EA041646B1 - PROTEIN DELIVERY BASED ON BACTERIA - Google Patents

Description

The field of technology to which the invention belongs

The present invention relates to recombinant strains of gram-negative bacteria and their use for the delivery of heterologous proteins into eukaryotic cells.

State of the art

Transient transfection techniques have been used for many years in cell biology research to elucidate the functions of proteins. These methods generally lead to an unbalanced increase in the presence of the protein under study, which can lead to oversimplified models of signal transduction in the cell [1]. In the case of proteins that control signaling processes of short duration, the protein of interest will exist much longer than the signaling event it controls [2]. Moreover, temporal overexpression using DNA transfection leads to the formation of a heterogeneous and unsynchronized cell population, which complicates functional studies and impedes the conduct of integrated studies, the so-called omics. In addition, scaling up such analyzes to large volumes is very costly. Some of the problems mentioned above are solved by existing techniques, such as microinjection or proteofection with purified proteins, an inducible translocation strategy to rapidly direct plasmid-generated GTPases to the cell membrane [2], or the addition of purified proteins fused with cell-penetrating bacterial toxins [3]. However, all of these techniques are time consuming and labor intensive and, as far as is known, none of them solves all the problems mentioned.

In the course of evolution, bacteria have acquired various mechanisms that allow them to directly inject proteins into target cells [4]. The type 3 secretion system (CC3T; T3SS) used by bacteria such as Yersinia, Shigella, and Salmonella [5] acts as a nanosyringe that injects so-called bacterial effector proteins into host cells. Bacterial proteins secreted by CC3T, called effectors, carry a short secretion signal at the N-terminus [6]. Within bacteria, some effectors are linked by chaperones. Chaperones can mask toxic domains [7], they contribute to the exposure of the secretion signal [8, 9], and keep substrates in a secretion-competent conformation [10], thereby facilitating secretion. As a result of secretion induction, CC3T-coupled ATPase removes chaperones [11], and the effectors move unfolded or only partially folded through the needle [10] and fold again when they enter the cytoplasm of the host cell.

The SZT system is used to deliver hybrid peptides and proteins to target cells. Heterologous CC3T effectors of bacteria were delivered in the case when the studied bacterium is difficult to genetically manipulate (for example, Chlamydia trachomatis [12]). Reporter proteins have often been fused to possible CC3T secretion signals to explore the requirements for CC3T dependent delivery of proteins such as Bordetella pertussis adenylate cyclase [13], mouse dehydrofolate reductase (DHFR) [10], or a phosphorylated label [14]. The delivery of peptides was mainly carried out for the purpose of vaccination. Such peptides include viral epitopes [15, 16], bacterial epitopes (listeriolysin O [17]), and peptides representing human tumor cell epitopes [18]. In several cases, functional eukaryotic proteins have been delivered to modulate the host cell, as was done with nanobodies [19], nuclear proteins (Cre recombinase, MyoD) [20, 21], or interleukin-10 (IL10) and an interleukin-1 receptor antagonist. (IL1ra) [22]. None of the systems mentioned above allows for the delivery of a single protein, since in each case one or more endogenous effector proteins are additionally encoded. In addition, the vectors used have not been designed to allow easy cloning of other DNA fragments encoding the selected proteins, making this system difficult to apply widely.

Thus, a cheap and simple method that allows for scalable, fast, synchronized, homogeneous and controlled delivery of a protein of interest at physiological concentrations would be very useful to many cell biologists.

The essence of the invention

The present invention relates primarily to recombinant Gram-negative bacterial strains and their use in delivering heterologous proteins to eukaryotic cells. The present invention provides gram-negative bacterial strains and uses thereof that allow for the translocation of various type III and also type IV effectors, viral proteins and, most importantly, functional eukaryotic proteins. Means are provided for fluorescent tracking of delivery, relocalization to the nucleus and, in particular, removal of bacterial derivatives (remnants of bacterial origin) after delivery to the host cell. This allows for the first time the delivery of practically native proteins into a eukaryotic cell using only CC3T. The presented CC3T-based system results in scalable, fast, synchronized, homogeneous and controlled delivery of the protein of interest. The delivery system of the present invention is suitable for injecting eukaryotic proteins into live animals and can be used for therapeutic purposes.

In a first aspect, the present invention relates to a recombinant gram-negative bacterial strain selected from the group consisting of the bacterial genera Yersinia, Escherichia, Salmonella and

Pseudomonas, while the specified strain of gram-negative bacteria transformed with a vector that includes in the direction from the 5' end to the 3' end of the promoter;

a first DNA sequence encoding a delivery signal derived from a bacterial CC3T effector protein operably linked to said promoter; and a second DNA sequence encoding a heterologous protein fused in-frame to the 3' end of said first DNA sequence, the heterologous protein being selected from the group consisting of proteins involved in apoptosis or apoptosis regulation.

In a further aspect, the present invention relates to a recombinant Gram-negative bacterial strain transformed with a vector that includes a 5' to 3' promoter;

a first DNA sequence encoding a delivery signal from a bacterial CC3T effector protein operably linked to said promoter;

a second DNA sequence encoding a heterologous protein fused in the same reading frame to the 3' end of said first DNA sequence; and a third DNA sequence encoding a protease cleavage site, wherein the third DNA sequence is located between the 3'end of said first DNA sequence and the 5'end of said second DNA sequence.

In a further aspect, the present invention relates to a recombinant gram-negative bacterial strain, wherein the recombinant gram-negative bacterial strain is a Yersinia bacterial strain, and wherein said Yersinia strain is wild-type or deficient in the production of at least one CC3T effector protein, and the strain is transformed with a vector that includes a promoter in the direction from the 5' end to the 3' end;

a first DNA sequence encoding a delivery signal from an effector protein of the bacterial C3T system, wherein the delivery signal from the bacterial CC3T effector protein comprises the 138 N-terminal amino acids of the YopE effector protein of Y. enterocolitica operably linked to said promoter; and a second DNA sequence encoding a heterologous protein fused in the same reading frame to the 3' end of said first DNA sequence.

In a further aspect, the present invention relates to a recombinant gram-negative bacterial strain, wherein the recombinant gram-negative bacterial strain is a Salmonella bacterial strain, and wherein said Salmonella strain is wild-type or deficient in the production of at least one CC3T effector protein, and the strain is transformed with a vector that includes a promoter in the 5' to 3' direction;

a first DNA sequence encoding a delivery signal from a bacterial CC3T effector protein, wherein the delivery signal from a bacterial CC3T effector protein comprises a S. enterica SteA effector protein or 81 or 105 N-terminal amino acids of a S. enterica SopE effector protein operably linked to said promoter; and a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence.

In an additional aspect, the present invention relates to a vector that includes in the direction from the 5'end to the 3'end of the promoter;

a first DNA sequence encoding a delivery signal from a bacterial CC3T effector protein operably linked to said promoter;

a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence; and a third DNA sequence encoding a protease cleavage site, wherein the third DNA sequence is located between the 3'end of said first DNA sequence and the 5'end of said second DNA sequence.

The present invention further relates to a method for delivering a heterologous protein to the interior of a eukaryotic cell, comprising the following steps:

i) culturing a strain of gram-negative bacteria; and ii) bringing the eukaryotic cell into contact with the gram-negative bacterial strain of step i), wherein the fusion protein, which includes the delivery signal from the effector protein of the C3 system and the heterologous protein, is expressed by the gram-negative bacterial strain and translocated into the eukaryotic cell.

The present invention further relates to a method for delivering a heterologous protein into a eukaryotic cell, comprising the following steps:

i) culturing a strain of gram-negative bacteria;

ii) bringing the eukaryotic cell into contact with the gram-negative bacterial strain of step i), wherein the fusion protein, which includes the delivery signal from the effector protein of the C3T system and the heterologous protein, is expressed by the gram-negative bacterial strain and translocated into the eukaryotic cell; and iii) cleaving the fusion protein such that the heterologous protein is cleaved from the delivery signal from the effector protein of the C3T system.

The present invention further relates to a method for purifying a heterologous protein, comprising culturing a gram-negative bacterial strain such that a fusion protein that includes a delivery signal from a C3 system effector protein and a heterologous protein is expressed and secreted into the cell culture supernatant.

In a further aspect, the present invention relates to a library of gram-negative bacterial strains, wherein the heterologous protein encoded by the second DNA sequence of the gram-negative bacterial strains expression vector is a human or mouse protein, and wherein each of the human or murine proteins expressed by the gram-negative bacterial strain is different by amino acid sequence.

Brief description of the drawings

Fig. 1 - characteristics of the protein delivery carried out by CC3T. (A). Schematic representation of CC3T-dependent secretion of proteins into the surrounding nutrient medium (in vitro secretion) (left side) or into eukaryotic cells (right side). I shows the type 3 secretion system. II indicates proteins secreted into the surrounding nutrient medium, III - proteins translocated through the membrane into the cytosol of eukaryotic cells (VII). VI shows a section of two bacterial membranes into which CC3T is inserted, and the bacterial cytosol underneath. IV is a fusion protein attached to the N-terminal fragment of YopE1_ ₁₃₈ (V). (IN). Secretion in vitro: I: Y. enterocolitica E40 wild type, II: Y. enterocolitica AHOPEMT asd strain or III: Y. enterocolitica AHOPEMT asd strain + pBadSi_2, as revealed by Western blotting of total bacterial lysates (IV) and precipitated culture supernatants ( V) using an anti-YopE antibody.

Fig. 2 - characteristics of the CC3T delivery of proteins to epithelial cells. (A). AntiMus immunofluorescent staining performed on HeLa cells that were infected at a MOI of 100 for 1 h with strains I: Y. enterocolitica AHOPEMT asd or II: Y. enterocolitica AHOPEMT asd + pBad_Si2. (IN). Quantitative determination of the intensity of anti-Muimmunofluorescent antibody staining on (A) inside HeLa cells. Data were pooled from n=20 sites, the indicated error bars represent the standard deviation of the mean. I: uninfected cells, II: infection with Y. enterocolitica AHOPEMT asd or III: infection with Y. enterocolitica AHOPEMT asd + pBad_Si2. The y-axis denotes the intensity of anti-Mus staining [arbitrary units], the x-axis denotes the infection time in minutes. (WITH). Quantitative determination of the intensity of anti-Myc immunofluorescent staining inside cells. HeLa cells were infected for 1 h with Y. enterocolitica AHOPEMT asd + pBad_Si2 at MOI indicated on the x-axis. Data were pooled from n=20 sites, the indicated error bars represent the standard deviation of the mean. The y-axis denotes the intensity of anti-muscle dyeing [conventional units (c.u.)].

Fig. 3 - Modifications of CC3T-based protein delivery allow for nuclear localization of the YopE1_ ₁₃₈ fusion protein (using EGFP). Enhanced green fluorescent protein (EGFP) signal in HeLa cells infected with strain I: Y. enterocolitica AHOPEMT asd or II: Y. enterocolitica AHOPEMT asd AuopB carrying plasmids III: +YopE ₁ . ₁₃₈ -UZFB or IV: + YopE ₁ . ₁₃₈ -USFB-NLS at MOI 100. The USFB signal is shown in a, nuclei were stained for localization comparison in b.

Fig. 4 - modifications of protein delivery based on CC3T allow the removal of the YopE1_ ₁₃₈ residue. HeLa cells are infected with two different strains of Y. enterocolitica at the same time, which is achieved by simply mixing the two bacterial suspensions. One strain delivers _{a tobacco etch virus (TEV) protease fused to YopE 1-138 while} the other strain delivers a protein of interest fused to YopE1_ ₁₃₈ with a linker containing a double TEV protease cleavage site. Upon delivery of the protein into the eukaryotic cell, the TEV protease will cleave the YopE1_ ₁₃₈ residue from the protein of interest. (A). Digitonin-lysed HeLa cells, uninfected (II) or after infection (MOI 100) for 2 h with strain I: Y. enterocolitica AHOPEMT asd and III: + pBadSi_2, IV: +YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-Flag- INK4C, V: +YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-Flag-INK4C and overnight treatment with purified TEV protease and VI: +YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-Flag-INK4C and second strain + YopE ₁ . _138- TEV protease was analyzed by Western blotting with an anti-INK4C antibody (shown in a) for the presence of YopE1_ _138- (2 TEV protease cleavage sites)-Flag-INK4C or its cleaved form

- 3 041646

Flag-INK4C. Western blotting with anti-actin antibody was performed as a loading control (shown in b). In one case (V), lysed cells were incubated overnight with purified TEV protease. (IN). Actin-normalized quantification of the intensity of anti-INK4C staining (shown as [a.u.] on the y-axis) on (A) by the size of full-length YopE ₁ - ₁₃₈ - (2 TEV protease cleavage sites)-Flag-INK4C, where sample IV is taken for 100%. I: Y. enterocolitica AHOPEMT asd and IV: +YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-Flag-INK4C, V: +YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-Flag-INK4C and additional overnight treatment of purified TEV protease and VI: +YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-Flag-INK4C and the second strain + YopE1_ ₁₃₈ TEV protease. Data were pooled from n=2 independent experiments, the indicated error bars represent the standard deviation of the mean. (WITH). Digitonin-lysed HeLa cells uninfected (II) or after infection (MOI 100) for 2 h with strain I: Y. enterocolitica AHOPEMT asd and III: + pBadSi_2, IV: + YopE ₁ - ₁₃₈ - (2 TEV protease cleavage sites) -ET1 -Myc, V: + YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-ET1-Myc and overnight treatment with purified TEV protease and VI: + YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-ET1-Myc and second strain + YopE ₁ . _138- TEV protease was analyzed by Western blotting with an anti-Myc antibody (shown in a) for the presence of YopE1_ _138- (2 TEV protease cleavage sites)-ET1-Myc or its cleaved form, ET1-Myc. As a loading control, a Western blot was performed with an anti-actin antibody (shown in b). In one case (V), lysed cells were incubated overnight with purified TEV protease.

Fig. 5 - delivery of bacterial effector proteins into eukaryotic cells. (A). HeLa cells were infected with strain I: Y. enterocolitica AHOPEMT asd carrying II: pBad_Si2 or III: YopE1_ ₁₃₈ -SopE at MOI 100 for the time indicated at the top of the images (2, 10, or 60 min). After fixation, the actin cytoskeleton was stained in the cells. (IN). HeLa cells were left uninfected (II) or infected with strain I: Y. enterocolitica AHOPEMT asd carrying III: YopE1_ ₁₃₈ -SopE-Myc and in some cases co-infected with IV: YopE1_ ₁₃₈ -SptP at the MOI of the strain below (MOI 50; MOI 50:MOI 50 or MOI 50:MOI 100) for 1 h. After fixation, the cells were stained with the actin cytoskeleton (shown in a) and monitored for the presence of the YopE1_ _138- SopE-Myc fusion protein by anti-Myc antibody staining (shown in b ).

Fig. 6 - delivery of bacterial effector proteins into eukaryotic cells. (A). Western blot analysis of phospho-p38 (a), p38 total protein (b), and actin (c) on HeLa cells left untreated (II) or infected for 75 min at MOI 100 with strain I:Y. enterocolitica AHOPEMT asd carrying III: pBad_Si2 or IV: YopE1_ ₁₃₈ -OspF. Cells were stimulated with tumor necrosis factor alpha (TNF-α, TNFa) during the last 30 min of infection as indicated (+ denotes addition of TNF-α, − denotes no TNF-α treatment). (IN). Analysis of phospho-Akt T308 (a), and S473 (b), and actin (c) by Western blotting performed on HeLa cells that were left uninfected (II) or infected for 22.5 or 45 min (indicated below under blots) at MOI 100 with strain I: Y. enterocolitica AHOPEMT asd carrying III: pBad_Si2, IV: YopE1_ ₁₃₈ -SopE or V: YopE1_ ₁₃₈ -SopB. (WITH). cAMP levels (in fmol/well, shown on y-axis) in HeLa cells left untreated (I) or infected for 2.5 h at MOI 100 with strain V: Y. enterocolitica AHOPEMT asd + YopE1_ ₁₃₈ -BepA, VI: Y. enterocolitica AHOPEMT asd + YopE ₁ _ ₁₃₈ -BepA _E305 _ _end , VII: Y. enterocolitica AHOPEMT asd + YopE1. ₁₃₈ -BepGBid or VIII: Y. enterocolitica AHOPEMT asd + pBad_Si2. Cholera toxin (XT) was added for 1 hour as a positive control to samples II (1 μg/ml), III (25 μg/ml) or IV (50 μg/ml). Data were pooled from n=3 independent experiments, the indicated error bars represent the standard deviation of the mean. Statistical analysis was performed using a two-tailed unpaired Student's t-test (n.s. denotes non-significant change, ** denotes p-value <0.01, *** denotes p-value <0.001).

Fig. 7 - delivery of the human tBid protein into eukaryotic cells induces large-scale apoptosis. (A). Analysis of the p17 subunit of cleaved caspase 3 (a) and actin (b) by Western blotting performed on HeLa cells left untreated (II) or infected for 60 min at MOI 100 with strain I: Y. enterocolitica AHOPEMT asd bearing III: pBad_Si2, IV: YopE1_ ₁₃₈ -Bid or V: YopE1. ₁₃₈ -t-Bid. In some cases, cells were treated with VI: 0.5 μM staurosporine or VII: 1 μM staurosporine. (IN). Digitonin-lysed HeLa cells left untreated (II) or after infection for 1 h at MOI 100 with strain I: Y. enterocolitica AHOPEMT asd bearing III: pBad_Si2, IV: YopE1_ ₁₃₈ -Bid or V: YopE1_ ₁₃₈ -t-Bid , were analyzed by Western blotting with anti-Bid antibody (a), which allows comparison of the levels of endogenous Bid (marked Z) with the levels of translocated YopE _{1_ 138} -Bid (marked X) or YopE1_ ₁₃₈ -tBid (marked Y). Western blotting with anti-actin antibody was performed as a loading control (shown in b). In some cases, cells were treated with VI: 0.5 μM staurosporine or VII: 1 μM staurosporine. (WITH). HeLa cells were left untreated (I) or infected at MOI 100 for 1 h with strain II: Y. enterocolitica AHOPEMT asd + pBad_Si2, III: Y. enterocolitica AHOPEMT asd + YopE ₁ _ ₁₃₈ -Bid, IV: Y. en- 4 041646 terocolitica AHOPEMT asd + YopE ₁ - ₁₃₈ -tBid. In some cases, cells were treated with V: 0.5 μM staurosporine or VI: 1 μM staurosporine. After fixation, the cells were stained with the actin cytoskeleton (gray).

Fig. 8 - CC3T-dependent delivery of BIM protein to zebrafish induces apoptosis in zebrafish embryos. (A). Zebrafish embryos 2 days after fertilization were infected with a USFB-expressing control strain of Y. enterocolitica AHOPEMT asd + pBad_Si1 (I) or a translocating zBIM strain (II: Y. enterocolitica AHOPEMT asd + YopE _1-138 -zBIM) by injecting approximately 400 bacteria into the posterior region. brain. After 5.5 hours, the embryos were fixed, stained with activated caspase 3 (cleaved caspase 3, p17 subunit; shown in c) and analyzed for the presence of bacteria (UFP signal, shown in b). The maximum intensity of projections along the z-axis for fluorescent images is shown. The bright-field projection along the z-axis is shown in a. (IN). Automated image analysis by the maximum intensity of projections along the z-axis of the registered images of z-stacks from (A). Briefly, bacteria were detected through the green fluorescent protein (GFP) channel. A circle with a radius of 10 pixels was created around each area of the bacteria spot. The overlapping areas were divided equally among the contacting members. In these areas, densely surrounding the bacteria, the staining intensity of the p17 subunit of caspase 3 was measured and plotted on the y-axis (as [c.u.]). Statistical analysis was performed using the Mann-Whitney test (*** denotes p-value <0.001). Data were pooled from n=14 for control Y. enterocolitica AHOPEMT asd + pBad_Si1 (I) or from n=19 for animals infected with II: Y. enterocolitica AHOPEMT asd + YopE _1-138 -zBIM, error bars are standard deviation of the mean.

Fig. 9 - tBiD-dependent phosphoproteome. HeLa cells were infected for 30 min with Y. enterocolitica AHOPEMT asd + YopE ₁ - ₁₃₈ -t-Bid at MOI 100 and infected with Y. enterocolitica AHOPEMT asd + pBad_Si2 as a control. (A). Graphical representation of the tBID phosphoproteome. Proteins containing phosphopeptides that are highly regulated in a tBid-dependent manner (grey) (q-value <0.01) and apoptosis-associated known proteins (dark grey) are presented as a network according to STRING. known and suspected protein–protein interactions (high confidence, value 0.7). Only proteins with at least one bond in STRING are shown. (IN). Confocal images of HeLa cells infected with either Y. enterocolitica AHOPEMT asd + pBad_Si2 (I) or Y. enterocolitica AHOPEMT asd + YopE ₁ - ₁₃₈ -t-Bid (II) show the induction of an apoptotic phenotype as a result of tBid delivery. Cells were stained with nuclei with Hoechst stain (a), F-actin with phalloidin stain (b), tubulin with antibodies against tubulin (c), and mitochondria with mitotracker (d). The scale scale corresponds to 40 µm.

Fig. 10 is a description of delivery based on type III secretion instruments. (A). Vector maps of the cloning plasmids pBad_Si1 and pBad_Si2 used to generate constructs fused to YopE _1-138 . Chaperone SycE and YopE ₁ . _{The 138} -hybrid is under the control of the native Y. enterocolitica promoter. The two plasmids differ only in the presence of arabinose-induced UZFB present on the pBad_Si1 plasmid. (IN). The multiple cloning site immediately follows the YopE _1-138 fragment on plasmids pBad_Si1 and pBad_Si2.

Fig. 11 is a characterization of protein delivery by CC3T to various cell lines. AntiMus immunofluorescent staining performed on Swiss 3T3 fibroblasts (a), Jurkat cells (b), and HUVEC cells (c) left untreated (II) or infected with Y. enterocolitica AHOPEMT asd + pBad_Si2 (I) at the MOI indicated above over images (MOI 25, 50, 100, 200 and 400 for HUVEC cells), for 1 h.

Fig. 12 - dependence of the C3T system on the delivery of bacterial effector proteins into the eukaryotic cell. Digitonin-lysed HeLa cells after infection at MOI 100 for the time indicated above the blots (0, 5, 15, 10, 60, and 120 min) with Y. enterocolitica AHOPEMT asd AyopB + YopE ₁ - ₁₃₈ -SopE-Myc (I ) or Y. enterocolitica AHOPEMT asd + YopE ₁ - ₁₃₈ -SopE-Myc (II) were analyzed by Western blotting with anti-Myc antibody. The size corresponding to YopE ₁ - ₁₃₈ -SopE-Myc is indicated as a, while the size of the endogenous c-Myc protein is indicated as b.

Fig. 13 and 14 - CC3T-dependent secretion of various other proteins into the culture supernatant. In vitro secretion experiment with strain I: Y. enterocolitica AHOPEMT asd + YopE _1-138 fused to protein as indicated. The protein content of total bacterial lysates (A) and precipitated culture supernatants (B) was analyzed by Western blotting using an anti-YopE antibody. The numbers written indicate the molecular weight in kDa at the corresponding height.

Fig. 15A to 15M - Y. enterocolitica and S. enterica strains used in this study. List of Y. enterocolitica and S. enterica strains used in this study, providing information on background strains, plasmids, and CVD-dependent delivery proteins encoded on the respective plasmids. Additionally, information is provided on the oligonucleotides used to construct the corresponding plasmid, the host plasmid, and antibiotic resistance.

Fig. 16 - Delivery of the mouse tBid protein, the BH3 portion of the mouse Bid protein, and the BH3 portion of the mouse Bax protein to B16F10 cells induces extensive apoptosis. B16F10 cells uninfected (I) or after infection (MOI 50) for 2.5 h with Y. enterocolitica AHOPEMT asd and II: + pBadSi_2, III: +YopE ₁ . ₁₃₈ -codon-optimized for Y. enterocolitica tBid mouse, IV: + YopE ₁ . ₁₃₈ - (codon-optimized for mouse Y. enterocolitica Bid, BH3-part) or V: + YopE1_ ₁₃₈ - (codon-optimized for Y. enterocolitica Bax mouse, BH3-part). After fixation, the cells were stained for the actin cytoskeleton and nuclei (both gray).

Fig. 17 - Delivery of the mouse tBid protein, the BH3 portion of the mouse Bid protein, and the BH3 portion of the mouse Bax protein into D2A1 cells induces extensive apoptosis. D2A1 cells uninfected (I) or after infection (MOI 50) for 2.5 h with Y. enterocolitica AHOPEMT asd and II: + pBadSi_2, III: + YopE ₁ . ₁₃₈ codon-optimized for Y. enterocolitica tBid mouse, IV: + YopE ₁ . ₁₃₈ -(codon-optimized for mouse Y. enterocolitica Bid, BH3 part) or V: + YopE ₁ . ₁₃₈ - (codon-optimized for mouse Y. enterocolitica Bax, BH3-part). After fixation, the cells were stained for the actin cytoskeleton and nuclei (both gray).

Fig. 18 - Delivery of the mouse tBid protein, the BH3 portion of the mouse Bid protein, and the BH3 portion of the mouse Bax protein into HeLa cells induces extensive apoptosis. HeLa cells uninfected (I) or after infection (MOI 50) for 2.5 h with Y. enterocolitica AHOPEMT asd and II: + pBadSi_2, III: + YopE ₁ . ₁₃₈ -codon optimized for mouse Y. enterocolitica tBid, IV: + YopE ₁ . ₁₃₈ -(codon-optimized for mouse Y. enterocolitica Bid, BH3 part) or V: + YopE ₁ . ₁₃₈ (codon-optimized for mouse Y. enterocolitica Bax, BH3 part). After fixation, the cells were stained for the actin cytoskeleton and nuclei (both gray).

Fig. 19 - Delivery of the mouse tBid protein, the BH3 portion of the mouse Bid protein, and the BH3 portion of the mouse Bax protein into 4T1 cells induces extensive apoptosis. 4T1 cells uninfected (I) or after infection (MOI 50) for 2.5 h with Y. enterocolitica AHOPEMT asd and II: + pBadSi_2, III: + YopE ₁ . ₁₃₈ -codon optimized for mouse Y. enterocolitica tBid, IV: + YopE ₁ . ₁₃₈ -(codon-optimized for mouse Y. enterocolitica Bid, BH3 part) or V: + YopE ₁ . ₁₃₈ - (codon-optimized for mouse Y. enterocolitica Bax, BH3-part). After fixation, the cells were stained for the actin cytoskeleton and nuclei (both gray).

Fig. 20 - Delivery of tBid mice by S. enterica bacteria grown under conditions that induce SPI-1 of the C3T system into eukaryotic cells induces apoptosis. Analysis of the p17 subunit of cleaved caspase 3 by Western blotting performed on HeLa cells left untreated (I) or infected for 4 h at MOI 100 with strain III: S. enterica aroA carrying IV: SteA ₁ _ ₂₀ -t- Bid, V: SteA _FL -Bid, VI: SopE ₁ _ ₈₁ -t-Bid or VII: SopE ₁ _ ₁₀₅ -t-Bid. For this experiment, all strains of S. enterica aroA were grown under conditions that induce SPI-1 of the C3T system. In some cases, cells were treated with II: 1 μM staurosporine. The numbers written indicate the molecular weight in kDa at the corresponding height.

Fig. 21 - Delivery of mouse tBid protein by S. enterica bacteria grown under conditions that induce SPI-2 of the C3T system into eukaryotic cells induces apoptosis. Analysis of the p17 subunit of cleaved caspase 3 by Western blotting performed on HeLa cells left untreated (I) or infected for 4 h at MOI 100 with strain III: S. enterica aroA carrying IV: SteA ₁ _ ₂₀ -t- Bid, V: SteAFL-Bid, VI: SopE ₁ _ ₈₁ -t-Bid or VII: SopE ₁ _ ₁₀₅ -t-Bid. For this experiment, all S. enterica aroA strains were grown under conditions that induce SPI-2 of the C3T system. In some cases, cells were treated with II: 1 μM staurosporine. The numbers written indicate the molecular weight in kDa at the corresponding height.

Fig. 22 - CC3T-dependent secretion by S. enterica of various cell cycle proteins into the culture supernatant. In vitro secretion experiment with S. enterica aroA + SteAFL (I, III, V, VII) or + SopE ₁ _ ₁₀₅ (II, IV, VI, VIII) fused to the following listed proteins: I and II: Ink4aMycHis; III and IV: Ink4c-MycHis; V and VI: Mad2-MycHis; VII and VIII: Cdk1-MycHis. The protein content of precipitated culture supernatants (A) and total bacterial lysates and (B) was analyzed by Western blotting using anti-Myc antibody. The numbers written indicate the molecular weight in kDa at the corresponding height.

Fig. 23 - CC3T-dependent secretion of various known cell cycle disrupting peptides into the culture supernatant. In vitro secretion experiment with strain I: Y. enterocolitica AHOPEMT asd + pBad_Si2. II-VII: Y. enterocolitica strain AHOPEMT asd + YopE1_ ₁₃₈ fused with the following listed peptides: II: Ink4A84.1oz; III: p107/RBL16 ₅ 7-66 ₂ ; IV: p21141.160D149A; V: p21 _U5 .i6odi49a; VI: p21 ₁₇ _ ₃₃ ; VII: _{cyclin D2 139-147 .} The protein content of precipitated culture supernatants (A) and total bacterial lysates and (B) was analyzed by Western blot using an anti-YopE antibody. The numbers written indicate the molecular weight in kDa at the corresponding height.

Fig. The 24-fusion of the CC3T-delivered protein with ubiquitin allows the removal of the YopE1_ ₁₃₈ residue. HeLa cells are infected with a strain delivering a protein of interest, which is fused

- 6 041646 with _YopE1-138 directly fused to ubiquitin ( _YopE1.138 -Ubi). After the protein has been delivered into the eukaryotic cell, endogenous ubiquitin-specific proteases cleave the YopE _1-138 -Ubi residue from the protein of interest. Digitonin-lysed HeLa cells uninfected (I) or after infection (MOI 100) for 1 h with strain II: Y. enterocolitica AHOPEMT asd + YopE1_ ₁₃₈ -Flag-INK4CMycHis or III: + YopE _1-138 -Flag-ubiquitin-INK4C- MycHis was analyzed by Western blotting with anti-INK4C antibody for the presence of IV: YopE ₁ _ ₁₃₈ -Flag-ubiquitin-INK4C-MycHis or V: YopE1_ ₁₃₈ -Flag-INK4CMycHis, cleaved form VI: INK4C-MycHis and VII: endogenous INK4C.

Detailed description of the invention

The present invention provides recombinant Gram-negative bacterial strains and their use for delivering heterologous proteins into eukaryotic cells.

For the purposes of interpreting this description of the present invention, the following definitions will apply and, where appropriate, terms used in the singular will also include the plural forms and vice versa. It should be understood that the terminology used in this application is only intended to describe specific implementations and is not intended to be limiting.

The term Gram-negative bacterial strain used in this application includes the following bacteria: Aeromonas salmonicida, Aeromonas hydrophila, Aeromonas veronii, Anaeromyxobacter dehalogenans, Bordetella bronchiseptica, Bordetella bronchiseptica, Bordetella parapertussis, Bordetella pertussis, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia cepacia, Burkholderia mallei, Burkholderia pseudomallei, Chlamydia muridarum, Chlamydia trachmoatis, Chlamydophila abortus, Chlamydophila pneumoniae, Chromobacterium violaceum, Citrobacter rodentium, Desulfovibrio vulgaris, Edwardsiella tarda, Endozoicomonas elysicola, Erwinia amylovora, Escherichia albertii, Escherichia coli, Lawsonia intracellularis, Mesorhizobium loti, Myxococcus xanthus, Pantoea agglomerans , Photobacterium damselae, Photorhabdus luminescens, Photorabdus temperate, Pseudoalteromonas spongiae, Pseudomonas aeruginosa, Pseudomonas plecoglossicida, Pseudomonas syringae, Ralstonia solanacearum, Rhizobium sp, Salm onella enterica and other Salmonella spp., Shigella flexneri and other Shigella spp., Sodalis glossinidius, Vibrio alginolyticus, Vibrio azureus, Vibrio campellii, Vibrio caribbenthicus, Vibrio harvey, Vibrio parahaemolyticus, Vibrio tasmaniensis, Vibrio tubiashii, Xanthomonas axonopodis, Xanthomanthomantris, campsory, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis. Preferred gram-negative bacterial strains according to the present invention are gram-negative bacterial strains belonging to the Enterobacteriaceae and Pseudomonadaceae families. The gram-negative bacterial strain of the present invention is commonly used to deliver heterologous proteins by the bacterial CCT system into eukaryotic cells in vitro and in vivo.

The term recombinant gram-negative bacterial strain as used herein refers to a gram-negative bacterial strain genetically transformed with a vector. A suitable vector according to the present invention is, for example, an expression vector, a vector for chromosomal or virulence plasmid insertion, or a DNA fragment for chromosomal or virulence plasmid insertion.

The terms gram-negative bacterial strain deficient in the production of an amino acid essential for growth and auxotrophic mutant are used interchangeably herein and refer to gram-negative bacterial strains that cannot grow in the absence of at least one exogenously supplied essential amino acid or its precursor. The amino acid, in the production of which the strain is deficient, is, for example, aspartate, meso-2,6-diaminopimelic acid, aromatic amino acids or leucine-arginine [23]. Such a strain can be obtained, for example, by deleting the aspartate-b-semialdehyde dehydrogenase (Aasd) gene. Such an auxotrophic mutant cannot grow in the absence of exogenous meso-2,6-diaminopimelic acid [24]. Mutation, for example deletion of the aspartate-β semialdehyde dehydrogenase gene, is preferred in this application for a gram-negative bacterial strain deficient in producing the amino acid required for growth according to the present invention.

The term Gram-negative bacterial strain deficient in the production of adhesive proteins that bind to the eukaryotic cell surface or extracellular matrix refers to mutant strains of Gram-negative bacteria that do not express at least one adhesive protein compared to the adhesive proteins expressed by the corresponding wild-type strain. Adhesive proteins may include, for example, extended polymeric adhesive molecules such as pili/fimbriae or non-fimbriae adhesins. Fimbriated adhesins include type 1 pili (such as E. coli Fim pili with FimH adhesin), P pili (such as Pap pili with PapG adhesin from E. coli), type 4 pili (like pilin protein, for example from P . aeruginosa) or kurli (Csg proteins with CsgA adhesin from S. enterica). Non-fimbrial adhesive proteins include trimeric autotransport adhesins such as YadA from Y. enterocolitica, BpaA (B. pseudomallei), Hia (H. influenzae), BadA (B. henselae), NadA (N. meningitidis) or UspA1 (M catarrhalis), as well as other automotive adhesives such as AIDA-1

- 7 041646 (E. colt) as well as other adhesins/invasives such as InvA from Y. enterocolitica or intimin (E. coli) or members of the Dr or Afa family (E. coli). The terms YadA and InvA as used in this application refer to proteins from Y. enterocolitica. The YadA autotransport protein [25, 26] binds to various forms of collagen as well as fibronectin, while the invasion InvA [27-29] binds to β-integrins in the eukaryotic cell membrane. If the Gram-negative bacterial strain is a Y. enterocolitica strain, it is preferred that the strain is deficient in InvA and/or YadA.

As used herein, the family Enterobacteriaceae includes a family of Gram-negative, rod-shaped, facultative anaerobic bacteria found in soil, water, plants, and animals that are frequently found as pathogens in vertebrates. Bacteria from this family have similar physiology and show conservatism within the functional elements and genes of the respective genomes. In addition to being oxidase-negative, all members of this family ferment glucose and most are nitrate reducing agents.

The Enterobacteriaceae bacteria of the present invention may be any bacteria from this family and specifically include but are not limited to the following genera: Escherichia, Shigella, Edwardsiella, Salmonella, Citrobacter, Klebsiella, Enterobacter, Serratia, Proteus, Erwinia, Morganella, Providencia, or Yersinia . In more specific embodiments, the bacterium is Escherichia coli, Escherichia blattae, Escherichia fergusonii, Escherichia hermanii, Escherichia vuneris, Salmonella enterica, Salmonella bongori, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei, Enterobacter aerogenes, Enterobacter gergoviae, Enterobacter sakazakii, Enterobacter cloacae, Enterobacter agglomerans, Klebsiella pneumoniae, Klebsiella oxytoca, Serratia marcescens, Yersinia pseudotuberculosis, Yersinia pestis, Yersinia enterocolitica, Erwinia amylovora, Proteus mirabilis, Proteus vulgaris, Proteus penneri, Proteus hauseri, Providencia or Morganella maciens. Preferably, the gram-negative bacterial strain is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella, Shigella, Pseudomonas, Chlamydia, Erwinia, Pantoea, Vibrio, Burkholderia, Ralstonia, Xanthomonas, Chromobacterium, Sodalis, Citrobacter, Edwardsiella, Rhizobiae, Aeromonas, Photorhabdus, Bordetella and Desulfovibrio, more preferably from the group consisting of the genera Yersinia, Escherichia, Salmonella and Pseudomonas, most preferably from the group consisting of the genera Yersinia and Salmonella.

The term Yersinia as used in this application includes all Yersinia species including Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis. Yersinia enterocolitica is preferred.

The term Salmonella as used in this application includes all Salmonella species, including Salmonella enterica and S. bongori. Preferred species is Salmonella enterica.

The term promoter as used in this application refers to a nucleic acid sequence that regulates the expression of a transcription unit. A promoter region is a regulatory region capable of binding an RNA polymerase in a cell and initiating transcription of a downstream (3') coding sequence. Within the promoter region, a transcription initiation site (conveniently identified by S1 nuclease mapping) is found, as well as protein binding domains (consensus sequences) responsible for RNA polymerase binding, such as the putative -35 region and the Pribnow box.

The term operably linked when describing the relationship between two regions of DNA simply means that they are operably linked to each other and they are located on the same nucleic acid fragment. A promoter is operably linked to a structural gene if it controls the transcription of the gene and is located on the same nucleic acid fragment as the gene. As a rule, the promoter is functional in the specified strain of gram-negative bacteria, i. the promoter is capable of expressing the fusion protein of the present invention, i.e. the promoter is capable of expressing the fusion protein of the present invention without further intervention by genetic engineering or the expression of additional proteins. In addition, a functional promoter should not be a natural antagonist to the C3T system of bacteria.

The term delivery as used herein refers to the transport of a protein from a recombinant gram-negative bacterial strain into a eukaryotic cell, including the steps of expressing the heterologous protein in the recombinant gram-negative bacterial strain, secreting the expressed protein(s) from said gram-negative bacterial strain, and translocating the secreted protein(s) the specified strain of gram-negative bacteria inside the cytosol of a eukaryotic cell. Accordingly, the terms delivery signal or secretion signal, as used interchangeably herein, refers to a polypeptide sequence that can be recognized by the secretion or translocation system of a Gram-negative bacterial strain and that directs protein delivery from the Gram-negative bacterial strain to eukaryotic cells.

- 8 041646

As used herein, the term protein secretion refers to the outward transport of a heterologous protein across the cell membrane of a recombinant gram-negative bacterial strain. The term protein translocation refers to the transport of a heterologous protein from a recombinant strain of Gram-negative bacteria across the plasma membrane of a eukaryotic cell into the cytosol of said eukaryotic cell.

The term eukaryotic cells as used in this application includes, for example, the following eukaryotic cells: Hi-5, HeLa, Hek cells, HUVEC, 3T3, CHO, Jurkat, Sf-9, HepG2, Vero, MDCK, Mefs, THP-1 cells , J774, RAW, Caco2, NCI60, DU145, Lncap, MCF-7, MDA-MB-438, PC3, T47D, A549, U87, SHSY5Y, Ea.Hy926, Saos-2, 4T1, D2A1, B16F10 and primary human hepatocytes . The term eukaryotic cells as used in this application also refers to target cells or eukaryotic target cells.

The term C3T system effector protein as used in this application refers to proteins injected naturally by C3T systems into the cytosol of eukaryotic cells and to proteins naturally secreted by C3T systems that can, for example, form a translocation pore in the eukaryotic membrane. (including pore-forming translocator proteins (like YopB and YopD Yersinia) and needle-tip proteins like LcrV Yersinia). Preferably, proteins are used that are naturally injected by C3T systems into the cytosol of eukaryotic cells. These virulence factors will paralyze or reprogram the eukaryotic cell to the benefit of the pathogen. Effectors of the C3T system demonstrate a wide range of biochemical activities and modulate the function of key regulatory molecules of the host cell [5, 30] and include

Avra,

AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrDl, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, AvrRpml, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS, ExoT, GogB, GtgA, GtgE, protein family GALA, HopAB2, HopAOl, Hopll, HopMl, HopNl, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, HopUl, HsvB, IcsB, IpaA, IpaB, IpaC, IpaH, IpaH7.8, IpaH9.8, IpgBl, IpgB2, IpgD, LcrV, Map, OspCl, OspE2, OspF, OspG, OspI, PipB, PipB2, PopB, PopP2, PthXol, PthXo6, PthXo7, SifA, Siffi, SipA/SspA, SipB, SipC/SspC, SipD/SspD, SlrP, SopA, SopB/SigD, SopD, SopE, SopE2, SpiC/SsaB, SptP, SpvB, SpvC, SrfH, Srfl, Sse, SseB, SseC, SseD, SseF, SseG, SseESrfH, SseJ, SseKl, SseK2, SseK3, SseL, SspHl, SspH2, SteA, SteB, SteC, SteD, SteE, TccP2, Tir, VirA, VirPphA, VopF, XopD, YopB, YopD YopE, YopH, YopJ, YopM, YopO, YopP, YopT, YpkA.

The effector genes of the C3T system of Yersinia bacteria were cloned, for example, from Y. enterocolitica; they are the YopE, YopH, YopM, YopO, YopP/YopJ, and YopT genes [31]. Appropriate effector genes can be cloned from Shigella flexneri (eg OspF, IpgD, IpgB1), Salmonella enterica (eg SopE, SopB, SptP), P. aeruginosa (eg ExoS, ExoT, ExoU, ExoY) or E. coli (eg , Tir, Map, EspF, EspG, EspH, EspZ). The nucleic acid sequences of these genes are available to those skilled in the art, for example, from the Genebank database (yopH, yopO, yopE, yopP, yopM, yopT from NC_002120 GI:10955536; S. flexneri effector proteins from AF386526.1 GI:18462515; effectors S. enterica from NC_016810.1 GI:378697983 or FQ312003.1 GI:301156631; P. aeruginosa effectors from AE004091.2 GI: 110227054 or CP000438.1 GI:115583796 and F. coli effector proteins from NC_0116015) .

For the purposes of the present invention, genes are indicated in lowercase letters and in italics to distinguish them from proteins. When genes (denoted in lower case and in italics) follow the name of a bacterial species (as in E. coli), they refer to a mutation of the corresponding gene in the corresponding bacterial species. For example, YopE refers to the effector protein encoded by the yopE gene. Y. enterocolitica yopE refers to the bacterium Y. enterocolitica having a mutation in the yopE gene.

Used in this application, the terms polypeptide, peptide, protein, polypeptide and peptide are used interchangeably to refer to a series of amino acid residues connected to each other by peptide bonds between the α-amino group and the carboxyl group of adjacent residues. Preferred are proteins that have an amino acid sequence of at least 10 amino acids, more preferably at least 20 amino acids.

According to the present invention, the term heterologous protein includes naturally occurring proteins or parts thereof, and also includes artificially genetically engineered proteins or parts thereof. Used in this application, the term heterologous protein refers to a protein or part thereof, other than the effector protein of the C3T system or its N-terminal fragment, with which it can be fused. In particular, the term heterologous protein, as used in this application,

- 9 041646 refers to a protein or part of it that does not belong to the proteome, i.e. a whole natural set of proteins of a specific recombinant strain of gram-negative bacteria proposed and used according to the present invention, for example, which does not belong to the proteome, i.e. a whole natural set of proteins of a specific strain of bacteria of the genera Yersinia, Escherichia, Salmonella or Pseudomonas. Typically, a heterologous protein is of animal origin, including human origin. Preferably the heterologous protein is a human protein. More preferably, the heterologous protein is selected from the group consisting of proteins involved in apoptosis or regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR-related proteins (GPCR - receptor, associated with G-protein), constructs fused with nanobodies and nanobodies, effectors of the C3T system of bacteria, effectors of the type 4 secretion system (CC4T) of bacteria and viral proteins. Particularly preferably, the heterologous protein is selected from the group consisting of proteins involved in apoptosis or regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR-related proteins, constructs fused to nanobodies, effectors of the C3T system. bacteria, bacterial CC4T effectors (type 4 secretion system), and viral proteins. Even more preferred are heterologous proteins selected from the group consisting of proteins involved in apoptosis or the regulation of apoptosis, cell cycle regulators and ankyrin repeat proteins. Most preferred are proteins involved in apoptosis or the regulation of apoptosis, such as animal, preferably heterologous human proteins involved in apoptosis or the regulation of apoptosis.

In some embodiments, the Gram-negative bacterial strain vector of the present invention comprises two second DNA sequences encoding identical heterologous proteins or two different heterologous proteins fused independently in-frame to the 3' end of said first DNA sequence. In some embodiments, the Gram-negative bacterial strain vector of the present invention comprises three second DNA sequences encoding identical heterologous proteins or three different heterologous proteins fused independently in-frame to the 3' end of said first DNA sequence.

The heterologous protein expressed by the recombinant gram-negative bacterial strain typically has a molecular weight of 1 to 150 kDa, preferably 1 to 120 kDa, more preferably 1 to 100 kDa, most preferably 15 to 100 kDa.

According to the present invention, proteins involved in apoptosis or regulation of apoptosis include Bad, Bcl2, Bak, Bmt, Bax, Puma, Noxa, Bim, Bcl-xL, Apaf1, caspase 9, caspase 3, caspase 6, caspase 7, caspase 10, DFFA (DNA fragmentation factor α subunit), DFFB (DNA fragmentation factor β subunit), ROCK1 (Rho-related protein kinase 1), APP (amyloid precursor protein), CAD (caspase-activated DNase), ICAD (caspase-activated DNase inhibitor), CAD, EndoG, AIF, HtrA2, Smac/Diablo, Arts, ATM (ataxia-telangiectasia mutant protein kinase), ATR (ATM-related kinase), Bok/Mtd, Bmf, Mcl-1(S), IAP family (inhibitor protein apoptosis), LC8 (dynein light chain 1), PP2B (protein phosphatase 2B), proteins 14-3-3, PKA (protein kinase A), PKC (protein kinase C), PI3K (phosphatidylinositol-3-kinase), Erk1/2, p90RSK , TRAF2 (tumor necrosis factor receptor (TNRF)-associated factor 2), TRADD (protein interacting with the death domain of the TNFR1 receptor), FADD (protein interacting Fas receptor death domain), Daxx, caspase 8, caspase 2, RIP (receptor-interacting protein), RAIDD (RIP-associated homologous Ich-1/Ced-3 death domain containing protein), MKK7 (mitogen- activated protein kinase kinase 7), JNK (c-Jun N-terminal protein kinase), FLIP (FLICE (FADD-like interleukin-1b-converting enzyme) inhibitory protein), FKHR (forkhead family transcription factor), GSK3 (glycogen synthase kinase 3) , cyclin-dependent kinases (CDKs) and their inhibitors, such as the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)), and the Cip1/Waf1/Kip1-2 family (p21(Cip1/Wafl ), p27(Kip1), p57(Kip2), but are not limited to them. Preferably, Bad, Bmt, Bcl2, Bak, Bax, Puma, Noxa, Bim, Bcl-xL, caspase 9, caspase 3, caspase 6, caspase 7, Smac/Diablo, Bok/Mtd, Bmf, Mcl-1(S ), LC8, PP2B, TRADD, Daxx, caspase 8, caspase 2, RIP, RAIDD, FKHR, cyclin-dependent kinases (CDKs) and their inhibitors, like the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)), most preferably BIM, Bid, truncated Bid, FADD, caspase 3 (and its subunits), Bax, Bad, Akt, cyclin-dependent kinases (CDKs) and their inhibitors like the INK4 family (p16(Ink4a) , p15(Ink4b), p18(Ink4c), p19(Ink4d)) [32-34]. Additionally, proteins involved in apoptosis or regulation of apoptosis include DIVA, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bid and tBid, Egl-1, Bcl-Gs, Cytochrome C, Beclin, CED-13, BNIP1, BNIP3 , Bcl-B, Bcl-W, Ced-9, A1, NR13, Bfl-1, caspase 1, caspase 2, caspase 4, caspase 5, caspase 8. Proteins involved in apoptosis or regulation of apoptosis are selected from the group consisting of of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of anti-apoptosis pathways, and inhibitors of signaling or survival pathways. Proapoptotic proteins include proteins selected from the group consisting of Bax, Bak,

- 10 041646

Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apafl, Smac/Diablo, BNIP1, BNIP3, Bcl-Gs, becklin 1, Egl-1 and CED-13, cytochrome C, FADD, the caspase and cyclin-dependent kinase (CDK) families and their inhibitors, such as the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)), or proteins, selected from the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Egl-1, Apaf1, Smac/Diablo, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Cytochrome C, FADD and the caspase family. Preferred are Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and fflid, Bok, Egl-1, Apafl, BNIP1, BNIP3, Bcl-Gs, beclin 1, Egl-1 and CED-13, Smac/Diablo, FADD, caspase family, cyclin-dependent kinases (CDKs) and their inhibitors, like the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19( Ink4d)). Equally preferred are Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and fflid, Bok, Apafl, BNIP1, BNIP3, Bcl-Gs, becklin 1, Egl-1 and CED-13, Smac/Diablo, FADD, caspase family.

Anti-apoptotic proteins include proteins selected from the group consisting of Bcl-2, Bcl-Xl, BclB, Bcl-W, Mcl-1, Ced-9, A1, NR13, the IAP family and Bfl-1. Preferred are Bcl-2, Bcl-Xl, Bcl-B, Bcl-W, Mcl-1, Ced-9, Al, NR13 and Bfl-1.

Anti-apoptosis pathway inhibitors include proteins selected from the group consisting of Bad, Noxa and Cdc25A. Bad and Noxa are preferred.

Inhibitors of signaling or survival pathways include proteins selected from the group consisting of PTEN (phosphatase and tensin homologue protein deleted on chromosome 10), ROCK, PP2A, PHLPP (leucine rich repeat plextrin homologous domain protein phosphatase) , JNK, p38. The PTEN, ROCK, PP2A and PHLPP proteins are preferred.

In some embodiments, the heterologous proteins involved in apoptosis or regulation of apoptosis are selected from the group consisting of BH3-only proteins (BH3-only proteins, BH3only proteins), caspases, and intracellular signaling proteins involved in the control of apoptosis by death receptors.

BH3 proteins only include proteins selected from the group consisting of Bad, BIM, Bid and tBid, Puma, Bik/Nbk, Bod, Hrk/Dp5, BNIP1, BNIP3, Bmf, Noxa, Mcl-1, Bcl-Gs, Beclin 1, Egl-1 and CED-13. Bad, BIM, Bid and tBid are preferred.

Caspases include proteins selected from the group consisting of caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10. Preferred are caspase 3, caspase 8 and caspase 9 .

Intracellular signaling proteins involved in the control of apoptosis by death receptors include proteins selected from the group consisting of FADD, TRADD, ASC (Apoptosis-associated speck-like protein containing a CARD domain), BAP31, GULP1/CED-6, CIDEA ( DNA fragmentation factor-inducing cell death α effector A), MFG-E8, CIDEC (DNA fragmentation factor-inducing cell death α effector C), RIPK1/RIP1 (RIPK1 serine-threonine receptor-interacting protein kinase 1), CRADD (caspase adapter protein and death domain-containing RIP), RIPK3/RIP3, Crk, SHB, CrkL, DAXX, family 14-3-3, FLIP, DFF40 (DNA fragmentation factor 40) and 45, PEA-15 (phosphoprotein elevated in astrocytes-15 ), SODD (death domain silencer protein). FADD and TRADD are preferred.

In some embodiments, two heterologous proteins involved in apoptosis or the regulation of apoptosis are included in the vector of the Gram-negative bacterial strain of the present invention, where one protein is a pro-apoptotic protein and the other protein is an inhibitor of apoptosis-preventing pathways, or where one protein is pro-apoptotic protein, and the other protein is an inhibitor of the signaling system or pathways that promote survival.

Proapoptotic proteins encompassed by the present invention typically have an α-helical structure, preferably a hydrophobic helix surrounded by amphipathic helices, and typically contain at least one of BH1, BH2, BH3 or BH4 domains, preferably contain at least one BH3- domain. As a rule, proapoptotic proteins covered by the present invention do not have enzymatic activity.

The term protease cleavage site as used herein refers to a specific amino acid motif within an amino acid sequence, such as within the amino acid sequence of a protein or fusion protein, that is cleaved by a specific protease that recognizes that amino acid motif. See the review in [35]. Exemplary protease cleavage sites are amino acid motifs that are cleaved by a protease selected from the group consisting of enterokinase (light chain), enteropeptidase, PreScission protease (a hybrid protease based on human rhinovirus 3C protease and glutathione-S-transferase), human rhinovirus protease ( human rhinovirus (HRV) 3C protease), tobacco etch virus (TEV) protease, tobacco mosaic vein virus (TVMV) protease, blood factor Xa and thrombin proteases.

The following amino acid motif is recognized by the corresponding protease: Asp-Asp-Asp-Asp-Lys: enterokinase (light chain)/enteropeptidase,

Leu-Glu-Val-Leu-Phe-Gln/Gly-Pro: PreScission Protease/Human Rhinovirus Protease (Protease 3C

- 11 041646

HRV),

Glu-Asn-Leu-Tyr-Phe-Gln-Ser and modified motifs based on the sequence Glu-X-XTyr-X-Gln-Gly/Ser (where X is any amino acid) recognized by the TEV protease (tobacco etch virus) Glu -Thr-Val-Arg-Phe-Gln-Ser: TVMV protease,

Ile-(Glu or Asp)-Gly-Arg: blood factor Xa protease,

Leu-Val-Pro-Arg/Gly-Ser: thrombin.

The protease cleavage sites used herein include ubiquitin. Thus, in some preferred embodiments of the present invention, ubiquitin is used as a protease cleavage site, i. the third DNA sequence encodes ubiquitin as a protease cleavage site, which can be cleaved by specific ubiquitin-processing proteases at the N-terminal site, for example, which can be cleaved by specific ubiquitin-processing proteases called deubiquitinating enzymes, at the N-terminal site endogenously in the cell, where the fusion protein was delivered. Processing of ubiquitin at its C-terminus is carried out by a group of endogenous ubiquitin-specific C-terminal proteases (deubiquitinating enzymes, DUB). Cleavage of ubiquitin by deubiquitinating enzymes presumably occurs at the very C-terminus of ubiquitin (after G76).

The individual, subject, or patient is a vertebrate. In certain embodiments, the vertebrate is a mammal. Examples of mammals include, but are not limited to, primates (including humans and other primates) and rodents (eg, mice and rats). In certain embodiments, the mammal is a human.

The term mutation is used in this application as a general term and includes changes in both a single base pair and multiple base pairs. Such mutations may include substitutions, frameshift mutations, deletions, insertions, and truncations.

The term tag molecule or acceptor site for a tag molecule as used in this application refers to the binding of a small chemical compound to a specific amino acid sequence resulting in fluorescence of the bound chemical compound, preferred examples of which are the coumarin ligase/coumarin acceptor site (and its derivatives), a resorufin ligase/resorufin acceptor site (and its derivatives) and a tetracysteine motif (as Cys-Cys-Pro-Gly-Cys-Cys and its derivatives) when used with a FlAsH/ReAsH dye (Life technologies) or a fluorescent protein such as enhanced green fluorescent protein (UFP).

The term nuclear localization signal as used herein refers to an amino acid sequence that marks a protein for import into the nucleus of a eukaryotic cell and includes preferably a viral nuclear localization signal, such as the SV40 virus large T antigen nuclear localization signal (NSL) (PPKKKRKV).

The term multiple cloning site as used in this application refers to a short DNA sequence containing multiple restriction sites for cleavage by restriction endonucleases such as

- 12 041646

Acll, Hindll,

SspI, MluCI, Tsp509I, Pcil, Agel, BspMI, BfuAI, SexAI, MluI, BceAI, HpyCH4IV, HpyCH4III, Bael, BsaXI, AflIII, Spel, Bsrl, BmrI, Bglll, Afel, Alul, Stul, Seal, Clal, BspDI, PI-SceI, Nsil, Asel, Sval, CspCI, Mfel, BssSI, BmgBI, Pmll, Dralll, Alel, EcoP15I, PvuII, AlwNI, BtsIMutl, TspRI, Ndel, Nlalll, CviAII, Fatl, MslI, FspEI, Xcml, BstXI, PflMI, Bed, Ncol, BseYI, Faul, Smal, Xmal, TspMI, Nt.CviPII, LpnPI, Acil, Sadi, BsrBI, MspI, Hpall, ScrFI, BssKI, StyD4I, BsaJI, BslI, Btgl, Neil, Avril, Mnll, BbvCI, Nb.BbvCI, Nt.BbvCI, Sbfl, BpulOI, Bsu36I, EcoNI, HpyAV, BstNI, PspGI, Styl, Bcgl, Pvul, BstUI, EagI, Rsrll, BsiEI, BsiWI, BsmBI, Hpy99I, MspAlI, MspJI, SgrAI, Bfal, BspCNI, Xhol, Earl, Acul, PstI, Bpml, Ddel, Sfd, Aflll, BpuEI, Smll, Aval, BsoBI, MboII, BbsI, XmnI, BsmI, Nb.BsmI, EcoRI, Hgal, Aatll, Zral, Tthllll PflFI , PshAI, AhdI, DrdI, Eco53kl, Sad, BseRI, Piel, Nt.BstNBI, Mlyl, Hinfl, EcoRV, Mbol, Sau3AI, DpnII BfuCI, Dpnl, BsaBI, Tfil, BsrDI, Nb.BsrDI, Bbvl, BtsI, Nb. BtsI, BstAPI, Sf aNI, SphI, NmeAIII, Nael, NgoMIV, Bgll, AsiSI, BtgZI, HinPlI, Hhal, BssHII, Notl, Fnu4HI, Cac8I, Mwol, Nhel, Bmtl, SapI, BspQI, Nt.BspQI, BlpI, Tsel, ApeKI, Bsp 12861 , Alwl, Nt.AlwI, BamHI, FokI, BtsCI, Haelll, Phol, Fsel, Sfil, Nari, KasI, Sfol, PluTI, Asd, Ecil, BsmFI, Apal, PspOMI, Sau96I, NlalV, Kpnl, Acc65I, Bsal, HphI , BstEII, Avail, BanI, BaeGI, BsaHI, Banll, Rsal, CviQI, BstZ17I, BciVI, Sall, Nt.BsmAI, BsmAI, BcoDI, ApaLI, Bsgl, Acd, Hpyl66II, Tsp45I, Hpal, Pmel, Hindi, BsiHKAI, Apol , NspI, BsrFI, BstYI, Haell, CviKI-1, EcoO109I, PpuMI, I-Ceul, SnaBI, I-Scel, BspHI, BspEI, Mmel, TaqaI, Nrul, Hpyl88I, Hpy188III, Xbal, Bell, HpyCH4V, FspI, PI -PspI, Msd, BsrGI, Msel, Pad, Psil, BstBI, Dral, PspXI, BsaWI, BsaAI, Eael, preferably Xhol, Xbal, Hindll, Ncol, Notl, EcoRI, EcoRV, BamHI, Nhel, Sad, Sall, BstBI.

The term multiple cloning site as used herein further refers to a short DNA sequence used for recombination events such as in the Gateway cloning strategy or for methods such as Gibbson assembly cloning or topo cloning.

The term wild-type Yersinia strain as used herein refers to a naturally occurring variant (as Y. enterocolitica E40 strain) or a naturally occurring variant containing genetic modifications to allow the use of vectors, such as deletion mutations in restriction endonuclease genes or resistance genes. to antibiotics (as Y. enterocolitica MRS40 strain, ampicillin-sensitive derivative of Y. enterocolitica E40 strain). These strains contain chromosomal DNA as well as an unmodified virulence plasmid (called pYV).

The term include is mainly used in the sense of containing, i.e. allow for the presence of one or more features or components.

In one embodiment, the present invention provides a recombinant gram-negative bacterial strain, wherein the gram-negative bacterial strain is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella, and Pseudomonas. In one embodiment, the present invention provides a recombinant gram-negative bacterial strain, wherein the gram-negative bacterial strain is selected from the group consisting of the genera Yersinia and Salmonella. Preferably, the gram-negative bacteria strain is a Yersinia strain, more preferably a Yersinia enterocolitica strain. Most preferred is the Yersinia enterocolitica E40 strain [13] or its ampicillin-sensitive derivatives such as the Y. enterocolitica MRS40 strain as described in [36]. It is also preferred that the Gram-negative bacteria strain is a Salmonella strain, more preferably a Salmonella enterica strain. Most preferred is Salmonella enterica Serovar Typhimurium strain SL1344 as described by the UK Department of Health Culture Collection (NCTC 13347).

In one embodiment of the present invention, the delivery signal from a bacterial C3T system effector protein comprises a bacterial C3T system effector protein or an N-terminal fragment thereof, wherein the C3T system effector protein or its N-terminal fragment may include a chaperone binding site. The effector protein of the C3T system, or its N-terminal fragment, which includes a chaperone binding site, is particularly useful as a delivery signal according to

- 13 041646 of the present invention. Preferred effector proteins of the C3T system or their N-terminal fragments are selected from the group consisting of protein

SopE, SopE2, SptP, YopE,

ExoS, SipA, SipB, SipD, Sop A, SopB, SopD, IpgBl, IpgD, SipC, SifA, SseJ, Sse, SrfH, YopJ, AvrA, AvrBsT, YopT, YopH, YpkA, Tir, EspF, TccP2, IpgB2, OspF , Map, OspG, OspI, IpaH, SspHl, VopF, ExoS, ExoT, HopAB2, XopD, AvrRpt2, HopAOl, HopPtoD2, HopUl, GALA protein families, AvrBs2, AvrDl, AvrBS3, YopO, YopP, YopE, YopM, YopT, EspG , EspH, EspZ, IpaA, IpaB, IpaC, VirA, IcsB, OspCl, OspE2, IpaH9.8, IpaH7.8, AvrB, AvrD, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, VirPphA, AvrRpml, HopPtoE, HopPtoF , HopPtoN, PopB, PopP2, AvrBs3, XopD and AvrXv3.

More preferred effector proteins of the C3T system, or N-terminal fragments thereof, are selected from the group consisting of

SopE, SptP, YopE, ExoS, SopB, IpgBl, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE, YopM, YopT, from which the most preferred effector proteins of the C3 system or their N-terminal fragments are selected from group consisting of IpgB 1,

SopE, SopB, SptP, OspF, IpgD, YopH, YopO, YopP, YopE, YopM, YopT, more specifically YopE or an N-terminal fragment thereof.

Equally preferred effector proteins of the C3T system or their N-terminal fragments are selected from the group consisting of the protein

SopE, SopE2, SptP, SteA,

SipA, SipB, SipD, SopA, SopB, SopD, IpgBl, IpgD, SipC, SifA, SifB, SseJ, Sse, SrfH, YopJ, AvrA, AvrBsT, YopH, YpkA, Tir, EspF, TccP2, IpgB2, OspF, Map, OspG, OspI, IpaH, VopF, ExoS, ExoT, HopAB2, AvrRpt2, HopAOl, HopUl, GALA protein families, AvrBs2, AvrDl, YopO, YopP, YopE, YopT, EspG, EspH, EspZ, IpaA, IpaB, IpaC, VirA, and AvrXv3.

Equally preferred C3T system effector proteins or N-terminal fragments thereof are selected from the group consisting of

sope,

SptP, SteA, SifB, SopB, IpgBl, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE,

YopT, from which the most preferred effector proteins of the C3T system or their N-terminal fragments are selected from the group consisting of

IpgBl, SopE, SopB, SptP, SteA, SifB, OspF, IpgD, YopH, YopO, YopP, YopE and YopT, more specifically SopE, SteA or YopE or its N-terminal fragment, more specifically SteA or YopE or its N-terminal fragment , most specifically YopE or its N-terminal fragment.

In some embodiments, the delivery signal from the bacterial C3T system effector protein encoded by the first DNA sequence includes the bacterial C3T system effector protein or an N-terminal fragment thereof, wherein its N-terminal fragment includes at least the first 10, preferably at least the first 20, more preferably at least the first 100 amino acids of the effector protein of the bacterial C3T system.

In some embodiments, the delivery signal from a bacterial C3T system effector protein encoded by the first DNA sequence includes a bacterial C3T system effector protein or an N-terminal fragment thereof, wherein the bacterial C3T system effector protein or an N-terminal fragment thereof includes a chaperone binding site.

Preferred C3T system effector proteins or N-terminal fragments thereof that include a chaperone binding site include the following combinations of a chaperone binding site and a C3T system effector protein or N-terminal fragment thereof:

SycE-YopE, InvB-SopE, SicP-SptP, SycT-YopT, SycO-YopO, SycN/YscB-YopN,

SycH-YopH, SpcS-ExoS, CesF-EspF, SycD-YopB, SycD-YopD.

More preferred are

SycE-YopE, InvB-SopE, SycT-YopT, SycO-YopO, SycN/YscB-YopN, SycH-YopH,

- 14 041646

SpcS-ExoS, CesF-EspF.

Most preferred is YopE or an N-terminal fragment thereof comprising a SycE chaperone binding site, such as the N-terminal fragment of the YopE effector protein containing the 138 N-terminal amino acids of the YopE effector protein, referred to herein as YopE _1-138 and as shown in the SEQ sequence ID NO: 2, or SopE or an N-terminal fragment thereof, comprising an InvB chaperone binding site, such as an N-terminal fragment of the SopE effector protein containing 81 or 105 N-terminal amino acids of the SopE effector protein, designated in this application, respectively, as SopE _{1 -81} or SopE _1-105 and as shown in SEQ ID NO: 142 or 143.

In one embodiment of the present invention, the recombinant gram-negative bacterial strain is a Yersinia strain and the delivery signal from the bacterial C3T system effector protein encoded by the first DNA sequence comprises the YopE effector protein or its N-terminal portion, preferably the Y. enterocolitica YopE effector protein or its N-terminal. Preferably, the SycE binding site is included in the N-terminal portion of the YopE effector protein. In this regard, the N-terminal fragment of the YopE effector protein can include 12, 16, 18, 52, 53, 80, or 138 N-terminal amino acids [10, 37, 38]. Most preferred is the N-terminal fragment of the YopE effector protein, _containing the 138 N-terminal amino acids of the YopE effector protein, e.g. SEQ ID NO: 2.

In one embodiment of the present invention, the recombinant Gram-negative bacterial strain is a Salmonella strain and the delivery signal from the bacterial C3T system effector protein encoded by the first DNA sequence comprises a SopE or SteA effector protein or an N-terminal portion thereof, preferably a Salmonella SopE or SteA effector protein enterica or its N-terminal portion. Preferably, the chaperone binding site is included in the N-terminal portion of the SopE effector protein. In this regard, the N-terminal fragment of the SopE effector protein may include 81 or 105 N-terminal amino acids. Most preferred is the full-length SteA effector protein and an N-terminal fragment of the SopE effector protein containing the 105 N-terminal amino acids of the effector protein, for example, as described in SEQ ID NO: 142 or 143.

One skilled in the art is familiar with methods for identifying effector protein polypeptide sequences capable of delivering the protein. For example, one such method is described by Sory et al. [13]. Briefly, in-frame fusion of polypeptide sequences from, for example, various portions of Yop proteins with a reporter enzyme, such as the calmodulin-activated adenylate cyclase domain (or Cya) of Bordetella pertussis cyclosin, can be performed. Delivery of the Yop-Cya fusion protein into the cytosol of eukaryotic cells is demonstrated by the appearance of cyclase activity in infected eukaryotic cells, which leads to the accumulation of cAMP. Using such an approach, one skilled in the art can determine, if desired, a minimum sequence size requirement, i.e. a continuous amino acid sequence of the shortest length that is capable of delivering a protein, see, for example, [13]. Accordingly, the preferred delivery signals of the present invention consist of at least the minimum amino acid sequence of the effector protein of the C3T system that is capable of delivering the protein.

In one embodiment, the present invention provides mutant recombinant gram-negative bacterial strains, in particular recombinant gram-negative bacterial strains, that are deficient in the production of at least one functional effector protein of the C3T system.

According to the present invention, such a mutant strain of gram-negative bacteria, for example, such a mutant strain of Yersinia, can be obtained by introducing at least one mutation in at least one coding effector gene. Preferably, such effector-encoding genes include ^Yo P ^E ' ^Yo PH YopO/YpkA, YopM, YopP/YopJ and YopT in the case of a Yersinia strain. Preferably, such effector-coding genes include

AvrA, CigR, GogB, GtgA, GtgE, PipB, SifB, SipA/SspA, SipB, SipC/SspC, SipD/SspD, SlrP,

SopB/SigD, SopA, SpiC/SsaB, SseB, SseC, SseD, SseF, SseG, Ssel/SrfH, SopD, SopE, SopE2,

SspHl, SspH2, PipB2, SifA, SopD2, SseJ, SseKl, SseK2, SseK3, SseL, SteC, SteA, SteB, SteD, SteE, SpvB, SpvC, SpvD, Srfl, SptP in the case of a Salmonella strain. More preferably, all effector-coding genes are removed. One skilled in the art can use any number of standard techniques to generate mutations in these C3T system effector genes. Sambrook et al. describes such techniques in general terms. See Sambrook et al. [40].

In accordance with the present invention, a mutation can be obtained in the promoter region of a gene encoding an effector such that expression of such an effector gene is stopped. Mutation also

- 15 041646 can be obtained in the coding region of the coding effector gene, so that the catalytic activity of the encoded effector protein is lost. The term catalytic activity of an effector protein generally refers to the function of the effector protein against the target cell, i. to toxicity. Such activity is due to catalytic motifs in the catalytic domain of the effector protein. Approaches for identifying the catalytic domain and/or catalytic motifs of an effector protein are well known to those skilled in the art. See, for example, [41, 42].

Accordingly, one of the preferred mutations according to the present invention is a deletion of the entire catalytic domain. Another preferred mutation is a frameshift mutation in the coding effector gene such that the catalytic domain is not present in the protein product expressed from such a shifted gene. The most preferred mutation is a mutation with a deletion of the entire coding region of the effector protein. Other mutations are also contemplated by the present invention, such as small deletions or base pair substitutions that occur in the catalytic motifs of an effector protein, resulting in the abolition of the catalytic activity of that effector protein.

Mutations that are made in the genes for functional effector proteins of the C3T system can be introduced into a particular strain in a number of ways. One such method involves cloning the mutated gene into a suicide vector that is capable of introducing the mutated sequence into the strain via allelic exchange. An example of such a suicide vector is described in [43].

Thus, mutations made in multiple genes can be sequentially introduced into a Gram-negative bacterial strain, resulting in a polymutant, such as a sixfold mutant recombinant strain. The order in which these mutated sequences are introduced is not important. In some conditions, it may be necessary to mutate only some, but not all, effector genes. Accordingly, the present invention further contemplates a polymutant Yersinia strain rather than a sixfold mutant Yersinia strain, such as double mutants, triple mutants, quadruple mutants, and fivefold mutants. For the purpose of protein delivery, the secretion and translocation system of the mutant strain according to the present invention must be intact.

A preferred recombinant Gram-negative bacterial strain of the present invention is a six-fold mutant Yersinia strain in which all effector-coding genes are mutated such that the resulting Yersinia strain no longer produces any functional effector proteins. A similar sixfold mutant strain of Yersinia is designated AyopH,O,P,E,M,T for Y. enterocolitica. As an example, a similar sixfold mutant can be generated from Y. enter ocolitica MRS40, resulting in Y. enterocolitica MRS40 AyopH,O,P,E,M,T, which is preferred.

An additional aspect of the present invention relates to a vector for use in combination with recombinant strains of gram-negative bacteria to deliver the desired protein into eukaryotic cells, while the vector includes in the direction from the 5'end to the 3'end: a promoter; a first DNA sequence encoding a delivery signal from an effector protein of C3T bacteria operably linked to said promoter; a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence; and alternatively a third DNA sequence encoding a protease cleavage site, wherein the third DNA sequence is located between the 3'end of said first DNA sequence and the 5'end of said second DNA sequence.

A promoter, a heterologous protein, and a protease cleavage site, as previously described, can be used for a gram-negative bacterial strain vector.

The vectors that can be used according to the present invention depend on the strains of gram-negative bacteria used, as is known to a person skilled in the art. Vectors that can be used according to the present invention include expression vectors, vectors for chromosomal or virulence plasmid insertion, and DNA fragments for chromosomal or virulence plasmid insertion. Expression vectors which are suitable, for example, in the case of a strain of Yersinia, Escherichia, Salmonella or Pseudomonas are, for example, plasmids pUC, pBad, pACYC, pUCP20 and pET. Vectors for chromosome insertion or virulence plasmid insertion which are suitable, for example, in the case of a Yersinia, Escherichia, Salmonella or Pseudomonas strain, are, for example, pKNG101. DNA fragments for chromosomal insertion or virulence plasmid insertion refer to methods used, for example, in the case of a strain of Yersinia, Escherichia, Salmonella or Pseudomonas, such as genetic engineering using lambda red phage. Vectors for chromosomal insertion or virulence plasmid insertion or DNA fragments for chromosomal insertion or virulence plasmid insertion may insert a first, second and/or third DNA sequence according to the present invention such that the first, second and/or third DNA sequence is operably linked to an endogenous promoter. recombinant strain of gram-negative bacteria. Thus, if a vector is used for chromosome insertion or virulence plasmid insertion or a DNA fragment for

- 16 041646 chromosomal insertion or virulence plasmid insertion, the endogenous promoter can be encoded on endogenous bacterial DNA (chromosomal or plasmid DNA) and only the first and second DNA sequence will be provided by the genetically engineered vector for chromosomal insertion or virulence plasmid insertion or DNA fragment for chromosomal insertion or insert a virulence plasmid. Thus, it is not necessary that the promoter be included in the vector used to transform recombinant strains of Gram-negative bacteria, i.e. recombinant strains of gram-negative bacteria according to the present invention can be transformed with a vector, the dose of which does not include a promoter. Preferably, an expression vector is used. The vector of the present invention is generally used to deliver heterologous proteins by the bacterial CCT system into eukaryotic cells in vitro and in vivo.

A preferred expression vector for Yersinia is selected from the group consisting of pBad_Si1 and pBad_Si_2. Plasmid pBad_Si2 was constructed by cloning the SycE-YopE ₁ fragment. ₁₃₈ containing endogenous promoters for YopE and SycE, from the purified pYV40 plasmid to the KpnI/HindIII site of the pBad-MycHisA plasmid (Invitrogen). Additional modifications include the removal of the NcoI/BglII fragment of the pBad-MycHisA plasmid by enzymatic digestion, treatment with a Klenow fragment and re-ligation. Additionally, the following cleavage sites were added at the 3' end of YopE1_ ₁₃₈ : XbaI-XhoI-BstBI-(HindIII). Plasmid pBad_Si1 is equivalent to plasmid pBad_Si2, but encodes USFP (EGFP) amplified from plasmid pEGFP-C1 (Clontech) at the NcoI/BglII site under the control of an arabinose-inducible promoter.

A preferred expression vector for Salmonella is selected from the group consisting of pSi_266, pSi_267, pSi_268 and pSi_269. Plasmids pSi_266, pSi_267, pSi_268, and pSi_269 containing the corresponding endogenous promoter and the _{SteA1_20} (pSi_266) fragment, the full-length SteA sequence (pSi_267), the _{SopE1_81} (pSi_268) fragment, or the _{SopE1_105} (pSi_269) fragment were amplified from the genomic DNA of the S. enterica strain SL1344 and cloned into the NcoI/KpnI site of the pBad-MycHisA plasmid (Invitrogen).

The vectors of the present invention may include other sequence elements such as a 3' termination sequence (including a stop codon and a poly-A sequence) or a drug resistance gene that allows selection of transformants that receive the present vector. Transformation of the vectors of the present invention into recombinant strains of Gram-negative bacteria can be accomplished by a number of known methods. For the purpose of the present invention, transformation methods for introducing a vector include, but are not limited to, electroporation, calcium phosphate-mediated transformation, conjugation, or a combination thereof. For example, the vector can be transformed into a first bacterial strain by a standard electroporation procedure. Subsequently, such a vector can be transferred from the first strain of bacteria to the desired strain by conjugation, a process also called mobilization. A selection of the transformant (ie strains of Gram-negative bacteria that have adopted the vector) can be made, for example, with the help of antibiotics. These techniques are well known in the art. See, for example, [13].

According to the present invention, the promoter of the expression vector of the recombinant Gram-negative bacterial strain of the present invention may be a native promoter of the C3T effector protein of the respective strain or a suitable bacterial strain, or a promoter used in expression vectors, which are suitable, for example, in the case of Yersinia, Escherichia, Salmonella or Pseudomonas, such as pUC and pBad plasmids. Such promoters are the T7 promoter, the Plac promoter or the Ara-bad promoter.

If the recombinant Gram-negative bacteria strain is a Yersinia strain, the promoter may be from the Yersinia virulon gene. The term Yersinia virulon gene refers to genes on the pYV Yersinia plasmid whose expression is controlled by both temperature and contact with the target cell. Such genes include genes coding for elements of the secretory apparatus (Ysc genes), genes coding for translocators (YopB, YopD and LcrV), genes coding for control elements (YopN, TyeA and LcrG), genes coding for chaperones of effectors of the C3T system (SycD, SycE, SycH, SycN, SycO, and SycT), and genes encoding for effectors (YopE, YopH, YopO/YpkA, YopM, YopT, and YopP/YopJ), as well as other pYV-encoded proteins like VirF and YadA .

In a preferred embodiment of the present invention, the promoter is a native promoter of a gene encoding a functional effector of the C3T system. When the recombinant gram-negative bacterial strain is a Yersinia strain, the promoter is selected from any of the promoters for YopE, YopH, YopO/YpkA, YopM, and YopP/YopJ. More preferably the promoter is selected from the promoters for YopE or SycE.

If the recombinant Gram-negative bacterial strain is a Salmonella strain, the promoter may be from the SpiI or SpiII pathogenicity island, or from an effector protein encoded elsewhere. Such genes include genes encoding for elements of the secretory apparatus, genes encoding for translocators, genes encoding for control elements, genes encoding for effector chaperones of the C3T system, and genes encoding for effectors as well as other encoded proteins. SPI-1 or SPI-2. In a preferred embodiment of the present invention, the promoter is a native promoter of a gene encoding a functional effector of the C3T system.

If the recombinant Gram-negative bacterial strain is a Salmonella strain, the promoter is selected from any promoter of one of the effector proteins. More preferably the promoter is selected from the SopE, InvB or SteA promoters.

In a preferred embodiment, the expression vector comprises a DNA sequence encoding a protease cleavage site. Obtaining a functional and commonly used cleavage site allows the delivery signal to be cleaved after translocation. Since the delivery signal may interfere with the correct localization and/or function of the translocated protein within target cells, the introduction of a protease cleavage site between the delivery signal and the protein of interest allows for the first time delivery of substantially native proteins into eukaryotic cells. Preferably, the protease cleavage site is an amino acid motif that is cleaved by a protease or its catalytic domains selected from the group consisting of enterokinase (light chain), enteropeptidase, PreScission prostheses, human rhinovirus 3C protease, TEV protease, TVMV protease, blood factor Xa protease, and thrombin, more preferably an amino acid motif that is cleaved by the TEV protease. It is equally preferred that the protease cleavage site is an amino acid motif that is cleaved by a protease or its catalytic domains selected from the group consisting of enterokinase (light chain), enteropeptidase, PreScission prostheses, human rhinovirus 3C protease, TEV protease, TVMV protease, blood factor Xa protease, a ubiquitin-processing protease called the deubiquitinating enzyme, and thrombin. Most preferred is an amino acid motif that is cleaved by the TEV protease or a ubiquitin-processing protease. Thus, in a further embodiment of the present invention, a heterologous protein is cleaved from a delivery signal belonging to an effector protein of the bacterial C3T system by a protease. Preferred cleavage methods are those in which

a) the protease is translocated into a eukaryotic cell using a recombinant gram-negative bacterial strain as described herein that expresses a fusion protein that includes a delivery signal from the effector protein of the bacterial C3 system and the protease as a heterologous protein; or

b) the protease is expressed constitutively or transiently in the eukaryotic cell.

Generally, the recombinant gram-negative bacterial strain used to deliver the desired protein into the interior of the eukaryotic cell and the recombinant gram-negative bacterial strain that translocates the protease into the eukaryotic cell are different.

In one embodiment of the present invention, the vector includes an additional DNA sequence encoding a tag molecule or an acceptor site for a tag molecule. An additional DNA sequence encoding a tag molecule or an acceptor site for a tag molecule is typically fused to the 5' or 3' end of the second DNA sequence. Preferably, the label molecule or acceptor site for the label molecule is selected from the group consisting of enhanced green fluorescent protein (GFP), coumarin, coumarin ligase acceptor site, resorufin, resorufin ligase acceptor site, tetracysteine motif using FlAsH/ReAsH dye (life technologies).

Most preferred is resorufin and the acceptor site of resorufin ligase or USFB. The use of a tag molecule or an acceptor site for a tag molecule will result in the attachment of the tag molecule to the heterologous protein of interest, which will then be delivered as such into the interior of the eukaryotic cell, and this allows the protein to be monitored by, for example, microscopy of a living cell.

In one of the embodiments of the present invention, the vector includes an additional DNA sequence encoding a peptide tag (tag). The additional DNA sequence encoding the peptide tag is typically fused to the 5' or 3' end of the second DNA sequence. The preferred peptide tag is selected from the group consisting of a Myc tag, a His tag, a Flag tag, an HA tag, a Strep tag, or a V5 tag, or a combination of two or more of these tags. The most preferred are Myc-tag, Flag-tag, His-tag and combined Musi His-tags. The use of a peptide label will result in the ability to trace the labeled protein, for example by immunofluorescence or Western blotting using anti-label antibodies. Additionally, the use of a peptide tag allows affinity purification of the desired protein either after secretion into the culture supernatant or after translocation into eukaryotic cells, in both cases using a purification method suitable for the corresponding tag (e.g., metal chelate affinity purification using a His tag, or purification based on anti-Flag antibodies when using a Flag tag).

In one embodiment of the present invention, the vector includes an additional DNA sequence encoding a nuclear localization signal (NSL). An additional DNA sequence encoding a nuclear localization signal, usually fused at the 5' or 3' end

- 18 041646 of the second DNA sequence, wherein said additional DNA sequence encodes a nuclear localization signal. The preferred nuclear localization signal is selected from the group consisting of the nuclear signaling signal (NSL) of the large T antigen of the SV40 virus and its derivatives.

[44], as well as other viral signals of nuclear localization. Most preferred is the nuclear signaling signal (NSL) of the large T antigen of the SV40 virus and its derivatives.

In one embodiment of the present invention, the vector includes a multiple cloning site. The site of multiple cloning, as a rule, is located at the 3'end of the first DNA sequence and/or at the 5'end or 3'end of the second DNA sequence. One or more than one multiple cloning site can be included in the vector. The preferred site for multiple cloning is selected from the group of restriction enzymes consisting of

Xhol, Xbal, Hindll, Ncol, Notl, EcoRI, EcoRV, BamHI, Nhel, SacI, Sall, BstBI.

Most preferred are Xbal, Xhol, BstBI and Hindll.

The protein expressed from the fusion of the first and second and optionally third DNA sequences of the vector is also referred to as a fusion protein or fusion protein, i.e. a fusion protein or a hybrid of a delivery signal and a heterologous protein. A fusion protein may also include, for example, a delivery signal and two or more different heterologous proteins.

The present invention contemplates a method for delivering heterologous proteins, as described herein above, into eukaryotic cells in cell culture as well as in vivo.

Thus, in one embodiment, a method for delivering heterologous proteins includes:

i) cultivation of a strain of gram-negative bacteria, as described in this application;

ii) bringing the eukaryotic cell into contact with the gram-negative bacterial strain of point i), wherein the fusion protein, which contains the delivery signal from the effector protein of the bacterial CCT system and the heterologous protein, is expressed by the gram-negative bacterial strain and translocated into the eukaryotic cell; and optionally iii) cleaving the fusion protein so that the heterologous protein is cleaved from the delivery signal belonging to the effector protein of the bacterial C3 system.

In some embodiments, at least two fusion proteins that include a delivery signal from a bacterial CCT system effector protein and a heterologous protein are expressed by a gram-negative bacterial strain and translocated into a eukaryotic cell by the methods of the present invention.

A recombinant strain of Gram-negative bacteria can be cultured such that expression of a fusion protein that includes a delivery signal from an effector protein of the bacterial C3T system and a heterologous protein, according to methods known in the art (e.g., FDA, Bacteriological Analytical Manual (BAM) , chapter 8: Yersinia enterocolitica). Preferably, the recombinant Gram-negative bacterial strain can be cultured in brain-heart broth, for example at 28°C. To induce the expression of CC3T and, for example, genes dependent on the YopE/SycE promoter, bacteria can be grown at 37°C.

In a preferred embodiment, the eukaryotic cell is brought into contact with two Gram-negative bacterial strains of point i), wherein the first Gram-negative bacterial strain expresses a first fusion protein that includes a delivery signal from an effector protein of the bacterial C3T system and a first heterologous protein, and the second Gram-negative bacterial strain expresses a second fusion protein that includes a delivery signal from an effector protein of the bacterial C3T system and a second heterologous protein such that the first and second fusion proteins translocate into the interior of a eukaryotic cell. This embodiment proposed for co-infection of e.g. eukaryotic cells with two bacterial strains as a viable method for delivering e.g. two different fusion proteins into single cells to elucidate their functional interaction.

The present invention contemplates a wide range of eukaryotic cells that can be targets for the recombinant Gram-negative bacterial strain of the present invention, e.g. Hi-5 cells (BTI-TN-5B1-4; life technologies B855-02), HeLa cells, e.g. HeLa Ccl2 cells (such as ATCC No. CCL-2), fibroblast cells, such as 3T3 fibroblast cells (such as ATCC No. CCL-92) or Mef cells (such as ATCC No. SCRC-1040), Hek (such as ATCC No. CRL-1573), HUVEC cells (such as ATCC No. PCS-100-013), CHO (such as ATCC No. CCL-61), Jurkat (such as ATCC No. TIB-152), Sf-9 (such as ATCC No. CRL-1711), HepG2 (such as ATCC No. HB-8065), Vero (such as ATCC No. CCL-81), MDCK (such as ATCC No. CCL-34), THP-1 (such as ATCC No. TIB202), J774 (such as ATCC No. TIB -67), RAW (such as ATCC No. TIB-71), Caco2 (such as ATCC No. HTB-37), NCI cell lines (such as ATCC No. HTV-182), DU145 (such as ATCC No. HTV-81), Lncap (such as ATCC No. CRL-1740), MCF-7 (such as ATCC No. NTV-22), line and MDA-MB cells (such as atss

- 19 041646 No. NTV-128), PC3 (such as ATCC No. CRL-1435), T47D (such as ATCC No. CRL-2865), A549 (such as ATCC No. CCL-185), U87 (such as ATCC No. NTV- 14), SHSY5Y (such as ATCC No. CRL-2266s), Ea.Hy926 (such as ATCC No. CRL-2922), Saos-2 (such as ATCC No. HTVH-85), 4T1 (such as ATCC No. CRL-2539) , B16F10 (such as ATCC # CRL-6475) or primary human hepatocytes (such as life technologies HMCPIS), preferably HeLa, Hek cells, HUVEC cells, 3T3, CHO, Jurkat, Sf-9, HepG2 Vero, THP-1, Caco2 , Mef, A549, 4T1, B16F10 and primary human hepatocytes and most preferably HeLa, Hek cells, HUVEC cells, 3T3, CHO, Jurkat, THP-1, A549 and Mef. By being a target is meant the extracellular adhesion of a recombinant Gram-negative bacterial strain to a eukaryotic cell.

In accordance with the present invention, protein delivery can be accomplished by contacting a eukaryotic cell with a recombinant Gram-negative bacterial strain under suitable conditions. Various literature sources and methods are commonly available to those skilled in the art regarding conditions for inducing expression and translocation of virulon genes, including the required temperature, Ca~ concentration, the addition of inducers such as Congo red, techniques by which a recombinant Gram-negative bacterial strain is mixed, and target cells, and the like. See, for example, [45]. Conditions may vary depending on the target eukaryotic cell type and the recombinant bacterial strain used. Such variations can be dealt with by those skilled in the art using conventional techniques. Those skilled in the art can also use a variety of assays to determine if delivery of the fusion protein has been successful. For example, a fusion protein can be detected by immunofluorescence using antibodies that recognize a tag (such as a Myc tag) fused to the protein. The determination can also be based on the enzymatic activity of the delivered protein, for example, the analysis described in [13].

In one embodiment, the present invention provides a method for purifying a heterologous protein, comprising culturing a gram-negative bacterial strain as described herein such that a fusion protein that includes a delivery signal from a bacterial C3 system effector protein and a heterologous protein is expressed and secreted into the supernatant. cell cultures. The expressed fusion protein may further include a protease cleavage site located between the delivery signal from the effector protein of the bacterial C3T system and the heterologous protein, and/or may further include a peptide tag.

Thus, in a particular embodiment, a method for purifying a heterologous protein comprises:

i) culturing a gram-negative bacterial strain as described herein such that a fusion protein that includes a delivery signal from the effector protein of the bacterial C3T system, a heterologous protein, and a protease cleavage site between the delivery signal from the effector protein of the bacterial C3T system and the heterologous protein is expressed, and secreted into cell culture supernatant;

ii) adding a protease to the culture supernatant, wherein the protease cleaves the fusion protein so that the heterologous protein is cleaved from the delivery signal belonging to the effector protein of the bacterial C3T system;

iii) optionally isolating the heterologous protein from the cell culture supernatant.

Thus, in another specific embodiment, a method for purifying a heterologous protein comprises:

i) culturing a gram-negative bacterial strain as described herein such that a fusion protein, which includes a delivery signal from the effector protein of the bacterial C3T system, a heterologous protein, and a peptide tag, is expressed and secreted into the culture supernatant;

ii) using a peptide label as a target, for example, by affinity purification of the supernatant on a column.

Thus, in another specific embodiment, a method for purifying a heterologous protein comprises:

i) culturing a Gram-negative bacterial strain as described herein such that a fusion protein that includes a delivery signal from the effector protein of the bacterial C3T system, a heterologous protein, a protease cleavage site between the delivery signal from the effector protein of the bacterial C3T system and the heterologous protein, and a peptide the label is expressed and secreted into the culture supernatant;

ii) adding a protease to the culture supernatant, wherein the protease cleaves the fusion protein so that the heterologous protein is cleaved from the delivery signal belonging to the effector protein of the bacterial C3T system;

iii) using a peptide label as a target, for example, by affinity purification of the supernatant on a column.

In the specific embodiments described above, the protease can be added to the culture supernatant in the form of, for example, a purified protease protein or by adding a bacterial strain expressing and secreting the protease to the culture supernatant. Additional steps can

- 20 041646 include removal of the protease, for example by column affinity purification.

In one embodiment, the present invention provides a recombinant Gram-negative bacterial strain as described herein for use in medicine.

In one embodiment, the present invention provides a recombinant Gram-negative bacterial strain as described herein for use in delivering a heterologous protein as a drug or vaccine to a subject. A heterologous protein can be delivered to a subject as a vaccine by contacting a gram-negative bacterial strain with eukaryotic cells, such as a live animal in vivo, such that the heterologous protein is translocated into the living animal, which then produces antibodies against the heterologous protein. Generated antibodies can be used directly or isolated and purified and used in diagnostics, research, and therapy. Antibody-producing B cells, or the DNA sequence contained therein, can be used to further generate specific antibodies for use in diagnostics, research, and therapy.

In one embodiment, the present invention provides a method for delivering a heterologous protein, wherein the heterologous protein is delivered in vitro to the interior of eukaryotic cells.

In a further embodiment, the present invention provides a method for delivering a heterologous protein, wherein the eukaryotic cell is a living animal, wherein the living animal is brought into contact with a Gram-negative bacterial strain in vivo such that the fusion protein is translocated into the living animal. The preferred animal is a mammal, more preferably a human.

In a further embodiment, the present invention provides for the use of a recombinant Gram-negative bacterial strain as previously described to perform high-throughput screening for inhibitors of a cellular pathway or event triggered by translocated heterologous protein(s).

In a further embodiment, the present invention provides a library for gram-negative bacterial strains, wherein the heterologous protein encoded by the second DNA sequence of the gram-negative bacterial strains expression vector is a human or mouse protein, preferably a human protein, and wherein each human or mouse protein expressed by the strain Gram-negative bacteria differ in amino acid sequence. The proposed library may, for example, contain a collection of open reading frames (Orf) human kinases containing 560 proteins, the organization Addgene (Addgene No. 1000000014). As a cloning expression vector, the expression vectors described above can be used.

In a further embodiment, the present invention provides a kit comprising a vector as described herein and a bacterial strain expressing and secreting a protease capable of cleaving a protease cleavage site included in the vector. A particularly suitable vector is one for use in combination with a bacterial strain to deliver the desired protein into eukaryotic cells as described above, wherein the vector includes a 5' to 3' promoter;

the first DNA sequence encoding the delivery signal from the effector protein of the C3T system of bacteria, functionally linked to the specified promoter;

a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence; and alternatively a third DNA sequence encoding a protease cleavage site, wherein the third DNA sequence is located between the 3'end of said first DNA sequence and the 5'end of said second DNA sequence.

Examples

A) Materials and methods.

Bacterial strains and culture growth conditions.

The strains used in this study are listed in FIG. 15A-15M. The strain is. coli Top10 used for plasmid purification and cloning, and the E. coli Sm10 λ pir strain used for conjugation, as well as the E. coli BW19610 strain [46] used to propagate the pKNG101 vector, were routinely grown on LB agar plates and in broth LB at 37°C. Ampicillin was used at a concentration of 200 μg/ml (Yersinia) or 100 μg/ml (E. coli) for selection of expression vectors. Streptomycin was used at a concentration of 100 μg/ml for the selection of suicide vectors. The Y. enterocolitica strain MRS40 [36], an ampicillin-resistant derivative of the E40 strain [13], and strains derived from it were routinely grown in brain-heart extract (BHI; Difco) at room temperature (RT). Nalidixoic acid (35 μg/ml) was added to all Y. enterocolitica strains and 100 μg/ml meso-2,6-diaminopimelic acid (mDAP, Sigma Aldrich) was added to all Y. enterocolitica asd strains.

S. enterica SL1344 was routinely grown on LB agar plates and LB broth at 37°C. Ampicillin was used at a concentration of 100 μg/ml to carry out the selection of expression vectors in S. enterica.

Genetic manipulations with Y. enterocolitica.

Genetic manipulations with Y. enterocolitica have been described in [47, 48]. Briefly, mutators were genetically engineered to modify or delete genes in pYV plasmids or on the chromosome by polymerase chain reaction (PCR) with 2 overlapping primer fragments using purified pYV40 plasmid or genomic DNA as template, resulting in flanking sequences of 200- 250 base pairs (bp) on both sides of the deleted or modified part of the corresponding gene. The resulting fragments were cloned into the pKNG101 vector [43] in E. coli strain BW19610 [46]. Sequence-verified plasmids were transformed into E. coli Sm10 λ pir strain, from where the plasmids were mobilized into the corresponding Y. enterocolitica strain. Mutants carrying the integrated vector were propagated for several generations without selection pressure. Sucrose was then used to select clones that had lost the vector. Finally, the mutants were identified by the molecular colony method.

Construction of plasmids.

Plasmid pBad_Si2 or pBad_Si1 (FIG. 10) was used to clone the 138 N-terminal YopE amino acid fusion proteins (SEQ ID NO: 2). Plasmid pBad_Si2 was constructed by cloning the SycE-YopE ₁ fragment. ₁₃₈ containing endogenous promoters for YopE and SycE, from the purified pYV40 plasmid to the KpnI/HindIII site of the pBad-MycHisA plasmid (Invitrogen). Additional modifications include the removal of the NcoI/BglII fragment of the pBad-MycHisA plasmid by digestion, treatment with a Klenow fragment and re-ligation. A bidirectional transcription terminator (BBa_B1006; iGEM foundation) was cloned into a KpnI cleaved and Klenow-treated site (pBad_Si2) or a cleaved BgIII site (pBad_Si1). Additionally, the following cleavage sites were added at the 3' end of the YopE1_ ₁₃₈ sequence: XbaI-XhoI-BstBI-(HindIII) (FIG. 10B). Plasmid pBad_Si1 is equivalent to plasmid pBad_Si2, but encodes USFP (EGFP) amplified from plasmid pEGFP-C1 (Clontech) at the NcoI/BglII site under the control of an arabinose-inducible promoter. Plasmids pSi_266, pSi_267, pSi_268, and pSi_269 containing the corresponding endogenous promoter and the _{SteA1_20} (pSi_266) fragment, the full-length SteA sequence (pSi_267), the _{SopE1_81} (pSi_268) fragment, or the _{SopE1_105} (pSi_269) fragment were amplified from the genomic DNA of strain S. enterica SL1344 and cloned into the NcoI/KpnI site of the pBad-MycHisA plasmid (Invitrogen).

Full length genes or their fragments were amplified with the specific primers listed in Table 1 below. I, and cloned as fusion constructs with _{YopE1_138} into the pBad_Si2 plasmid or, in the case of the z-BIM protein (SEQ ID NO: 21), into the pBad_Si1 plasmid (see Table II below). For fusion with SteA or SopE, artificial DNA constructs were digested with KpnI/HindII proteases and cloned into pSi_266, pSi_267, pSi_268, or pSi_269, respectively. In the case of bacterial species genes, purified genomic DNA (S. flexneri M90T, Salmonella enterica subsp. enterica serovar, Typhimurium SL1344, Bartonella henselae ATCC 49882) was used as a template. For human genes, the universal coding DNA (cDNA) library (Clontech) was used, unless otherwise noted (FIGS. 15A-15M), zebrafish genes were amplified from the cDNA library (a kind gift from M. Affolter). The ligated plasmids were cloned into E. coli Top10 strain. Sequence verified plasmids were electroporated into the desired Y. enterocolitica or S. enterica strain using the same parameters as for standard E. coli electroporation.

- 22 041646

Table I (Primer No. Si_: sequence)

285: CATACCATGGGAGTGAGCAAGGGCGAG

286: GGAAGATCTttACTTGTACAGCTCGTCCAT

287: CGGGGTACCTCAACTAAATGACCGTGGTG

288: GTTAAAGCTTttcgaatctagactcgagCGTGGCGAACTGGTC

292: CAGTctcgagCAAAATTCTAAACAAAATACTTCCAC

293: cagtTTCGAATTAATTTGTATTGCTTTGACGG

296: CAGTctcgagACTAACATAACACTATCCACCCAG

297: GTTAAAGCTTTCAGGAGGCATTCTGAAG

299: CAGTctcgagCAGGCCATCAAGTGTGTG

300: cagtTTCGAATCATTTTCTCTTCCTCTTCTTC A

301: CAGTctcgagGCTGCCATCCGGAA

02: cagtTTCGAATCACAAGACAAGGCACCC

306: GTTAAAGCTTGGAGGCATTCTGAAGatacttatt

07: C AGTctcgagC AA AT AC AGAGCTTCT ATC ACTC AG

308: GTTAAAGCTTTCAAGATGTGATTAATGAAGAAATG

317: cagtTTCGAACCCATAAAAAAGCCCTGTC

318: GTTAAAGCTTCTACTCTATCATCAAACGATAAAATGg

324: CAGTctcgagTTCACTCAAGAAACGCAAA

339: cagtTTCGAATTTTCTCTTCCTCTTCTTCAcg

- 23 041646

341: cgtaTCTAGAAAAATGATGAAAATGGAGACTG

342: GTTAAAGCTTttaGCTGGAGACGGTGAC

346: CAGTctcgagTTCCAGATCCCAGAGTTTG

347: GTTAAAGCTTTCACTGGGAGGGGG

351: CAGTctcgagctcgagTTATCTACTCATAGAAACTACTTTTGCAG

52: cgcGGATCCtcagtgtctctgcggcatta

353: CATTTATTCCTCTAGTTAGTCAcagcaactgctgctcctttc

54: gaaaggagcagcagttgctgTGACTAACTAGGAGGAATAAATG

5 5: cgattcacggattgctttctC ATTATTCCCTCC AGGT ACT A

356: TAGTACCTGGAGGGAATAATGagaaagcaatccgtgaatcg

357: cgtaTCTAGAcggctttaagtgcgacattc

364: cgtaTCTAGACTAAAGTATGAGGAGAGAAAATTGAA

365: GTTAAAGCTTTCAGCTTGCCGTCGT

367: CGTAtctagaGACCCGTTCCTGGTGC

369: cgtaTCTAGAccccccaagaagaagc

373: GTTAAAGCTTGCTGGAGACGGTGACC

86: CGTAtctagaTCAGGACGCTTCGGAGGTAG

87: CGTAtctagaATGGACTGTGAGGTCAAACAA

389: CGTAtctagaGGCAACCGCAGCA

391: GTTAAAGCTTTCAGTCCATCCCATTTCTg

403: CGTAtctagatctggaatatccctggaca

406: GTTAAAGCTTgtctgtctcaatgccacagt

410: CAGTctcgagATGTCCGGGGTGGTg

413: cagtTTCGAATC ACTGC AGC ATGATGTC

417: CAGTctcgagAGTGGTGTTGATGATGACATG

420: cagtTTCGAATTAGTGATAAAAATAGAGTTCTTTTGTGAG

423: CAGTctcgagATGCACATAACTAATTTGGGATT

424: cagtTTCGAATT AT AC AAATGACGAATACCCTTT

425: GTTAAAGCTTttacaccttgcgcttcttcttgggcggGCTGGAGACGGTGAC

428: CGTAtctagaATGGACTTCAACAGGAACTTT

429: CGTAtctagaGGACATAGTCCACCAGCG

430: GTTAAAGCTTTCAGTTGGATCCGAAAAAC

433: CGTAtctagaGAATTAAAAAAAACACTCATCCCA

434: CGTAtctagaCCAAAGGCAAAAGCAAAAA

5: GTTAAAGCTTTTAGCTAGCCATGGCAAGC

- 24 041646

436: CGTAtctagaATGCCCCGCCCC

437: GTTAAAGCTTCTACCCACCGTACTCGTCAAT

8: CGTAtctagaATGTCTGACACGTCCAGAGAG

439: GTTAAAGCTTTCATCTTCTTTCGCAGGAAAAAAG

445: cgcGGATCCttatgggttctcacagcaaaa

446: CATTTATTCCTAGTTAGTCaaggcaacagccaatcaagag

447: ctcttgattggctgttgcctTGACTAACTAGGAGGAATAAATG

448: ttgattgcagtgacatggtgCATTATTCCCTCCAGGTACTA

449: TAGTACCTGGAGGGAATAATGcaccatgtcactgcaatcaa

0: cgtaTC TAGAtagccgcagatgttggtatg

451: CGTAtctagaGATCAAGTCCAACTGGTGG

463: CAGTctcgaggaaagcttgtttaaggggc

464: cagtTTCGAAttagcgacggcgacg

476: GTTAAAGCTTttACTTGTACAGCTCGTCCAT

477: CGTAtctagaGTGAGCAAGGGCGAG

478: C AGTctcgagATGGAAGATT AT ACC AAAAT AGAGAAA

479: GTTAAAGCTTCTACATCTTCTTAATCTGATTGTCCa

482: CGTAtctagaATGGCGCTGCAGCt

483: GTTAAAGCTTTCAGTCATTGACAGGAATTTTg

486: CGTAtctagaATGGAGCCGGCGGCG

487: GTTAAAGCTTTC AATCGGGGATGTCTg

492: CGTAtctagaATGCGCGAGGAGAACAAGGG

493: GTTAAAGCTTTCAGTCCCCTGTGGCTGTGc

494: CGTAtctagaATGGCCGAGCCTTG

495: GTTAAAGCTTttaTTGAAGATTTGTGGCTCC

504:CGTAtctagaGAAAATCTGTATTTTTCAAAGTGAAAATCTGTATTTTTCAAAGTATGCC CCGCCCC

505: GTTAAAGCTTCCCACCGTACTCGTCAATtc

508:CGTAtctagaGAAAATCTGTATTTTTCAAAGTGAAAATCTGTATTTTTCAAAGTATGGC CGAGCCTTG

509: GTTAAAGCTTTTGAAGATTTGTGGCTCCc

511 :CGTAtctagaGAAAATCTGTATTTTTCAAAGTGAAAATCTGTATTTTTCAAAGTGTGAG CAAGGGCGAG

512:CGTAtctagaGAAAATCTGTATTTTTCAAAGTGAAAATCTGTATTTTTCAAAGTCCGCC GAAAAAAAAACGTAAAGTTGTGAGCAAGGGCGAG

- 25 041646

513 :GTTAAAGCTTTttAAACTTTACGTTTTTTTTTCGGCGGCTTGTACAGCTCGTCCAT

515 :CGTAtctagaGAAAATCTGTATTTTTCAAAGTGAAAATCTGTATTTTTCAAAGTGATTA

TAAAGATGATGATGATAAAATGGCCGAGCCTTG

558: CGTATCTAGAATGACCAGTTTTGAAGATGC

559:GTTAAAGCTTTCATGACTCATTTTCATCCAT

561 :CGTATCTAGAATGAGTCTCTTAAACTGTGAGAACAG

562:GTTAAAGCTTCTACACCCCCGCATCA

580: catgccatggATTTATGGTCATAGATATGACCTC

585: CAGTctcgagATGCAGATCTTCGTCAAGAC

586: GTTAAAGCTTgctagcttcgaaACC ACC ACGTAGACGTAAGAC

588: cagtTTCGAAGATTATAAAGATGATGATGATAAAATGGCCGAGCCTTG

612: CGGGGTACCatgaggtagcttatttcctgataaag

613: CGGGGTACCataattgtccaaatagttatggtagc

614: catgccatggCGGCAAGGCTCCTC

615: cggggtaccTTTATTTGTCAACACTGCCC

616: cggggtaccTGCGGGGTCTTTTACTCG

677:TTACTATTCGAAGAAATTATTCATAATATTGCCCGCCATCTGGCCCAAATTGGTG

ATGAAATGGATCATTAAGCTTGGAGTA

678:TACTCCAAGCTTAATGATCCATTTCATCACCAATTTGGGCCAGATGGCGGGCAA

TATTATGAATAATTTCTTCGAATAGTAA

682:TTACTACTCGAGAAAAAACTGAGCGAATGTCTGCGCCGCATTGGTGATGAACTG

GATAGCTAAGCTTGGAGTA

683:TACTCCAAGCTTAGCTATCCAGTTCATCACCAATGCGGCGCAGACATTCGCTCA _{GTTTTTTCTCGAGTAGTAA}

Table II. Cloned fusion proteins

Deliverable SSTT protein Protein sequence ID number Background plasmid Final plasmid name SiHOMep primers: Primer sequence ID number YopEl-138MycHis 3 pBadMycHisA (Invitrogen) pBadSil 285/286 (UZFB), 287/288 (sycEYopEl-138) 44/45 and 46/47 YopEl-138MycHis 3 pBadMycHisA (Invitrogen) pBad_Si_2 287/288 (sycEYopEl-138) 46/47

- 26 041646

YopEl-138- IpgBl 4 pBad_Si_2 pSi_16 292/293 48/49 YopEl-138SopE 5 pBad_Si_2 PSi 20 296/297 50/51 YopEl-138- Racl Q61L 26 pBad_Si_2 pSi_22 299/300 52/53 YopEl-138- RhoAQ61E 27 pBad_Si_2 pSi_24 301/302 54/55 YopEl-138SopE-MycHis 135 pBad_Si_2 PSi 28 296/306 50/56 YopEl-138SopB 6 pBad_Si_2 PSi 30 307/308 57/58 YopEl-138- FADD 28 pBad_Si_2 PSi 37 367/386 76/79 YopEl-138OspF 7 pBad_Si_2 PSi 38 317/318 59/60 YopEl-138- BepG 715 end 136 pBad_Si_2 PSi 43 324/351 61/67 YopEl-138Racl Q61LMycHis 137 pBad_Si_2 pSi_51 299/339 52/62 YopEl-138- Slmbl-VhH4 32 pBad_Si_2 PSi 53 341/342 63/64 YopEl-138Bad 29 pBad_Si_2 PSi 57 346/347 65/66 YopEl-138SptP 8 pBad_Si_2 PSi64 364/365 74/75 YopEl-138NLS-SlmblVhH4 33 pBad_Si_2 PSi 70 369/342 77/64 YopEl-138-Bid 24 pBad_Si_2 PSi 85 387/391 80/82 YopEl-138-t- Bid 25 pBad_Si_2 PSi 87 389/391 81/82 YopEl-138caspase 3 subunit pl7 22 pBad Si 2 PSi 97 403/406 83/84 YopEl-138- GPCR GNA12 thirty pBad_Si_2 PSi 103 410/413 85/86 YopEl-138caspase 3 plO/12 23 pBad_Si_2 PSi 106 417/420 87/88 YopEl-138IpgD 9 pBad_Si_2 PSi 111 423/424 89/90 YopEl-138Slmbl-VhH4NLS 34 pBad_Si_2 PSi 112 341/425 63/91 YopEl-138-zBid 19 pBad_Si_2 PSi 116 428/430 92/94 YopEl-138-z-t- Bid 20 pBad_Si_2 PSi 117 429/430 93/94

- 27 041646

YopEl-138- BepA E305-end AND pBad_Si_2 PSi 118 433/435 95/97 YopEl-138BepA 10 pBad_Si_2 PSi 119 434/435 96/97 YopEl-138- ET1 36 pBad_Si_2 psi 120 436/437 98/99 YopEl-138-z- BIM 21 pbadSil PSi 121 438/439 100/101 YopEl-138 VhH4 Nanobody Recognizing USFB 31 pBad_Si_2 PSi 124 451/373 108/78 YopEl-138 protease TEV variant S219V 42 pBad_Si_2 PSi 132 463/464 109/110 YopEl-138- UZFB 37 pBad_Si_2 psi 140 477/476 112/111 YopEl-138Cdkl 14 pBad_Si_2 PSi 143 478/479 113/114 YopEl-138- Mad2 15 pBad_Si_2 PSi 145 482/483 115/116 YopEl-138- Ink4A 16 pBad_Si_2 PSi 147 486/487 117/118 YopEl-138- Ink4B 17 pBad_Si_2 psi 150 492/493 119/120 YopEl-138- Ink4C 18 pBad_Si_2 PSi 151 494/495 121/122 YopEl-138TIFA 13 pBad_Si_2 PSi 153 558/559 131/132 YopEl-138-(2 TEV protease cleavage sites)-ET1 41 pBad_Si_2 PSi 156 504/505 123/124 ΥορΕ1-138-(2 TEV protease cleavage sites) - USFB NLS 39 pBad_Si_2 PSi 159 511/513 127/129 ΥορΕ1-138-(2 cleavage sites by TEV protease) - NLS of UZFB 38 pBad_Si_2 PSi 160 512/476 128/111 ΥορΕ1-138-(2 TEV protease cleavage sites) - INK4C 40 pBad_Si_2 PSi 161 508/509 125/126

- 28 041646

ΥορΕ1-138-(2 TEV protease cleavage sites) - Flag INK4C 43 pBad_Si_2 PSi 164 515/509 130/126 YopEl-138- Traf6 mice 12 pBad_Si_2 PSi 166 561/562 133/134 YopEl-138 (codon-optimized for mouse Y. enterocolitica tBid, BH3 part) 138 pBad_Si_2 PSi 318 677/678 148/149 YopEl-138 (codon-optimized for Y. enterocolitica Bax mouse, BH3 part) 139 pBad_Si_2 PSi 322 682/683 150/151 SteAl-20 140 pBadMycHisA (Invitrogen) PSi 266 580/612 152/153 SteA 141 pBadMycHisA (Invitrogen) PSi 267 580/613 152/154 SopEl-81 142 pBadMycHisA (Invitrogen) PSi 268 614/615 155/156 SopEl-105 143 pBadMycHisA (Invitrogen) PSi 269 614/616 155/157 SteAl-20- KODON optimized for S. enterica tBid mouse 144 PSi 266 PSi 270 artificial structure / SteA codon-optimized for S. enterica tBid mouse 145 pSi_267 PSi 271 artificial structure / SopEl-81KODON optimized for S. enterica tBid mouse 146 pSi_268 PSi 272 artificial structure / SopEl-105- 147 pSi_269 PSi 273 artificial /

- 29 041646

codon-optimized for S. enterica tBid mouse design YopEl-138 (codon-optimized other for Y. enterocolitica Ink4A, residues 84-103) 158 pBad_Si_2 PSi 362 745/746 172/173 YopEl-138 (codon-optimized for Y. enterocolitica plO7/RBLl, residues 657662) (AAA02489.1) 159 pBad_Si_2 PSi 363 747/748 174/175 YopEl-138 (codon-optimized other for Y. enterocolitica p21, residues 141-160) (AAH13967.1) 160 pBad_Si_2 PSi 364 749/750 176/177 YopEl-138 (codon-optimized other for Y. enterocolitica p21, residues 145-160) (AAH13967.1) 161 pBad_Si_2 PSi 366 753/754 178/179 YopEl-138 (codon-optimized other for Y. enterocolitica p21, residues 17-33) (AAH13967.1) 162 pBad_Si_2 PSi 367 755/756 180/181 YopEl-138 (codon-optimized other for Y. enterocolitica cyclin D2, residues 139- 163 pBad_Si_2 PSi 368 757/758 182/183

- 30 041646

147) (CAA48493.1) SteA-Ink4a- mychis 164 pSi_267 PSi 333 703/704 184/185 SopEl-105- Ink4a-MycHis 165 pSi_269 PSi 334 703/704 184/185 SteA-Ink4c- mychis 166 pSi_267 PSi 335 PCR1: 705/706; PCR2: 707/708; PCR with overlapping primers: 705/708 186/187, 188/189 SopEl-105- Ink4c-MycHis 167 pSi_269 PSi 336 PCR1: 705/706; PCR2: 707/708; PCR with overlapping primers: 705/708 186/187, 188/189 SteA-Mad2- mychis 168 pSi_267 PSi 337 709/710 190/191 SopEl-105- Mad2-MycHis 169 pSi_269 PSi 338 709/710 190/191 SteA-Cdkl- mychis 170 pSi_267 PSi 339 711/712 192/193 SopEl-105- Cdkl-MycHis 171 pSi_269 PSi 340 711/712 192/193 YopEl-138KODON optimized for Y. enterocolitica tBid mice 194 pBad_Si_2 PSi 315 artificial structure / YopEl-138ubiquitin 195 pBad_Si_2 PSi 236 585/586 197/198 YopEl-138ubiquitinFlag-INK4CMycHis 196 pSi_236 pSi 237 II 588/509 199/126

Yop protein secretion.

Regulon yor was induced by transferring the culture to a temperature of 37°С in BHIOx medium (permissive conditions for secretion) [49]. Glucose (4 mg/ml) was added as a carbohydrate source.

The fraction of total cells and the supernatant fraction were separated by centrifugation at 20800 g for 10 min at 4°C. The cell mass was taken as the fraction of total cells. The proteins in the supernatant were precipitated with trichloroacetic acid at a final concentration of 10% (w/v) for 1 h at 4°C. After centrifugation (20800 g for 15 min) and removal of the supernatant, the resulting cell mass was washed in ice-cold acetone overnight. The samples were centrifuged again, the supernatant was discarded and the cell mass was air dried and resuspended in 1 x sodium dodecyl sulfate (SDS) loading dye.

Secreted proteins were analyzed by polyacrylamide gel electrophoresis in the presence of SDS (SDS-PAGE electrophoresis); in each case, proteins secreted by 3x10 ⁸ bacteria were loaded onto the lane. The determination of specific secreted proteins was carried out by immunoblotting using 12.5% gels for SDS-PAGE electrophoresis. For the determination of proteins in total cells, bacteria were loaded onto a 2x10 ⁸ lane, unless otherwise indicated, and proteins were separated on a 12.5% SDS-PAGE gel prior to detection by immunoblotting.

Immunoblotting was performed using rat monoclonal antibodies against YopE (MIPA193-13A9; 1:1000, [50]). Antiserum was depleted twice overnight against the Y. enterocolitica ΔΗΟΡΕΜΤ asd strain to reduce background staining. Detection was performed with secondary antibodies directed against rat antibodies and conjugated with horseradish peroxidase (1:5000; Southern biotech) prior to development with ECL chemiluminescent substrate (LumiGlo, KPM).

Cell culture and infection processes.

HeLa Ccl2 cells, swiss 3T3, 4T1, B16F10, and D2A1 fibroblast cells were cultured on the medium

- 31 041646

Dulbecco's modified needle (DMEM) supplemented with 10% fetal calf serum (FES) and 2 mM L-glutamine (cDMEM medium). HUVEC cells were isolated and cultured as described in [51]. Jurkat and 4T1 cells were cultured in RPMI 1640 medium supplemented with 10% FTS and 2 mM L-glutamine. Y. enterocolitica was grown in supplemented brainheart extract overnight at room temperature, diluted in fresh brainheart extract to an optical density at 600 nm (OD ₆₀₀ ) of 0.2, and grown 2 h at room temperature before the implementation of a temperature shift in a water bath-shaker with a temperature of 37°C for an additional 30 minutes or 1 hour in the case of delivery of UZFB. Finally, bacteria were harvested by centrifugation (relative centrifugal acceleration (RCF) 6000, 30 s) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. S. enterica was grown on supplemented LB medium overnight at 37°C and either diluted 1:40 in fresh LB medium and grown for 2.5 h at 37°C (C3T SpiI system inducing conditions) or left on The culture was additionally incubated overnight at 37°C (inducing conditions for the SpiII system C3T). Finally, the bacteria were harvested by centrifugation (RCC 6000, 30 s) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. Cells seeded in 96-well (for immunofluorescence) or 6-well (for Western blotting) plates were infected with bacteria at the indicated MOI values in DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. After bacteria were added, the plates were centrifuged for 1 min at 1750 RCC and left at 37° C. for the indicated time periods. Extracellular bacteria were killed with gentamicin (100 mg/ml) if indicated. In the case of immunofluorescence assay, infection evaluation was stopped by 4% paraformaldehyde (PFA) fixation. For Western blotting, cells were washed twice with ice-cold phosphate-buffered saline (PBS) and Phosphosafe lysis buffer (Novagen) was added to lyse the cells. After incubation on ice, the cells were centrifuged (OCU 16000, 25 min, 4°C). Supernatants were collected and analyzed for total protein content by the Bradford method or the bicinchoninic acid (BCA) method (Pierce) before SDS-PAGE and Western blotting using anti-phospho-Akt (phosphorylated residues Ser473 and T308, both from Cell Signaling), anti -actin (Millipore), anti-Bid (Cell Signaling), anti-Myc (Santa Cruz), anti-p38 (Cell Signaling), anti-phospho-p38 (phosphorylated residues Thr180/Tyr182; Cell Signaling), anti(caspase- 3, p17 subunit) (Cell Signaling) and anti-Ink4C (Cell Signaling) antibodies.

Secretion analysis with S. enterica.

To induce protein secretion by S. enterica, S. enterica was cultured overnight in LB medium containing 0.3 M NaCl on an orbital shaker (set at 150 rpm). S. enterica was then diluted 1:50 in fresh LB medium containing 0.3M NaCl and grown for 4 hours at 37°C without shaking.

The fraction of total cells and the supernatant fraction were separated by centrifugation at 20800 g for 20 min at 4°C. The cell mass was taken as the fraction of total cells. The proteins in the supernatant were precipitated with trichloroacetic acid at a final concentration of 10% (w/v) for 1 h at 4°C. After centrifugation (20800 g for 15 min) and removal of the supernatant, the resulting cell mass was washed in ice-cold acetone overnight. The samples were centrifuged again, the supernatant was discarded and the cell mass was air dried and resuspended in 1x loading dye with SDS.

Secreted proteins were analyzed by SDS-PAGE; in each case, proteins secreted by 3x10 ⁸ bacteria were loaded onto the lane. Specific secreted proteins were determined by immunoblotting using 12.5% SDS-PAGE electrophoresis gels. For the determination of proteins in 2x10 ⁸ total cells, bacteria were loaded onto a lane, unless otherwise indicated, and the proteins were separated on 12.5% SDS-PAGE gels prior to detection by immunoblotting. Immunoblotting was performed using an anti-Mus (Santa Cruz) antibody.

Western blotting of transposed CC3T proteins from infected cells.

HeLa cells in 6-well plates were infected at MOI 100 as described above. In the case of co-infection with a strain of Y. enterocolitica translocating the TEV protease, the OD ₆₀₀ of the strains was established and two suspensions of bacteria in a tube were mixed at a ratio of 1:1 (unless otherwise indicated) before being added to the cells. At the end of the infection process, cells were washed twice with ice-cold PBS and harvested by scraping into small volumes of ice-cold PBS. After centrifugation (RTC 16000, 5 min, 4°C), the cell mass was dissolved in 0.002% digitonin, to which a protease inhibitor cocktail (Roche complete, Roche) was added. Dissolved cell masses were incubated for 5 min on ice and then centrifuged (OCU 16000, 25 min, 4°C). Supernatants were harvested and analyzed for total protein by the Bradford or BCC method (Pierce) before SDS-PAGE and Western blotting using anti-Myc (Santa Cruz, 9E11) or anti-Ink4C (Cell Signaling) antibodies.

Immunofluorescence.

Cells seeded in 96-well plates (Corning) were infected as described above and after fixation with 4% PFA, the cells were washed three times with PBS. Wells were blocked using 5% serum

- 32 041646 goat ki in PBS with 0.3% Triton X-100 for 1 hour at room temperature. Primary antibody (anti-Mus, Santa Cruz, 1:100) was diluted in PBS with 1% bovine serum albumin (BSA) and 0.3% Triton X-100 and cells were incubated overnight at 4°C. Cells were washed 4 times with PBS before adding a second antibody (anti-mouse antibody with AF 488, life technologies, 1:250) diluted in PBS with 1% BSA and 0.3% Triton X-100. If necessary, DNA staining with Hoechst dye (life technologies, 1:2500) and/or actin staining (Dy647-phalloidin, DyeOmics) was included. In some cases, only DNA and/or actin staining was used immediately after washing away from PFA. Cells were incubated for 1 hour at room temperature, washed three times with PBS, and analyzed by automated image analysis as described below.

Automated microscopy and image analysis.

Images were obtained automatically using an ImageXpress Micro system (Molecular devices, Sunnyvale, USA). Anti-Mus staining intensities were quantified using MetaXpress software (Molecular devices, Sunnyvale, USA). Areas within cells, except for nuclear areas and areas containing bacteria, were selected manually (circles with an area of 40 pixels) and the average intensity was recorded.

Stimulation with tumor necrosis factor alpha (TNF-α) and Western blotting with phospho-p38.

HeLa cells seeded in 6-well plates were infected at MOI 100 as described above. 30 minutes after infection, gentamicin was added and 45 minutes after infection, TNF-α (10 ng/ml) was added. 1 h 15 min after infection, the cells were washed twice with ice-cold PBS and Phospho-safe lysis buffer (Novagen) was added to lyse the cells. After incubation on ice, the cells were centrifuged (OCU 16000, 25 min, 4°C). Supernatants were harvested and analyzed for total protein by the Bradford or BCC method (Pierce) before SDS-PAGE and Western blotting using anti-phospho-p38 antibodies, anti-total p38 antibodies (Cell Signaling) and anti-actin antibodies (Millipore) .

Determination of cAMP levels in infected HeLa cells. HeLa cells seeded in 96 well plates were infected as described above. 30 min before infection, cDMEM medium was changed to DMEM medium supplemented with 10 mM HEPES and 2 mM L-glutamine and 100 μM 3-isobutyl-1-methylxanthine (IBMC, Sigma Aldrich). 60 min after infection, gentamicin was added and the cells were additionally incubated at 37°C for another 90 min. The determination of cAMP was performed using a competitive enzyme-linked immunosorbent assay (ELISA) according to the manufacturer's instructions (Amersham, cAMP Biotrak, RPN225). As a positive control, the indicated amount of cholera toxin (C8052, Sigma Aldrich) was added to the cells for 1 h in DMEM medium supplemented with 10 mM HEPES and 2 mM L-glutamine and 100 μM IBMK.

Dario embryo infection processes, imaging and automated image quantification. All animal experiments were performed in accordance with accepted guidelines. Dario was kept under standard conditions [52]. Embryos were divided into stages by the hour after fertilization at 28.5°C [53]. The following lines of dario were used in the study: wild-type fish (lines AB/EK and EK/TL). The infection protocol followed the guidelines presented in [54]. Embryos at the stage of 12 h after fertilization were kept in E3 medium containing 0.2 mM N-phenylthiourea (PTM) to prevent pigment formation. Embryos at day 2 after fertilization were anesthetized with 0.2 mg/ml tricaine and leveled on 1% agar plates in E3 medium using a hair loop [54]. Y. enterocolitica was grown on brain-heart extract supplemented with 0.4% arabinose and antibiotics and mDAP overnight at room temperature, diluted in fresh brain-heart extract with 0.5% arabinose and other supplements to an OD ₆₀₀ of 0.2, and grown 2 hours at room temperature before temperature shifting in a 37° C. shaker water bath for an additional 45 minutes. Finally, the bacteria were collected by centrifugation (OCU 6000, 30 s) and washed once with PBS. OD ₆₀₀ was set to 2 in PBS containing mDAP. 1-2 nl of this suspension was injected into the hindbrain of aligned dario embryos using a Femtojet Microinjector (Eppendorf) with Femtotips II capillaries (Eppendorf), where the end of the needle was broken off with fine forceps. The injection time was set to 0.2 s and the compensation pressure to 15 hPa (Eppendorf, Femtojet) and the injection pressure was adjusted from 600 to 800 hPa. The droplet size and thus the inoculum was checked by microscopy and control inoculation on Petri dishes. After microinjection, fish were harvested on E3 medium containing tricaine and FTM and incubated for 30 min at 37°C and additionally incubated for 5 h at 28°C. A fluorescent binocular (Leica) was used to observe the fluorescence of the USFB bacteria 1 hour after infection in the hindbrain of the dario, and embryos that were not properly injected were discarded. At the end of the infection process, the fish were fixed with 2% ice-cold PFA for 1 h on ice and additionally with fresh ice-cold PFA overnight at 4°C. Antibody staining was performed as described previously [55, 56]. Briefly, embryos were washed 4 times in PBS with 0.1% Tween (PBS-T) for 5 min each wash and permeabilized with PBS + 0.5% Triton X-100 for 30 min at room temperature. Embryos blocked into blocks

- 33 041646 solution (PBS, 0.1% Tween, 0.1% Triton X-100, 5% goat serum and 1% BSA) at 4°C overnight. Antibody (Cleaved Caspase-3 (Asp175), Cell Signaling) was diluted 1:100 in blocking solution and incubated with shaking at 4° C. in the dark. Fish were washed 7 times with PBS with 0.1% Tween for 30 min before the second antibody (goat anti-rabbit with AF647, Invitrogen, 1:500) diluted in blocking solution was added and incubated at 4°C for night. The larvae were washed with PBS with 0.1% Tween four times for 30 min at 4°C and once at night and additionally washed 3-4 times. Images were acquired with a Leica TCS SP5 confocal microscope using a 40x water immersion objective.

Images were analyzed using Imaris software (Bitplane) and Image J (http://imagej.nih.gov/ij/).

Image analysis (n=14 for pBad_Si2 or n=19 for z-BIM) was performed using CellProfiler [57] according to the maximum intensity of projections along the z-axis of the registered z-stack images. Briefly, bacteria were detected through the GFP channel. A circle with a radius of 10 pixels was created around each area of the bacteria spot. The overlapping areas were divided equally among the contacting members. In these areas densely surrounding the bacteria, the staining intensity of the p17 subunit of caspase 3 was measured.

Sample preparation for phosphoproteomics.

For each case, HeLa CCL-2 cells were grown in two 6-well plates until a state of confluence was reached. Cells were infected for 30 min as described above. At the indicated time points, the plates were placed on ice and washed twice with ice-cold PBS. The samples were then collected in a urea solution [8M urea (AppliChem), 0.1M ammonium bicarbonate (Sigma), 0.1% RapiGest detergent (Waters), 1x PhosSTOP inhibitor kit (Roche)]. Samples were briefly vortexed, sonicated at 4°С (Hielscher), shaken for 5 min on a thermomixer (Eppendorf), and centrifuged for 20 min at 4°С and 16000 g. The supernatants were collected and stored at -80°C for further processing. The BHC protein assay method (Pierce) was used to measure the protein concentration.

Enrichment of phosphopeptides.

Disulfide bonds were reduced with tris-(2-carboxyethyl)phosphine at a final concentration of 10 mM at 37°C for 1 h. Free thiol groups were alkylated with 20 mM iodoacetimide (Sigma) at room temperature for 30 min in the dark. Excess iodoacetamide was neutralized with Nacetylcysteine at a final concentration of 25 mM for 10 min at room temperature. Lys-C endopeptidase (Wako) was added to a final enzyme/protein ratio of 1:200 (v/v) and incubated for 4 h at 37°C. The solution was serially diluted with 0.1M ammonium bicarbonate (Sigma) to a final concentration below 2M urea and digested overnight at 37°C with modified trypsin for sequencing (Promega) at a protein to enzyme ratio of 50:1. The peptides were desalted on a C18 Sep-Pak cartridge (Waters) and dried under vacuum. Phosphopeptides were isolated from 2 mg of the total peptide mass using TiO ₂ as described previously [58]. Briefly, the dried peptides were dissolved in a solution of 80% acetonitrile (ACN) - 2.5% trifluoroacetic acid (TFA) saturated with phthalic acid. The peptides were added to the same volume of equilibrated TiO2 (granule size 5 μm, GL Sciences) in a blocked Mobicol spin column (MoBiTec), which was incubated for 30 min with top-down and bottom-up rotation. The column was washed twice with saturated phthalic acid, twice with 80% acetonitrile and 0.1% TFA, and finally twice with 0.1% TFA. The peptides were eluted with 0.3M NH ₄ OH. The pH of the eluates was adjusted with 5% TFA and 2M HCl to pH below 2.5. Phosphopeptides were again desalinated on C18 microspin cartridges (Harvard Apparatus).

Analysis by liquid chromatography with tandem mass spectrometry (LC-MS/MS).

Chromatographic separation of peptides was performed using an EASY nano-LC system (Thermo Fisher Scientific) equipped with a heated column for reverse phase high performance liquid chromatography (RP HPLC) (75 µm x 45 cm) prefilled with 1.9 µm C18 resin (Reprosil-AQ Pur, Dr. Maisch). Aliquots of a 1 µg sample of total phosphopeptides were analyzed per LC-MS/MS cycle using a linear gradient ranging from 98% solvent A (0.15% formic acid) and 2% solvent B (98% acetonitiryl, 2% water, 0.15 % formic acid) to 30% solvent B in 120 min with a linear flow rate of 200 nl/min. Mass spectrometry was performed on an LTQ-Orbitrap dual pressure mass spectrometer equipped with a nanoelectrospray ionization source (both from Thermo Fisher Scientific). Each first mass spectrometry (MS1) scan (obtained by Orbitrap) was followed by collision-induced dissociation (CID obtained by LTQ) of the 20 most abundant precursor ions with a dynamic exclusion of 30 s. For the analysis of phosphopeptides, the 10 most common precursor ions were subjected to collision-induced dissociation with allowed multi-step activation. The total cycle time was approximately 2 s. For MC1, 106 ions were accumulated in the Orbitrap chamber over a maximum time of 300 ms and scanned at a resolution of 60,000 FWHM (full width at half maximum) (at 400 m/z). Mass spectrometry 2 (MS2) scans were acquired using normal scan mode, target setting of 10 ⁴ ions, and acquisition time of 25 ms.

Singly charged ions and ions with an indeterminate charged state were excluded from triggering

MS2 events. The normalized collision energy was set to 32% and one microscan was obtained for each spectrum.

Marker-free quantification and database search.

The resulting raw files were imported into the Progenesis tool (Nonlinear Dynamics, version 4.0) for markerless quantification using the default parameters. MS2 spectra were directly exported from Progenesis to mgf format and searched using the MASCOT algorithm (Matrix Science, version 2.4) against a database of spurious proteins [59] containing normal and reverse sequences of SwissProt predicted data records for Homo sapiens (www.ebi.ac .uk, release date 16/05/2012) and traditionally occurring contaminants (total 41250 sequences) created using the SequenceReverser tool from the MaxQuant software (version 1.0.13.13). To identify proteins derived from Y. enterocolitica, samples not enriched in phosphopeptides were searched against the same database mentioned above, including SwissProt no Y. enterocolitica predicted data records (www.ebi.ac.uk, issue date 15/08/ 2013). The precursor ion tolerance was set to 10 ppm and the fragment ion tolerance was set to 0.6 Da. The search criteria was set as follows: complete specificity for trypsin was required (cleavage after lysine or argnine residues if the next residue was not proline), 2 missed cleavages were allowed, urea methylation (C) was set as a fixed modification and phosphorylation (S, T, Y,) or oxidation (M) as a variable modification for enriched TiO ₂ or unenriched samples, respectively. Finally, the database search results were exported as xml files and imported back into the Progenesis software for feature assignment in MCl. For the quantification of phosphopeptides, a csv file containing the MCl peak intensities of all identified traits was exported, and for unenriched samples, a csv file was created containing protein measurements based on the summed peak intensities of all identified peptides per protein. It is important that the Progenesis software be set up so that proteins identified by similar sets of peptides are grouped together and that only non-conflicting peptides with specific sequences for single proteins in the protein quantification database are used. Both files were further processed using our own SafeQuant v1.0 R script (unpublished data, available at https://github.com/eahrne/SafeQuant/). Briefly, the software sets the percentage of false positives on identification to 1% (based on the number of matches in the false protein sequence database) and normalizes the identified peak intensities of MC1 (extracted ion chromatogram, XIC) among all samples, i.e. the summed XIC of all confidently identified peptide traits is scaled to be equivalent to all LC-MS cycles. Next, all quantified phosphopeptides/proteins are assigned an intensity ratio at each time point based on the average XIC per time unit. The static significance of each relationship is represented by its q-value (p-values adjusted for false positive rate) obtained by calculating modified t-statistical p-values [60] and adjusting for multiple comparisons [61]. The localization of phosphorylated residues was automatically assigned by the MASCOT algorithm (value >10). All annotated spectra, along with mass spectrometry raw files and search parameters used, will be placed on the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the PRIDE partner repository [62].

Sequence alignment was performed using the web version of the ClustalW2 multisequence alignment tool at http://www.ebi.ac.uk/Tools/msa/clustalw2/ owned by the European Molecular Biology Laboratory and European Bioinformatics Institute (EMBL-EBI).

C) results.

Protein delivery system based on the secretion of type 3 YopE fusion proteins.

While the very N-terminus of the YopE effector (SEQ ID NO: 1) of the Y. enterocolitica C3T system contains a secretion signal sufficient for translocation of heterogeneous proteins [10], the chaperone-binding site (CBS) for its chaperone (SycE) is not included in it. [63]. The present inventors chose the 138 N-terminal amino acids of YopE (SEQ ID NO: 2) to be fused to the delivered proteins, as this has been shown to give the best results for translocation of other heterologous C3T substrates [38]. Because these 138 N-terminal amino acids of YopE contain a chaperone binding site, the present inventors decided to co-express SycE. The SycEYopE1-138 fragment cloned from the purified Y. enterocolitica pYV40 virulence plasmid contains endogenous promoters of YopE and its SycE chaperone (Fig. 10). Thus, SycE and any merged with YopE1. ₁₃₈ proteins are induced by a rapid temperature shift from growth at room temperature to 37°C. The culture time at 37°C will affect the amount of fusion protein present in the bacteria. A multiple cloning site (MCS) was added to the 3' end of YopE1_ ₁₃₈ (Fig.

B), followed by a Myc tag and a 6 Hys tag (6xHis tag) and a stop codon.

The background strain was carefully chosen. First, in order to limit the translocation of endogenous effectors, the authors of the present invention used a Y. enterocolitica strain that had all known effectors, Yop H, O, P, E, M, and T (called ANOREMT) removed [64]. Additionally, the authors used an auxotrophic mutant that cannot grow in the absence of exogenous meso-2,6-diaminopimelic acid [65]. The aspartate-β-semialdehyde dehydrogenase (Aasd) gene was deleted from this strain and classified as biosafety level 1 according to the Swiss Safety Agency (Amendment to A010088/2). Additionally, the authors of the present invention removed the YadA and/or InvA adhesion proteins to offer a wider choice of background strains. While the use of yadA or yadA/invA strains reduces induced background signaling [66], it also affects the amount of protein delivered [67].

Characterization of the delivery of the YopE fusion protein into eukaryotic cells.

In the in vitro secretion assay (see FIG. 1A), protein secretion into the surrounding fluid is artificially induced. After protein precipitation with TCA, Western blotting with anti-YopE antibody was used to determine the amounts of secreted protein (FIG. 1B). Whereas the wild-type (wt) strain secreted full-length YopE, the ANOREMT asd strains did not. As a result of the presence of YopE1. ₁₃₈ -Myc-His (hereinafter referred to as YopE ₁ . ₁₃₈ -Myc; SEQ ID NO: 3) a small band of YopE became visible (FIG. 1B). Therefore, the YopE1_ ₁₃₈ fragment is well secreted under the conditions described in this application. To analyze the homogeneity of protein translocation into eukaryotic cells, the present inventors infected HeLa cells with a strain encoding YopE1_ ₁₃₈ -Myc and stained Musmetka with immunofluorescence (IF) (FIGS. 2A and B). Whereas only bacteria stained initially, 30 min after infection, cell outlines become visible and become more intense with increased infection time (FIG. 2B). This trend is well reflected by the intensity of Myc staining inside HeLa cells (FIGS. 2A and B). YopE1_ ₁₃₈ -Myc can be detected throughout the cells (Fig. 2A), except for the nuclei [68]. Notably, most, if not all, cells were comparatively affected by this approach. Since Y. enterocolitica is known to infect many different cell types [69], the authors of the present invention followed the delivery of YopE1_ ₁₃₈ -Myc to various cell lines. The same homogeneous immunofluorescent antiMus staining was observed in infected mouse fibroblasts, Jurkat cells and HUVEC cells (FIG. 11). Moreover, decreasing or increasing the MOI allows modulation of the amount of delivered protein (Fig. 2C), while most cells still remain targets. A low number of bacteria will not result in a few cells with a lot of delivered protein, but rather a majority of cells with a low amount of delivered protein (FIG. 2C).

Redirection of CC3T-delivered proteins to the nucleus.

Since the YopE protein itself is localized in the cytoplasm (FIG. 2A), it is of particular interest to check whether the YopE ₁ fragment makes it difficult. ₁₃₈ localization of nuclear fusion proteins. Thus, the present inventors added the SV40 nuclear localization signal (NSL) to the C-terminus (and N-terminus, similar results) of YopE ₁ . ₁₃₈ -UZFB (respectively, SEQ ID NO: 39 and SEQ ID NO: 38). Whereas YopE1_ ₁₃₈ USFB (SEQ ID NO: 37) resulted in weak cytoplasmic staining, YopE ₁ . ₁₃₈ -UZPB-NLS elicited a stronger UZPB nuclear signal in infected HeLa cells (FIG. 3). This indicates that the YopE1_ ₁₃₈ fragment is compatible with the use of a nuclear localization signal (NLS). While mCherry has already been used in plant pathogens [70], this demonstrates the successful delivery of a PBS-like protein via human or animal pathogenic bacteria encoding CC3T. This confirms that the SycE and YopE1_ ₁₃₈ based strategy is very promising for delivering a variety of selected proteins.

Removal of the YopE1_ ₁₃₈ residue after translocation of the fusion protein into the eukaryotic cell.

Although bacterial delivery of the YopE1_ ₁₃₈ fragment offers many advantages, it can interfere with the function of the fusion proteins and/or their localization. Thus, removal of this fragment after protein delivery would be optimal. To this end, the present inventors introduced two TEV protease (ENLYFQS) cleavage sites [71-73] between YopE1_ ₁₃₈ and a fusion partner (ET1-Myc transcription regulator (SEQ ID NOS: 36 and 41) [74] and human INK4C (SEQ ID NO: 40 and SEQ ID NO: 43)). To maintain the advantages of the present method, we additionally fused the TEV protease (variant S219V; [75]) to YopE1_ ₁₃₈ (SEQ ID NO: 42) in another strain of Y. enterocolitica. HeLa cells were infected with both strains at the same time. To be able to analyze only translocated protein fractions, infected HeLa cells were lysed 2 h after infection (Fig. 4) with digitonin, which is known to not lyse bacteria ([76]; see Fig. 12, control). Western blotting showed only YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-ET1-Myc or only YopE1_ ₁₃₈ -(2 TEV protease cleavage sites)-Flag-INK4C-Myc when cells were infected with the respective strain (Fig. 4A and C ). As a result of overnight digestion of these cell lysates with purified TEV protease, a shifted band could be observed (FIGS. 4 A and C). This strip

- 36 041646 corresponds to ETl-Myc (Fig. 4C) or Flag-INK4C (Fig. 4A) with N-terminal residues of the TEV protease cleavage site, most likely represented by only one serine. Co-infection of cells with the strain delivering the TEV protease results in the same cleavage fragments of ET1-Myc or Flag-INK4C, indicating that the TEV protease delivered via CC3T is functional and that single cells were infected with both strains of bacteria (Fig. 4A and C). Although cleavage is not complete, most of the translocated protein is cleaved as early as 2 hours post-infection, and even overnight cleavage with purified TEV protease did not reach the best cleavage rates (FIG. 4B). As noted, TEV protease-based cleavage may require optimization depending on the fusion protein [77, 78]. TEV protease dependent removal of YopE ₁ residue. ₁₃₈ after translocation, therefore, provides for the first time the delivery of proteins by the C3T system in relation to practically native heterologous proteins, changing the amino acid composition by only one N-terminal amino acid.

An alternative approach to TEV protease-based cleavage of the YopE fragment is to incorporate ubiquitin into the fusion protein of interest. Indeed, ubiquitin is processed at its C-terminus by a group of endogenous ubiquitin-specific C-terminal proteases (deubiquitinating enzymes, DUB). Since the cleavage is assumed to occur at the very C-terminus of ubiquitin (after G76), the protein of interest should not contain an additional amino acid sequence. This method was tested on the YopE ₁ fusion protein. ₁₃₈ -ubiquitin-FlagINK4C-MycHis. In control cells infected with bacteria expressing YopE1_ ₁₃₈ Flag-INK4C-MycHis, a band corresponding to YopE1_ ₁₃₈ -Flag-INK4C-MycHis was detected, indicating efficient translocation of the fusion protein (FIG. 24). When cells were infected for 1 h with bacteria expressing YopE ₁ . ₁₃₈ -ubiquitin-Flag-INK4C-MycHis, an additional band corresponding to the size of Flag-INK4C-MycHis was visible, indicating that part of the fusion protein had been cleaved. This result shows that the introduction of ubiquitin into the fusion protein allows the YopE1_ ₁₃₈ fragment to be cleaved without the need to use an exogenous protease.

Translocation of effectors of type III and type IV bacteria.

The SopE protein from Salmonella enterica is a well-characterized guanine nucleotide exchange factor (GEF) that interacts with Cdc42 to stimulate actin cytoskeleton remodeling [79]. While the translocation of YopE ₁ . ₁₃₈ -Myc inside HeLa cells has no effect, transposed YopE1_ ₁₃₈ -SopE (SEQ ID NO: 5 and 135) induces significant changes in the actin network (Fig. 5A). Similar results were obtained with another guanine nucleotide exchange factor effector protein, IpgB1 from Shigella flexneri (SEQ ID NO: 4). Notably, the first changes in the actin cytoskeleton were observed as soon as 2 min after infection (Fig. 5A). Thus, it can be concluded that CC3T-dependent protein delivery occurs immediately after initiation of infection by centrifugation. To prove strict CC3T-dependent transport, one of the proteins of the C3T system, which forms a translocation pore into the eukaryotic cell, was removed (YopB, see [80]) (Fig. 12).

During Salmonella infection after translocation of SopE, translocation of SptP occurred, which functions as a GTPase activating protein (GAP) for Cdc42 [81]. Although translocation of YopE1_ ₁₃₈ -SopE-Myc (SEQ ID NO: 135) by itself triggers massive F-actin rearrangements, co-infection with bacteria expressing YopE1_ ₁₃₈ -SptP (SEQ ID NO: 8) abolished this effect in a dose-dependent manner. (Fig. 5B). Anti-Myc staining showed that the cause of this inhibition was not a reduced level of YopE1_ ₁₃₈ -SopE-Myc translocation (FIG. 5B). Together, these results showed that co-infection of cells with two strains of bacteria is a reliable way to deliver two different effectors to individual cells in order to elucidate their functional interaction.

The type III effector OspF from S. flexneri functions as a phosphothreonine lyase that dephosphorylates p38 and ERK MAP kinases [82]. To test the functional properties of the translocated protein YopE1_ ₁₃₈ -OspF (SEQ ID NO: 7), the authors of the present invention monitored the phosphorylation of p38 after stimulation with TNF-α. In uninfected cells or in cells infected with bacteria expressing YopE1_ ₁₃₈ -Myc, TNF-α induced p38 phosphorylation. In contrast, after YopE1_ ₁₃₈ -OspF translocation, TNF-α induced phosphorylation ceased, indicating that the delivered OspF was active against p38 (FIG. 6A).

During Salmonella infection, the SopB type III effector protects epithelial cells from apoptosis by sustained activation of the Akt protein [83]. Although YopE1_ ₁₃₈ -Myc or YopE1_ ₁₃₈ -SopE translocation does not affect Akt, YopE1_ ₁₃₈ -SopB translocation (SEQ ID NO: 6) induced significant Akt phosphorylation at positions T308 and S473, reflecting the active form (Fig. 6B) . Similar results were obtained with the SopB homologue from S. flexneri (IpgD, SEQ ID NO: 9). Taken together, the results of the present inventors show that the _{YopE1_138} delivery system functions for all C3T system effectors tested to date, and this allows the study of proteins involved in the control of central cellular functions, including the cytoskeleton, the inflammation process, and

- 37 041646 cell survival.

A number of bacteria, including Agrobacterium tumefaciens, Legionella pneumophila, and Bartonella henselae, use type IV secretion to inject effectors into cells. The present inventors tested whether the type IV VerA effector from B. henselae could be translocated into HeLa cells using our tool. The full-length BepA protein (SEQ ID NO: 10) and BepA _E305 _ _end (SEQ ID NO: 11) containing the Bid C-terminal domain were cloned and the cells were infected with the respective strains. Since VerA has been shown to induce the production of cyclic AMP (cAMP) [84], the level of cAMP in HeLa cells was measured after infection. While translocation of the B. henselae BepG effector Bid domain (SEQ ID NO: 136) failed to induce cAMP production, full-length VerA and BepA _E305 _ _end triggered cAMP production in expected amounts [84] (Fig. 6C). These results indicate that type IV effectors can also be efficiently delivered by the _YopE1-138 delivery system to target cells and that they are functional proteins.

Translocation of eukaryotic proteins into epithelial cells.

In order to show that human proteins can be translocated via type III secretion, the present inventors have fused inducers of human apoptosis when Y. enterocolitica is delivered to YopE ₁ _ ₁₃₈ or when S. enterica is delivered to SteA1_2 ₀ , SteA, SopE ₁ _ ₈₁ or SopE ₁ _ ₁₀₅ . We then monitored the translocation of a human BH3-interacting death domain agonist (BID, SEQ ID NO: 24), which is a pro-apoptotic member of the Bcl-2 protein family. It mediates mitochondrial damage induced by caspase-8 (CASP8). CASP8 cleaves BID and the truncated BID (tBID, SEQ ID NO: 25) is translocated into mitochondria where it triggers the release of cytochrome c. The latter leads to the internal mode of caspase 3 (CASP3) activation, during which it is cleaved into subunits of 17 and 12 kDa [85]. Although 1 h infection with Y. enterocolitica expressing _{YopE1_138} -Myc or _YopE1-138 BID failed to _induce apoptosis, human tBID translocation triggers cell death on a larger scale than the well-characterized apoptosis inducer staurosporine (Fig. 7A and C). As expected, the tBID translocation leads to the production of the p17 CASP3 subunit even in greater amounts than with staurosporine (FIG. 7A). In order to be able to compare the amounts of translocated protein with the amount of endogenous Bid, HeLa cells were lysed with digitonin and analyzed by Western blot using an anti-Bid antibody (FIG. 7B). CC3T-delivered YopE1_ ₁₃₈ -tBID protein reached approximately endogenous Bid levels in HeLa cells, while YopE1_ ₁₃₈ -BID delivered was present at even higher levels (2.5-fold) (FIG. 7B). Deep proteomic and transcriptomic mapping of HeLa cells calculated 4.4 x ¹⁰⁵ BID copies per cell [86]. Thus, it can be concluded that CVD-dependent human protein delivery reaches values of 105-106 proteins per cell. These numbers correspond to the number of copies per cell of nanoparticles translocated by E. coli CC3T [19]. Assuming a factor of 10 for MOI and duration of infection, a factor of 3.2 for antibiotic addition time, and culture time at 37°C prior to infection, the number of copies of delivered protein per cell can be set from a few 1000 copies/cell to a few 106 copies/ cell. Taken together, these results indicate that the translocated tBID was functioning and its delivery was at an appropriate level. This confirmed the suitability of the translocation tool for studying the role of proteins in the regulation of apoptosis, a central aspect of cell biology.

The present inventors further fused mouse tBID (codon-optimized for Y. enterocolitica; SEQ ID NO: 194) or mouse tBID BH3 or mouse BAX domains (both codon-optimized for Y. enterocolitica; SEQ ID NO: 138 and 139) with YopE1_ ₁₃₈ to deliver Y. enterocolitica. While infection within 2.5 h with a Y. enterocolitica AHOPEMT asd strain that does not deliver protein or delivers YopE ₁ . ₁₃₈ -Myc failed to trigger apoptosis, translocation of mouse tBID (codon-optimized for Y. enterocolitica, SEQ ID NO: 194) triggered cell death in B16F10 (Fig. 16), D2A1 (Fig. 17), HeLa (Fig. 18) and 4T1 (Fig. 19). Translocation of the BH3 domain of mouse BID codon-optimized for Y. enterocolitica (SEQ ID NO: 138) or mouse BAX codon-optimized for Y. enterocolaitica (SEQ ID NO: 139) has also been found to induce massive cell death in B16F10 (Fig. 16), D2A1 (Fig. 17), HeLa (Fig. 18) and 4T1 (Fig. 19) cells.

While infection for 4 hours with S. enterica aroA failed to induce apoptosis, mouse tBID translocation triggered apoptosis, as mouse t translocation resulted in the production of the p17 CASP3 subunit (FIGS. 20 and 21). The scale of apoptosis induction for SopE fusion proteins was greater under conditions inducing SpiI CC3T (FIG. 20), reflecting SopE transport exclusively by SpiI CC3T. Mouse tBid fused to SteA1_ ₂₀ failed to induce apoptosis, most likely because the secretion signal within the 20 N-terminal amino acids of SteA is not sufficient to effect delivery of the fusion protein (FIGS. 20 and 21). Mouse tBid fused to full-length SteA induced apoptosis in HeLa cells (FIGS. 20 and 21), under conditions that induce both SpiI and SpiII CC3T, reflecting the ability of SteA to be transported by both CC3T. It should be noted that even under conditions that induce SpiII CC3T, partial activity of SpiI CC3T is expected, as observed by the activity of SopE fusion proteins under conditions that induce SpiII CC3T (Fig. 21).

In addition to the translocated eukaryotic proteins carefully functionally disassembled in this application, several other eukaryotic proteins were secreted using the tool described in this application. This includes, in the case of Y. enterocolitica delivery (FIGS. 13, 14 and 23), proteins from cell cycle regulation (Mad2 (SEQ ID NO: 15), CDK1 (SEQ ID NO: 14), INK4A (SEQ ID NO: 16), INK4B (SEQ ID NO: 17) and INK4C (SEQ ID NO: 18)), as well as parts thereof (INK4A, residues 84-103 (SEQ ID NO: 158), p107, residues 657-662 (SEQ ID NO: 159 ), p21, residues 141-160 (SEQ ID NO: 160), p21, residues 145-160 (SEQ ID NO: 161), p21, residues 17-33 (SEQ ID NO: 162) and cyclin D2, residues 139- 147 (SEQ ID NO: 163)), apoptosis-associated proteins (Bad (SEQ ID NO: 29), FADD (SEQ ID NO: 28), and subunits p17 (SEQ ID NO: 22) and p12 (SEQ ID NO: 23) caspase 3, Bid (SEQ ID NO: 19) and t-Bid (SEQ ID NO: 20)) of Dario, as well as their parts (tBid, BH3 domain (SEQ ID NO: 138), Bax, BH3 domain (SEQ ID NO: 139)), signal proteins (mouse TRAF6 (SEQ ID NO: 12), TIFA (SEQ ID NO: 13)), GPCR Ga subunit (GNA12, shortest isoform, (SEQ ID NO: 30)) , nanobody (vhhGFP4, (SEQ ID NO: 31)) and constructs fused with nanobodies for targeted protein degradation ka (Slmb-vhhGFP4; (SEQ ID NOS: 32, 33, 34) [87]) (FIGS. 13 and 14), as well as small GTPases (Rac1 Q61E (SEQ ID NOS: 26 and 137) and RhoA Q63L (SEQ ID NOS: 27) and plextrin homologous domain from human Akt protein (SEQ ID NO: 35) In addition to the carefully functionally disassembled apoptosis-associated proteins (mouse tBid, SEQ ID NO: 144-147), this further includes in the case of S. enterica delivery (Fig. 22 ) proteins from cell cycle regulation (Mad2 (SEQ ID NO: 168169), CDK1 (SEQ ID NO: 170-171), INK4A (SEQ ID NO: 164-165) and INK4C (SEQ ID NO: 166-167)). Despite the fact that these proteins have not been functionally confirmed, the possibility of CC3T-dependent secretion of various eukaryotic proteins, combined with the possible removal of the YopE residue, opens up new prospects for the widespread use of CC3T in cell biology.

In vivo translocation of the truncated Bid in dario embryos induces apoptosis.

An interesting feature of this bacterial instrument is its potential use in living animals. Dario in its embryonic state can be kept transparent, allowing fluorescent staining and microscopy [54, 88, 89]. Several inducers of dario apoptosis have been described in detail, of which z-BIM is the most active [90]. Thus, the authors of the present invention decided to clone z-BIM into their system. Although it is weakly homologous to human BIM, we evaluated the apoptosis induction activity of YopE ₁ _ ₁₃₈ -z-BIM (SEQ ID NO: 21) in human epithelial cells. HeLa cells infected for 1 h with a strain translocating YopE1_ ₁₃₈ -z-BIM showed clear signs of cell death. The authors then performed in vivo experiments with dario embryos at the 2-day post-fertilization stage using a localized infection model by microinjection of bacteria into the hindbrain [54]. After infection for 5.5 hours, the dario was fixed, permeabilized and stained to determine the presence of the p17 CASP3 subunit. As a result of infection with a strain expressing YopE ₁ . ₁₃₈ -Myc, bacteria were visible in the hindbrain region (staining b, Fig. 8A I), but no induction of apoptosis around the bacteria was detected (staining c, Fig. 8A I). In contrast, as a result of infection with a strain delivering YopE ₁ _ ₁₃₈ -z-BIM, a significant increase in the level of cleaved CASP3 was observed in areas surrounding the bacteria (Fig. 8A II). Automated image analysis of peak intensity z-axis projections confirms that bacteria translocating YopE1_ ₁₃₈ -zBIM induce apoptosis in neighboring cells much more frequently than control bacteria do (Fig. 8B). This indicates that z-BIM is functional as a result of bacterial translocation. These results further support the use of CC3T to deliver eukaryotic proteins in live animals.

Phosphoproteomics shows the global impact of translocated proteins on protein phosphorylation.

Phosphorylation is a widespread post-translational modification that can both activate and inactivate biological processes and thus is a suitable target for studying signal transduction phenomena [91, 92]. Despite this, there is currently no analysis of phosphorylation during apoptosis at the system level. To analyze the impact of human tBid protein delivered inside HeLa cells, the present inventors used a marker-free phosphoproteomic approach using LC-MS/MS. In three independent experiments, cells were either left untreated, infected with ANOREMT strain asd + YopE ₁ . ₁₃₈ -Myc, or infected with a strain with ANOREMT asd + YopE1_ ₁₃₈ -tBid for 30 min. Cells were lysed followed by enzymatic digestion, enrichment of phosphopeptides, and quantification and identification of individual phosphopeptides. The present inventors compared cells infected with ANOREMT asd + YopE ₁ strain. ₁₃₈ -Myc with cells infected with the ANOREMT asd + YopE1_ ₁₃₈ -tBid strain, which made it possible to identify 363 tBid-dependent phosphorylation phenomena. 286 phosphopeptides showed an increase in the degree of phosphorylation, while 77 were less phosphorylated as a result of tBid delivery, corresponding to 243 differences.

- 39 041646 proteins, which we identified as the phosphoproteome of the tBid protein. The STRING database was used to create a network of protein-protein interactions of the tBid phosphoproteome [93] (Fig. 9A). An additional 27 proteins known to be associated with mitochondrial apoptosis were added to the network, forming a central cluster. Interestingly, only a few proteins from the tBid phosphoproteome are associated with this central cluster, indicating that many proteins undergo changes in the degree of phosphorylation that have not been directly associated with apoptotic proteins until now. In order to characterize the biological functions encompassed by the tBid phosphoproteome, the present inventors performed a gene ontology analysis using the Database for Annotation, Visualization, and Integrated Discovery (DAVID, http://david.abcc) annotation tool. .ncifcrf.gov/) [94, 95]. The identified biological functions show that tBid influences various cellular processes. Many proteins involved in chromatin rearrangement and transcriptional regulation undergo a change in degree of phosphorylation (ie, CBX3, CBX5, TRIM28, HDAC1). HDAC1, for example, is a histone deacetylase that plays a role in the regulation of transcription. It has been shown that HDAC1 can modulate the transcriptional activity of NF-kB, a protein also involved in apoptosis. The authors additionally identified a cluster of proteins involved in RNA processing, which, as previously shown, plays an important role in the regulation of apoptosis [96]. HNRPK, for example, mediates the p53/TP53 response to DNA damage and is required for the induction of apoptosis [97]. In addition, the phosphorylation of proteins involved in the translation of proteins is also affected. Several eukaryotic initiation factors (ie EIF4E2, EIF4B, EIF3A, EIF4G2) undergo a change in degree of phosphorylation consistent with the observation that overall protein synthesis is reduced in apoptotic cells. Interestingly, the phosphorylation of many proteins involved in cytoskeletal remodeling (eg, PXN, MAP1B9) is altered by tBid delivery. This is in line with the observation that cell morphology is significantly altered as a result of tBid delivery (FIG. 9B). Cell contraction and loss of contact is reflected by the fact that the authors observe phosphorylation of adhesion-related proteins such as ZO2 and paxillin. Similarly, nuclear contraction is accompanied by phosphorylation of laminar proteins such as lamin A/C and lamin B1. Taken together, tBID delivery induces a rapid apoptotic response, also demonstrated by disruption of mitochondrial integrity (FIG. 9B). The present inventors have shown that tBid-induced apoptosis affects hundreds of phosphorylation events involved in a variety of cellular processes. While many identified proteins have been associated with apoptosis, only a few proteins have been known to be phosphorylated as a result of apoptosis induction. Thus, the phosphoproteomic approach provides a useful source for further studies of apoptosis.

- 40 041646

List of reference documents

1. Gibson, T.J., M. Seiler, and R.A. Veitia (2013) The transience of transient overexpression. Nat Methods. 10:715-21.

2. Inoue, T., W.D. Heo, J.S. Grimley, T.J. Wandless, and T. Meyer (2005) An inducible translocation strategy to rapidly activate and inhibit small GTPase signaling pathways. Nat Methods. 2:415-8.

3. Pust, S., H. Hoehmann, E. Kaiser, G. von Figura, K. Heine, et al. (2007) A cellpermeable fusion toxin as a tool to study the consequences of actin-ADP-ribosylation caused by the Salmonella enterica virulence factor SpvB in intact cells. J Biol Chern. 282:10272-82.

4. Hayes, C.S., S.K. Aoki, and D.A. Low (2010) Bacterial contact-dependent delivery systems. Annu Rev Genet. 44:71-90.

5. Cornelis, G.R. (2006) The type III secretion injectisome. Nat Rev Microbiol. 4:811-25.

6. Michiels, T., P. Wattiau, R. Brasseur, J.M. Ruysschaert, and G. Cornelis (1990) Secretion of Yop proteins by Yersiniae. Infect Immun. 58:2840-9.

7. Letzelter, M., I. Sorg, L.J. Mota, S. Meyer, J. Stalder, et al. (2006) The discovery of SycO highlights a new function for type III secretion effector chaperones. EMBO J. 25: 3223-33.

8. Gauthier, A., and B.B. Finlay (2003) Translocated intimin receptor and its chaperone interact with ATPase of the type III secretion apparatus of enteropathogenic Escherichia coli. J Bacteriol. 185:6747-55.

9. Wattiau, P., and G.R. Cornelis (1993) SycE, a chaperone-like protein of Yersinia enterocolitica involved in the secretion of YopE. Mol Microbiol. 8:123-31.

10. Feldman, M.F., S. Muller, E. Wuest, and G.R. Cornelis (2002) SycE allows secretion of YopE-DHFR hybrids by the Yersinia enterocolitica type III Ysc system. Mol Microbiol. 46:1183-97.

11. Akeda, Y., and J.E. Galan (2005) Chaperone release and unfolding of substrates in type III secretion. Nature. 437:911-5.

12. Pais, S.V., C. Milho, F. Almeida, and L.J. Mota (2013) Identification of novel type III secretion chaperone-substrate complexes of Chlamydia trachomatis. PLOS One. 8:e56292.

13. Sory, M.P., and G.R. Cornelis (1994) Translocation of a hybrid YopE-adenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol Microbiol. 14:583-94.

14. Garcia, J.T., F. Ferracci, M.W. Jackson, S.S. Joseph, I. Pattis, et al. (2006) Measurement of effector protein injection by type III and type IV secretion systems by using a 13-residue phosphorylatable glycogen synthase kinase tag. Infect Immun. 74:5645-57.

- 41 041646

15. Chen, L.M., G. Briones, R.O. Donis, and J.E. Galan (2006) Optimization of the delivery of heterologous proteins by the Salmonella enterica serovar Typhimurium type III secretion system for vaccine development. Infect Immun. 74:5826-33.

16. Russmann, H., H. Shams, F. Poblete, Y. Fu, J.E. Galan, et al. (1998) Delivery of epitopes by the Salmonella type III secretion system for vaccine development. Science. 281:565-8.

17. Russmann, H., U. Gerdemann, E.I. Igwe, K. Panthel, J. Heesemann, et al. (2003) Attenuated Yersinia pseudotuberculosis carrier vaccine for simultaneous antigen-specific CD4 and CD8 T-cell induction. Infect Immun. 71:3463-72.

18. Chaux, P., R. Luiten, N. Demotte, V. Vantomme, V. Stroobant, et al. (1999) Identification of five MAGE-A1 epitopes recognized by cytolytic T lymphocytes obtained by in vitro stimulation with dendritic cells transduced with MAGE-A1. J Immunol. 163:2928-36.

19. Blanco-Toribio, A., S. Muyldermans, G. Frankel, and L.A. Fernandez (2010) Direct injection of functional single-domain antibodies from E. coli into human cells. PLOS One. 5: el5227.

20. Bichsel, C., D. Neeld, T. Hamazaki, L.J. Chang, L.J. Yang, et al. (2013) Direct reprogramming of fibroblasts to myocytes via bacterial injection of MyoD protein. Cell Reprogram. 15:117-25.

21. Bichsel, C., D.K. Neeld, T. Hamazaki, D. Wu, L.J. Chang, et al. (2011) Bacterial delivery of nuclear proteins into pluripotent and differentiated cells. PLOS One. 6: el6465.

22. Chamekh, M., A. Phalipon, R. Quertainmont, I. Salmon, P. Sansonetti, et al. (2008) Delivery of biologically active anti-inflammatory cytokines IL-10 and IL-Ira in vivo by the Shigella type III secretion apparatus. J Immunol. 180:4292-8.

23. Hoffman, R.M. (2011) Tumor-seeking Salmonella amino acids auxotrophs. Curr Opin Biotechnol. 22:917-23.

24. Hoang, T.T., S. Williams, H.P. Schweizer, and J.S. Lam (1997) Molecular genetic analysis of the region containing the essential Pseudomonas aeruginosa asd gene encoding aspartate-beta-semialdehyde dehydrogenase. microbiology. 143 (Pt 3): 899-907.

25. Skumik, M., and H. Wolf-Watz (1989) Analysis of the yopA gene encoding the Yopl virulence determinants of Yersinia spp. Mol Microbiol. 3:517-29.

26. Tertti, R., M. Skurnik, T. Vartio, and P. Kuusela (1992) Adhesion protein YadA of Yersinia species mediates binding of bacteria to fibronectin. Infect Immun. 60:3021-4.

27. Isberg, R.R., and J.M. Leong (1990) Multiple beta 1 chain integrins are receptors for invasin, a protein that promotes bacterial penetration into mammalian cells. cell. 60:861-71.

28. Isberg, R.R., D.L. Voorhis, and S. Falkow (1987) Identification of invasin: a protein that allows enteric bacteria to penetrate cultured mammalian cells. cell. 50:769-78.

- 42 041646

29. Leon, J.M., R.S. Fournier, and R.R. Isberg (1990) Identification of the integrin binding domain of the Yersinia pseudotuberculosis invasin protein. EMBO J. 9: 1979-89.

30. Mota, L.J., and G.R. Cornelis (2005) The bacterial injection kit: type III secretion systems. Ann Med. 37:234-49.

31. Trosky, J.E., A.D. Liverman, and K. Orth (2008) Yersinia outer proteins: Yops. Cell Microbiol. 10:557-65.

32. Brenner, D., and T.W. Mak (2009) Mitochondrial cell death effectors. Curr Opin Cell Biol. 21:871-7.

33. Chalah, A., and R. Khosravi-Far (2008) The mitochondrial death pathway. Adv Exp Med Biol. 615:25-45.

34. Fuchs, Y., and H. Steller (2011) Programmed cell death in animal development and disease. cell. 147:742-58.

35. Waugh, D.S. (2011) An overview of enzymatic reagents for the removal of affinity tags. Protein Expr Purif. 80:283-93.

36. Sarker, M.R., C. Neyt, I. Stainier, and G.R. Cornelis (1998) The Yersinia Yop virulon: LcrV is required for extrusion of the translocators YopB and YopD. J Bacteriol. 180:1207-14.

37. Ramamurthi, K.S., and O. Schneewind (2005) A synonymous mutation in Yersinia enterocolitica yopE affects the function of the YopE type III secretion signal. J Bacteriol. 187:707-15.

38. Wolke, S., N. Ackermann, and J. Heesemann (2011) The Yersinia enterocolitica type 3 secretion system (T3SS) as a toolbox for studying the cell biological effects of bacterial Rho GTPase modulating T3SS effector proteins. Cell Microbiol. 13:1339-57.

39. Forsberg, A., and H. Wolf-Watz (1990) Genetic analysis of the yopE region of Yersinia spp.: identification of a novel conserved locus, yerA, regulating yopE expression. J Bacteriol. 172:1547-55.

40. Sambrook, J. 2001. Molecular cloning : a laboratory manual. D.W. Russell, editor. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. .

41. Alto, N.M., and J.E. Dixon (2008) Analysis of Rho-GTPase mimicry by a family of bacterial type III effector proteins. Methods Enzymol. 439:131-43.

42. Alto, N.M., F. Shao, C.S. Lazar, R.L. Brost, G. Chua, et al. (2006) Identification of a bacterial type III effector family with G protein mimicry functions. cell. 124:133-45.

43. Kaniga, K., I. Delor, and G.R. Cornelis (1991) A wide-host-range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene. 109:137-41.

- 43 041646

44. Yoneda, Y., T. Semba, Y. Kaneda, R.L. Noble, Y. Matsuoka, et al. (1992) A long synthetic peptide containing a nuclear localization signal and its flanking sequences of SV40 Tantigen directs the transport of IgM into the nucleus efficiently. Exp Cell Res. 201:313-20.

45. Cornelis, G.R. 1997. Cross talk between Yersinia and eukaryotic cells. In Molecular aspects of host-pathoge interactions. S. MoCRAE, SMYTH, STOW, editor. Cambridge University Press.

46. Metcalf, W.W., W. Jiang, and B.L. Wanner (1994) Use of the rep technique for allele replacement to construct new Escherichia coli hosts for maintenance of R6K gamma origin plasmids at different copy numbers. Gene. 138:1-7.

47. Diepold, A., M. Amstutz, S. Abel, I. Sorg, U. Jenal, et al. (2010) Deciphering the assembly of the Yersinia type III secretion injectisome. EMBO J. 29: 1928-40.

48. Iriarte, M., I. Stainier, and G.R. Cornelis (1995) The rpoS gene from Yersinia enterocolitica and its influence on expression of virulence factors. Infect Immun. 63: 1840-7.

49. Cornelis, G., J.C. Vanootegem, and C. Sluiters (1987) Transcription of the yop regulon from Y. enterocolitica requires trans acting pYV and chromosomal genes. microbe pathogen. 2:367-79.

50. Grosdent, N., I. Maridonneau-Parini, M.P. Sory, and G.R. Cornelis (2002) Role of Yops and adhesins in resistance of Yersinia enterocolitica to phagocytosis. Infect Immun. 70:4165-76.

51. Dehio, C., M. Meyer, J. Berger, H. Schwarz, and C. Lanz (1997) Interaction of Bartonella henselae with endothelial cells results in bacterial aggregation on the cell surface and the subsequent engulfment and internalization of the bacterial aggregate by a unique structure, the invasome. J Cell Sci. 110 (Pt 18): 2141-54.

52. Westerfield, M. (2000) The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish Danio rerio University of Oregon Press, Eugene, ORp.

53. Kimmel, C.B., W.W. Ballard, S.R. Kimmel, B. Ullmann, and T.F. Schilling (1995) Stages of embryonic development of the zebrafish. Dev Dyn. 203:253-310.

54. Benard, E.L., A.M. van der Sar, F. Ellett, G.J. Lieschke, H.P. Spaink, et al. (2012) Infection of zebrafish embryos with intracellular bacterial pathogens. J Vis Exp.

55. Blum, Y., H.G. Belting, E. Ellertsdottir, L. Herwig, F. Luders, et al. (2008) Complex cell rearrangements during intersegmental vessel sprouting and vessel fusion in the zebrafish embryo. Dev biol. 316:312-22.

56. Herwig, L., Y. Blum, A. Krudewig, E. Ellertsdottir, A. Lenard, et al. (2011) Distinct cellular mechanisms of blood vessel fusion in the zebrafish embryo. Curr Biol. 21:1942-8.

- 44 041646

57. Carpenter, A.E., T.R. Jones, M.R. Lamprecht, C. Clarke, I.H. Kang, et al. (2006)

CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome

Biol. 7:R100.

58. Bensimon, A., A. Schmidt, Y. Ziv, R. Elkon, S.Y. Wang, et al. (2010) ATM-dependent and -independent dynamics of the nuclear phosphoproteome after DNA damage. sci signal. 3:rs3.

59. Perkins, D.N., D.J. Pappin, D.M. Creasy, and J.S. Cottrell (1999) Probability-based protein identification by searching sequence databases using mass spectrometry data. electrophoresis. 20:3551-67.

60. Smyth, G.K. (2004) Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol. 3: article3.

61. Ting, L, MJ Cowley, S.L. Hoon, M. Guilhaus, M.J. Raftery, et al. (2009) Normalization and statistical analysis of quantitative proteomics data generated by metabolic labeling. Mol Cell Proteomics. 8:2227-42.

62. Vizcaino, J.A., R.G. Cote, A. Csordas, J.A. Dianes, A. Fabregat, et al. (2013) The Proteomics IDEntifications (PRIDE) database and associated tools: status in 2013. Nucleic Acids Res. 41: D1063-9.

63. Boyd, A.P., I. Lambermont, and G.R. Cornelis (2000) Competition between the Yops of Yersinia enterocolitica for delivery into eukaryotic cells: role of the SycE chaperone binding domain of YopE. JBacteriol. 182:4811-21.

64. Iriarte, M., and G.R. Cornelis (1998) YopT, a new Yersinia Yop effector protein, affects the cytoskeleton of host cells. Mol Microbiol. 29:915-29.

65. Kudryashev, M., M. Stenta, S. Schmelz, M. Amstutz, U. Wiesand, et al. (2013) In situ structural analysis of the Yersinia enterocolitica injectisome. elife. 2: e00792.

66. Schulte, R., G.A. Grassi, S. Preger, S. Fessele, C.A. Jacobi, et al. (2000) Yersinia enterocolitica invasin protein triggers IL-8 production in epithelial cells via activation of Rei p65-p65 homodimers. FASEB J. 14: 1471-84.

67. Mota, L.J., L. Joumet, I. Sorg, C. Agrain, and G.R. Cornelis (2005) Bacterial injectisomes: needle length does matter. Science. 307:1278.

68. Isaksson, E.L., M. Aili, A. Fahlgren, S.E. Carlsson, R. Rosqvist, et al. (2009) The membrane localization domain is required for intracellular localization and autoregulation of YopE in Yersinia pseudotuberculosis. Infect Immun. 77:4740-9.

69. Denecker, G., S. Totemeyer, L.J. Mota, P. Troisfontaines, I. Lambermont, et al. (2002) Effect of low- and high-virulence Yersinia enterocolitica strains on the inflammatory response of human umbilical vein endothelial cells. Infect Immun. 70:3510-20.

- 45 041646

70. Sharma, S., A. Hirabuchi, K. Yoshida, K. Fujisaki, A. Ito, et al. (2013) Deployment of the

Burkholderia glumae type III secretion system as an efficient tool for translocating pathogen effectors to monocot cells. Plant J. 74: 701-12.

71. Carrington, J.C., and W.G. Dougherty (1988) A viral cleavage site cassette: identification of amino acid sequences required for tobacco etch virus polyprotein processing. Proc Natl Acad Sci US A. 85: 3391-5.

72. Kapust, R.B., J. Tozser, T.D. Copeland, and D.S. Waugh (2002) The specificity of tobacco etch virus protease. Biochem Biophys Res Commun. 294:949-55.

73. Liang, H., H. Gao, C.A. Maynard, and W.A. Powell (2005) Expression of a selfprocessing, pathogen resistance-enhancing gene construct in Arabidopsis. Biotechnol Lett. 27:435-42.

74. Weber, W., C. Fux, M. Daoud-el Baba, B. Keller, C.C. Weber, et al. (2002) Macrolide-based transgene control in mammalian cells and mice. Nat Biotechnol. 20:901-7.

75. Kapust, R.B., J. Tozser, J.D. Fox, D.E. Anderson, S. Cherry, et al. (2001) Tobacco etch virus protease: mechanism of autolysis and rational design of stable mutants with wild-type catalytic proficiency. ProteinEng. 14:993-1000.

76 Lee, V.T., D.M. Anderson, and O. Schneewind (1998) Targeting of Yersinia Yop proteins into the cytosol of HeLa cells: one-step translocation of YopE across bacterial and eukaryotic membranes is dependent on SycE chaperone. Mol Microbiol. 28:593-601.

77. Gray, D.C., S. Mahrus, and J.A. Wells (2010) Activation of specific apoptotic caspases with an engineered small-molecule-activated protease. cell. 142:637-46.

78. Henrichs, T., N. Mikhaleva, C. Conz, E. Deuerling, D. Boyd, et al. (2005) Target-directed proteolysis at the ribosome. Proc Natl Acad Sci USA. 102:4246-51.

79. Hardt, W.D., L.M. Chen, K.E. Schuebel, X.R. Bustelo, and J.E. Galan (1998) S. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells. cell. 93:815-26.

80. Hakansson, S., K. Schesser, C. Persson, E.E. Galyov, R. Rosqvist, et al. (1996) The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity. EMBO J. 15: 5812-23.

81. Stebbins, C.E., and J.E. Galan (2001) Structural mimicry in bacterial virulence. Nature. 412:701-5.

82. Li, H., H. Xu, Y. Zhou, J. Zhang, C. Long, et al. (2007) The phosphothreonine lyase activity of a bacterial type III effector family. Science. 315:1000-3.

- 46 041646

83. Norris, F.A., M.P. Wilson, T.S. Wallis, E.E. Galyov, and P.W. Majerus (1998) SopB, a protein required for virulence of Salmonella dublin, is an inositol phosphate phosphatase. Proc

Natl Acad Sci U S A. 95: 14057-9.

84. Pulliainen, A.T., K. Pieles, C.S. Brand, B. Hauert, A. Bohm, et al. (2012) Bacterial effector binds host cell adenylyl cyclase to potentiate Galphas-dependent cAMP production. Proc Natl Acad Sci USA. 109:9581-6.

85. Li, H., H. Zhu, C.J. Xu, and J. Yuan (1998) Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. cell. 94:491-501.

86 Nagaraj, N., J.R. Wisniewski, T. Geiger, J. Cox, M. Kircher, et al. (2011) Deep proteome and transcriptome mapping of a human cancer cell line. Mol Syst Biol. 7:548.

87. Caussinus, E., O. Kanca, and M. Affolter (2011) Fluorescent fusion protein knockout mediated by anti-GFP nanobody. Nat Struct Mol Biol. 19:117-21.

88. Cosma, C.L., L.E. Swaim, H. Volkman, L. Ramakrishnan, and J.M. Davis (2006) Zebrafish and frog models of Mycobacterium marinum infection. Curr Protoc Microbiol. Chapter 10: Unit 10B 2.

89. Mathias, J.R., M.E. Dodd, K.B. Walter, S.K. Yoo, E.A. Ranheim, et al. (2009) Characterization of zebrafish larval inflammatory macrophages. Dev Comp Immunol. 33:12127.

90Jette, C.A., A.M. Flanagan, J. Ryan, U.J. Pyati, S. Carbonneau, et al. (2008) BIM and other BCL-2 family proteins exhibit cross-species conservation of function between zebrafish and mammals. Cell Death Different. 15:1063-72.

91. Olsen, J.V., B. Blagoev, F. Gnad, B. Macek, C. Kumar, et al. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. cell. 127:635-48.

92. Schmutz, C., E. Ahme, C.A. Kasper, T. Tschon, I. Sorg, et al. (2013) Systems-Level Overview of Host Protein Phosphorylation During Shigella flexneri Infection Revealed by Phosphoproteomics. Mol Cell Proteomics. 12:2952-68.

93. Szklarczyk, D., A. Franceschini, M. Kuhn, M. Simonovic, A. Roth, et al. (2011) The STRING database in 2011: functional interaction networks of proteins, globally integrated and scored. Nucleic Acids Res. 39:D561-8.

94. Huangda, W., B.T. Sherman, and R.A. Lempicki (2009) Bioinformatics enrichment tools: paths towards the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 37:1-13.

95. Huangda, W., B.T. Sherman, R. Stephens, M.W. Baseler, H.C. Lane, et al. (2008) DAVID gene ID conversion tool. bioinformation. 2:428-30.

96. Schwerk, C., and K. Schulze-Osthoff (2005) Regulation of apoptosis by alternative premRNA splicing. Mol Cell. 19:1-13.

97. Papagiannakopoulos, T., A. Shapiro, and K.S. Kosik (2008) MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. Cancer Res. 68:8164-72.

98. Hoiseth, S.K., B.A. Stocker (1981) Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature 291:238-239.

-

Claims (13)

CLAIM 1. A recombinant gram-negative bacteria strain capable of delivering a heterologous protein to a eukaryotic cell, said gram-negative bacterial strain being transformed with a vector that contains a promoter in the 5' to 3' direction; a first DNA sequence operably linked to said promoter encoding a delivery signal from an effector protein of the type 3 secretion system (CC3T) of bacteria; and a second DNA sequence encoding a heterologous protein fused to the 3' end of said first DNA sequence in the same reading frame, wherein said heterologous protein is an intracellularly active heterologous protein which is selected from the group consisting of proteins involved in apoptosis or regulation of apoptosis, proteins with ankyrin repeats, reporter proteins, transcription factors, proteases, small GTPases, GPCR-associated proteins, nanobodies, bacterial C3T system effectors, bacterial C4T system effectors and viral proteins, moreover, these proteins involved in apoptosis or regulation of apoptosis, are selected from the group consisting of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of pathways that prevent apoptosis, inhibitors of pathways or a signaling system that promote survival, and wherein said recombinant gram-negative bacterial strain is a Yersinia strain, and said delivery signal from an effector protein of the C3T system ba The cterium encoded by the specified first DNA sequence contains the YopE effector protein or its N-terminal fragment, while the specified N-terminal fragment includes at least the first 20 amino acids of the specified effector protein of the bacterial C3T system and contains the chaperone binding site. 2. A recombinant Gram-negative bacteria strain according to claim 1, characterized in that said vector contains a third DNA sequence encoding a protease cleavage site, wherein said third DNA sequence is located between the 3' end of said first DNA sequence and the 5' end of said second DNA sequences. 3. A recombinant strain of gram-negative bacteria according to any one of claims 1, 2, characterized in that said Yersinia strain is a wild-type strain or a strain deficient in the production of at least one effector protein of the C3T system, and at the same time the specified delivery signal from the effector protein of the C3T system of bacteria contains 138 N-terminal amino acids of the YopE effector protein of Y. enterocolitica. 4. A recombinant gram-negative bacterial strain according to any one of claims 1 to 3, characterized in that said gram-negative bacterial strain is deficient in the production of adhesion proteins that bind to the eukaryotic cell surface or extracellular matrix. 5. A recombinant strain of gram-negative bacteria according to any one of claims 1 to 4, characterized in that said proteins involved in apoptosis or regulation of apoptosis are selected from the group consisting of proteins with only the BH3 domain, caspases and intracellular signaling proteins included in apoptosis control system by death receptors. 6. A recombinant strain of gram-negative bacteria according to any one of claims 1 to 5, characterized in that said vector contains two second DNA sequences encoding identical heterologous proteins or two different heterologous proteins that are fused independently of each other in the same reading frame from 3 the '-end of said first DNA sequence, wherein both heterologous proteins are proteins involved in apoptosis or the regulation of apoptosis, and wherein one protein is a pro-apoptotic protein and the other protein is an inhibitor of apoptosis-preventing pathways, or where one protein is a pro-apoptotic protein, and the other protein is an inhibitor of survival pathways or signaling. 7. Vector capable of delivering a heterologous protein to a eukaryotic cell, which contains in the direction from the 5'end to the 3'end of the promoter; a first DNA sequence operably linked to said promoter encoding a delivery signal from a YopE effector protein or an N-terminal fragment thereof, said N-terminal fragment comprising at least the first 20 amino acids of said effector protein of the bacterial C3T system and containing a chaperone binding site; a second DNA sequence encoding a heterologous protein fused to the 3' end of said first DNA sequence in the same reading frame, wherein said heterologous protein is an intracellularly active heterologous protein that is selected from the group consisting of proteins involved in apoptosis or regulation apoptosis, ankyrin repeat proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR-associated proteins, nanobodies, effectors of the bacterial C3T system, effectors of the bacterial C4T system, and viral proteins, wherein said proteins involved in apoptosis or regulation of apoptosis are selected from the group consisting of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of pathways that prevent apoptosis, - 48 041646 survival pathway or signaling inhibitors. 8. The vector according to claim 7, characterized in that said vector further comprises a third DNA sequence encoding a protease cleavage site, wherein said third DNA sequence is located between the 3' end of said first DNA sequence and the 5' end of said second DNA sequence . 9. The vector according to claim 7, characterized in that said proteins involved in apoptosis or regulation of apoptosis are selected from the group consisting of proteins with only the BH3 domain, caspases, and intracellular signaling proteins included in the apoptosis control system by death receptors. 10. Vector according to claim 7, characterized in that said vector contains two second DNA sequences encoding identical heterologous proteins or two different heterologous proteins that are fused independently of each other in the same reading frame with the 3'-end of said first DNA sequence , wherein both heterologous proteins are proteins involved in apoptosis or the regulation of apoptosis, and wherein one protein is a pro-apoptotic protein and the other protein is an inhibitor of apoptosis-preventing pathways, or wherein one protein is a pro-apoptotic protein and the other the protein is an inhibitor of survival pathways or signaling. 11. A method for delivering a heterologous protein to a eukaryotic cell, comprising the following steps: i) cultivating a Gram-negative bacterial strain according to any one of claims 1 to 6; and ii) bringing the eukaryotic cell into contact with the gram-negative bacterial strain cultured in step i), wherein the fusion protein, which contains the delivery signal from the bacterial C3T system effector protein and the heterologous protein, is expressed by said gram-negative bacterial strain and translocated into said eukaryotic cell. 12. The use of a recombinant gram-negative bacterial strain according to any one of claims 1 to 6 when delivering a heterologous protein as a drug or vaccine to a subject. 13. The use of a recombinant Gram-negative bacterial strain according to any one of claims 1 to 6 for high throughput screening of cell pathway inhibitors. -