course of the experiment, in stark contrast to the rapid fermentation phenotype seen in the wild type.

Example 9 Genomic deletions occur by recombination between homologous IS elements.

To study the deletion mechanism, the nucleotide sequences flanking the segment were determined. The only homologous sequences observed at the junctions were two truncated IS1193 insertion sequences with 91% nucleotide sequence identity over the entire length of 727 bp. Thus, to amplify the genomic DNA of surviving clones containing the deletion, a pair of primers flanking two IS elements was developed. Each of the deletion strains had a well-defined band of predicted size (approximately

1.2 kb), which is a confirmation of a large genomic deletion event (Fig. 8A). Interestingly, a weak amplicon corresponding to a chromosomal deletion was observed in the wild type, indicating that this region may naturally be excluded from the genome at a low rate in wild type populations. The junction amplicon sequencing was performed for 20 clones generated by chromosomal self-targeting with the participation of CRISPR3. Locus genotyping revealed the presence of one chimeric IS element in each clone, and in addition, each clone showed a transition of the upstream element to the downstream sequence within the chimera (FIG. 8B). The observed deletion size ranged from 101.865 to 102.146 bp. The exact size of the transition locus was not constant, but was not random within clones, implying potential bias in the deletion mechanism. S. thermophilus has a typical recombination apparatus, coded as RecA

- 35 042506 (STER_0077), AddAB homologues functioning as double ATP-dependent DNA exonucleases (STER_1681 and STER_1682), and helicase (STER_1742) of the RecD family. The high nucleotide identity between flanking IS elements and the ability of S. thermophilus to perform site-specific recombination (4) confirm the efficacy of RecA-mediated recombination involved in genomic segment excision (Fig. 8C).

The possibility of using CRISPR-Cas targeting to isolate deletions for each locus with the same genetic structure was then evaluated. For this purpose, three CRISPR3 repeat-spacer arrays were created, one of which targeted the oligonucleotide transporter at the first locus, prtS at the second locus, and the ATP-dependent copper ion pump gene at the third locus, and cloned into pORI28 (Fig. 5). To screen for the presence of a deletion, primers flanking the IS elements at each locus were designed to amplify each deletion junction (FIG. 8D). The absence of wild-type loci was also confirmed in each case by designing internal primers for each genomic island (FIG. 8E). After transformations, deletions at each locus were isolated using targeted plasmids and their absence in the wild type was confirmed. Amplicon sequencing of the deletion junction confirmed the presence of one remaining trace of the chimeric IS element, indicating a common deletion mechanism at each locus. Interestingly, the primers flanking the IS elements were also amplified from wild-type gDNA, further indicating that population heterogeneity occurs naturally at each locus due to spontaneous genomic deletions. These results suggest that cleavage of Cas9-specific sequences occurs selectively in variants that do not contain the protospacer-PAM combinations required for targeting. Thus, spontaneous genomic deletions can be isolated using CRISPR-Cas targeting as an efficient selection mechanism for microbial variants that have lost such genomic islands.

Example 10 Screening of populations.

In this study, type IIA native systems contained in S. thermophilus were used to detect spontaneous deletions of large genomic islands. Through independent targeting of the four islands in S. thermophilus, stable mutants were generated that were missing a total of 7% of the genome. Deletion junction characterization suggested that an IS-dependent recombination mechanism contributes to population heterogeneity and provides detection of deletion events ranging in size from 8 to 102 kb. Accurate mapping of chimeric IS elements indicates that natural recombination events are likely responsible for large chromosomal deletions in S. thermophilus and could potentially be used for targeted genome editing.

Our results show that wild-type clones were removed from the population, while mutants without signs of directed CRISPR-Cas survived. Thus, adaptive islands have been identified and validated, demonstrating that precise targeting by endogenous Cas9 can be used to isolate large deletion variants in mixed populations.

The evolution of the bacterial genome occurs through horizontal gene transfer, internal mutation, and reorganization of the genome. Genome sequencing and comparative analysis of S. thermophilus strains revealed significant genome disruption, but also showed that adaptation to enriched nutrient media occurred through niche-specific gene acquisition (18, 35). The presence of MGEs, including integrated and conjugated elements, prophages, and IS elements, in the genomes of S. thermophilus indicates their rapid evolution in the dairy environment (38-39). Mobile genetic traits facilitate the acquisition of genes and, conversely, the inactivation or loss of non-essential sequences. Therefore, MGEs are conferred genomic plasticity as a means of increasing fitness or changing ecological lifestyles. These results clearly indicate that CRISPR-Cas targeting of these elements can influence chromosomal rearrangements and homeostasis. This contrasts with experiments targeting essential features, which led to the selection of variants with inactivated CRISPR-Cas apparatus (Jiang 2013). Mutation of vital ORFs is not an effective approach to avoid CRISPR-Cas targeting, and thus only clones with inactivated CRISPR-Cas systems remain. By design, targeting genetic elements predicted to be hypervariable and foreign demonstrated that variants with altered loci that retained active CRISPR-Cas systems during self-targeting events were viable.

Despite the almost ubiquitous distribution of IS elements in bacterial genomes, they remain a mysterious genetic entity, mainly due to their functional diversity and plasticity (34). The results obtained make it possible to predict recombination between related IS elements by analyzing their location, orientation, and sequence retention (FIGS. 4 and 5). CRISPR-Cas targeting can then be used to empirically test population heterogeneity at each predicted locus and simultaneously increase the recovery of low-frequency mutants. The high occurrence of MGE in lactic acid bacteria and especially in S. thermophilus is consistent with their role in the speciation of these hyperadapted bacteria through genome evolution (39-40). Moreover, the extraction of mutants with genomic deletions by

- 36 042506

CRISPR-Cas targeting can allow phenotypic characterization of genes with unknown function. Mutants showing a deletion of the 102 kb island encoding the lac operon significantly increased the generation time compared to the wild type and achieved a lower final OD value. With 102 predicted ORFs in them, it is likely that additional phenotypes are possible and many genes do not have annotated functions. Given the industrial importance of niche-specific genes such as prtS, this method allows for a direct assessment of how island-encoded genes promote adaptation to growth in milk. Moreover, it occurs in a genomic and ecological context that is natural for these horizontally acquired traits, since they were probably acquired as separate islands. These results provide new opportunities for the application of self-targeted CRISPR-Cas9 systems in bacteria to study transposition, DNA repair mechanisms, and genome plasticity.

CRISPR-Cas systems typically limit genetic diversity through interference with genetic elements, but acquired MGEs may also provide adaptive benefits to host bacteria. Thus, the advantage of maintaining genome-integrated MGE despite CRISPR-Cas targeting is an important factor in genome homeostasis. Taken together, these results indicate that in silico GEI prediction can be linked to CRISPR-Cas targeting to isolate clones showing large genomic deletions. Traces of a chimeric insertion sequence at each deletion junction point to a common deletion mechanism for all four islands. The high occurrence of self-targeted spacers showing identity with genomic loci, combined with experimental demonstrations of genomic alterations, suggests that CRISPR-Cas self-targeting may contribute significantly to the evolution of the bacterial genome (28, 30). Taken together, the study of large deletions induced by CRISPR-Cas confirms that this approach is a fast and efficient means of evaluating the importance and functionality of annotated gene clusters and determining minimal bacterial genomes based on chromosome deletions occurring through transposable elements.

In FIG. 9 shows certain genetic loci for lethality assessment based on the type II CRISPR-Cas system by targeting the genome of Streptococcus thermophilus LMD-9. Methods for performing this assessment are known in the art, see Selle and Barrangou PNAS. 112 (26): 8076-8081 (2015).

Both type II orthogonal systems (CRISPR1 and CRISPR3) were tested; CRISPR1 targets are shown in dark gray and CRISPR3 targets in light gray. Specific genetic traits were chosen to test for (i) intergenic regions (INT), (ii) transposable genetic elements (IS, GEI1-GEI3, PRO, lacZ, EPS), (iii) vital genes (dltA, LTA), (iv ) replichora poles (ORI, TER) and forward or reverse DNA strands (external targets in relation to internal targets).

In FIG. 10 shows CRISPR-based lethality achieved by targeting the regions shown in FIG. 9. The logarithmic reduction in units of CFU was calculated in relation to the transformation of the control - non-self-targeted plasmid; pORI28; Lethality was within the 2-3 log reduction for all tested targets regardless of chromosomal location, coding sequence, or survival importance.

In FIG. 11 shows the transcription profiles of strains with CRISPR-mediated genomic island deletions. Isolation and genotyping of cells that survived CRISPR targeting of genomic islands 1-4 led to the identification of stable independent mutants not containing the genomic island targeted in each experiment. The cells were then expanded and their total RNA was isolated and sequenced. Using this approach, transcription profiles were obtained by mapping reads when sequencing into the reference genome. In each case, the lack of sequencing data for the predicted genomic island locus further suggested loss of the target genetic entity, while having minimal impact on core gene expression throughout the rest of the genome.

In addition, RNA sequencing data confirms deletion boundaries by mapping read coverages and comparing transcription values, and confirms phenotype recognition by comparative transcriptomics generated using the same data set. In particular, high throughput RNA sequencing data confirms the absence of transcriptional activity present in the expected regions of the deletions, as shown in FIG. 12. In FIG. 12 shows Log ₂ read coverage for sequencing transformed RNA strains with genomic island deletions and for each strain with genomic island (GEI1-GEI4); the lack of sequencing data for the predicted loci with genomic islands also confirmed the loss of the target genetic entity with minimal impact on core gene expression throughout the rest of the genome.

- 37 042506

Fig. 13 further confirms the absence of transcriptional activity of the deleted genes. For each of the strains with deletions of the genomic islands (GEI1-GEI4), expression of the genes encoded on each of the target islands (black) was minimal. GEI1 encoded genes are shown in the upper left panel, GEI2 encoded genes are shown in the upper right panel, GEI3 encoded genes are shown in the lower left panel, and GEI4 encoded genes are shown in the lower right panel. In general, deletions of genomic islands 1 and 2 had minimal effect on the transcription of other genes (grey), while deletion of genomic islands 3 and 4 appeared to affect the transcription of other genes not encoded in the islands.

In addition, RNA sequencing data was used to compare transcription levels of genes not encoded on the remote island (GEI4), i.e. other genes still present on the chromosome and identification of phenotypes associated with genomic deletions. Genes that are differentially transcribed in the deletion strain indicate that cellular processes are affected by genes that have been lost, or that there is compensation for the loss of activity of these genes. Thus, conclusions can be drawn about the pathways to which these genes or genomic regions belong. In table. 5 is a list of differentially expressed genes identified in the GEI4 deletion strain. Many of the genes observed to be differentially expressed are related to the biosynthetic capacity of Streptococcus thermophilus, including the biosynthesis of aromatic amino acids and purines.

Example 11 Targeted Killing of Lactobacllus easei with CRISPR-Cas Type II System.

Exemplary type II CRISPR-Cas guides for L. casei are shown in FIG. 15. The top panel shows the predicted guide, while the bottom left panel shows an exemplary dual guide structure and the bottom right panel shows an exemplary single strand guide structure.

Example 12 Targeted Killing of Lactobacllus gasserl with CRISPR-Cas Type II System.

Exemplary type II guides for targeted killing of L. gasseri are shown in FIG. 16. The top panel shows the predicted guide and the bottom left panel shows the correct crRNA:tracrRNA double guide (confirmed by RNA sequencing), the bottom right panel shows an exemplary predicted single strand overhang guide.

The plasmids were transformed into L. gasseri, each plasmid having a different construct: an empty pTRK563 vector, a construct with the correct protospacer but the wrong PAM, a correct PAM but a protospacer that is not in the array, and a correct protospacer and PAM. The results are shown in FIG. 19. The plasmid having the correct protospacer and the correct PAM showed a significantly higher degree of interference targeting and cell death.

Example 13 Targeted killing of Lactobacillus pentosus using the Type II CRISPR-Cas system.

Exemplary type II guides for targeted killing of L. pentosus are shown in FIG. 17. The top panel shows the predicted guide. The lower left panel shows the correct crRNA:tracrRNA double guide (confirmed by RNA sequencing) and the lower right panel shows an exemplary predicted artificial single-stranded overhanging guide.

The plasmids were transformed into L. pentosus, with each plasmid having a different construct: a construct with the correct protospacer but the wrong PAM, a construct with the correct PAM but a protospacer that is not in the array, an empty pTRK563 vector, and a construct with the correct protospacer and the correct PAM. The results are shown in FIG. 20. The plasmid with the correct protospacer and the correct PAM (Lpe1 gttaat) showed a significantly higher degree of interference targeting and cell death.

Example 14 Targeted killing of Lactobacillus jensenii using the Type II CRISPR-Cas system.

In FIG. 18 are exemplary CRISPR-Cas type II guides. The left panel shows the correct crRNA:tracrRNA double guide confirmed by RNA sequencing, the right panel shows an example predicted artificial single strand guide.

The plasmids were transformed into L. jensenii, each of the plasmids had different constructs: a construct containing an empty pTRK563 vector, a construct with the correct protospacer but the wrong PAM, a construct with the correct PAM but with a protospacer that is not in the array, and a construct having correct protospacer and correct PAM. The results are shown in FIG. 22. The plasmid having the correct protospacer and the correct PAM showed a significantly higher degree of interference targeting and cell death.

Example 15 Targeted killing of Lactobacillus casei NCK 125 using the Type I CRISPR-Cas system.

In FIG. 21 is an exemplary type I CRISPR-Cas guide for L. casei that contains a native type I leader and a repeat found in L. casei NCK 125. PAM 5'-YAA-3' was predicted using native spacer sequences in body. This artificial array contains a spacer that targets the 16s rDNA gene in the host genome. The results are shown in FIG. 22, which shows a significant decrease between the empty vector and two different artificial arrays: one containing a single spacer targeting the +strand in the 16s gene (1-2 alt) and the other containing the original spacer targeting the +strand and also containing an additional spacer , targeting -chain in the 16s gene (1, 2, 3).

CRISPR-Cas systems as disclosed herein can be used, for example, to (i) target pathogen reduction in the event of a medical intervention (e.g., pathogens including, but not limited to, fungi, nematodes, protozoan (e.g., malaria) cestode, coccidia ( microsporidia), trematodes, pentastomids, acanthocephals, arthropods, etc.);

(ii) to protect consumables (food systems, animals, crops);

(iii) to control and/or remove unwanted organisms from industrial enzymatic processes (raw materials, process equipment, starter cultures); and (iv) to control ecological microbial consortia for impacts on ecosystems and/or chemical cycles, and for remediation.

Table 1

Bacterial strains and plasmids

Strain designation Description Source E. coli EC1000 Host for pORI plasmids, chromosomal repA ⁺ (pWVOl), Km ^R Host for pTRK935 47 S. thermophilus LMD-9 S thermophilus LMD-9 with pTRK669 Wild type Wild type, RepA ⁺ and Cm ^R acquired with pTRK669 40 in that research Plasmids pORI28 A widely used non-replicative vector, Em ^R 47 pTRK669 Ts-helper plasmid repA ⁺ , Cm ^R 44 pCRISPRl::lacZ pORI28::CRISPRl-nnflep-RSR-IacE N-terminal spacer This study pCRISPR3::lacZ pORI28::CRISPRl-nnflep-RSR-IacE active site spacer This study pCRISPR3::ABC pORI28::CRISPRl-nnflep-RSR-ABC spacer This study pCRISPR3::Cu pORI28::CRISPRl-nnflep-RSR-Cu spacer pump This study pCRISPR3::prts pORI28::CRISPRl-nnflep-RSR-prts spacer This study pCRISPR3: -.lacZ pCRISPRl::nes mo-targeted pORI28::CRISPR3-nnflep-RSR-IacX N-terminal spacer pORI28::CRISPRl-nnflep-RSR non-self-targeted spacer This study This study

- 39 042506

table 2

Primers

Primer name Subsequence Function Cl_N-term_F CAAGAACAGTTATTTGATTTTATAATCACTATGTGGGTATGAAAATCTCAAAAATCATTTG AGGTTTTTGTACTCTCAAGATTTAAGTAACTGTACAACATTAAGAGATTGTCTTAACTT Matrix for SOE-PCR C3_N-term AGCGGATAACAATTTCACGTTTTGGAACCATTCGAAACAACACAGCTCTAAAACTCAGAA AATTCTTCAAGAGATTCAAAATACTGTTTTGGAACCATTCGAAACAACACAGCTCTAAAA CCTCGTAGGATATCTTTTCTAC Matrix for SOE-PCR Cl_N-term_R AGCGGATAACAATTTCACGTTGTACAGTTACTTAAATCTTGAGAGTACAAAAACAGGGGA GATGAAGTTAAGACAATCTCTTAATGT Matrix for SOE-PCR C3_A-site AGCGGATAACAATTTCACGTTTTGGAACCATTCGAAACAACACAGCTCTAAAACGAAGTC TTGGTCTTCCAACCAGCTTGCTGTAGTTTTGGAACCATTCGAAACAACACAGCTCTAAAA CCTCGTAGGATATCTTTTCTAC Matrix for SOE-PCR C3_ABC AGCGGATAACAATTTCACGTTTTGGAACCATTCGAAACAACACAGCTCTAAAACGATAACAC GAGATAAAACATCCAGCCCACCGTTTTGGAACCATTCGAAACAACACAGCTCTAAAACctcg taggatatcttttctac C3_prtS AGCGGATAACAATTTCACGTTTTGGAACCATTCGAAACAACACAGCTCTAAAACGTTGTAGC TTTGAGGTCTGAGAATACACGCGTTTTGGAACCATTCGAAACAACACAGCTCTAAAACctcg taggatatcttttctac C3_Cu AGCGGATAACAATTTCACGTTTTGGAACCATTCGAAACAACACAGCTCTAAAACGATTGC TCAATCAATCGTTTCAGCTGCTAAGTTTTGGAACCATTCGAAACAACACAGCTCTAAAAC ctcgtaggatatcttttctac C3LF AGCAGGGATCCTGGTAATAAGTATAGATAGTCTTG Amplification of Sth3 Leader from dDNA C3LR CTCGTAGGATATCTTTTCTAC Amplification of Sth3 Leader from dDNA C1F AGCAGGGATCCCAAGAACAGTTATTTGATTTTATAATC CRISPR1 SOE-PCR Direct C3F AGCAGGGATCCTGGTAATAAGTATAGATAGTCTTG CRISPR3 SOE-PCR Direct C1C3R TGCTGGAGCTCGTGAAATTGTTATCCGCT CRISPR1 and CRISPR3 SOE-PCR Reverse 1193F TTGAACACTAGGAACCTCATA Deletion junction amplification 1193R CGTAAGGTTTTGATGACTCAAG Deletion junction amplification pORI28F TTGGTTGATAATGAACTGTGCTG MCS sequencing from pORI28 pORI28R TTGTTGTTTTTATGATTACAAAAGTGA MCS sequencing from pORI28

Table 3

Putative foreign genomic islands and islets

Genomic th island Region ORS Length, T. π . O . Genomic content, % Known genes IS- family 1 STER_139- 7.81 37.1 Transporters IS6 STER_148 oligopeptides 2 STER_840- 10.29 39, 9 Proteinase PrtS ISSthl6/ STER_848 IS1167 3 STER_881- 8.71 39, 3 Copper ion pump IS1191 STER_888 4 STER_1277- 101.76 37.2 Catabolism IS1193 STER_1380 lactose, regulation 2- component, synthesis bacteriocin, ABC conveyors

- 40 042506

Table 4

Homologues to about 239 vital ORFs identified in S. thermophilus

Genome _part STER Start end direction coating eValue aa id Bacillus subtilis annotation CSTER 1 101 1465 + DnaA protein initiator of chromosomal replication 98% 4.00E124 44% DnaA protein initiator chromosomal replication CSTER 2 1620 2756 + beta subunit of DNA polymerase III 99% 1.00E-88 39% dnan beta subunit of DNA polymerase III CSTER 6 5818 6387 + Peptidyl-tRNA hydrolase 97% 1.00E-61 51% CSTER 9 10331 10702 + Cell cycle protein 94% 1.00Е-05 22% cell division DivIC protein CSTER 12 12122 13387 + tRNA (He)-lyzidine synthase, MesJ 92% 3.00E-40 32% tRNA (He)-lysidine synthase tils CSTER 13 13469 14011 + hypoxanthine-guanine phosphoribosyltransferase 99% 2.00E-82 63% hypoxanthine-guanine phosphoribosyltransferase hprt CSTER 40 25595 26425 + MgeC protein that determines the shape of cells 94% 1.00Е-22 28% MgeC protein that determines the shape of cells CSTER 43 28617 29582 + ribose phosphate pyrophosphokinase 97% 3.00Е145 65% Ribose phosphate pyrophosphokinase prs CSTER 47 32842 33846 + Assumption glycerin-3- phosphate acyltransferase 94% 9.00E- 124 54% Phosphate acyltransferase PlsX CSTER 48 33846 34091 + acyl-carrying protein 76% 1.00Е-08 40% acyl-carrying protein CSTER 65 53036 54727 - arginyl-tRNA synthetase 98% 6.00Е-52 28% CSTER 95 72798 77192 + DNA polymerase III Pole 99% 0.00Е+00 51% DNA polymerase III Po1Stip CSTER 105 82956 83723 + 30S ribosomal protein S2 96% 1.00E- 118 69% CSTER 106 83841 84881 + elongation factor translations Ts 97% 8.00E-72 44% CSTER 117 97363 98706 + cysteinyl-tRNA synthetase 99% 1.00E- 178 54% CSTER 127 104406 104852 + 50S ribosomal protein L13 99% 9.00E-57 57% CSTER 128 104880 105272 + 30S ribosomal protein S9 100% 3.00E-59 68% CSTER 193 159363 160967 + STR synthetase 99% 0.00Е+00 68% Pyrg synthase CSTER 199 166439 166897 - canned hip. protein. 81% 2.00E-07 28% NrdI protein CSTER 208 176203 176472 + 30S ribosomal protein S15 100% 6.00E-38 63% CSTER 217 183028 184185 + undecaprinyl pyrophosphate phosphatase 98% 2.00E-68 38% possibly undecaprinyl pyrophosphate phosphatase Nacetylglucosomenil 1phosphate transferase tagO CSTER 218 184346 185116 + ABC transporter ATPase 95% 8.00E- 130 71% Vegetable protein 296 suf C CSTER 219 185153 186415 + hip. protein 97% 4.00Е111 42% FeS assembly protein SufD clusters CSTER 220 186469 187701 + predp. aminotransferase (class V) 98% 0.00Е+00 60% cysteine desulfurase SufS CSTER 221 187688 188122 + NifU protein family 95% 3.00E-48 51% zinc dependent sulfotransferase SufU CSTER 245 208199 208993 + phosphotidate cytidylyltransferase 98% 3.00E-67 41% phosphotidate cytidylyltransferase CSTER 247 210343 212205 + prolyl-tRNA synthetase 98% 0.00Е+00 50% CSTER 252 215735 216022 + Co-chaperone GroES (HSP10) 97% 1.00E-18 43% CSTER 253 216071 217690 + GroEL chaperone (HSP60 family) 98% 0.00Е+00 75% CSTER 261 224055 224204 + 50S ribosomal protein L33 97% 9.00Е-12 50% CSTER 262 224216 224392 + Subunit of SecE translocase preprotein 81% 1.40Е+00 21% Subunit of SecE translocase preprotein CSTER 268 227616 230117 + leucyl-tRNA synthetase 99% 0.00Е+00 70% CSTER 273 232342 233796 + nicotinate phosphoribosyltransferase 97% 0.00Е+00 63% nicotinate phosphoribosyltransferase CSTER 274 233808 234629 + NAD synthetase 100% 9.00E- 109 59% NH(3) dependent NAD(+) nade synthetase CSTER 286 248252 249580 + UDP-N-acetylmuramatalanine ligase 99% 3.00Е170 55% UDP-N-acetylmuramatalanine ligase murC CSTER 302 260849 261664 + Glutamate racemase 94% 7.00E-83 48% Glutamate racemase 1 gaC CSTER 307 264328 265041 + Protein A segregation and condensation 93% 5.00E-37 39% Protein A segregation and condensation CSTER 308 265034 265615 + Protein In segregation and condensation 94% 9.00E-36 40% Protein In segregation and condensation CSTER 313 269788 270297 + rRNA methyltransferase 96% 3.00E-58 51% rRNA methyltransferase CSTER 349 303983 305959 + transketolase 98% 0.00Е+00 58% transketolase tkt CSTER 357 312857 314032 + DnaB protein initiating chromosome replication/attachment to membrane 63% 3.00Е-02 18% Protein initiating chromosome replication and attachment to the membrane CSTER 358 314036 314938 + ribosomal protein Dnal 99% 7.00E-58 35% ribosomal protein Dnal

- 41 042506

CSTER 359 315044 316354 + GTP binding protein EngA 100% 0.00Е+00 67% GTPase Der CSTER 368 321054 322394 - seryl-tRNA synthetase 100% 0.00Е+00 63% CSTER 376 329673 330116 + conservative hip. protein 89% 6.00E-33 43% tRNA biosynthesis protein threonylcarbamoyladenosine a TsaE CSTER 380 332545 333732 + elongation factor transcriptions 90% 2.00E113 46% Transcription termination/anti-termination protein NusA CSTER 383 334363 337194 + initiation factor transcription of IF-2 99% 0.00Е+00 55% CSTER 387 339864 341309 UDP-Nacetylmuromoylalanyl-Dglutamate--2,6diaminopimelate ligase 92% 3.00Е-52 29% UDP-Nacetylmuromoylalanyl-Dglutamate--2,6diaminopimelate ligase murE CSTER 419 364962 365894 + predp. manganese-dependent inorganic pyrophosphatase 99% 3.00E125 58% manganese-dependent inorganic pyrophosphatase ppac CSTER 430 375355 375579 + Acyl-carrying protein 93% 5.00E-14 49% Acyl-carrying protein CSTER 432 376667 377593 + Acyl-carrying protein S-malonyltransferase 95% 3.00E-86 47% malonyl CoA-acyl transfer protein transferase CSTER 433 377606 378340 + 3-ketoacyl-(acyl-carrying protein ok) reductase 99% 6.00E-79 47% 3-oxoacyl-[acyl-carrying protein ok] reductase FabG CSTER 434 378401 379633 + 3-oxoacyl-(acyl-carrying protein ok) synthase II 99% 1.00E- 133 48% 3-oxoacyl-[acyl-carrying protein ok] synthase 2 CSTER 435 379637 380125 + Biotin subunit carboxyl-carrying protein acetyl-CoA carboxylase 98% 9.00Е-26 37% biotin carboxyl transfer protein acetyl-CoA carboxylase CSTER 437 380667 382037 + Subunit of biotin carboxylase acetyl-CoA carboxylase 98% 0.00Е+00 60% Biotin carboxylase 1 CSTER 438 382043 382909 + Beta subunit of acetylCoA carboxylase 94% 8.00E-98 51% Beta subunit of carboxyl transferase acetyl-coenzyme A carboxylase CSTER 439 382906 383676 + alpha subunit acetyl-CoA carboxylase 76% 2.00E-81 53% Alpha subunit of carboxyl transferase acetyl coenzyme A carboxylase CSTER 442 385819 387417 + Conservative hip. protein 98% 0.00Е+00 58% ribonuclease Y ymda CSTER 455 402156 402470 + 50S ribosomal protein L21 99% 2.00Е-44 66% CSTER 456 402507 402797 + 50S ribosomal protein L27 95% 5.00E-47 79% CSTER 460 405038 405805 + dihydrodipicolinate reductase 98% 7.00E-95 53% 4-hydroxy- tetrahydrodipicolinate reductase dapb CSTER 461 405802 407010 + tRNA CCA pyrophosphorylase 98% 6.00E-86 40% CCA-Adding Enzyme CSTER 475 422256 422813 + recycling factor ribosomes 100% 2.00E-68 56% CSTER 485 430547 432550 + methionyl-tRNA synthetase 98% 0.00Е+00 58% CSTER 492 438748 439890 + protein precursor protease maturation 91% 6.00E-11 26% PrsA foldase protein CSTER 493 440232 442850 + alanyl-tRNA synthetase 99% 0.00Е+00 52% CSTER 513 460453 463104 + valyl-tRNA synthetase 99% 0.00Е+00 63% CSTER 523 469888 471168 + cell division FtsW protein 93% 4.00E-59 34% putative lipid II flippase FtsW CSTER 524 471406 472602 + Elongation factor You 99% 0.00Е+00 76% CSTER 525 472851 473609 + triosephosphate isomerase 97% 8.00E- 109 62% triosephosphate isomerase tpia CSTER 526 473848 474477 + thymidylate kinase 96% 4.00E-73 55% Thymidylate kinase tmk CSTER 527 474486 475361 + Delta subunit of DNA polymerase III 96% 8.00E-41 33% Delta subunit of DNA polymerase III CSTER 539 484827 485744 + Alpha subunit glycyl-tRNA synthetase 97% 4.00E169 74% CSTER 540 486028 488064 + Beta subunit of glycyltRNA synthetase 97% 0.00Е+00 45% CSTER 567 512413 512916 + 50S ribosomal proteinIO 100% 7.00E-61 57% CSTER 568 512991 513359 + 50S ribosomal protein L7/L12 100% 4.00E-38 67% CSTER 603 548926 550308 + N-acetylglucosamine-!phosphate uridyltransferase 97% 3.00Е164 52% Bifunctional protein GlmU CSTER 623 566278 566781 + dihydrofolate reductase 94% 8.00E-34 38% dihydrofolate reductase dfra

- 42 042506

CSTER 626 568210 568809 + GTPase EngB 96% 7.00E-92 63% possible GTP- binding protein EngB CSTER 632 573613 574254 - prev. glycerol-3-phosphate acyltransferase PlsY 90% 3.00E-40 46% glycerol-3-phosphate acyltransferase plsy CSTER 633 574392 576341 + Subunit B of DNA topoisomerase IV 97% 0.00Е+00 71% Subunit B of DNA topoisomerases 4 CSTER 634 576969 579434 + Subunit A of DNA topoisomerase IV 95% 0.00Е+00 54% Subunit A of DNA topoisomerases 4 CSTER 660 598871 599725 + methylenetetrahydrofolate dehydrogenase/ methylenetetrahydrofolate cyclohydrolase 99% 2.00Е109 56% Bifunctional protein Fold CSTER 668 605570 606469 + GTPase Era 98% 5.00Е143 64% GTPase Era CSTER 670 607313 607927 + dephospho-CoA canase 95% 2.00Е-50 45% dephospho-CoA kinase soae 672 609192 609338 50S ribosomal prot. L33 97% 1.00E-16 52% CSTER 684 620012 621316 + enolase 100% 0.00Е+00 70% enolase epo CSTER 731 664470 665690 predp. CYTOSIN-C5 spec. DNA methylase 60% 5.00E-16 31% Possible subunit of YdiO methylase BsuMI modification CSTER 733 666939 668429 - lysyl-tRNA synthetase (class II) 97% 0.00Е+00 64% CSTER 761 694548 695582 + Delta subunit of DNA polymerase III 84% 2.00E-37 33% Uncharacterized YqeN protein CSTER 773 704704 706056 + UDF-N- acetylmuramoylalanine--Bglutamate ligase 98% 8.00E- 147 49% UDF-N- acetylmuramoylalanine--Bglutamate ligase murD CSTER 774 706060 707130 + N-acetylglucosaminyl transferase 95% 3.00E-30 27% UD Φ-N-acetylglucosamineN-acetylmur amyl(pentapeptide) phosphorylundecaprenol N- acetylglucosamine transferase murG CSTER 775 707140 708264 + Cell division protein FtsQ 79% 4.00E-15 26% Cell division protein DivIB CSTER 776 708388 709764 + Cell division protein FtsA 84% 4.00E103 44% Cell division protein FtsA CSTER 777 709793 711115 + Cell division protein FtsZ 92% 2.00E- 123 53% Cell division protein FtsZ CSTER 783 714803 717592 + isoleucyl-tRNA synthetase 99% 0.00Е+00 58% CSTER 787 720193 720459 - 50S ribosomal protein L31 100% 1.00Е-22 50% CSTER 793 725315 726394 + release factor peptide chain 1 99% 6.00E- 158 59% CSTER 796 727911 729161 + Serine hydroxymethyltransferase 97% 2.00Е171 60% Serine hydroxymethyltransferase glya CSTER 833 760678 762396 - predp. phosphoglucomutase 98% 0.00Е+00 47% phosphoglucomutase pgm CSTER 850 783500 783736 - 30S ribosomal protein S20 94% 1.00E-13 46% CSTER 864 797961 799307 + asparaginyl-tRNA synthetase 99% 4.00E180 56% CSTER 903 833853 835661 + D-fructose-6-phosphate amidotransferase 100% 0.00Е+00 59% glutamine--fructose-6phosphate aminotransferase [isomerization] glmS CSTER 915 845349 846911 + protein particles signal recognition 95% 2.00Е178 57% protein particles signal recognition CSTER 919 848991 849845 + Ribosomal biogenesis GTPase 98% 8.00E- 101 50% Ribosomal biogenesis GTPase rbga CSTER 923 852605 854749 + DNA topoisomerase I 98% 0.00Е+00 64% DNA topoisomerase 1 CSTER 994 915311 917623 + ATP-dependent DNA helicase PsrA 99% 0.00Е+00 54% ATP-dependent DNA helicase PsrA CSTER 1034 959843 961231 Subunit E2 branched dehydrogenase alpha keto acids 99% 5.00E-69 34% Succidyltransferase residue component dihydrolipoyllisin 2- oxoglutarate dehydrogenase complex odhb CSTER 1036 962412 963383 acetoin dehydrogenase complex, E1 component, alpha subunit 81% 3.00E-33 28% Alpha subunit of component E1 of pyruvate dehydrogenase pdha CSTER 1087 1007529 1007888 - 50S ribosomal protein L2 0 85% 2.00Е-56 80% CSTER 1088 1007945 1008145 - 50S ribosomal protein L35 100% 1.00E-23 62% CSTER 1089 1008184 1008714 initiation factor transcription 3 (IF-3) 98% 2.00E-63 60% CSTER 1102 1017867 1018880 release factor peptide chain 2 91% 2.00E137 57% CSTER 1115 1029796 1031136 Sensory histidine kinase 97% 4.00Е117 71% Regulatory protein YycF transcription CSTER 1116 1031129 1031836 - Two Component Response Regulator 68% 2.00Е120 47% Sensory histidine kinase YycG

-43 042506

CSTER 1123 1036555 1037826 UDΦ-N-acetylglucosamine 1- carboxyvinyltransferase 96% 2.00E172 59% UDΦ-N-acetylglucosamine 1- carboxyvinyltransferase 1 muraa CSTER 1135 1049456 1050649 - S-adenosylmethionine synthetase 97% 0.00Е+00 67% S-adenosylmethionine synthetase metk CSTER 1136 1050929 1051867 + biotin-(acetyl-CoA carboxylase) ligase 92% 4.00E-44 33% bifunctional BirA ligase/repressor CSTER 1138 1052266 1053918 - DNA polymerase III, gamma/tau subunit 93% 3.00E137 44% Gamma subunit of DNA polymerase III/tau Dnax CSTER 1144 1056546 1056893 - 50S ribosomal protein L19 100% 2.00E-61 77% CSTER 1164 1073225 1074244 6-phosphofructokinase 93% 4.00E124 61% ATP-dependent 6- phosphofructokinase pfka CSTER 1165 1074337 1077447 - DNA polymerase III, alpha subunit of DnaE 96% 0.00Е+00 35% Alpha subunit of DNA polymerase III dnae CSTER 1166 1077600 1078385 Translation factor pyruvate (SUA5) 42% 3.00Е-04 24% ywlC unknown conserved protein with pyruvate RNA-binding motif TW CSTER 1175 1085950 1086225 - histone-like DNA binding protein 95% 4.00E-40 72% DNA-binding protein HU 1 CSTER 1182 1091629 1092501 geranylgeranyl pyrophosphate synthase 89% 5.00E-58 44% farnesyl diphosphate synthase ispa yqid CSTER 1188 1095764 1096462 DNA replication protein DnaD 85% 1.00Е-07 22% DNA replication protein DnaD CSTER 1193 1101272 1102201 ribonuclease Z 99% 2.00Е105 50% Ribonuclease Z rnz CSTER 1197 1105450 1106877 cell division protein 88% 2.00E-57 38% Rod form-determining protein RodA CSTER 1230 1131390 1132742 - Phosphoglucosamine mutase 100% 0.00Е+00 63% Phosphoglucosamine mutase ybbt glnM CSTER 1248 1154457 1156616 + ribonucleotide diphosphate reductase, alpha subunit 98% 0.00Е+00 47% ribonucleotide diphosphate reductase, alpha subunit nrde CSTER 1249 1156775 1157737 + ribonucleotide diphosphate reductase, beta subunit 97% 8.00E-98 49% ribonucleotide diphosphate reductase, beta nrdf subunit CSTER 1256 1161831 1164284 - DNA gyrase, A subunit 98% 0.00Е+00 62% DNA gyrase, A subunit CSTER 1267 1174041 1176449 phenylalanyl-tRNA synthetase, beta subunit 99% 0.00Е+00 47% CSTER 1270 1177285 1178328 phenylalanyl-tRNA synthetase, alpha subunit 98% 3.00E161 62% CSTER 1271 1178950 1182483 ATPava chromosomal segregation, SMC protein 99% 0.00Е+00 37% separating chromosomes Smc protein CSTER 1272 1182486 1183175 - ribonuclease III 89% 4.00E-68 47% ribonuclease 3 CSTER 1273 1183332 1184267 dihydrodipicolinate synthase 93% 5.00E-88 47% 4-hydroxytetrahydropicolinate synthase dapA CSTER 1274 1184605 1185681 - aspartate semialdehyde dehydrogenase 99% 1.00E- 143 58% aspartate semialdehyde dehydrogenase asd CSTER 1382 1293065 1294063 thyredoxin reductase 97% 7.00E113 50% ferredoxin--NADP reductase 2 yumc CSTER 1383 1294065 1294784 tRNA (guanine-N(1)-)- methyltransferase 100% 6.00E-87 56% tRNA (guanine-N(1)-)- methyltransferase CSTER 1395 1303326 1304261 - methionyl-tRNA formyltransferase 96% 5.00E-98 49% CSTER 1396 1304279 1306675 Primosomal complex assembly protein PriA 99% 0.00Е+00 48% Primosomal protein N PriA CSTER 1398 1307153 1307782 - Guanylate kinase 98% 5.00E-87 59% Guanylate kinase gmk CSTER 1399 1308015 1309406 Cell division protein FtsY 97% 8.00E- 121 55% particle receptor, recognizing the FtsY signal CSTER 1422 1330503 1331339 Inorganic polyphosphate /ATP-NAD kinase 100% 5.00E-78 44% OVER kinase 1 ppnk CSTER 1425 1333019 1333990 + ribose phosphate pyrophosphokinase 100% 4.00Е113 54% ribose phosphate pyrophosphokinase prs CSTER 1426 1333994 1335106 + predp. cysteine desulfurase 98% 2.00Е115 47% predp. cysteine desulfurase IscS CSTER 1448 1355769 1356878 - Sigma factor RNA RpoD polymerases 93% 6.00E- 167 70% Sigma factor RNA SigA polymerases CSTER 1449 1356882 1358693 - Primase DNA 68% 9.00E-86 37% DnaG primase DNA CSTER 1451 1359076 1359252 30S ribosomal protein S21 98% 3.00E-29 89% CSTER 1464 1371306 1372619 - GTPase ObgE 100% 0.00Е+00 67% GTPase ObgE CSTER 1480 1387053 1389005 - subunit B of gyrase DNA 100% 0.00Е+00 68% subunit B of gyrase DNA

- 44 042506

CSTER 1497 1401241 1402143 UDF-N- acetylenolpyruvoylglucose amine reductase 98% 1.00E-66 40% UDF-N- acetylenolpyruvoylglucose amine reductase murB CSTER 1506 1409996 1410268 - 30S ribosomal protein S16 100% 5.00E-42 67% CSTER 1512 1415065 1416078 - predp. lipid kinase 95% 1.00E-96 51% Diaglycerol kinase dagK CSTER 1513 1416088 1418034 - NAD-dependent DNA ligase 97% 0.00Е+00 55% DNA ligase LigA CSTER 1516 1419659 1420519 - methionine aminopeptidase 99% 6.00E-56 37% CSTER 1519 1422447 1423709 UDΦ-N-acetylglucosamine 1- carboxyvinyltransferase 96% 6.00E- 125 46% UDΦ-N-acetylglucosamine 1- carboxyvinyltransferase 1 muraa CSTER 1522 1426828 1427583 1-acyl-sn-glycerol-3phosphate acyltransferase 92% 1.00E-29 32% 1-acyl-sη-glycerol-3-phosphate acyltransferase plsC CSTER 1534 1439747 1441120 UDP-N-acetylmuramoyltripeptide-B-alanyl-Dalanyl ligase 98% 2.00E-98 38% UDP-N-acetylmuramoyltripeptide-B-alanyl-Dalanyl murF ligase CSTER 1544 1447537 1448583 D-alanyl-alanyl synthetase A 98% 2.00E-95 42% D-alanyl--D-alanyl ligase ddl CSTER 1583 1483475 1484107 Nicotinic acid mononucleotide adenylyltransferase 98% 2.00E-62 44% nicotinate-nucleotide adenylyltransferase nadd CSTER 1584 1484211 1484528 predp. RNA binding protein 95% 1.00E-24 50% possible RNA- binding protein Yqel CSTER 1585 1484767 1485885 GTP binding protein YqeH 100% 6.00E- 163 59% Uncharacterized protein YqeH CSTER 1590 1488021 1489463 aspartyl/glutamyl-tRNA amidotransferase, subunit B 99% 0.00Е+00 63% CSTER 1591 1489463 1490929 aspartyl/glutamyl-tRNA amidotransferase, subunit A 99% 0.00Е+00 59% CSTER 1592 1490929 1491231 aspartyl/glutamyl-tRNA amidotransferase, subunit C 97% 1.00E-18 41% CSTER 1615 1511378 1512298 - Thioredoxin reductase 95% 3.00Е126 58% Thioredoxin reductase trxb CSTER 1665 1554189 1555211 phospho-N-acetylmuramoyl pentapeptide transferase 92% 1.00E-66 41% phospho-N-acetylmuramoyl pentapeptide transferase mray CSTER 1666 1555213 1557480 predp. penicillin- binding protein 2X 90% 9.00E-88 32% penicillin-binding protein 2B CSTER 1667 1557484 1557804 Cell division protein FtsL CSTER 1701 1591284 1592387 - Alanine racemase 93% 1.00E-98 43% Alanine racemase 1 air CSTER 1702 1592408 1592767 predp. 4'- phosphopantetheynyl transferase 97% 6.00E-29 41% holo-[acyl-carrying protein] synthase CSTER 1705 1594955 1597504 - Preprotin subunit SecA translocases 100% 0.00Е+00 55% Preprotin subunit SecA translocases CSTER 1726 1616337 1616576 - 30S ribosomal protein S18 100% 5.00E-32 65% CSTER 1727 1616618 1617136 A protein that binds single-stranded DNA 93% 1.00Е-41 56% Protein B, which binds single-stranded DNA CSTER 1728 1617148 1617438 - 30S ribosomal protein S6 96% 4.00E-40 61% CSTER 1745 1633808 1634821 predp. ABOUT- sialoglycoprotein endopeptidase 97% 6.00E- 130 55% tRNA Nb-adenosine threonylcarbamoyltransfer aza tsad CSTER 1747 1635236 1635922 predp. glycoprotein endopeptidase 100% 6.00E-44 38% protein TsaB of tRNA biosynthesis threonylcarbamoyladenosine CSTER 1749 1636421 1638103 + mRNA degradation ribonuclease J1/J2 99% 0.00Е+00 62% ribonuclease L yqkc CSTER 1755 1642501 1643700 - Phosphoglycerate kinase 100% 2.00E124 50% Phosphoglycerate kinase pgk CSTER 1762 1648240 1650321 - elongation factor transcription G 100% 0.00Е+00 77% CSTER 1763 1650542 1651012 - 30S ribosomal protein S7 100% 1.00E-86 75% CSTER 1764 1651031 1651444 - 30S ribosomal protein S12 98% 3.00E-80 86% CSTER 1770 1656078 1656950 ribosome-associated GTPase 99% 5.00E105 51% putative GTPase of ribosomal biogenesis RsgA CSTER 1776 1660099 1660413 - predp. thioredoxin 92% 1.00E-37 61% thioredoxin trxa CSTER 1787 1670058 1670192 - 50S ribosomal protein L34 100% 1.00E-15 70%

-45042506

CSTER 1790 1673060 1673395 - ribonuclease P 95% 1.00Е-31 47% Protein component ribonuclease P CSTER 1793 1677296 1678750 - glutamyl-tRNA synthetase 100% 0.00Е+00 55% CSTER 1797 1681106 1681795 - 50S ribosomal protein LI 98% 4.00E-99 65% 50S ribosomal protein L1 CSTER 1809 1690036 1691058 + glycerol-3-phosphate dehydrogenase 94% 4.00E122 53% glycerol-3-phosphate dehydrogenase [NAD(P)+] gspA CSTER 1813 1693298 1694431 metal-dependent amdase/aminoacylase/carboxypeptidase 95% 6.00E- 120 47% N-acetyldiaminopimelate diacetylase ykur CSTER 1814 1694510 1695208 predp. 2,3,4,5- tetrahydropyridine-2carboxylate N- succinyltransferase 98% 4.00E-86 60% 2,3,4,5- tetrahydropyridine-2,6dicarboxylate N- acetyltransferase dapH CSTER 1821 1699209 1699601 - A protein that binds signal thread 93% 1.00E-25 40% Protein B, which binds DNA signaling strand CSTER 1844 1713286 1716924 DNA-dependent RNA polymerase, beta subunit 97% 0.00Е+00 68% DNA-directed RNA polymerase, beta subunit CSTER 1845 1717025 1720606 DNA-dependent RNA polymerase, beta subunit 98% 0.00Е+00 71% DNA-directed RNA polymerase, beta subunit CSTER 1847 1723493 1724749 + tyrosyl-tRNA synthetase 99% 0.00Е+00 58% CSTER 1876 1751169 1752050 - fructose bisphosphate aldolase 100% 4.00E-83 45% possible fructose- aldolase biphosphate fbaa CSTER 1880 1755102 1755488 - 50S ribosomal protein L17 100% 2.00E-62 73% CSTER 1881 1755506 1756444 DNA-dependent RNA polymerase, alpha subunit 99% 7.00E139 62% DNA-directed RNA polymerase, alpha subunit CSTER 1882 1756493 1756876 - 30S ribosomal protein S11 93% 7.00E-69 87% CSTER 1883 1756904 1757269 30S ribosomal protein S13 100% 2.00E-58 73% CSTER 1884 1757290 1757403 50S ribosomal protein L36 100% 4.00E-16 84% CSTER 1885 1757429 1757647 - initiation factor broadcast 1 (IF-1) 100% 1.00E-38 7 8% CSTER 1886 1757765 1758421 - Adenylate kinase 99% 3.00E-89 59% Adenylate kinase adk CSTER 1887 1758553 1759848 predp. subunit translocases, SecY 99% 4.00Е140 49% translocase subunit SecY CSTER 1888 1759865 1760305 - 50S ribosomal protein L15 100% 1.00E-70 72% CSTER 1889 1760433 1760615 50S ribosomal protein L30 98% 3.00E-20 62% CSTER 1890 1760630 1761124 - 30S ribosomal protein S5 93% 8.00E-70 76% CSTER 1891 1761143 1761499 50S ribosomal protein L18 100% 4.00Е-55 73% CSTER 1892 1761589 1762125 50S ribosomal protein L6 100% 3.00E-69 60% 50S ribosomal protein L6 CSTER 1893 1762252 1762650 - 30S ribosomal protein S8 100% 1.00E-73 77% CSTER 1894 1762773 1762958 30S ribosomal protein S14 100% 1.00Е-31 77% CSTER 1895 1762976 1763518 - 50S ribosomal protein L5 99% 3.00Е100 77% CSTER 1896 1763545 1763850 50S ribosomal protein L24 99% 7.00E-38 64% CSTER 1897 1763931 1764299 - 50S ribosomal protein L14 100% 5.00E-74 87% CSTER 1898 1764324 1764584 30S ribosomal protein S17 97% 4.00E-46 84% CSTER 1899 1764612 1764818 50S ribosomal protein L2 9 78% 1.00E-14 58% CSTER 1900 1764828 1765241 50S ribosomal protein L16 93% 1.00E-76 83% CSTER 1901 1765245 1765898 30S ribosomal protein S3 100% 1.00E- 119 75% CSTER 1902 1765911 1766255 50S ribosomal protein L22 96% 7.00E-49 64% CSTER 1903 1766271 1766549 - 30S ribosomal protein S19 100% 2.00Е-54 83% CSTER 1904 1766643 1767476 - 50S ribosomal protein L2 100% 5.00Е159 76% 50S ribosomal protein L2 CSTER 1905 1767494 1767790 - 50S ribosomal protein L23 94% 2.00E-31 60% CSTER 1906 1767790 1768413 - 50S ribosomal protein L4 100% 9.00E-92 60% 50S ribosomal protein L4

-46042506

CSTER 1907 1768438 1769064 - 50S ribosomal protein L3 99% 4.00E- 115 75% 50S ribosomal protein L3 CSTER 1908 1769181 1769489 - 30S ribosomal protein S10 100% 1.00E-58 78% CSTER 1936 1795296 1795484 + 50S ribosomal protein L2 8 100% 7.00E-26 69% CSTER 1948 1805428 1807179 - aspartyl-tRNA synthetase 98% 0.00Е+00 57% CSTER 1950 1807719 1808999 histidyl-tRNA synthetase 99% 1.00E- 140 49% CSTER 1953 1810651 1810833 + 50S ribosomal protein L32 91% 1.00E-10 48% CSTER 1954 1810849 1810998 + 50S ribosomal protein L33 100% 1.00E-14 55% CSTER 1973 1823718 1824329 30S ribosomal protein S4 100% 1.00E-95 69% CSTER 1975 1824852 1826213 - Replicative DNA helicase 95% 8.00E- 176 56% Replicative DNA helicase DnaC CSTER 1976 1826257 1826715 - 50S ribosomal protein L9 100% 2.00E-39 55% CSTER 1979 1830931 1832052 tRNA (5-methylaminomethyl2-thiouridylate) methyltransferase 98% 9.00E- 177 70% tRNA-specific 2- thiouridylase MnmA CSTER 1986 1838183 1838725 phosphatidylhycyrophosphate synthase 93% 2.00E-45 52% CDP-diacylglycero-glycerol-3-phosphate 3- phosphatidyltransferase pgsA CSTER 1992 1843910 1845391 inosine 5'-monophosphate dehydrogenase 99% 0.00Е+00 68% inosine 5'-monophosphate dehydrogenase guab CSTER 1993 1845568 1846590 - tryptophanyl-tRNA synthetase II 98% 8.00E-42 35%

Table 5

List of differentially expressed genes identified in the GEI4 strain containing deletions

Operon Intended Path/Function Regulator-effector Gene log 2 change p-value STER_O39O-STER-Q393 Cysteine metabolism Cmbr/H o ch r/Mtar STER_Q39O -1.1 2.7E-23 STER_O391 -1.3 2.2E-22 STER_O392 -1.4 1.2E-32 STER 0393 -1.2 2.8E-15 STER_1016-STER_1017 Metabolism of maltodextrin STER_1016 -1.0 0 STER 1017 -0.8 7.50E-38 STER_1 54B-STER_1555 Biosynthesis of aromatic amino acids T-box RNA (Tgr) STER_1548 STER__1549 -1.3 -1.0 2.3E-37 1.5Ε-2Θ STER_1550 -1.3 7.9E-38 STER_1551 -1.3 1.2E-35 STER_1552 -1.3 ABOUT STER_1553 -1.4 ABOUT STER_1 554 -1.3 ABOUT STER 15BB -1.© 7.8E-73 STER_1 960-STER_19©3 Membrane proteins STER_1 960 -0.9 0 STER_1961 -1.0 0 STER_1962 -1.0 8.3E-317 STER 1963 -1.1 3.2E-965 STER_0049-STER_0054 Biosynthesis of purines PurR STER_0<M9 1.2 5.5E-34 STER_0O5O 1.1 1.4E-29 STER_QO61 1.1 0 STER_0O52 1.1 0 STER_OO53 1.1 0 STER 0054 1.1 Θ.6Ε-40 STER_0699-STER_0701 Metabolism of ethanolamine STER_06©9 1.6 0 STER„0700 2.1 9.5E-200 STER 0701 2.2 7.ΘΕ-329 STER_1020-STER_1024 Twin arginine transl render TatA STER_1020 1.3 b.ZE-14 STER_1O21 1.3 8.BE-12 STER_1022 Ί .-4 3.ZE-12 STER_1023 1.0 9.βΕ-β STER_1O24 0.9 0.0022 STER_1 02&-STER_1028 iron homeostasis PerR STER_1025 1.1 1.9E-09 STER_102© 0.9 2.6E-6 STER_1027 1.2 ZE-12 STER 1028 1.2 1.5E-17 ST E R_1405- STE R_1409 Transport involving ABC proteins Cody STER_14O5 STER_14O6 1.6 1.6 9.5E-9O 0 STER_14O7 1.6 3 _7E _ _bv STER_14O8 1.5 0 STER„14O9 1.4 4.2E-54 STER_1821-STER_1823 With stress STER_1821 2.0 ABOUT STER_1822 2.2 5.4E-98 STER 1823 2.0 0

-47042506

Literature

1. Darmon E, Leach DE. (2014) Bacterial Genome Instability. microbiol. Mol. Biol. Rev. 78:1-39.

2. Labrie SJ, Samson JE, and Moineau S. (2010) Bacteriophage resistance mechanisms. Nat. Rev. microbiol. 8, 317-327.

3. Barrangou R, Marraffini LA (2014) CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity. Mol Cell 54(2):234244.

4 Barrangou R, et al. (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315(5819):1709-1712.

5. Brouns SJJ, et al. (2008) Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321(5891):960-964.

6 Young JC et al. (2012) Phage-induced expression of CRISPR-associated proteins is revealed by shotgun proteomics in Streptococcus thermophilus. PLoS ONE 7(5):e38077.

7. Garneau JE, et al. (2010) The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468(7320):67-71.

8. Groenen PM, Bunschoten AE, Van Soolingen D, Van Embden JD (1993) Nature of DNA polymorphism in the direct repeat cluster of Mycobacterium tuberculosis; application for strain differentiation by a novel typing method. Mol Microbiol 10(5):1057-1065.

9. Yin S, et al. (2013) The evolutionary divergence of Shiga toxin-producing Escherichia coli is reflected in clustered regularly interspaced short palindromic repeat (CRISPR) spacer composition. Appl Environ Microbiol 79(18):5710-5720.

10 Liu F, et al. (2011) Novel virulence gene and clustered regularly interspaced short palindromic repeat (CRISPR) multilocus sequence typing scheme for subtyping of the major serovars of Salmonella enterica subsp. enterica. Appl Environ Microbiol 77(6):1946-1956.

- 48 042506

11. Barrangou R, Horvath P (2012) CRISPR: new horizons in phage resistance and strain identification. Annu Rev Food Sci Technol 3, 143-162.

12. Sander JD, and Joung JK. (2014) CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355.

13 Bicard D, et al. (2013) Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic Acids Res 41(15):7429-7437

14. Qi LS, et al. (2013) Repurposing CRISPR as an RNAGuided Platform for Sequence-Specific Control of Gene Expression. Cell 152(5):1173-1183.

15. Gomaa AA, et al. (2014) Programmable Removal of Bacterial Strains by Use of Genome-Targeting CRISPR-Cas Systems. mBio 5(1):e00928-13.

16. Ishino Y, Shinagawa H, Makino K, Amemura M, Nakata A (1987) Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coll, and identification of the gene product. J Bacteriol 169(12):54295433.

17. Jansen R, Embden JDA van, Gaastra W, Schouls LM (2002) Identification of genes that are associated with DNA repeats in prokaryotes. Mol Microbiol 43(6):1565-1575.

18 Bolotin A, et al. (2004) Complete sequence and comparative genome analysis of the dairy bacterium Streptococcus thermophilus. Nat Biotechnol 22(12):1554-1558.

19 Horvath P, et al. (2008) Diversity, activity, and evolution of CRISPR loci in Streptococcus thermophilus. J Bacteriol 190(4):1401-1412.

20. Bolotin A, Quinguis B, Sorokin A, Ehrlich SD (2005) Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology 151(Pt 8):2551-2561.

21 Deveau H, et al. (2008) Phage response to CRISPRencoded resistance in Streptococcus thermophilus. J Bacteriol 190(4):1390-1400.

- 49 042506

22 Paez-Espino D, et al. (2013) Strong bias in the bacterial CRISPR elements that confer immunity to phage. Nat Commun 4, 1430.

23. Sun CL, et al. (2013) Phage mutations in response to CRISPR diversification in a bacterial population. Environ Microbiol 15(2):463-470.

24 Sapranauskas R, et al. (2011) The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coll. Nucleic Acids Res 39(21):9275-9282.

25. Gasiunas G, Barrangou R, Horvath P, Siksnys V (2012) Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc Natl Acad Sci USA 109(39):E2579-2586.

26 Briner AE, et al. (2014) Guide RNA Functional Modules Direct Cas9 Activity and Orthogonality. Molecular cell. 56(2):333-339

27. Bondy-Denomy J, Davidson AR. (2014) To acquire or resist: the complex biological effects of CRISPR-Cas systems. Trends Microbiol. 22, 218-225.

28 Horvath P, et al. (2009) Comparative analysis of CRISPR loci in lactic acid bacteria genomes. Int J Food Microbiol 131(1):62-70.

29. Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA. (2013a) RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol 31(3):233-239.

30. Vercoe RB, et al. (2013) Cytotoxic chromosomal targeting by CRISPR/Cas systems can reshape bacterial genomes and expel or remodel pathogenicity islands. PLoS Genet 9(4):el003454.

31 Oh JH, van Pijkeren JP. (2014) CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri. Nucleic Acids Res 10.1093/nar/gku623

32. Selle K, Barrangou R. (2015) Harnessing CRISPR-Cas systems for bacterial genome editing. Trends Microbiol. In press

33. Kobayashi K, et al. (2003) Essential Bacillus subtilis genes. Proc. Natl. Acad. sci. U.S.A. 100, 4678-4683.

- 50 042506

34. Mahillon J, Chandler M. (1998) Insertion sequences. Microbiol Mol Biol Rev 62(3):725-774.

35. Goh YJ, Goin C, O'Flaherty S, Altermann E, Hutkins R (2011) Specialized adaptation of a lactic acid bacterium to the milk environment; the comparative genomics of Streptococcus thermophilus LMD-9. Microbial Cell Factories 10 (Suppl 1):S22

36 Dandoy D, et al. (2011) The fast milk acidifying phenotype of Streptococcus thermophilus can be acquired by natural transformation of the genomic island encoding the cellenvelope proteinase PrtS. Microb. cell fact. 10 Suppl 1, S21.

37 Deltcheva E, et al. (2011) CRISPR RNA maturation by trans-activating small RNA and host factor RNase III. Nature 471, 602-607.

38. Aravind L, Koonin EV (2001) Prokaryotic homologs of the eukaryotic DNA-end-binding protein Ku, novel domains in the Ku protein and prediction of a prokaryotic double-strand break repair system. Genome Res 11(8):1365-1374.

39. Koonin EV, Makarova KS (2007) Evolutionary genomics of lactic acid bacteria. J Bacteriol 189(4):1199-1208

40 Makarova KS, et al. (2006) Comparative genomics of the lactic acid bacteria. Proc Natl Acad Sci USA 103(42):1561115616.

41 Goh YJ, et al. (2009) Development and application of a upp-based counterselective gene replacement system for the study of the S-layer protein SlpX of Lactobacillus acidophilus NCFM. Appl Environ Microbiol 75(10):3093-3105.

42. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77(1):61-68.

43. Mojica FJM, Diez-Villasenor C, Garcia-Martinez J, Almendros C (2009) Short motif sequences determine the targets of the prokaryotic CRISPR defense system. Microbiology 155(Pt 3):733-740.

44. Russell WM, Klaenhammer TR (2001) Efficient System for Directed Integration into the Lactobacillus acidophilus and Lactobacillus gasseri Chromosomes via Homologous Recombination. Appl Environ Microbiol 67(9):4361-4364.

45 Wei M-Q, et al. (1995) An improved method for the transformation of Lactobacillus strains using electroporation. Journal of Microbiological Methods 21(1):97-109.

46. Zhang X, Bremer H (1995) Control of the Escherichia coli rrnB pl promoter strength by ppGpp. Journal of Biological Chemistry 270(19):11181-11189.

47 Law J, et al. (1995) A system to generate chromosomal mutations in Lactococcus lactis which allows fast analysis of targeted genes. J Bacteriol 177(24):7011-7018.

The above description illustrates the present invention and should not be construed as limiting it in any way. The invention is defined by the following claims, which cover all equivalents thereof.

-

Claims (18)

CLAIM 1. A method for killing one or more bacterial cells in a population of bacterial cells, comprising introducing into the population of bacterial cells a heterologous nucleic acid construct comprising (a) a CRISPR-Cas system, where the CRISPR-Cas system is a type I CRISPR-Cas system, where CRISPR -Cas type I system comprises (i) a heterologous nucleic acid construct encoding at least one type I cascade polypeptide, and (ii) a Cas3, Cas3' and Cas3'' polypeptide or a heterologous nucleic acid construct encoding a Cas3, Cas3' polypeptide and Cas3''; and (b) a type I CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, where the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial cells in said population, thereby killing one or more bacterial cells that contain the target region in the bacterial cell population. 2. The method of claim 1, wherein the target region is in a vital gene or a non-essential gene. 3. The method of claim 1 or 2, wherein the repeat-spacer-repeat sequence, or at least one repeat-spacer sequence, contains a repeat that is identical to a repeat from a wild type I CRISPR array. 4. The method according to any one of claims 1 to 3, wherein the target region is selected from any of at least 10 consecutive nucleotides adjacent to the PAM sequence in one or more bacterial cells. 5. The method of any one of the preceding claims, wherein the CRISPR guide is operably linked to a promoter. 6. The method according to any one of the preceding claims, wherein at least one bacterial cell in the population does not contain the target region and, therefore, at least one bacterial cell is not killed when the CRISPR-Cas system is administered. 7. A method according to any one of the preceding claims, wherein the spacer of said repeat-spacer-repeat sequence or repeat-spacer sequence contains a nucleotide sequence that is 100% complementary to the target region. 8. The method of any one of the preceding claims, wherein the target region is selected from a gene, open reading frame, or putative open reading frame, or intergenic region. 9. A pharmaceutical composition for killing one or more bacterial cells in a population of bacterial cells, wherein the pharmaceutical composition comprises a heterologous nucleic acid construct comprising (a) a CRISPR-Cas system, where the CRISPR-Cas system is a Type I CRISPR-Cas system, where CRISPR -Cas type I system comprises (i) a heterologous nucleic acid construct encoding at least one type I cascade polypeptide, and (ii) a Cas3, Cas3' and Cas3'' polypeptide or a heterologous nucleic acid construct encoding a Cas3, Cas3' polypeptide and Cas3''; and (b) a type I CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, where the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is essentially complementary to a target region in the genome of the bacterial cells of the specified population, where the target region is the genetic sequence of one or more bacterial cells, where the CRISPR array is a type I CRISPR array, where the pharmaceutical composition is introduced into the population of bacterial cells and, thus, one or more bacterial cells that contain the target region in the bacterial cell population is destroyed. 10. The pharmaceutical composition of claim 9, wherein the repeat-spacer-repeat sequence, or at least one repeat-spacer sequence, contains a repeat that is identical to a repeat from a wild type I CRISPR array. 11. A pharmaceutical composition according to claim 9 or 10, wherein the CRISPR array is a type I CRISPR array and the repeat-spacer-repeat sequence or at least one sequence - 52 042506 The repeat-spacer value contains a repeat that is identical to a repeat from a wild-type CRISPR type I array, and the CRISPR-Cas system comprises (i) a heterologous nucleic acid construct encoding at least one type I cascade polypeptide, and (ii) a polypeptide Cas3 or Cas3' and Cas3'' or a heterologous nucleic acid construct encoding a Cas3 or Cas3' and Cas3'' polypeptide. 12. A method for selecting at least one isolate from a population of bacterial cells that does not contain in its genome a target region that is present in the genome of one or more bacterial cells in the population, comprising introducing into the population of bacterial cells a heterologous nucleic acid construct containing (a ) a CRISPR-Cas system, wherein the CRISPR-Cas system is a type I CRISPR-Cas system, wherein the type I CRISPR-Cas system comprises (i) a heterologous nucleic acid construct encoding at least one type I cascade polypeptide, and (ii) a Cas3, Cas3' and Cas3'' polypeptide or a heterologous nucleic acid construct encoding a Cas3, Cas3' and Cas3'' polypeptide; and (b) a type I CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, where the spacer of said repeat-spacer-repeat sequence or of said at least one repeat-spacer sequence contains a nucleotide sequence that is substantially complementary to a target region in the genome of one or more bacterial cells in said population, thereby selecting at least one isolate from the bacterial cell population without a target region in its genome, where the CRISPR array is a type I CRISPR array. 13. The method according to claim 12, further comprising growing individual bacterial colonies of at least one isolate without a target region in its genome. 14. The method of claim 12 or 13, wherein the repeat-spacer-repeat sequence, or at least one repeat-spacer sequence, contains a repeat that is identical to a wild-type type I CRISPR array repeat. 15. The method according to any one of claims 12-14, wherein the CRISPR array is a type I CRISPR array and the repeat-spacer-repeat sequence or at least one repeat-spacer sequence contains a repeat that is identical to a repeat from the type I CRISPR array wild-type, and the CRISPR-Cas system comprises (i) a heterologous nucleic acid construct encoding at least one type I cascade polypeptide, and (ii) a Cas3, Cas3' and Cas3'' polypeptide or a heterologous nucleic acid construct encoding a Cas3 polypeptide, Cas3' and Cas3''. 16. The use of a heterologous nucleic acid construct comprising a CRISPR-Cas system in the targeted reduction of pathogens in the event of a medical intervention in a patient, the medical intervention comprising killing a specific subset of bacteria in a mixed population of bacterial cells based on differing genetic content in a subset of bacteria by introducing into a mixed population bacterial cell constructs of a heterologous nucleic acid comprising (a) a CRISPR-Cas system, wherein the CRISPR-Cas system is a type I CRISPR-Cas system, wherein the type I CRISPR-Cas system comprises (i) a heterologous nucleic acid construct encoding at least one type I cascade polypeptide, and (ii) a Cas3, Cas3' and Cas3'' polypeptide or a heterologous nucleic acid construct encoding a Cas3, Cas3' and Cas3'' polypeptide; and (b) a type I CRISPR array containing (in the 5'-3' direction) a repeat-spacer-repeat sequence or at least one repeat-spacer sequence, where the spacer of said repeat-spacer-repeat sequence or at least one repeat-spacer sequence is the spacer contains a nucleotide sequence that is substantially complementary to a target region in the genetic sequence of a specific subset of bacteria, wherein the target region has at least 10 consecutive nucleotides adjacent to a motif protospacer (PAM) recognized by the CRISPR-Cas system, thereby eliminating the specific subset bacteria that includes the target area. 17. Use according to claim 16, wherein at least one or more bacterial cells in the population do not contain the target region and, therefore, at least one bacterial cell does not die when the CRISPR-Cas system is administered. 18. Use according to claim 16 or 17, wherein the spacer of said repeat-spacer-repeat sequence or repeat-spacer sequence contains a nucleotide sequence that is 100% complementary to the target region. -