EA042263B1 - ANTIBODY COMPOSITIONS FOR TUMOR TREATMENT - Google Patents

Description

Sequence listing

The application for this invention contains a sequence listing in a machine-readable format in a file called A0015WO01-Sequence.txt created March 4, 2015 (83454 bytes), incorporated herein by reference.

Technical field

The present invention relates to bispecific antibodies targeting CD20 and CD3 antigens, as well as methods for killing tumors. The present invention also relates to methods for reducing and/or regulating effector functions that may result from Fc binding, in conjunction with antibody therapy for the treatment of tumors.

State of the art

Dual antibody strategies are used in complex diseases where multifactorial modulation helps improve therapeutic efficacy. CD20 is a non-glycosylated phosphoprotein expressed on the cell membranes of mature B cells. CD20 is considered a B-cell tumor-associated antigen because it is expressed in more than 95% of B-cell non-Hodgkin's lymphomas (NHL) and other B-cell malignancies, but is absent on progenitor B cells, dendritic cells, and plasma cells. Methods for treating cancer by targeting CD20 are known in the art. For example, the chimeric anti-CD20 monoclonal antibody rituximab has been used or proposed for use in the treatment of cancers such as NHL, chronic lymphocytic leukemia (CLL) and small cell lymphocytic lymphoma (MLL). Anti-CD20 antibodies are believed to kill CD20-expressing tumor cells through complement-dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), and/or induction of apoptosis and increased responsiveness to chemotherapy, although some patients have developed resistance to anti-CD20 therapy or they showed incomplete responses to it (for example, resistance to rituximab). CD3 is a homodimeric or heterodimeric antigen expressed on T cells in association with the T cell receptor complex (RTC) required for T cell activation. Functional CD3 results from the dimeric association of two of four different chains: epsilon, zeta, delta, and gamma. Bispecific antibodies that are capable of binding to CD3 and targeting an antigen such as CD20 have been proposed for therapeutic applications involving directing T-cell immune responses to tissues and cells expressing the target antigen.

A bispecific antibody containing a CD20-binding arm and a CD3-binding arm can provide the necessary mutual influence to increase antitumor activity. The third active element in such a bispecific antibody is the Fc domain. Modification of the Fc-binding properties can further enhance the antitumor efficacy of the therapeutic antibody.

Binding of the Fc domain of an immunoglobulin to its receptors results in numerous signaling and immune responses. These multiple effector functions, such as CDC and ADCC, are the result of class G immunoglobulins (IgG) complexing between the IgG Fab domain and the target antigen, with the IgG Fc domain binding to Fc receptors on effector cells. Some effector functions of IgG are independent of antigen binding and include functions such as circulating serum levels and the ability to transport Ig across barriers. Other effector functions are considered important for use in immunoglobulin therapy such as cancer treatment. In particular, the ADCC mechanism is believed to be one of the main antitumor mechanisms of therapeutic antibodies already commercially available, such as rastuzumab (metastatic breast cancer) and rituximab (non-Hodgkin's lymphoma). Current therapeutic strategies generally suggest that a reduction in effector functions (or a reduction in Fc-gamma receptor binding) may be beneficial for antibodies whose goal is to neutralize or inhibit the biological activity of an antigen (for example, blocker or antagonist antibodies) or activation or initiation of downstream cell signaling (eg, antibody agonists). However, the development of tumor-targeting antibodies with reduced effector function is counter-intuitive for tumor therapy, since reduction in the cytotoxicity of target cells is not expected to be effective in terms of treating the disease, i.e. destruction of tumor cells or inhibition of tumor growth.

One strategy described herein uses differential Fc receptor binding in combination with bispecific antigen binding to specific target tumor markers, as well as triggering tumor-specific T cell killing. The Fc domain of an antibody is designed to carefully regulate Fc receptor binding in order to eliminate or reduce undesirable killing of cells such as T cells, natural killer cells, and Fc receptor-bearing macrophages. A unique binding profile with respect to Fc receptor interaction, including FcγRII receptor binding interactions, but characterized by the absence of FcyRI or FcyRIII interactions, has not been described in the art for targeting

- 1 042263 Ig-therapy tumors. Thus, the combination of bispecific B-cell and T-cell antibodies with reduced binding to Fc receptors leads to unexpectedly favorable therapeutic properties. Bispecific antibodies that bind both CD3 and CD20 are particularly useful in clinical settings where specific targeting of CD20 with controlled and effective cytotoxicity is desired.

Brief description of the essence of the invention

In a first aspect, the present invention provides bispecific antibodies with altered Fc binding domains that bind human CD3 and CD20. The antibodies of this aspect of the invention are useful, among other things, for targeting CD3-expressing T cells and for stimulating T cell activation, for example, under conditions where T cell-mediated killing is advantageous or necessary as part of a bispecific antibody. , which directs CD3-mediated T cell activation to specific cell types, such as anti-CD20 tumor cells. Additionally, antibodies are designed to have specific effector functions that are not found in the natural repertoire of the immune system. Typical anti-CD3/CD20 antibodies according to the invention are listed in table. 1-8 in this document.

In table. 1 shows the amino acid sequence designations of the heavy chain variable regions (HCVR) and light chain variable regions (LCVR), as well as the heavy chain complementarity determining regions (HCDR1, HCDR2 and HCDR3) and the light chain complementarity determining regions (LCDR1, LCDR2 and LCDR3) typical bispecific antibodies.

In table. 2 shows the sequence designations of nucleic acid molecules encoding HCVR, LCVR, HCDR1, HCDR2 HCDR3, LCDR1, LCDR2 and LCDR3 generic bispecific antibodies.

In table. 3 shows combinations of amino acid sequence designations of exemplary bispecific antibodies, including combinations of HCVR, heavy chain constant region (CH), and LCVR.

In table. 4 shows the designations for combinations of nucleic acid molecules encoding combinations of HCVR, heavy chain constant region ( _CH ), and LCVR of exemplary bispecific antibodies.

In table. 5 shows the amino acid sequence designations of examples of heavy chains according to the invention, in which the bispecific antibody contains HCVR containing HCDR1, HCDR2 and HCDR3 from table. 5 paired with _CH according to the invention.

In table. 6 shows separately the designations of the amino acid sequences of examples of light chains according to the invention, in which the bispecific antibody contains an LCVR containing LCDR1, LCDR2 and LCDR3 from table. 6.

The present invention provides antibodies or antigen-binding fragments thereof containing an HCVR containing an amino acid sequence selected from the HCVR amino acid sequences listed in Table 1. 1, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

The present invention also provides antibodies or antigen-binding fragments thereof containing an LCVR containing an amino acid sequence selected from the LCVR amino acid sequences listed in Table 1. 1, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

The present invention also provides antibodies or antigen-binding fragments thereof, containing a pair of amino acid sequences HCVR and LCVR (HCVR/LCVR), containing a pair of amino acid sequences found in typical anti-CD3/CD20 antibodies listed in table. 1. In certain embodiments, the HCVR/LCVR amino acid sequence pair is selected from the group consisting of SEQ ID NOs: 2/18 and 10/18 (eg, Antibody 1 and Antibody 2).

The present invention also provides antibodies or antigen-binding fragments thereof containing a heavy chain CDR1 (HCDR1) containing an amino acid sequence selected from the HCDR1 amino acid sequences listed in Table 1. 1, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

The present invention also provides antibodies or antigen-binding fragments thereof containing a heavy chain CDR2 (HCDR2) containing an amino acid sequence selected from the HCDR2 amino acid sequences listed in Table 1. 1, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

The present invention also provides antibodies or antigen-binding fragments thereof containing a heavy chain CDR3 (HCDR3) containing an amino acid sequence selected from the HCDR3 amino acid sequences listed in Table 1. 1, or a substantially similar sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

The present invention also provides antibodies or antigen-binding fragments thereof containing a light chain CDR1 (LCDR1) containing an amino acid sequence selected from the LCDR1 amino acid sequences listed in Table 1. 1, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

The present invention also provides antibodies or antigen-binding fragments thereof containing a light chain CDR2 (LCDR2) containing an amino acid sequence selected from the LCDR2 amino acid sequences listed in Table 1. 1, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

The present invention also provides antibodies or antigen-binding fragments thereof containing a light chain CDR3 (LCDR3) containing an amino acid sequence selected from the LCDR3 amino acid sequences listed in Table 1. 1, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

The present invention also provides antibodies or antigen-binding fragments thereof, containing a pair of amino acid sequences HCDR3 and LCDR3 (HCDR3/LCDR3), containing the amino acid sequences of HCDR3 listed in table. 1 paired with any of the LCDR3 amino acid sequences listed in Table. 1, such as an HCDR3/LCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 8/16 (eg, Antibody 1 or Antibody 2).

The present invention also provides antibodies or antigen-binding fragments thereof containing a group of six CDRs (ie HCDR1-HCDR2-HCDR3-LCDR1-LCDR2-LCDR3) from Table. 1. In certain embodiments of the invention, the group of amino acid sequences HCDR1-HCDR2-HCDR3-LCDR1-LCDR2-LCDR3 is SEQ ID NO: 4-6-8-20-22-24 or 12-14-16-20-22-24 (eg, Antibody 1 or Antibody 2).

In a related embodiment, the present invention provides antibodies, or antigen-binding fragments thereof, comprising a group of six CDRs (i.e., HCDR1-HCDR2-HCDR3LCDR1-LCDR2-LCDR3) contained in the HCVR/LCVR amino acid sequence pair defined for the exemplary antibodies listed in table. 1. For example, included in the present invention are antibodies or antigen-binding fragments thereof comprising a group of amino acid sequences HCDR1-HCDR2-HCDR3-LCDR1-LCDR2-LCDR3 contained in an HCVR/LCVR amino acid sequence pair selected from the group consisting of SEQ ID NO: 2 /18 (for example, antibody 1 or antibody 2). Methods and methods for determining CDRs in HCVR and LCVR amino acid sequences are well known in the art and can be used to detect CDRs in specific HCVR and/or LCVR amino acid sequences disclosed herein. Model conventions that can be used to define CDR boundaries include, for example, the definition of Kabat, the definition of Hotia, and the definition of AbM. In general terms, the definition of Kabat is based on sequence variability, the definition of Hotia is based on the location of regions of structural loops, and the definition of AbM is a compromise between the approaches of Kabat and Hotia. See, for example, Kabat, Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md. (1991); Al-Lazikani et al., J. Mol. Biol. 273:927-948 (1997); and Martin et al., Proc. Natl. Acad. sci. USA, 5619268-9272 (1989). General databases are also available for determining CDR sequences in an antibody.

The present invention also provides nucleic acid molecules encoding antibodies or parts thereof, for example, the present invention provides nucleic acid molecules encoding the HCVR or LCVR amino acid sequences listed in Table 1. 1; in certain embodiments of the invention, the nucleic acid molecule contains a polynucleotide sequence selected from the HCVR/LCVR nucleotide sequences listed in table. 2, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

Also provided in the present invention are nucleic acid molecules encoding the amino acid sequences of HCDR1 or HCDR2 or HCDR3 listed in Table 1. 1; in certain embodiments of the invention, the nucleic acid molecule contains a polynucleotide sequence selected from any of the nucleotide sequences HCDR1, or HCDR2, or HCDR3 listed in table. 2, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

Also provided in the present invention are nucleic acid molecules encoding any of the LCDR1 or LCDR2 or LCDR3 amino acid sequences listed in Table 1. 1; V

- 3 042263 certain embodiments of the invention, the nucleic acid molecule contains a polynucleotide sequence selected from any of the LCDR1 or LCDR2 or LCDR3 nucleotide sequences listed in Table. 2, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them. Also provided herein are nucleic acid molecules encoding HCVR, wherein the HCVR contains a group of three CDRs (i.e., HCDR1-HCDR2-HCDR3), with the group of amino acid sequences HCDR1-HCDR2-HCDR3 corresponding to those defined for exemplary anti-POPs antibodies. listed in Table. 1. Also provided in the present invention are nucleic acid molecules encoding an LCVR, wherein the LCVR contains a group of three CDRs (i.e. LCDR1-LCDR2-LCDR3), wherein the group of amino acid sequences LCDR1-LCDR2-LCDR3 corresponds to those defined for typical anti- CD3 antibodies listed in Table. 1. Also provided in the present invention are nucleic acid molecules encoding both HCVR and LCVR, wherein the HCVR contains an amino acid sequence from the HCVR amino acid sequences listed in Table 1. 1, a LCVR contains the amino acid sequence of the LCVR amino acid sequences listed in table. 1. In certain embodiments of the invention, the nucleic acid molecule contains a polynucleotide sequence selected from any of the HCVR nucleotide sequences listed in table. 2 or substantially sequence-similar having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them, a polynucleotide sequence selected from the LCVR nucleotide sequences listed in Table . 2, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them. In certain embodiments in accordance with this aspect of the invention, the nucleic acid molecule encodes HCVR and LCVR, while HCVR and LCVR are both derived from a single anti-CD3 antibody, shown in table. 1.

The present invention also provides antibodies, or antigen-binding fragments thereof, comprising a heavy chain constant region ( _CH ) comprising an amino acid sequence selected from the CH amino acid sequences listed in Table 1. 2, or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

The present invention also provides antibodies, or antigen-binding fragments thereof, comprising a heavy chain constant region (CH) encoded by a nucleotide sequence selected from the CH nucleotide sequences listed in Table 1. 2 or a substantially similar sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with them.

Also provided herein are recombinant expression vectors capable of expressing a polypeptide comprising an anti-CD3 antibody heavy or light chain variable region and an anti-CD20 antibody heavy or light chain variable region. For example, the present invention includes recombinant expression vectors containing any of the above nucleic acid molecules, ie. nucleic acid molecules encoding the HCVR, LCVR and/or CDR and/or CH sequences shown in Table 1. 1 and 2. Also included within the scope of the present invention are host cells into which such vectors have been introduced, as well as methods for producing antibodies or parts thereof by culturing the host cells under conditions that can produce antibodies or antibody fragments, and isolating antibodies and fragments of antibodies obtained in this way.

In another aspect, the invention provides a therapeutically effective amount of a recombinant human antibody or fragment thereof that specifically binds CD3 and CD20, wherein the antibody comprises a chimeric Fc domain and a pharmaceutically acceptable carrier. In a related aspect, the invention relates to a composition that is a combination of an anti-CD3/CD20 antibody and a second therapeutic agent. In one embodiment of the invention, the second therapeutic agent is any agent that provides an advantage in combination with an anti-CD3/CD20 antibody. Exemplary agents that provide benefit in combination with an anti-CD3/CD20 antibody include, without limitation, other agents that bind and/or activate CD3 signaling (including other antibodies or antigen-binding fragments thereof, etc.) and/or agents which do not directly bind CD3 but nevertheless activate immune cells, or stimulate immune cell activation, or increase tumor killing. Additional combination therapies and co-formulations containing anti-CD3 antibodies of the present invention are disclosed elsewhere in this document.

According to another aspect, the present invention provides bispecific antigen-binding molecules that bind CD3 and a target antigen, wherein the molecule contains a chimeric Fc domain having reduced effector function. In a specific embodiment of the invention, the molecule contains the chimeric Fc domain described herein. According to

- 4 042263 with certain exemplary embodiments of the invention, bispecific antigen-binding molecules bind CD3 and CD20; such bispecific antigen-binding molecules are referred to herein as anti-CD3/anti-CD20 bispecific molecules. The Ahtu-CD20 portion of the anti-CD3/anti-CD20 bispecific molecule is used to target tumor cells that express CD20 (eg, B cell tumors), and the anti-CD3 portion of the bispecific molecule is used to activate T cells. The simultaneous binding of CD20 on the tumor cell and CD3 on the T cell mediates targeted killing (cell lysis) of the target tumor cell activated by the T cell, which is facilitated by effector cells that bind the chimeric Fc domain. Therefore, the anti-CD3/anti-CD20 bispecific molecules of the invention are useful, among other things, in the treatment of diseases or disorders associated with or caused by CD20-expressing tumors (eg, lymphomas and melanoma tumors).

The anti-CD3/anti-CD20 bispecific molecules of the invention further provide a method for regressing CD20 positive tumors. Therefore, the invention provides a method of treating B-cell cancer in a subject, comprising administering a therapeutic amount of the anti-CD3/anti-CD20 bispecific molecules of the invention, the amount being sufficient to reduce tumor burden, tumor regression, or tumor development in the subject.

The anti-CD3/anti-CD20 bispecific molecules of the invention further provide a method for suppressing or regressing CD20-positive (ie, CD20-expressing) melanoma. Therefore, the invention provides a method of treating CD20 positive melanoma in a subject, comprising administering a therapeutic amount of the anti-CD3/anti-CD20 bispecific molecules of the invention, the amount being sufficient to inhibit tumor growth, reduce tumor burden, or slow tumor development in the subject. In another aspect, the present invention provides the use of a bispecific antibody for treating or ameliorating cancer in a subject, wherein the bispecific antibody comprises a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc domain associated with each of the first and second antigen-binding domains, and the treatment or reduction of the intensity of cancer includes (a) inhibition of tumor growth in the subject; (b) mediating B cell lysis in a subject; (c) treating a B cell cancer in a subject; (d) treating a cancer positive for CD20 expression in a subject; or (e) treating a CD20-expressing melanoma cancer in a subject. In another aspect, the present invention provides the use of a bispecific antibody to suppress tumor growth in a subject, wherein the bispecific antibody comprises a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc domain associated with each of first and second antigen-binding domains. In some instances, suppressing tumor growth includes (a) inhibiting tumor growth in a subject; (b) reducing the size of the tumor(s) in the subject; or (c) reducing the number of tumors in the subject.

In another aspect, the present invention provides the use of a bispecific antibody to mediate B-cell lysis in a subject, wherein the bispecific antibody comprises a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc domain associated with each of the first and second antigen-binding domains. In some cases, the B cells are pre-B lymphocytes, mature B lymphocytes, or B-cell non-Hodgkin's lymphoma cells. In another aspect, the present invention provides the use of a bispecific antibody for the treatment of B cell cancer in a subject, wherein the bispecific antibody comprises a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc domain associated with each of the first and second antigen-binding domains. In some cases, B-cell cancer is selected from the group consisting of follicular lymphoma, B-cell chronic lymphocytic leukemia, B-cell lymphoblastic lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, diffuse large B-cell lymphoma, marginal zone lymphoma, mantle cell lymphoma, leukemia hairy cells and Burkitt's lymphoma. In some cases, the subject is affected by a tumor that is resistant or not fully responsive to (a) anti-CD20 monospecific monotherapy or (b) rituximab monotherapy. In some instances, the subject has received anti-CD20 monospecific antibody therapy for at least 1 day to 1 year prior to administration of the bispecific antibody. In some cases, anti-CD20 monospecific therapy includes or consists of the use of an anti-CD20 monospecific antibody. In some instances, the anti-CD20 monospecific antibody is rituximab.

In another aspect, the present invention provides the use of a bispecific antibody for the treatment of B cell cancer in a subject, comprising (a) selecting a subject that is afflicted with a cancer that is resistant or not fully responsive to anti-CD20 monospecific monotherapy; and (b) administering to the subject a therapeutic amount of a bispecific antibody comprising the first

- 5 042263 an antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc domain associated with each of the first and second antigen-binding domains. In some instances, the subject is selected based on the presence of a tumor that is resistant, refractory, or not fully responsive to anti-CD20 monospecific therapy. In some cases, anti-CD20 monospecific therapy includes or consists of the use of an anti-CD20 monospecific antibody. In some instances, the anti-CD20 monospecific antibody is rituximab. In some cases, B-cell cancer is a lymphoma. In some cases, the lymphoma is non-Hodgkin's lymphoma (NHL). In some cases, B-cell cancer is chronic lymphocytic leukemia (CLL).

In another aspect, the present invention provides the use of a bispecific antibody for the treatment of B cell cancer in a subject, wherein the bispecific antibody comprises a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc domain associated with each of the first and second antigen-binding domains, and the bispecific antibody is administered in an amount sufficient to reduce tumor burden, regress the tumor, inhibit tumor growth, or slow down tumor development in the subject.

In some cases, B-cell cancer is selected from the group consisting of follicular lymphoma, B-cell chronic lymphocytic leukemia, B-cell lymphoblastic lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, diffuse large B-cell lymphoma, marginal zone lymphoma, mantle cell lymphoma, leukemia hairy cells and Burkitt's lymphoma. In some cases, the subject is affected by a tumor that is resistant or not fully responsive to anti-CD20 monospecific monotherapy. In some cases, the subject is affected by a tumor that is resistant or not fully responsive to rituximab monotherapy. In some instances, the subject has received anti-CD20 monospecific antibody therapy for at least 1 day to 1 year prior to administration of the bispecific antibody. In some cases, anti-CD20 monospecific therapy includes or consists of the use of an anti-CD20 monospecific antibody. In some instances, the anti-CD20 monospecific antibody is rituximab. In some instances, an amount sufficient to reduce tumor burden, regress the tumor, inhibit tumor growth, or slow tumor development in a subject is about 0.001 to about 1 mg/kg. In some instances, an amount sufficient to reduce tumor burden, regress the tumor, or slow down tumor development in a subject is about 0.4 mg/kg. In another aspect, the present invention provides the use of a bispecific antibody for the treatment of cancer positive for CD20 expression in a subject, comprising (a) selecting a subject that is afflicted with cancer and/or tumors; (b) obtaining one or more biological samples from the subject; (c) determining CD20-expressing cancer or tumor cells in one or more samples; and (d) administering to the subject a therapeutic amount of a bispecific antibody comprising a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc domain associated with each of the first and second antigen-binding domains.

In some instances, the subject is selected based on the presence of a cancer or tumor that is resistant, refractory, or not fully responsive to anti-CD20 therapy. In some cases, the subject is selected based on the presence of residual cancer. In some cases, anti-CD20 therapy includes or consists of the use of an anti-CD20 monospecific antibody. In some instances, the anti-CD20 monospecific antibody is rituximab. In some cases, the cancer is lymphoma or leukemia. In some cases, the lymphoma is selected from the group consisting of follicular lymphoma, B-cell lymphoblastic lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, diffuse large B-cell lymphoma, marginal zone lymphoma, mantle cell lymphoma, hairy cell leukemia, and Burkitt's lymphoma. In some cases, the leukemia is chronic lymphocytic leukemia (CLL).

In another aspect, the present invention provides the use of a bispecific antibody for the treatment of CD20-expressing melanoma cancer in a subject, comprising administering a therapeutic amount of a bispecific antibody comprising a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc- a domain associated with each of the first and second antigen-binding domains, wherein the amount is sufficient to reduce tumor burden, inhibit tumor growth, or slow tumor development in a subject.

The bispecific antigen-binding molecules according to this aspect of the present invention comprise a first antigen-binding domain that specifically binds human CD3, a second antigen-binding domain that specifically binds human CD20, and a chimeric Fc domain. Included in the present invention are anti-CD3/anti-CD20 bispecific molecules (eg, bispecific antibodies) wherein each antigen binding domain comprises a heavy chain variable region (HCVR) paired with a light chain variable region (LCVR). IN

- 6 042263 certain exemplary embodiments of the invention, each aHTu-CD3 antigen-binding domain and anti-CD20 antigen-binding domain contains different, distinct HCVRs paired with a common LCVR. For example, as illustrated in Example 2 herein, bispecific antibodies were constructed comprising a first antigen-binding domain that specifically binds CD3, wherein the first antigen-binding domain comprises an HCVR/LCVR pair derived from an anti-CD3 antibody; and a second antigen-binding domain that specifically binds CD20, wherein the second antigen-binding domain comprises an HCVR derived from an anti-CD20 antibody paired with an LCVR derived from an anti-CD3 antibody (e.g., the same LCVR that is included in the anti-CD3 antigen-binding domain ). In other words, in exemplary molecules disclosed herein, pairing an HCVR from an anti-CD20 antibody with an LCVR from an anti-CD3 antibody results in an antigen-binding domain that specifically binds CD20 (but does not bind CD3). In such embodiments, the first and second antigen-binding domains contain distinct anti-CD3 and anti-CD20 HCVR, but share a common anti-CD3 LCVR.

The present invention provides anti-CD3/anti-CD20 bispecific molecules in which the first antigen-binding domain that specifically binds CD3 contains any of the HCVR amino acid sequences shown in Table 1. 1 or 2. The first antigen-binding domain that specifically binds CD3 may also contain any of the LCVR amino acid sequences shown in table. 1 or 2. In accordance with certain embodiments of the invention, the first antigen-binding domain that specifically binds CD3 contains any of the pairs of amino acid sequences HCVR/LCVR shown in table. 1 or 2. The present invention also provides anti-CD3/anti-CD20 bispecific molecules, wherein the first antigen-binding domain that specifically binds CD3 comprises any of the heavy chain CDR1-CDR2-CDR3 amino acid sequences shown in Table 1. 1 or 2, and/or any of the light chain CDR1-CDR2-CDR3 amino acid sequences shown in Table. 1 or 2.

In accordance with certain embodiments, the present invention provides anti-CD3/anti-CD20 bispecific molecules wherein the first antigen-binding domain that specifically binds CD3 comprises a heavy chain variable region (HCVR) having an amino acid sequence comprising SEQ ID NO: 10 or a substantially similar sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it. Also provided herein are anti-CD3/anti-CD20 bispecific molecules wherein the first antigen-binding domain that specifically binds CD3 comprises a light chain variable region (LCVR) having an amino acid sequence comprising SEQ ID NO: 18 or substantially similar to a sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it.

Also provided herein are anti-CD3/anti-CD20 bispecific molecules, wherein the first antigen-binding domain that specifically binds CD3 comprises a pair of amino acid sequences HCVR and LCVR (HCVR/LCVR) selected from the group consisting of SEQ ID NO: 10 /18. Also provided herein are anti-CD3/anti-CD20 bispecific molecules wherein the first antigen-binding domain that specifically binds CD3 comprises a heavy chain CDR3 domain (HCDR3) having an amino acid sequence comprising SEQ ID NO: 16 or substantially similar to a sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it; and a light chain CDR3 domain (LCDR3) having an amino acid sequence comprising SEQ ID NO: 24 or a substantially similar sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In certain embodiments of the invention, the first antigen-binding domain that specifically binds CD3 contains a pair of amino acid sequences HCDR3/LCDR3 containing SEQ ID NO: 16/24.

Also provided herein are anti-CD3/anti-CD20 bispecific antigen-binding molecules, wherein the first antigen-binding domain that specifically binds CD3 comprises a heavy chain CDR1 domain (HCDR1) having an amino acid sequence comprising SEQ ID NO: 12 or substantially a similar sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it; a heavy chain CDR2 domain (HCDR2) having an amino acid sequence comprising SEQ ID NO: 14 or a substantially similar sequence having at least 90%, at least 95%, at least 98%, or at least 99 % sequence identity; a light chain CDR1 domain (LCDR1) having an amino acid sequence comprising SEQ ID NO: 20 or a substantially similar sequence, having at least 90%, at least 95%, at least 98%, or at least 99 % sequence identity; and a light chain CDR2 domain (LCDR2) having

- 7 042263 amino acid sequence containing SEQ ID NO: 22 or a substantially similar sequence, having at least 90%, at least 95%, at least 98% or at least 99% sequence identity with it. Some non-limiting exemplary anti-CD3/anti-CD20 bispecific antigen-binding molecules of the invention comprise a first antigen-binding domain that specifically binds CD3, comprising HCDR1-HCDR2-HCDR3-LCDR1-LCDR2-LCDR3 domains, respectively having amino acid sequences selected from the group consisting of SEQ ID NO: 12-14-16-20-22-24.

Also provided herein are anti-CD3/anti-CD20 bispecific molecules wherein the second antigen-binding domain that specifically binds CD20 comprises a heavy chain variable region (HCVR) having an amino acid sequence comprising SEQ ID NO: 2 or substantially similar to a sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it.

Also provided herein are anti-CD3/anti-CD20 bispecific molecules wherein the second antigen-binding domain that specifically binds CD20 comprises a light chain variable region (LCVR) having an amino acid sequence comprising SEQ ID NO: 18 or substantially similar to a sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it. Also provided herein are anti-CD3/anti-CD20 bispecific molecules wherein the second antigen-binding domain that specifically binds CD20 comprises a light chain variable region (LCVR) having an amino acid sequence comprising SEQ ID NO: 75 or substantially similar to a sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it.

Also provided in the present invention are anti-CD3/anti-CD20 bispecific molecules, wherein the second antigen-binding domain that specifically binds CD20 comprises a pair of amino acid sequences HCVR and LCVR (HCVR/LCVR) containing SEQ ID NO: 2/18 or SEQ ID NO: 2/75. Also provided herein are anti-CD3/anti-CD20 bispecific molecules wherein the second antigen-binding domain that specifically binds CD20 comprises a heavy chain CDR3 domain (HCDR3) having the amino acid sequence of SEQ ID NO: 8 or a substantially similar sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it; and a light chain CDR3 domain (LCDR3) having an amino acid sequence comprising SEQ ID NO: 24 or a substantially similar sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

In certain embodiments of the invention, the second antigen-binding domain that specifically binds CD20 contains a pair of amino acid sequences HCDR3/LCDR3 containing SEQ ID NO: 8/24. Also provided herein are anti-CD3/anti-CD20 bispecific antigen-binding molecules, wherein the second antigen-binding domain that specifically binds CD20 comprises a heavy chain CDR1 domain (HCDR1) having the amino acid sequence of SEQ ID NO: 4 or a substantially similar sequence. having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it; a heavy chain CDR2 domain (HCDR2) having the amino acid sequence of SEQ ID NO: 6 or a substantially similar sequence having at least 90%, at least 95%, at least 98%, or at least 99% identity with it sequences; a light chain CDR1 domain (LCDR1) having the amino acid sequence of SEQ ID NO: 20 or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% identity with it sequences; and a light chain CDR2 domain (LCDR2) having the amino acid sequence of SEQ ID NO: 22 or substantially similar in sequence, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[Some non-limiting exemplary anti-CD3/anti-CD20 bispecific antigen-binding molecules of the invention comprise a second antigen-binding domain that specifically binds CD20, comprising HCDR1-HCDR2-HCDR3-LCDR1-LCDR2-LCDR3 domains, respectively having amino acid sequences selected from the group consisting of from SEQ ID NO: 4-6-8-20-22-24 (eg Antibody 1 or Antibody 2).

In one embodiment, the anti-CD3/anti-CD20 bispecific antigen-binding molecules of the invention comprise a first antigen-binding domain (A1) that specifically binds human CD3 and contains three heavy chain complementarity-determining regions (A1-HCDR1, A1-HCDR2, A1-HCDR3 ) and three complementarity-determining regions

- 8 042263 light chain (A1-LCDR1, A1-LCDR2, A1-LCDR3), and a second antigen-binding domain (A2) that specifically binds human CD20 and contains three heavy chain complementarity-determining regions (A2-HCDR1, A2-HCDR2 and A2 -HCDR3) and three light chain complementarity determining regions (A2-LCDR1, A2-LCDR2 and A2-LCDR3); wherein (a) A1-HCDR1 contains the amino acid sequence of SEQ ID NO: 12; (b) A1-HCDR2 contains the amino acid sequence of SEQ ID NO: 14; (c) A1-HCDR3 contains the amino acid sequence of SEQ ID NO: 16; (d) A1-LCDR1 contains the amino acid sequence of SEQ ID NO: 20; (e) A1-LCDR2 contains the amino acid sequence of SEQ ID NO: 22; (f) A1-LCDR3 contains the amino acid sequence of SEQ ID NO: 24; (g) A2-HCDR1 contains the amino acid sequence of SEQ ID NO: 4; (h) A2-HCDR2 contains the amino acid sequence of SEQ ID NO: 6; (i) A2-HCDR3 contains the amino acid sequence of SEQ ID NO: 8; (j) A2-LCDR1 contains the amino acid sequence of SEQ ID NO: 20; (k) A2-LCDR2 contains the amino acid sequence of SEQ ID NO: 22; and (I) A2-LCDR3 contains the amino acid sequence of SEQ ID NO: 24.

In a related embodiment, the invention includes anti-CD3/anti-CD20 bispecific antigen-binding molecules, wherein the second antigen-binding domain that specifically binds CD20 comprises the heavy and light chain CDR domains contained in the heavy and light chain variable region sequences (HCVR/LCVR) SEQ ID NO: 2/18.

In another aspect, the present invention provides nucleic acid molecules encoding any of the HCVR, LCVR, or CDR sequences of the anti-CD3/anti-CD20 bispecific antigen-binding molecules disclosed herein, including nucleic acid molecules comprising the polynucleotide sequences shown herein in Table 1. 2, 7 and 8, as well as nucleic acid molecules containing two polynucleotide sequences shown in table. 2, 7 and 8, in any functional combination or arrangement. Also included in the invention are recombinant expression vectors carrying the nucleic acids of the invention and host cells in which such vectors have been introduced, as well as methods for producing antibodies by culturing host cells under conditions that allow antibody production and isolating the resulting antibodies. The present invention includes anti-CD3/anti-CD20 bispecific antigen-binding molecules, in which any of the above antigen-binding domains that specifically bind CD3 is combined, linked or otherwise associated with any of the above antigen-binding domains that specifically bind CD20, with the formation of a bispecific antigen-binding molecule that binds CD3 and CD20. In another aspect, the invention provides a bispecific antibody comprising a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc domain associated with each of the first and second antigen-binding domains. In a related aspect, the bispecific antibody is capable of specifically binding to human FcyRIIA and human FcyRIIB. The present invention provides anti-CD3/anti-CD20 bispecific antigen-binding molecules that preferentially bind to human FcyRIIA and human FcyRIIB and exhibit little or no binding affinity for human FcyRI or human FcyRIII. In one aspect, the bispecific antibodies are capable of specifically binding to human FcyRIIA with higher affinity than for binding human FcyRIIB, human FcyRI, and/or human FcyRIII, as measured by an in vitro assay. The bispecific antibodies of the invention are able to specifically bind to human FcyRIIA and human FcyRIIB with a higher affinity than these antibodies bind to human FcyRI or human FcyRIII, according to in vitro assay data. In some embodiments, the antibody specifically binds to both human FcyRIIA and human FcyRIIB and exhibits a binding affinity corresponding to a K _D of less than 1 μM for each of human FcyRI and human FcyRIII, as determined by an in vitro assay. In other aspects, the invention provides a bispecific antibody comprising a first and a second heavy chain polypeptide each containing a chimeric Fc domain, wherein the first heavy chain polypeptide comprises an antigen-binding domain that binds human CD3 and the second heavy chain polypeptide comprises a second antigen-binding domain. domain that binds human CD20.

In other embodiments of the invention, the antibody shows a higher, i. stronger binding affinity for human FcyRIIA compared to its binding to human FcyRIIB according to in vitro assay data. In other embodiments, the antibody binds to human FcyRIIA and exhibits a lower K _D value compared to its binding to human FcyRIIB as determined by an in vitro assay. In some embodiments of the invention, the antibody binds to human FcyRIIA at 25° C. with a K _D value between 10 and 30 μM according to in vitro assay data. In some embodiments of the invention, the antibody binds to human FcyRIIB at 25°C with a K _D value between 100 and 250 μM according to in

- 9 042263 vitro analysis. In another embodiment, the antibody exhibits low or no detectable binding affinity for human FcyRI as determined by an in vitro assay. In some embodiments, the antibody exhibits low or no detectable binding affinity for human FcyRIII as determined by an in vitro assay. In some embodiments, the in vitro assay is a surface plasmon resonance assay.

In some embodiments, the antibody exhibits reduced antibody-dependent cellular cytotoxicity (ADCC) compared to an antibody containing a wild-type Fc domain, as determined by an in vitro cytotoxicity assay.

In some embodiments, the antibody exhibits little or no detectable antibody-dependent cellular cytotoxicity (ADCC).

In some embodiments, the antibody exhibits reduced complement-dependent cytotoxicity (CDC) compared to an antibody containing a wild-type Fc domain, as determined by an in vitro cytotoxicity assay. In some embodiments, the antibody exhibits less than 50% cytotoxicity as measured by cell lysis data obtained in an in vitro assay.

In some embodiments, the antibody exhibits little or no detectable complement dependent cytotoxicity (CDC).

In some embodiments, the antibody induces a reduction in T cell-mediated killing of cells bearing Fc receptors, such as NK cells or macrophages, compared to an antibody containing a wild-type Fc domain. In certain embodiments, the antibody induces a reduction in T cell killing mediated by cells bearing Fc receptors, such as NK cells or macrophages, compared to an antibody containing a wild-type Fc domain.

In some embodiments, the antibody exhibits a stronger binding affinity for human FcyRIIA than its binding affinity for human FcyRIIB, which is stronger than its binding affinity for human FcyRI, which is greater than or equal to its binding affinity for human FcyRIII, according to determination by measuring K _D in an in vitro assay. In other embodiments, the antibody exhibits binding affinity for human FcyRIIA>human FcyRIIB>human FcyRI>=human FcyRIII as determined by an in vitro assay.

In some embodiments, the antibody exhibits a stronger binding affinity for human FcyRIIA than its binding affinity for human FcyRIIB, which is stronger than its binding affinity for human FcyRIII, which is greater than or equal to its binding affinity for human FcyRIIA, according to determination by measuring K _D in an in vitro assay. In other embodiments, the antibody exhibits binding affinity for human FcyRIIA>human FcyRIIB>human FcyRIII>=human FcyRI according to an in vitro assay.

In some embodiments, the human FcyRIII is a human FcyRIIIA or a human FcyRIIIB. In some embodiments, the chimeric Fc domain contains a chimeric hinge region.

In another aspect, the present invention provides a bispecific antibody comprising a first antigen-binding domain, a second antigen-binding domain, and a chimeric heavy chain constant region (CH), wherein (a) the first antigen-binding domain binds CD3; (b) the second antigen binding domain binds CD20. In certain aspects of the invention, the chimeric CH region binds to the higher, i. stronger affinity for human FcyRIIA and human FcyRIIB compared to an antibody containing the wild-type CH region, according to in vitro analysis. In another aspect, the chimeric CH binds to the lower, i. weaker, or no, affinity for human FcyRI and human FcyRIII compared to an antibody containing the wild-type CH region, according to in vitro assay data.

The invention provides bispecific antibodies containing a chimeric hinge region. In some aspects, the chimeric hinge region contains amino acid sequence residues from positions 216 to 236 (EU numbering). The bispecific antibodies of the invention are designed such that the chimeric hinge contains the human IgG2 PCPAPPVA lower hinge amino acid sequence (SEQ ID NO: 52) from position 228 to 236 (EU numbering). In certain embodiments, the bispecific antibodies of the invention comprise a chimeric hinge, and a portion of the upper hinge of the chimeric hinge contains amino acid residues 216 to 227 (EU numbering) of an IgG1 upper hinge. In other embodiments of the invention, the bispecific antibodies of the invention comprise a chimeric hinge region, and part of the upper hinge region of the chimeric hinge region contains amino acid residues from position 216 to 227 (EU numbering)

- 10 042263 IgG4 upper hinge region.

In one embodiment, the bispecific antibody comprises the chimeric hinge amino acid sequence EPKSCDKTHTCPPCPAPPVA (SEQ ID NO: 53). In another embodiment, the bispecific antibody comprises the chimeric hinge amino acid sequence ESKYGPPCPPCPAPPVA (SEQ ID NO: 54). In certain embodiments of the invention, the bispecific antibody comprises the amino acid sequence of the C _H 2 domain of human IgG4 from position 237 to 340 (EU numbering). In other embodiments, the bispecific antibody comprises a CH3 domain derived from a human IgG1 CH3 domain or a human IgG4 CH3 domain. In other embodiments, the bispecific antibody comprises a human IgG1 CH1 domain and a human IgG1 CH3 domain. In additional embodiments, the bispecific antibody comprises a human IgG4 CH1 domain and a human IgG4 CH3 domain.

In an aspect of the invention, there is provided a method for producing a bispecific antibody comprising a chimeric heavy chain constant region, comprising (a) transfecting a host cell with a nucleic acid molecule encoding a first light chain capable of binding the CD3 antigen, said nucleic acid molecule comprising a nucleotide sequence encoding VL the first light chain region, and the nucleotide sequence encoding the Ig constant CL region, wherein said nucleotide sequence encoding the VL region of the selected antigen-specific antibody and said nucleotide sequence encoding the Ig CL region are operably linked; (b) transfecting the host cell from step (a) with a nucleic acid molecule encoding the first heavy chain of an antibody capable of binding the CD3 antigen, said nucleic acid molecule comprising a nucleotide sequence encoding a VH region and a nucleotide sequence encoding a chimeric constant CH a human Ig region, wherein said nucleotide sequence encoding the VH region and the nucleotide sequence encoding the CH region of said Ig are operably linked; wherein the CH region encodes one or more amino acid modifications in the CH3 domain that reduce or eliminate the binding of the second CH3 domain to protein A; (c) transfecting the host cell from step (a) with a nucleic acid molecule encoding a second antibody heavy chain capable of binding the CD20 antigen, said nucleic acid molecule comprising a nucleotide sequence encoding a VH region and a nucleotide sequence encoding a chimeric CH- a human Ig region, wherein said nucleotide sequence encoding the VH region and the nucleotide sequence encoding the CH region of said Ig are operably linked; and (d) obtaining said antibody by co-expressing nucleic acid molecules according to (a) and (b) in said host cell.

In one embodiment, the present invention provides a method for producing a bispecific antibody by (a) transfecting a host cell with (i) a nucleic acid molecule encoding an antibody light chain, the nucleic acid molecule comprising a nucleotide sequence encoding an LCVR comprising SEQ ID NO: 18 , and a nucleotide sequence encoding an Ig CL constant region, wherein said nucleotide sequence encoding an LCVR region of an antibody is operably linked to a nucleotide sequence encoding an Ig CL region; (b) transfecting the host cell from step (a) (i) with a nucleic acid molecule encoding the first heavy chain of said antibody, said nucleic acid molecule comprising a nucleotide sequence encoding an HCVR comprising SEQ ID NO: 10 and a nucleotide sequence, coding chimeric CH-region of IgG, while the nucleotide sequence encoding the CH-region contains a nucleotide sequence encoding SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30 or SEQ ID NO: 32, while the specified nucleotide sequence the HCVR coding sequence is operably linked to the nucleotide sequence encoding the CH region; and (ii) a nucleic acid molecule encoding a second heavy chain of said antibody, said nucleic acid molecule comprising a nucleotide sequence encoding an HCVR comprising SEQ ID NO: 2 and a nucleotide sequence encoding an IgG chimeric CH region, wherein the nucleotide sequence , encoding the CH-region, contains a nucleotide sequence encoding SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30 or SEQ ID NO: 32, while the specified nucleotide sequence encoding HCVR is operably linked to the nucleotide sequence, encoding the CH region; and (c) obtaining said antibody by co-expressing nucleic acid molecules according to (a) and (b) in said host cell. In some cases, the method further includes the steps of culturing the host cell from step (b), wherein the antibody is secreted into the cell culture medium; and isolating the antibody from the cell culture medium.

In some aspects, a method for producing a bispecific antibody optionally comprises transfecting a host cell from step (a) with a nucleic acid molecule encoding a second light chain capable of binding the CD20 antigen, said nucleic acid molecule

- 11 042263 contains a nucleotide sequence encoding the VL region of the second light chain, and a nucleotide sequence encoding the constant CL region of Ig, while the specified nucleotide sequence encoding the VL region of the second light chain, and the specified nucleotide sequence encoding the CL region of Ig are functionally related.

In some embodiments, the first heavy chain contains a C _H 3 region containing the H95R modification (according to IMGT exon numbering; H435R according to EU numbering). In another embodiment, the first heavy chain comprises a C _H 3 region further comprising a Y96F (LMGT; Y436F according to EU numbering) modification. In additional embodiments of the invention, the method includes isolating the antibody using protein A. In another aspect of the invention, a bispecific antibody is provided, comprising (a) a first heavy chain containing an antigen-binding domain capable of recognizing and binding the first target antigen; (b) a second heavy chain containing an antigen-binding domain capable of recognizing and binding a second target antigen; and (c) a common light chain antigen-binding domain capable of recognizing and binding the first or second target antigen, wherein the heavy chain according to (a) or (b) or both (a) and (b) contains a heavy chain constant region ( C _H ) containing a chimeric hinge region containing the amino acid sequence of SEQ ID NO: 53 or SEQ ID NO: 54.

In certain embodiments, the heavy chain constant region ( _CH ) comprises the amino acid sequence of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, or SEQ ID NO: 32. In some embodiments, encoding the chimeric CH region the nucleotide sequence comprises SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, or SEQ ID NO: 33. In other embodiments, the nucleotide sequence of the chimeric CH region encodes the amino acid sequence of SEQ ID NO: : 26, SEQ ID NO: 28, SEQ ID NO: 30, or SEQ ID NO: 32. In other embodiments, the nucleotide sequence of the CH region comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, or SEQ ID NO: 33.

In certain aspects, the bispecific antibody comprises a light chain encoding nucleic acid molecule comprising the amino acid sequence of SEQ ID NO: 35. In other aspects, the bispecific antibody comprises a light chain encoding nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 34.

In certain aspects, the bispecific antibody comprises a heavy chain-encoding nucleic acid molecule comprising the amino acid sequence of SEQ ID NO: 37. In other aspects, the bispecific antibody comprises a heavy chain-encoding nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 36.

In certain aspects, the bispecific antibody comprises a heavy chain-encoding nucleic acid molecule comprising the amino acid sequence of SEQ ID NO: 40. In other aspects, the bispecific antibody comprises a heavy chain-encoding nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 38 or SEQ ID NO: 39 In certain aspects, the bispecific antibody comprises a heavy chain-encoding nucleic acid molecule comprising the amino acid sequence of SEQ ID NO: 42. In other aspects, the bispecific antibody comprises a heavy chain-encoding nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 41.

In certain aspects, the bispecific antibody comprises a heavy chain-encoding nucleic acid molecule comprising the amino acid sequence of SEQ ID NO: 44. In other aspects, the bispecific antibody comprises a heavy chain-encoding nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 43.

In another aspect, the invention provides a therapeutically effective amount of the anti-CD3/anti-CD20 bispecific antigen binding molecule disclosed herein. In a related aspect, the invention relates to a composition that is a combination of an anti-CD3/anti-CD20 bispecific antigen-binding molecule and a second therapeutic agent. In one embodiment, the second therapeutic agent is any agent that provides an advantage in combination with an anti-CD3/anti-CD20 bispecific antigen binding molecule. Exemplary agents that may provide benefit in combination with an anti-CD3/anti-CD20 bispecific antigen-binding molecule are discussed in detail elsewhere in this document.

In another aspect, the invention provides therapeutic methods for targeting/killing CD20-expressing tumor cells with an anti-CD3/anti-CD20 bispecific antigen-binding molecule of the invention, wherein the therapeutic methods comprise administering a therapeutically effective amount of a pharmaceutical composition comprising anti-CD3/ an anti-CD20 bispecific antigen-binding molecule of the invention to a subject in need thereof. In some instances, the bispecific antigen-binding molecule (eg, antibody) binds human cells expressing CD20 or binds human B cells.

- 12 042263

In another aspect, the invention provides bispecific antibodies, wherein the antibody binds human cells expressing human CD3 and cynomolgus monkey cells expressing cynomolgus CD3; binds human or cynomolgus monkey T cells; binds to CD3-expressing human T cells with an EC ₅₀ value between 1x10'1 and 1x10' ⁶ M; binds to CD3-expressing human T cells with an EC50 value between 1x10'9 and 1x10' ⁸ M; binds to CD20-expressing human B cells with an EC50 value between 1x10' ¹² and 1x10' ⁶ M; binds to CD20-expressing human B cells with an EC ₅₀ value between 1x10'9 and 1x10'8 M, or enhances T cell-mediated cytotoxicity of human B cells that are resistant or refractory to anti-CD20-mediated cytotoxicity. In various methods or uses of the present invention, a single administration of a bispecific antibody to a subject at a dose of at least about 0.01 mg/kg results in a sub-detectable reduction in the number of B cells in the subject about 2 days after administration of the bispecific antibody to the subject. In some instances, B cell counts remain below detectable levels for at least about 7 days after a single dose of at least about 0.01 mg/kg of the bispecific antibody is administered to the subject.

The present invention includes the use of an anti-CD3/anti-CD20 bispecific antigen-binding molecule of the invention for targeting/killing CD20-expressing tumor cells and in the manufacture of a medicament for the treatment of a disease or disorder associated with or caused by CD20 expression. In some cases, a bispecific antibody of the invention is used in the manufacture of a medicament for treating or ameliorating cancer in a subject, wherein the bispecific antibody comprises a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric Fc domain that binds with each of the first and second antigen-binding domains, and the treatment or reduction of the intensity of cancer includes (a) suppression of tumor growth in the subject; (b) mediating B cell lysis in a subject; (c) treating a B cell cancer in a subject; (d) treating a CD20-expressing cancer in a subject; or (e) treating a CD20-expressing melanoma cancer in a subject. The present invention also includes a bispecific antibody comprising a first antigen-binding domain, a second antigen-binding domain and a chimeric heavy chain constant region (CH), wherein: the first antigen-binding domain binds CD3, the second antigen-binding domain binds CD20, the chimeric CH region binds to a higher t .e. stronger affinity for human FcyRIIA and human FcyRIIB compared to an antibody containing a wild-type CH region, and such a bispecific antibody is intended for use in the manufacture of a medicament. The invention provides a bispecific antibody comprising a first antigen-binding domain that binds CD3, a second antigen-binding domain that binds CD20, and a chimeric CH region that binds to the higher, i. stronger affinity for human FcyRIIA than it binds to human FcyRIIB for use in drug manufacturing.

Other embodiments of the invention will become apparent upon reading the following detailed description.

Brief description of graphic materials

Fig. 1 illustrates the hinge amino acids used in the construction of chimeric hinge regions and the corresponding amino acid numbering system.

In FIG. 2 shows the amino acid sequence of the human IgG1 heavy chain constant region, including the CH1, hinge, CH2 and CH3 domains, described as IGHG1 in UniProtKB/Swiss-Prot Accession No. P01857 (SEQ ID NO: 45).

In FIG. 3 shows the amino acid sequence of the human IgG2 heavy chain constant region, including the CH1, hinge, CH2 and CH3 domains, described as IGHG2 in UniProtKB/Swiss-Prot Accession No. P01859 (SEQ ID NO: 46).

In FIG. 4 shows the amino acid sequence of the human IgG4 heavy chain constant region, including the C _H 1, hinge, C _H 2 and C _H 3 domains, described as IGHG4 in UniProtKB/Swiss-Prot Accession No. P01861 (SEQ ID NO: 47).

Fig. 5A and 5B: Dose-response curves illustrating the lack of CSC activity against Daudi (FIG. 5A) and Raji (FIG. 5B) cells in the presence of antibodies having wild type or chimeric CH hinge regions. (Control antibody 4 = bispecific antibody with gt IgG1 _CH ; antibody 1; antibody 2; isotype control IgG1 = non-specific antibody with gt IgG1 CH).

Fig. 6A and 6B: Dose-response curves illustrating the lack of ADCC activity against Daudi (FIG. 6A) and Raji (FIG. 6B) cells in the presence of antibodies having wild type or chimeric CH hinge regions. (Control antibody 4 = bispecific antibody with gt IgG1 _CH ; antibody 1; antibody 2; isotype control IgG1 = non-specific antibody with gt IgG1 CH).

- 13 042263

Fig. 7A-7F illustrate the volume of tumors (in mm ³ ) over time in NSG mice implanted subcutaneously with a mixture of Raji tumor cells and PBMC (or a control mixture without PBMC of FIG. 7D), with the CD3xCD20 bispecific antibody of the invention (Ab1), or stock solution or control antibody was administered after tumor implantation and treatment, starting on the day of tumor implantation (day 0), and measurements were taken throughout the study.

Fig. 7A: None of the mice showed inhibition of tumor growth when treated with stock solution.

Fig. 7B: 1 out of 5 (1/5) mice showed tumor growth inhibition when treated with 0.4 mg/kg control Ab5 (anti-FelD1 Ab).

Fig. 7C: 5/5 mice showed inhibition of tumor growth when treated with 0.4 mg/kg of antibody 1 (Ab1).

Fig. 7D: 0/5 mice showed tumor growth inhibition when not implanted with PBMCs and when treated with 0.4 mg/kg Ab1.

Fig. 7E: 5/5 mice showed tumor growth inhibition when treated with 0.04 mg/kg Ab1.

Fig. 7F: 5/5 mice showed inhibition of tumor growth when treated with 0.004 mg/kg Ab1.

Fig. 8A and 8B illustrate the volume of tumors (in mm ³ ) over time in NSG mice implanted subcutaneously with a mixture of Raji tumor cells and PBMCs and treated with Ab1 (CD3xCD20 chimeric Fc) compared to stock solution, with or without IgG injection (Fig. 8A) , or treated with Ab4 (CD3χCD20-dt Fc) versus stock solution, with or without IgG injection (FIG. 8B). In this model, both CD3xCD20 bispecific antibodies showed significant tumor growth inhibition without IgG administration. As seen in FIG. 8A, in this experiment, the CD3χCD20 chimeric Fc bispecific antibody (Ab1) demonstrates complete inhibition of tumor growth without IgG administration throughout the duration of the study.

Fig. 9 illustrates the regression of advanced tumors (˜200-400 mm ³ ) at day 14 in NSG mice treated with CD3xCD20 bispecific antibody. NSG mice were subcutaneously implanted with a mixture of Raji tumor cells and PBMCs 15 days prior to treatment to allow tumors to develop. Mice were treated subcutaneously with 0.4 mg/kg of antibody 1 (CD3χCD20 chimeric Fc antibody) or 0.4 mg/kg of control Ab5 (anti-FeLD1 Ab), or control stock solution once a week (day 7, day 14, day 21).

Fig. 10 illustrates the regression of advanced tumors (~500-900 mm ³ ) at day 21 in NSG mice treated with CD3xCD20 bispecific antibody. NSG mice were subcutaneously implanted with a mixture of Raji tumor cells and PBMCs 15 days prior to treatment to allow tumors to develop. Mice were treated with 0.4 mg/kg of antibody 1 (CD3χCD20 chimeric Fc antibody) or 0.4 mg/kg of control Ab5 (anti-FelD1 Ab) once a week (day 7, day 14, day 21).

Fig. 11A and 11B illustrate the in vivo efficacy of administration of the CD3xCD20 bispecific antibody, antibody 1 and antibody 4, compared with administration of the monospecific antibody (rituximab) by determining the change in CD20+ B cell levels or CD3+ T cell levels in the peripheral blood of cynomolgus monkeys on day 7 of the study. . Antibodies or placebo were administered on day 0.

Fig. 11A: Peripheral blood B cell levels were significantly reduced on day 2 in all samples except placebo.

Fig. 11B: In the peripheral blood of animals treated with bispecific antibodies, a temporary decrease in the number of T cells was observed on day 2, which was restored to the original level on day 4. For the placebo or rituximab (Rituxan) treated groups, no decrease in T cell numbers (below baseline) was observed.

Fig. 12A and 12B illustrate the in vivo efficacy of administering the CD3xCD20 bispecific antibody, Antibody 1 and Antibody 4, by detecting changes in CD20+ B cell levels or CD3+ T cell levels in peripheral blood of cynomolgus monkeys over a long-term (3 month) study. Placebo (stock solution) or bispecific antibodies were administered at 1.0 mg/kg on day 0.

Fig. 12A: Peripheral blood B cell levels were significantly reduced on day 2 and remained reduced throughout the study in all samples except placebo.

Fig. 12B: For animals treated with bispecific antibodies, a temporary decrease in the number of T cells was observed on day 2, which was restored to baseline on day 4 and remained within baseline throughout the study (> 80 days). For placebo-treated animals, no transient decrease in T cell numbers was observed.

Fig. 13A and 13B illustrate the in vivo efficacy of low dose CD3xCD20 bispecific antibody antibody 1 and antibody 4 by detecting changes in CD20+ B cell levels or CD3+ T cell levels in peripheral blood of cynomolgus monkeys over a long-term (2 month) study. Bispecific antibodies were administered at 0.01 mg/kg or 0.001 mg/kg (1 µg/kg) on day 0.

Fig. 13A: Peripheral blood B cell levels were significantly reduced on day 2 and remained reduced throughout the study, as observed in animals treated with higher doses of CD3xCD20 bispecific antibodies (see also FIG. 11A or 12A).

- 14 042263

Fig. 13B: Animals treated with very low doses (1 μg/kg) of the bispecific antibodies showed the same transient T cell reduction and recovery seen in animals treated with higher doses of the CD3xCD20 bispecific antibodies (see also FIG. 11B or 12B). ).

Fig. 14 shows the correlation of the decrease in the number of B cells with the decrease in the number of antibodies in the peripheral blood of animals treated with CD3χCD20-chimeric Fc antibody 1. While the number of antibodies (uncolored symbols) in the animal circulation is reduced over time, the B cell populations ( colored symbols) begin to recover (eg, as observed at day 81 for animal #106881 (colored circle)).

Fig. 15 shows the correlation of the decrease in the number of B cells with the decrease in the number of antibodies in the peripheral blood of animals treated with CD3χCD20-chimeric Fc antibody 2. While the number of antibodies (uncolored symbols) in the animal circulation decreases with time, populations of B cells (colored symbols ) begin to recover (eg, as observed at day 66 for animal #106876 (colored triangle) and at day 68 for animal #106877 (colored square)).

Fig. 16 shows the correlation of the decrease in the number of B cells with the decrease in the number of antibodies in the peripheral blood of animals treated with CD3χCD20-dt Fc (Ab4) bispecific antibody. While the number of antibodies (uncolored symbols) in the animal circulatory system decreases with time, B cell populations (colored symbols) begin to recover (e.g., as observed at day 91 for animal #106870 (colored triangle) and at day 64 for animal No. 106872 (colored square)).

Fig. 17A and 17B show a correlation of reductions in tissue B cells in the spleen (FIG. 17A) or mesenteric lymph nodes (FIG. 17B) in cynomolgus monkeys following administration of a CD3xCD20 bispecific antibody compared to an anti-CD20 monospecific antibody, with administration of much lower doses (doses from 0.01 to 1.0 mg/kg) in bispecific groups. This reduction was not observed in any tissue in the placebo control group of animals. Both CD3xCD20 bispecific antibodies (Ab1 and Ab4) resulted in a dose-dependent decrease in the number of B cells in lymphoid organs, and at doses equal to or greater than 0.1 mg/kg, the bispecific antibodies reduced the number of B cells more effectively than rituximab.

Fig. 18A and 18B illustrate that CD3xCD20 bispecific antibodies induce proliferation of human PBMCs (Fig. 18A) or cynomolgus monkey PBMCs (Fig. 18B) in an in vitro bioassay, while control antibody 5 (-Λ-; non-specific for CD3xCD20) did not showed activity.

Fig. 19A and 19B illustrate CD3xCD20 mediated targeted killing of Raji in a cytotoxicity assay. Antibody 1 mediated targeted cell killing with typical EC ₅₀ values of 25.0 and 9.10 pM for human (FIG. 19A) and cynomolgus monkey (FIG. 19B) T cells, respectively. Antibody 4 mediated targeted cell killing with typical EC ₅₀ values of 15.7 and 1.73 pM for human (FIG. 19A) and cynomolgus monkey (FIG. 19B) T cells, respectively. Control (-l-) antibody activity was not observed.

Fig. 20A and 20B illustrate that the CD3xCD20 bispecific antibody mediates cell killing by naive T cells.

In FIG. 20A shows a typical FACS scatter plot at the highest concentration of antibody 4 tested. Wild type B16F10.9 cells were labeled with CFDA-SE and B16F10.9/CD20 cells were labeled with Violet Cell Tracker. Effector cells were not labeled. On the second panel of Fig. 20A shows that killing of CD20-expressing cells (lower right quadrant) occurs due to anti-CD3xCD20 treatment.

In FIG. 20B shows the proportion of surviving B16F10.9/CD20 cells at 48 h in the presence of CD20xCD3 antibodies, ie. antibody 4 (dt Fc), antibody 1 (chimeric Fc) or control Ab5, and PBMC. Percent survival was determined by comparing the percentage of B16F10.9/CD20 cells with CD20-negative B16F10.9 cells in the live cell population. Ab4 and Ab1 specifically targeted human T cells to kill only CD20-expressing target cells (FIG. 20B) in a mixed cell population. Targeted cell killing was observed only in the presence of bispecific antibodies, with a dose-dependent decrease in B16F10.9/CD20 cells due to antibody 4 (EC ₅₀ 12.8 pM) and antibody 1 (EC ₅₀ 19.5 pM) (Fig. 20V). Less than 5% of CD20-expressing cells remained alive at the highest dose studied (10 μg/ml).

In FIG. 21 shows the percentage of activated cells (CD69+) out of total CD2+ effector cells in a 48-hour cytotoxicity assay targeting B16F10.9/CD20 cells, with any CD20xCD3 antibody induced such activation, i.e. antibody 4 (dt Fc) or antibody 1 (chimeric Fc).

Fig. 22A and 22B illustrate that the CD3xCD20 bispecific antibody induced clustering of T cells with target cells (CD20+ cells) via its bispecific binding arms. Effector cells were stained with CFSE and CD20+ cells were stained with Violet Cell Tracker, data plotted in separate quadrants. After incubation with an irrelevant control antibody (control antibody 5), no clustering (double staining) occurred in the cell mixture (FIG. 22A). After incubation with the CD3xCD20 bispecific antibody (Ab4), cell clusters appeared as they were stained with both CFSE and Violet (see top left quadrant of the scatter plot in FIG. 22B, bold square area).

Fig. 23 illustrates a tumor volume study (in mm ³ ) in NSG mice implanted subcutaneously with a mixture of Raji tumor cells and PBMCs in which the CD3xCD20 bispecific antibody of the invention (Ab1) at 0.4 mg/kg, 2x/week (w.b. ), an irrelevant Ab6 control antibody at 0.4 mg/kg, 2x/week (ip) or stock solution compared to rituximab, an anti-CD20 antibody at 8 mg/kg, 5x/week (ip), and CD19xCD3 BiTE at 0.5 mg/kg, 5x/week (i.v.). (For CD19xCD3 BiTE, see Nagorsen D., et al. Pharmacol Ther. 2012 Dec; 136(3):334-42, 2012). The treatment was carried out for mice with developed tumors (~100-500 mm ³ ). Data were expressed as mean (SPS) and ANOVA was performed. Ab1 dosing 2x/week (ip) was comparable in efficacy to CD19χCD3 BiTE dosing 5x/week (i.v.) in this in vivo model.

Fig. 24 illustrates a study of tumor volumes (in mm ³ ) in NSG mice implanted subcutaneously with Raji/PBMC mixture similar to FIG. 23, with ANOVA performed for Ab1, control Ab6, rituximab, and control stock solution. Ab1, dosed 2x/week, was superior to rituximab therapy (dosed at 8 mg/kg; 5x/week ip) in suppressing advanced Raji tumors.

Fig. 25A and 25B illustrate tumor growth retardation when treatment is initiated simultaneously with or after hCD20/B16F10.9 tumor transplantation in humanized mice treated with CD3χCD20 bispecific antibody.

Fig. 25A: hCD3 mice were implanted subcutaneously with hCD20-transduced B16F10.9 melanoma cells and simultaneously treated with 0.004 or 0.4 mg/kg of antibody 1 (CD3χCD20 chimeric Fc antibody), or 4 mg/kg of control Ab5 (anti-FelD1 Ab), or control stock solution (w.b. 2 times a week).

Fig. 25B: hCD3 mice were subcutaneously implanted with hCD20/B16F10.9 melanoma cells and developed tumors were treated on day 10 and thereafter with antibody 1 (CD3χCD20 chimeric Fc antibody) or control. Mice were treated i.b. twice a week 0.4 or 4 mg/kg Ab1, or 0.4 mg/kg control Ab5 (anti-FelD1 Ab), or control stock solution.

Detailed description of the invention

Before describing the present invention, it should be noted that the present invention is not limited to the specific methods and experimental conditions described, as these methods and conditions may vary. It should also be understood that the terminology used herein is used for the purpose of describing only specific embodiments of the invention and is not limiting, since the scope of the present invention is limited solely by the appended claims.

Unless otherwise indicated, all technical and scientific terms used herein have the same meanings that are usually understood by a person skilled in the art to which this invention pertains. In the context of this document, the term about, when used in relation to a specific given numerical value, means that this value can vary relative to the given value by no more than 1%. For example, in the context of this document, an expression near 100 includes 99 and 101, as well as all values in between (eg, 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein may be used to practice and test the present invention, the following describes the preferred methods and materials.

Definitions

As used herein, the expression CD3 refers to an antigen that is expressed on T cells as part of the multimolecular T cell receptor (RTC) and which consists of a homodimer or heterodimer formed by association of two or four receptor chains: CD3-epsilon, CD3-delta , CD3-zeta and CD3-gamma. All proteins, polypeptides, and protein fragments referred to herein refer to the human version of the corresponding protein, polypeptide, or protein fragment, unless specifically stated that they are derived from a non-human species. Thus, the term CD3 means human CD3 unless specifically stated to be derived from a non-human species, such as mouse CD3, simian CD3, etc.

As used herein, an antibody that binds to CD3 or an anti-CD3 antibody includes antibodies and their antigen-binding fragments that specifically recognize one CD3 subunit (e.g., epsilon, delta, gamma, or zeta), as well as antibodies and their antigen-binding fragments.

- 16 042263 fragments that specifically recognize the dimeric complex of the two CD3 subunits (eg CD3 dimers gamma/epsilon, delta/epsilon and zeta/zeta). The antibodies and antigen-binding fragments of the present invention can bind soluble CD3 and/or cell surface expressed CD3. Soluble CD3 includes native CD3 proteins as well as recombinant variants of CD3 proteins, such as, for example, monomeric and dimeric CD3 constructs that lack a transmembrane domain or otherwise lack association with the cell membrane.

Cell surface expressed CD3 as used herein refers to one or more CD3 proteins that are expressed on the cell surface in vitro or in vivo such that at least a portion of the CD3 protein is present on the extracellular portion of the cell membrane and is accessible to the antigen-binding portion of the antibody. Cell-surface-expressed CD3 includes CD3 proteins contained within a functional T-cell receptor in the cell membrane.

Cell surface expressed CD3 expression includes CD3 protein expressed as part of a cell surface homodimer or heterodimer (eg, CD3 gamma/epsilon, delta/epsilon, and zeta/zeta dimers). The expression of cell surface expressed CD3 also includes the CD3 chain (eg, CD3 epsilon, CD3 delta, or CD3 gamma) that is expressed alone, in the absence of other types of CD3 chains, on the cell surface. Cell surface expressed CD3 may comprise or consist of a CD3 protein expressed on a cell surface that normally expresses the CD3 protein. Alternatively, cell surface-expressed CD3 may comprise or consist of a CD3 protein expressed on the surface of a cell that does not normally express human CD3 on its surface but has been artificially engineered to express CD3 on its surface.

As used herein, the expression anti-CD3 antibody includes monovalent antibodies with single specificity, as well as bispecific antibodies containing a first arm that binds CD3 and a second arm that binds a second (target) antigen, while the anti-CD3 arm contains any of sequences HCVR/LCVR or CDR, are given in this document in table. 1 or 2. Examples of anti-CD3 bispecific antibodies are described elsewhere in this document.

The term antigen-binding molecule includes antibodies and antigen-binding fragments of antibodies, including, for example, bispecific antibodies.

Exemplary anti-CD3 antibodies are also described in US 2007/0280945 A1 and in PCT International Application No. PCT/US13/60511, filed September 19, 2013, which is incorporated herein by reference in its entirety.

As used herein, the term CD20 refers to the human CD20 protein, unless specifically stated to be derived from a non-human species (eg, murine CD20, simian CD20, etc.). The human CD20 protein has an amino acid sequence corresponding to the standard NCBI NP 690605.1 sequence.

As used herein, the term anti-CD20 antibody includes single specificity monovalent antibodies such as Rituxan (rituximab) as described in US 7,879,984. Exemplary anti-CD20 antibodies are also described in US 7,879,984 and PCT International Application No. PCT/US13/60511, filed September 19, 2013, which are incorporated herein by reference.

As used herein, the term antibody refers to any antigen-binding molecule or molecular complex containing at least one complementarity determining region (CDR) that specifically binds or interacts with a particular antigen (eg, CD3). The term antibody includes immunoglobulin molecules containing four polypeptide chains - two heavy (H) chains and two light (L) chains linked by disulfide bonds, as well as their multimers (for example, IgM). Each heavy chain contains a heavy chain variable region (referred to herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region contains three domains, CH1, C _H 2 and C _H 3. Each light chain contains a light chain variable region (referred to herein as LCVR or VL) and a light chain constant region. The light chain constant region contains one domain (CL1). The V _H and V _L regions can be further divided into regions of hypervariability called complementarity determining regions (CDRs) separated by more conserved regions called framework regions (FRs). Each V _H and V _L consists of three CDRs and four FRs, arranged from amino to carboxy in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. In various embodiments, the FR of an anti-CD3 antibody (or antigen-binding portion thereof) may be identical to human germline sequences, or may be naturally or artificially modified. The consensus amino acid sequence can be determined based on a parallel analysis of two or more CDRs.

As used herein, the term antibody also includes antigen-binding

- 17 042263 fragments of full-sized antibody molecules.

As used herein, the terms antigen-binding portion of an antibody, antigen-binding fragment of an antibody, and the like include any naturally occurring, enzymatically produced, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds an antigen to form a complex. Antigen-binding antibody fragments can be generated, for example, from full-length antibody molecules using any suitable standard methods, such as proteolytic cleavage or recombinant genetic engineering methods, involving processing and expression of DNA encoding the variable and optionally constant domains of the antibody. Such DNA is known and/or readily available, for example from commercial sources, DNA libraries (including, for example, phage-antibody libraries), or can be synthesized. DNA can be sequenced and chemically processed using molecular biology techniques, for example, to arrange one or more variable and/or constant domains into a suitable configuration, or to introduce codons, introduce cysteine residues, modify, add or remove amino acids, etc.

Non-limiting examples of antigen-binding fragments include (i) Fab fragments; (ii) F(ab') ₂ fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single chain Fv molecules (scFv); (vi) dAb fragments; and (vii) minimal recognition units consisting of amino acid residues that mimic an antibody hypervariable region (e.g., an isolated complementarity determining region (CDR) such as a CDR3 peptide) or a FR3-CDR3-FR4 conformationally restricted peptide . Other engineered molecules such as domain specific antibodies, single domain antibodies, domain deleted antibodies, chimeric antibodies, CDR grafted antibodies, diabodies, tribodies, tetrabodies, minibodies, nanobodies (e.g., monovalent nanobodies, bivalent nanobodies, etc.) .), small modular protein (SMTP) immunopharmaceuticals, and shark IgNAR variable domains are also included in the term antigen-binding fragment as used herein.

An antigen binding fragment of an antibody typically contains at least one variable domain. The variable domain may be of any size or amino acid composition, and generally contains at least one CDR that is adjacent to or in-frame with one or more framework sequences. In antigen-binding fragments in which a VH domain is linked to a V _L domain, the VH and V _L domains may be arranged relative to each other in any suitable order. For example, the variable region may be dimeric and contain VH-VH, VH-VL, or VL-VL dimers. Alternatively, the antigen-binding fragment of an antibody may comprise a VH or VL monomeric domain.

In certain embodiments, an antigen-binding fragment of an antibody may comprise at least one variable domain covalently linked to at least one constant fragment (Fc) domain or otherwise linked to the Fc domain. The term linked to refers to a direct connection through a covalent bond or linker polypeptide sequence, which results in the combination of two components, such as a variable domain associated with a constant domain. Thus, in certain examples, variable domains containing first and second antigen-binding domains, such as those that bind CD3 and CD20 to form a bispecific antibody, are directly connected (or linked) via a covalent bond or linker amino acid sequence, for example, to (from N-terminus to C-terminus) complete or partial CH1, chimeric hinge, CH2 and CH3 domains. Non-limiting exemplary configurations of variable and constant domains that may be present in an antigen-binding fragment of an antibody of the present invention include (i) V _{H -CH} 1-hinge- _CH 2 _-CH 3; (ii) V _H -hinge-C _H 2 -C _H 3; (iii) V _H -C _L ; (iv) VL-CH1-CH2-CH3; (v) VL-CH2-CH3; and (vi) VL-CL. In any configuration of the variable and constant domains, including any of the above exemplary configurations, the variable and constant domains can be directly connected to each other or can be connected (linked) through a complete or partial chimeric hinge region according to the invention or through a complete or partial C _H 1 and chimeric hinge region. In some instances, a polypeptide linker (eg, 2 to 10 amino acids) may join the variable and Fc domains, or there may be an additional connection to a complete or partial chimeric hinge region and/or CH1. The hinge region may be composed of at least upper and lower hinge amino acids, resulting in a flexible or semi-flexible connection between adjacent variable and/or constant domains in a single polypeptide molecule. In addition, an antigen-binding fragment of an antibody of the present invention may comprise a homodimer or heterodimer (or other multimer) of any of the above variable and constant domain configurations in non-covalent association with each other and/or with one or more VH or VL monomeric domains (e.g., via disulfide(s) bond(s)). The multispecific antibody format of the invention, including the exemplary bispecific antibody formats disclosed herein, typically contains two different variable domains, with each variable domain capable of specifically

- 18 042263 bind to a single antigen. Multispecific formats can be adapted for use in the context of an antigen-binding fragment of an antibody of the present invention using routine methods available in the art.

Antibodies of the present invention are modified to have reduced or absent complement-dependent cytotoxicity (CCC) or antibody-dependent cell-mediated cytotoxicity (ADCC) as measured in vitro. Complement dependent cytotoxicity (CDC) refers to the lysis of antigen expressing cells by an antibody of the invention in the presence of complement. Antibody-dependent cell-mediated cytotoxicity (ADCC) refers to a cell-mediated response in which non-specific cytotoxic cells that express Fc receptors (FcRs) (e.g., natural killer (NK) cells, neutrophils, and macrophages) recognize bound antibody on the target cell and thereby lead to lysis of the target cell. CDC and ADCC can be determined using assay methods that are well known and available in the art. (See, for example, US Pat. Nos. 5,500,362 and 5,821,337 and Clynes et al. (1998) Proc. Natl. Acad. Sci. (USA) 95:652-656). The heavy chain constant region (CH) of an antibody is important in the context of the antibody's ability to fix complement and mediate cell-dependent cytotoxicity. Thus, the CH antibody can be selected based on whether antibody mediation of cytotoxicity is necessary.

In certain embodiments of the invention, the bispecific antibodies of the invention are human antibodies. As used herein, the term human antibody includes antibodies having variable and constant regions derived from human germline immunoglobulin sequences. Human antibodies of the invention may contain amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by in vitro random or site-directed mutagenesis or by in vivo somatic mutation), for example, in CDRs and in particular in CDR3 . However, as used herein, the term human antibody does not include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted into human framework sequences.

The antibodies of the invention may, in some embodiments, be recombinant human antibodies. As used herein, the term recombinant human antibody includes all human antibodies that are produced, expressed, generated, or isolated by recombinant methods, such as antibodies expressed using a recombinant expression vector that transfects a host cell (described in more detail below), antibodies isolated from a recombinant, combinatorial library of human antibodies (described in more detail below), antibodies isolated from an animal (e.g., mouse) transgenic for human immunoglobulin genes (see, e.g., Taylor et al. (1992), Nucl. Acids Res. 20 :6287-6295), or antibodies that are made, expressed, made or isolated by any other means that involve splicing human immunoglobulin gene sequences into other DNA sequences. Such recombinant human antibodies contain variable and constant regions derived from human germline immunoglobulin sequences. However, in certain embodiments of the invention, such recombinant human antibodies are subjected to in vitro mutagenesis (or, in the case of an animal transgenic for human Ig sequences, in vivo somatic mutagenesis), and thus the amino acid sequences of the VH and V _L regions of the recombinant antibodies are are sequences which, although derived from and related to human germline VH and V _L sequences, may not be present in the natural repertoire of human germline antibodies in vivo.

Human antibodies can exist in two forms due to the heterogeneity of the hinge region. In one form, the immunoglobulin molecule contains a stable four-chain construct of approximately 150-160 kDa, in which the dimers are held together by an inter-chain heavy chain disulfide bond. In the second form, the dimers are not connected by interchain disulfide bonds, and the resulting molecule weighing about 75–80 kDa consists of covalently coupled light and heavy chains (semi-antibody). These forms are extremely difficult to separate even after affine purification. The frequency of occurrence of the second form in different isotypes of intact IgG is associated with, but not limited to, structural differences associated with the isotype of the hinge region of the antibody. A single amino acid substitution in the hinge region of human IgG4 can significantly reduce the appearance of the second form (Angal et al. (1993), Molecular Immunology, 30:105) to levels normally seen with the hinge region of human IgG1. The present invention includes antibodies containing one or more mutations in the hinge region, which can, for example, when produced, improve the yield of the desired form of the antibody.

The antibodies of the invention may be isolated antibodies. In the context of this document, an isolated antibody means an antibody that has been detected and separated and/or spared by

- 19 042263 from at least one component of their natural environment. For example, an antibody that has been separated or disposed of from at least one component of an organism, or from a tissue or cell in which the antibody occurs naturally or is naturally produced, is an isolated antibody in the context of the present invention. An isolated antibody also includes an antibody in situ in a recombinant cell. Isolated antibodies are antibodies that have been subjected to at least one purification or isolation step. In accordance with certain embodiments of the invention, the isolated antibody may be substantially free of other cellular material and/or chemicals.

The anti-CD3 or anti-CD20 variable regions disclosed herein may contain one or more amino acid substitutions, insertions and/or deletions in the framework regions and/or CDR regions of the heavy and light chain variable domains compared to the corresponding germline sequences, of which antibodies were obtained. Such mutations can be readily identified by comparing the amino acid sequences disclosed herein with germline sequences available, for example, from public antibody sequence databases. The present invention includes antibodies and antigen-binding fragments thereof, which are derived from any of the amino acid sequences disclosed herein, in which one or more amino acids within one or more framework regions and/or CDR regions have been mutated to the corresponding residue(s) the germline sequence from which the antibody was derived, or to the corresponding residue(s) of another human germline sequence, or to a conservative amino acid substitution of the corresponding germline residue(s) (such sequence changes are referred to herein as germline mutations). One skilled in the art, starting from the heavy and light chain variable region sequences disclosed herein, can readily generate a variety of antibodies and antigen-binding fragments that contain one or more individual germline mutations or combinations thereof.

In certain embodiments of the invention, all framework and/or CDR residues within the VH and/or V _L domains are mutated back to residues located in the original germline sequence from which the antibody was derived. In other embodiments, only certain residues are mutated back to the original germline sequence, for example, within the first 8 amino acids of FR1 or within the last 8 amino acids of FR4, there are only mutated residues, or within CDR1, CDR2, or CDR3, there are only mutated residues. In other embodiments, one or more framework residues and/or CDRs are mutated to the corresponding residue(s) of a different germline sequence (i.e., a germline sequence that differs from the germline sequence from which it was originally derived antibody). In addition, the antibodies of the present invention may contain any combination of two or more germline mutations within the framework regions and/or CDR regions, for example, when certain individual residues are mutated to the corresponding residue of a particular germline sequence, while certain other residues, that differ from the original germline sequence, are retained or mutated to the corresponding residue of a different germline sequence. Once generated, antibodies and antigen-binding fragments thereof that contain one or more germline mutations can be tested for one or more desired properties, such as improved binding specificity, increased binding affinity, improved or enhanced antagonistic or agonistic biological properties (as appropriate). ), reduced immunogenicity, etc. Antibodies and antigen-binding fragments obtained by such a general method are included in the present invention. Also included in the invention are anti-CD3 or anti-CD20 variable regions containing variants of any of the HCVR, LCVR and/or CDR amino acid sequences disclosed herein containing one or more conservative substitutions. For example, included in the present invention are anti-CD3 antibodies having the amino acid sequences of HCVR, LCVR, and/or CDR, e.g., 10 or less, 8 or less, 6 or less, 4 or less, etc. conservative amino acid substitutions compared to any of the amino acid sequences of HCVR, LCVR and/or CDR listed in this document in table. 1.

The term epitope refers to an antigenic determinant that interacts with a specific antigen binding site in the variable region of an antibody molecule known as a paratope. One antigen may have more than one epitope. Thus, different antibodies may bind to different sites on the antigen and may have different biological effects. Epitopes may be conformational or linear. A conformational epitope is formed due to the spatial arrangement of a number of amino acids from different segments of a linear polypeptide chain. A linear epitope is formed by adjacent amino acid residues in a polypeptide chain. In certain circumstances, an epitope on an antigen may contain components of saccharides, phosphoryl groups, or sulfonyl groups. The term significant degree of identity or substantially identical, used

- 20 042263 relative to a nucleic acid or fragment thereof, indicates that, when optimally aligned with the appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), the nucleotide sequence identity is at least about 95% and more preferably at least about 96%, 97%, 98%, or 99% nucleotide bases, as determined by any well-known sequence identity algorithm such as FASTA, BLAST, or Gap, as discussed below. A nucleic acid molecule that has a significant degree of identity with a standard nucleic acid molecule may, in some cases, encode a polypeptide having the same or substantially similar amino acid sequence as the polypeptide encoded by the standard nucleic acid molecule.

With respect to polypeptides, the term significant similarity or substantially similar means that two peptide sequences, when optimally aligned, such as performed using the GAP or BESTFIT programs with default gap weights, have at least 95% sequence identity, even more preferably at least 98 or 99% sequence identity. Preferably, residue positions that are not identical are distinguished by conservative amino acid substitutions. A conservative amino acid substitution is one in which an amino acid residue is replaced with another amino acid residue having a side chain (R group) with similar chemical properties (eg, charge or hydrophobicity). In general, a conservative amino acid substitution does not significantly change the functional properties of the protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of similarity may be increased to account for the conservative nature of the substitution. Methods for making such adjustments are well known to those skilled in the art. See, for example, Pearson (1994), Methods Mol. Biol. 24:307-331. Examples of groups of amino acids that have side chains with similar chemical properties include (1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; (2) aliphatic hydroxyl side chains: serine and threonine; (3) amide-containing side chains: asparagine and glutamine; (4) aromatic side chains: phenylalanine, tyrosine and tryptophan; (5) main side chains: lysine, arginine and histidine; (6) acidic side chains: aspartate and glutamate; and (7) sulfur-containing side chains - cysteine and methionine. Preferred groups of conservative amino acid substitutions are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate, and asparagine-glutamine. Alternatively, a conservative substitution is any change that has a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992), Science, 256:1443-1445. A moderately conservative substitution is any change that has a non-negative value in the PAM250 log-likelihood matrix. Sequence similarity for polypeptides, also referred to as sequence identity, is typically determined using sequence analysis software. The protein analysis software compares similar sequences, taking into account similarity scores attributed to various substitutions, deletions, and other modifications, including conservative amino acid substitutions. For example, the GCG software includes programs such as Gap and Bestfit that can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species, or between a wild-type protein and its mutein. . See, for example, GCG version 6.1. Comparison of polypeptide sequences can also be performed using FASTA with default or recommended parameters, the FASTA program in GCG version 6.1. (eg, FASTA2 and FASTA3) provides alignment and percent sequence identity determination of regions with the best overlap between query and search sequences (Pearson (2000) supra). Another preferred algorithm in the case of comparing a sequence according to the invention with a database containing a large number of sequences from different organisms is the BLAST computer program, in particular BLASTP or TBLASTN with default parameters. See, for example, Altschul et al. (1990), J. Mol. Biol. 215:403-410 and Altschul et al. (1997), Nucleic Acids Res. 25:3389-402.

Bispecific antigen-binding molecules.

The antibodies of the present invention may be bispecific or multispecific. Multispecific antibodies may be specific for different epitopes on a target polypeptide or may contain antigen-binding domains specific for more than one target polypeptide. See, for example, Tutt et al., 1991, J. Immunol. 147:60-69; Kufer et al., 2004, Trends Biotechnol. 22:238-244. The Ahtu-CD3xCD20 antibodies of the present invention may be linked to or co-expressed with another functional molecule, such as another peptide or protein. For example, an antibody or fragment thereof may be operably linked (eg, by chemical coupling, genetic fusion, non-covalent association, or other

- 21 042263 way) with one or more other molecular components, such as another antibody or antibody fragment, to obtain a bispecific or multispecific antibody with additional binding specificity.

Thus, included in the present invention are bispecific antibodies in which one arm of the immunoglobulin binds human CD3 and the other arm of the immunoglobulin is specific for the target antigen. The target antigen to which the other arm of the CD3 bispecific antibody binds can be any antigen expressed on or near the cell, tissue, organ, microorganism, or virus against which a targeted immune response is desired. The CD3 binding arm may comprise any of the HCVR/LCVR or CDR amino acid sequences listed herein in Table 1. 1.

In the context of the bispecific antibodies of the present invention, in which one arm of the antibody binds CD3 and the other arm binds the target antigen, the target antigen may be a tumor-associated antigen.

Non-limiting examples of tumor associated antigens include, for example, AFP, ALK, BAGE proteins, BIRC5 (survivin), BIRC7, β-catenin, brc-abl, BRCA1, BORIS, CA9, carbonic anhydrase IX, caspase-8, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD30, CD40, CDK4, CEA, CTLA4, cyclin-B1, CYP1B1, EGFR, EGFRvIII, ErbB2/Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE proteins (e.g. GAGE-1, -2), GD2, GD3, GloboH, glypican-3, GM3, gp100, Her2, HLA/B-raf, HLA/k-ras, HLA/MAGE-A3, hTERT, LMP2, proteins MAGE (eg, MAGE-1, -2, -3, -4, -6 and -12), MART-1, mesothelin, ML-IAP, Muc1, Muc2, Muc3, Muc4, Muc5, Muc16 (CA-125) , MUM1, NA17, NY-BR1, NY-BR62, NY-BR85, NY-ESO1, OX40, p15, p53, PAP, PAX3, PAX5, PCTA-1, PLAC1, PRLR, PRAME, PSMA (FOLH1), RAGE proteins , Ras, RGS5, Rho, SART-1, SART-3, Steap-1, Steap-2, TAG-72, TGF-β, TMPRSS2, Thomsen antigen (Tn), TRP-1, TRP-2, tyrosinase and uroplakin -3.

In the context of the bispecific antibodies of the present invention, in which one arm of the antibody binds CD3 and the other arm binds the target antigen, the target antigen may be an infectious disease-associated antigen. Non-limiting examples of infectious disease-associated antigens include, for example, an antigen that is expressed on the surface of a viral particle, or preferably expressed on a cell that is infected with a virus, the virus being selected from the group consisting of HIV, hepatitis (A, B or C), virus herpes (eg, HSV-1, HSV-2, CMV, HAV-6, VZV, Epstein-Barr virus), adenovirus, influenza virus, flavivirus, echovirus, rhinovirus, coxsackievirus, coronavirus, respiratory syncytial virus, mumps virus, rotavirus , measles virus, rubella virus, parvovirus, vaccinia virus, HDTV, dengue virus, papillomavirus, molluscum contagiosum virus, poliovirus, rabies virus, John Cunningham virus and arbovirus encephalitis virus. Alternatively, the target antigen may be an antigen that is expressed on the surface of a bacterium, or preferably expressed on a cell that is infected with the bacterium, the bacterium being selected from the group consisting of Chlamydia, Rickettsia, Mycobacterium, Staphylococcus, Streptococcus, Pneumococcus, Meningococcus, Gonococcus , Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, Diphtheria, Salmonella, Bacillus, Cholera, Tetanus, Botulism, Anthrax, Plague, Leptospira and Lyme disease bacteria. In certain embodiments, the target antigen is an antigen that is expressed on the surface of a fungus, or is preferably expressed on a cell that is infected with a fungus, the fungus being selected from the group consisting of Candida (albicans, krusei, glabrata, tropicalis, etc.). ), Crytococcus neoformans, Aspergillus (fumigatus, niger, etc.), Mucorales (mucor, absidia, rhizopus, etc.), Sporothrix schenkii, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Coccidioides immitis, and Histoplasma capsulatum. In certain embodiments of the invention, the target antigen is an antigen that is expressed on the surface of a parasite, or is preferably expressed on a cell that is infected with the parasite, the parasite is selected from the group consisting of Entamoeba histolytica, Balantidium coli, Naegleriafowleri, Acanthamoeba sp., Giardia lambia, Cryptosporidium, Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma cruzi, Leishmania donovani, Toxoplasma gondii, Nippostrongylus brasiliensis, Taenia crassiceps and Brugia malayi. Non-limiting examples of specific pathogen-associated antigens include, for example, HIV gp120, HIV CD4, hepatitis B glycoprotein L, hepatitis B glycoprotein M, hepatitis B glycoprotein S, hepatitis C E1, hepatitis C E2, hepatocyte-specific protein, herpes simplex virus gB, cytomegalovirus gB and TLHV envelope protein.

In accordance with certain exemplary embodiments, the present invention includes bispecific antigen-binding molecules that specifically bind CD3 and CD20. In this document, such molecules can be called, for example, anti-CD3/anti-CD20, or anti-CD3/CD20, or anti-CD3χCD20, or CD3xCD20 bispecific molecules, or other similar terminology.

As used herein, the expression antigen-binding molecule means a protein

- 22 042263 a polypeptide or molecular complex containing or consisting of at least one complementarity determining region (CDR), which alone or in combination with one or more additional CDRs and/or framework regions (FRs) specifically binds to a particular antigen. In certain embodiments, the antigen-binding molecule is an antibody or antibody fragment as defined elsewhere herein.

As used herein, the term "bispecific antigen-binding molecule" means a protein, polypeptide, or molecular complex comprising at least a first antigen-binding domain and a second antigen-binding domain. Each antigen-binding domain in the bispecific antigen-binding molecule contains at least one CDR that, alone or in combination with one or more additional CDRs and/or FRs, specifically binds to a particular antigen. In the context of the present invention, a first antigen-binding domain specifically binds a first antigen (eg, CD3) and a second antigen-binding domain specifically binds a second, distinct antigen (eg, CD20).

In certain exemplary embodiments of the present invention, the bispecific antigen-binding molecule is a bispecific antibody. Each antigen-binding domain of a bispecific antibody contains a heavy chain variable domain (HCVR) and a light chain variable domain (LCVR). In the context of a bispecific antigen-binding molecule comprising first and second antigen-binding domains (eg, a bispecific antibody), the CDRs of the first antigen-binding domain may be denoted by the prefix A1 and the CDRs of the second antigen-binding domain may be denoted by the prefix A2. Thus, the CDRs of the first antigen-binding domain may be referred to herein as A1-HCDR1, A1-HCDR2, and A1-HCDR3; a CDRs of the second antigen-binding domain may be referred to herein as A2-HCDR1, A2-HCDR2, and A2-HCDR3. The first antigen-binding domain and the second antigen-binding domain can be directly or indirectly connected to each other, forming a bispecific antigen-binding molecule of the present invention (ie, a bispecific ScFv) further associated with an Fc domain. Alternatively, the first antigen-binding domain and the second antigen-binding domain can be connected to a separate Fc domain. The bispecific antigen-binding molecules of the present invention typically contain two Fc domains, each of which is part of a separate antibody heavy chain. The first and second Fc domains may have the same sequence, except for a mutation in the _CH 3 domain designed to facilitate purification of heterodimeric (ie, bispecific) molecules.

The present invention includes bispecific antigen-binding molecules comprising a first CH3 domain and a second C _H 3 Ig domain, wherein the first and second C _H 3 Ig domains differ from each other by at least one amino acid, and at least one amino acid difference reduces the binding of the bispecific antibody protein A. In one embodiment, the first Ig CH3 domain binds protein A and the second Ig CH3 domain contains a mutation that reduces or abolishes protein A binding, such as an H435R modification (according to EU numbering; H95R according to LMGT exon numbering). The second CH3 may additionally contain a Y436F modification (according to EU numbering; Y96F according to LMGT). Additional modifications that may be present in the second CH3 include:

D356E, L358M, N384S, K392N, V397M and V422I according to EU (D16E, L18M, N44S, K52N, V57M and V82I according to IMGT) in the case of C _H 3 IgG1 domains; And

Q355R, N384S, K392N, V397M, R409K, E419Q and V422I according to EU (Q15R, N44S, K52N, V57M, R69K, E79Q and V82I according to IMGT) in the case of C _H 3 IgG4 domains.

Other formats or technologies for bispecific antibodies can be used to produce the bispecific antigen-binding molecules of the invention. For example, an antibody or fragment thereof having a first antigen-binding specificity may be operably linked (e.g., by chemical coupling, genetic fusion, non-covalent association, or otherwise) to one or more other molecular moieties, such as another antibody or antibody fragment having a second antigen-binding specificity to obtain a bispecific antigen-binding molecule. Specific exemplary bispecific formats that can be used in the context of the present invention include, without limitation, for example, scFv or diabody based bispecific formats, IgG-scFv fusion products, double variable domain (DVD)-Ig, quadroma, ridge-to-gallow , common light chain (e.g., common light chain with ledge-in-gallow, etc.), CrossMab, CrossFab, (SEED)body, leucine zippers, duotelo, IgG1/IgG2, Fab (DAF)-IgG dual action and bispecific Mab ² formats (see, for example, Klein et al. 2012, mAbs 4:6, 1-11, and the references listed therein for an overview of the above formats).

In the context of the bispecific antigen-binding molecules of the present invention, Fc domains may contain one or more amino acid changes (eg, insertions, deletions, or substitutions) from a particular chimeric version of the Fc domain without changing the required functionality. For example, the invention includes bispecific antigen-binding molecules,

- 23 042263 containing one or more modifications in the Fc domain, which result in a modified Fc domain characterized by a modified binding interaction (eg enhanced or weakened) between Fc and FcRn. In one embodiment, the bispecific antigen-binding molecule comprises a modification in the CH2 or CH3 region, wherein the modification increases the affinity of the Fc domain for FcRn in an acidic environment (e.g., in the endosome where the pH is in the range of about 5.5 to about 6.0) . Non-limiting examples of such Fc modifications include, for example, a modification at position 250 (eg, E or Q); 250 and 428 (for example, L or F); 252 (eg L/Y/F/W or T), 254 (eg S or T) and 256 (eg S/R/Q/E/D or T); or a modification at 428 and/or 433 (eg L/R/S/P/Q or K) and/or 434 (eg H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (eg, 308F, V308F) and 434. In one embodiment, the modification includes modification 428L (eg, M428L) and 434S (eg, N434S); modification 428l, 259I (for example, V259i) and 308F (for example, V308F); modification 433K (for example, H433K) and 434A (for example, 434Y); modification 252, 254 and 256 (for example, 252Y, 254T and 256E); modification 250Q and 428L (for example, T250Q and M428L); and modification 307 and/or 308 (for example, 308F or 308P).

Sequence Options

The antibodies and bispecific antigen-binding molecules of the present invention may contain one or more amino acid substitutions, insertions and/or deletions in the framework regions and/or CDR regions of the heavy and light chain variable domains compared to the corresponding germline sequences from which the individual antigen-binding domains were derived. . Such mutations can be readily identified by comparing the amino acid sequences disclosed herein with germline sequences available, for example, from public antibody sequence databases. The antigen-binding molecules of the present invention may comprise antigen-binding domains that are derived from any exemplary amino acid sequences disclosed herein in which one or more amino acids within one or more framework regions and/or CDR regions have been mutated to the corresponding residue(s). ) the germline sequence from which the antibody was derived, or to the corresponding residue(s) of another human germline sequence, or to a conservative amino acid substitution of the corresponding germline residue(s) (such sequence changes are referred to in this document with germline mutations). One skilled in the art, starting from the heavy and light chain variable region sequences disclosed herein, can readily generate a variety of antibodies and antigen-binding fragments that contain one or more individual germline mutations or combinations thereof. In certain embodiments, all framework and/or CDR residues within the VH and/or VL domains are mutated back to residues located in the original germline sequence from which the antigen binding domain was originally derived. In other embodiments, only certain residues are mutated back to the original germline sequence, for example, within the first 8 amino acids of FR1 or within the last 8 amino acids of FR4 are only mutated residues, or within CDR1, CDR2, or CDR3 are only mutated residues. In other embodiments, one or more framework region residues and/or CDRs are mutated to the corresponding residue(s) of a different germline sequence (i.e., a germline sequence that differs from the germline sequence from which the antigen binding domain). In addition, antigen-binding domains may contain any combination of two or more germline mutations within the framework regions and/or CDR regions, for example, where certain individual residues are mutated to the corresponding residue of a particular germline sequence, while certain other residues that differ from the original germline sequence, retained or mutated to the corresponding residue of a different germline sequence. Once generated, antigen-binding domains that contain one or more germline mutations can be tested for one or more desirable properties, such as improved binding specificity, increased binding affinity, improved or enhanced antagonistic or agonistic biological properties (as appropriate), reduced immunogenicity, etc. Bispecific antigen-binding molecules containing one or more antigen-binding domains obtained in such a general way are included in the present invention.

Also included in the invention are antigen-binding molecules in which one or both of the antigen-binding domains comprise variants of any of the HCVR, LCVR and/or CDR amino acid sequences disclosed herein containing one or more conservative substitutions. For example, included in the present invention are antigen-binding molecules comprising an antigen-binding domain having the amino acid sequences HCVR, LCVR, and/or CDR, e.g., 10 or less, 8 or less, 6 or less, 4 or less, etc. conservative amino acid substitutions compared to any of the amino acid sequences disclosed herein

- 24 042263 HCVR, LCVR and/or CDR. A conservative amino acid substitution is one in which an amino acid residue is replaced with another amino acid residue having a side chain (R group) with similar chemical properties (eg, charge or hydrophobicity). In general, a conservative amino acid substitution does not significantly change the functional properties of the protein. Examples of groups of amino acids that have side chains with similar chemical properties include (1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; (2) aliphatic hydroxyl side chains: serine and threonine; (3) amide-containing side chains: asparagine and glutamine; (4) aromatic side chains: phenylalanine, tyrosine and tryptophan; (5) main side chains: lysine, arginine and histidine; (6) acid side chains: aspartate and glutamate; and (7) sulfur side chains: cysteine and methionine. Preferred groups of conservative amino acid substitutions are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate, and asparagine-glutamine. Alternatively, a conservative substitution is any change that has a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992), Science, 256:1443-1445. A moderately conservative substitution is any change that has a non-negative value in the PAM250 log-likelihood matrix. Sequence similarity for polypeptides, also referred to as sequence identity, can be determined using sequence analysis software. The protein analysis software compares similar sequences, taking into account similarity scores attributed to various substitutions, deletions, and other modifications, including conservative amino acid substitutions. For example, the GCG software includes programs such as Gap and Bestfit that can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species, or between a wild-type protein and its mutein. . See, for example, GCG version 6.1. Comparison of polypeptide sequences can also be performed using FASTA with default or recommended parameters, the FASTA program in GCG version 6.1. (eg, FASTA2 and FASTA3) provides alignment and percent sequence identity of regions with the best overlap between query and search sequences (Pearson (2000), supra). Another preferred algorithm in the case of comparing a sequence according to the invention with a database containing a large number of sequences from different organisms is the BLAST computer program, especially BLASTP or TBLASTN with default parameters. See, for example, Altschul et al. (1990), J. Mol. Biol. 215:403-410 and Altschul et al. (1997), Nucleic Acids Res. 25:3389-402.

pH dependent binding.

Included in the present invention are anti-CD3/anti-CD20 bispecific antibodies with pH dependent binding characteristics. For example, an anti-CD3 antibody of the present invention may show reduced binding to CD3 at acidic pH compared to neutral pH. Alternatively, anti-CD3 antibodies of the invention may show increased binding to CD3 at acidic pH compared to neutral pH. The expression acidic pH includes pH values below 6.2, for example about 6.0, 5.95, 5.9, 5.85, 5.8, 5.75, 5.7, 5.65, 5.6, 5 .55, 5.5, 5.45, 5.4, 5.35, 5.3, 5.25, 5.2, 5.15, 5.1, 5.05, 5.0 or less. As used herein, neutral pH means a pH of about 7.0 to about 7.4. The expression neutral pH includes pH values of about 7.0, 7.05, 7.1, 7.15, 7.2, 7.25, 7.3, 7.35 and 7.4.

In certain cases, reduced binding ... at acidic pH compared to neutral pH is expressed in terms of the ratio of the KD value of the binding of an antibody to its antigen at acidic pH and the KD value of binding of an antibody to its antigen at neutral pH (or vice versa). For example, in the context of the present invention, an antibody or antigen-binding fragment thereof may be considered to exhibit reduced binding to CD3 at acidic pH compared to neutral pH if the antibody or antigen-binding fragment thereof exhibits an acid/neutral KD ratio of about 3.0 or greater. In certain exemplary embodiments, the acid/neutral KD ratio for an antibody or antigen-binding fragment of the present invention may be about 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12, 5, 13.0, 13.5, 14.0, 14.5, 15.0, 20.0, 25.0, 30.0, 40.0, 50.0, 60.0, 70.0, 100.0 or more.

Antibodies with pH-dependent binding characteristics can be obtained, for example, by screening a population of antibodies for reduced (or increased) binding to a particular antigen at acidic pH compared to neutral pH. In addition, modifications to the antigen-binding domain at the amino acid level can result in antibodies with pH-dependent characteristics. For example, by replacing one or more amino acids of an antigen-binding domain (eg, in a CDR) with a histidine residue, an antibody with reduced antigen binding at acidic pH compared to neutral pH can be obtained.

Fc receptor binding.

Provided are anti-CD3/anti-CD20 bispecific antigen-binding molecules according to the invention containing a chimeric Fc domain, such as a hinge- _C 2-C ₃ heavy chain Ig constant domain derived from IgG of different isotypes and having unique characteristics. in relation to binding and activation of the Fc receptor. Some Fc domains according to the invention are designed to contain a chimeric hinge region.

As used herein, the term chimeric means made from parts of different origins. The expression chimeric protein includes a first amino acid protein associated with a second amino acid protein with which it is not normally associated in nature. Amino acid sequences that would normally exist as separate proteins or be in a different location within the same protein are joined in a new location in the fusion protein. Chimeric proteins can be created by various methods known in the art, for example by chemical synthesis or by creating a polynucleotide that encodes the amino acids of the chimeric protein in the desired location. Exemplary chimeric proteins include chimeric hinge sequences connecting IgG heavy chain domains and fusion proteins designed to produce human antibodies and antigen-binding proteins of the present invention.

The chimeric proteins disclosed herein were designed to minimize the creation of immunogenic epitopes in compounds, for example, compared to the Fc region or Fc domain of wild-type IgG. Therefore, engineered proteins according to the invention have reduced immunogenicity and exhibit reduced binding to Fc receptors as well as reduced or absent effector functions.

As used herein, the term hinge region includes the region of contiguous amino acid residues that connect the C-terminus of CH1 to the N-terminus of the CH2 domain of an immunoglobulin. Several amino acids at the N-terminus of the CH2 domain, which are encoded by the CH2 exon, are also considered to be part of the lower hinge region. Without wishing to be bound by any one theory, the hinge amino acids of IgG1, IgG2, and IgG4 contain 12-15 consecutive amino acids encoded by a distinct hinge exon and several N-terminal amino acids of the CH2 domain (encoded by the CH2 exon) (Brekke, O.H. , et al Immunology Today, 16(2):85-90 (1995)). On the other hand, IgG3 contains a hinge region consisting of four segments: one upper segment, resembling the hinge region of IgG1, and three segments, which are identical amino acid repeats inherent in IgG3.

The term chimeric hinge as used herein includes a chimeric protein comprising a first amino acid sequence derived from the hinge region of one Ig molecule and a second amino acid sequence derived from the hinge region of an Ig molecule of another class or subclass. Exemplary chimeric regions of the present invention comprise a first amino acid sequence or upper hinge sequence derived from a human IgG1 hinge region or a human IgG4 hinge region and a second amino acid sequence or lower hinge sequence derived from a human IgG2 hinge region. In certain embodiments of the invention, the first or upper hinge sequence contains amino acid residues from positions 216 to 227 according to EU numbering. In some embodiments, the second or lower hinge sequence contains amino acid residues from positions 228 to 236 according to EU numbering.

In the context of this description, it is understood that the upper hinge region includes amino acid residues from position 216 to 227 according to EU numbering (amino acid residues from positions 226 to 240 according to Kabat numbering) (see Fig. 1). The lower hinge region is meant to include amino acid residues from positions 228 to 236 according to EU numbering (amino acid residues from positions 241 to 249 according to Kabat numbering) (see Fig. 1).

In the present specification, for the convenience of the practitioner, the human IgG1, IgG2, and IgG4 hinge amino acids have been defined according to the Kabat EU numbering (Kabat, EA et al., Sequences of Proteins of Immunological interest. 5 ^th ed. US Department of Health and Human Services, NIH publication No. 91-3242 (1991)), also known as EU numbering or EU index, supplemented according to LMGT® Scientific Chart, LMGT®, ImMunoGeneTics® international information system, http:/ /www.imgt.org/LMGTScientificChart/Numbering/Hu_IGHGnber.html, File Created: May 17, 2001, Last updated: January 10, 2013 Correspondence between EU numbering of human IgG1, IgG2, and IgG4 hinge region amino acids and unique domain numbering systems according to IMGT, exon numbering according to IMGT and Kabat numbering (See also Kabat, EA et al., 1991, supra) are described below in Table. from A to F.

- 26 042263

Table A

Numbering for the IgG1 hinge region

Amino acids IgGl (IGHG1) [SwissProt P01857] Unique IMGT numbering for the 'hinge region' IMGT ^a exon numbering EU numbering Kabat numbering (E) 1 1 216 226 R 2 2 217 227 TO 3 3 218 228 S 4 4 219 232 ^a [229] ^b With 5 5 220 233 ^a [230] ^b D 6 6 221 234 ^a [232] ^b TO 7 7 222 235 T 8 8 223 236 n 9 9 224 237 T 10 10 225 238 With AND AND 226 239 R 12 12 227 240 R 13 13 228 241 With 14 14 229 242 R 15 15 230 243

Table B

C-domain numbering for the IgG1 hinge region

Amino acids IgGl (IGHG1) [SwissProt P01857] Unique IMGT numbering for Sdomains ^& IMGT ^a exon numbering EU numbering Numbering Kabata (A) 1.6 1 231 244 R 1.5 2 232 245 E 1.4 3 233 246 L 1.3 4 234 247 L 1.2 5 235 248 G 1.1 6 236 249

Table C

Numbering for the IgG2 hinge region

Amino acids IgG2 (IGHG2) [SwissProt P01859] Unique IMGT numbering for the hinge area^ Exon numbering IMGT ^a EU numbering Kabat numbering (E) 1 1 216 226 R 2 2 217 227 TO 3 3 218 228 WITH 4 4 219 ^a (221) ^b 232 With 5 5 220 ^a (-) ^b 233 V 6 6 222 235 E 7 7 224 237 WITH 8 8 226 239 R 9 9 227 240 R 10 10 228 241 With AND AND 229 242 R 12 12 230 243

Table D

C-domain numbering for the IgG2 hinge region

Amino acids IgG2 (IGHG2) [Swi s sProt P01859] EU numbering Numbering Kabata (A) 231 244 P 232 245 P 233 246 V 234 247 A 235 248 — 236 249

- 27 042263

Table E

Numbering for the IgG4 hinge region

Amino acids IgG4 (IGHG4) [SwissProt P01861] Unique IMGT numbering for the 'hinge region' IMGT ^a exon numbering EU numbering Kabat numbering (E) 1 1 216 226 S 2 2 217 227 TO 3 3 218 228 γ 4 4 - ^a (219) ^b 229 G 5 5 - ^a (220) ^b 230 R 6 6 224 237 R 7 7 225 238 WITH 8 8 226 239 R 9 9 227 240 S 10 10 228 241 With AND AND 229 242 R 12 12 230 243

Table F

C-domain numbering for the IgG4 hinge region

Amino acids IgG4 (IGHG4) [SwissProt P01861] EU numbering Kabat numbering (A) 231 244 R 232 245 E 233 246 F 234 247 L 235 248 G 236 249

Amino acids resulting from exon splicing are shown in brackets.

- means no corresponding number.

-- indicates the absence of the corresponding amino acid at that position.

^a Numbering according to the latest update of IMGT Scientific Chart.

^b Numbering according to the EU index published in Kabat, EA, et al. 1991.

See also, for example, Lefranc, M.-P. et al., Devel Comp Immunol, 29, 185-203 (2005); and Edelman, G.M. et al. PNAS USA, 63:78-85 (1969).

The term binding, in the context of the binding of an antibody, Ig, antibody-binding fragment, or Fc-containing protein to any of, for example, a given antigen or FcyR, generally refers to an interaction or association between at least two components or molecular structures, such as an antibody-antigen interaction. or an Fc-containing protein with an FcyR.

For example, the binding affinity typically corresponds to a K _D value of about ^10-7 M or less, for example, about ^10-8 M or less, for example, about ^10-9 M or less, determined, for example, by surface plasmon resonance (SPR) ) using a BIAcore 3000 instrument using an antigen or FcR as ligand and an antibody, Ig, antibody binding fragment, or Fc-containing protein as analyte (or anti-ligand). Accordingly, the antibody or other binding protein binds to a given antigen or receptor with an affinity corresponding to a K _D value of at least ten times lower, such as at least 100 times lower, such as at least 1000 times lower, such as , at least 10,000 times lower, for example, at least 100,000 times lower than its affinity for binding a non-specific antigen (eg, BSA, casein).

As used herein, the term K _D (M) refers to the equilibrium dissociation constant of a particular antibody-antigen interaction, or the equilibrium dissociation constant of an antibody, Ig, antibody binding fragment, or Fc-containing protein with FcyR. There is an inverse relationship between K _D and binding affinity, therefore, the lower the value of K _D , the higher, i.e. stronger, affinity. Thus, the terms higher affinity or stronger affinity refer to greater reactivity and hence lower K _D , and conversely, the terms lower affinity or weaker affinity refer to lower reactivity and hence higher K _D. In some circumstances, the higher binding affinity (or K _D ) of a particular molecule (for example, an antibody) to its partner molecule (for example, an X receptor) compared to the binding affinity of a molecule (for example, an antibody) for another partner molecule (for example, a receptor Y) can be expressed as a ratio of binding by dividing the larger K _D value (lower or weaker affinity) by the smaller K _D value (higher or stronger affinity), for example, depending on the situation, expressed as 5-fold or 10 - times the binding affinity.

As used herein, the term K _D (c- ¹ or 1/s) refers to the dissociation rate constant of a particular antibody-antigen interaction, or the dissociation rate constant of an antibody,

Ig binding fragment of an antibody or Fc-containing protein to FcyR. This value is also called the k _diss value. As used herein, the term k _acc (M ^-1 x c ^-1 or 1/M) refers to the association rate constant of a particular antibody-antigen interaction, or the association rate constant of an antibody, Ig, antibody binding fragment, or Fc-containing protein to an FcyR.

As used herein, the term KA (M ^-1 or 1/M) refers to the equilibrium association constant of a particular antibody-antigen interaction, or the equilibrium association constant of an antibody, Ig, antibody binding fragment, or Fc-containing protein to FcyR. The equilibrium association constant is determined by dividing k _acc by k _diss .

As used herein, the term EC ₅₀ refers to the half-maximal effective concentration, which means the concentration of antibody that induces a response corresponding to the midpoint between baseline and maximum level at the specified exposure time. In fact, _EC50 represents the concentration of an antibody at which 50% of its maximum effect is observed. Thus, a decrease in binding is observed with an increase in the value of EC ₅₀ or half maximum effective concentration.

In one embodiment, reduced binding can be defined as an increase in EC50 for an antibody concentration that binds to half the maximum number of target cells.

In some embodiments of the invention, a decrease in cytotoxic activity, such as ADCC or CDC, can be defined as an increase in EC ₅₀ for an antibody concentration that results in lysis of half the maximum number of target cells. Cytotoxicity is also defined as percent cytotoxicity or percent lysis, which corresponds to the lysed portion of the cell population as determined by a calcein release assay or equivalent assay. The percentage of cytotoxicity can be determined as described in example 6.

In other embodiments of the invention, the decrease in proliferation can be defined as an increase in EC ₅₀ for the concentration of antibodies, which allows the proliferation of half the maximum number of target cells.

As used herein, the term effector functions includes the functionality provided by the Fc-containing protein to bind to FcyR. Without wishing to be bound by any one theory, the formation of the Fc/FcyR complex attracts a variety of effector cells to the site of antigen binding, which typically leads to the triggering of a variety of cell signaling cascades and important subsequent immune responses. The chimeric Fc-containing antigen-binding proteins and antibodies of the invention exhibit altered or reduced effector functions compared to the corresponding wild-type Fc-containing antigen-binding proteins or antibodies. See, for example, PCT Publication No. WO 2014/121087, published August 7, 2014, which is incorporated herein by reference in its entirety.

In some embodiments, the effector function that has been reduced or altered is a cytotoxic effector function, such as cytotoxicity, complement-dependent cytotoxicity (CCC), or antibody-dependent cytotoxicity (ADCC). In one embodiment of the present invention, the effector function that has been reduced or altered is complement-dependent cytotoxicity. In another embodiment of the invention, the effector function that has been reduced or altered is antibody dependent cytotoxicity. In other embodiments of the invention, the effector function that has been reduced or altered is the cellular proliferation of target cells.

Some effector functions of antibodies are mediated, at least in part, by Fc receptors (FcRs) that bind the Fc region of an antibody in the constant domain (in particular the C _H 2 and C _H 3 domain) of a typical immunoglobulin. There are a large number of Fc receptors specific for different classes of immunoglobulins, i.e. IgG, IgE, IgA, IgM and IgD. The human IgG Fc receptor family is divided into three groups: FcyRI (CD64), which is able to bind IgG with high affinity, FcyRII (CD32) and FcyRIII (CD16), which are both low affinity receptors. Each FcyR subclass is encoded by two or three genes, and alternative RNA splicing results in multiple transcripts, hence there is a wide variety of FcyR isoforms (e.g., FcyRIA (CD64; FCGR1 A), FcyRIB (CD64; FCRG1B), FcyRIIA (CD32A; FCGR2A), FcyRIIB (CD32B; FCGR2B), FcyRIIC (CD32C; FCGR2C), FcyRIIIA (CD16a; FCGR3A) and FcyRB (CD16b; FCGR3B)). In addition, the FcRn or neonatal Fc receptor (also known as the Fc transfer receptor, alpha or FCGRT) is able to transfer IgG antibodies from the mother to the fetus across the placenta. In addition, Fc receptors are expressed on a variety of cells, including, for example, B cells, monocytes, dendritic cells, neutrophils, and some lymphocytes. For example, U937 cells of the human monocyte cell line express both FcyRI and FcyRIIA (see, e.g., Jones, et al. J. Immunol. 135(5):3348-53 (1985); and Brooks, et al. J. Exp Med 170:1369-85 (October 1989)). Every

- 29 042263 referred to in this document, the receptor includes any known functional form of the receptor, including transcriptional variants, isoforms and polymorphisms.

Binding of Fc Ig to its receptor attracts these effector cells to the antigen binding site, which ultimately leads to the triggering of a variety of signaling and immune responses, including B cell activation, inflammatory responses, cytotoxic responses, and phagocytic responses. Therefore, a decrease or change in Fc Ig binding to its receptor can lead to a decrease in effector functions.

The term antibody-dependent cellular phagocytosis or ADCP refers to an effector function that results in the elimination (or destruction) of a target cell by engulfing the target cell rather than inducing cytolysis. ADCP may be an important in vivo mechanism for killing tumor cells. ADCP can be determined using two-color fluorescent flow cytometric analysis, for example, using PKH2 (green fluorescent dye) and phycoerythrin-conjugated (red) monoclonal antibodies against various cell surface proteins to differentiate the cells under study, thus determining the phagocytic activity and the rate of phagocytosis. The definition of ADCF is well known in the art. Therapeutic strategies that selectively activate FcyRIIA over FcyRIIB can increase macrophage phagocytic activity (Richards, J.O., et al. 2008, Mol. Cancer Ther. 7(8):2517-27). The chimeric Fc-containing antigen-binding proteins and antibodies of the invention bind and activate human FcyRIIA. Under certain circumstances, the antigen-binding proteins and antibodies of the invention bind human FcyRIIA with a higher binding affinity than they bind FcyRIIB. In some embodiments, the antibody exhibits a binding affinity for human FcyRIIA greater than about 5 times its binding affinity for human FcyRIIB, with binding affinities expressed as KD. In other embodiments, the antibody exhibits a binding affinity for human FcyRIIA greater than about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times its affinity. binding against human FcyRIIB.

Biological characteristics of antibodies and bispecific antigen-binding molecules.

The present invention includes antibodies and antigen-binding fragments thereof that bind human CD3 and CD20. For example, included in the present invention are anti-CD3χCD20 antibodies that bind Jurkat (CD3+) cells and Raji (CD20+) cells with an EC ₅₀ value of less than about 60 nM as determined by an in vitro binding assay, e.g., using an assay format, defined in example 3 (for example, assessing the binding of Jurkat cells or Raji cells with CD3xCD20 antibodies), or a largely similar analysis. In certain embodiments, the antibodies or antigen-binding fragments of the present invention bind CD3 or CD20 on the surface of a cell (e.g., Jurkat cells and/or Raji cells) with an EC ₅₀ value of less than about 75 nM, less than about 70 nM, less than about 65 nM, less than about 60 nM, less than about 50 nM, less than about 40 nM, less than about 30 nM, or less than about 25 nM, as determined by an in vitro binding assay, e.g., using the assay format defined in Example 4, or a largely similar analysis. The present invention includes bispecific antigen-binding molecules (eg, bispecific antibodies) that are capable of simultaneously binding to human CD3 and human CD20. According to certain embodiments of the invention, the bispecific antigen-binding molecules of the invention specifically interact with cells that express CD3 and/or CD20. The extent to which a bispecific antigen-binding molecule binds cells that express CD3 and/or CD20 can be assessed by fluorescence-activated cell sorting (FACS) as illustrated in Example 4. For example, included in the present invention are bispecific antigen-binding molecules that specifically bind human T cell lines that express CD3 (eg, Jurkat) bind human B cell lines that express CD20 (eg, Raji) and primate T cells (eg, peripheral blood mononuclear cells [PBMC] of cynomolgus monkeys). The present invention includes bispecific antigen-binding molecules that bind any of the above cells with an EC ₅₀ value of about 8.74x10'6 to about 5.99x10'8 or less, as measured by FACS analysis as shown in Example 4, or in largely similar analysis.

Also included in the present invention are antibodies and antigen-binding fragments thereof that bind human CD3 and induce T cell-mediated killing of tumor cells. For example, included in the present invention are anti-CD3χCD20 antibodies that induce T cell-mediated tumor cell killing with an EC ₅₀ value of less than about 60 nM as measured by an in vitro T cell-mediated tumor cell killing assay, e.g., using the assay format defined in Example 5 (e.g., evaluating the degree of killing of Raji tumor cells by human PBMCs in the presence of anti-CD3 antibodies),

- 30 042263 or substantially similar analysis. In certain embodiments, the antibodies or antigen-binding fragments of the present invention induce T cell-mediated killing of tumor cells (e.g., PBMC-mediated killing of Raji cells) with an EC ₅₀ value of less than about 56 pM, less than about 50 pM, less than about 45 pM, less than about 40 pM, less than about 35 pM, less than about 30 pM, less than about 25 pM, less than about 20 pM, less than about 15 pM, less than about 10 pM, less than about 5 pM or less than about 1 pM as measured by an in vitro T cell-mediated tumor cell killing assay, eg, using the assay format defined in Example 5, or a substantially similar assay.

Also included in the present invention are antibodies and antigen-binding fragments thereof that bind human CD3/CD20 and induce complement-dependent cytotoxicity (CDC), although to a lesser extent than antibodies having a wild-type IgG Fc domain. For example, included in the present invention are anti-CD3χCD20 antibodies that induce CSC killing of Raji or Daudi (CD20 expressing) cells with a percentage of cytotoxicity (% cytotoxicity or % cell lysis) of less than about 50% according to an in vitro mediated assay. Tumor cell killing by T cells, e.g. using the assay format defined in Example 6 (e.g. assessing the degree of killing of target cells (Raji or Daudi) in the presence of complement and anti-CD3xCD20 antibodies), or a substantially similar assay. In certain embodiments, the antibodies or antigen-binding fragments of the present invention induce cell killing by CSC (e.g., complement-mediated killing of Raji or Daudi cells) with a percent cytotoxicity of less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 1%, less than background cytotoxicity, or there is no detectable cytotoxicity according to an in vitro complement-mediated cell killing assay, e.g. using the assay format defined in Example 6 or a substantially similar assay.

Also included in the present invention are antibodies and antigen-binding fragments thereof that bind human CD3/CD20 and do not significantly induce antibody-dependent cell-mediated cytotoxicity (ADCC) when compared to antibodies having a wild type IgG Fc domain. For example, included in the present invention are anti-CD3χCD20 antibodies characterized by no significant killing of Raji or Daudi cells (CD20-expressing), with a percentage of cytotoxicity (% cytotoxicity or % cell lysis) of less than about 20% (or below background cytotoxicity) according to in vitro assay data of NK cell-mediated tumor cell killing, e.g. using the assay format defined in Example 7 (e.g. assessing target cell killing (Raji or Daudi) in the presence of NK cells and anti-CD3χCD20 antibodies), or a largely similar analysis. Substantially similar assays may include the presence of NK cells, macrophages, neutrophils, eosinophils, or other FcγRIII-expressing cells, including cells expressing variant FcyRIII. In certain embodiments, the antibodies or antigen-binding fragments of the present invention exhibit no detectable ADCC activity (e.g., FcyRIII NK-mediated killing of Raji or Daudi cells), with a percentage of cytotoxicity of less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 1%, less than background cytotoxicity, or no detectable cytotoxicity as determined by an in vitro FcyRIII-mediated cell killing assay, e.g. , using the analysis format defined in Example 7, or a substantially similar analysis.

In accordance with certain embodiments, included in the present invention are antibodies and antigen-binding antibody fragments that bind human FcyRIIA (e.g., at 25° C.) with a K _D of less than about 23.5 μM as measured by surface plasmon resonance, e.g., using the assay format defined in Example 8. In certain embodiments, antibodies or antigen binding fragments of the present invention bind FcyRIIA with a K _D of less than about 20.5 μM, less than about 20 μM, less than about 19.3 μM, less than about 18 μM, less than about 17 μM, less than about 16 μM, less than about 15 μM, less than about 10 μM, less than about 9 μM, less than about 8 μM, less than about 7 μM, less than about 6 μM, less than about 5 μM, less than about 4 μM, less than about 3 μM, less than about 2 μM, less than about 1 μM, less than about 900 nM, less than about 800 nM, or less than about 70 0 nM as measured by surface plasmon resonance, eg, using the assay format defined in Example 8 (eg, mAb capture or antigen capture format), or a substantially similar assay.

In accordance with certain embodiments of the invention, the present invention

- 31 042263 includes antibodies and antigen-binding antibody fragments that bind human

FcyRIIB (e.g., at 25° C.) with a K _D of less than about 233 pM as measured by surface plasmon resonance, e.g., using the assay format defined in Example 8. In certain embodiments, the antibodies or antigen-binding fragments of the present invention bind FcyRIIB with a K _D of less than about 200 μM, less than about 190 μM, less than about 180 μM, less than about 170 μM, less than about 160 μM, less than about 150 μM, less than about 140 μM, less than less than about 130 μM, less than about 125 μM, less than about 123 μM, less than about 120 μM, less than about 110 μM, less than about 100 μM, less than about 90 μM, less than about 80 μM, less than about 70 µM, less than about 60 µM, less than about 50 µM, or less than about 40 µM, as determined by SPR data, e.g., using the assay format defined in Example 8 (e.g., mAb capture format or capture antigen volume), or a substantially similar assay.

The present invention also includes antibodies and antigen-binding fragments thereof that bind CD3xCD20 with a dissociative half-life (t1/ ₂ ) of greater than about 8 days as measured by surface plasmon resonance at 25 or 37°C, e.g. using an assay format, as defined in Example 9, or a substantially similar analysis. In certain embodiments, the antibodies exhibit a t ¹ / ₂ value of greater than about 5 days, greater than about 6 days, greater than about 7 days, greater than about 8 days, greater than about 9 days, greater than about 10 days, more than about 11 days, more than about 12 days, more than about 13 days, more than about 14 days, more than about 15 days, or more than about 20 days, as measured by surface plasmon resonance at 25 or 37°C, for example, using the assay format defined in Example 9 (eg, mAb capture or antigen capture format), or a substantially similar assay.

Also included in the present invention are anti-CD3/anti-CD20 bispecific antigen-binding molecules that do not show significant activity in one or more assays selected from the group consisting of (a) inducing PBMC proliferation in vitro; (b) CSC cytotoxicity (see, for example, example 6); (d) ADCC (see, for example, example 7).

The present invention also includes anti-CD3/anti-CD20 bispecific antigen-binding molecules that exhibit significant activity in one or more assays selected from the group consisting of (a) reducing the number of B cells (e.g., CD45+/CD20+ B cells) in Javan macaques (see, for example, examples 10 and 11); (b) reduction in B-cell tumor volume (e.g. Raji tumor volume) in immunodeficient mouse models (see e.g. Example 12A) and (c) regression of tumors in advanced tumor mouse models (e.g. see Example 12B) .

Included in the present invention are anti-CD3/anti-CD20 bispecific antigen-binding molecules that are capable of reducing the number of B cells in a subject (see, for example, Example 10). For example, in accordance with certain embodiments of the invention, anti-CD3/anti-CD20 bespecifically antigen-binding molecules are provided, wherein a single administration of the bispecific antigen-binding molecule to a subject (e.g., at a dose of about 1 mg/kg, about 0.9 mg/kg, about 0.8 mg/kg, about 0.7 mg/kg, about 0.6 mg/kg, about 0.5 mg/kg, about 0.4 mg/kg, about 0.3 mg/kg, about 0, 2 mg/kg, about 0.1 mg/kg, about 0.08 mg/kg, about 0.06 mg/kg about 0.04 mg/kg, about 0.03 mg/kg, about 0.02 mg/kg kg, about 0.01 mg/kg or less) leads to a decrease in the number of B cells in the subject (for example, in a blood sample taken from the subject) to a level below detectable.

In certain embodiments of the invention, a single administration of an anti-CD3/anti-CD20 bispecific antigen-binding molecule at a dose of about 0.1 mg/kg results in a decrease in the number of B cells in a subject to a level below detectable by about 7 days, by about 6 day, about day 5, about day 4, about day 3, about day 2, or about day 1 after administration of the bispecific antigen-binding molecule to a subject. In accordance with certain embodiments of the invention, a single administration of an anti-CD3/anti-CD20 bispecific antigen-binding molecule according to the invention at a dose of about 0.01 mg/kg results in the number of B cells remaining below a detectable level for at least within 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days or more after administration. As used herein, the expression below detectable level means that a blood sample obtained from a subject cannot be directly or indirectly detected for the presence of B cells using standard B cell detection methods, such as the FACS assay for B cell markers described in the example. 10.

Also provided by the present invention are anti-CD3/anti-CD20 bispecific antigen-binding molecules that, when administered to a subject, result in only a temporary reduction in T cell numbers. For example, anti-CD3/anti-CD20 bispecific antigen-binding molecules are provided which, when administered to a subject at a dose of about 0.01 mg/kg, or about 0.1 mg/kg, or

- 32 042263 about 1 mg/kg, lead to a decrease in the number of T cells on day 1 after administration, but the number of T cells per 1 μl of blood is restored at subsequent time points (for example, approximately on day 2, day 4, 7 day, day 14, day 28 or later after administration). For example, the present invention provides an anti-CD3/anti-CD20 bispecific antigen-binding molecule, wherein the number of T cells per 1 μl of blood taken from a subject approximately 4-7 days after administration of the antigen-binding molecule to the subject at a dose of about 0.01 mg/kg, or about 0.1 mg/kg, or about 1 mg/kg, equal to or greater than the number of T cells per microliter of blood drawn from the subject prior to administration of the bispecific antigen-binding molecule, as measured by a standard T cell detection assay, for example, the FACS assay for T cell markers described in Example 10.

Epitope mapping and related technologies.

The epitope on CD3 or on CD20 to which the antigen-binding molecules of the present invention bind may consist of one contiguous sequence of three or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16, 17, 18, 19, 20 or more) amino acids of the CD3 protein. Alternatively, an epitope may consist of several non-contiguous amino acids (or amino acid sequences) of CD3 or CD20. Antibodies of the invention may interact with amino acids contained on the same CD3 chain (eg, CD3 epsilon, CD3 delta, or CD3 gamma) or may interact with amino acids on two or more different CD3 chains. As used herein, the term epitope refers to an antigenic determinant that interacts with a specific antigen binding site in the variable region of an antibody molecule known as a paratope. One antigen may have more than one epitope. Thus, different antibodies may bind to different sites on the antigen and may have different biological effects. Epitopes may be conformational or linear. A conformational epitope is formed due to the spatial arrangement of a number of amino acids from different segments of a linear polypeptide chain. A linear epitope is formed by adjacent amino acid residues in a polypeptide chain. In certain circumstances, an epitope on an antigen may contain components of saccharides, phosphoryl groups, or sulfonyl groups.

To determine whether the antigen-binding domain of an antibody interacts with one or more amino acids in a polypeptide or protein, various methods known to those skilled in the art can be used. Exemplary methods include, for example, standard cross-blocking assays such as those described in Antibodies, Harlow and Lane (Cold Spring Harbor Press, Cold Spring Harb., NY), alanine-scanning mutagenesis assay, peptide blot analysis (Reineke, 2004, Methods Mol Biol 248:443-463) and peptide digestion assay. In addition, techniques such as epitope exclusion, epitope removal, and chemical modification of antigens can be used (Tomer, 2000, Protein Science 9:487-496). Another method that can be used to determine the amino acids in a polypeptide that the antigen-binding domain of an antibody interacts with is hydrogen-deuterium exchange, detected by mass spectrometry. In general terms, the hydrogen-deuterium exchange method involves deuterium labeling of a protein of interest, followed by binding of an antibody to the deuterium labeled protein. The protein/antibody complex is then transferred to water to allow hydrogen-deuterium exchange in all residues except for the residues protected by the antibody (which remain labeled with deuterium). After dissociation of the antibody, the target protein is subjected to protease digestion and analysis by mass spectrometry, thereby revealing deuterium-labeled residues that correspond to the specific amino acids with which the antibody interacts. See, for example, Ehring (1999), Analytical Biochemistry, 267(2):252259; Engen and Smith (2001), Anal. Chem. 73, 256A-265A. X-ray crystallography of the antigen/antibody complex can also be used for epitope mapping purposes.

The present invention further includes anti-CD3 antibodies that bind to the same epitope as any of the specific generic antibodies described herein (eg, antibodies containing any of the amino acid sequences shown in Table 1). Likewise, the present invention also includes anti-CD3 antibodies that compete for CD3 binding with any of the specific generic antibodies described herein (eg, antibodies containing any of the amino acid sequences shown in Table 1). The present invention also includes bispecific antigen-binding molecules comprising a first antigen-binding domain that specifically binds human CD3 and a second antigen-binding domain that specifically binds human CD20, wherein the first antigen-binding domain binds the same epitope on CD3 as specific exemplary CD3-specific the antigen-binding domains described herein and/or the second antigen-binding domain binds the same epitope on CD20 as the particular exemplary CD20-specific antigen-binding domains described herein.

Similarly, the present invention also includes bispecific antigen-binding molecules comprising a first antigen-binding domain that specifically binds human CD3 and a second antigen-binding domain that specifically binds human CD20, wherein the first antigen-binding domain competes for CD3 binding with any of the specific

- 33 042263 exemplary CD3-specific antigen-binding domains described herein and/or a second antigen-binding domain competes for binding to CD20 with any of the specific exemplary

CD20-specific antigen-binding domains described in this document.

In one aspect, the present invention includes a bispecific antibody in which the first antigen-binding domain competes for binding to human CD3 with a standard antigen-binding protein that contains three heavy chain complementarity-determining regions (A1-HCDR1, A1-HCDR2, and A1-HCDR3) and three complementarity-determining regions. light chain regions (A1-LCDR1, A1-LCDR2 and A1-LCDR3), wherein (i) A1-HCDR1 contains the amino acid sequence of SEQ ID NO: 12; (ii) A1-HCDR2 contains the amino acid sequence of SEQ ID NO: 14; (iii) A1-HCDR3 contains the amino acid sequence of SEQ ID NO: 16; (iv) A1-LCDR1 contains the amino acid sequence of SEQ ID NO: 20; (v) A1-LCDR2 contains the amino acid sequence of SEQ ID NO: 22; and (vi) A1-LCDR3 contains the amino acid sequence of SEQ ID NO: 24. a protein that contains (i) a heavy chain variable region (HCVR) amino acid sequence of SEQ ID NO: 10 and (ii) a light chain variable region (LCVR) amino acid sequence of SEQ ID NO: 18.

In another aspect, the present invention includes a bispecific antibody wherein a second antigen-binding domain competes for binding to human CD20 with a standard antigen-binding protein that contains three heavy chain complementarity-determining regions (A2-HCDR1, A2-HCDR2, and A2-HCDR3) and three complementarity-determining regions. light chain regions (A2-LCDR1, A2-LCDR2 and A2-LCDR3), while (i) A2-HCDR1 contains the amino acid sequence of SEQ ID NO: 4; (ii) A2-HCDR2 contains the amino acid sequence of SEQ ID NO: 6; (iii) A2-HCDR3 contains the amino acid sequence of SEQ ID NO: 8; (iv) A2-LCDR1 contains the amino acid sequence of SEQ ID NO: 20; (v) A2-LCDR2 contains the amino acid sequence of SEQ ID NO: 22; and (vi) A2-LCDR3 contains the amino acid sequence of SEQ ID NO: 24. a protein that contains (i) a heavy chain variable region (HCVR) containing the amino acid sequence of SEQ ID NO: 2, and (ii) a light chain variable region (LCVR) containing the amino acid sequence of SEQ ID NO: 18.

In another aspect, the present invention includes a bispecific antibody comprising a first antigen-binding domain that competes for binding to human CD3 with a standard antigen-binding protein that contains (i) a heavy chain variable region (HCVR) comprising the amino acid sequence of SEQ ID NO: 10; and (ii) a light chain variable region (LCVR) comprising the amino acid sequence of SEQ ID NO: 18; and containing a second antigen-binding domain that competes for binding to human CD20 with a standard antigen-binding protein that contains (iii) a heavy chain variable region (HCVR) containing the amino acid sequence of SEQ ID NO: 2, and a light chain variable region (LCVR) containing amino acid sequence of SEQ ID NO: 18.

One skilled in the art can readily determine whether a particular antigen-binding molecule (e.g., antibody) or antigen-binding domain thereof binds to the same epitope or competes for its binding with a standard antigen-binding molecule of the present invention using routine methods known in the art. For example, to determine if an antibody of interest binds to the same epitope on CD3 (or CD20) as the standard bispecific antigen binding molecule of the present invention, the standard bispecific molecule is first allowed to bind to the CD3 protein (or CD20 protein). The ability of the test antibody to bind the CD3 (or CD20) molecule is then evaluated. If the test antibody is able to bind to CD3 (or CD20) after saturation of binding with the standard bispecific antigen-binding molecule, it can be concluded that the test antibody binds to a different CD3 (or CD20) epitope than the standard bispecific antigen-binding molecule. On the other hand, if the test antibody is unable to bind to the CD3 (or CD20) molecule after saturation of binding with the standard bispecific antigen-binding molecule, then the test antibody can bind to the same CD3 (or CD20) epitope as the epitope bound by the standard bispecific antigen-binding molecule according to invention. Additional routine experiments can be performed to confirm that the cause of the observed lack of binding of the test antibody is indeed binding to the same epitope as the standard bispecific antigen-binding molecule, and that steric blocking (or other phenomenon) is not responsible for the lack of observed binding, additional routine experiments can be performed ( for example, by peptide mutation or binding assay). Experiments of this type can be performed using ELISA, RIA, Biacore, flow cytometry, or any other quantitative or qualitative antibody binding assay available in the art. In accordance with certain embodiments of the present invention

- 34 042263 two antigen-binding proteins bind to the same (or overlapping) epitope if, for example, a 1-, 5-, 10-, 20-, or 100-fold excess of one antigen-binding protein inhibits binding of the other by at least 50% , but preferably by 75%, 90% or even 99% according to competitive binding assays (see, for example, Junghans et al., Cancer Res. 1990, 50:1495-1502). Alternatively, two antigen-binding proteins are said to bind to the same epitope if substantially all amino acid mutations in the antigen that reduce or eliminate the binding of one antigen-binding protein reduce or eliminate the binding of the other. Two antigen-binding proteins are considered to have overlapping epitopes if only a fraction of the amino acid mutations that reduce or eliminate the binding of one antigen-binding protein reduce or eliminate the binding of the other.

To determine if an antibody or its antigen-binding domain competes for binding with a standard antigen-binding molecule, the binding assay described above is performed in two orientations: in the first orientation, the standard antigen-binding molecule is allowed to bind to the CD3 protein (or CD20 protein) under saturating conditions, followed by a binding assay of the antibody under test with a CD3 (or CD20) molecule. In the second orientation, the antibody of interest is allowed to bind to the CD3 (or CD20) molecule under saturating conditions, followed by analysis of the binding of the standard antigen-binding molecule to the CD3 (or CD20) molecule. If in both orientations only the first (saturating) antigen-binding molecule is able to bind to the CD3 (or CD20) molecule, it can be concluded that the test antibody and the standard antigen-binding molecule compete for binding to CD3 (or CD20). One of skill in the art will understand that an antibody that competes for binding with a standard antigen-binding molecule may not necessarily bind the same epitope as the standard antibody, but may sterically block binding of the standard antibody by binding to an overlapping or contiguous epitope.

Preparation of antigen-binding domains and construction of bispecific molecules.

Antigen binding domains specific for particular antigens can be generated using any method known in the art for generating antibodies. Once two different antigen-binding domains specific for two different antigens (eg, CD3 and CD20) have been generated, they can be properly positioned relative to each other using routine methods to obtain a bispecific antigen-binding molecule of the present invention. (Discussion of typical formats of bispecific antibodies that can be used to construct bispecific antigen-binding molecules of the present invention is provided elsewhere in this document). In certain embodiments of the invention, one or more individual components (eg, heavy and light chains) of the multispecific antigen-binding molecules of the invention are derived from chimeric, humanized, or fully human antibodies. Methods for creating such antibodies are also well known in the art. For example, one or more of the heavy and/or light chains of the bispecific antigen-binding molecules of the present invention can be produced using the VELOCIMMUNE™ technology. Using VELOCIMMUNE™ technology (or any other human antibody generation technology), high affinity for a particular antigen (eg CD3 or CD20) is initially isolated chimeric antibodies having a human variable region and a mouse constant region. Antibodies are characterized and selected for the desired characteristics, including affinity, selectivity, epitope, etc. Mouse constant regions are replaced with the desired human constant region to provide fully human heavy and/or light chains that can be incorporated into the bispecific antigen binding molecules of the present invention.

Genetically engineered animals can be used to produce human bispecific antigen-binding molecules. For example, a genetically modified mouse that is unable to rearrange and express an endogenous mouse immunoglobulin light chain variable sequence can be used, wherein the mouse expresses only one or two human light chain variable domains encoded by human immunoglobulin sequences operably linked to the endogenous mouse kappa constant gene. mouse kappa locus. Such genetically modified mice can be used to generate fully human bispecific antigen binding molecules containing two different heavy chains that are linked to an identical light chain that contains a variable domain derived from one or two human light chain variable region gene segments. (See, for example, US 2011/0195454 for a discussion of such engineered mice and their use in the production of bispecific antigen-binding molecules).

Bioequivalents.

Included in the present invention are antigen-binding molecules having amino acid sequences that differ from those of the exemplary molecules disclosed herein but retain the ability to bind CD3 and/or CD20. Such variant molecules may contain one or more amino acid additions, deletions or substitutions compared to the parent.

- 35 042263 sequence, but show a biological activity substantially equivalent to that of the described bispecific antigen-binding molecules.

Included in the present invention are antigen-binding molecules that are bioequivalent to any of the exemplary antigen-binding molecules described herein. Two antigen-binding proteins or antibodies are considered bioequivalent if, for example, they are pharmaceutical equivalents or pharmaceutical alternatives whose rate and extent of absorption does not show a significant difference when administered at the same molar doses under similar experimental conditions, regardless of whether the dose is a single dose. or reusable. Some antigen-binding proteins are considered equivalents or pharmaceutical alternatives if they are equivalent in terms of extent of absorption but not in rate of absorption, and may be considered bioequivalent because such a difference in rate of absorption is intentional and labeled, and is not essential to achieve effective concentration in the body, for example, with chronic use, and is considered medically insignificant for a particular investigational medicinal product.

In one embodiment of the present invention, two antigen-binding proteins are bioequivalent if there is no clinically significant difference in their safety, purity, and efficacy.

In one embodiment of the present invention, two antigen-binding proteins are bioequivalent if the patient can switch one or more times between a standard product and a biological product without an expected increase in the risk of side effects, including a clinically significant change in immunogenicity, or a decrease in efficacy compared to continuous therapy without such a switch.

In one embodiment of the present invention, two antigen-binding proteins are bioequivalent if they both share a common mechanism or mechanisms of action for a given pathological condition or conditions, to the extent that such mechanisms are known.

Bioequivalence can be demonstrated in vivo and in vitro methods. The definition of bioequivalence includes, for example, (a) an in vivo study in humans or other mammals, which measures the concentration of an antibody or its metabolites in blood, plasma, serum, or other biological fluid as a function of time; (b) an in vitro study that has been correlated with and is reasonably predictive of in vivo human bioavailability data; (c) an in vivo study in humans or other mammals that measures the corresponding acute pharmacological effect of an antibody (or its target) as a function of time; and (d) a well-controlled clinical trial that establishes the safety, efficacy, or bioavailability or bioequivalence of the antigen-binding protein. Bioequivalent variants of the exemplary bispecific antigen-binding molecules provided herein can be constructed, for example, by making various residue or sequence substitutions, or by deleting terminal or internal residues or sequences not required for biological activity. For example, cysteine residues not essential for biological activity can be removed or replaced with other amino acids to prevent the formation of unnecessary or incorrect intramolecular disulfide bridges after renaturation. Alternatively, bioequivalent antigen-binding proteins may include variants of the exemplary bispecific antigen-binding molecules described herein containing amino acid changes that modify the glycosylation characteristics of the molecules, such as mutations that result in the elimination or cessation of glycosylation.

Species selectivity and species cross-reactivity.

According to certain embodiments of the invention, antigen-binding molecules are provided that bind to human CD3 but not CD3 of other species. Also provided are antigen-binding molecules that bind to human CD20 but not CD20 of other species. The present invention also includes antigen-binding molecules that bind to human CD3 and CD3 of one or more non-human species; and/or antigen-binding molecules that bind to human CD20 and CD20 of one or more non-human species.

In accordance with certain exemplary embodiments of the invention, antigen-binding molecules are provided that bind to human CD3 and/or human CD20 and may or may not bind, as the case may be, to CD3 and/or CD20 of one or more animals from mouse, rat, marine guinea pig, hamster, gerbil, pig, cat, dog, rabbit, goat, sheep, cow, horse, camel, cynomolgus monkey, marmoset, rhesus monkey, or chimpanzee. For example, in a particular exemplary embodiment, the present invention provides antigen-binding molecules comprising a first antigen-binding domain that binds human CD3 and cynomolgus CD3, and a second antigen-binding domain that specifically binds human CD20.

- 36 042263

Immunoconjugates.

The present invention includes antigen-binding molecules conjugated to a therapeutic compound (immunoconjugate), such as a cytotoxin, a chemotherapeutic drug, an immunosuppressant, or a radioisotope. Cytotoxic agents include any agent that is detrimental to a cell. Examples of suitable cytotoxic agents and chemotherapeutic agents for the preparation of immunoconjugates are known in the art (see, for example, WO 05/103081).

Formulation and administration of therapeutic drugs

As used herein, the terms effective amount and therapeutically effective amount refer to an amount of the active therapeutic agent sufficient to elicit the desired therapeutic response without undesired detrimental side effects such as toxicity, irritation, or allergic reactions. The specific effective amount will obviously vary depending on such factors as the particular pathological condition being treated, the physical condition of the patient, the type of animal being treated, the duration of treatment, the nature of the concurrent therapy (if any) and the specific drugs used, as well as the structure of compounds or their derivatives. In this case, an amount will be considered therapeutically effective if it results in one or more, without limitation, of the following: (a) inhibition of tumor growth (eg, B cell cancer) and (b) reversal or stabilization of B cell cancer.

The dose of antigen binding molecule administered to a patient may vary depending on the age and size of the patient, the target disease, conditions, route of administration, and the like. The preferred dose is generally calculated according to body weight or body surface area. When the bispecific antigen-binding molecule of the present invention is administered therapeutically to an adult patient, intravenous administration of the bispecific antigen-binding molecule of the present invention, typically in a single dose of about 0.01 to about 20 mg/kg body weight, may be advantageous. , more preferably from about 0.02 to about 7, from about 0.03 to about 5, or from about 0.05 to about 3 mg/kg of body weight. Depending on the severity of the pathological condition, the frequency and duration of treatment can be adjusted. Effective dosages and regimens for administering a bispecific antigen-binding molecule can be empirically determined; for example, the patient's progress can be monitored by periodically evaluating and adjusting the dose accordingly. In addition, cross-species dosage adjustments can be made using methods well known in the art (eg, Mordenti et al., 1991, Pharmaceut. Res. 8:1351).

Numerous delivery systems are known that can be used to administer the pharmaceutical composition of the invention, such as encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing mutant viruses, receptor-mediated endocytosis (see, for example, Wu et al., 1987, J. Biol Chem 262:4429-4432). Routes of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The composition may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous membranes (eg, oral mucosa, colonic and intestinal mucosa, etc.), and may be administered together with others. biologically active agents. The introduction can be systemic or local.

The pharmaceutical composition of the present invention can be delivered subcutaneously or intravenously using a standard needle and syringe. In addition, in the case of subcutaneous delivery, a pen can be used to deliver the pharmaceutical composition of the present invention. Such a syringe pen can be reusable or disposable. A reusable pen typically uses a replaceable cartridge that contains a pharmaceutical composition. Once all of the pharmaceutical composition has been injected from the cartridge and the cartridge has been emptied, the empty cartridge can be easily removed and replaced with a new cartridge that contains the pharmaceutical composition. The pen can then be reused. There is no replaceable cartridge in the disposable syringe pen. The disposable pen comes pre-filled with a pharmaceutical composition in a reservoir inside the device. After the reservoir is empty of the pharmaceutical composition, the entire device is disposed of.

For subcutaneous delivery of the pharmaceutical composition of the present invention, many types of reusable pens and auto-injectors can be used. Examples include, but are not limited to, AUTOPEN™ (Owen Mumford, Inc., Woodstock, UK), DISETRONIC™ handle (Disetronic Medical Systems, Bergdorf, Switzerland), HUMALOG MIX 75/25™ handle, HUMALOG™ handle, HUMALIN 70 handle /30™ (Eli Lilly and Co., Indianapolis, IN), NOVOPEN™ I, II and III (Novo Nordisk, Copenhagen, Denmark), NOVOPEN JUNIOR™ (Novo Nordisk, Copenhagen, Denmark), BD™ pen (Becton Dickinson, Franklin Lakes, NJ), OPTIPEN™, OPTIPEN PRO™, OPTIPEN STARLET™ and OPTICLIK™ (Sanofi-aventis, Frankfurt, Germany) to name but a few. Examples of disposable syringe

- 37 042263 pens that can be used for subcutaneous delivery of the pharmaceutical composition of the present invention include, but are not limited to, SOLOSTAR™ pen (sanofi-aventis), FLEXPEN™ (Novo Nordisk) and KWIKPEN™ (Eli Lilly), SURECLICK™ autoinjector (Amgen, Thousand Oaks, CA), PENLET™ (Haselmeier, Stuttgart, Germany), EPIPEN (Dey, L.P.), and HUMIRA™ Pen (Abbott Labs, Abbott Park IL), to name but a few. In certain situations, the pharmaceutical composition can be delivered using a controlled release system. In one embodiment of the present invention, a pump may be used (See Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201). In another embodiment of the invention, polymeric materials can be used; see, Medical Applications of Controlled Release, Langer and Wise (eds.), 1974, CRC Pres., Boca Raton, Florida. In another embodiment of the invention, the controlled release system can be placed near the target of the composition, thus resulting in only a portion of the systemic dose being needed (see, for example, Goodson, 1984, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138). Other controlled release systems are discussed in Langer, 1990, Science, 249:1527-1533.

Injectable preparations may include dosage forms for intravenous, subcutaneous, intradermal and intramuscular injections, drip infusions, and the like. Injectable preparations can be prepared by conventional methods. For example, injectable preparations can be prepared, for example, by dissolving, suspending, or emulsifying an antibody as described above, or a salt thereof, in a sterile aqueous or oily medium conventionally used for injection. Of the aqueous injection media, for example, physiological saline, isotonic solution containing glucose and other auxiliary agents, etc., which can be used in combination with a suitable solubilizing agent such as alcohol (for example, ethanol), polyalcohol ( e.g. propylene glycol, polyethylene glycol), non-ionic surfactant [e.g. polysorbate 80, HCO50 (polyoxyethylene (50 mol) - hydrogenated castor oil adduct)], etc. As oil media, for example, sesame oil, soybean oil, etc. are used, which can be used in combination with a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc. The injection thus prepared is preferably filled into a suitable ampoule.

The above-described pharmaceutical compositions for oral and parenteral use are advantageously formulated in single dose dosage forms corresponding to the dosage of the active ingredients. Such single dose dosage forms include, for example, tablets, pills, capsules, injections (ampoules), suppositories, and the like. The content of the above antibody in the General case is from about 5 to about 500 mg per dosage form in the form of a single dose; in particular, in the case of injection, it is preferred that the content of the above antibody is from about 5 to about 100 mg, and in the case of other dosage forms, from about 10 to about 250 mg.

Therapeutic applications of antigen-binding molecules.

Included in the present invention are methods comprising administering to a subject in need thereof a composition comprising an anti-CD3 antibody or a bispecific antigen-binding molecule that specifically binds CD3 and a target antigen (eg, CD20). The therapeutic composition may contain any antibodies or bispecific antigen-binding molecules disclosed herein and a pharmaceutically acceptable carrier or diluent. As used herein, subject in need means a human or non-human animal that exhibits one or more of the symptoms or signs of cancer (e.g., a subject expressing a tumor or suffering from any of the following cancers) or who will experience any or otherwise beneficial is inhibition of CD20 activity or reduction in CD20+ B cells or regression of CD20+ B cell tumors. The antibodies and the bispecific antigen-binding molecules of the invention (and pharmaceutical compositions containing them) are useful, among other things, in the treatment of any disease or disorder in which stimulation, activation and/or targeting of an immune response is beneficial. In particular, the anti-CD3/anti-CD20 bispecific antigen binding molecules of the present invention can be used to alleviate, prevent and/or reduce the extent of any disease or disorder associated with or mediated by CD20 expression or activity or CD20+ B cell proliferation. The mechanism of action by which the therapeutic methods of the invention are carried out involves the killing of CD20 expressing cells in the presence of effector cells, for example, by apoptosis, phagocytosis, or a combination of two or more of these mechanisms or similar cytotoxic mechanisms. CD20-expressing cells that can be inhibited or killed with the bispecific antigen-binding molecules of the invention include, for example, oncogenic B cells.

Tumor burden reduction or tumor regression includes partial or complete disappearance of a tumor or tumors in a subject. It is understood that tumor regression reflects a trend towards a decrease in tumor burden or a decrease in the severity of the disease state. Thus, regression is a progressive decrease in detectable malignancies in the body, including a decrease in tumor size and/or a decrease in the number of tumors. Reducing tumor development includes partial or complete inhibition or suppression of further tumor growth or the growth of new tumors.

The antigen binding molecules of the present invention can be used to target and treat, for example, primary and/or metastatic tumors arising in the brain or meninges, oropharynx, lungs and bronchi, gastrointestinal tract, male and female reproductive system, muscles , bones, skin and appendages, connective tissue, spleen, immune system, hematopoietic cells and bone marrow, liver and urinary system, and special sense organs such as the eyes. In certain embodiments, the bispecific antigen binding molecules of the invention are used to treat one or more of the following cancers: renal cell carcinoma, pancreatic carcinoma, breast cancer, head and neck cancer, prostate cancer, malignant gliomas, osteosarcoma, colorectal cancer, gastric cancer (eg, MET-amplifying gastric cancer), malignant mesothelioma, multiple myeloma, ovarian cancer, small cell lung cancer, non-small cell lung cancer, synovial sarcoma, thyroid cancer, or melanoma.

In accordance with certain exemplary embodiments of the invention, the bispecific antigen-binding molecules of the invention are used to treat B-cell cancer (e.g., Hodgkin's lymphoma, non-Hodgkin's lymphoma [NHL], lymphoblastic leukemia/progenitor B-cell lymphoma, mature B-cell chronic lymphocytic leukemia). small lymphocyte cells/lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, mantle cell lymphoma, follicular lymphoma, cutaneous follicle center cell lymphoma, marginal zone B-cell lymphoma, hairy cell leukemia, diffuse large B-cell lymphoma, Burkitt's lymphoma, plasmacytoma, plasma cell myeloma, post-transplant lymphoproliferative disorder, Waldenström's macroglobulinemia, and anaplastic large cell lymphoma).

The anti-CD3/anti-CD20 bispecific antigen-binding molecules of the present invention are administered in an amount sufficient to reduce tumor burden, induce tumor regression, inhibit tumor growth, or reduce tumor development in a subject. In some exemplary embodiments of the invention, the amount administered is from about 0.001 to about 1 mg/kg. In other embodiments, the amount administered is about 0.4 mg/kg. In other embodiments, the amount administered is about 0.04 mg/kg. In other embodiments, the amount administered is about 0.004 mg/kg.

In accordance with certain exemplary embodiments of the present invention, antigen binding molecules are useful for treating a patient afflicted with B-cell lymphoma (eg, NHL) that is resistant or not fully responsive to anti-CD20 monotherapy (eg, resistant to rituximab therapy). In accordance with other related embodiments of the invention, methods are provided comprising administering an anti-CD3/antiCD20 bispecific antigen-binding molecule disclosed herein to a patient afflicted with B-cell lymphoma (e.g., NHL) that is refractory to anti-CD20 therapy (e.g., a patient with rituximab-resistant tumor or relapsed or refractory B-cell lymphoma). In order to check if a patient is carrying a tumor that is resistant, not fully responsive, or not treatable with anti-CD20 therapy alone, analytical/diagnostic methods known in the art, such as tumor scanning, etc., can be used.

The present invention also includes methods for treating residual cancer in a subject. As used herein, the term residual cancer means the presence or retention of one or more cancer cells in a subject after treatment with an anticancer therapy.

In accordance with certain aspects, the present invention provides methods for treating a disease or disorder associated with CD20 expression (e.g., B-cell lymphoma) comprising administering to a subject one or more of the bispecific antigen-binding molecules described elsewhere herein after the subject has received anti-CD20 monotherapy. (eg, following administration of a pharmaceutical composition containing an anti-CD20 antibody such as rituximab). For example, the present invention includes methods for treating B-cell lymphoma comprising administering an anti-CD3/anti-CD20 bispecific antigen-binding molecule to a patient after 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks , 3 weeks, or 4 weeks, 2 months, 4 months, 6 months, 8 months, 1 year or more after the subject received anti-CD20 monotherapy (eg, treatment with rituximab or equivalent treatment).

Combination therapy and drugs.

Included within the present invention are methods that include administering a pharmaceutical composition comprising any of the generic antibodies and antigen-binding molecules described herein in combination with one or more additional therapeutic agents. Exemplary additional therapeutic agents that can be combined or administered in combination with an antigen binding molecule of the present invention include, for example, an EGFR antagonist (e.g., an anti-EGFR antibody [e.g., cetuximab or panitumumab] or a small molecule EGFR inhibitor [e.g., gefitinib or erlotinib]), an antagonist of another member of the EGFR family such as Her2/ErbB2, ErbB3, or ErbB4 (e.g., an anti-ErbB2, anti-ErbB3, or anti-ErbB4 antibody or small molecule inhibitor of ErbB2, ErbB3, or ErbB4 activity), an EGFRvIII antagonist ( e.g., an antibody that specifically binds EGFRvIII), a cMET antagonist (e.g., an anti-cMET antibody), an IGF1R antagonist (e.g., an anti-IGF1R antibody), a B-raf inhibitor (e.g., vemurafenib, sorafenib, GDC-0879, PLX-4720), PDGFR-α inhibitor (eg, anti-PDGFR-a antibody), PDGFR-β inhibitor (eg, anti-PDGFR-e antibody), VEGF antagonist (eg, VEGF-Trap, see, for example, US 7,087,411 (also referred to herein as VEGF inhibitory fusion protein), an anti-VEGF antibody (e.g., bevacizumab), a small molecule VEGF receptor kinase inhibitor (e.g., sunitinib, sorafenib, or pazopanib)), a DLL4 antagonist (e.g., an anti-DLL4 antibody disclosed in US 2009/0142354), an Ang2 antagonist (for example, an anti-Ang2 antibody disclosed in US 2011/0027286, such as H1H685P), a FOLH1 antagonist (for example, an anti-FOLH1 antibody), a PRLR antagonist (for example, an anti-PRLR antibody), a STEAP1 or STEAP2 antagonist (eg, anti-STEAP1 antibody or anti-STEAP2 antibody), TMPRSS2 antagonist (eg, anti-TMPRSS2 antibody), MSLN antagonist (eg, anti-MSLN antibody), CA9 antagonist (eg, anti-CA9 antibody) , a uroplakin antagonist (eg, an anti-uroplakin antibody), an anti-CTLA4 antibody (eg, ipilimumab (MDX-010)), a monovalent CD20 antagonist (eg, a monovalent anti-CD20 antibody such as rituximab), etc.

Other agents useful in combination with the antigen binding molecules of the invention include immune activators or inhibitors. Some immune activators or inhibitors are cytokine activators or inhibitors, including small molecule compounds and antibodies that bind to cytokines such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL -8, IL-9, IL-11, IL-12, IL-13, IL-17, IL-18 or their respective receptors. Pharmaceutical compositions of the present invention (e.g., pharmaceutical compositions comprising the anti-CD3/anti-CD20 bispecific antigen-binding molecule disclosed herein) may also be administered as part of a therapeutic regimen comprising one or more therapeutic combinations selected from ICE: ifosfamide ( eg Ifex®), carboplatin (eg Paraplatin®), etoposide (eg Etopophos®, Toposar®, Vepezid®, VP-16); DHAP: dexamethasone (eg Decadron®), cytarabine (eg Cytosar-U®, cytosine arabinoside, ara-C), cisplatin (eg Platinol®-AC)); and ESHAP: etoposide (eg, Etopophos®, Toposar®, Vepezid®, VP-16), methylprednisolone (eg, Medrol®), high dose cytarabine, cisplatin (eg, Platinol®-AS)).

The present invention also includes therapeutic combinations of any of the antigen-binding molecules herein and an inhibitor of one or more of VEGF, Ang2, DLL4, EGFR, ErbB2, ErbB3, ErbB4, EGFRvIII, c-Met, IGF1R, B-raf, PDGFR-α , PDGFR-β, FOLH1, PRLR, STEAP1, STEAP2, TMPRSS2, MSLN, CA9, uroplakin, or any of the above cytokines, wherein the inhibitor is an aptamer, antisense, ribozyme, siRNA, peptibody, nanobody, or antibody fragment (e.g., Fab fragment ; F(ab') ₂ fragment; Fd fragment; Fv fragment; scFv; dAb fragment or other constructed molecules such as diabodies, triabodies, tetrabodies, minibodies and minimal recognition units). The antigen-binding molecules of the invention can also be administered and/or obtained in combination with antivirals, antibiotics, analgesics, corticosteroids and/or NSAIDs. The antigen binding molecules of the invention can also be administered as part of a treatment regimen that also includes radiation therapy and/or conventional chemotherapy. Additional(s) therapeutically active component(s) can be administered immediately before, simultaneously with or shortly after administration of the antigen-binding molecule according to the present invention (in the context of the present description, such administration regimens are considered to be the administration of the antigen-binding molecule in combination with an additional therapeutically active component).

Included within the present invention are pharmaceutical compositions in which an antigen-binding molecule of the present invention is combined with one or more additional therapeutically active ingredients as described elsewhere herein.

Introduction schemes.

In accordance with certain embodiments of the present invention, multiple doses of an antigen-binding molecule (eg, an anti-CD3 antibody or a bispecific antigen-binding molecule that specifically binds CD20 and CD3) may be administered to a subject over a period of time. Methods in accordance with this aspect of the invention include sequential administration of multiple doses of an antigen-binding molecule according to the invention to a subject. As used herein, sequential administration means that each dose of an antigen-binding molecule is administered to a subject at a different time point, eg, on different days separated by a predetermined interval (eg, hours, days, weeks, or months). Included in the present invention are methods that include sequentially administering to a patient one initial dose of antigen-binding molecule followed by one or more secondary doses of antigen-binding molecule and optionally one or more tertiary doses of antigen-binding molecule.

The terms initial dose, secondary dose and tertiary dose refer to the time sequence of administration of the antigen-binding molecule according to the invention. Thus, the initial dose is the dose that is administered at the beginning of the treatment regimen (also called the initial dose); secondary doses are doses that are administered after the initial dose; and tertiary doses are doses administered after secondary doses. Initial, secondary and tertiary doses may all contain the same amount of antigen-binding molecule, but in General may differ from each other in the context of the frequency of administration. However, in certain embodiments of the invention, the amount of antigen-binding molecule contained in the initial, secondary and/or tertiary doses may differ (eg, up or down depending on the situation) during the course of treatment. In certain embodiments, two or more doses (eg, 2, 3, 4, or 5) are administered at the beginning of the treatment regimen as loading doses, followed by doses that are administered less frequently (eg, maintenance doses).

In one exemplary embodiment of the present invention, each secondary and/or tertiary dose is administered 1-26 (for example, 1, 11/2, ₂ , 21/2, 3, 31/2, ₄ , 41/2, 5, 51/ 2, ₆ , 61/2, 7, 71/2, 8, 81/2, 9, 91/2, 10, 101/2, 11, 111/2, 12, 121/2, 13, 131/2, 14, 141/2, 15, 151/2, 16, 161/2, 17, 171/2, 18, 181/2, 19, 191/2, 20, 201/2, 21, 211/2, 22, 221/2, 23, 231/2, 24, 241/2, 25, 251/2, 26, 261/2 or more) weeks after the immediately preceding dose. As used herein, the term "immediately preceding dose" refers to the dose of the antigen-binding molecule in a multi-dose sequence that is administered to the patient until the next dose in the sequence without intermediate doses.

Methods in accordance with this aspect of the invention may include administering to a patient any number of secondary and/or tertiary doses of an antigen-binding molecule (eg, a bispecific antigen-binding molecule that specifically binds to CD20 and CD3). For example, in certain embodiments of the invention, only one secondary dose is administered to the patient. In other embodiments, two or more (eg, 2, 3, 4, 5, 6, 7, 8 or more) secondary doses are administered to the patient. Similarly, in certain embodiments of the invention, only one tertiary dose is administered to the patient. In other embodiments, two or more (eg, 2, 3, 4, 5, 6, 7, 8 or more) tertiary doses are administered to the patient.

In embodiments of the invention involving the administration of multiple secondary doses, each secondary dose may be administered at the same frequency as the other secondary doses. For example, each secondary dose may be administered to a patient 1-2 weeks after the immediately preceding dose. Similarly, in embodiments of the invention involving the administration of multiple tertiary doses, each tertiary dose may be administered at the same frequency as the other tertiary doses.

For example, each tertiary dose may be administered to a patient 2-4 weeks after the immediately preceding dose. Alternatively, the frequency of administration of secondary and/or tertiary doses to a patient may vary during the course of treatment. The frequency of administration can also be adjusted during the course of treatment by the attending physician, depending on the needs of the individual patient after clinical examination.

Diagnostic applications of antibodies.

The Ahtu-CD3xCD20 antibodies of the present invention can also be used to detect and/or detect CD3 or CD3 expressing cells in a sample, for example for diagnostic purposes. For example, an anti-CD3χCD20 antibody or fragment thereof can be used to diagnose a pathological condition or disease characterized by aberrant expression (eg, overexpression, low or no expression, etc.) of CD3. Typical diagnostic assays for CD3 may include, for example, contacting a patient sample with an anti-CD3xCD20 antibody of the invention, the antibody being labeled with a detectable label or reporter molecule. Alternatively, an unlabeled anti-CD3xCD20 antibody can be used in diagnostic applications in combination with a secondary antibody that is labeled with a detectable label. The detectable label or reporter molecule may be a radioisotope such as ³ H, ¹⁴ C, ³² P, ³⁵ S or ¹²⁵ I; a fluorescent or chemiluminescent compound such as isothiocyanate or rhodamine; or an enzyme such as alkaline phosphatase, beta-galactosidase, horseradish peroxidase or luciferase. Specific exemplary assay methods that can be used to detect or determine CD3 in a sample include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescent activated cell sorting (FACS). Similarly, the anti-CD3χCD20 antibodies of the present invention can also be used to detect and/or detect CD20 or CD20 expressing cells in a sample, or to diagnose a pathological condition or disease characterized by aberrant expression (e.g.,

- 41 042263 overexpression, low or no expression, etc.) CD20.

Samples that may be used in the CD3 or CD20 diagnostic assay methods of the present invention include any patient-derived tissue or fluid sample that contains a detectable amount of CD3 and/or CD20 protein or fragments thereof under normal or pathological conditions. In general, CD3 or CD20 levels are first measured in a specific sample from a healthy patient (e.g., a patient not affected by a disease or condition associated with abnormal CD3 or CD20 levels or activity) to establish a baseline or standard CD3 or CD20 level. This baseline CD3 or CD20 level can then be compared with CD3 levels measured in samples obtained from individuals suspected of having a CD3 or CD20 related disease or condition, respectively.

Examples

The following examples are provided to provide those skilled in the art with a full disclosure and description of how to make and use the methods and compositions of the invention, and do not limit the scope of what the authors consider their invention. Care has been taken to ensure accuracy with respect to the numbers used (eg quantities, temperatures, etc.), but the possibility of some experimental errors and deviations should be taken into account. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight, temperature is expressed in degrees Celsius, and pressure is at or near atmospheric.

Example 1 Preparation of anti-CD3 and anti-CD20 antibodies.

Several methods are known for isolating anti-CD3 or anti-CD20 antibodies. The fully human anti-CD3 antibodies used in the following examples were isolated directly from antigen-positive B cells without fusion with myeloma cells, as described in US 2007/0280945 A1.

Additional examples of anti-CD3 antibodies can be used in these methods, and a description of such antibodies and the biological properties of such anti-CD3 antibodies is given in PCT International Application No. PCT/US13/60511, filed September 19, 2013, which is incorporated in its entirety in this document by reference. Exemplary anti-CD20 antibodies and the biological properties of such anti-CD20 antibodies are described in US 7,879,984 and PCT International Application No. PCT/US13/60511, filed September 19, 2013, which are incorporated herein by reference. The Ahtu-CD20 antibody and the method of making the antibody used to construct the bispecific antibodies in this example are as described in US 7,879,984. bispecific antibodies according to the invention are given in table. 1. The corresponding designations of the nucleotide sequences are given in table. 2.

Table 1

Amino acid sequence designations (SEQ ID NO)

SEQID NO: Antibody designation HCVR HCDR1 HCDR2 HDDR3 LCVR LCDR1 LCDR2 LCDR3 Ahtii-CD20 2 4 6 8 18 20 22 24 Ahth-CD3 10 12 14 16 18 20 22 24

table 2

Nucleotide sequence designations (SEQ ID NO)

SEQID NO: Antibody designation HCVR HCDR1 HCDR2 HDDR3 LCVR LCDR1 LCDR2 LCDR3 Ahth-CD20 1 3 5 7 17 19 21 23 Ahth-CD3 9 eleven 13 15 17 19 21 23

Example 2 Preparation of bispecific antibodies that bind CD3 and CD20.

Bispecific antibodies containing an anti-CD3 specific binding domain and an anti-CD20 specific binding domain were constructed with the above sequences using standard methodology in which the heavy chain and cognate light chain from an anti-CD3 antibody were combined with the heavy chain from an anti-CD20 antibody.

Thus, the bispecific antibodies constructed in accordance with the present example contain two separate antigen-binding domains (ie, binding arms). The first antigen binding domain comprises a heavy chain variable region derived from an anti-CD20 antibody (CD20-VH) coupled to a light chain variable region derived from an anti-CD3 antibody (CD3-VL). The CD20-VH/CD3-VL junction forms an antigen-binding domain that specifically recognizes CD20. The second antigen binding domain comprises a heavy chain variable region derived from an anti-CD3 antibody (CD3-VH) coupled to a light chain variable region derived from an anti-CD3 antibody (CD3-VL). The CD3-VH/CD3-VL junction forms an antigen-binding domain that specifically recognizes CD3. In all bispecific antibodies created in

- 42 042263 this example, used the same CD20-VH, referred to as CD20-VH-A. The heavy chain constant domain (CH) wild type for each heavy chain was replaced with chimeric CH using recombinant techniques. The CH of one binding arm (eg, the anti-CD3 binding arm) contains a mutation in the _CH 3 region of CH that facilitates the isolation of the bispecific antibody. Summarized information on the constituent parts of various bispecific antibodies created in accordance with this example, is given in table. 3 and 4.

Table 3

Amino acid sequence designations

Name of the bispecific antibody Ahth-CD20 antigen binding domain Ahth-CD3 antigen binding domain Variable heavy chain region Constant heavy chain region Variable light chain region Variable heavy chain region Constant heavy chain region Variable light chain region CD20-VH-A CH CD3-VL-A CD3-VH-A CH CD3-VL-A Antibody 1 2 26 18 10 28 18 Antibody 2 2 thirty 18 10 32 18

Table 4

Nucleotide sequence designations

Name of the bispecific antibody Ahth-CD20 antigen binding domain Ahth-CD3 antigen binding domain Variable heavy chain region Constant heavy chain region Variable light chain region Variable heavy chain region Constant heavy chain region Variable light chain region CD20-VH-A CH CD3-VL-A CD3-VH-A CH CD3-VL-A Antibody 1 1 25 17 9 27 17 Antibody 2 1 29 17 9 31 17

In table. 5 and 6 show the amino acid sequence designations for the various heavy chain variable regions (Table 5) and light chain variable regions (Table 6) with the corresponding CDRs of the bispecific antibodies from this example.

Table 5

Heavy chain amino acid sequence designations

Designation heavy chain Heavy chain variable region (HCVR) HCDR1 HCDR2 HDDR3 Heavy chain constant region (CH) CD20-VH-CH-A 2 4 6 8 26 or 28 or 30 or 32 CD3-VH-CH-A 10 12 14 16

Table 6

Light chain amino acid sequence designations

Light chain designation Light chain variable region (LCVR) LCDR1 LCDR2 LCDR3 CD3-VL-A 18 20 22 24

In addition, in Table. 7 and 8 show the sequence designations for the nucleotide sequences encoding the various heavy chain variable regions (Table 7), heavy chain constant regions and light chain variable regions (Table 8) with the corresponding CDRs of the bispecific antibodies from this example.

- 43 042263

Table 7

Heavy chain nucleotide sequence designations

Designation heavy chain Heavy chain variable region (HCVR) HCDR1 HCDR2 HDDR3 Heavy chain constant region (SI) CD20-VH-A 1 3 5 7 25 or 27 or 29 or 31 CD3-VH-A 9 AND 13 15

Table 8

Light chain nucleotide sequence designations

Easy designation chains Light chain variable region (LCVR) LCDR1 LCDR2 LCDR3 CD3-VL-A 17 19 21 23

In addition to the bispecific antibodies described above, the following control antibodies were also used in some of the experiments described in the following examples.

Control antibody 1: Monoclonal antibody 'OKT-3 against human T-cell surface antigens described in US 4361549 and available from hybridoma CRL-8001 (American Type Culture Collection, Manassas, VA).

Control Antibody 2: Antibody SP34 reactive against T3 complex epsilon chain on human T lymphocyte cells, available from BD Pharmagen, Cat # 55052.

Control antibody 3: Ahtu-CD20 therapeutic antibody with Rituxan® heavy and light chain sequences (rituximab) disclosed in US 5,736,137.

Control Antibody 4: Also known as CD3xCD20 wild-type Fc antibody (dt Fc), this antibody was generated similarly to the methods above and contains an anti-CD20 arm containing the amino acid sequence pair HCVR/LCVR SEQ ID NO: 2/18 (HCDR1 amino acid sequences -HCDR2-HCDR3-LCDR1-LCDR2-LCDR3 SEQ ID NO: 4-6-8-20-22-24) and wild-type IgG1 CH region (SEQ ID NO: 45); and an anti-CD3 arm containing a pair of amino acid sequences HCVR/LCVR SEQ ID NO: 10/18 (amino acid sequences HCDR1-HCDR2HCDR3-LCDR1-LCDR2-LCDR3 SEQ ID NO: 12-14-16-20-22-24) and C _H -region of wild-type IgG1 with two amino acid modifications (SEQ ID NO: 48) in the C _H 3 domain to facilitate isolation. The CD3xCD20 antibody-gt Fc (antibody 4) may be referred to as an equivalent control antibody having a wild-type IgG1 Fc domain (i.e. equivalent in terms of antigen-binding domains of the CD3xCD20 chimeric Fc of an antibody of the invention) in order to compare antibody effector functions or other properties with antibodies having different Fc domain sequences or structure.

Control antibody 5: The anti-FelDi monoclonal antibody binds feline antigen and is not cross-reactive with human CD20 or CD3. This IgG1 non-specific control antibody was obtained by the methods described in PCT Publication No. WO2013/166236 published November 7, 2013.

Control antibody 6: The anti-FelD1 antigen binding domain described in PCT Publication No. WO2013/166236 was designed as described herein to contain a chimeric IgG4 Fc domain similar to Ab1. Control Ab6 does not cross-react with human CD20 or CD3, but has similar effector functions to Ab1.

Example 3 Construction of a chimeric heavy chain.

Obtaining chimeric heavy chains, such as chimeric C _H IgG4 (SEQ ID NO: 26) and chimeric C _H IgG1 (SEQ ID NO: 30), was carried out using standard cloning methods. First, a chimeric IgG4 _CH was obtained by a two-step PCR amplification process. Two PCR fragments, fragments 1 and 2, were amplified using the starter vector construct pR001 containing wild-type hIgG4 C _H DNA using primer pairs flanking the CH region, P1-P2 and P3-P4, respectively (see Table 9). below). Primers were introduced into the fragments both the required IgG2 lower hinge sequence (which encodes SEQ ID NO: 52) and the flanking restriction sites. Then these two fragments were connected using PCR primers P2 and P4. The resulting sequence was inserted into pR001 through the Xho1-Not1 restriction sites, giving

- 44 042263 vector construct pR002 which contains a chimeric IgG4 CH containing an IgG2 lower hinge sequence. The sequence was confirmed using primers P10 and P11.

In addition, chimeric IgG1 CH was obtained using multi-step PCR amplification. Fragment 1a was generated using primers P2 and P5 (see Table 9 below) from template pR85503 (which contains wild type human IgG1 CH DNA). Fragment 2a was amplified with primers P6 and P8 using pR002 (containing chimeric IgG4 _CH DNA) as template. Fragment 3 was generated using primers P7 and P9 from template pR003 (wt hIgG1 CH DNA; SEQ ID NO: 45). Fragments 1a and 2a were fused using primers P2 and P8, resulting in fragment 4. Linking fragments 2a and 3 using primers P6 and P9 resulted in fragment 5. Fragments 4 and 5 were then fused using primers P2 and P9. The resulting sequence was inserted into pR001 via the Xho1-Not1 restriction sites to give construct pR004, which contains an IgG1 constant region with an IgG2 lower hinge region and an IgG4 C _H 2 domain. The sequence was confirmed using primers P10 and P11.

Table 9

Primers for PCR generation of nucleotide constructs of chimeric CH

Primer name Primer sequence (SEQ ID NO) P1 5'- TTCGCGCAGCTTAGGTTTATGCCAGGGGGGACGGGTGGCACGGGTCGTGGTGGACACCGT3' (antisense) (SEQ ID NO: 63) R2 5'-AAG CTT ATACTCG AG CT CT AG ATT GGGAACCCGGGTCTCT-3' (SEQ ID NO: 64) RZ 5'-CCCACCGTGCCCAGCACCACCT GT GGCAGG ACCAT CAGT CTTCCT GTT CCCCCCAAAA-3' (SEQ ID NO: 65) P4 5'-TGTGTCTTCAGGGAGAGGGACAGAGACCCATTTACTCGCC GGCG-3'(antisense) (SEQ ID NO: 66) R5 5- CTCGGGTTTAGAACACTGTTTTGAGTGTGTACGGGTGGCACGGGTCGTGGTGGACACCGT-3' (antisense) (SEQ ID NO:67) R6 5-AAAT CTTGT G ACAAAACTCACACATGCCCACCGTGCCCAGCACCACCT GTG-3' (SEQ ID NO: 68) R7 5-GAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACC-3'(SEQ ID NO: 69) R8 5'-CTCTTTTGGTAGAGGTTTCGGTTTCCCGTCGGGGCTCTTG GTGTCCACATGTGG-3' (antisense) (SEQ ID NO: 70) R9 5'-CTTCAGGGAGAGGGACAGAGGCCCATTTACTCGCCGGCG-3' (antisense) (SEQ ID NO: 71) P10 5'-GCTGACAGACTAACAGACTG-3' (SEQ ID NO: 72) P11 5-AT AC ATT ATACGAAGTTATACCGGTA-3' (SEQ ID NO: 73)

Example 4 CD20xCD3 bispecific antibodies selectively bind Jurkat, Raji and simian T cells compared to CD3xCD20 monospecific antibodies gt Fc (control antibody 4) were compared to the monospecific control antibodies shown in Example 2 using the FACS binding method for their ability to bind to Jurkat (CD3 ⁺ , CD20 human T-cell line), Raji ( ^CD3- , CD20+ human B-cell line) or cynomolgus monkey PBMC (mkT cells).

FACS data were obtained using the following protocol: Cells at 2x105 per well were incubated (for cynomolgus monkey PBMC) and further incubated for 30 with serial antibody dilutions for 30 min on ice. After incubation, the cells were washed and the appropriate secondary antibody (Jurkat cells, RAJI) or secondary antibody cocktail min. After incubation, cells were washed, resuspended in chilled PBS containing 1% BSA, and analyzed by flow cytometry on a BD FACS Canto II. Jurkat and Raji cells were ranked for lateral and anterior expansion, while cynomolgus macaque T cells were gated for both the CD2+CD4+ population. EC ₅₀ for cell binding titration was determined using the Prism software, with values calculated using a four-parameter non-linear regression analysis. The results are shown in table. 10.

Table 10

EC ₅₀ binding values (molar) for monospecific and CD3xCD20 bispecific antibodies

Antibody FACS-Jurkat FACS-RAJI FACS - mkT cells Control 1 (antiCD3) 1.96E-10 NS NS Control 2 (antiCD3) (+) NS 7,OSE-11 Control 3 (antiCD20) No binding (+) NS Control 4 3.85Е-08 5.99E-08 8.74Е-06 (Ahth-CD3xCD20, WT CH)

(+) EC ₅₀ values not determined, but binding was observed;

HC: no binding;

NI: - did not investigate.

- 45 042263

As shown in Table. 10, a panel of test antibodies showed a range of binding affinities for different cell lines depending on their specificity. Bispecific control antibody 4 demonstrated the ability to bind both human and cynomolgus monkey target lines. Control antibody 4 contains the same anti-SDR xSP20 variable regions as antibody 1 and antibody 2 of the invention, but has a wild-type IgGl C _n region. Ahth-CD3 control 1 (OCTS), anti-POPs control 2 (SP34), and anti-CO20 control 3 bind to Jurkat, cynomolgus T cells and RAJI, respectively.

Example 5 CD20xCD3 _wild -type CD20xCD3 bispecific antibodies induce cytotoxicity against Raji cells in the presence of activated T cells.

The ability of CD20xCD3 bispecific antibodies to redirect T cell-mediated killing to SP20-expressing Raji cells was examined in an in vitro cytotoxicity assay. In addition, the ability of bispecific and parental anti-POP antibodies to kill U937 cells via Fc/FcR interactions was also investigated.

Kill assay with calcein was performed using the following protocol: Human and cynomolgus PBMC were isolated using ficoll-Plaque or Lympholyte Mammal cell separation medium, respectively. The isolated PBMCs were activated for several days in a medium containing recombinant human IL-2 (30 U/ml) and T-cell activation granules (anti-POPs/CO28 for human PBMCs, aHTH-CD2/CD3/CD28 for cynomolgus PBMCs).

Target cells (Raji for CD20-mediated killing and U937 for FcR-mediated killing) were labeled with calcein and incubated with activated T cells at an effector:target ratio of 10:1 using three-fold serial antibody dilutions for 3 hours at 37°C. After incubation, the plates were centrifuged and the supernatants were transferred to a translucent black plate with a transparent bottom for fluorescent analysis. EC ₅₀ , defined as the molar concentration of the bispecific antibody that induces 50% cytotoxicity, was determined using Prism. Values were calculated using a four-parameter non-linear regression analysis. The results are summarized in table. 10.

Table 11

EC ₅₀ values for SP20xSPD-induced cytotoxicity against Raji and U937 cells

Antibody Raji Cytotoxicity Human Cells [M] Cytotoxicity of Raji Monkey T- cells [M] Cytotoxicity U937 Human Cells [M] Control Ab 1 (anti-SDR) ON ON 3.04Е-12 Control AB 4 5.63E-11 * 1.27E-12* 8.86E-11* (Ahth-CD3xCD20)

*Data are median values from three or more independent analyses.

Data without * are typical/mean values from one or two independent analyses.

ON: no activity.

As shown in Table. 11, a CD20xCD3 bispecific antibody containing anti-SDR arms specific to human and cross-reactive to cynomolgus monkey and C _n region of wild-type IgGl was able to specifically redirect cytotoxicity to Raji cells in the presence of activated human T cells. In the presence of activated cynomolgus monkey T cells, killing of Raji occurred when they were incubated with the control AL4 bispecific antibody, which contains an anti-CPS arm that activates monkey T cells. Both the bispecific antibody and the control AI (anti-SDR mAb) showed activity in the U937 Fc/FcR dependent kill assay. This activity can be blocked by adding blocking non-specific human IgG to the reaction (data not shown).

Example 6 SP20xSP3 bispecific antibodies containing chimeric _Cn regions show reduced effector function in a CSC assay.

The SP20xSP3 bispecific antibodies with chimeric _Cn regions (antibody 1 and antibody 2) described in Example 2 above were designed to alter or reduce effector function. Compared to antibodies containing the heavy chain constant region of the wild-type (wt) isotype IgGl (control AL4), amino acid substitutions in the C _n -region can interfere with the ability of Ig Fc to bind to its receptor(s). Consequently, signaling and immune responses such as B-cell activation or phagocytosis may be altered. The effect of amino acid modifications in the CH region on the effector function of complement-dependent cytotoxicity (CDC) (in this example) and antibody-dependent cell-mediated cytotoxicity (ADCC) (see example 7) was investigated.

To investigate the effect of Antibody 1 and Antibody 2 on CSC effector function, SP20-46042263 expressing Raji (target) cells (5000/well) or Daudi cells were seeded in the presence of 5% human serum complement. Serial dilutions of antibody 1, antibody 2 and control antibodies, starting at 100 nM, were added to the cells for 4 hours at 37°C. Target cell lysis was determined using the CytoTox Glo™ kit (Promega) and the percentage of cytotoxicity was calculated. Percent cytotoxicity was calculated using the equation: % cytotoxicity = ((LS-L _SR )/(L _MR -L _SR ))x100%, where LSR is the baseline luminescence of target cells and LMR is the maximum release of calcein from cells lysed with digitonin. EC ₅₀ for cytotoxicity was determined using Prism software (GraphPad). The values were calculated using a 4-parameter non-linear regression analysis and are given in Table. 12 and in FIG. 5A and 5B. The CSC activity of Antibody 1 and Antibody 2 against Daudi and Raji cells was significantly reduced compared to the corresponding antibody containing the wild-type heavy chain constant region. See table. 12 and FIG. 5A, 5B. Some degree of CDC activity was observed for antibody 1 in the case of Raji cells, however, the overall results indicate that the chimeric antibodies exhibited weaker effector responses than control antibodies with gt IgG1 Fc.

Table 12

CD20xCD3 bispecific antibodies containing chimeric CH regions showing reduced activity in the CSC assay for effector functions

KZTs Target cell—» Daudi Raji EU ₅₀ [M] Maximum cytotoxicity EU ₅₀ [M] Maximum cytotoxicity Control AB 4 6.12E-08 ~95 1.98E-08 ~85 Ab 1 ON ON 2.86Е-08 ~45 AB 2 ON ON 3.49Е-08 ~10

ON: no activity.

Example 7 CD3xCD20 bispecific antibodies containing chimeric CH regions showing reduced effector function in an ADCC assay.

To investigate the effects of Antibody 1 and Antibody 2 versus a bispecific antibody with wild-type CH regions (and identical variable regions) on ADCC effector function, freshly isolated unstimulated CD56-positive NK cells or NK92 cells engineered to express high affinity V the FcyRIIIA allele were seeded in calcein-labeled CD20-positive Raji or Daudi cells in the presence of chimeric CH antibodies (antibody 1 and antibody 2) and a dt-CH control antibody (control antibody 4). The release of calcein from target cells was monitored and the percentage of cytotoxicity was determined. Percent cytotoxicity and EC ₅₀ were calculated as described above for the CSC analysis. The results are shown in table. 13 and in FIG. 6A and 6B.

Chimeric _CH antibodies, Antibody 1 and Antibody 2, did not mediate ADCC activity (Table 13) against Raji or Daudi cells.

Table 13

CD3xCD20 bispecific antibodies containing chimeric CH regions show reduced activity in the ADCC assay for effector functions

ADCC Target cell—» Daudi Raji EU ₅₀ [M] Maximum cytotoxicity (%) EU ₅₀ [M] Maximum cytotoxicity (%) Control AB 4 1.87E-10 ~70 ^# 1.48Е-09 ~65 ^# AB 1 ON ON ON ON AB 2 ON ON ON ON

ON: no activity;

#: background cytotoxicity ~20%.

Example 8 Surface Plasmon Resonance Obtained Binding Affinities and Kinetic Constants of Chimeric Antibodies.

Anti-CD3χanti-CD20 bispecific antibodies having chimeric heavy chain constant regions - antibody 1 and antibody 2 - were analyzed by surface plasmon resonance

- 47 042263 (PPR) (Biacore) to determine their kinetic parameters of binding to human and cynomolgus monkey FcY receptors. Isotype controls, namely the gt-IgG1 isotype control and the gt-IgG4 isotype control of CPPC, were examined in a similar manner.

Briefly, SPR experiments were performed at 25° C. on a Biacore T200 instrument using a carboxymethyl dextran (CM-5) coated chip. A mouse monoclonal anti-pentahistidine antibody (GE Healthcare) was immobilized on the surface of a CM-5 sensor chip using standard amine conjugation. 140RU-376RU His-tagged human or simian FcyR proteins were captured on a CM-5 anti-pentahistidine amine-coupled chip and antibody stock solutions were passed at 20 μl/min for 2.5 min through the captured proteins. mAb binding was monitored and, in the case of low affinity receptors, steady state equilibrium binding was calculated. The kinetic rate constants of association (ka) and dissociation (k _d ) were determined by processing and fitting the data with a 1:1 binding model using Scrubber 2.0 curve fitting software. Equilibrium dissociation constants (KD) and dissociative half-life (t _1/2 ) for binding were calculated from the kinetic constants as: KD (M) = k _d /k _a ; and t _1/2 (min) = (In2/(60*k _d ).

Table 14

Binding Kinetic Parameters for Antibodies with Wild Type Heavy Chains (wt) and Chimeric Heavy Chains

Binding to His-captured human FcyRI at 25°C Antibody k _a (M^seC ¹ ) K _d (^ec ^-1 ) CD (10' ⁹ M) T ^1/2 (min) Isotype control dt-IgGl 1.74E+05 7.48Е-04 4.3 15 Isotype control .u-lgG4 СРРС 1.71E+05 2.36E-03 13.9 5 Ab 1 NS NS NS NS AB 2 NS NS NS NS

HC: No binding detected.

As the results in Table. 14, bispecific antibody 1 and antibody 2 show no binding to human FcyRI compared to antibodies having the wild-type (wt) CH region of hIgG1 or hIgG4-CPPC in SPR analysis. The chimeric heavy chain bispecific antibodies of the invention also show weak or no binding to several low affinity human FcRy receptors (e.g. weak binding to FcRyIIA, FcRyIIB and no detectable binding to human FcRyI, FcRyIIIA or FcRyIIIB) compared to Fc antibodies. -sequence dt hIgG1 or hIgG4-CPRS Fc (Table 15).

Table 15 Equilibrium binding at steady state for antibodies with wild-type heavy chains (wt) and chimeric heavy chains

Binding to His-captured low-affinity human FcyR receptors at 25°C Exploring th antibody Kd values (10' ^b M) for low affinity FcyR binding to antibodies containing chimeric heavy chains people hFcyRII A (H131) people FcyRIIA (R131) FcyRIIA java. toque people FcyRIIB FcyRIIB java. toque people FcyRIIIA(VI76) people FcyRIIIA (Fl 7 6) FcyRIIIA java. toque people FcyRIIIB Isotype. aTlgGI control 1.1 2 4.2 2 4.2 1.5 1.3 0.6 2.3 Isotype. aHgG4 control (SRPC) 12 10 19.3 9.8 9.6 10 26 5.8 NS Ab 1 12 19.3 23.1 123 13.9 NS NS 66.3 NS AB 2 11.7 20.5 23.5 233 14.6 NS NS 42.4 NS

HC: No binding detected.

Example 9 Pharmacokinetic profile of chimeric antibodies.

The toxicokinetic profile of Antibody 1 and Antibody 2 was assessed by obtaining blood samples from male cynomolgus monkeys (3 animals/treatment group) receiving one 30 minute IV infusion followed by a 12 week observation period. Blood samples for toxicokinetic analysis of total drug concentration were taken before dosing and after dosing at 5 minutes, 5, 24, 48, 72 and 168 hours and 14, 21, 35, 49, 66 and 84 days. The resulting serum samples were analyzed by direct enzyme immunosorbent assay (ELISA) to determine the total concentration of Ab1 or Ab2 preparation. The toxicokinetics of the test antibodies were evaluated by a non-compartmental assay (Phoenix WinNonLin) to determine pharmacokinetic parameters. The results are shown in table. 16 (AUC = area under the concentration-time curve; C _max = observed maximum serum concentration).

Table 16 Pharmacokinetic profile of chimeric antibodies in cynomolgus monkey serum after a single intravenous infusion in cynomolgus monkeys

Parameter Units 1 mg/kg AB 2 1 mg/kg Ab 1 Average SO Average SO Smake mcg/ml 33.4 3.79 26.0 4.72 C max/Dose a kg*mcg/ml/mg 33.4 3.79 26.0 4.72 1max day 0.0243 0 0.0243 0 ΠΠΚθ-168 h day.mcg/ml 100 20.1 61.1 8.04 ΠΠΚθ-168 h/dose day* kg* mcg/ml/mg 100 20.1 61.1 8.04 Т1/2 Day 8.14 1.15 14.0 2.64

Following a single intravenous dose of 1.0 mg/kg of Ab1 and Ab2, cynomolgus monkeys experienced mean peak concentrations ( _Cmax ) of 33.4 and 26.0 µg/mL, respectively, and AUC values of _{0-168 h} at 100 and 61.1 days -µg/ml, respectively. The estimated apparent terminal half-life of these two molecules was 8.14-14.0 days. These data indicate that continuous exposure to Ab1 and Ab2 was maintained in all animals for most of the 12 week observation period and that exposure was comparable across all treatment groups. No apparent immunogenicity was observed for the antibodies tested. The overall pharmacokinetic profiles of Ab1 and Ab2 are typical of monoclonal antibodies when dosing cynomolgus monkeys.

Example 10 CD3xCD20 bispecific antibodies can reduce the number of CD20+ B cells in cynomolgus monkeys at lower doses than a monospecific antibody.

To determine the in vivo efficacy of administration of CD3xCD20 bispecific antibody 1 and control antibody 4, the change in CD20+ B cell levels in the peripheral blood of cynomolgus monkeys following administration of anti-CD3xCD20 bispecific antibody compared with monospecific anti-CD20 antibody (control Ab3) was examined by FACS. The study was carried out on male cynomolgus monkeys (Macaca fascicularis) divided into 8 dosing groups of 3 animals per dosing group, as follows:

Group 1 received placebo (control stock solution administration);

Group 2 received a monospecific antibody (control Ab3; rituxan) at 30 mg/kg (30 mg/kg in monkeys is equivalent to a human dose of 375 mg/m ² which is considered the maximum clinical dose);

Group 3 received the CD3xCD20 bispecific control antibody 4 at 0.01 mg/kg;

Group 4 - antibody 4 at 0.1 mg/kg;

Group 5 - antibody 4 at 1 mg/kg;

Group 6 - antibody 1 at 0.01 mg/kg;

Group 7 - antibody 1 at 0.1 mg/kg;

Group 8 - antibody 1 at 1 mg/kg.

Blood was taken at day -7 and day -4 before dosing the animals. Doses of antibody preparations or stock solution (placebo) were administered by iv. infusions and blood draws 2, 4 and 7 days after dosing. Blood samples were analyzed by FACS for markers of B cells (CD20; Table 17) and T cells (CD3, see below) and the absolute number of these cell types was determined.

Briefly, 100 µl of blood was incubated with 1.5 ml of RBC lysis buffer in Eppendorf tubes for 3 min. Cells were centrifuged for 5 min at 0.4xg, washed 2x with FACS solution (PBS + 3% PBS) and blocked for 10 min at room temperature with Fc blocking reagent. Cells were then incubated for 30 min at 4°C with antibodies directly conjugated to hCD45 and CD20 fluorescent reagents. B cell subsets (CD20) or T cell subsets (CD3) were quantitated first by a heterogeneous gating strategy of CD45 fluorescent staining and lateral expansion pattern (SSC) demarcation (CD45brightSSCdim) to isolate white blood cell (BCT) populations. B cell populations were then determined using the relevant fluorescently labeled antibodies (CD20 APC-Cy7).

After staining, cells were washed twice before obtaining FACS data on a cytometer.

FACSCanto and analyzed using FlowJo software. The results are shown in table. 17 and in FIG. 11A and 11B.

Table 17

Number of circulating CD45-, CD20-positive cells in peripheral blood of monkeys after treatment

CD20+ cells (U/µl) on the day of the study Treatment Animal, -7 -4 2 4 7 Ш№ placebo 78 1.87 2.69 1.85 2.09 1.62 79 1.28 1.31 0.98 1.24 0.98 80 2.41 2.90 2.23 2.71 1.78 Control AB 3 81 0.71 0.80 0.00 0.00 0.00 82 0.97 2.49 0.00 0.00 0.00 83 0.71 1.28 0.00 0.00 0.00 CD3xCD20-a _T Fc (Ab 4) 0.01 mg/kg 84 2.00 2.82 0.03 0.02 0.03 85 1.23 1.96 0.00 0.00 0.00 88 1.50 2.29 0.01 0.00 0.00 CD3xCD20-a _T Fc (Ab 4) 0.1 mg/kg 87 0.79 1.20 0.00 0.00 0.00 88 1.72 3.05 0.00 0.00 0.00 89 0.28 0.60 0.00 0.00 0.00 CD3xCD20-a _T Fc (Ab 4) 1 mg/kg 90 0.63 1.02 0.00 0.00 0.00 91 0.66 0.65 0.00 0.00 0.00 92 0.56 1.50 0.00 0.00 0.00 Ab 1 0.01 mg/kg 93 1D6 1.96 0.00 0.00 0.00 94 0.72 1.49 0.00 0.04 0.00 95 1.95 1.94 0.02 0.02 0.01 Ab 1 0.1 mg/kg 96 0.48 0.60 0.00 0.00 0.00 97 1.30 1.82 0.00 0.00 0.00 98 4.87 5.00 0.00 0.00 0.00 Ab 1 1 mg/kg 99 0.23 0.34 0.00 0.00 0.00 00 1.39 1.93 0.00 0.00 0.00 01 2.29 2.30 0.00 0.00 0.00

As shown in Table. 17 and in FIG. 11A, administration of CD3xCD20 bispecific antibodies and anti-CD20 monospecific antibody resulted in a decrease in the number of circulating B cells to baseline at the first time point measured (day 2). Such a decrease was not observed in the placebo control animals. The reduced number of B cells in the bispecific groups persisted for 1 week after the 1 mg/kg dosing of the bispecific antibodies, and also the reduced number of B cells persisted in the bispecific groups treated with doses of 0.01 and 0.10 mg/kg.

Also in this experiment, T-cell (CD3+) levels were monitored with fluorescently labeled anti-CD3 antibodies. A transient decrease in T cell numbers was observed on day 2 post dosing in the bispecific antibody groups (Ab4 and Ab1; all doses). No decrease in T cells (below baseline) was observed in the stock solution control group (placebo) or the Ab3 control group (rituxan) at the time points measured. T cell levels returned to baseline in the bispecific antibody groups on day 4 and remained at baseline until the end of the experiment (see FIG. 11B).

In vivo potency of the CD3xCD20 bispecific antibodies, Antibody 1 and Antibody 4, was determined in the peripheral blood of cynomolgus monkeys in a long-term study (3 months) by measuring the change in levels of CD20+ B cells or CD3+ T cells similarly to the study described above. Placebo (stock solution) or bispecific antibodies were administered at 1.0 mg/kg on day 0. Peripheral B cell levels were significantly reduced by day 2 in both bispecific antibody groups and remained reduced throughout the study in all samples beyond excluding placebo (see Fig. 12A). A transient decrease in T cells was observed on day 2 in the bispecific groups, then T cells recovered to baseline on day 4 and remained at approximately baseline throughout the study (>80 days) in animals treated with bispecific antibodies (Fig. 12B). ). A decrease in the number of T cells was not observed in animals treated with placebo. To further evaluate the in vivo CD3xCD20 of bispecific antibody 1 and antibody 4 at low doses, the change in CD20+ B cells or CD3+ T cells in the peripheral blood of cynomolgus monkeys in a long-term study (2 months) was determined, similar to the experiments described above. Bispecific antibodies were administered at 0.01 or 0.001 mg/kg (1 μg/kg) on day 0. Peripheral blood B cell levels were significantly reduced by day 2 and remained reduced into

- 50 042263 throughout the study for both groups of CD3xCD20 (Fig. 13A), which is similar to the pattern observed for animals treated with higher doses of CD3xCD20 bispecific antibodies (as seen in table. 17 and in Fig. 11A or 12A). Animals treated with very low doses (1 μg/kg) of the bispecific antibodies showed the same transient decrease in T cell numbers and recovery as observed in animals treated with higher doses of CD3xCD20 bispecific antibodies (see Fig. 13B vs. Fig. 11B). or 12V). The decrease in the number of B cells observed in the described studies correlated with a decrease in the levels of circulating antibodies in the peripheral blood of animals treated with CD3χCD20-chimeric Fc antibody 1 (see Fig. 14). As the presence of antibodies in the animal circulatory system decreased over time, the B cell population began to recover (eg, as observed at day 81 in animal no. 106881).

A correlation of a decrease in the number of B cells with a decrease in the number of circulating antibodies in the peripheral blood was also observed in animals treated with CD3χCD20-chimeric Fc antibody 2 (see Fig. 15), when the presence of antibodies in the animal circulatory system decreased over time, the B cell population began recover, for example, as observed at day 66 in animal #106876 and at day 68 in animal #106877. A similar correlation was also observed in animals treated with the CD3χCD20-dt Fc (Ab4) bispecific antibody (see FIG. 16). As the presence of antibodies in the animal circulatory system decreased over time, the B cell population began to recover (see FIG. 16, for example, as observed at day 91 in animal #106870 and at day 64 in animal #106872).

Example 11 CD3xCD20 bispecific antibodies can reduce the number of CD20+ B cells in lymphoid tissues of cynomolgus monkeys at lower doses than a monospecific antibody.

Changes in levels of CD20+ B cells in lymphoid tissues of cynomolgus monkeys were studied by FACS after administration of an anti-CD3χCD20 bispecific antibody (antibody 1 or antibody 4) compared with a monospecific anti-CD20 antibody (control Ab3 - rituxan). The study was performed on male cynomolgus monkeys (Macaca fascicularis) divided into 8 dosing groups of 3 animals per dosing group, similarly to groups 1-8 described above in example 10. Doses of antibody preparations or stock solution were administered by i.v. infusion, and the animals were sacrificed and collected tissues 7 days after dosing. Tissue samples were analyzed by FACS for white blood cells (CD45+) and in particular for B cell markers (CD20+), then the % B cell volume was determined.

B cell populations were determined using relevant fluorescently labeled antibodies (CD20 APC-Cy7) and FACS data acquisition in a similar manner to that described in Example 10 above. The results are shown in Table 1. 18 and in FIG. 17A and 17B.

Table 18

Percentage of CD20-positive cells in mesenteric lymph nodes and spleen after treatment

mesenteric lymph nodes Spleen Treatment Animal, ID no. Day 7 Day 7 placebo 78 38.14 63.22 79 38.57 62.79 80 37.36 49.17 Control AB 3 30 mg/kg 81 6.21 4.5 82 10.3 3.45 83 4.21 2.18 AB 4 0.01 mg/kg 84 13.43 3.14 85 6.88 2.27 86 10.78 1.39 AB 4 0.1 mg/kg 87 1.51 2.37 88 0.45 1.65 89 1.24 2.4 AB 4 1 mg/kg 90 0.63 0.97 91 0.62 1.93 92 1.08 1.22 AB 1 0.01 mg/kg 93 5.38 1.22 94 6.37 1.89 95 13.25 6.99 AB 1 0.1 mg/kg 96 0.43 1.55 97 0.68 1.75 98 2.36 2.97 AB 1 1 mg/kg 99 0.33 1.79 00 1.6 1.71 01 0.5 1.21

- 51 042263

As shown in Table. 18 and in FIG. 17A, administration of CD3xCD20 bispecific antibodies compared with anti-CD20 monospecific antibody resulted in a decrease in the number of tissue B cells in the spleen at much lower doses (0.01 to 1.0 mg/kg doses) in the bispecific groups. Such a decrease was not observed in the placebo control animals.

As shown in Table. 18 and in FIG. 17B, administration of CD3xCD20 bispecific antibodies compared with anti-CD20 monospecific antibody resulted in a decrease in tissue B cells in mesenteric lymph nodes at much lower doses (0.01 to 1.0 mg/kg doses) in bispecific groups, with In this case, the bispecific antibody doses of 0.1 and 1 mg/kg resulted in a more effective reduction in the number of B cells than that observed in the monospecific group. Such a decrease was not observed in the placebo control group of animals. After CD20 immunohistochemical staining (data not shown), residual B cells were recorded in the lymph nodes monospecifically (Rituxan®, 30 mg/kg) of the treated group. Tissues collected from groups treated with doses of 0.1 to 1.0 mg/kg of the bispecific anti-CD3χCD20 antibody showed no residual B cells. These data demonstrate that Ab1 and Ab4 have a greater degree of B cell killing than Ab3.

Example 12 Treatment of CD3xCD20 tumors with a bispecific antibody.

A. Treatment of CD20xCD3 with a bispecific antibody suppresses the growth of Raji tumors in NSG mice.

To evaluate the efficacy of selected anti-CD3χCD20 bispecific antibodies in reducing the growth of Raji tumors, NSG mice (NOD/LtSz-scid/IL2Ry ^nuU mice) purchased from Jackson Laboratories (Bar Harbor, Maine, USA) were subcutaneously co-implanted with 2x10 ⁶ Raji tumor cells and 5x105 human PBMCs (day 0). On the same day, mice were treated with an intraperitoneal dose of 0.4, 0.04, or 0.004 mg/kg per mouse (N=5 mice per treatment group) of antibody 1 or control antibody 5 (anti-irrelevant target IgG1 antibody), or control stock solution. Starting on day 0, mice were treated twice a week with an intraperitoneal dose of drug or stock solution until the end of the study. The size of the tumors was measured twice a week using calipers, and the volume of the tumors was calculated as: Volume = (length x width ² )/2. Statistical analysis was performed using GraphPad Prism 5.0 software (Macintosh Version). Statistical significance was determined by two-way ANOVA using Tukey's multiple comparison test. Data for each sample were compared for treatment groups. A threshold value of p<0.05 was considered statistically significant.

The results are shown in FIG. 7A-7F. These results indicate that Antibody 1 (CD3xCD20 chimeric Fc) targets Raji tumors in mice co-implanted with human immune cells resulting in complete suppression of tumor growth at the doses studied (Fig. 7C: 0.4 mg/kg Ab1; Fig. Fig. 7E: 0.04 mg/kg Ab1, Fig. 7F: 0.004 mg/kg Ab1). This example demonstrates that treatment of CD3xCD20 with bispecific antibody 1 was effective in inhibiting tumor growth from the time of tumor implantation. Complete suppression of the growth of Raji tumors was maintained up to 23 days post-implantation in mice treated with 0.4, 0.04, or 0.004 mg/kg of antibody 1 compared to controls. It was also observed that neither antibody 1 nor the control antibody had a significant effect on the body weight of the mice during the study (data not shown).

The antitumor activity of the CD3xCD20 bispecific antibodies was further investigated in a similar NSG mouse model (as described above), with each NSG mouse dosed with 1 mg mouse IgG (mIgG2a Fc) on day -1 and once a week thereafter. The results are shown in FIG. 8A, 8B.

This experiment demonstrates that treatment of CD3xCD20 with bispecific antibody 1 (CD3xCD20-chimeric Fc) or CD3xCD20 with bispecific antibody 4 (CD3xCD20-dt Fc) was effective in inhibiting tumor growth from the time of tumor implantation at the studied doses of the bispecific Ab in the presence of circulating IgG ( Fig. 8A, 8B). As seen in FIG. 8A, antibody 1 (CD3χCD20 chimeric Fc bispecific antibody) demonstrated complete suppression of tumor growth during the study period without IgG supplementation in this experiment.

B. Treatment of CD20xCD3 with a bispecific antibody reduces the size of developed tumors in NSG Mice mice.

The effectiveness of selected anti-CD3xCD20 bispecific antibodies in reducing the size of developed tumors in NSG mice was evaluated. NSG mice (NOD/LtSz-scid/IL2Ry ^nun mice) were purchased from Jackson Laboratories (Bar Harbor, Maine, USA) and coimplanted subcutaneously with HLA-compatible Raji tumor cells (2x 10 ⁶ ) and human PBMCs (5x105) (day -15) . Tumors were allowed to develop in hosts for 15 days prior to treatment. One day prior to drug administration (day -1), each mouse was additionally dosed with 5 mg mIgG2a Fc. Mice were dosed subcutaneously with mIgG2a Fc at a dose of 5 mg per mouse once a week during the experiment (day 7, day 14, etc.). Before drug administration, mice were divided into two experimental groups according to the size of the tumors:

- 52 042263

Group 1: ~200-400 ^mm3 or

Group 2: ~500-900 mm ³ .

Following drug treatment, tumor size was monitored and recorded for each mouse at days 0, 3, 6, 10, 14, 17, 21 and 28. The size of the tumors was measured twice a week using calipers, and the volume of the tumors was calculated as: Volume = (length x width ² )/2. The presence of tumors was also determined by palpation. Statistical analysis was performed using GraphPad Prism 5.0 software (Macintosh Version). Data for each sample were compared for treatment groups. The results are shown in FIG. 9 and 10.

a) Group 1: ~200-400 mm ³ tumors. Starting on day 0, several groups of 4 and 5 mice each were treated with the indicated dose of drug or stock solution once a week (i.e. day 7, day 14, etc.) as follows:

i) control: stock solution only;

ii) control antibody 5, 0.4 mg/kg;

iii) antibody 1 (CD20xCD3 chimeric Fc), 0.4 mg/kg.

b) Group 2: ~500-900 mm ³ tumors. Starting from day 0, several groups of 4 mice each were treated with the indicated dose of drug once a week (i.e. day 7, day 14, etc.) as follows:

i) control antibody 5, 0.4 mg/kg;

ii) antibody 1 (CD20xCD3 chimeric Fc), 0.4 mg/kg.

Tumors completely regressed in the 0.4 mg/kg antibody 1 (CD20xCD3 chimeric Fc) group after 14 days. See fig. 9.

In a model with larger advanced tumors (i.e. Group 2, ~500-900 mm ³ ), treatment with antibody 1 (CD20xCD3-chimeric Fc) (0.4 mg/kg) resulted in complete ablation of observed tumors in mice after 21 days . See fig. 10, which demonstrates the efficacy of Ab1 in treating mice with voluminous lymphoma masses (i.e., tumors positive for CD20 expression) greater than 0.5 and up to 0.9 cm in volume.

Example 13 CD3xCD20 bispecific antibodies induce PBMC proliferation in vitro.

The ability of the selected anti-CD3χCD20 bispecific antibodies and control constructs to stimulate peripheral blood mononuclear cells (PBMCs) and induce proliferation was assessed using an ATP-catalyzed assay (CellTiter Glo®). Activation of PBMCs results in the release of cytokines that stimulate cell proliferation.

Proliferation data were obtained using the following protocol.

Human or cynomolgus monkey-derived PBMCs (5 x 105/well) were incubated with serial dilutions of CD3xCD20 bispecific antibody or control antibody and commercial anti-CD28 antibody (human: 200 ng/ml, cynomolgus: 500 ng/ml) for 72 h at 37 °C. Cells were quantified using a Cell Titer Glo® and luminescence as cell viability data was measured using a VICTOR X5 multi-label plate reader (PerkinElmer) to detect live cells. Cell viability (induction ratio of stimulated and unstimulated cells) was determined by dividing the luminescence data for stimulated cells by the baseline luminescence for unstimulated cells and plotted using the Prism software. The results are summarized in table. 19 and in FIG. 18A and 18B.

Table 19

EC ₅₀ for human or cynomolgus PBMC proliferation induced by anti-CD3χCD20 bispecific antibodies

Antibody ECso [M] for human PBMC proliferation ECso [M] for cynomolgus monkey PBMC proliferation Control AB 5 ON ON SOPxCO20-dt Fc (Ab 4) 8.427E-12 3.325E-11 Antibody 1 1.163E-10 1.275E-11

Data represent median values for three or more independent analyses.

ON: no activity.

As shown in Table. 19 and in FIG. 18A, 18B, both CD20xCD3 bispecific antibodies of the invention induced human or cynomolgus PBMC proliferation. Antibody 1 induced human or cynomolgus PBMC proliferation with approximately the same efficiency. Control Ab5 showed no activity.

Example 14 CD20xCD3 bispecific antibodies mediate cell killing by activated T cells in vitro.

Human or cynomolgus PBMCs were isolated using Ficoll-Paque or using Lympholyte Mammal cell separation medium, respectively. Isolated PBMCs (1 x 10 ⁶ cells/ml PBMCs

- 53 042263 human or 5x10 ⁶ cells/ml cynomolgus monkey PBMC) were activated for 7 and 21 days respectively in complete medium (RPMI supplemented with 10% PBS, 100 U/ml penicillin, 100 μg/ml streptomycin, 292 μg/ml L -glutamine) containing recombinant human IL-2 (30 U/ml for human PBMC, 100 U/ml for cynomolgus PBMC) and activation T-cell granules (anti-POP/CO28 for human PBMC, aHTH-CD2/CD3/ CD28 for cynomolgus monkey PBMC). CO20-expressing Raji cells (2x10 ⁶ cells/ml) were labeled with 8 μM calcein-AM for 30 min at 37°C and washed 3 times with medium. Calcein-labeled target cells (10,000-20,000 cells/well) were plated in 200 µl of activated T cells (effector/target ratio 10:1) and serial dilutions of antibody 1, AL4 or control AL5 (human concentration range: 2 to 0.00003 nM; concentration range for cynomolgus monkey: 6.6 nM to 0.002 pM) in complete medium for 2 hours at 37°C. After incubation, the plates were centrifuged and the supernatants were transferred to a translucent black plate with a transparent bottom for fluorescent analysis. Percent cytotoxicity was calculated using the equation: % cytotoxicity = ((F _s -F _sr )/(F _mr -F _sr ))x 100%, where F _s is the release of calcein from the test well, F _SR is the spontaneous release of calcein, and F _MR - maximum release of calcein from cells lysed with Triton-X.

EC ₅ o for cell viability (ATP-catalyzed quantitation) was determined using Prism software. Cell lysis (cytotoxicity) was determined by the release of calcein as a fraction of the maximum release. The percentage of cellular cytotoxicity was calculated as the ratio of the observed release to the maximum release and the EC ₅₀ values were determined. The results are shown in table. 20 and in FIG. 19A (human T cells) and 19B (monkey T cells).

Table 20

EC ₅ o values for SP3xSP20-induced cytotoxicity against Raji cells

Antibody Raji [Ml Raji [Ml Control AB 5 ON NO SOPxCO20-dt Fc (Ab 1,571 E-11 1,730E-12 4) Antibody 1 2.503E-11 9.104E-12

ON: no activity;

NT: Not explored.

As shown in Table. 20, Antibody 1 mediated targeted cell killing with typical EC ₅ o values of 25.0 and 9.1 pM for human (FIG. 19A) and cynomolgus monkey (FIG. 19B) T cells, respectively. Antibody 4 mediated targeted cell killing with typical EC ₅ o values of 15.7 and 1.73 pM for human (FIG. 19A) and cynomolgus monkey (FIG. 19B) T cells, respectively. No activity was observed for the control antibody.

To monitor the specific killing of CO20-bearing target cells by flow cytometry, parental B16F10.9 mouse myeloma cells (which do not express CD20) and B16F10.9 cells engineered to stably express human CD20 (B16F10.9/CD20) were labeled 1 μM fluorescent tracking dye carboxyfluorescein diacetate succinimidyl ether (CFDA-SE) and Violet Cell Tracker, respectively. After labeling, the cells were mixed in a 1:1 ratio and seeded overnight at 37°C. Separately, human MCGI were seeded in RPMI supplemented medium at 1 x 10 ⁶ cells/ml and incubated overnight at 37°C to enrich for lymphocytes by reducing adherent macrophages, dendritic cells and some monocytes. The next day, target cells were co-incubated with adherent cell-free naïve PBMCs (effector/target ratio 4:1) and serial dilutions of test CD3xCD20 bispecific antibodies or IgGl control antibody 5 (concentration range: 66.7 nM to 0.25 pM ) for 48 hours at 37°C. Cells were removed from cell culture plates with enzyme-free cell dissociation buffer and analyzed by FACS. For FACS analysis, cells were stained with live/non-live far red cell tracker (Invitrogen). To evaluate the specificity of killing, cell gating was performed on live labeled Violet and CFDA-SE populations. The percentage of each population was used to calculate the reported survival value as follows: Adjusted survival value = (Rl/R2)xl00 where R1 = [(B16P10.9/SP20)/foreign cells (B16F10.9)] x 100 in the absence of antibody, and R2 = same ratio but in the presence of antibody.

-54042263

Table 21

EC50 values for target-specific killing in B16F10.9/CD20 cells

Antibody % surviving B16F10.9/CD20 cells [M] Control AB 5 ON SPZxCO20-dt Fc (Ab 4) 1.282E-11 Antibody 1 1,952E-11

ON: no activity.

Both CD3χCD20 chimeric Fc (antibody 1) and CD3χCD20-gt Fc (antibody 4) specifically targeted human T cells to kill only CD20-expressing target cells (FIGS. 20A, 20B) in a mixed cell population. Killing of target cells was observed only in the presence of the bispecific antibody with a dose dependent reduction in B16F10.9/CD20 cells due to antibody 1 (EC50 19.5 pM) and antibody 4 (EC50 12.8 uM) (FIG. 20B). Less than 5% of CD20-expressing cells remained alive at the highest dose studied (10 μg/ml) (FIG. 20B). No signs of cell death were observed in the B16F10.9 parent cell population or in the B16F10.9/CD20 population with control Ab5, an IgG1 control antibody.

Example 15 The CD3xCD20 bispecific antibody is characterized by upregulation of early markers of CD69 activation on T cells in a 20 hour in vitro FACS assay.

CD69+ is one of the earliest inducible cell surface markers indicative of T cell activation. T cell activation can be determined by examining the upregulation of specific cell surface markers such as CD69.

The ability of the CD3xCD20 bispecific antibody to upregulate the early activation marker CD69 on human or cynomolgus monkey T cells in whole blood was determined in a 20 hour in vitro FACS assay. Briefly, T cell activation was assessed by incubating freshly obtained human or cynomolgus whole blood (100 µl) in 96-well flat bottom plates with 5-fold (human) or 10-fold (cynomolgus) serial dilutions of Antibody 1, Antibody 4 or control Ab5 (concentration range 50 to 0.0006 nM) in RPMI + L-glutamate in a final volume of 200 μl for 20 h at 37°C. After incubation, the plates were centrifuged for 5 min at 1000 rpm and the plasma was removed. To determine the presence of CD69 upregulation on T cells, a phenotyping cocktail containing directly conjugated antibodies to CD2 and CD69, as well as CD45, CD4, CD8, and either CD19 (human) or CD16 (cynomolgus monkey) was added directly to the blood for 30 min. at 4°C. Red blood cells were lysed for 15 min in 1.5 ml PharmLyse buffer following the manufacturer's instructions. Cells were washed twice, resuspended in 200 μl of cold PBS + 1% PBS and analyzed by flow cytometry using a BD FACSCanto cytometer. CD4 ⁺ T cells were detected by first gating on viable CD45+ small lymphocytes and then gating on ^CD19- /CD2 ⁺ /CD4 ⁺ T-cells (human) or ^CD16- /CD2 ⁺ /CD4 ⁺ T-cells (cynomolgus monkey) .

The percentage of activated T cells (CD69 ⁺ ) of the total number of CD2 ⁺ effector cells is shown. See table. 22 as well as FIG. 21. The results show that CD3xCD20 bispecific antibodies significantly activate T cells, as evidenced by the presence of an early marker of CD69 activation.

Table 22

EC ₅₀ values for target-specific killing in B16F10.9/CD20 cells

Antibody % activated T cells (CD69+) [Ml Control AB 5 ON SOPxCO20-dt Fc (Ab 4) 7.907E-11 SOPxCO20-chimeric Fc(antibody 1) 1,560E-11

ON: no activity.

Example 16 CD3xCD20 bispecific antibodies induce clustering of T cells with target cells.

The cell clustering format was used to determine that a CD3xCD20 bispecific antibody binds T cells to target cells (CD20 ⁺ cells) via its bispecific binding arms. Effector cells were pre-stained with CFSE and CD20+ cells were pre-stained with Violet Cell Tracker for 24 h and gated in separate quadrants after incubation with an irrelevant control antibody (control antibody 5, an irrelevant IgG1 isotype antibody). See fig. 22A, which shows the absence of clustering (double staining) in the cell mixture when treated with an irrelevant antibody. After incubation with CD3xCD20

- 55 042263 cell clusters were manifested by the bispecific antibody, as they are stained with both CFSE and

Violet (see Fig. 22B, top left quadrant of the scatter plot, bold square area).

Example 17 Expression of inhibitory markers Tim-3 and PD-1 on CD3+ cells.

In tumor-bearing host organisms, T cell dysfunction or depletion occurs. The Tim-3 and PD-1 receptors have been identified as markers of T cell depletion in chronic disease states. According to Sakuishi, K. et al. (J. Exp. Med. 207(10):2187-2194, 2010), tumor infiltrating lymphocytes (TIL) positive for Tim-3 and PD-1 (Tim-3+PD-1+TIL) correspond to the most severe wasting phenotype, defined by the inability to proliferate and produce IL-2, TNF and IFN-γ.

CD3-positive cells were isolated from the blood and tumors of NSG mice coimplanted subcutaneously with HLA-compatible Raji tumor cells and human PBMCs, see example 12B, above. Briefly, tumors were allowed to develop in the hosts for 15 days prior to treatment, then the mice were divided into two treatment groups according to the size of the tumors (see Example 12B). Blood was taken from treated (bispecific Ab) and untreated mice on day 9 in each study group, ie. group 1, ~200-400 mm ³ or group 2, ~500-900 mm ³ . Untreated mice (stock solution or control Ab) having tumors reaching 1500 mm ³ were sacrificed at the end of the study and these tumors were examined for PD1 and Tim-3 expression.

For circulating T cell experiments, viable CD45+CD3+ T cell fractions were selected for marker determination using directly labeled anti-Tim-3 or PD-1 antibodies (commercially available from Biolegend). Tim-3+PD-1+ cells constituted the major fraction of circulating T cells in the blood of untreated animals. At the same time, T-cells in the blood of animals treated with CD20xCD3 bispecific antibody (Ab1) showed smaller fractions of Tim-3+PD-1+ cells.

Tumor cells from untreated host mice were separated and stained for viability. FACS analysis was performed on viable single cells to sort out CD45+CD3+ cell fractions that were examined for Tim-3 or PD-1 expression.

The inventors found that the inhibitory Tim-3 and PD-1 receptors were expressed on CD3 ⁺ TIL in NSG B-cell lymphomas of untreated mice during the experiments described in Example 12B, and Tim-3+PD-1+ cells constituted the major fraction of T tumor-infiltrating cells.

Example 18 Treatment with CD3xCD20 bispecific antibody is more effective than anti-CD20 ⁺ antibody in NSG mice with advanced Raji tumors.

The efficacy of selected anti-CD3xCD20 bispecific antibodies in reducing tumor size in NSG mice was evaluated. NSG mice (NOD/LtSz-scid/IL2Rynull mice; Jackson Laboratories) were subcutaneously co-implanted with Raji tumor cells (2x10 ⁶ ) and human PBMCs (5x105) (day -14) (similar to example 12B, above). CD20xCD3 bispecific Ab1 (dosed at 0.4 mg/kg; 2x/week, ip) was comparable to CD19xCD3 BiTE (dosed at 0.5 mg/kg; 5x/week, i.v.) (Fig. 23 ) and was superior to rituximab therapy (dosed at 8 mg/kg; 5x/week, ip) (Fig. 24) in suppressing advanced Raji tumors, thereby demonstrating that Ab1 was effective in treating mammals with large lymphoma masses in excess of volume is 0.5 cm.

Example 19 Treatment of CD20+ melanoma with CD3xCD20 bispecific antibody.

Researchers have determined that certain subpopulations of melanoma cancer in patients, such as CD20+ melanoma tumor cells, may have tumor-initiating characteristics and an increased risk of disease recurrence (Pinc et al. Mol. Ther. 20(5):1056-1062, 2012, epub Feb 21, 2012). The CD20xCD3 bispecific antibody Ab1 showed potential activity against CD20-expressing B16F10.9 tumor cells, as it significantly retarded the growth of hCD20-transduced B16F10.9 (B16F10.9/CD20) tumors in immunocompetent mice. Mice humanized for CD3 (humanized CD3γε mice) were humanized at the CD20 locus such that the mice expressed both humanized proteins. Humanized CD3/CD20 mice were implanted subcutaneously with 2x105 B16F10.9 melanoma tumor cells (K. Peters/Charles Lin; Duke University) transduced with human CD20. Beginning on Day 0 (tumor transplantation day), mice were treated intraperitoneally with stock solution (PBS; n=5), 0.4mg/kg of control Ab5 (anti-irrelevant antigen control; n=5), 0.4mg intraperitoneally 2x/week. /kg Ab1 (N=5) or .004 mg/kg Ab1 (n=5). Tumor volumes were determined as indicated in FIG. 25A. Mice were sacrificed when the tumors reached a volume in excess of 1500 mm ³ . As shown in FIG. 25A, Ab1 treatment retarded tumor growth when treatment was started concurrently with tumor transplantation.

In a separate experiment, the ability of Ab1 to inhibit the growth of tumors in the case of already developed tumors was also investigated (Fig. 25B). Humanized CD3/CD20 mice were implanted subcutaneously with 2x105 B16F10.9 melanoma tumor cells expressing human CD20. On day 10 post tumor implantation, mice were randomized based on tumor size and distributed

- 56 042263 for the following treatment groups, 5 mice per group: stock solution (PBS), 4 mg/kg control Ab5 (control antibody to an irrelevant antigen), 4 mg/kg Ab1 or 0.4 mg/kg Ab1. All mice were treated i.b. 2 times per week. Mice were sacrificed when the tumors reached a volume in excess of 1500 mm ³ . As shown in FIG. 25B, Ab1 treatment retarded tumor growth in established tumors, demonstrating that Ab1 showed potential activity against CD20-expressing B16F10.9 melanoma cells.

The present invention is not limited by the scope of the specific embodiments described herein. Indeed, the existence of various modifications of the invention other than those described herein will become apparent to those skilled in the art upon examination of the foregoing description and the accompanying figures. Such modifications are within the scope of the appended claims.

Claims (16)

CLAIM 1. A bispecific antibody comprising a first antigen-binding domain that binds human CD3, a second antigen-binding domain that binds human CD20, and a chimeric heavy chain constant region associated with each of the first and second antigen-binding domains, wherein the first antigen-binding domain (A1), which specifically binds human CD3, contains three heavy chain complementarity determining regions (HCDR1, HCDR2, HCDR3) and three light chain complementarity determining regions (LCDR1, LCDR2, LCDR3), where: (i) A1-HCDR1 contains the amino acid sequence of SEQ ID NO: 12; (ii) A1-HCDR2 contains the amino acid sequence of SEQ ID NO: 14; (iii) A1-HCDR3 contains the amino acid sequence of SEQ ID NO: 16; (iv) A1-LCDR1 contains the amino acid sequence of SEQ ID NO: 20; (v) A1-LCDR2 contains the amino acid sequence of SEQ ID NO: 22; (vi) A1-LCDR3 contains the amino acid sequence of SEQ ID NO: 24; where the second antigen-binding domain (A2) that specifically binds human CD20 contains three heavy chain complementarity determining regions (HCDR1, HCDR2, HCDR3) and three light chain complementarity determining regions (LCDR1, LCDR2, LCDR3), where: (i) A2-HCDR1 contains the amino acid sequence of SEQ ID NO: 4; (ii) A2-HCDR2 contains the amino acid sequence of SEQ ID NO: 6; (iii) A2-HCDR3 contains the amino acid sequence of SEQ ID NO: 8; (iv) A2-LCDR1 contains the amino acid sequence of SEQ ID NO: 20; (v) A2-LCDR2 contains the amino acid sequence of SEQ ID NO: 22; (vi) A2-LCDR3 contains the amino acid sequence of SEQ ID NO: 24; where the chimeric heavy chain constant region contains: (i) the amino acid sequence of the upper hinge region of human IgG1 or human IgG4 from positions 216 to 227 (EU numbering); (ii) the amino acid sequence of the lower hinge region of human IgG2 PCPAPPVA (SEQ ID NO: 52) from positions 228 to 236 (EU numbering); (iii) human IgG1 CH1 domain and human IgG1 CH3 domain or human IgG4 CH1 domain and human IgG4 CH3 domain; (iv) the amino acid sequence of the CH2 domain of human IgG4 from positions 237 to 340 (EU numbering); and wherein the bispecific antibody exhibits higher binding affinity for human FcyRIIA compared to human FcyRIIB and exhibits little or no detectable binding affinity for human Fc-RIA and human FcyRIII as measured by surface plasmon resonance. 2. A bispecific antibody according to claim 1, characterized in that the bispecific antibody: (a) shows reduced antibody-dependent cellular cytotoxicity (ADCC) compared to an antibody containing a wild-type Fc domain, as measured by an in vitro cytotoxicity assay; (b) exhibits little or no detectable antibody-dependent cellular cytotoxicity (ADCC); (c) shows reduced complement-dependent cytotoxicity (CDC) compared to an antibody containing a wild-type Fc domain, as measured by an in vitro cytotoxicity assay; (d) shows less than 50% cytotoxicity according to cell lysis data obtained in an in vitro assay; (e) exhibits little or no detectable complement dependent cytotoxicity (CDC); (f) induces a reduction in T-cell mediated killing of cells bearing Fc receptors, such as NK cells or macrophages, as compared to an antibody containing an Fc domain - 57 042263 wild type; or (g) induces a reduction in T cell killing mediated by cells bearing Fc receptors such as NK cells or macrophages compared to an antibody containing a wild-type Fc domain. 3. A bispecific antibody according to claim 1 or 2, wherein the bispecific antibody contains: (a) the amino acid sequence of the chimeric hinge region EPKSCDKTHTCPPCPAPPVA (SEQ ID NO: 53) or (b) the amino acid sequence of the chimeric hinge region ESKYGPPCPPCPAPPVA (SEQ ID NO: 54). 4. A bispecific antibody according to any one of claims 1 to 3, characterized in that the first antigen-binding domain comprises a heavy chain variable region (HCVR) amino acid sequence comprising SEQ ID NO: 10 and a light chain variable region (LCVR) amino acid sequence comprising SEQ ID NO: 18. 5. A bispecific antibody according to any one of claims 1 to 4, characterized in that the second antigen-binding domain that specifically binds human CD20 comprises a heavy chain variable region (HCVR) amino acid sequence comprising SEQ ID NO: 2 and a variable region amino acid sequence light chain (LCVR) containing SEQ ID NO: 18. 6. A bispecific antibody according to any one of claims 1 to 5, characterized in that the bispecific antibody contains a chimeric Fc domain containing the amino acid sequence of SEQ ID NO: 26. 7. A bispecific antibody according to any one of claims 1 to 5, characterized in that the bispecific antibody contains a chimeric Fc domain containing the amino acid sequence of SEQ ID NO: 28. 8. A bispecific antibody according to any one of claims 1 to 5, characterized in that the bispecific antibody contains a chimeric Fc domain containing the amino acid sequence of SEQ ID NO: 30. 9. A bispecific antibody according to any one of claims 1 to 5, characterized in that the bispecific antibody contains a chimeric Fc domain containing the amino acid sequence of SEQ ID NO: 32. 10. A bispecific antibody according to any one of claims 1 to 5, wherein the bispecific antibody comprises a first heavy chain constant region comprising the amino acid sequence of SEQ ID NO: 26 and a second heavy chain constant region comprising the amino acid sequence of SEQ ID NO: 28 . 11. A bispecific antibody according to any one of claims 1 to 5, wherein the bispecific antibody comprises a first heavy chain constant region comprising the amino acid sequence of SEQ ID NO: 30 and a second heavy chain constant region comprising the amino acid sequence of SEQ ID NO: 32 . 12. A pharmaceutical composition for treating or reducing the severity of B-cell cancer in a subject, comprising a bispecific antibody according to any one of claims 1-11 and a pharmaceutically acceptable carrier or diluent. 13. The pharmaceutical composition of claim 12, wherein the B cell cancer is follicular lymphoma. 14. The pharmaceutical composition of claim 12, wherein the B cell cancer is diffuse large B cell lymphoma. 15. The pharmaceutical composition of claim 12 wherein the B cell cancer is mantle cell lymphoma. 16. The pharmaceutical composition of claim 12 wherein the B cell cancer is marginal zone lymphoma.