EA041936B1 - PHARMACEUTICAL COMPOSITION AND FOOD PRODUCT CONTAINING NEW LACTOBACILLUS FERMENTUM STRAINS - Google Patents

Description

Cross-reference to related applications

This application claims the benefit and priority of U.S. Provisional Application Serial No. 62/387474, filed December 24, 2015, which is hereby incorporated by reference in its entirety.

Sequence list

The present application contains a sequence listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The specified ASCII copy, created on December 23, 2016, is named UGD-001-Sequence-Listing.txt and is 1839 bytes in size.

State of the art

Lactic acid bacteria, including those of the genera Lactococcus, Lactobacillus, Streptococcus, Bifidobacterium, and Pediococcus, have long been used as fermenting agents for food preservation and for the preparation of a variety of food products from milk, such as cheese, yogurt, and other fermented dairy products. Recently, certain strains of lactic acid bacteria have been found to exhibit beneficial properties in humans and animals, including, for example, improved immune system function.

Despite the benefits achieved to date, there is still a need for additional strains of lactic acid bacteria to be used to improve immune system function.

The essence of the invention

The present disclosure relates to new strains of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060 and a bacterial preparation containing them, which can produce a biologically active fermented dairy product, in particular a product that modulates the immune system to improve health.

In one aspect, the present disclosure relates to a composition or edible product containing one or more Lactobacillus fermentum strains that have at least 80% to 100% genome sequence identity with Lactobacillus fermentum NRRL B-67059 strain and/or Lactobacillus fermentum NRRL B- strain. 67060. In embodiments, the present disclosure relates to a composition comprising one or more strains of Lactobacillus fermentum that have at least 80 to 100% sequence identity with the sequence of the 16S rRNA gene fragment of SEQ ID NO: 1 or SEQ ID NO: 2. For example, the composition contains a strain of Lactobacillus fermentum NRRL B-67059 and/or a strain of Lactobacillus fermentum NRRL B-67060.

In one aspect, the modulation of the immune system is the modulation of total IgA and the anti-inflammatory cytokine interleukin-10 (IL-10). In another aspect, the modulation of the immune system is the modulation of the pro-inflammatory cytokines interleukin-6 (IL-6) and interleukin-2 (IL-2). This biologically active fermented dairy product can be obtained to produce a functional food product. Another aspect relates to the isolation of biologically active fractions from this fermented dairy product and their addition to the food product as an integral component of the composition or as an integral component of a food supplement or pharmaceutical preparation.

Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, can be used to produce a biologically active fermented dairy product with a remarkable ability to modulate the immune system of humans or mammals. Such a biologically active fermented dairy product, or biologically active fractions isolated therefrom, provide a method for inducing, increasing or stimulating the secretion of cytokines such as interleukin-10 (IL-10) and immunoglobulin A (IgA) antibodies. On the other hand, such a biologically active fermented dairy product or active fractions thereof did not induce a pro-inflammatory response such as that exhibited by interleukin-2 (IL-2) or interleukin-6 (IL-6).

The biologically active fermented dairy product, or fractions isolated from it, described herein, are a viable option for modulating the immune system without the side effects produced by some drugs. In addition, such a biologically active fermented dairy product or fractions isolated from it induces an anti-inflammatory effect at the system level. Therefore, said strains of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, and biologically active compounds derived therefrom, can be used in pharmaceutical preparations as well as in food products.

The new strains of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, and biologically active products containing or derived from the new strains of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, can be administered to persons suffering from a deficiency in the immune system, and, in particular, a defect in cytokine secretion, in order to modulate and improve the functioning of their immune system and the secretion of cytokines.

Biologically active compounds can be formed under the action of new strains of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, during the fermentation of dairy substrates. One goal is to produce food products with biologically active compounds for

- 1 041936 obtaining functional food products as a result of the action of specific strains of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, on a food product substrate. In addition, these biologically active compounds can be used in an edible product such as a dietary supplement or as a pharmaceutical composition. New strains of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, can be concentrated in the resulting food products to provide increased efficiency.

Brief description of the figures

In FIG. 1 is a graph showing the growth of Lactobacillus fermentum NRRL B-67059 and NRRL B-67060 cells. Optical density (OD600) was measured after cells were incubated in base medium with mucin or glucose for 24 h. Values presented are mean values (n=3) and mean values for each value without a common letter are statistically significantly different (p<0.05 ).

In FIG. 2 is a graph showing lactic acid production in milk fermented with Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060 at the indicated time points. Values shown are mean values (n=3) and mean values for each value without a common letter are statistically significantly different (p<0.05).

In FIG. 3 is a graph showing the pH values of milk fermented with Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060 at the indicated time points. Values shown are mean values (n=3) and mean values for each value without a common letter are statistically significantly different (p<0.05).

In FIG. 4 is a graph showing proteolytic activity measured by absorbance at 340 nm in milk fermented with Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, at different incubation times. Values shown are mean values (n=3) and mean values for each value without a common letter are statistically significantly different (p<0.05).

In FIG. 5 is a graph showing the effect of oral administration of Lactobacillus fermentum fermented milk, NRRL B-67059 or NRRL B-67060, on the production of the anti-inflammatory cytokine IL-10 in rats. Values shown are mean values (n=6) and mean values for each value without a common letter are statistically significantly different (p<0.05).

In FIG. 6 is a graph showing the effect of oral administration of Lactobacillus fermentum fermented milk, NRRL B-67059 or NRRL B-67060, on the production of the anti-inflammatory cytokine IL-6 in rats. Values shown are mean values (n=6) and mean values for each value without a common letter are statistically significantly different (p<0.05).

Detailed description of the invention

The present disclosure relates in part to new strains of Lactobacillus fermentum, hereinafter referred to as NRRL B-67059 and NRRL B-67060. NRRL B-67059 and NRRL B-67060 were deposited on April 17, 2015 at the National Center for Agricultural Use Research of the United States Department of Agriculture.

In the sense in which NRRL B-67059 and NRRL B-67060 are used here, it is understood that they refer to deposited strains of Lactobacillus fermentum, as well as to progeny obtained by subculture of isolated strains or their mutants that retain the biological properties of the deposited strains of NRRL B -67059 and NRRL B-67060. In embodiments, the Lactobacillus fermentum of the present disclosure has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% genome sequence identity with deposited NRRL B-67059 and NRRL B-67060 . In embodiments, the Lactobacillus fermentum of the present disclosure has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the 16S rRNA gene fragment sequence of SEQ ID NO: 1 or SEQ ID NO: 2 respectively.

The following abbreviations are used in the present invention:

L. fermentum - Lactobacillus fermentum;

LAB - lactic acid bacteria;

CFU - colony forming units.

Compositions.

In one aspect, the present disclosure provides a composition comprising one or more Lactobacillus fermentum strains that have at least 80% to 100% genome sequence identity with Lactobacillus fermentum NRRL B-67059 strain and/or Lactobacillus fermentum NRRL B-67060 strain.

In embodiments, the present disclosure relates to a composition comprising one or more strains of Lactobacillus fermentum that have at least 80 to 100% sequence identity with the sequence of the 16S rRNA gene fragment of SEQ ID NO: 1 or SEQ ID NO: 2. For example, the composition contains a strain of Lactobacillus fermentum NRRL B-67059 and/or a strain of Lactobacillus fermentum NRRL B-67060. In embodiments, Lactobacillus fermentum strain NRRL B-67059 and/or Lactobacillus fermentum strain NRRL B-67060 is purified. In embodiments, the composition contains or may contain a biologically active substance, an additive, a filler, an emulsifier, a drug and/or a preservative.

- 2 041936

In some embodiments, the implementation of the composition of the present disclosure is in the form of a pharmaceutical composition or edible product. For example, the pharmaceutical composition is or may be in a solid dosage form, a semi-solid dosage form, or a liquid dosage form. In embodiments, the solid dosage form is or may be a tablet, lozenge, or capsule.

In embodiments, the tablet or capsule includes microtablets, minitablets, pellets, or granules containing the lyophilized powder of the strain. In embodiments, the semi-solid dosage form is a gel, cream, ointment, or chewable lozenge. In embodiments, the liquid form is or may be an emulsion or solution.

In embodiments, the composition or pharmaceutical composition of the present disclosure can be or is prepared for oral, rectal, or parenteral administration to a subject in need thereof.

In embodiments, the edible product of the present disclosure is a food product or nutritional supplement. The food product or food supplement contains or may contain a food carrier. The food or food supplement contains or may contain a dairy product.

In embodiments, the edible product of the present disclosure is a dairy product.

In embodiments, the edible product of the present disclosure is a beverage.

Edible products.

In one aspect, the present disclosure relates to an edible product or pharmaceutical composition comprising one or more Lactobacillus fermentum strains that have at least 80% to 100% genome sequence identity with Lactobacillus fermentum strain NRRL B-67059 and/or Lactobacillus fermentum strain NRRL B-67060. For example, the edible product and/or pharmaceutical composition contains the Lactobacillus fermentum NRRL B-67059 strain and/or the Lactobacillus fermentum NRRL B-67060 strain. In embodiments, the present disclosure relates to an edible product and/or pharmaceutical composition comprising one or more strains of Lactobacillus fermentum that have at least 80 to 100% sequence identity with the sequence of the 16S rRNA gene fragment of SEQ ID NO: 1 or SEQ ID NO : 2. In embodiments, Lactobacillus fermentum strain NRRL B-67059 and/or Lactobacillus fermentum strain NRRL B-67060 is purified.

In embodiments, the edible product or pharmaceutical composition actually contains or may contain a biologically active substance, additive, excipient, emulsifier, drug, and/or preservative. In some embodiments, the comestible product is a food or nutritional supplement. In some embodiments, the implementation of the food product or dietary supplement contains a food carrier. In some embodiments, the implementation of the food product or nutritional supplement contains a dairy product. In some embodiments, the edible product is obtained as a dairy product. In some embodiments, the comestible product is in the form of a beverage.

In addition, physiologically acceptable compositions containing strains of Lactobacillus fermentum, such as deposited strains NRRL B-67059 and NRRL B-67060, and a physiologically acceptable carrier are provided.

As used herein, the term physiologically acceptable carrier or pharmaceutically acceptable carrier means buffers, carriers, and excipients suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic reaction, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The carrier(s) must be acceptable in the sense of being compatible with the other components of the compositions and not harmful to the recipient. A physiologically acceptable carrier can be administered to an individual along with an appropriate active compound without causing clinically unacceptable biological effects or interacting in an adverse manner with any other components of the composition in which it is contained. Physiologically acceptable carriers include buffers, diluents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, which are compatible with the administration of the pharmaceutical formulation. Physiologically acceptable carriers include any of the standard carriers such as phosphate buffered saline, water, emulsions (eg, such as oil/water or water/oil type emulsions), and various types of wetting agents. The compositions may also include stabilizers and preservatives. For examples of carriers, stabilizers and excipients, see, for example, Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, PA [1975]. Physiologically acceptable carriers include buffers, diluents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, which are compatible with the administration of the pharmaceutical formulation. The use of such media and agents for pharmaceutically active substances is known in the art.

- 3 041936

The use of such media and/or agents for pharmaceutically active substances is known in the art. In some embodiments, the composition is administered orally and includes an enteric coating suitable for controlling the site of absorption of the encapsulated substances in the digestive system or intestines. For example, the enteric coating may include an ethyl acrylate-methacrylic acid copolymer. The term carrier as used herein refers to the medium used to carry the active substances. The carriers of the present invention typically contain components such as polymers and solvents.

Also provided are fermented dairy products made using strains of Lactobacillus fermentum, such as deposited strains NRRL B-67059 or NRRL B67060. As used herein, the term fermented dairy product refers to products that are obtained by multiplying lactic acid bacteria, such as Lactobacillus fermentum, in a milk base, resulting in a milk clot. The milk preparation used as the fermentation feedstock may be skimmed or full-fat milk, optionally concentrated or in powder form. In addition, this milk preparation can be subjected to a heat treatment operation which is at least as effective as pasteurization. Specific characteristics of various fermented dairy products depend on various factors such as milk base composition, incubation temperature, lactic acid microflora and/or non-lactic microflora. Thus, fermented dairy products made herein include, for example, various types of regular yogurt, low fat yogurt, low fat yogurt, kefir, ymer, buttermilk, butterfat, sour cream and sour whipped cream, as well as fresh cheeses. Methods for producing fermented dairy products are well known in the art. As used herein, the term biologically active dairy product refers to a fermented dairy product that may affect biological function. The biological activity of a biologically active dairy product may, for example, be due to specific compounds produced by strains of Lactobacillus fermentum during the fermentation of dairy products.

Accordingly, isolated fractions of the biologically active dairy product are also provided here, i. e. fractions of a biologically active dairy product or isolated compounds of a biologically active dairy product, i. biologically active compounds that have the same biological properties as a biologically active dairy product. Methods for fractionating fermented dairy products or isolated compounds from fermented dairy products are well known in the art.

The disclosed strains of Lactobacillus fermentum, biologically active dairy products, fractions of biologically active dairy products, or biologically active compounds may be formulated into physiologically acceptable compositions in combination with suitable physiologically acceptable carriers.

Additional components of the composition may include trehalose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, hydroxypropyl methylcellulose, sodium hyaluronate, sodium alginate, chitosan and its derivatives, polyethylene glycol, glycerin, propylene glycol, triacetin, N,Ndimethylacetamide, pyrrolidone, dimethyl sulfoxide, ethanol, N-(β- hydroxyethyl)lactamide, 1-methyl-2pyrrolidinone, triglycerides, monothioglycerol, sorbitol, lecithin, methylparaben, propylparaben, polysorbates, block copolymers of ethylene oxide and propylene oxide, diblock polymers or triblock copolymers of polyethylene oxide and polypropylene oxide, ethoxylated emulsifiers, polyethylene glycol esters, sucrose laurate, tocopherol-PEG-succinate, phospholipids and their derivatives and/or other non-ionic self-emulsifying agents. Additional components of the composition may include triacetin, L-lysine, ammonium acetate.

Disclosed strains of Lactobacillus fermentum, biologically active dairy products, fractions of biologically active dairy products, or biologically active compounds may be formulated into preparations including, for example, tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants and aerosols, and compositions for local application. The compositions may be intended for a number of different routes of administration, including, for example, oral, buccal, sublingual, rectal, parenteral, intraperitoneal, intradermal, transdermal or intragastric administration.

In embodiments, the composition is a food product. Food products of interest include the disclosed strain of Lactobacillus fermentum in combination with a food carrier. A nutritional carrier is understood to mean a carrier that is a nutrient that is eaten, drunk, or otherwise ingested into the body to sustain life, provide energy, promote growth, and the like. Examples of nutritional carriers or foods of interest include, but are not limited to, infant formulas or initial infant formulas, infant formula products (e.g., pureed foods suitable for consumption by infants under 1 year of age or 1 to 3 years of age). years), chips, biscuits, bread, spreads, creams, yoghurts, liquid drinks, chocolate products, sweets, ice cream,

- 4 041936 cereal products, coffee, pureed food products, water, liquid dairy products, milk, concentrated milk, fermented milk, yogurt, curdled milk, frozen yogurt, drinks fermented with lactic acid bacteria, powdered milk, ice cream, cream cheeses, dry cheeses, soy milk, fermented soy milk, vegetable and fruit juices, juices, sports drinks, confectionery, jellies, hard candies, infant formulas, diet foods and/or pet foods. In embodiments, the composition is a nutritional supplement. The food additive may further include, for example, a sweetener, stabilizer, flavor, emulsifier, and/or color.

In embodiments, the composition (e.g., pharmaceutical composition) and/or comestible of the present disclosure contains about 0.01 mg, about 0.05 mg, about 0.1 mg, about 1 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 150 mg , about 200 mg or about 250 mg of one or more Lactobacillus fermentum strains that have at least 80 to 100% genome sequence identity with Lactobacillus fermentum NRRL B67059 strain and/or Lactobacillus fermentum NRRL B-67060 strain.

In embodiments, the composition (e.g., pharmaceutical composition) and/or comestible product of the present disclosure contains from about 0.01% (wt./wt. or wt./vol.) to about 50% (wt./wt. or wt. ./vol.) biologically active agent, additive, excipient, emulsifier, drug, pharmaceutically acceptable carrier and/or preservative.

Methods of treatment and / or prevention.

The above compositions can be used for the treatment or prevention of various medical indications.

Treatment includes any effect, such as reduction, reduction, modulation, prevention, or elimination, that results in a positive change in a condition, disease, disorder, or the like. Treatment or therapy of a disease state includes: (1) inhibition of the disease state, ie. stopping the development of the disease state or its clinical symptoms; (2) relief of the disease state, i.e. the implementation of a temporary or permanent regression of the disease state or its clinical symptoms; (3) reduction or reduction in the symptoms of the disease state; or (4) preventing the disease state, for example, by effecting the development of clinical symptoms of the disease state in a subject who may be susceptible to or predisposed to the disease state but is not yet experiencing or exhibiting symptoms of the disease state. The term prophylaxis or prevention, as used herein, describes the reduction or elimination of the manifestation of symptoms or complications of a disease, condition, or disorder. The term prophylaxis, when used in relation to a condition, is accepted in the art and refers to a dosage form, composition and/or agent that reduces the frequency or delays the onset of signs and/or symptoms of a disease in a subject compared to a subject who does not receive the composition.

The word reduce or its other forms, such as reducing or reducing, means a decrease in a manifestation or sign. It is clear that this usually refers to some standard or expected value, in other words, it is relative, except that it is not always necessary to refer to the standard or relative value.

Since the methods of the present disclosure relate to disease prevention, it is understood that the term prevention does not imply complete prevention of a disease state. Rather, in the sense in which the term prevention is used here, it refers to the ability of a skilled person to identify a population that is susceptible to diseases, whereby the administration of the compounds of the present disclosure can be carried out before the onset of the disease. This term does not mean that the disease state is completely excluded.

The term symptom amelioration, or other forms of the word, such as symptom amelioration, is used herein to mean that administration of a drug of the present disclosure ameliorates one or more symptoms of a disease or disorder in a wearer and/or reduces, inhibits, or eliminates a particular symptom associated with with a disease or disorder, before and/or after drug administration.

In embodiments, a disclosed composition, such as a composition comprising a strain of Lactobacillus fermentum, a biologically active dairy product, a fraction of a biologically active dairy product, or biologically active compounds, can be used in a method of treating an immune system deficiency, such as a deficiency in cytokine secretion, such as IL-10, IL -6 and/or IL-2. Therefore, such method comprises administering an effective amount of the disclosed composition to treat a subject.

As used herein, the terms effective amount or therapeutically effective amount refer to an amount of a substance that is sufficient to at least partially treat a disease when administered to a patient. A therapeutically effective amount will vary depending on the disease, the route of administration of the component, and age, weight, and the like. the patient being treated. Accordingly, an effective amount of a particular composition/comedible inhibitor is the amount of composition/comedible required in relation to the intended purpose for the patient. An effective amount may be administered by one or more administrations, uses, or dosages and is not intended to be limited to a particular composition or route of administration.

A patient, as described herein, refers to any animal suffering from or diagnosed with a disease or disorder, including, but not limited to, mammals, primates, and humans. In some embodiments, the patient may be a non-human mammal, such as, for example, a cat, dog, or horse. In a preferred embodiment, the patient is a human.

As used herein, the term subject means an individual. Thus, the subject may include domestic animals (e.g., cats, dogs, and the like), domestic animals (e.g., cattle, horses, pigs, sheep, goats, and the like), laboratory animals (e.g., mice , rabbits, rats, guinea pigs, etc.) and birds. The subject may also include a mammal, such as a primate or a human. The terms subject and patient can be used interchangeably, however, in some embodiments, the subject cannot be diagnosed or is suffering from a disease or disorder, although it may be in need of treatment.

As used herein, the term administration means administration by suppository, administration by topical contact (eg, spray), parenteral, intramuscular, intralesional, intrathecal, intranasal, or subcutaneous administration to a subject. Administration is by any route, including parenteral and transmucosal (eg, buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Other delivery methods include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, and the like.

In the sense in which the term sequential administration is used in this description, it provides that the administration of two components (for example, the compositions described in this disclosure) occurs separately on the same day or does not occur on the same day ( e.g. occurs on consecutive days).

In the sense in which the term simultaneous introduction is used in this description, it provides for a coincidence in duration, at least partially. For example, when two components (eg, any compositions described in this disclosure that have biological activity) are administered simultaneously, their administration occurs within a certain required time. The introduction of the components can begin and end on the same day. Administration of one component may also precede administration of the second component by a day(s), provided that both components are taken on the same day, at least once. Similarly, the administration of one component may continue beyond the administration of the second component, provided that both components are taken on the same day, at least once. Compositions/components do not have to be taken at the same time each day to qualify for simultaneous administration.

In the sense in which the term intermittent administration is used in this description, it provides for the administration of a component for a period of time (which can be considered the first period of administration), followed by a period of time during which the component is not taken or taken at a lower maintenance dose. (which may be considered outside the period) followed by a period during which the component is administered again (which may be considered the second administration period). Typically, during the second administration period, the dosage level of the component will correspond to the administration level during the first administration period, but may be increased or decreased as medically necessary.

By co-administration is meant that the composition described in this disclosure is administered at the same time, immediately before or immediately after the administration of additional medications. The disclosure composition may be administered alone or may be co-administered to a patient. Co-administration is intended to include the simultaneous or sequential administration of a composition alone or in combination (more than one composition or component). The preparations can also be combined, if necessary, with other active substances (eg for wound healing).

In embodiments, administration of the disclosed composition stimulates the secretion of interleukin 10 (IL-10) and/or immunoglobulin A (IgA) immunoglobulin antibodies. In embodiments, administration of the disclosed composition does not induce pro-inflammatory responses, such as those determined by levels of interleukin-2 (IL-2) or interleukin-6 (IL-6).

In embodiments, administration of a disclosed composition, such as a composition comprising a strain of Lactobacillus fermentum, a biologically active dairy product, a fraction of a biologically active dairy product, or a biologically active compound, stimulates the secretion of the anti-inflammatory cytokine IL-10. Accordingly, in embodiments, the disclosed composition is used to treat an inflammatory condition. In the sense in which the term inflammatory condition is used here, it means a disease or condition characterized entirely by

- 6 041936 or partly by inflammation or inflammatory response in the patient. The inflammatory process can be characterized, for example, on the basis of the primary tissue affected, the mechanism of action underlying the condition, or a part of the immune system that is unregulated or overactive. In some embodiments, examples of inflammatory conditions that can be treated include inflammation of the lungs (eg, asthma, adult respiratory distress syndrome, bronchitis, pneumonia, pulmonary fibrosis, and cystic fibrosis), joints (eg, rheumatoid arthritis, rheumatoid spondylitis, juvenile rheumatoid arthritis, osteoarthritis , gouty arthritis, and other arthritic conditions), connective tissue, eyes (eg, uveitis (including iritis), conjunctivitis, scleritis, and keratoconjunctivitis sicca), nose, intestines (eg, Crohn's disease, ulcerative colitis, inflammatory bowel disease, irritable bowel syndrome, and distal proctitis), kidney (eg, glomerulonephritis, interstitial nephritis, lupus nephritis, nephritis due to Wegener's disease, acute renal failure due to acute nephritis, Goodpasture's syndrome, post-obstructive syndrome, and tubular ischemia), liver (eg, hepatitis (due to viral infection, autoimmune reactions, drug treatment drugs, toxins, environmental factors, or as a secondary consequence of the primary disorder), obesity, biliary atresia, primary biliary cirrhosis, and primary sclerosing cholangitis), skin (eg, psoriasis, eczema, and dermatitis, eg, pruritic dermatitis, topical and seborrheic dermatitis, allergic or irritant contact dermatitis, asteatotic eczema, photoallergic dermatitis, phototoxic dermatitis, phytophotodermatitis, radiation dermatitis and congestive dermatitis), central nervous system (e.g. multiple sclerosis and neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease or HIV-associated dementia), vascular system (eg, coronary infarction, peripheral vascular disease, myocarditis, vasculitis, stenosis revascularization, atherosclerosis, and vascular disease associated with type II diabetes), endocrine system (eg, autoimmune thyroiditis (Hashimoto's disease), type I diabetes pa, inflammation of the liver and adipose tissue associated with type II diabetes, and acute and chronic inflammation of the adrenal cortex), heart or adipose tissue. The disclosure suggests that certain inflammatory conditions involve inflammation of various tissues. Moreover, the disclosure suggests that certain inflammatory conditions may fall into more than one category. In some embodiments, the inflammatory condition is an autoimmune disease. Typical autoimmune diseases include, but are not limited to, rheumatoid arthritis, psoriasis (including plaque psoriasis), psoriatic arthritis, ankylosing spondylitis, ulcerative colitis, multiple sclerosis, lupus, alopecia, autoimmune pancreatitis, celiac disease, Behçet's disease, Cushing's syndrome, and Graves' disease . In some embodiments, the inflammatory condition is a rheumatoid disease. Typical rheumatoid diseases include, but are not limited to, rheumatoid arthritis, juvenile arthritis, bursitis, spondylitis, gout, scleroderma, Still's disease, and vasculitis. It is noted that some categories of states coincide. For example, rheumatoid arthritis is an inflammatory rheumatoid disease, an inflammatory joint disease, and an autoimmune disease.

In one aspect, the present disclosure relates to a method of treating a disease or disorder, such as a nutritional disease or disorder, an inflammatory disease or disorder, and an autoimmune disease or disorder, in a subject in need thereof, the method comprises administering to the subject an effective amount of a composition comprising one or more strains of Lactobacillus fermentum that have at least 80 to 100% genome sequence identity with Lactobacillus fermentum NRRL B-67059 strain and/or Lactobacillus fermentum NRRL B-67060 strain. In embodiments, the described composition, in any of its forms described in the present disclosure, is administered to a subject for the treatment of a disease or disorder.

In one aspect, the present disclosure relates to a method for modulating the immune system and/or response in a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising one or more Lactobacillus fermentum strains that have at least 80% to 100% sequence identity. genome with Lactobacillus fermentum NRRL B-67059 strain and/or Lactobacillus fermentum NRRL B-67060 strain. In embodiments, the described composition, in any of its forms described in this disclosure, is administered to a subject to modulate the immune system and/or response in the subject. In embodiments, the present disclosure relates to a method for modulating the immune system and/or response in a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising one or more Lactobacillus fermentum strains that have at least 80% to 100% sequence identity. with the sequence of the 16S rRNA gene fragment SEQ ID NO: 1 or SEQ ID NO: 2.

In one aspect, the present disclosure relates to a method for improving the immune system of a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising one or more Lactobacillus fermentum strains that have at least 80% to 100% genome sequence identity with the Lactobacillus fermentum strain. NRRL B-67059 and/or Lactobacillus fermentum strain NRRL B-67060. In embodiments, the present disclosure relates to a method for improving the immune system of a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising one or more Lactobacillus fermentum strains that have at least 80% to 100% sequence identity with the sequence of the 16S rRNA gene fragment SEQ ID NO: 1 or SEQ ID NO: 2.

In one aspect, the present disclosure relates to a method for treating and/or ameliorating an immunodeficiency state in a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising one or more strains of Lactobacillus fermentum that have at least 80% to 100% identity. sequences with the sequence of the 16S rRNA gene fragment of SEQ ID NO: 1 or SEQ ID NO: 2. An immunodeficiency state includes a violation of the immune system, leading to infections that occur and recur more often, are more severe and last longer than usual. Immunodeficiencies usually result from drug use or a long-term serious illness (such as cancer), but are sometimes inherited. People usually suffer from frequent, unusual, or unusually severe or prolonged infections, and may develop an autoimmune disease or cancer. Doctors suspect immunodeficiency based on symptoms and do blood tests to look for a specific condition. People may be given antimicrobials (such as antibiotics) to prevent and treat infections. Immunoglobulin may be given when levels of antibodies (immunoglobulins) are too low or their function is impaired. In severe cases, stem cell transplantation is sometimes performed. An immunodeficiency state reduces the ability of the immune system to protect the body from foreign or abnormal cells that invade or attack it (for example, bacteria, viruses, fungi, and cancer cells). As a result, unusual bacterial, viral, or fungal infections or lymphomas or other cancers may develop. Another problem is that up to 25% of people who are immunocompromised also have an autoimmune disease (such as immune thrombocytopenia). In an autoimmune disease, the immune system attacks the body's own tissues. Sometimes an autoimmune disease develops before any symptoms of immunodeficiency develop.

There are two types of immunodeficiency states: primary and secondary. The primary conditions are usually congenital and are usually hereditary. They usually become apparent in infancy or childhood. However, some primary immunodeficiency conditions (such as variable unclassifiable immunodeficiency) are not recognized until adulthood. There are over 100 primary immunodeficiency conditions, all relatively rare. Secondary conditions usually develop later in life and often result from certain medications or another disease, such as diabetes or the human immunodeficiency virus (HIV). They are more common than primary immunodeficiency states. Some immunodeficiency conditions shorten life expectancy. Others persist throughout life but do not affect life expectancy, and some are eliminated with or without treatment.

In one aspect, the present disclosure relates to a method for improving the health of a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising one or more strains of Lactobacillus fermentum that have at least 80% to 100% genome sequence identity with a strain of Lactobacillus fermentum NRRL B-67059 and/or Lactobacillus fermentum NRRL B-67060. In embodiments, the present disclosure relates to a method for improving the health of a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising one or more Lactobacillus fermentum strains that have at least 80% to 100% sequence identity with a 16S rRNA gene fragment sequence. SEQ ID NO: 1 or SEQ ID NO: 2.

In embodiments, the described composition, in any of its forms described in the present disclosure, is administered to a subject to improve the subject's health. In embodiments, improving the subject's health is achieved by modulating the subject's immune system.

In embodiments, a composition of the present disclosure for use by the methods described herein is obtained as a biologically active milk fraction prior to administration to a subject.

Ways to get.

In one aspect, the present disclosure relates to a process for the preparation of a food, dietary supplement, or pharmaceutical composition comprising a biologically active milk fraction of one or more strains of Lactobacillus fermentum that have at least 80% to 100% genome sequence identity with a strain of Lactobacillus fermentum NRRL B- 67059 and/or strain Lactobacillus fermentum NRRL B-67060, where in the method the biologically active fraction is obtained by a biocontrolled procedure and used to prepare a food product, food supplement or pharmaceutical composition.

In one aspect, the present disclosure relates to a method for producing an edible product comprising fermenting a proteinaceous starting material with one or more strains of Lactobacillus fermentum NRRL B-67059 that have at least 80 to 100% genome sequence identity with a strain of Lactobacillus fermentum NRRL B-67059 and /or strain Lactobacillus fermentum NRRL B67060. In embodiments, the starting material is milk or a milk-based product. In embodiments, the method for producing a comestible product includes removing non-hydrolyzed protein from milk or milk-based starting material.

In embodiments, the method for producing an edible product includes a starting material that contains one or more biologically active milk fractions. One or more biologically active milk fractions may have immunomodulatory activity.

In embodiments, the method for producing an edible product includes a starting material that includes one or more biologically active compounds. One or more biologically active compounds may have immunomodulatory activity.

In one aspect, the present disclosure relates to a method for modulating the immune system of a subject in need thereof, the method comprising administering to the subject an effective amount of a comestible obtained by the method described herein.

In one aspect, the present disclosure relates to a method for treating, preventing, and/or reducing inflammation in a subject in need thereof, the method comprising administering to the subject an effective amount of a comestible obtained by the method described herein.

The edible product of the present disclosure is or may be suitable for use in the dairy, beverage, food processing, meat processing, bakery, and/or confectionery industries.

The edible product of the present disclosure is or may be a fermented dairy product. The edible product of the present disclosure is or may be a beverage. The edible product of the present disclosure is or may be a pharmaceutical composition.

In one aspect, the present disclosure relates to a method for improving the immune system of a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising one or more Lactobacillus fermentum strains that have at least 80% to 100% genome sequence identity with the Lactobacillus fermentum strain. NRRL B-67059 and/or Lactobacillus fermentum strain NRRL B-67060.

In one aspect, the present disclosure relates to a method of increasing the secretion of cytokines in a subject in need thereof, comprising administering to the subject an effective amount of a composition described in this disclosure.

In embodiments, the composition for improving the immune system and/or increasing cytokine secretion in a subject in need thereof is or may be a food product.

In embodiments, a composition for improving the immune system and/or increasing cytokine secretion in a subject in need thereof is or may be a pharmaceutical composition.

In the composition, edible product, method and process of the present disclosure, one or more strains of Lactobacillus fermentum are concentrated to provide increased efficacy.

Throughout the description, where compositions are described as having, including, or containing certain components, or where processes and methods are described as having, including, or containing certain steps, it is contemplated that, in addition, there are compositions of the present invention that consist essentially of or consist of the listed components, and that there are processes and methods of the present invention that consist essentially of or consist of the listed process steps.

In the application, where it is said that an element or component is included and / or selected from a list of listed elements or components, it should be understood that the element or component can be any of the listed elements or components, or the element or component can be selected from the group consisting two or more of the listed elements or components.

In addition, it should be understood that the elements and/or features of the composition or method described herein can be combined in various ways without departing from the spirit and scope of the present invention, whether express or implied here. For example, when reference is made to a specific compound, that compound can be used in various embodiments of the compositions of the present invention and/or in the methods of the present invention, unless otherwise implied from the context. In other words, in this application, the embodiments have been described and presented in a manner that allows the application to be clearly and concisely described and depicted, but it is contemplated and will be understood that the embodiments can be combined or separated in various ways without departing from the present idea and invention(s). . For example, it will be understood that all features described and presented here may be applicable to all aspects of the invention(s) described and presented here.

- 9 041936

The terminology used here is only intended to describe specific embodiments and is not intended to limit the scope of the present disclosure. In the sense in which the grammatical forms of the singular are used in this disclosure, they include a reference to the plural, unless the context clearly indicates otherwise. Thus, for example, a reference to a composition includes a plurality of such compositions as well as a single composition, and a reference to a drug is a reference to one or more drugs and/or pharmaceuticals and equivalents that are known to those skilled in the art, and so on. All percentages and ratios used here, unless otherwise indicated, are by weight.

Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In the event of a conflict, this description will be verified. In the description of the singular form, the plural is also included, unless the context clearly indicates otherwise. While methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference. References herein are not recognized as prior art for the claimed disclosure. In the event of a conflict, the present description, including definitions, will be verified. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.

The weight percent of a component, unless specifically stated otherwise, is based on the total weight of the formulation or composition in which the component is included.

The term about refers to any minimal change in the concentration or amount of a component that does not change the effectiveness of the component in formulating and treating a disease or disorder. The term about in relation to the range of concentrations of components (eg, drugs/active substances) of the present disclosure also refers to any change in the claimed amount or range, which will be an effective amount or range. In embodiments, the term about may include ±15% of a given numerical value or measured parameter. In this disclosure, ranges may be expressed as from about one particular value and/or to about another particular value. If such a range is expressed, the other aspect includes from one particular value and/or to another particular value. Similarly, when values are expressed as approximations, using the preceding about, it is understood that the particular value constitutes a different aspect.

In addition, it is clear that the limit values of each range are significant both relative to the other limit value and independently of the other limit value. It is also understood that there are a variety of values specified in this disclosure, and each value is also disclosed as being about that particular value in addition to the value itself. It is also understood that parameters are given in a variety of ways throughout the scope of the application, and that these parameters are represented by end and start values and ranges for any combination of parameter values. For example, if a specific quotient of 10 and a specific quotient of 15 are specified, it is understood that greater than, greater than, or equal to, less than, less than, or equal to, and equal to 10 and 15 are considered specified, as well as a range between 10 and 15. In addition, , it is clear that each value between two specific units is also indicated. For example, if 10 and 15 are specified, 11, 12, 13, and 14 are also specified.

It should be understood that the expression of at least one of includes individually each of the listed objects after the expression and various combinations of two or more of the listed objects, unless otherwise implied from the context and application. The expression and/or in relation to three or more listed entities should be understood to have the same meaning, unless otherwise implied from the context.

The use of the term include, includes, including, have, has, has, contains, contains or containing, including their grammatical equivalents, should be understood generally as open and non-limiting, for example, not excluding additional non-listed elements or steps, unless otherwise indicated specifically or not implied from the context.

Sequence identity can be determined in a variety of ways that are within the skill of the art, for example using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. BLAST analysis (basic local alignment finder) using the algorithm used by the programs blastp, blastn, blastx, tblastn, and tblastx (Karlin et al., (1990) PROC. NATL. ACAD. SCI. USA 87:2264-2268; Altschul, (1993) J. MOL EVOL 36, 290-300, Altschul et al., (1997) NUCLEIC ACIDS RES 25:3389-3402, incorporated by reference) is designed to search for sequence similarity. For a discussion of basic search issues in sequence databases, see Altschul et al., (1994) Nature Genetics 6, 119-129, which is incorporated by reference in its entirety. Those skilled in the art can determine the appropriate parameters for measuring

- 10 041936 alignment adjustments, including any algorithms necessary to achieve maximum alignment over the entire length of the compared sequences. The search options histogram, description, alignment, expectation (i.e. the threshold of statistical significance for specified matches against database sequences), cutoff, matrix, and filter are in the default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff et al., (1992) PROC. NATL. ACAD. SCI. USA 89:1091510919, incorporated by reference in its entirety). The four blastn parameters can be adjusted as follows: Q=10 (blank penalty); R=10 (penalty for space expansion); wink=1 (generates word hits at each wink.sup.th position as requested); and gapw=16 (sets the width of the window in which gap alignments are generated). Equivalent Blastp parameter settings may be Q=9; R=2; wink=1 and gapw=32. Searches can also be performed using the NCBI (National Center for Biotechnology Information) BLAST Advanced Option (for example: -G, gap opening cost [integer]: default=5 for nucleotides/11 for proteins; -E, gap expansion cost [integer] value]: default=2 for nucleotides/1 for proteins; -q, nucleotide mismatch penalty [integer]: default=-3; -r, nucleotide match reward [integer]: default=1; - e, expected value [actual value]: default=10 -W, wordlength [integer]: default=11 for nucleotides/28 for megablast/3 for proteins; -y, discrepancy (X) for BLAST extensions in bits: default=20 for blastn/7 for others: -X, divergence of X value to align with spaces (in bits): default=15 for all programs, does not apply in blastn, and -Z, final divergence of X value to align with spaces (in bits): 50 for blastn, 25 for others). For pairwise protein alignments, ClustalW can also be used (default parameters may include, for example, Blosum62 matrix and gap opening penalty=10 and gap widening penalty=0.1). The intersequence Bestfit comparison available in the GCG package version 10.0 uses the parameters for DNA GAP=50 (gap penalty) and LEN=3 (gap extension penalty), and the equivalent settings for protein comparisons are GAP=8 and LEN= 2.

Examples

The following examples are illustrative only and are not intended to limit the scope or content of the description of the invention in any way.

Example 1 Identification and characterization of Lactobacillus fermentum strains NRRL B-67059 and NRRL B-67060.

The relationship between nutrition and health is now well established as one of the decisive factors in disease prevention and well-being. It is for this reason that there has been significant growth in the market for functional foods, which are foods that have a positive impact on people's health in addition to their nutritional value. Dairy products occupy a significant share of this market, in part because the manufacturing process for fermented dairy products involves the addition of lactic acid bacteria (LAB), many of which are known to have probiotic properties or to themselves produce secondary metabolites that cause therapeutic and prophylactic effects (Mills et al ., 2011, Int. Dairy J. 21:377-401). Although the conversion of lactose to lactic acid is the most significant effect associated with LAB, fermented milk also contains a wide range of potentially active components that are still not fully characterized. These compounds, usually present in small amounts, are believed to have specific properties predominantly in the field of immunostimulation (Granier et al., 2013, Pediatric Research 74:238-244).

Although lactic acid production is a common feature of all LAB, the production of other compounds depends on bacterial strains and fermentation conditions. In addition, some LABs have received particular attention in recent decades due to their use as probiotic microorganisms. Probiotics are traditionally defined as live microorganisms which, when administered at the appropriate dose, provide a health benefit to the host (FAO/WHO 2001). However, scientific evidence has shown that inactivated microorganisms (killed by heat) can also positively affect human health (Taverniti and Guglielmetti 2011, Genes Nutr 6:261-274).

There is still a great need to find new effective LABs that are suitable both as starters for fermented dairy products and for the production of biologically active compounds with immunomodulatory and anti-inflammatory activity that can be used as a dietary supplement or as a pharmaceutical composition.

Specific strains of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, which can produce a biologically active fermented dairy product and have a remarkable ability to modulate the immune system of humans or mammals. Such a biologically active fermented dairy product, or biologically active fractions isolated therefrom, provide a method for inducing, increasing or stimulating the secretion of cytokines such as

- 11 041936 as interleukin-10 (IL-10). On the other hand, such a biologically active fermented dairy product or active fractions thereof did not induce a pro-inflammatory response such as that exhibited by interleukin-6 (IL-6).

The biologically active fermented dairy product or fractions isolated from it, covered by this invention, is an acceptable option for modulating the immune system without the side effects produced by certain drugs. In addition, such a biologically active fermented dairy product or fractions isolated from it induce an anti-inflammatory effect at the system level. Therefore, the isolated strains of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, disclosed herein, and the biologically active compounds covered by this disclosure derived from them, can be used in pharmaceutical preparations as well as in food products.

This disclosure includes the synthesis of biologically active compounds under the action of new strains of Lactobacillus fermentum NRRL B-67059 or NRRL B-67060 during the fermentation of dairy substrates. One purpose of the present disclosure is to produce food products with biologically active compounds to produce functional foods by exposing specific strains of Lactobacillus fermentum NRRL B-67059 or NRRL B-67060 to a food substrate. In addition, these biologically active compounds can be used in an edible product such as a dietary supplement or as a pharmaceutical composition.

New strains of Lactobacillus fermentum, hereinafter referred to as NRRL B-67059 and NRRL B-67060. NRRL B-67059 and NRRL B-67060 were isolated and deposited on April 17, 2015 at the United States Department of Agriculture's National Center for Agricultural Use Research.

The present invention relates to specific strains of Lactobacillus, NRRL B-67059 or NRRL B-67060, which can produce a biologically active fermented dairy product advantageously having a remarkable ability to modulate the immune system of humans or mammals.

These bacteria were isolated from raw dairy products and were Gram-negative, catalase-negative and rod-shaped organisms. These bacteria were identified as Lactobacillus fermentum by partial amplification of the 16S rRNA gene and sequencing (Table 1). These strains have been characterized for their probiotic potential. Thus, L. fermentum strains were evaluated by studying their resistance (percentage of survival) under conditions of low pH and treatment with enzymes (Maragkoudakis et al., 2006, International Dairy Journal, 16, 189-199) and tolerance to bile salts (Thirabunyanon et al., 2009, Biotechnology Letters, 31, 571-576). In general, L. fermentum strains showed high viability under various conditions of the gastrointestinal tract, with ranges in percent cell survival at pH 3.0, enzyme and bile salt treatments of 94-99%, 71-99%, and 79-96%, respectively. (Table 2).

Table 1

Identification of Lactobacillus fermentum strains by partial 16S rRNA gene sequence

Strain Subsequence NRRL B-67059 GGATGAACGCCGGCGGTGTGCCTAATACATGCAAGTCGAACGCGTTGGC CCAATTGATTGATGGTGCTTGCACCTGATTGATTTTGGTCGCCAACGAG TGGCGGACGGGTGAGTAACACGTAGGTAACCTGCCCAGAAGCGGGGGAC AACATTTGGAAACAGATGCTAATACCGCATAACAGCGTTGTTCGCATGA ACAACGCTTAAAAGATGGCTTCTCGCTATCACTTCTGGATGGACCTGCG GTGCATTAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGATGATGCAT AGCCGAGTTGAGAGACTGATCGGCCACAATGGGACTGAGACACGGCCCA TACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGGCGCAAGC CTGATGGAGCAACACCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAGC TCTGTTGT ТAAAGAAGAACACGТAT GAGAGТAAC TGTTCATACGTT GAC GGTATTTAACCAGAAAGTCACGGCTAACTAC [SEQ ID NO: 1] NRRL B-67060 GGATGAACGCCGGCGGTGTGCCTAATACATGCAAGTCGAACGCGTTGGC CCAATTGATTGATGGTGCTTGCACCTGATTGATTTTGGTTGCCAACGAG TGGCGGACGGGTGAGTAACACGTAGGTAACCTGCCCAGAAGCGGGGGAC

- 12 041936

AACATTTGGAAACAGATGCTAATACCGCATAACAGCGTTGTTCGCATGA ACAACGCTTAAAAGATGGCTTCTCGCTATCACTTCTGGATGGACCTGCG GTGCATTAGCTTGTTGGTGGGGTAACGGCCTACCAAGGCGATGATGCAT AGCCGAGTTGAGAGACTGATCGGCCACAATGGGACTGAGACACGGCCCA TACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGGCGCAAGC CTGATGGAGCAACACCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAGC TCTGTTGTTAAAGAAGAACACGTATGAGAGTAACTGTTCATACGTTTAC GGTATTTAACCAGAAAGTCACGGCTAACTACGTGC [SEQ ID NO: 2]

table 2

Characterization of Lactobacillus fermentum NRRL B67059 and NRRL B67060 for the purpose of evaluating ________________________ their probiotic potential ____________________________

Strains Viability (%) 1 pH 3.0 Pepsin Pancreatin Lysozyme bile salts acids Auto Aggregate (%) hydrophobic st L. fermentum NRRL B-67059 94.96+ ^0.31a 96.65+ ^0.03a 98.88+ ^0.36a 98.73+ ^0.34a 96.95+ ^0.10a 31.85+ ^0.05a 20.1 + 1.11 ^a L. fermentum NRRL B-67060 9 9, 7 6+0, 0 6 ^b 71.5 6+0.6 ^9b 94.68+ ^0.15a 99.21+ ^0.14a 78.99+ ^0.10b 10.57+0.03 ^b 5.10 + 1.59 ^b

The values are averages for n=3. Mean values for each value without a common letter differ significantly (p<0.05).

Table 3

Susceptibility of Lactobacillus fermentum to various antibiotics (n=3)

Cefalotin Dicloque Acillin Erythrom icin Ghent mi ching Penicillin Ampicillin Tsefep im Cefurok Sim tetraci wedge L. fermentum NRRL B-67059 R R R R R R R R R L. fermentum NRRL B-67060 R R R I R R R R R

R - stable,

I - moderately resistant.

Autoaggregation (Collado et al., 2008, European Food Research and Technology, 226, 1065-1073) and hydrophobicity (Marin et al., 1997) were evaluated. In general, low levels of both parameters were observed (Table 2). They are indicators of adhesion on epithelial cells and mucosal surfaces and may be a preferred feature of probiotics. Both strains of L. fermentum showed no hemolytic activity when grown on blood agar medium (Thirabunyanon, et al., 2009, Biotechnology Letters, 31, 571-576). The absence of hemolytic activity is an important indicator when choosing probiotics. Similarly, L. fermentum strains are incapable of mucin degradation (Fig. 1). Mucin degradation is considered an undesirable characteristic of probiotics.

In general, the antibiotic susceptibility test (multidisc Gram-positive II, BIO-RAD) of Lactobacillus fermentum strains NRRL B-67059 and NRRL B-67060 showed resistance to all tested antibiotics (Table 3). Although probiotics may be sensitive to most antibiotics, their resistance may be beneficial in people with intestinal microflora imbalances resulting from the administration of various antimicrobials, hence probiotics can be administered with antibiotics to prevent gastrointestinal side effects (Courvalin, 2006 , Digestive Liver Diseases, 38, S261-S26).

In addition, Lactobacillus fermentum strains, NRRL B-67059 and NRRL B-67060, showed important technological characteristics such as high oxidative and proteolytic activity when they were inoculated with reconstituted skimmed milk powder. Indeed, lactic acid production was statistically significantly (p<0.05) higher at 48 h of fermentation for both strains (FIG. 2). In addition, these strains showed high oxidative activity (pH<4.0 for 48 h) (Fig. 3) and high proteolytic activity (absorption 340>0.20 for 48 h) (Fig. 4) in accordance with OPA (o-phthalic dialdehyde method) (Church et al., 1983, J. Dairy Sci. 66: 1219-1227).

Lactobacillus fermentum bacterial strains, NRRL B-67059 and NRRL B-67060, were activated in MRS broth (De Man, Rogosa and Sharpe, Difco) by three consecutive passages, they were inoculated at 1% and incubated at 37°C for 24, 18 and 12 hours, respectively. Fresh cultures were obtained by repeating the same procedure. Stock starter cultures were prepared by allowing L. fermentum strains to reach 106-10 ⁷ colony forming units (CFU) ml ^-1 as indicated on MRS agar.

Example 2. Obtaining fermented milk containing biologically active compounds.

Reconstituted skimmed milk powder (10% w/v) was sterilized at 110° C. for 10 minutes. A preculture (10 ⁷ cfu ml ^-1 ) of Lactobacillus fermentum, NRRL B-67059 or NRRL B-67060, was inoculated with 1% sterilized milk and incubated for 12 hours. Milk (20 ml) was then inoculated with 3% preculture . The samples were incubated at 37°C for 48 h to obtain different batches of fermented milk (10 ⁹ CFU ml ^-1 ). To prepare fermented pasteurized milk, fermented milk was exposed to 75° C. for 15 minutes.

Example 3 Immunomodulating effect after administration of milk fermented with Lactobacillus fermentum strains NRRL B-67059 or NRRL B-67060.

Samples (1 ml, 10 ⁹ cfu ml ^-1 ) of certain fermented milk (prepared as described above) were cannulated to female Wistar rats (6-8 weeks old, weighing 140±20 g) obtained from Harlan Laboratories, INC. (Indianapolis, IN, USA, through their Mexico City office). The control groups were given unfermented milk. Rats were randomly divided into groups of six and housed in pairs in a cage at 23±2°C with 12-hour light/dark cycles, 52±6% relative humidity, ad libitum standard diet (Teklad, Harlan Laboratories, USA) and purified water. Blood samples were taken from each group after 7 and 21 days. administering the treatment agent prior to killing the animals. Blood samples were centrifuged (1800xg, 10 min, 4°C) and serum samples were stored at -20°C until cytokine analysis. Experimental procedures on animals were carried out in accordance with the guidelines and under the supervision of the CIAD Research Ethics Committee, A.S.

The concentration of cytokines (IL-10 and IL-6) was assessed using a commercially available ELISA kit (BD, Invitrogen). The results were expressed as the concentration of each cytokine (pg ml ^-1 ).

All groups treated with fermented milk containing Lactobacillus fermentum strains NRRL B-67059 or NRRL B-67060 had statistically significantly (p<0.05) more anti-inflammatory cytokine IL-10 than the control group after 7 days of treatment (Fig. . 5). In addition, the concentration of IL-10 was maintained at higher levels than the control at 21 days, although when treated only with milk fermented by Lactobacillus fermentum NRRL B-67059, it was highly statistically significant (p<0.05) (Fig. 5 ). In addition, the concentration of the pro-inflammatory cytokine IL-6 was statistically significantly reduced (p<0.05) in the group that consumed Lactobacillus fermentum NRRL B-67059 fermented pasteurized milk compared to the control group (Fig. 6). Therefore, a positive effect on the immune system can be associated with biologically active compounds formed during fermentation (postbiotics) and/or live or heat-killed bacteria.

Thus, the use of milk fermented with specific lactic acid bacteria Lactobacillus fermentum NRRL B-67059 or NRRL B-67060 can be considered as an adjuvant to improve health by modulating the immune system. Thus, dairy products fermented with Lactobacillus fermentum NRRL B-67059 or NRRL B-67060 can be used as functional foods with potential benefits.

The method is carried out to obtain a food product, food supplement or pharmaceutical composition containing a biologically active milk fraction of one or more Lactobacillus fermentum strains that have at least 80 to 100% genome sequence identity with the Lactobacillus fermentum NRRL B-67059 strain and/or strain Lactobacillus fermentum NRRL B-67060, where the biologically active fraction is obtained by a biocontrolled procedure and used for the preparation of a food product, dietary supplement or pharmaceutical composition.

The method is described for obtaining an edible product, the method includes fermentation of a protein-containing starting material with one or more Lactobacillus fermentum strains that have at least 80 to 100% genome sequence identity with Lactobacillus fermentum NRRL B-67059 strain and/or Lactobacillus fermentum NRRL B- strain 67060. The starting material is milk or a milk-based product. The method includes removing the non-hydrolyzed protein. The edible product contains a biologically active fraction. In the method, the starting material may contain one or more biologically active compounds.

A subject is administered a composition, pharmaceutical composition and/or edible product of the present invention for the treatment of an eating disease or disorder, an inflammatory disease or disorder, and/or an immune disease or disorder.

Numbered Embodiments.

Numbered embodiments of the present disclosure are listed below.

1. New Lactobacillus fermentum strains deposited April 17, 2015 at the United States Department of Agriculture's National Center for Agricultural Use of Research, which is Lactocobacillus fermentum NRRL B-67059 or Lactobacillus fermentum NRRL B-67060.

2. A bacterial preparation containing Lactobacillus fermentum NRRL B-67059 or Lactobacillus fermentum NRRL B-67060.

3. A bacterial preparation according to claim 2, characterized in that it is in solid (lyophilized powder or capsule), semi-solid (gel) or liquid form.

- 14 041936

4. Strains of Lactobacillus fermentum NRRL B-67059 or Lactobacillus fermentum NRRL B-67060 for use in the food industry.

5. Use according to claim 4, characterized in that a dairy or beverage product is obtained.

6. Lactobacillus fermentum NRRL B-67059 or Lactobacillus fermentum NRRL B-67060 strains for use in an edible product such as a food product, dietary supplement or pharmaceutical preparation.

7. A bacterial preparation according to claim 2 for use in an edible product such as a food, dietary supplement or pharmaceutical.

8. Edible product, characterized in that it contains the bacteria according to claim 1 or the bacterial preparation according to claim 2.

9. Edible product according to claim 8, characterized in that it is a dairy product.

10. Edible product according to claim 8, characterized in that it is a drink.

11. Strains of Lactobacillus fermentum NRRL B-67059 or Lactobacillus fermentum NRRL B-67060 or bacterial preparations according to claim 2 for use as a medicine.

12. Lactobacillus fermentum NRRL B-67059 or Lactobacillus fermentum NRRL B-67060 strains or bacterial preparations according to claim 2 for use as health enhancing substances by modulating the immune system of humans or pets.

13. Lactobacillus fermentum NRRL B-67059 or Lactobacillus fermentum NRRL B-67060 strains or bacterial preparations according to claim 2 for use as an anti-inflammatory agent.

14. Strains of Lactobacillus fermentum NRRL B-67059 or Lactobacillus fermentum NRRL B-67060 or bacterial preparations according to claim 2 for use in obtaining biologically active milk fractions.

15. Strains of Lactobacillus fermentum NRRL B-67059 or Lactobacillus fermentum NRRL B-67060 or bacterial preparations according to claim 2 for use in the preparation of a food product, food supplement or pharmaceutical preparation containing biologically active fractions of milk.

16. A method for producing an edible product, such as a food product, food supplement or pharmaceutical preparation, characterized in that it includes the steps of fermenting a protein-containing starting material with lactic acid bacteria according to claim 15.

17. Method according to claim 16, characterized in that the starting material is milk or a milk-based product.

18. The method of claim 17, further comprising the step of removing non-hydrolyzed protein.

19. The method according to claims 16-18, characterized in that the edible product contains biologically active fractions.

20. A method according to one of the preceding claims, characterized in that it comprises one or more biologically active compounds.

21. The method of claim 20, comprising one or more biologically active compounds with immunomodulatory activity.

22. An edible product obtained by the method of claim 19 for use as an immunomodulator.

23. An edible product obtained by the method of claim 19 for use as an anti-inflammatory agent.

24. Edible product according to one of claims 22, 23, characterized in that it may contain one or a mixture of biologically active compounds.

25. An edible product according to one of claims 22, 23 for use in the dairy industry, beverage industry, food processing industry, meat processing industry, bakery industry and/or confectionery industry.

26. An edible product according to one of claims 22, 23, characterized in that it is a fermented dairy product.

27. Edible product according to one of claims 22, 23, characterized in that it is a drink.

28. Edible product according to one of claims 22, 23, characterized in that the final product is a pharmaceutical composition.

Inclusion by reference.

The full disclosure of each patent document and scientific article referenced herein is incorporated by reference for all purposes.

Equivalents.

The invention can be implemented in other specific forms without deviating from the idea or its essential features. Therefore, the above embodiments are to be considered in all respects as illustrative and not as limiting of the invention described herein. Thus, the scope of the invention is indicated in the appended claims and not in the above description,

- 15 041936 and all changes that are within the meaning and range of equivalence of the claims, should be covered by its scope.

Claims (18)

1. Pharmaceutical composition containing Lactobacillus fermentum NRRL B-67059 strain and/or Lactobacillus fermentum NRRL B-67060 strain. 2. Pharmaceutical composition according to claim 1, where said strains of Lactobacillus fermentum have 100% sequence identity with the sequence of the 16S rRNA gene fragment SEQ ID NO: 1 or SEQ ID NO: 2. 3. Pharmaceutical composition according to any one of claims 1, 2, additionally containing an additive, excipient, emulsifier, pharmaceutically acceptable carrier and/or preservative. 4. A pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is in a solid dosage form, a semi-solid dosage form, or a liquid dosage form. 5. Pharmaceutical composition according to claim 4, wherein the solid dosage form is a tablet, lozenge or capsule. 6. Pharmaceutical composition according to claim 5, wherein the tablet or capsule comprises a lyophilized powder of a strain of Lactobacillus fermentum. 7. The pharmaceutical composition of claim 4, wherein the semi-solid dosage form is a gel, cream, ointment, or chewable lozenge. 8. Pharmaceutical composition according to claim 4, where the liquid form is an emulsion or solution. 9. Pharmaceutical composition according to one of claims 1 to 8, obtained for oral, rectal or parenteral administration. 10. Pharmaceutical composition according to any one of claims 1 to 9, wherein the strain(s) of Lactobacillus fermentum are concentrated to provide increased efficacy. 11. A food product containing a strain of Lactobacillus fermentum NRRL B-67059 and/or a strain of Lactobacillus fermentum NRRL B-67060. 12. A food product according to claim 11, wherein said strains of Lactobacillus fermentum have 100% sequence identity with the sequence of the 16S rRNA gene fragment of SEQ ID NO: 1 or SEQ ID NO: 2. 13. Food product according to any one of claims 11 or 12, additionally containing an additive, an emulsifier, and/or a preservative. 14. Food product according to claim 11, where the food product contains a food carrier. 15. Food product according to claim 11 or 14, where the food product contains a fermented dairy product. 16. A food product according to any one of claims 11 to 15, wherein the food product is obtained as a dairy product. 17. A food product according to any one of claims 11 to 16, wherein the food product is in the form of a beverage. 18. A food product according to any one of claims 11 to 17, wherein the strain(s) of Lactobacillus fermentum are concentrated to increase efficiency.