EA042493B1 - SYSTEM AND METHOD FOR GENOME EDITING - Google Patents

Description

The field of technology to which the invention belongs

The present invention relates to the field of genetic engineering. In particular, the present invention relates to a genome editing method that has high efficiency and high specificity. More specifically, the present invention relates to a method for increasing the efficiency of site-directed modification of a target sequence in the genome of an organism using a highly specific Cas9 nuclease variant.

Prior Art

The most common genome editing tools are regularly spaced short palindromic repeats (CRISPR) and the associated system (CRISPR/Cas9). In this double-strand break (DSB) system, the Cas9 protein cleaves a specific DNA sequence under the influence of gRNA. A double-strand break can activate intracellular non-homologous end-joining (NHEJ) and homologous recombination (HR) repair mechanisms to repair DNA damage in cells such that a particular DNA sequence can be edited during the repair process. Currently, the most commonly used Cas9 protein is Cas9, derived from Streptococcus pyogenes (SpCas9). One of the disadvantages of the CRISPR/Cas9 genome editing system is its low specificity and non-targeted action, which significantly limits its application.

There remains a need in the art for a method and tool that enables efficient, highly specific genome editing.

The essence of the invention

One aspect of the present invention provides a genome editing system for site-directed modification of a target sequence in the genome of a cell, which contains at least one element selected from i) to iii):

i) a Cas9 nuclease variant and an expression construct containing a nucleotide sequence encoding a tRNA-guide RNA fusion;

ii) an expression construct containing a nucleotide sequence encoding a Cas9 nuclease variant and an expression construct containing a nucleotide sequence encoding a tRNA-guide RNA fusion; and iii) an expression construct comprising a nucleotide sequence encoding a Cas9 nuclease variant and a nucleotide sequence encoding a tRNA-guide RNA fusion;

in which the Cas9 nuclease variant has increased specificity compared to the wild-type Cas9 nuclease, in which the 5' end of the guide RNA is linked to the 3' end of the tRNA, in which the fusion is cleaved at the 5' end of the guide RNA after being transcribed into the cell, whereby the guide RNA is formed , which does not carry an extra nucleotide at the 5' end.

A second aspect of the present invention provides a genome editing system for site-directed modification of a target sequence in the genome of a cell, which contains at least one element selected from i) to iii):

i) a Cas9 nuclease variant and an expression construct containing a nucleotide sequence encoding a ribozyme-guide RNA fusion;

ii) an expression construct containing a nucleotide sequence encoding a Cas9 nuclease variant and an expression construct containing a nucleotide sequence encoding a ribozyme-guide RNA fusion; and iii) an expression construct comprising a nucleotide sequence encoding a Cas9 nuclease variant and a nucleotide sequence encoding a ribozyme guide RNA fusion;

wherein the Cas9 nuclease variant has increased specificity compared to the wild-type Cas9 nuclease, wherein the 5' end of the guide RNA is linked to the 3' end of the first ribozyme, wherein the first ribozyme is designed to cleave the fusion at the 5' end of the guide RNA, thereby forming the guide RNA that does not carry an extra nucleotide at the 5' end.

A third aspect of the present invention provides a method for genetically modifying a cell, comprising introducing into the cell a genome editing system of the present invention, whereby a Cas9 nuclease variant is targeted to a target sequence in the genome of the cell by gRNA, and the result is a substitution, deletion and/or addition one or more nucleotides in the target sequence.

The fourth object of the present invention provides a genetically modified organism that contains a genetically modified cell obtained by the method of the present invention.

- 1 042493

Brief description of the figures

In FIG. 1 shows strategies for constructing a single guide RNA (sgRNA) for target sequences with different 5' terminal nucleotides using U3 or U6. A: By fusion with tRNA, sgRNA can be designed without considering the 5' terminal nucleotide of the target sequence; B: Precise cleavage of the tPHK-sgPHK fusion.

In FIG. Figure 2 shows the efficiency of editing WT SpCas9 (wild type SpCas9), eSpCas9(1.0), eSpCas9(1.1), SpCas9-HF1 on targets of class (1).

In FIG. Figure 3 shows the efficiency of editing WT SpCas9 (wild type SpCas9), eSpCas9(1.0), eSpCas9(1.1), SpCas9-HF1 on targets of class (2).

In FIG. 4 shows that an additional nucleotide at the 5' end of sgRNA affects editing efficiency when using the U6 promoter.

In FIG. 5 shows that for the OsMKK4 locus, tPHK-sgPHK is able to improve editing efficiency and provide a high level of specificity compared to sgRNA.

In FIG. 6 shows that for the OsCDKB2 locus, the use of tRNA-sgRNA can increase editing efficiency to that of wild-type SpCas9 while providing high specificity.

In FIG. 7 shows the specificity of editing the Cas9 variant to break complementarity between gRNA and the target sequence.

In FIG. 8 shows tRNA-sgRNA improving the editing efficiency of eSpCas9(1.1) and SpCas9-HF1 to the level of wild-type SpCas9 in human cells.

In FIG. 9 shows the sequence structure of the pUC57-U3-tPHK-sgPHK vector for expression of the tPHK-sgPHK fusion.

Detailed description of the invention

1) Definition.

In the present invention, unless otherwise indicated, the scientific and technological terms used herein have the meanings generally accepted by those skilled in the art. Also, the terminology and experimental procedures used herein relating to protein and nucleotide chemistry, molecular biology, cell and tissue culture, microbiology, immunology refer to the terminology and standard methods commonly used in the art. For example, the standard DNA recombination and molecular cloning technology used here is well known to those skilled in the art and is detailed in the following references: Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989. However, for a better understanding of the present invention, definitions and explanations for the respective terms are provided below.

The nuclease Cas9 and Cas9 may be used interchangeably herein, and refer to an RNA-directed nuclease, including the Cas9 protein or fragments thereof (such as a protein containing an active Cas9 DNA cleavage domain and/or a Cas9 gRNA binding domain). Cas9 is a component of the CRISPR/Cas (Regularly Clustered Short Palindromic Repeats and Associated System) genome editing system that, under the influence of a guide RNA, targets and cleaves a target DNA sequence to form DNA double-strand breaks (DSBs).

Guide RNA and gRNA can be used interchangeably herein, and typically consist of crRNA and tracrPHK molecules complexed by partial complement, in which the crRNA contains a sequence that is sufficiently complementary to the target sequence for hybridization and directs the complex. CRISPR (Cas9+crPHK+tracrPHK) for specific binding to the target sequence. However, it is known in the art that a single guide RNA (sgPHK) can be constructed that contains the characteristics of both crPHK and tracrPHK.

In this document, the terms tRNA and transfer RNA can be used interchangeably and refer to small RNA molecules that have the function of transferring and transporting amino acids. The tRNA molecule usually consists of a short chain that has about 70-90 nucleotides packed in a clover shape. In eukaryotes, tRNA genes in the genome are transcribed into tRNA precursors, which are then processed into mature tRNA after removal of additional 5' and 3' sequences by ribonuclease P (RNase P) and ribonuclease Z (RNase Z).

As used herein, the term ribozyme refers to an RNA molecule having a catalytic function that participates in the cleavage and processing of RNA by catalyzing the transphosphate and phosphodiester bond hydrolysis reactions.

The term genome as used herein encompasses not only chromosomal DNA present in the nucleus, but also organelle DNA present in subcellular components of the cell (eg, mitochondria, plastids).

As used herein, the term organism includes any organism suitable for genomic editing. Typical organisms include, but are not limited to, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, cats; poultry such as chicken, duck, goose; plants including monocots and dicots such as rice, corn, wheat, sorghum, barley, soybeans, peanuts, Arabidopsis, and the like.

Genetically modified organism or genetically modified cell means an organism or cell that contains in its genome an exogenous polynucleotide or a modified gene or sequence that controls expression. For example, an exogenous polynucleotide is stably integrated into the genome of an organism or cell and is inherited in subsequent generations. The exogenous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct. A modified gene or expression control sequence is a sequence in the genome of an organism or cell that consists of one or more deoxynucleotide substitutions, deletions, and additions.

The term "exogenous" in relation to a sequence means a sequence that is derived from a foreign species or, if derived from the same species, is substantially altered from its native form in composition and/or genomic locus due to intentional human interference.

The terms polynucleotide, nucleic acid sequence, nucleotide sequence, or nucleic acid fragment are used interchangeably to refer to an RNA or DNA polymer that is single or double stranded and optionally contains synthetic, non-natural, or altered nucleotide bases. Nucleotides (usually occurring in their 5'-monophosphate form) are designated by a single letter as follows: A for adenylate or deoxyadenylate (for RNA or DNA, respectively), C for cytidylate or deoxycytidylate, G for guanylate or deoxyguanylate, U for uridylate, T for deoxythymidylate, R for purines (A or G), Y for pyrimidines (C or T), K for G or T, H for A or C, or T, I for inosine, and N for any nucleotide.

The terms polypeptide, peptide, amino acid sequence, and protein are used interchangeably herein to refer to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of the corresponding naturally occurring amino acid, as well as naturally occurring amino acid polymers. The terms polypeptide, peptide, amino acid sequence, and protein also encompass modifications including, but not limited to, glycosylation, lipid addition, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADPribosylation.

As used herein, the term expression construct refers to a vector suitable for expression in an organism of a nucleotide sequence of interest, such as a recombinant vector. The term expression refers to the production of a functional product. For example, expression of a nucleotide sequence may refer to the transcription of a nucleotide sequence (such as transcription to produce mRNA or functional RNA) and/or translation of an RNA into a protein precursor or mature protein.

The expression construct of the invention may be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, RNA that can be translated (such as mRNA).

The expression construct of this invention may contain regulatory sequences and nucleotide sequences of interest that are obtained from different sources, or regulatory sequences and nucleotide sequences of interest obtained from the same source but ordered in a manner different from that normally found in nature.

The terms regulatory sequence or regulatory element are used interchangeably and refer to nucleotide sequences located before (5' non-coding sequences), within, or after (3' non-coding sequences) a coding sequence that affect transcription, processing, or stability of RNA, or translation of the associated coding sequence. . Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

The term promoter refers to a nucleic acid fragment that is capable of controlling the transcription of another nucleic acid fragment. In some embodiments, the implementation of the present invention, the promoter is a promoter capable of controlling the transcription of a gene into a cell, whether it is derived from such a cell or not. The promoter may be a constitutive promoter, or a tissue-specific promoter, or a developmental promoter, or an inducible promoter.

The term constitutive promoter refers to a promoter that, under most circumstances, can cause gene expression in most cell types. The terms tissue-specific promoter and

Tissue-preferred promoter is used interchangeably and refers to a promoter that is predominantly, but not necessarily exclusively, expressed in one tissue or organ, but which may also be expressed in one particular cell or cell type. The term developmentally regulated promoter refers to a promoter whose activity is determined by developmental events. An inducible promoter selectively expresses a DNA sequence operably linked to it in response to an endogenous or exogenous stimulus (environment, hormones or chemical signals, etc.).

As used herein, the term operably linked means that a regulatory element (for example, but not limited to, a promoter sequence, a transcription termination sequence, etc.) is linked to a nucleic acid sequence (such as a coding sequence or an open reading frame), such that that transcription of a nucleotide sequence is controlled and regulated by a transcriptional regulatory element. Techniques are known in the art for operably linking a region of a regulatory element to a nucleic acid molecule.

The introduction of a nucleic acid molecule (eg, plasmid, linear nucleic acid fragment, RNA, etc.) or protein into an organism means that the nucleic acid or protein is used to transform a cell of the body such that the nucleic acid or protein functions in such a cell. As used in the present invention, the term transformation includes both stable and transient transformations. Stable transformation refers to the introduction into the genome of an exogenous nucleotide sequence resulting in stable inheritance of foreign genes. After stable transformation, the exogenous nucleic acid sequence is stably integrated into the genome of the organism and any subsequent generations. Transient transformation refers to the introduction of a nucleic acid molecule or protein into a cell that performs its function without sustained inheritance of an exogenous gene. In transient transformation, the exogenous nucleic acid sequence is not integrated into the genome.

2) Genome editing system with high efficiency and high specificity.

As reported, Cas9 nuclease variant eSpCas9(1.0) (K810A/K1003A/R1060A), eSpCas9(1.1) (K848A/K1003A/R1060A) developed by Feng Zhang et al., and Cas9 nuclease variant SpCas9-HF1 (N497A/R661A /Q695A/Q926A), developed by J. Keith Joung et al., can significantly reduce the level of non-targeted genomic editing, i.e. have high specificity. Surprisingly, however, the present inventors have found that these three variants of the Cas9 nuclease, while having high specificity, have a much lower gene editing efficiency compared to wild-type Cas9.

The present inventors have surprisingly found that editing efficiency with a highly specific Cas9 nuclease variant can be improved by fusing the 5' end of the guide RNA with tRNA, even to the wild-type level while maintaining high specificity.

Without considering the limitations imposed by any theory, it is assumed that the reduction in the editing efficiency of highly specific Cas9 nuclease variants is related to whether transcription of the guide RNA can be accurately initiated or not. Promoters commonly used in the art for in vivo production of guide RNA include, for example, the snRNA U6 or U3 promoters, for which transcription is driven by RNA polymerase III. The U6 promoter is required to initiate transcription at G, and thus for target sequences with an A, C, or T first nucleotide, an additional G will be present at the 5' end of the transcribed sgRNA. The U3 promoter initiates transcription at A, and thus for target sequences with a G, C, or T first nucleotide, an additional A will be present at the 5' end of the transcribed sgRNA. The inventors have found that the efficiency of editing highly specific Cas9 nuclease variants is reduced if an additional nucleotide is present at the 5' end of sgRNA. sgPHK without an extra nucleotide at the 5' end can easily be generated even with the U6 or U3 promoters by fusion of the transcription with tRNA, thanks to the precise tPHK processing mechanism (precisely removing the extra 5' and 3' tRNA precursor sequence to form mature tRNA), without the need take into account the type of the first nucleotide of the target sequence. Thus, the editing efficiency of highly specific Cas9 nuclease variants can be improved, as well as the range of target sequence selection can be expanded. In addition, without being bound by any theory, tRNA fusion may increase the level of sgRNA expression, which may also improve editing efficiency with highly specific Cas9 nuclease variants.

Thus, the present invention provides a genome editing system for site-directed modification of a target sequence in the genome of a cell, which contains at least one element selected from i) to iii):

i) a Cas9 nuclease variant and an expression construct containing a nucleotide sequence encoding a tRNA-guide RNA fusion;

ii) an expression construct containing a nucleotide sequence encoding a variant

- 4 042493 ant Cas9 nuclease, and an expression construct containing a nucleotide sequence encoding a tRNA-guide RNA fusion; and iii) an expression construct comprising a nucleotide sequence encoding a Cas9 nuclease variant and a nucleotide sequence encoding a fusion guide tRNA

RNA;

in which the Cas9 nuclease variant has increased specificity compared to the wild-type Cas9 nuclease, in which the 5' end of the guide RNA is linked to the 3' end of the tRNA, in which the fusion is cleaved at the 5' end of the guide RNA after being transcribed into the cell, whereby the guide RNA is formed , which does not carry an extra nucleotide at the 5' end.

In some embodiments, the tRNA and the cell to be modified are of the same species.

In some specific embodiments, the tRNA is encoded by the following sequence aacaaagcaccagtg^^ (SEQ id no:1).

The design of the tRNA-guide RNA fusion is within the skill of the art. For example, reference may be made to Xie et al., PNAS, Mar 17, 2015; vol. 112, by. 11.35703575.

The present invention also contemplates the fusion of a guide RNA and a ribozyme. Based on the fact that, according to the invention, the efficiency of editing with highly specific variants of the Cas9 nuclease is related to the accuracy of transcription initiation of sgRNA, using the ability of the ribozyme to cut RNA at a specific site, sgRNA without an additional nucleotide at the 5' end can be obtained by rationally designing the fusion of RNA and ribozyme, which improves editing efficiency while maintaining high specificity.

Thus, the present invention provides a genome editing system for site-directed modification of a target sequence in the genome of a cell, which contains at least one element selected from i) to iii):

i) a Cas9 nuclease variant and an expression construct containing a nucleotide sequence encoding a ribozyme-guide RNA fusion;

ii) an expression construct containing a nucleotide sequence encoding a Cas9 nuclease variant and an expression construct containing a nucleotide sequence encoding a ribozyme-guide RNA fusion; and iii) an expression construct comprising a nucleotide sequence encoding a Cas9 nuclease variant and a nucleotide sequence encoding a ribozyme guide RNA fusion;

wherein the Cas9 nuclease variant has increased specificity compared to the wild-type Cas9 nuclease, wherein the 5' end of the guide RNA is linked to the 3' end of the first ribozyme, wherein the first ribozyme is designed to cleave the fusion at the 5' end of the guide RNA, thereby forming the guide RNA that does not carry an extra nucleotide at the 5' end.

In one embodiment, where the 3' end of the guide RNA is linked to the 5' end of a second ribozyme, that second ribozyme is designed to cleave the fusion at the 3' end of the guide RNA, thereby forming a guide RNA that does not carry an extra nucleotide at the 3' end.

The design of the first ribozyme or the second ribozyme is within the skill of the art. For example, reference may be made to Gao et al., JIPB, Apr , 2014; Vol 56, Issue 4,343349.

In one particular embodiment, the first ribozyme is encoded by the following sequence

WCTGATGAGTCCGT^^ (SEQ _ro NO: 12) wherein N is independently selected from A, G, C, and T, and (N) ₆ refers to the sequence reversely complementary to the first 6 nucleotides at the 5' end of the guide RNA. In one particular embodiment, the second ribozyme is encoded by the following sequence

5'-GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCnCGGCATGGCGAATGGGAC-3' (SEQ ID NO: 13).

The Cas9 nuclease variant of the present invention, which has a higher specificity than the wild-type Cas9 nuclease, can be obtained from Cas9 of various species, for example, those obtained from Cas9 of Streptococcus pyogenes (SpCas9, nucleotide sequence shown in SEQ ID NO: 2, amino acid the sequence shown in SEQ ID NO: 3).

In some embodiments, the Cas9 nuclease variant is

- 5 042493

SEQ ID NO: 2, which contains the amino acid substitution at position 855 of SEQ ID NO: 2. In some specific embodiments, the amino acid substitution at position 855 is K855A.

In some embodiments, the Cas9 nuclease variant is a SEQ ID NO: 2 variant that contains amino acid substitutions at positions 810, 1003, and 1060 of SEQ ID NO: 2. In some specific embodiments, the amino acid substitutions are, respectively, K810A, K1003A, and R1060A.

In some embodiments, the Cas9 nuclease variant is SEQ ID NO: 2, which contains amino acid substitutions at positions 848, 1003, and 1060 of SEQ ID NO: 2. In some specific embodiments, the amino acid substitutions are K848A, K1003A, and R1060A, respectively. .

In some embodiments, the Cas9 nuclease variant is a SEQ ID NO: 2 variant that contains amino acid substitutions at positions 611, 695, and 926 of SEQ ID NO: 2. In some specific embodiments, the amino acid substitutions are, respectively, R611A, Q695A, and Q926A.

In some embodiments, the Cas9 nuclease variant is a variant of SEQ ID NO: 2 that contains amino acid substitutions at positions 497, 611, 695, and 926 of SEQ ID NO: 2. In some specific embodiments, the amino acid substitutions are, respectively, N497A, R611A, Q695A and Q926A.

In some specific embodiments, the Cas9 nuclease variant comprises the amino acid sequence shown in SEQ ID NO: 4 (eSpCas9(1.0)), SEQ ID NO: 5 (eSpCas9(1.1)) or SEQ ID NO: 6 (SpCas9-HF1).

In some embodiments, the Cas9 nuclease variant of the invention further comprises a nuclear localization sequence (NLS). In general, one or more NLSs in the Cas9 nuclease variant should be present in sufficient abundance to drive the accumulation of the Cas9 nuclease variant in the cell nucleus in an amount sufficient for genome editing function. Typically, nuclear localization activity is quantified by the number and position of nuclear localization sequences (NLSs), and the Cas9 nuclease variant uses one or more NLSs, or a combination thereof.

In some embodiments, NLS sequences of the Cas9 nuclease variant of the invention may be located at the N-terminus and/or at the C-terminus. In some embodiments, the Cas9 nuclease variant contains about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs. In some embodiments, the Cas9 nuclease variant contains about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the N-terminus. In some embodiments, the Cas9 nuclease variant contains about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the C-terminus. In some embodiments, the Cas9 nuclease variant contains combinations thereof, such as one or more NLSs at the N-terminus or one or more NLSs at the C-terminus. If there is more than one NLS, each NLS may be selected independently of the other NLSs. In some preferred embodiments, the Cas9 nuclease variant contains two NLSs, for example, these two NLSs are located at the N-terminus and C-terminus, respectively.

In general, an NLS consists of one or more short sequences of positively charged lysine or arginine located on the surface of a protein, but other types of NLS are also known in the art. Non-limiting examples of NLS include KKRKV (nucleotide sequence ⁵ -AAGAAGAGAAAGGTC-3), PKKKRKV (nucleotide sequence 5'-CCCAAGAAGAAGAGGAAGGTG-3' _: or CCAAAGAAGAAGAGGAAGGTT) or SGGSPKKKRKV (nucleotide sequence 5'-TCGGGGGGAGCCCAAAGAAGAAGCGGAAGGTG-3').

In some embodiments, the N-terminus of the Cas9 nuclease variant contains an NLS with the amino acid sequence shown as PKKKRKV.

In some embodiments, the C-terminus of the Cas9 nuclease variant contains an NLS with the amino acid sequence shown as SGGSPKKKRKV.

In addition, the Cas9 nuclease variant of the present invention may also include other localization sequences such as cytoplasmic localization sequences, chloroplast localization sequences, mitochondrial localization sequences, and the like, depending on the location of the DNA to be edited.

To obtain efficient expression in the target cell, in some embodiments of the invention, the nucleotide sequence encoding the Cas9 nuclease variant is codon-optimized for the organism from which the cell to be edited is derived.

Codon optimization refers to the process of modifying a nucleic acid sequence to enhance expression in host cells of interest by changing at least one codon (e.g., about or more than 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) of a native sequence with codons that are frequently or most frequently used in the genes of that host cell while providing a native amino acid sequence. Different species show particular preference for certain codons of a particular amino acid. Codon preference (differences in codon usage between organisms) often correlates with the efficiency of messenger RNA (mRNA) translation, which in turn is thought to depend, among other things, on the properties of the codons being translated and the presence of particular messenger RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is usually a reflection of the codons most frequently used in peptide synthesis. Accordingly, genes can be adapted for optimal gene expression in a given organism based on codon optimization. Codon usage tables are available, for example, in the Codon Usage Database located at www.kazusa.oijp/codon/ and these tables can be adapted in various ways. See Nakamura, Y., et al. Codon usage tabulated from the international DNA sequence databases: status for the year 2000 Nucl. Acids Res. 28:292 (2000).

The organism from which the cell originated, the genome of which can be edited using the system of the present invention, can be, but not limited to, mammals such as human, mouse, rat, monkey, dog, pig, sheep, cow and cat; poultry such as chicken, duck and goose; plant, including monocots and dicots, for example, rice, corn, wheat, sorghum, barley, soybeans, peanuts, Arabidopsis thaliana and the like.

In some specific embodiments, the codon-optimized nucleotide sequence encoding the Cas9 nuclease variant is the sequence shown in SEQ ID NO: 7 (eSpCas9(1.0)), SEQ ID NO: 8 (eSpCas9(1.1)) or SEQ ID NO: 9 (SpCas9-HF1).

In some embodiments, the guide RNA is a single guide RNA (sgRNA). Methods for constructing suitable sgRNAs according to a given target sequence are known in the art. See, for example, Wang, Y. et al. Simultaneous editing of three homoeoalleles in hexapioid bread wheat confers heritable resistance to powdery mildew. Nat. Biotechnol. 32, 947-951 (2014); Shan, Q. et al. Targeted genome modification of crop plants using a CRISPR-Cas system. Nat. Biotechnol. 31, 686-688 (2013); Liang, Z. et al. Targeted mutagenesis in Zea mays using TALENs and the CRISPR/Cas system. J Genet Genomics. 41, 63-68 (2014).

In some embodiments, the nucleotide sequence encoding the Cas9 nuclease variant and/or the nucleotide sequence encoding the guide RNA fusion is operably linked to an expression control element, such as a promoter.

Examples of promoters that can be used in the present invention include, but are not limited to, polymerase (pol) I, pol II, or pol III promoters. Examples of pol I promoters include the chicken RNA pol I promoter. Examples of pol II promoters include, but are not limited to, the cytomegalovirus immediate-early (CMV) promoter, the Rous sarcoma virus long terminal repeat (RSV-LTR) promoter, and the simian virus 40 immediate-early (SV40) promoter. Examples of pol III promoters include the U6 and H1 promoters. An inducible promoter such as metallothionein may be used. Other examples of promoters include the bacteriophage T7 promoter, the bacteriophage TK promoter, the (3-galactosidase) promoter, the bacteriophage Sp6 promoter, etc. When used in plants, promoters can be used that include, but are not limited to, the mosaic virus 35S promoter cauliflower, corn Ubi-1 promoter, U6 wheat promoter, U3 rice promoter, U3 corn promoter, rice actin promoter, etc.

3) The method of genetic modification of the cell.

Another object of the invention provides a method for genetically modifying a cell, comprising: introducing into the cell a genome editing system of the present invention, whereby a Cas9 nuclease variant is targeted to a target sequence in the genome of the cell using a guide RNA, and the result is a replacement, deletion and/ or adding one or more nucleotides to the target sequence.

Development of a target sequence that can be recognized and targeted by the Cas9 complex and guide RNA is within the technical skill of one of ordinary skill in the art. Typically, the target sequence is a sequence that is complementary to a leader sequence of about 20 nucleotides contained in the guide RNA and whose 3' end is adjacent to the NGG protospacer (PAM) adjacent motif.

For example, in some embodiments of the invention, the target sequence has the structure: 5'-N _x -NGG-3', in which N is selected independently of A, G, C and T; X is an integer within 14<X<30; NX represents X overlapping nucleotides, and NGG is the protospacer adjacent motif (PAM) sequence. In some specific embodiments of the invention, X is equal to 20.

According to the present invention, the target sequence to be modified may be located anywhere in the genome, for example, within a functional gene, such as a gene encoding a protein, or, for example, may be located in a regulatory region of gene expression, such as a promoter region or an enhancer region, and , thus, can perform a functional modification of the specified gene or perform a modification of the expression of the gene.

- 7 042493

A substitution, deletion and/or addition in the target sequence of a cell can be detected by T7E1, PCR/RE or sequencing methods, see e.g. Shan Q., Wang Y., Li, J. & Gao, C.

Genome editing in rice and wheat using the CRISPR/Cas system. Nat. Protocol. 9, 2395-2410 (2014).

In the method of the present invention, a genome editing system can be introduced into a cell using various methods well known to those skilled in the art.

Methods for introducing a genome editing system into a cell of the present invention include, but are not limited to, calcium phosphate transfection, protoplast fusion, electroporation, liposome transfection, microinjection, viral infection (such as baculovirus, vaccinia virus, adenovirus, and other viruses), particle bombardment, PEG-mediated protoplast transformation, or transformation by agrobacteria.

The cell whose genome can be edited with the system of the present invention may be, for example, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cows and cats; poultry such as chicken, duck and goose; and plants, including monocots and dicots such as rice, corn, wheat, sorghum, barley, soybeans, peanuts, Arabidopsis thaliana, and the like.

In some embodiments, the method of the present invention is performed in vitro. For example, such a cell is an isolated cell. In some other embodiments, the implementation of the method of the present invention can be performed in vivo. For example, such a cell is a cell in the body, and the system of the present invention can be introduced into said cell in vivo using, for example, a virus-mediated method. In some embodiments, such a cell is a germ cell. In some embodiments, such a cell is a somatic cell.

Another object of the present invention further provides a genetically modified organism that contains a genetically modified cell obtained by the method of the present invention.

Such organisms include, but are not limited to, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cows, and cats; poultry such as chicken, duck, and goose; plants including monocots and dicots such as rice, corn, wheat, sorghum, barley, soybeans, peanuts and Arabidopsis thaliana.

Examples

Materials and methods.

Construction of binary expression vectors pJIT163-SpCas9. pJIT163-eSpCas9(1.0), rLT163eSpCas9(1.1), and rLT163-SpCas9-HF 1.

SpCas9, eSpCas9(1.0), eSpCas9(l.l) and SpCas9-HFl sequences were codon optimized for rice, SpCas9, eSpCas9(1.0), eSpCas9(l.l) and SpCas9-HFI were generated by site-directed mutagenesis using the Fast MultiSite system Metagenesis System (TransGen) with plasmid pLT163SpCas9 (SEQ ID NO: 10) as template.

Construction of the sgPHK expression vector.

The sgRNA target sequences used in the experiments are shown in Table 1. 1 next.

Table 1. Target gene and sgRNA target sequence

sgPHK Subsequence- target Oligo-F Oligo-R Skgt-nt AGGTCGGGGAGGGGACGTACGGG GGCAAGGT( OGG ~UGGGG ?GTA< AACGTACGTCCCCTCCCCGACCCT : j-mkk ; GACGTCGGCGAGGAAGGCCTCGG GGCAGACGTCGGCGAGGAAGGCCT A A ACAGGCCTTCCTCGCCGACGTC Al CATGGTGGGGAAAGCTTGGAGGG GGCACATGGTGG FOR: Ah A~T< V s XGCTTTCCCCACC V >. A2; CCGGACGACGACGTCGACGACGG GGCACCGGACGACGACGTCGACGA 'A v^TCGTCGACGTCGTCGTCrGG AZ TTGAAGTCCCTTCTAGATGGAGG CGCATTC A lGTCCCTTCTAGATGG ^: AAACCCATCTAGAAGGGACTTCAA Al Alo .CGaCACCCAGAToTC F IC GG rAiTG- 3 MVCOCAGATATCG AAAGS^^T^ ATGTCGCAGT WS GTTGGTrTTTGCTn-TGF A., GGCA<iΠuGTCTTTGCTTCCTGCAG AAACCTGCAi 1GAGOAAAGACCAAC

The sgPHK expression vectors pOsU3-CDKB2-sgPHK, pOsU3-MKK4-sgPHK, pOsU3-AT'sgPHK, as well as pOsU3-A2-sgPHK, pOsU3-A3-sgPHK, pOsU3-A4-sgPHK and pOsU3-PDS-sgPHK are constructed based on pOsU3-sgPHK (Addgene ID53063) as previously described (Shan, Q. et al. Targeted genome modification of crop plants using a CRISPR-Cas system. Nat. Biotechnol. 31, 686-688, 2013).

Construction of tPHK-sgPHK expression vectors.

The tPHK-sgPHK expression vectors are constructed based on the pUC57-U3-tPHK-sgPHK vector. (SEQ ID NO: 11, FIG. 6). A linear vector is obtained after pUC57-U3-tPHK-sgPHK is cleaved with Bsal, the corresponding oligo-F and oligo-R are hybridized and connected into a linear vector, and the subsequent steps are similar to the construction of sgRNA expression vectors.

-8042493

Table 2. Target genes and oligonucleotide sequences for constructing tRNA-sgRNA expression vectors

sgPHK Subsequence- target Oligo-F Oligo-R OsCDKB2 AGGTCGGGGAGGGGACGTACGGG TGCAAGGTCGGC 4AH A <4 CCCTCCCCGACCT OsMKK4 GACGTCGGCGAC co.,- O'O 3CGAGGAAGGC'7 , x iGGCCTTCCTC< 7G- 7- Al i CATGGTGGGGAAAGCTTGGAGGG “ ,T KOIGGAAAGCI I',o < GCAAGCTTTCCCCACCATG /V .CGACGACGTCGACGAGGG TGCAC .CGTCGACGA AAACTCGTCGACGTCGTCGTCCGG AZ 3 TGCATTGA; AAACCCATCTAGAAG GG ACTTC AA A4 , ”7 >gasSS‘ ϊ’τη,ΤΌ ΤΑ ' KTGCOACACCCpG ^τ 'ΤιΗ AAACCGATATCTGGGTGTCGCAGT PDS GTTGGTCTTTGC3A<n GV ,, N.g.AZTKlTSTTTOS I AAACCTGCAGGAGCAAAGACC;

protoplast analyses.

The study used the nipponbare rice variety. Protoplast transformation is carried out as described below. Transformation is performed for 10 μg of each plasmid by polyethylene glycol-mediated transfection. Protoplasts were harvested after 48 h and DNA was extracted during PCR-RE analysis.

Preparation and transformation of rice protoplast.

1) For the isolation of protoplasts, the sheath of seedling leaves was used, cut with a sharp blade into pieces 0.5 mm wide.

2) Immediately after incision, the sample was transferred to a 0.6 M mannitol solution and placed in the dark for 10 min.

3) The mannitol solution was removed by filtration and the products were transferred to the fermentolysis solution and subjected to vacuum for 30 minutes.

4) Fermentolysis was carried out for 5-6 hours, in the dark and with gentle shaking (discoloration in a shaker, speed 10).

5) At the end of the enzymatic lysis, an equal volume of W5 was added and horizontal shaking was performed for 10 s to release the protoplasts.

6) The protoplasts were filtered into a 50 ml round bottom centrifuge tube with a 40 µm nylon membrane and washed with W5 solution.

7) To precipitate the protoplasts, a horizontal centrifuge treatment at 250 g for 3 min was performed to remove the supernatant.

8) The protoplasts were re-suspended by adding 10 ml of W5 and then centrifuged at 250g for 3 min to remove the supernatant.

9) An appropriate amount of MMG solution was added to re-suspend the protoplasts at a concentration of 2x10 ⁶ /ml.

Note: All previous steps were carried out at room temperature.

10) 10-20 µg of plasmids, 200 µl of protoplasts (about 4x10 ⁵ cells) and 220 µg of fresh PEG solution were added to a 2 ml centrifuge tube, mixed and placed at room temperature in the dark for 10-20 min to induce transformation .

11) After completion of the transformation, 880 µl of W5 solution were slowly added, the tubes were carefully turned upside down to mix, and then centrifuged at 250 g for 3 min to remove the supernatant.

12) The resulting products were resuspended by adding 2 ml of WI solution, transferred to a six-well plate and cultured at room temperature (or 25°C) in the dark. To isolate protoplast genomic DNA, the products must be cultured for 48 hours.

Mutation identification using deep sequencing.

Deep sequencing analysis performed using Liang, Z., Chen, K., Li, T, Zhang, Y., Wang, Y., Zhao, Q., Liu, J., Zhang, H., Liu, C , Ran, Y., et al. (2017). Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nature Communications 8, 14261.

Example 1. Comparison of editing capabilities of WT SpCas9 and its options for target sites.

WT SpCas9, eSpCas9(1.0), eSpCas9(1.1), and SpCas9-HF1, respectively, were constructed into the pJIT163 transient expression vector, and WT SpCas9, eSpCas9(1.0), eSpCas9(1.1), and SpCas9HF1 expressions are driven by the maize ubiquitin gene promoter. sgRNAs were constructed in the pOsU3-sgPHK vector, and sgRNA expression is driven by the OsU3 promoter. Rice protoplasts were transformed and protoplast DNA was extracted for PCR-RE analysis to evaluate mutation efficiency. Five target sites (A1, A2, A3, A4 and PDS, see FIGS. 2 and 3) were selected to compare differences in editing ability between wild-type SpCas9 and eSpCas9(1.0), eSpCas9(1.1) and SpCas9-HF1.

Transcription with nucleotide A must be initiated by the OsU3 promoter, therefore, the construction of sgRNA expression vectors for target sites can be divided according to two conditions as follows.

(1) If the first nucleotide at the 5' end of the desired sgPHK target sequence (20 bp) is either G/T/C, since the U3 promoter initiates transcription from A, an additional A will be added to the 5' end of the transcribed sgRNA , and furthermore, the sgRNA being transcribed may not exactly match the target sequence. The sgPHK expression vector can be designed as U3+AN ₂₀ in FIG. 1, where N ₂₀ is the target sequence, A is the extra nucleotide at the 5' end.

(2) If the first nucleotide at the 5' end of the desired sgRNA target sequence (20 bp) is A, it can be used by the U3 promoter to initiate transcription, and therefore there will be no additional nucleotides at the 5' end of the transcribed sgRNA nucleotides. The sgPHK expression vector can be designed as U3+AN ₁₉ in FIG. 1, where AN ₁₉ is the target sequence.

Selected target sites A1, A2, A3 and PDS belong to target sites of class (1), and target site A4 refers to target sites of class (2).

The results of the experiment show (FIG. 2) that the editing efficiency of eSpCas9 (1.0), eSpCas9 (1.1) and SpCas9-HF1 for class (1) target sites is extremely low. The differences in the editing efficiency of eSpCas9(1.0), eSpCas9(1.1), and SpCas9-HF1 and the editing efficiency of WT SpCas9 are not significant for class (2) target sites. This indicates that an extra nucleotide at the 5' end of sgRNA resulting from transcription can reduce the editing efficiency of eSpCas9 (1.0), eSpCas9 (1.1), and SpCas9-HF1.

Similar to the OsU3 promoter, the maize U6 promoter (TaU6) must initiate transcription from the G nucleotide, and therefore the construction of sgRNA expression vectors for target sites can be divided according to two conditions as follows.

(1) If the first nucleotide at the 5' end of the desired sgPHK target sequence (20 bp) is any of A/T/C, since the U6 promoter initiates transcription from G, an additional nucleotide will be added to the 5' end of the transcribed sgRNA G and, in addition, the transcribed sgRNA may not completely match the target sequence.

(2) If the first nucleotide at the 5' end of the desired sgRNA target sequence (20 bp) is G, it can be used by the U6 promoter to initiate transcription, with no additional nucleotides at the 5' end of the transcribed sgRNA.

The OsPDS target site belongs to class (2) target sites. Transcriptional control of sgPHK GN ₁₉ and GN ₂₀ for the OsPDS target site was performed using the TaU6 promoter, where GN ₂₀ can mimic class (1) target sites, namely sites with an additional G nucleotide at the 5' end of sgRNA.

Table 3. Target gene and oligonucleotide sequences for constructing TaU6-sgRNA expression vectors

sgPHK Subsequence- ; target Oligo-F : : Oligo-R 1 OsPDS-GNi9 . GTTGGTCTTTGCTCCCTGCAGAGG.....; GGCGTTGGTCTTTGCTCCTGCAG ^: _: AAACCTGCAGGAG! OsPDS-GN-o ' ..... ......... ' ;g : GGCGGTTGGTCTTTGCTCCCTGCAC ^ACCTGCAGGAGC A'

The results show (FIG. 2) that one additional G nucleotide at the 5' end of sgRNA significantly reduces the editing efficiency of eSpCas9(1.0), eSpCas9(1.1) and SpCas9-HF1.

Example 2 Increasing the Efficiency of Cas9 Variant Editing by tPHK-sgPHK Fusion.

According to the result of Example 1, an important factor affecting the editing efficiency of eSpCas9(1.0), eSpCas9(1,1) and SpCas9-HF1 is whether sgPHK is accurately initiated or not.

According to a previous report, tRNA fusion to the 5' end of sgRNA can activate sgRNA expression and result in a precise cleavage at the 5' end of sgRNA, and thus avoid having an extra nucleotide at the 5' end of sgRNA. (See Xie K, Minkenberg B, Yang Y. Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc NatI Acad Sci USA. 2015 Mar 17; 112(11):3570-5. doi: 10.1073/pnas 1420294112. Epub 2015 Mar 2.) The sgRNA for each target site in Example 1 was fused to tRNA and expressed under the control of the OsU3 promoter. Experiments were carried out as in Example 1 with tPHK-sgPHK instead of sgPHK. As shown in FIG. 2, for A1, A2, A3 and PDS target sites, the editing efficiency of eSpCas9(1.0), eSpCas9(1.1) and SpCas9-HF1 is significantly improved by using tPHK-sgPHK instead of sgPHK.

Example 3 Effect of tRNA-sgRNA fusion on the specificity of editing Cas9 variants 3.1 Rice OsMKK4 target site.

The target site GACGTCGGCGAGGAAGGCCT'CGG in the rice MKK4 gene was chosen for the construction of sgRNA and tPHK-sgPHK. This target site has two possible non-target sites, as shown in FIG. 5. The sgPHK or tPHK-sgPHK expression vector and the WTSpCas9, eSpCas9(1.0), eSpCas9(1.1) and SpCas9-HF1 expression vectors were appropriately co-transformed into rice protoplasts. Two days after transformation, protoplast DNA was extracted, and genomic fragments of the target site and non-target sites were amplified using specific primers. The mutation rates of these three sites were analyzed using second generation sequencing technology.

The results of the experiment are shown in Fig. 5.

When sgPHKs were used, eSpCas9(1.0), eSpCas9(1.1) and SpCas9-HF1 compared to WT SpCas9 showed extremely low off-target effect but had significantly lower editing efficiency.

When tRNA-sgPHK were used, the editing efficiency of each group was increased, however, eSpCas9(1.0), eSpCas9(1.1) and SpCas9-HF1 are able to provide relatively high specificity. In particular, for SpCas9-HF1, only two extremely low-level mutations could be detected for both non-target sites. Therefore, the combination of tRNA-sgRNA and SpCas9-HF1 is particularly suitable for genome editing with high efficiency and high specificity.

3.2 OsCDKB2 target site in rice.

The AGGTCGGGGGAGGGGACGIACGGG target site in the rice OsCDKB2 gene was chosen for sgRNA construction. This target site has three possible non-target sites, as shown in FIG. 6. The sgPHK or tPHK-sgPHK expression vector and the WTSpCas9, eSpCas9(1.0), eSpCas9(1.1) and SpCas9-HF1 expression vectors were appropriately co-transformed into rice protoplasts. Two days after transformation, protoplast DNA was extracted, and genomic fragments of the target site and non-target sites were amplified using specific primers. The mutation rates of these four sites were analyzed using deep sequencing technology.

The results of the experiment are shown in Fig. 6. The efficiency of editing eSpCas9 (1.0), eSpCas9 (1.1), and SpCas9-HF1 target sites is markedly improved when using tPHK-sgPHK instead of sgPHK. In particular, the editing efficiency of SpCas9-HF1 can be restored to wild-type levels with high specificity. Since this target sequence starts at nucleotide A, from which the U3 promoter can accurately initiate transcription, the increased editing efficiency may be the result of increased sgRNA expression due to tRNA fusion.

Example 4: Specificity of editing Cas9 variants by mismatch between gPHK and target sequence.

When constructing sgRNA for the target site GACGlCGGCGAGGAAGGCC 1CGG in the rice MKK4 gene, two adjacent base mismatches (purine for purine and pyrimidine for pyrimidine) were artificially introduced. An edit has been identified under the assumption that the sgRNA may not fully match the target site. If the edit can be detected, it is considered inappropriate. The experiments were carried out in a manner similar to that described in example 3.1.

The results of the experiment are shown in Fig. 7. When using tRNA-sgRNA, SpCas9 variants showed higher sensitivity to mismatches between gRNA and target sequence (especially when the mismatch is closer to one of the ends).

Example 5 Efficiency and Specificity of Cas9 Variant Editing in Human Embryonic Kidney, 293 Cells.

sgRNAs were designed for the target sequence

GG JGAG FGAG 1 G rGlGCGlGTCG in the human VEGFA gene. U6:sgPHK-GNj ₉ and U6:tPHK-sgPHK-N ₂₀ show that sgPHKs transcribed with the U6 promoter are 20 nucleotides long and completely match the target sequence; U6:sgPHK-GN ₂₀ shows that sgPHK transcribed with the U6 promoter is 21 nucleotides long and has an extra G at the 5' end.

The results of the T7E1 study show (FIG. 8) that WT Cas9 shows similar editing efficiency when using different sgRNA transcription strategies. However, the editing efficiency of eSpCas9(1.1) and SpCas9-HF1 was significantly reduced when the sgRNA contains an extra nucleotide at the 5' end. And when using tPHK-sgPHK fusions, the efficiency of editing eSpCas9(1.1) and SpCas9-HF1 increased to the level of WT Cas9 or even more.

In terms of edit specificity, WT Cas9 resulted in off-target editing at both off-target 1 and off-target 2 sites, and did not result in off-target editing using tPHK-sgPHK eSpCas9(1.1) and SpCas9-HF1 fusions.

-

Claims (9)

Таблица 4. Целевой ген и олигонуклеотидные последовательности для конструирования векторов экспрессии sgPHK sgPHK Последовательностьмишень Олиго-F Олиго-R vegfa-gn _I9 GGTGAGTGAGTGTGT GCGTGTGG ' GAGTGAGTGTGTG CGTG AAACCACGCiCACACTCACIC ACC vegfa-gn ₂₀ GGTGAGTGAGTGTGT GCGTGTGG CACCGGGTGAGTGAGTGTGT GCGTG AAACCACGCACACACTCACTC ACCC : VEGFA-tRNA- N ₂ o GGTGAGTGAGTGTGT GCGTGTGG CACCGaacaaagcaccagtggtctagtgg tagaatagtaccctgccacggtacagacccgg gttcgattcccggctggtgcaGGTGAGT GAGTGTGTGC AAACCACGCACACACTCACTC ACCtgcaccagccgggaatcccactcgggtc tgtaccactgtggcaggggtgtggcagggtg CLAIM 1. A genome editing system for site-directed modification of a target sequence in the genome of a cell, which contains at least one element from i) to iii): i) a Cas9 nuclease variant and an expression construct containing an RNA nucleotide sequence encoding a fusion of a tRNA and a guide RNA; ii) an expression construct containing a nucleotide sequence encoding a Cas9 nuclease variant and an expression construct containing an RNA nucleotide sequence encoding a tRNA-guide RNA fusion; and iii) an expression construct comprising a nucleotide sequence encoding a Cas9 nuclease variant and an RNA nucleotide sequence encoding a tRNA-guide RNA fusion; at the same time, the Cas9 nuclease variant has an increased editing specificity compared to wild-type Cas9 nuclease, while the 5'-end of the guide RNA is connected to the 3'-end of tRNA, while the RNA is cleaved at the 5'-end of the guide RNA after its transcription in the cell, as a result, a guide RNA is formed that does not carry an extra nucleotide at the 5' end. 2. A genome editing system for site-directed modification of a target sequence in the genome of a cell, which contains at least one of the following i) to iii): i) a Cas9 nuclease variant and an expression construct containing an RNA nucleotide sequence encoding a ribozyme-guide RNA fusion; ii) an expression construct comprising a nucleotide sequence encoding a Cas9 nuclease variant and an expression construct comprising an RNA nucleotide sequence encoding a ribozyme-guide RNA fusion; and iii) an expression construct comprising a nucleotide sequence encoding a Cas9 nuclease variant and a nucleotide sequence encoding a ribozyme-guide RNA fusion; at the same time, the Cas9 nuclease variant has an increased editing specificity compared to wild-type Cas9 nuclease, while the 5'-end of the guide RNA is connected to the 3'-end of the first ribozyme, while the first ribozyme is designed to cleave the RNA at the 5'-end of the guide RNA, as a result, a guide RNA is formed that does not carry an extra nucleotide at the 5' end. 3. The system of claim 1, wherein the tRNA and the cell to be modified are from the same species. 4. The system of claim 1, wherein the tRNA is encoded by the sequence shown in SEQ ID NO: 1. 5. The system of claim 1 or 2, wherein the Cas9 nuclease variant contains the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6. 6. The system according to claim 1 or 2, wherein the nucleotide sequence encoding the Cas9 nuclease variant is codon-optimized for the organism from which the cell to be modified originates. 7. The system of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA). 8. The system of claim 1 or 2, wherein the nucleotide sequence encoding the fused guide RNA is operably linked to a pol III promoter, the pol III promoter being selected from the group consisting of a U3 promoter, a U6 promoter, or an H1 promoter. 9. A method for genetically modifying a cell, comprising introducing into the cell a system according to any one of claims 1 to 8, by means of which the Cas9 nuclease variant targets the sequence - -