EA040983B1 - OLIGONUCLEOTIDE ANALOGUES TARGETING HUMAN LMNA - Google Patents

Description

Sequence listing statement

The sequence listing associated with this application is presented in text format instead of a paper copy and is thus incorporated herein by reference. The text file containing the sequence listing is named 120178_503WO SEQUENCE_LISTING.txt. A 6.5 KB text file created on April 26, 2017 and submitted electronically via EFS web.

Technical field

The present disclosure relates generally to human lamin A-targeted antisense compounds.

State of the art

Hutchinson-Gilford Progeria Syndrome (HGPS) is a rare genetic disorder characterized by premature atherosclerosis and degeneration of vascular smooth muscle cells (SMC). Most prominently, HGPS manifests itself as accelerated, premature aging of affected children. Children with HGPS show progressive symptoms such as stunting, baldness, loss of subcutaneous fat, and bone abnormalities. The average life expectancy is 12 years, and the most common cause of death is myocardial infarction or stroke.

Most cases of HGPS are caused by a single point mutation in the lamin A (LMNA) gene resulting in progerin, a truncated lamin A splicing mutant. The single point mutation is a de novo silent substitution (1824>T, Gly608Gly) in exon 11 of the lamin A (LMNA) gene. This substitution activates the cryptic splicing donor site, resulting in a dominant-negative mutant lamin A protein with an internal deletion of 50 amino acids. A mutant protein called progerin accumulates in the nuclear membrane, causing the characteristic bubbling of the nucleus (Scaffidi and Misteli, 2005; Cao, Blair et al., 2011).

It is known that aberrant splicing can be corrected using phosphorodiamidate morpholine oligonucleotides (PMOs), and more particularly splice-switching oligonucleotides (SSOs). SSOs block aberrant splicing sites by hybridizing at or near these sites, thereby preventing recognition of cellular splicing mechanisms. Typical SSOs are nuclease resistant and the resulting double-stranded structure eliminates the possibility of RNA cleavage by RNase H. SSOs have been shown to effectively restore the splicing profile both in vitro and in vivo in cases of thalassemia and Duchenne muscular dystrophy (Kinali, Arechavala-Gomeza et al ., 2009; Svasti, Suwanmanee et al., 2009). It has been shown that LMNA aberrant splicing associated with HGPS should be reduced by correcting the aberrant splicing event using modified antisense oligonucleotides targeting an activated cryptic splicing site, both in cell culture (Scaffidi and Misteli, 2005) and in an appropriate animal model. (Osorio, Navarro et al., 2011).

PCT publications WO 2013/086441 and WO 2013/086444 describe antisense oligomers targeting human lmna and methods for treating progeroid laminopathies using oligonucleotide analogs targeting human lmna, but do not describe antisense oligomeric compounds and methods of using them as described herein. .

Given the role of LMNA in HGPS, oligonucleotides that modulate LMNA pre-mRNA splicing are required to terminate progerin expression.

The essence of the invention

Embodiments of the present disclosure generally relate to antisense oligomers, pharmaceutical compositions thereof, and methods of use thereof that modulate aberrant LMNA pre-mRNA splicing. In one aspect, the description relates to a modified antisense oligonucleotide of 10 to 40 nucleotide bases. The modified antisense oligonucleotide includes a targeting sequence that is complementary to the target region within the LMNA pre-mRNA.

- 1 040983

In some embodiments, the antisense oligomer is a compound of formula (I)

or a pharmaceutically acceptable salt thereof, wherein each Nu is a nucleotide base, which together form a targeting sequence;

Z is an integer from 8 to 38;

T is selected from

G is a cell penetrating peptide (CPP) and a linker fragment selected from -C(O)(CH2)5NH-CPP-R ^a , -C(O)(CH2)2NH-CPP-R ^a , -C(O )(CH2)2NHC(O)(CH2)5NH-CPP-R ^a , -C(O)CH2NH-CPP-R ^a ,

and , where CPP is attached to the linker fragment by an amide bond at the carboxyl end of CPP, a

R ^a is attached to the amino terminus of the CPP by an amide bond, where R ^a is selected from H, acetyl, benzoyl and stearoyl.

In some embodiments, R ^a is acetyl.

- 2 040983

In various aspects, an antisense oligonucleotide as described herein comprises a compound of formula (II)

or a pharmaceutically acceptable salt thereof, wherein each Nu is a nucleotide base, which together form a targeting sequence;

Z is an integer from 8 to 38; A

G is a cell penetrating peptide (CPP) and a linker fragment selected from -C(O)(CH2)5NH-CPP-R ^a , -C(O)(CH2)2NH-CPP-R ^a , -C(O )(CH2)2NHC(O)(CH2)5NH-CPP-R ^a , -C(O)CH2NH-CPP-R ^a , O

and CPP-R ^a 1 / and , where CPP is attached to the linker fragment by an amide bond at the carboxyl end of CPP, a

R ^a is attached to the amino terminus of the CPP by an amide bond, where R ^a is selected from H, acetyl, benzoyl and stearoyl.

In some embodiments, R ^a is acetyl.

In some embodiments, the CPP is selected from SEQ ID NOs: 5-21. In some embodiments, G is selected from SEQ ID NOs: 22-25.

In various embodiments, G (as noted in formulas (I) and (II)) is selected from /? CPP-R ^a

XII /

-С(О)CH2NH-CPP and formulas , where CPP is attached to the linker fragment by an amide bond at the carboxyl end of CPP, a

R ^a is attached to the amino terminus of CPP by an amide bond, and wherein CPP-R ^a is selected from

- 3 040983

or (-R ₆ -R ^a ), where R ^a is selected from H, acetyl, benzoyl and stearoyl.

In some embodiments, R ^a is acetyl.

In some embodiments, G (as noted in formulas (I) and (II)) is represented by the formula

where R ^a is selected from H, acetyl, benzoyl and stearoyl, and J is an integer from 4 to 9.

In some embodiments, J is 6.

- 4 040983

In various embodiments, CPP-R ^a (as noted in formulas (I) and (II)) is represented by the formula

where R ^a is selected from H, acetyl, benzoyl and stearoyl, a

J is an integer from 4 to 9.

In some embodiments, the CPP is SEQ ID NO: 11. In various embodiments, J is 6. In some embodiments, Ra ^is selected from H and acetyl. For example, in some embodiments, R ^a is H. In some embodiments, R ^a is acetyl.

In some embodiments, G is selected from SEQ ID NOs: 22-25. In some embodiments, G is SEQ ID NO: 25.

In some embodiments, G is -C(O)CH ₂ NH-R ₆ -R ^a covalently linked to an antisense oligomer of the present disclosure at the 3' end of the oligomer, where R ^a is H, acetyl, benzoyl, or stearoyl, for capping the amino terminus of R6. In some embodiments, R ^a is acetyl. In non-limiting examples, CPP-R ^a is -R6-R ^a and the linker is C(O)CH2NH- (ie, glycine). This particular example of G=-C(O)CH ₂ NH-R ₆ -R ^a is also illustrated by the following structure:

where R ^a is selected from H, acetyl, benzoyl and stearoyl. In some embodiments, R ^a is acetyl.

In various embodiments, CPP-R ^a is -R ₆ -R ^a , which is also illustrated by the following formula:

where R ^a is selected from H, acetyl, benzoyl and stearoyl. In some embodiments, the CPP is SEQ ID NO: 11. In some embodiments, R ^a is acetyl.

- 5 040983

In some embodiments, CPP-R ^a is -(RXR) ₄ -R ^a , which is also illustrated by the following formula:

In various embodiments, CPP-R ^a is -R-(FFR) ₃ -R ^a , which is also illustrated by the following formula:

In some embodiments, the targeting sequence of the antisense oligomers of the present disclosure, including, for example, some embodiments of the antisense oligomers of formula (I) and (II), is selected from

a) SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) where Z is 23; And

b) SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) where Z is 23.

In another aspect, the present disclosure provides methods for treating diseases, such as diseases or conditions associated with human LMNA. In some embodiments, such methods are used to treat progeroid diseases or related pathological conditions such as progeroid laminopathy (eg, HGPS), an aging-associated condition, or cardiovascular disease (such as atherosclerosis).

In a further aspect, provided herein are pharmaceutical compositions comprising the antisense oligomers of this disclosure and a pharmaceutically acceptable carrier.

Thus, in a further aspect, the present specification also provides, in other embodiments, methods for treating progeroid laminopathies by administering a pharmaceutical composition comprising an antisense oligonucleotide as described herein and a pharmaceutically acceptable excipient.

These and other aspects of the present invention will become apparent upon consideration of the following detailed description. In this regard, each of the various references mentioned in the present description, which describe in more detail certain information about the prior art, procedures, compounds and/or compositions, is hereby incorporated by reference in its entirety.

Brief description of the drawings

In FIG. 1 shows the result of ssPCR analysis of lamin A and progerin from the hearts of mice treated with PPMO1 (7, 20, or 60 mg/kg), PPMO2 (7, 20, or 60 mg/kg), or control saline for 12 weeks.

In FIG. 2 shows the result of ssPCR analysis of lamin A and progerin from the descending aortas of mice treated with PPMO1 (7, 20, or 60 mg/kg), PPMO2 (7, 20, or 60 mg/kg), or control saline for 12 weeks.

In FIG. 3 shows the result of ssPCR analysis of lamin A and progerin from quadriceps mice treated with PPMO1 (7, 20, or 60 mg/kg), PPMO2 (7, 20, or 60 mg/kg), or control saline for 12 weeks.

In FIG. 4 shows the result of ssPCR analysis of lamin A and progerin from the liver of mice treated with

- 6 040983 treatment with PPMO1 (7, 20 or 60 mg/kg), PPMO2 (7, 20 or 60 mg/kg) or control saline for 12 weeks.

Detailed description of the invention

The present description relates to the oligonucleotides described herein and compositions containing them, as well as in vitro methods, in which the oligonucleotides inhibit the expression of mRNA of a mutant LMNA protein, for example, by modulating pre-LMNA mRNA splicing.

Definitions.

Unless otherwise indicated, all technical and scientific terms used in the present description have the generally accepted meanings understood by a person skilled in the art to which the present invention belongs. Although methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, exemplary methods and materials are described. For the purposes of the present invention, the following terms are defined below.

In the context of the present description, the singular form is used to refer to one or more than one (ie at least one) grammatical object of description. By way of example, element means one element or more than one element.

The term about means a number, level, value, number, frequency, percentage, magnitude, size, amount, weight, or length that ranges up to 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4 , 3, 2 or 1% of the mentioned number, level, value, number, frequency, percentage, magnitude, size, quantity, weight or length.

The term coding sequence means any nucleotide sequence involved in encoding a polypeptide gene product. In contrast, the term non-coding sequence refers to any nucleotide sequence that is not involved in encoding the polypeptide product of a gene.

Throughout this specification, unless the context otherwise requires, the words include, includes, and including should be understood to mean the inclusion of a specified step or element or group of steps or elements, but not the exclusion of any other step or element, or group of steps or elements.

The term consisting of means including and is limited to any listing of what follows the phrase consisting of. Thus, the phrase consisting of indicates that the listed elements are required or required and that no other elements may be present. The term practically consisting of means the inclusion of any elements listed after this phrase, and is limited to other elements that do not interfere with or contribute to the activity or action specified in the description for the listed elements. Thus, the phrase essentially consisting of indicates that the listed elements are required or required, but that other elements are optional and may or may not be present depending on whether they actually or not affect the activity or operation of the listed elements.

The term complementary and complementarity refers to polynucleotides (ie, sequences of nucleotides) linked according to the rules of base pairing. For example, the sequence A-G-T is complementary to the sequence T-C-A. Complementarity can be partial, in which only some nucleic acid bases match the base pairing rules. Or there may be complete or total complementarity between nucleic acids. The degree of complementarity between nucleic acid strands has a significant impact on the efficiency and strength of hybridization between nucleic acid strands. Since perfect complementarity is often required, some embodiments may include one or more, but preferably 6, 5, 4, 3, 2, or 1 mismatches with respect to the target RNA. This invention includes variations anywhere in the oligomer. In some embodiments, variations near the ends of the oligomer are generally preferred over variations in the interior, and if present, typically include about 6, 5, 4, 3, 2, or 1 nucleotide of the 5' and/or 3' ends.

The terms cell-penetrating peptide or CPP are used interchangeably and refer to cationic cell-penetrating peptides, also called transport peptides, carrier peptides, or peptide transduction domains. The peptides described herein have the ability to induce cell entry within 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of cells in a given cell culture population, including all whole numbers in between, and provide macromolecular translocation upon systemic administration. into multiple tissues in vivo.

The terms antisense oligomer or antisense compound or antisense oligonucleotide or oligonucleotide are used interchangeably and refer to a sequence of cyclic subunits, each of which carries a base-pairing fragment linked by inter-subunit bonds allowing the base-pairing fragments to hybridize to a target sequence in a nucleic acid ( usually RNA) by Watson-Crick base pairing to form within the target sequence a heterodupe

- 7 040983 Lexa nucleic acid: oligomer. The cyclic subunits may be based on a ribose or other pentose sugar or, in some embodiments, a morpholine group (see below for the description of morpholine oligomers). Also contemplated are peptido nucleic acids (PNAs), closed nucleic acids (LNAs), and 2'-O-methyl oligonucleotides, and other antisense agents known in the art.

Such an antisense oligomer can be designed to block or inhibit translation of an mRNA, or to inhibit natural pre-mRNA splice processing, or to induce degradation of targeted mRNAs, and may be said to be directed to or directed against the target sequence to which it hybridizes. In some embodiments, the target sequence is the region surrounding or including the mRNA start codon AUG, the 3' or 5' preprocessed mRNA splice site, or branch point. Within the exon or within the intron, or a combination thereof, the target sequence may be present. The splice site target sequence may include an mRNA sequence whose 5' end is 1 to about 25 base pairs downstream of the normal splicing acceptor junction in the preprocessed mRNA. An example of a splice site target sequence is any region of preprocessed mRNA that includes a splice site, or is contained entirely within an exon coding sequence, or encompasses an acceptor or donor splice site. An oligomer is more commonly referred to as targeting a biologically relevant target, for example, in the present description, it is a pre-mRNA of the LMNA gene encoding the lamin A protein when it is targeted against the target nucleic acid in the manner described above. Examples of targeting sequences include SEQ ID NO: 3 or 4.

Included in the present invention are oligonucleotides that comprise, essentially consist of, or consist of one or more of SEQ ID NOs: 3 or 4. Variants of these antisense oligomers are also included in the present invention, including variants of oligomers with 80, 85, 90, 95, 97 , 98 or 99% (including all integers between values) sequence identity or sequence homology to any of SEQ ID NO:3 or 4, and/or variants that differ from those sequences by about 1, 2, 3, 4, 5 , 6, 7, 8, 9 or 10 nucleotides, preferably such variants that modulate progerin expression in the cell. The present invention also includes oligonucleotides of any one or more of SEQ ID NO: 3 or 4 that contain an appropriate number of cationic or other modified bonds described herein, for example up to about 1 for every 2-5 uncharged bonds, for example about 4-5 for every 10 uncharged bonds, and which have a cell-penetrating transport peptide attached to them, also described herein.

The designation PMO+ refers to phosphorodiamidate morpholine oligomers containing any number of (1-piperazino)phosphinylideneoxy, (1-(4-(co-guanidino-alkanoyl))piperazino)phosphinylideneoxy linkages (A2 and A3) previously described (see e.g. , PCT publication WO 2008/036127, which is incorporated herein in its entirety by reference).

The designation PMO-X refers to the phosphorodiamidate morpholine oligomers described herein containing at least one (B) bond or at least one of the described terminal modifications, as described in PCT publication WO2011/150408 and US patent publication US2012/0065169, which are incorporated herein in their entirety by reference. Additional PMO-X phosphorodiamidate morpholine oligomers used herein can be found in US Interim Application No. 61/561,806, filed Nov. 18, 2011, which is incorporated herein in its entirety by reference.

The phosphoramidate group contains a phosphorus atom with three oxygen atoms attached and one nitrogen atom attached, while the phosphorodiamidate group contains a phosphorus atom with two oxygen atoms attached and two nitrogen atoms attached. In the uncharged or modified intersubunit linkages of the oligomers described herein and in co-pending interim US Patent Application No. 61/349,783 and US Patent Application No. 11/801,885, one nitrogen atom is always lateral to the backbone chain. The second nitrogen atom in the phosphorodiamide bond is typically the nitrogen of the ring in a ring morpholine structure.

Thiophosphoramidate or thiophosphorodiamidate bonds are respectively phosphoramidate or phosphorodiamidate bonds in which one oxygen atom, usually the oxygen lateral to the backbone, is replaced by a sulfur atom.

An intersubunit bond refers to a bond connecting two morpholine subunits, eg structure (I).

The terms charged, uncharged, cationic, and anionic as used herein refer to the predominant state of a chemical moiety at near neutral pH, such as about 6 to 8. For example, the term may refer to the predominant state of a chemical moiety at physiological pH, and exactly around 7.4.

- 8 040983

As used herein, the terms antisense oligonucleotide, antisense oligomer, or oligonucleotide refer to a linear sequence of nucleotides or nucleotide analogs that allows nucleotide bases to hybridize to a target sequence in RNA by Watson-Crick base pairing to form an oligomer:RNA heteroduplex within the target sequence. The terms antisense oligonucleotide, modified antisense oligonucleotide, antisense oligomer, oligomer, and oligomer compound may be used interchangeably. The cyclic subunits may be based on a ribose or other pentose sugar, or in some embodiments, a morpholine group (see below for a description of morpholine oligomers).

The term oligonucleotide analog refers to an oligonucleotide with (i) a modified backbone structure, eg a backbone that differs from the standard phosphodiester bond found in natural oligo- and polynucleotides; and (ii) optionally modified sugar moieties, eg morpholine moieties instead of ribose or deoxyribose moieties.

Oligonucleotide analogs contain bases capable of forming hydrogen bonds by Watson-Crick base-pairing with standard polynucleotide bases, with the backbone of the analogs representing the bases in such a way as to allow such formation of hydrogen bonds in a sequence-specific manner between the oligonucleotide analog molecule and the bases in the standard polynucleotide ( e.g. single-stranded RNA or single-stranded DNA). Examples of analogs are those containing a substantially uncharged, phosphorus-containing backbone.

A substantially uncharged, phosphorus-containing backbone in an oligonucleotide analog is one in which the majority of subunit bonds, e.g., between 50-100%, typically at least 60 to 100%, or 75%, or 80% of its bonds, are uncharged and contain one phosphorus atom. Antisense oligonucleotides and oligonucleotide analogs may contain between about 8 and 40 subunits, typically about 8-25 subunits, and preferably about 12 to 25 subunits (including all integers and ranges between these values). In some embodiments, oligonucleotides may have exact sequence complementarity to the target sequence, or approximate sequence complementarity, as defined below.

An oligonucleotide subunit refers to a single nucleotide (or nucleotide analog) unit containing a moiety that pairs with a purine or pyrimidine base. The term may refer to a nucleotide unit with or without an attached intersubunit bond, although when referring to a charged subunit, the charge is usually within the intersubunit bond (eg, phosphate or thiophosphate bond or cationic bond).

The purine or pyrimidine base-pairing moiety, also referred to herein as a nucleotide base, base or bases, can be adenine, cytosine, guanine, uracil, thymine, or inosine. Bases such as pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethoxybenzene, 3-methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5 -methylcytidine), 5-alkylridines (eg ribothymidine), 5-halogenuridine (eg 5-bromuridine) or 6-azapyrimidines or 6-alkylpyrimidines (eg 6-methyluridine), propyne, quezosine, 2-thiouridine, 4-thiouridine , vibutosin, vibutoxosin, 4-acetyltidine, 5-(carboxyhydroxymethyl)uridine, 5'-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, e-D-galactosylqueosin, 1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine, 3-methylcytidine , 2-methyladenosine, 2-methylguanosine, K6-methyladenosine, 7-methylguanosine, 5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylcarbonylmethyluridine, 5-methoxyuridine, 5-methyl-2-thiouridine, 2-methylthio-K6 -isopentenyladenosine, e-D-mannosylqueosin, uridine-5-hydroxyacetic acid, 2-thiocytidine, threonine derivatives and others (Burgin et al., 1996, Biochemistry, 35:14090; Uhlman & Peyman, supra). In this aspect, modified bases mean nucleotide bases other than adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U) illustrated above; such bases can be used at any position on the antisense molecule. Those skilled in the art will appreciate that, depending on the applications of the oligomers, T and U are interchangeable. For example, in the case of other antisense chemistries, such as 2'-0-methyl antisense oligonucleotides, which are more like RNA, T bases can be shown as U.

The term targeting sequence is a sequence in an oligomer or oligomer analog that is complementary (further meaning substantially complementary) to a target sequence in the RNA genome. The complementary target sequence may be all or part of the antisense oligomer sequence. For example, in a 20-30 base oligomer, about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 bases may be targeting sequences that are complementary to the target region. Typically, the targeting sequence is formed from consecutive bases in the oligomer, but alternatively may be formed from non-sequential sequences which, when located adjacent, for example, at opposite ends of the oligomer, constitute a sequence that spans the target sequence.

The targeting sequence may be nearly or substantially complementary to the target sequence and still function for the purposes of the present disclosure, namely still be complementary. Preferably, the oligomer analog compounds used herein have at most one mismatch per 10 nucleotides of the target sequence, and preferably at most one mismatch per 20 nucleotides. Alternatively, the antisense oligomers used have at least 90% sequence identity, and preferably at least 95% sequence identity, with examples of targeting sequences indicated herein.

Within the scope of the invention, the terms TEG, EG3 or triethylene glycol tail refer to fragments of triethylene glycol conjugated to an oligonucleotide, for example, at its 3' or 5' end. For example, in some embodiments, the TEG includes a fragment of the formula

The amino acid subunit or amino acid residue may refer to an amino acid residue (-CO-CHR-NH-) or a β- or other amino acid residue (e.g., -CO-(CH ₂ ) _n CHR-NH-) where R is a side chain ( which may include a hydrogen atom) and n is 1 to 7, preferably 1 to 4.

The term naturally occurring amino acid refers to an amino acid found in naturally occurring proteins, such as the 20 N-amino acids used during protein biosynthesis, as well as others such as 4-hydroxyproline, hydroxylysine, desmosine, isodesmosine, homocysteine, citrulline, and ornithine. The term artificial amino acids refers to those amino acids not found in naturally occurring proteins, examples include beta-alanine (β-Ala), 6-aminohexanoic acid (Ahx), and 6-aminopentanoic acid. Additional examples of artificial amino acids include, without limitation, (D)-amino acids, norleucine, norvaline, p-fluorophenylalanine, ethionine, and the like, which are known to the person skilled in the art.

An effective amount or therapeutically effective amount refers to the amount of a therapeutic compound, such as an antisense oligomer, administered to a mammalian patient, either as a single dose or as part of a series of doses, that is effective to produce the desired therapeutic effect (e.g., sensitization of a cancer cell to a chemotherapeutic agent) . For an antisense oligomer, this effect is usually achieved by inhibition of translation or natural spalling processing of the selected target sequence. An effective amount directed against LMNA mRNA also refers to an amount effective to modulate progerin expression.

The term improve or improve, increase or enhance, or stimulate or stimulate generally refers to the ability of one of the antisense compounds or compositions to produce or elicit a more pronounced physiological response in a cell (i.e., a subsequent cascade of effects) compared to the response caused or in the absence of an antisense compound, or a control compound. An increased or improved value can typically be a statistically significant value and may include an increase that is 1.1; 1.2; 2; 3; 4; 5; 6; 7; 8; 9; 10; 15; 20; thirty; 40; 50 or more times (for example, 500, 1000 times) (including all integers and tenths in between and greater than 1), such as 1.5; 1.6; 1.7; 1.8, etc.) greater than the value obtained without the antisense compound (in the absence of the agent) or with the control compound.

The term reduce or inhibit may generally refer to the ability of one or more antisense compounds of the present disclosure to reduce an appropriate physiological or cellular response when measured according to conventional techniques in the diagnostic field. The corresponding physiological or cellular responses (in vivo or in vitro) will be apparent to those skilled in the art.

- 10 040983 stats in the art and may include, for example, reductions in progerin expression as measured by mRNA and/or protein levels. The decrease in response may be statistically significant compared to the response obtained without the antisense compound or from the control composition and may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% reduction, all included integers between these values.

The term target sequence refers to the part of the target RNA against which the oligonucleotide or antisense agent is directed, namely the sequence to which the complementary sequence will hybridize by Watson-Crick base pairing. In some embodiments, the target sequence may be a contiguous region of premRNA that includes both an intron and an exon target sequence. In some other embodiments, the target sequence will consist solely of either intron or exon sequences.

The term targeting sequence or antisense targeting sequence refers to a sequence in an oligonucleotide or other antisense agent that is complementary (further meaning substantially complementary) to a target sequence in the RNA genome. All or part of the antisense compound sequence may be complementary to the target sequence.

For example, in a 20-30 base oligonucleotide, about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 bases may be targeting sequences that are complementary to the target region. Typically, a targeting sequence is formed from consecutive bases, but alternatively may be formed from non-sequential sequences which, when adjacent, eg, at opposite ends of an oligonucleotide, constitute a sequence that spans the target sequence.

Target sequences and targeting sequences are described as complementary to one another when hybridization occurs in an anti-parallel configuration. The targeting sequence may be nearly or substantially complementary to the target sequence and still function for the purpose of the present disclosure, ie still be functionally complementary. In some embodiments, the oligonucleotide may have at most one mismatch with the target sequence per 10 nucleotides, and preferably at most one mismatch per 20 nucleotides. Alternatively, the oligonucleotide may have at least 90% sequence identity, and preferably at least 95% sequence identity, with the exemplary antisense targeting sequences described herein.

An oligonucleotide specifically hybridizes to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions with a Tm substantially greater than 45°C, preferably at least 50°C and typically 60-80°C or greater. Such hybridization preferably corresponds to stringent hybridization conditions. For a given ionic strength and pH, Tm is the temperature at which 50% of the target sequence hybridizes to the complementary polynucleotide. Again, such hybridization can occur with an almost or substantially complementary sequence of the antisense oligomer to the target sequence, as well as with exactly the corresponding complementary sequence.

Homology refers to the percentage of amino acids that are identical to or make up conservative substitutions. Homology can be determined using sequence comparison programs such as GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395). Thus, sequences of similar or substantially different lengths to those described herein can be compared by inserting gaps during the alignment process, such gaps are determined, for example, by the comparison algorithm used by GAP.

The terms sequence identity or, for example, including 50% sequence identical to within the scope of the invention refers to the extent that the sequences are identical based on comparison of nucleotide for nucleotide or amino acid for amino acid within the window of comparison. Thus, percent sequence identity can be calculated by comparing two optimally aligned sequences within a comparison window, determining the number of positions at which an identical nucleic acid base (e.g., A, T, C, G, I) or an identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Tip, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) is present in both sequences to obtain the number of matching positions , dividing the number of matching positions by the total number of positions in the comparison window (ie, window size), and multiplying the result by 100 to obtain the percent sequence identity.

Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include reference sequence, comparison window,

- 11 040983 sequence identity, percent sequence identity and substantially identical. The reference sequence is at least 8 or 10, but more commonly 15 to 18, and more often at least 25 monomeric units long, including nucleotides and amino acid residues. Because two polynucleotides can each contain (1) a sequence (i.e., only a portion of the complete polynucleotide sequence) that is the same for both polynucleotides and (2) a sequence that is different for both polynucleotides, sequence comparisons between two (or more) polynucleotides is typically performed by comparing the sequences of both polynucleotides across a comparison window to identify and compare local areas of sequence similarity. A comparison window refers to a conceptual segment of at least 6 consecutive positions, typically about 50 to about 100, more typically about 100 to about 150, in which the sequence is compared to a reference sequence with the same number of consecutive positions after the two sequences have optimally aligned. For optimal alignment of the two sequences, the comparison window may contain additions or deletions (ie gaps) of about 20% or less compared to the reference sequence (which contains no addition or deletion).

For comparison window alignment, optimal sequence alignment can be performed by computerized implementations of the algorithms (GAP, BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Release 7.0, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA) or validation and best alignment (ie, leading to the highest percentage of homology across the comparison window) obtained by any of the various methods chosen. Reference may also be made to the BLAST family of programs, such as those described by Altschul et al., 1997, Nucl. Acids Res., 25:3389. A detailed discussion of the issue of sequence analysis can be found in section 19.3 Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994-1998, Chapter 15.

A nuclease-resistant oligomeric molecule (oligomer) refers to a molecule whose backbone is substantially resistant to nuclease cleavage in unhybridized or hybridized form by extracellular and intracellular nucleases in the body, namely the oligomer shows little or no nuclease cleavage under normal nuclease conditions. in the body into which the oligomer is administered.

An agent is actively taken up by mammalian cells when the agent can enter the cell through the cell membrane by a mechanism other than passive diffusion. The agent can be transported, for example, by active transport, which refers to the transport of agents across the mammalian cell membrane by, for example, an ATP-dependent transport mechanism, or by facilitated transport, which refers to the transport of antisense agents across the cell membrane by a transport mechanism requiring binding of the agent. with a transport protein, which then facilitates the passage of the bound agent through the membrane. For both active and facilitated transport, oligonucleotide analogs preferably have a substantially uncharged backbone, as defined below.

Heteroduplex refers to a duplex between an antisense oligonucleotide and the complementary portion of the target RNA. Nuclease-resistant heteroduplex refers to a heteroduplex formed by binding an antisense oligomer to its complementary target such that the heteroduplex is substantially resistant to degradation in vivo by intracellular and extracellular nucleases, such as RNase H, capable of cutting double-stranded RNA/RNA or DNA complexes. /DNA.

Within the scope of the invention, the term body fluid encompasses many types of samples obtained from a patient, including urine, saliva, plasma, blood, cerebrospinal fluid, or other samples of biological origin, such as skin cells or dermal debris, and may refer to cells or cell fragments suspended in samples, or a liquid medium and its solutes.

The term relative amount is used when a comparison is made between a test measurement and a control measurement. The relative amount of a reagent that forms a complex in a reaction is the amount that reacts with the test sample compared to the amount that reacts with the control sample. The control sample may be analyzed separately in the same assay, or it may form part of the same sample (eg, normal tissue surrounding a malignant area in a tissue section).

Treatment of an individual or a cell is a type of intervention provided as a means to alter the natural course of a disease or pathology in an individual or cell. Treatment includes, but is not limited to, administering, for example, a pharmaceutical composition, and may be performed either prophylactically or following the occurrence of a pathological event or exposure to an etiological agent. Treatment includes any desired effect on the symptoms or pathology of a disease or condition associated with inflammation, among others described herein.

- 12 040983

Also included in the present disclosure are prophylactic therapies that aim to slow the rate of progression of the disease or condition being treated, delay the onset of such disease or condition, or reduce the severity of its manifestations. Treatment or prevention does not necessarily indicate the complete eradication, cure or prevention of a disease or condition or associated symptoms.

A gene or wild-type gene product is one that is most commonly observed in a population and is thus arbitrarily chosen as the normal or wild-type form of the gene.

Targeting the LMNA.

Examples include antisense oligonucleotides that target SEQ ID NO: 1 and/or 2 discussed below.

Certain antisense oligonucleotides may contain a targeting sequence that is complementary to one or more bases of exon 11 in the human LMNA gene, including a wild-type sequence (SEQ ID NO: 1) and/or a sequence found in a patient with HGPS as shown in SEQ ID NO: 2. These target sequences are shown in Table 1 below. 1.

Table 1

Examples of LMNA target sequences

Name sequences SEQID NO: LMNA exon 11 GGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGA GTACAACCTGCGCTCGCGCACCGTGCTGTGCGGGA CCTGCGGGCAGCCTGCCGACAAGGCATCTGCCAGC GGCTCAGGAGCCCAGGTGGGCGGACCCATCTCCTC TGGCTCTTCTGCCTCCAGTGTCACGGTCACTCGCA GCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGC TTCGGGGACAATCTGGTCACCCGCTCCTACCTCCT GGGCAACTCCAGCCCCCGAACCCAG 1 HGPS exon 11 GGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGA GTACAACCTGCGCTCGCGCACCGTGCTGTGCGGGA CCTGCGGGCAGCCTGCCGACAAGGCATCTGCCAGC GGCTCAGGAGCCCAGGTGGGTGGACCCATCTCCTC TGGCTCTTCTGCCTCCAGTGTCACGGTCACTCGCA GCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGC TTCGGGGACAATCTGGTCACCCGCTCCTACCTCCT GGGCAACTCCAGCCCCCGAACCCAG 2

Examples include antisense oligonucleotides that are fully complementary to LMNA, exon 11 (SEQ ID NO: 1 or 2), including also complementary to the cryptic LMNA splicing site, exon 11, underlined in SEQ ID NO: 1 and 2 in Table 1. 1 (for example, CAGGTGGGC/T).

In some embodiments, the degree of complementarity between the target sequence and the antisense targeting sequence is sufficient to form a stable duplex. The complementarity region of antisense oligomers within a target RNA sequence may be as little as 8-11 bases in length, but is preferably 12-15 bases or more, such as 12-20 bases, 12-25 or 15-25 bases, including all integers and ranges between these ranges of values. The antisense oligomer of about 14-15 bases is generally long enough to contain the unique complementary sequence of the target mRNA. In some embodiments, a minimum length of complementary bases may be required to achieve the desired binding Tm, discussed below.

In some embodiments, 40 base length oligomers may be suitable in which at least a minimum number of bases, such as 10-12 bases, are complementary to the target sequence. However, in general, facilitated or active cellular uptake is optimized at oligomer lengths less than about 30. For PMO oligomers, further described below, the optimal balance between binding stability and uptake is typically achieved at lengths of 18-30 bases. Included herein are antisense oligomers (e.g., PNA, LNA, 2'-OMe, MOE, PMO) that are composed of about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases, in which at least about 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 consecutive and/or non-consecutive bases are complementary to the target sequence described herein, including the target sequences of SEQ ID NO: 1 and/or 2, or variants thereof.

In some embodiments, antisense oligomers may be 100% complementary to the target nucleotide sequence of the LMNA pre-mRNA, or they may include mismatches, e.g. to account for variants, since the heteroduplex formed between the oligomer and the target sequence is stable enough to resist the effects of cellular nucleases and other degradation or rearrangement mechanisms that may occur in vivo. Oligomeric backbones that are less sensitive to cleavage by nucleases are discussed below.

- 13 040983

Mismatches, if present, are less destabilizing when moved towards the end regions of the hybrid duplex than in its middle. The number of mismatches allowed will depend on the length of the oligomer, the percentage of G:C base pairs in the duplex, and the position of the mismatch(s) in the duplex, in accordance with well understood principles of duplex stability. While such an antisense oligomer is not necessarily 100% complementary to the target sequence, it is effective to stably and specifically bind to the target sequence such that the biological activity of the target nucleotide, e.g., the expression of the progerin protein(s), is modulated.

In some embodiments, as with PMO oligomers, the antisense activity of the oligomer can be enhanced by using a mixture of uncharged and cationic phosphorodiamidate bonds. The total number of cationic bonds in an oligomer can vary from 1 to 10 (including all integers in between) and be dispersed throughout the oligomer. Preferably, the number of charged bonds is at least 2 and not more than half of the total number of backbone bonds, for example, within 2, 3, 4, 5, 6, 7, or 8 positively charged bonds, and preferably each charged bond is separated along the backbone by at least 1, 2, 3, 4 or 5 uncharged bonds.

Examples of antisense sequences for targeting human pre-mRNA LMNA are shown in Table 1 below. 2. Antisense oligonucleotides may contain all or part of these targeting sequences.

table 2

Examples of HGPS Targeting Sequences*

Sequence name Targeting sequence 5' - 3' SEQ ID NO: Pr11-1 CTGAGCCGCTGGCAGATGCCTTGTC 3 Pr11-2 GAGGAGATGGGTCCACCCACCTGGG 4

Antisense oligonucleotide compounds.

Antisense oligonucleotides as described herein typically (a) have the ability to be actively taken up by mammalian cells, and (b) immediately upon uptake, form a duplex with the target RNA with a Tm greater than about 45°C.

In some embodiments, the implementation of the oligomeric backbone can be essentially uncharged, and preferably can be recognized as a substrate for active or facilitated transport through the cell membrane. The ability of the oligomer to form a stable duplex with the target RNA may also relate to other features of the oligomeric backbone, including the length and complementarity of the antisense oligomer in relation to the target, the G:C to A:T ratio of complementary bases, and the positions of any non-complementary bases.

The ability of the antisense oligomer to resist cellular nucleases may contribute to the retention of the agent and its maximum delivery to the cellular cytoplasm.

A variety of antisense chemistries can be used in antisense oligomers. Examples of oligomeric chemical structures include, without limitation, phosphoramidate morpholine oligomers and phosphorodiamidate morpholine oligomers (PMOs), thiophosphate modified oligomers, 2'O-methyl modified oligomers, peptido nucleic acid (PNA), closed nucleic acid (NNA), thiophosphate oligomers, 2'O-MOE modified oligomers, 2'-fluoro-modified oligomer, 2'O,4'C-ethylene bridged nucleic acids (ENA), tricyclo-DNA, tricyclo-DNA-thiophosphate nucleotides, 2'-O-[ 2-(Nmethylcarbamoyl)ethyl] modified oligomers, morpholine oligomers, peptide-conjugated phosphoramidate morpholine oligomers (PPMO), phosphorus diamidate morpholine oligomers with a phosphorus atom with (i) covalent bonds to the nitrogen atom of the morpholine ring and (ii) a second covalent bond with (1,4 -piperazin)-1-yl substituent or with substituted (1,4-piperazin)-1yl (PMO-plus), and phosphorus diamidate oligomers with a phosphorus atom with (i) a covalent bond to the a atom nitrogen of the morpholine ring and (ii) a second covalent bond to the nitrogen atom of the 4-aminopiperidin-1-yl ring (i.e. APN) or derivatives of the chemical structures of 4-aminopiperidin-1-yl (PMO-X), including combinations of any of the above. In general, shorter targeting sequences can be used in the chemical structures of PNA and LNA due to their relatively high target binding strength relative to PMO and 210-Me modified oligomers. Thiophosphate and 2'O-Me-modified chemical structures can combine to form a 2Ό-Me-thiophosphate backbone. See, for example, PCT Publication Nos. WO 2013/112053 and WO 2009/008725, which are hereby incorporated by reference in their entirety.

In some instances, antisense oligomers such as PMOs can be conjugated to cell penetrating peptides (CPPs) to facilitate intracellular delivery. Peptide conjugated PMOs are referred to as PPMOs and in some embodiments they include opi

- 14 040983 sleigh in PCT Publication No. WO 2012/150960, incorporated herein in its entirety by reference. In some embodiments, an arginine rich peptide sequence may be used conjugated or linked to, for example, the 3'terminal end of an antisense oligomer as described herein. In some embodiments, an arginine-rich peptide sequence can be used conjugated or linked to, for example, the 5'terminal end of an antisense oligomer as described herein.

1. Peptido nucleic acids (PNA).

Peptido nucleic acids (PNAs) are analogues of DNA in which the backbone is structurally homomorphic to the deoxyribose backbone consisting of N-(2-aminoethyl)glycine units to which pyrimidine or purine bases are attached. PNAs containing naturally occurring pyrimidine or purine bases hybridize to complementary oligomers, obeying the Watson-Crick rules for base pairing and mimicking DNA in understanding base pair recognition (Egholm, Buchardt et al., 1993). The PNA backbone is formed by peptide bonds instead of phosphodiester bonds, making it well suited for antisense applications (see structure below). The backbone is uncharged, resulting in PNA/DNA or PNA/RNA duplexes exhibiting above normal thermal stability. PNAs are not recognized by nucleases or proteases. A non-limiting example of PNA is shown below.

PNK

Despite a radical structural change in the natural structure, PNAs are capable of sequence-specific binding in a helical form to form DNA or RNA. Characteristics of PNA include high binding affinity for complementary DNA or RNA, destabilizing effect caused by single nucleotide mismatch, resistance to nucleases and proteases, hybridization with DNA and RNA regardless of salt concentration, and triplex formation with homopurine DNA. PANAGENE™ developed their proprietary Bts PNA monomers (Bts; benzotriazole-2-sulfonyl group) and proprietary oligomerization process. PNA oligomerization using PNA Bts monomers consists of repeated cycles of deprotection, coupling, and capping. PNA can be obtained by synthesis using any technique known in the art. See, for example, US Pat. Nos. 6,969,766; 7,211,668; 7,022,851; 7,125,994; Further ideas about PNA compounds can be found in Nielsen et al., Science, 254:1497-1500, 1991. Each of the above references is incorporated herein by reference in its entirety.

2. Closed nucleic acids (LNA).

Antisense oligomeric compounds may also contain closed nucleic acid (LNA) subunits. LNAs are a member of a class of modifications called bridging nucleic acids (BNAs).

MNCs are characterized by a covalent bond that closes the ribose ring conformation at the C30-endo (northern) non-planar position of the saccharide moiety. In LNA, the bridge consists of methylene between the 2'-O and 4'-C positions. LNAs enhance pre-backbone organization and base stacking to improve hybridization and thermal stability.

Structures of LNAs can be found, for example, in Wengel, et al., Chemical Communications, 1998, 455; Tetrahedron, 1998, 54:3607; and Accounts of Chem. Research, 1999, 32:301; Obika, et al., Tetrahedron Letters, 1997, 38:8735; 1998, 39:5401; and Bioorganic Medicinal Chemistry, 2008, 16:9230, which are hereby incorporated by reference in their entirety. A non-limiting example of a ZNK is shown below.

- 15 040983

Compounds according to the present description may include one or more NNK; in some cases, the compounds may consist entirely of ZNCs. Methods for synthesizing individual LNA nucleoside subunits and incorporating them into oligomers are described, for example, in US Pat. Exemplary intersubunit linkers include phosphodiester and thiophosphate moieties; alternatively, phosphorus-free linkers can be used. Additional embodiments include LNAs containing a compound in which each LNA subunit is separated by a DNA subunit. Certain compounds are composed of alternating LNA and DNA subunits, in which the intersubunit linker is a thiophosphate.

Another representative of the class of MNCs are nucleic acids with 2'O,4'C-ethylene bridge (ENA). A non-limiting example is shown below.

ENA oligomers and their preparation are described in Obika et al., Tetrahedron Lett, 38(50):8735, which is hereby incorporated herein by reference in its entirety. Description compounds may include one or more ENK subunits.

3. Thiophosphates.

Thiophosphates (or S-oligomers) are a variant of normal DNA in which one of the non-bridging oxygen atoms is replaced by a sulfur atom. A non-limiting example of a thiophosphate is shown below.

Sulfurization of the internucleotide bond reduces the action of endo- and exonucleases, including POL 1 endonuclease, acting in the 5' to 3' and 3' to 5' direction of DNA, S1 and P1 nucleases, RNase, serum nuclease, and snake venom phosphodiesterase. Thiophosphates are prepared in two main ways: by the action of a solution of elemental sulfur in carbon disulfide on the hydrophosphonate, or by the sulfurization of triesters of phosphites with either tetraethylthiuram disulfide (TETD) or 3H-1,2benzodithiol-3-one 1,1-dioxide (BDTD) (see Ref. , for example, Iyer et al., J. Org. Chem., 55, 4693-4699, 1990, which is hereby incorporated herein by reference in its entirety). The latest methods eliminate the problem with the insolubility of elemental sulfur in most organic races.

- 16 040983 solvents and toxicity of carbon disulphide. The TETD and BDTD methods also provide high purity thiophosphates.

4. Tricyclo-DNA and tricyclo-thiophosphate nucleotides.

Tricyclo-DNA (tc-DNA) is a class of sterically hindered DNA analogues in which each nucleotide is modified by introducing a cyclopropane ring to limit the conformational flexibility of the backbone in order to optimize the backbone geometry in terms of torsion angle γ. tcDNA containing homobases of adenine and thymine form extremely stable A-T base pairs with complementary RNAs. Tricyclo-DNA and their synthesis are described in PCT Patent Application Publication No. WO 2010/115993, which is hereby incorporated by reference in its entirety. Description compounds may include one or more tricyclo-DNA; in some cases, the compounds may consist entirely of tricyclo-DNA nucleotides.

Tricyclo-thiophosphate nucleotides are tricyclo-DNA nucleotides with thiophosphate intersubunit bonds. Tricyclothiophosphate nucleotides and their synthesis are described in PCT Patent Application Publication No. WO 2013/053928, which is hereby incorporated by reference in its entirety. Description compounds may include one or more tricyclo-DNA nucleotides; in some cases, the compounds may consist entirely of tricyclo-DNA nucleotides.

A non-limiting example of a tricyclo-DNA/tricyclo-thiophosphate nucleotide is shown below.

OR Oh? */'0^0 | Tricyclo-DNA base

5. 2'O-methyl, 2'O-MOE and 2'-F oligomers.

The 2Ό-Me molecules of the oligomer carry a methyl group on the 2'-OH residue of the ribose molecule. 2'-O-Me-RNAs exhibit the same (or similar) behavior as DNA, but are protected from degradation by nucleases. 2'-O-Me-RNAs can also be combined with thiophosphate oligomers (PTOs) for additional stabilization. oligomers (phosphodiester or thiophosphate) can be synthesized according to conventional techniques of the prior art (see, for example, Yoo et al., Nucleic Acids Res., 32:2008-16, 2004, which is hereby incorporated herein in its entirety by reference A non-limiting example of a 2'O-Me oligomer is shown below.

The 2'O-Me oligomer may also contain a thiophosphate bond (2'O-Me thiophosphate oligomers). 2'O-methoxyethyl oligomers (2'-O MOE), like 2'O-Me oligomers, carry a methoxyethyl group on the 2'-OH moiety of the ribose molecule and are discussed in Martin et al., Helv. Chirn. Acta, 78, 486-504, 1995, which is hereby incorporated in the present description in a general example of a 2' O-MOE nucleotide is shown below.

in its entirety by reference. Unlimited-

Unlike the previous alkylated derivatives of the 2'OH ribose, the 2'-fluoroligomers contain a fluorine radical in the 2' position instead of the 2'OH. A non-limiting example of a 2-F oligomer o is shown below.

- 17 040983

2'-fluoro oligomers are further described in PCT Application Publication No. WO 2004/043977, which is hereby incorporated herein by reference in its entirety.

Description compounds may include one or more of the 2U-methyl, 2'O-MOE, and 2'-F subunits and may use any of the intersubunit linkages described herein. In some cases, the description compound may consist entirely of 2Ό-Methyl, 2'O-MOE, or 2'-F subunits. One embodiment of a compound according to the present disclosure consists entirely of 2U-Methyl subunits.

6. 2'-O-[2-(N-methylcarbamoyl)ethyl] oligonucleotides (MCE) MCE is another example of 2'O modified ribonucleosides useful as compounds of the present disclosure. In this case, the 2'OH group is derivatized to a 2-(N-methylcarbamoyl)ethyl fragment to increase resistance to nucleases. A non-limiting example of an MCE oligomer is shown below.

MCE and their synthesis are described in Yamada et al., J. Org. Chem., 76(9): 3042-53, which is hereby incorporated herein by reference in its entirety. Description compounds may include one or more MCE subunits.

7. Stereospecific oligomers.

Stereospecific oligomers in which the stereochemical structure of each phosphorus-containing bond is adjusted by synthesis so that essentially a pure single oligomer is obtained. A non-limiting example of a stereospecific oligomer is shown below.

In the above example, each phosphorus atom of the oligomer has the same stereochemical structure. Additional examples include the oligomers described above. For example, ZNK

- 18 040983

ENA, tricyclo-DNA, MCE, 2'O-methyl, 2'O-MOE, 2'-F and morpholine oligomers can be prepared with stereospecific phosphorus-containing internucleoside bonds such as, for example, thiophosphate, phosphodiester, phosphoramidate, phosphorodiamidate and others phosphorus-containing internucleoside bonds. Stereospecific oligomers, preparation methods, chiral-guided synthesis, chiral design and chiral auxiliaries used in the preparation of such oligomers are described in detail, for example, in PCT Application Publication No. WO 2015/107425, WO 2015/108048, WO 2015/108046, WO 2015/ US Pat.

8. Morpholine oligomers.

Morpholine oligomers are based on an oligomer containing morpholine subunits holding a nucleotide base and, instead of ribose, contain a morpholine ring. Examples of internucleoside bonds include, for example, phosphoramidate or phosphorodiamidate internucleoside bonds connecting the nitrogen atom of the morpholine ring of one morpholine subunit to the 4' exocyclic carbon atom of the adjacent morpholine subunit. Each morpholine subunit contains a purine or pyrimidine nucleotide base effective for binding by base-specific hydrogen bonding to a base in the oligonucleotide.

Morpholine oligomers (including antisense oligomers) and their synthesis are described in detail in, for example, US Pat. Nos. 5,698,685; 5,217,866; and US Patent Application No. 12/271036, 12/271040; and PCT Publications Nos. WO 2009/064471 and WO 2012/043730; and Summerton et al., 1997, Antisense and Nucleic Acid Drug Development, 7:187-195, which are hereby incorporated herein by reference in their entirety. Within the oligomeric structure, phosphate groups are usually referred to as forming internucleoside bonds of the oligomer. The naturally occurring internucleoside bond between RNA and DNA is a phosphodiester bond from the 3' to 5' end. The phosphoramidate group contains phosphorus atoms with three oxygen atoms attached and one nitrogen atom attached, while the phosphorodiamidate group contains phosphorus atoms with two oxygen atoms attached and two nitrogen atoms attached. In the uncharged or cationic intersubunit bonds of the morpholine oligomers described herein, one nitrogen atom is always lateral to the backbone chain. The second nitrogen atom in the phosphorodiamidate bond is typically the ring nitrogen atom in the ring morpholine structure. PMO-X refers to phosphorus diamidate morpholine oligomers with phosphorus atoms with (i) a covalent bond to the nitrogen atom of the morpholine ring, and (ii) a second covalent bond to the nitrogen atom of the ring of 4-aminopiperidin-1-yl (i.e. APN) or a derivative 4-aminopiperidin-1yl. Examples of PMO-X oligomers are further described in PCT Application Publication No. 2011/38459 and PCT Publication No. WO 2013/074834, which are hereby incorporated by reference in their entirety. PMO-X includes PMO-apn or APN, which refers to a PMO-X oligomer containing at least one internucleoside bond in which a phosphorus atom is bonded to a morpholine group and to the ring nitrogen of 4-aminopiperidin-1-yl (i.e. APN). In specific embodiments, the implementation of the antisense oligomer containing the targeting sequence, as indicated in table. 2 contains at least one APN-containing bond or an APN-derived bond. Various embodiments include morpholine oligomers that contain about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% APNs. /APN-derived bonds, with the remaining bonds (if less than 100%) being uncharged bonds, e.g., about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 , 38, 39, or 40 of all internucleoside bonds are APN/APN-derived bonds.

- 19 040983

In some embodiments, the antisense oligomer is a compound of formula (I)

G is a cell penetrating peptide (CPP) and a linker fragment.

In some embodiments, G is selected from C(O)(CH ₂ ) ₅ NH-CPP-R ^a , -C(O)(CH ₂ ) ₂ NH-CPP-R ^a , O

and CPP-R

JI /

-C(O)(CH2)2NHC(O)(CH2)5NH-CPP-R ^a , -C(O)CH2NH-CPP-R ^a and , where CPP is attached to the linker fragment by an amide bond at the carboxyl end of CPP, a

R ^a is a moiety attached to the R ^a of the amino terminus of the CPP by an amide bond, where R ^a is selected from H, acetyl, benzoyl and stearoyl.

In some embodiments, R ^a is acetyl. In some embodiments, the CPP is selected from SEQ ID NOs: 5-21. In some embodiments, G is selected from SEQ ID NOs: 22-25. In some embodiments, the CPP is selected from SEQ ID NO: 11. In some embodiments, G is SEQ ID NO: 25.

/? CPP-R ³ \U /

H T ^N

In some embodiments, G is selected from -C(O)CH ₂ NH-CPP-R ^a and ' , where CPP is attached to the linker moiety by an amide bond at the carboxyl terminus of CPP, and R ^a is attached to the amino terminus of CPP by an amide bond, where R ^{a is} selected from H, acetyl, benzoyl and stearoyl, and CPP is selected from SEQ ID NO: 5-21.

In some embodiments, the CPP is selected from SEQ ID NO: 11. In some embodiments, R ^a is acetyl.

- 20 040983

In some embodiments, T is

In various aspects, an antisense oligonucleotide as described herein comprises a compound of formula (II)

or a pharmaceutically acceptable salt thereof, wherein each Nu is a nucleotide base, which together form a targeting sequence;

Z is an integer from 8 to 38; A

G is a cell penetrating peptide (CPP) and a linker fragment.

In some embodiments, G is selected from C(O)(CH ₂ ) ₅ NH-CPP-R ^a , -C(O)(CH ₂ ) ₂ NH-CPP-R ^a , O

CPP-R y L /

-C(O)(CH2)2NHC(O)(CH2)5NH-CPP-R ^a , -C(O)CH2NH-CPP-R ^a and , where CPP is attached to the linker fragment by an amide bond at the carboxyl end of CPP, a

- 21 040983

R ^a is a moiety attached to the R ^a of the amino terminus of the CPP by an amide bond, where R ^a is selected from H, acetyl, benzoyl and stearoyl.

In some embodiments, R ^a is acetyl. In some embodiments, the CPP is selected from SEQ ID NOs: 5-21. In some embodiments, G is selected from SEQ ID NOs: 22-25. In some embodiments, the CPP is selected from SEQ ID NO: 11. In some embodiments, G is SEQ ID NO: 25.

/? CPP-R ^a

In some embodiments, G is selected from -C(O)CH ₂ NH-CPP-R ^a and , where CPP is attached to the linker moiety by an amide bond at the carboxyl terminus of CPP, and R ^a is attached to the amino terminus of CPP by an amide bond, where R ^a is selected from H, acetyl, benzoyl and stearoyl, and CPP is selected from SEQ ID NO: 5-21.

In some embodiments, CPP is selected from SEQ ID NO: 11. In some embodiments, G is selected from SEQ ID NO: 24 or 25. In some embodiments, G is SEQ ID NO: 25.

In some embodiments, the targeting sequence of the antisense oligomers of the present disclosure, including, for example, some embodiments of the antisense oligomers of formula (I) and (II), is selected from

a) SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) where Z is 23; And

b) SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) where Z is 23.

peptide transporters.

CPP and arginine-rich peptide-PMO conjugates (RRMO).

In some embodiments, the antisense oligonucleotide is conjugated to a cell-penetrating peptide (referred to herein as CPP). In some embodiments, the CPP is an arginine-rich peptide. The term arginine-rich refers to a CPP with at least 2, and preferably 2, 3, 4, 5, 6, 7, or 8 arginine residues, each optionally separated by one or more uncharged hydrophobic residues, and optionally containing about 6-14 amino acid residues. As explained below, CPP is preferably linked at its carboxyl terminus to the 3' and/or 5' terminus of the antisense oligonucleotide via a linker, which may also be one or more amino acids, and is preferably also capped at its amino terminus by a substituent R ^a , wherein R ^a selected from H, acetyl, benzoyl or stearoyl. In some embodiments, R ^a is acetyl.

Table 3

Examples of CPP (SEQ ID NO: 5-21) and combinations of CPP linker fragments _________________________(SEQ ID NO:22-25)_________________________

Name (appointment) Subsequence SEQID NO. g tat RRRQRRKKR 5 Tat RKKRRQRRR 6 R9F2 RRRRRRRRRFF 7 r ₅ f ₂ r ₄ RRRRRFFRRRR 8 _r4 RRRR 9 r ₅ RRRRR 10 _R6 RRRRRR eleven _r7 RRRRRRR 12 _r8 RRRRRRRR 13 _r9 RRRRRRRRR 14

- 22 040983

(RX) 8 RXRXRXRXRXRXRXRX 15 (RXR)4 RXRRXRRXRRXR 16 (RXR) ₅ RXRRXRRXRRXRRXR 17 (RXRRBR)2 RXRRBRRXRRBR 18 (RAR) ₄ F ₂ RARRARRRAR F F 19 (RGR) ₄ F ₂ RGRRGRGRGRGRFF 20 (RFF) ₃ R RFFRFFFRFR 21 (RXR) _4XB RXRRXRRXRRXRXB 22 (RFF) ₃ RXB RFFRFFFRFFRXB 23 (RFF) _3RG RFFFRFFRG 24 R ₆ G RRRRRRG 25

X is 6-aminohexanoic acid;

B is β-alanine;

F is phenylalanine;

G is glycine;

R is arginine;

Q is glutamine;

K is lysine.

Each of SEQ ID NOs: 5-25 may further contain an R ^a group attached to the amino terminus, where R ^a is selected from H, acetyl, benzoyl and stearoyl. In some embodiments, R ^a is acetyl.

CPPs, their synthesis, and methods for conjugation to an oligomer are further described in US Patent Application Publication No. 2012/0289457 and PCT Patent Application Publication Nos. in its entirety by reference.

In various embodiments, G (as defined in formulas (I) and (II)), G is a cell penetrating peptide (CPP) and a linker fragment selected from -C(O)(CH ₂ ) ₅ NH-CPP-R ^a , /? CPP-R ^a γ X—\

С(О)(CH2)2NH-CPP-R ^a , -С(О)(CH2)2NHC(O)(CH2)5NH-CPP-R ^a , -C(O)CH2NH-CPP-R ^a and , where CPP is amide bonded to the linker moiety at the carboxy terminus of CPP, and R ^a is amide bonded to the R ^a amino terminus of CPP, where R ^a is selected from H, acetyl, benzoyl, and stearoyl. In some embodiments, R ^a is acetyl. In some embodiments, the CPP comprises or is selected from SEQ ID NOs: 5-21. In some embodiments, G comprises or is selected from SEQ ID NOs: 22-25. In some embodiments, the CPP is SEQ ID NO: 11. In some embodiments, G is SEQ ID NO: 25.

In some embodiments, G (as noted in formulas (I) and (II)) is represented by the formula

where R ^a is selected from H, acetyl, benzoyl and stearoyl, and J is an integer from 4 to 9. In some embodiments, J is 6.

- 23 040983

In various embodiments, CPP-R ^a (as noted in formulas (I) and (II)) is represented by the formula

where R ^a is selected from H, acetyl, benzoyl and stearoyl, a

J is an integer from 4 to 9.

In some embodiments, the CPP is SEQ ID NO: 11. In various embodiments, J is 6. In some embodiments, Ra ^is selected from H and acetyl. For example, in some embodiments, R ^a is H. In some embodiments, R ^a is acetyl.

In some embodiments, G comprises or is selected from SEQ ID NOs: 22-25. In some embodiments, G is SEQ ID NO: 25.

In some embodiments, including, for example, the antisense oligomers of formulas (I) and (II), G is -C(O)CH ₂ NH-R ₆ -R ^a covalently linked to the antisense oligomer of the present description at the 3' end oligomer, where R ^a represents H, acetyl, benzoyl or stearoyl, for capping the amino end of R6. In some embodiments, R ^a is acetyl. In non-limiting examples, the CPP is -R6-R ^a and the linker is C(O)CH2NH (ie, glycine). This particular example of G=-C(O)CH ₂ NH-R ₆ -R ^a is also illustrated by the following structure:

where R ^a is selected from H, acetyl, benzoyl and stearoyl.

In some embodiments, R ^a is acetyl.

In various embodiments, CPP-R ^a is -R ₆ -R ^a , where CPP is SEQ ID NO: 11, which is also illustrated by the following formula

where R ^a is selected from H, acetyl, benzoyl and stearoyl.

In some embodiments, the CPP is SEQ ID NO: 11. In some embodiments, R ^a is acetyl.

- 24 040983

In some embodiments, CPP-R ^a is the formula -(RXR) ₄ -R ^a , where CPP is SEQ ID NO: 16, which is also illustrated by the following formula:

In various embodiments, CPP-R ^a is -R-(FFR) ₃ -R ^a , where CPP is SEQ ID NO: 21, which is also illustrated by the following formula:

In various embodiments, G is a cell penetrating peptide (CPP) and a linker fragment selected from -C(O)(CH ₂ ) ₅ NH-CPP-R ^a , -C(O)(CH ₂ ) ₂ NH-CPP -R ^a , n CPP-R ^a

V>-- ^N

-C(O)(CH2)2NHC(O)(CH2)5NH-CPP-R ^a , -C(O)CH2NH-CPP-R ^a and , where CPP is attached to the linker fragment by an amide bond at the carboxyl end of CPP, a

R ^a is attached to the amino terminus of CPP by an amide bond, where R ^a is selected from H, acetyl, benzoyl and stearoyl and where CPP-R ^a is selected from

- 25 040983

, (-R ₆ -R ^a ) .

In some embodiments, R ^a is acetyl.

Additionally, in some embodiments, the antisense oligomer as described is a compound of formula (III)

at , or a pharmaceutically acceptable salt thereof, where each Nu is a nucleotide base, which together form a targeting sequence (5' to 3') selected from

a) SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) where Z is 23; And

b) SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) where Z is 23; a

R ^a is selected from H, acetyl, benzoyl and stearoyl.

In some embodiments, the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) and Z is 23. In some embodiments, the targeting sequence is SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) and Z is 23. In some embodiments, R ^a is acetyl.

- 26 040983

In some embodiments, antisense oligomers are described as including, for example, some embodiments of antisense oligomers of formula (III), wherein the antisense oligomer may be of formula (IV)

or a pharmaceutically acceptable salt thereof, wherein each Nu is a nucleotide base, which taken together form a targeting sequence (5' to 3') selected from

a) SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) where Z is 23; And

b) SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) where Z is 23; a

R ^a is selected from H, acetyl, benzoyl and stearoyl.

In some embodiments, the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) and Z is 23. In some embodiments, the targeting sequence is SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) and Z is 23. In some embodiments, R ^a is acetyl.

In some embodiments, the antisense oligomer compound of formula (III) is formula (IV) wherein the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) and Z is 23. In some embodiments, the antisense oligomer compound of formula (III) is is formula (IV) wherein the targeting sequence is SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) and Z is 23.

- 27 040983

In some embodiments, the antisense oligomer is a compound of formula (V), or a pharmaceutically acceptable salt thereof, selected from

In some embodiments, the antisense oligomer of formula (V) is formula (Va). In some embodiments, the antisense oligomer of formula (V) is formula (Vb).

In some embodiments, the antisense oligomer as described, including, for example, a compound of formula (III), formula (IV), formula (V), formula (Va), and formula (Vb), is a pharmaceutically acceptable salt. In some embodiments, the pharmaceutically acceptable salt is the HCl (hydrochloric acid) salt. For example, in some embodiments, the compound of formula (III) is an HCl salt. In some embodiments, the compound of formula (III) is a salt containing 0.6 HCl. In some embodiments, the compound of formula (IV) is an HCl salt. In some embodiments, the implementation of the compound of formula (IV) is a salt containing 0.6 HCl. In some embodiments, the compound of formula (V) is an HCl salt. In some embodiments, the compound of formula (V) is a salt containing 0.6 HCl. In some embodiments, the compound of formula (Va) is an HCl salt. In some embodiments, the compound of formula (Va) is a salt containing 0.6 HCl. In some embodiments, the compound of formula (Vb) is an HCl salt. In some embodiments, the compound of formula (Vb) is a salt containing 0.6 HCl.

In some embodiments, antisense oligomers are described as including, for example, certain embodiments of antisense oligomers of formula (V), wherein the antisense oligomers may be of formula (VI) (or be a pharmaceutically acceptable salt thereof) and be selected from

- 29 040983

In some embodiments, the antisense oligomer of formula (VI) is formula (VIa). In some embodiments, the antisense oligomer of formula (VI) is formula (VIb). In some embodiments, the antisense oligomer of formula (V) is formula (VIa). In some embodiments, the antisense oligomer of formula (V) is formula (VIb).

In some embodiments, the implementation of the antisense oligomer as described, including, for example, the compound of formula (VI), formula (VIa) and formula (VIb), is a pharmaceutically acceptable salt. In some embodiments, the pharmaceutically acceptable salt is the HCl (hydrochloric acid) salt. For example, in some embodiments, the compound of formula (VI) is an HCl salt. In some embodiments, the compound of formula (VI) is a salt containing 0.6 HCl. In some embodiments, the compound of formula (VIa) is an HCl salt. In some embodiments, the implementation of the compound of formula (VIa) is a salt containing 0.6 HCl. In some embodiments, the compound of formula (VIb) is an HCl salt. In some embodiments, the implementation of the compound of formula (VIb) is a salt containing 0.6 HCl.

For clarity, the structural formula of the antisense oligomers with formulas (V) and (VI) is a continuous structural formula from 5' to 3', and to facilitate the illustration of the entire structural formula in a compact form, the formulas are presented in this description with various illustrated breaks, indicated by BREAK A, BREAK B, and BREAK C. One skilled in the art will appreciate that, for example, each indication of BREAK A shows a continuation of the illustration of the structural formula at those points. The same statement is true for each instance of GAP B and GAP C in the structural formula of the antisense oligomers of formulas (V) and (VI). None of the illustrated breaks described above or used herein is intended to indicate or be understood by one of ordinary skill in the art as a break in the structural formula of the antisense oligomers of formulas (V) and (VI). Methods of Use and Pharmaceutical Compositions The present disclosure relates to methods of treating a patient for progeroid diseases, such as laminopathies and similar diseases or conditions, by administering an antisense oligonucleotide as described herein and a pharmaceutical composition comprising such oligonucleotides, wherein the oligonucleotide inhibits expression of the mRNA of the mutant protein. LMNA by modulating LMNA pre-mRNA splicing. In some aspects, such as these and similar methods, the treatment of progeroid laminopathy can be used in clinical settings in which progerin expression is associated with a disease such as HGPS. These and similar embodiments can also be combined with methods for treating or reducing progeroid laminopathies, by performing the methods in series or in parallel according to

- 30 040983 of the present invention with another treatment.

The results described herein can be extended to the aging process and related conditions and diseases, in addition to progeroid laminopathies. This is possible due to the fact that HGPS is in many respects closely related to natural aging processes. HGPS continues to be regarded as a valid model of aging (Fossel, J., Pediatr Endocrinol Metab 13 Suppl, 6:1477-1481, 2000). For example, the association with atherosclerosis is very strong, especially for the coronary arteries. In addition, alopecia in HGPS is similar to that seen in elderly patients. Additionally, the primary cellular hallmark of HGPS, as described many years ago by Hayflick et al. (Hayflick, N., Engl. J. Med., 295:1302-1308, 1976), is early cellular senescence. The limited number of cell divisions in fibroblasts in HGPS is similar to that seen in fibroblasts obtained from elderly individuals. This fact was further explored in a study showing similarities in gene expression profiles of fibroblasts in HGPS and older human-derived fibroblasts that differed from younger human-derived fibroblasts (Ly et al., Science, 287:2486-2492, 2000).

Accordingly, it is understood that a method of treating a progeroid disease or a similar condition described herein may include the treatment of progeroid laminopathy such as HGPS or another progeroid disease or condition associated with aging, a cardiovascular disease or condition (such as atherosclerosis) and so on.

It is understood that an effective in vivo treatment regimen employing the methods of the invention may vary according to the duration, dose, frequency, and route of administration of the oligonucleotide, as well as the condition of the patient being treated (i.e., prophylactic treatment versus administration in response to an existing state). Accordingly, such in vivo therapy will often require monitoring by tests appropriate to the particular type of disease being treated and appropriate adjustments to the dose or treatment regimen in order to achieve an optimal therapeutic outcome.

In some embodiments, the methods of the present invention use formulations or compositions suitable for therapeutic delivery of antisense oligomers as described herein. Therefore, in some embodiments, the methods of the present invention use pharmaceutically acceptable compositions that contain a therapeutically effective amount of one or more of the oligomers or agents described herein, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or thinners.

Although self-administration is possible for the oligomer of the present invention, it is preferable to administer the compound as a pharmaceutical formulation (composition).

Methods for delivering nucleic acid molecules are described, for example, in Akhtar et al., 1992, Trends Cell Bio., 2:139; and Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar; Sullivan et al., PCT Publication No. WO 94/02595. These and other protocols can be used to deliver virtually any nucleic acid molecule, including the isolated oligomers of the present invention.

As detailed below, the pharmaceutical compositions used in the methods of the present invention can be specifically prepared for administration in solid or liquid form, including adapted compositions for the following:

(1) oral administration, for example, kissels (aqueous or non-aqueous solutions or suspensions), tablets, for example intended for buccal, sublingual and systemic absorption, boluses, powders, granules, pastes for application to the tongue;

(2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection, for example as a sterile solution or suspension or sustained release formulation;

(3) topical application, for example as a cream, ointment, or controlled release patch or spray applied to the skin;

(4) vaginally or rectally, for example in the form of a pessary, cream or foam;

(5) sublingual;

(6) through the eyes;

(7) transdermally; or (8) nasally.

The phrase pharmaceutically acceptable is used herein to refer to those compounds, materials, compositions and/or dosage forms that, within the framework of rational medical judgment, are suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic reaction, or other problem. or complications, commensurate with a reasonable benefit/risk ratio.

The phrase pharmaceutically acceptable carrier, in the context of the invention, means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid excipient, diluted

- 31 040983 body, excipient, processing aid (for example, lubricant, talc, magnesium, calcium or zinc stearate, or stearic acid), or dissolving encapsulating material involved in the delivery or transport of the test compound from one organ or part of the body to another organ or part of the body. Each carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and harmless to the patient.

Some examples of substances that can serve as pharmaceutically acceptable carriers include, without limitation (1) sugars such as lactose, glucose and sucrose;

(2) starches such as corn starch and potato starch;

(3) cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate;

(4) powdered tragacanth;

(5) malt;

(6) gelatin;

(7) talc;

(8) excipients such as cocoa butter and suppository waxes;

(9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil;

(10) glycols such as propylene glycol;

(11) polyols such as glycerol, sorbitol, mannitol and polyethylene glycol;

(12) esters such as ethyl oleate and ethyl laurate;

(13) agar;

(14) buffering agents such as magnesium hydroxide and aluminum hydroxide;

(15) alginic acid;

(16) pyrogen-free water;

(17) isotonic saline solution;

(18) Ringer's solution;

(19) ethyl alcohol;

(20) pH buffer solutions;

(21) polyesters, polycarbonates and/or polyanhydrides; and (22) other non-toxic compatible substances used in pharmaceutical formulations.

Additional non-limiting examples of agents suitable for formulation with antisense oligomers of the present invention include PEG-conjugated nucleic acids, phospholipid-conjugated nucleic acids containing lipophilic nucleic acid fragments, thiophosphates, P-glycoprotein inhibitors (such as Pluronic P85) which can enhance penetration drugs in various tissues; biodegradable polymers such as poly(DL-lactide-coglycolide), sustained release microspheres after implantation (Emerich, DF et al., 1999, Cell Transplant, 8, 47-58) Alkermes, Inc. Cambridge, Mass.; and loaded nanoparticles, such as those made from polybutylcyanoacrylate, which can deliver drugs across the brain's blood-brain barrier and can alter neuronal uptake mechanisms (Prog. Neuropsychopharmacol. Biol. Psychiatry, 23, 941-949, 1999).

It is also characteristic of the methods of the present invention to use a composition comprising surface-modified liposomes containing poly(ethylene glycol) lipids (PEG-modified, branched and unbranched, or combinations thereof, or long-term circulating liposomes or stealth liposomes). The oligomers of the present invention may also include covalently attached PEG molecules of various molecular weights. These formulations provide a way to increase the accumulation of drugs in target tissues. This class of drug carriers resists opsonization and removal by the mononuclear phagocytic system (MPS or RES), thereby providing longer circulation times in the circulation and enhanced tissue exposure to the encapsulated drug (Lasic et al., Chem. Rev., 1995, 95 , 2601-2627; Ishiwata et al., Chem. Pharm. Bull., 1995, 43, 1005-1011). Such liposomes have been shown to selectively accumulate in tumors, preferably by leakage into or entrapment in neovascularized target tissues (Lasic et al., Science, 1995, 267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238, 86-90). Long-circulating liposomes enhance the pharmacokinetic and pharmacodynamic parameters of DNA and RNA, especially when compared to conventional cationic liposomes known to accumulate in MPS tissues (Liu et al., J. Biol. Chem., 1995, 42, 24864-24870; Choi et al., PCT Publication No. WO 96/10391; Ansell et al., PCT Publication No. WO 96/10390; Holland et al., PCT Publication No. WO 96/10392). Long-circulating liposomes are also likely to protect drugs from nuclease degradation to a greater extent than cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.

- 32 040983

In a further embodiment, the methods of the present invention comprise oligomeric compositions formulated for delivery as described in US Pat. lysine and histidine (NK) as described in US Pat. any of the above in combination with a cross-linking agent. In some embodiments, the present invention provides antisense oligomers in compositions containing gluconic acid-modified polyhistidine or gluconylated-polyhistidine/transferrin-polylysine. One of skill in the art will also appreciate that amino acids with properties similar to His and Lys can be substituted in the composition.

In some methods, the oligomers described herein may contain a basic functional group such as amino or alkylamino and thus be capable of forming pharmaceutically acceptable salts with pharmaceutically acceptable acids. In this regard, the term pharmaceutically acceptable salts refers to the relatively non-toxic, inorganic and organic acid addition salts of the compounds of the present invention. Such salts can be prepared in situ in an administration vehicle or during a manufacturing process for formulating a dosage form, or by separately carrying out the reaction of a purified compound of the present invention in its free base form with a suitable organic or inorganic acid to isolate the salt thus obtained during a subsequent purification process. Representative salts include hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate , lactobionate and laurylsulfonate salts, and the like. (See, for example, Berge et al. (1977), Pharmaceutical Salts, J. Pharm. Sci., 66:1-19).

Pharmaceutically acceptable salts of the contemplated oligomers include the conventional non-toxic or quaternary ammonium salts of these compounds, formed from, for example, non-toxic organic or inorganic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like; and salts derived from such organic acids as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethanesulfonic, ethanedisulfonic, oxalic, isothionic, etc.

In some methods, the oligomers of the present invention may contain one or more acidic functionalities and thus be capable of forming pharmaceutically acceptable salts with pharmaceutically acceptable bases. The term pharmaceutically acceptable salts in such cases refers to the relatively non-toxic inorganic and organic base addition salts of the compounds of the present invention. Such salts may likewise be prepared in situ in a vehicle for administration or in a manufacturing process for formulating a dosage form, or by separately bringing about the reaction of a purified compound in free acid form with a suitable base such as a hydroxide, carbonate or bicarbonate of a pharmaceutically acceptable metal cation, ammonia or a pharmaceutically acceptable acceptable organic primary, secondary or tertiary amine. Representative alkali or alkaline earth metal salts include lithium, sodium, potassium, calcium, magnesium and aluminum salts, and the like. Representative organic amines suitable for base addition salt formation include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, and the like. (see, for example, Berge et al. above).

Wetting agents, emulsifiers, and lubricants such as sodium lauryl sulfate and magnesium stearate, as well as colorants, release agents, coatings, sweeteners, flavoring and flavoring agents, preservatives, and antioxidants may also be present in the compositions.

Examples of pharmaceutically acceptable antioxidants include (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like;

(2) oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

Formulations useful in the methods of the invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration. The formulations may conveniently be provided in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. The amount of active ingredient

- 33 040983 which can be combined with a carrier substance to obtain a single dosage form will vary depending on the owner undergoing treatment, the specific route of administration. The amount of active ingredient that can be combined with a carrier material to form a single dosage form will generally be the amount of the compound that produces the therapeutic effect. In general, from 100%, this amount will vary from about 0.1% to about 99% active ingredient, preferably from about 5% to about 70%, most preferably from about 10% to about 30%.

In some embodiments, the composition used in the methods of the present invention contains an excipient selected from cyclodextrins, celluloses, liposomes, micelle forming agents, such as bile acids, and polymeric carriers, such as polyesters and polyanhydrides; and an oligomer according to the present invention. In some embodiments, the implementation of the above composition has oral bioavailability of the oligomer according to the present invention.

Methods for preparing these formulations or compositions include the step of bringing into association the oligomer of the present invention with the carrier and optionally one or more accessory ingredients. Typically, formulations are prepared by uniformly and thoroughly combining a compound of the present invention with liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product.

Formulations suitable for oral administration useful in this invention may be in the form of capsules, sachets, pills, tablets, lozenges (using a flavoring base, usually sucrose and gum arabic or tragacanth), powders, granules, or in the form of a solution or suspension. in an aqueous or non-aqueous liquid, or in the form of an oil-in-water or water-in-oil liquid emulsion, or in the form of an elixir or syrup, or in the form of lozenges (using an inert matrix such as gelatin and glycerin, or sucrose and acacia) and /or in the form of mouthwashes and the like, each of which contains as an active ingredient a predetermined amount of the compound according to the present invention. The oligomer of the present invention can also be administered as a bolus, electuary or paste.

In solid dosage forms used in the invention for oral administration (capsules, tablets, pills, dragees, powders, granules, lozenges, etc.), the active ingredient can be mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following:

(1) fillers or diluents such as starches, lactose, sucrose, glucose, mannitol and silicic acid;

(2) binders, for example, such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and/or gum arabic;

(3) a wetting agent such as glycerin;

(4) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate;

(5) retarding dissolution agents such as paraffin;

(6) absorption accelerators such as quaternary ammonium compounds and surfactants such as poloxamer and sodium lauryl sulfate;

(7) wetting agents such as, for example, cetyl alcohol, glycerol monostearate, and non-ionic surfactants;

(8) absorbents such as kaolin and bentonite clay;

(9) lubricants such as talc, sodium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof;

(10) dyes; and (11) controlled release agents such as crospovidone or ethylcellulose.

In the case of capsules, tablets and pills, the pharmaceutical compositions may also additionally contain buffering agents. Solid compositions of this type can also be used as fillers in soft and hard gelatin capsules using excipients such as lactose or milk sugars, as well as high molecular weight polyethylene glycols, and the like.

The tablet can be made by compression or molding, optionally with one or more additional ingredients. Compressed tablets can be prepared using a binder (eg, gelatin or hydroxypropyl methylcellulose), a lubricant, an inert diluent, a preservative, a disintegrant (eg, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), a surfactant, or a dispersing agent. Molded tablets can be prepared by molding in a suitable machine a mixture of a powdered compound moistened with an inert liquid diluent.

Tablets and other solid dosage forms of the pharmaceutical composition used in accordance with the present invention, such as dragees, capsules, pills and granules, optionally

- 34 040983 can have a break line or be prepared with coatings and shells, such as enteric coatings and other coatings well known in the field of pharmaceutical formulations. They can also be formulated to provide a slow or controlled release of the active ingredient using, for example, hydroxypropyl methylcellulose in varying proportions to provide the desired release profile, other polymeric matrices, liposomes and/or microspheres. They can also be formulated to provide fast release, such as lyophilized formulations. They may be sterilized, for example by filtration through a bacteria-retaining filter or by the administration of sterilizing agents, in the form of sterile solid compositions which can be dissolved in sterile water or some other sterile injectable medium immediately prior to use. These compositions may also optionally contain opacifiers and may be of the type of composition in which the active ingredient(s) are released only, or preferably in a certain part of the gastrointestinal tract, optionally with a delay. Examples of encapsulated compositions that can be used include polymeric substances and waxes. The active ingredient may also be in microencapsulated form, if appropriate, with one or more of the excipients described above.

Liquid dosage forms for oral administration of the composition according to the present invention contain pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents, and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (particularly cottonseed, peanut, corn, wheat germ, olive, castor and sesame oils), glycerin, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

In addition to inert diluents, oral compositions may additionally contain adjuvants such as humectants, emulsifiers and suspending agents, sweeteners, flavors, colors, flavors and preservatives.

Suspensions may contain, in addition to the active compound(s), suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, meta-aluminum hydroxide, bentonite, agar-agar and tragacanth, as well as mixtures thereof.

Compositions for rectal or vaginal administration can be prepared in the form of a suppository, which can be prepared by mixing one or more compounds of the invention with one or more suitable non-irritating excipients or carriers, including, for example, cocoa butter, polyethylene glycol, suppository wax, or salicylate, which is solid at room temperature but liquid at body temperature and thus melts in the rectum or vaginal cavity to release the active compound.

Formulations or unit dosage forms for topical or transdermal administration of the oligomer provided herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. The active oligomers may be mixed under sterile conditions with a pharmaceutically acceptable carrier and any preservatives, buffers or propellants that may be required. Ointments, pastes, creams and gels may contain, in addition to the active compound of this invention, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide or mixtures thereof.

Powders and sprays may contain, in addition to the compound of the present invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays may additionally contain conventional propellants such as chlorofluorocarbons and volatile unsubstituted hydrocarbons such as butane and propane.

Transdermal patches have the added benefit of providing controlled delivery of the oligomer of the present invention to the body. Such dosage forms can be prepared by dissolving or dispersing the oligomer in an appropriate medium. Additionally, absorption enhancers can be used to increase the penetration of the agent through the skin. Among other methods known in the art, the rate of such delivery can be controlled either by a rate controlling membrane or by dispersing the agent in a polymer matrix or gel.

Pharmaceutical compositions suitable for parenteral administration may contain one or more oligomers in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions or sterile powders, which can be reconstituted in sterile solutions before use.

- 35 040983 or injectable dispersions which may contain sugars, antioxidants, buffers, bacteriostatic agents, solutes which make the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Examples of suitable aqueous and non-aqueous carriers that can be used in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like) and acceptable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants.

These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms on the considered oligomers can be ensured by the introduction of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be necessary to include isotonic agents such as sugars, sodium chloride, and the like in the compositions. In addition, prolonged absorption of the injectable pharmaceutical form can be provided by the inclusion of agents that delay absorption, such as aluminum monostearate and gelatin.

In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. Among other methods known in the art, this can be done by using a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of drug absorption is further dependent on its rate of dissolution, which in turn may depend on crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered dosage form can be achieved by dissolving or suspending the drug in an oil vehicle.

Injectable depot forms can be obtained by creating microencapsulated matrices of the considered oligomers in biodegradable polymers such as polylactide-polyglycide. Depending on the ratio of oligomer to polymer, as well as the nature of the particular polymer used, the release rate of the oligomer can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations can also be prepared by incorporating the drug into liposomes or microemulsions that are compatible with body tissues.

When the oligomers of the present invention are administered as pharmaceuticals to humans and animals, they can be used per se or as a pharmaceutical composition containing, for example, 0.1 to 99% (more preferably 10 to 30%) of the active ingredient in combination with pharmaceutically acceptable carrier.

As described above, the compositions or formulations used in the present invention may be administered orally, parenterally, topically, or rectally. As a rule, they are used in forms suitable for each of the routes of administration. For example, they are administered in the form of tablets or capsules, injection, inhalation, eye lotion, ointment, suppository, etc. by injection, infusion or inhalation; topically in the form of a lotion or ointment; and rectally in the form of suppositories.

For the purposes of the invention, the phrases parenteral administration and parenterally administered means methods of administration other than enteral and topical administration, usually by injection, and include, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraocular, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular , intra-articular, subcapsular, subarachnoid, intra-spinal and intra-articular injection and infusion.

The phrases systemic administration, systemically administered, peripheral administration and peripheral administration within the meaning of the invention refer to the administration of a compound, drug or other material by a method other than direct administration to the central nervous system in such a way that they enter the patient's body system and are therefore metabolized and other similar processes, for example, when administered subcutaneously.

Regardless of the route of administration chosen, the oligomers used in the present invention, which can be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention can be formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention can be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition and mode of administration without causing unacceptable toxicity to the patient.

The selected dosage level will depend on a variety of factors, including the activity of the particular oligomer of the present invention employed or its ester, salt, or

- 36 040983 amide, route of administration, time of administration, rate of excretion or metabolism of the specific oligomer used, rate and duration of absorption, duration of treatment, other drugs, compounds and/or substances used in combination with the specific oligomer used, age, sex, weight, pathological condition, general health and previous medical history of the patient to be treated, and similar factors well known in the medical field.

A physician or veterinarian skilled in the art can readily determine and prescribe the effective amount of the pharmaceutical composition needed. For example, a physician or veterinarian may begin with dosages of the compounds of the invention used in a pharmaceutical composition at levels below those necessary to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved. In general, a suitable daily dose of a composition of the invention will be the amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose will usually depend on the factors described above. In general, for a patient, oral, intravenous, intracerebroventricular and subcutaneous doses of the compounds of this invention, when used for these treatments, will be in the range of from about 0.0001 to about 100 mg per kilogram of body weight per day.

If desired, the effective daily dose of the active compound may be administered as two, three, four, five, six or more divided doses administered separately at appropriate intervals throughout the day, optionally in unit dosage forms. In certain situations, the dosage is represented by one administration per day. In some embodiments, the dosage is represented by one or more administrations, as needed, every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months for target condition .

Antisense molecules can be introduced into cells by a variety of methods known to those of skill in the art, including, but not limited to, liposome encapsulation, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, such as described in the present description and known in the art. In some embodiments, microemulsification technology can be used to improve the bioavailability of lipophilic (water-insoluble) pharmaceutical agents. Examples include trimetrin (Dordunoo, S.K. et al., Drug Development and Industrial Pharmacy, 17(12), 1685-1713, 1991 and REV 5901 (Sheen, P.C et al., J. Pharm Sci, 80(7), 712- 714, 1991) Among other advantages, microemulsification provides bioavailability by preferentially directing absorption to the lymphatic system instead of the circulatory system, thereby bypassing the liver and preventing degradation of compounds in the hepatobiliary circulation.

In one aspect of the invention, the compositions contain micelles formed from the oligomer proposed in the present description, and at least one amphiphilic carrier, in which the micelles have an average diameter of less than about 100 nm. Preferred embodiments provide micelles with an average diameter of less than about 50 nm, and even more preferred embodiments provide micelles with an average diameter of less than about 30 nm, or even less than about 20 nm.

Since all suitable amphiphilic carriers are contemplated, the presently preferred carriers are generally those which have a Generally-Recognized-as-Safe (GRAS) status and which can both solubilize the compound of the present invention and microemulsify it in the subsequent the stage where the solution comes into contact with the complex aqueous phase (such as that found in the human gastrointestinal tract). Typically, amphiphilic ingredients that meet these requirements have HLB (Hydrophilic-Lipophilic Balance) values of 2-20 and their structures contain straight chain aliphatic radicals ranging from C-6 to C-20. Examples are polyethylene glycol fatty glycerides and polyethylene glycols.

Examples of amphiphilic carriers include saturated and monounsaturated polyethylene glycol fatty acid glycerides such as those derived from various fully or partially hydrogenated vegetable oils. Such oils may advantageously consist of tri-, di- and mono-fatty acid glycerides and di- and mono-polyethylene glycol esters of the corresponding fatty acids, with especially preferred fatty acid compositions comprising capric acid 4-10%, capric acid 3-9%, lauric acid 40-50%, myristic acid 14-24%, palmitic acid 4-14% and stearic acid 5-15%. Another useful class of amphiphilic carriers includes partially esterified sorbitan and/or sorbitol with saturated or monounsaturated fatty acids (SPAN series) or the corresponding ethoxylated analogs (TWEEN series).

In particular, commercially available amphiphilic carriers may be used, including the Gelucire series, Labrafil, Labrasol or Lauroglycol (all manufactured and distributed by Gattefosse Corporation, Saint-Priest, France), PEG-mono-oleate, PEG-di-oleate, PEG -mono-laurate and dilaurate, lecithin, poly

- 37 040983 sorbate 80, etc. (manufactured and distributed by a number of companies in the US and worldwide).

In some embodiments, delivery can be accomplished using liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like. for introducing the composition according to the present invention into suitable host cells. In particular, the compositions of the present invention can be formulated for delivery either encapsulated in a lipid particle, liposome, vesicle, nanosphere, nanoparticle, or the like. The preparation and use of such delivery vehicles can be accomplished using known and conventional techniques.

Suitable hydrophilic polymers for use in the present invention are those that are readily water-soluble, can be covalently attached to the vesicle-forming lipid, and are transported in vivo without causing toxicity (ie, biocompatible). Suitable polymers include polyethylene glycol (PEG), polylactic acid (also referred to as polylactide), polyglycolic acid (also referred to as polyglycolide) polymers, polylactic acid-polyglycolic acid copolymer, and polyvinyl alcohol. In some embodiments, the implementation of the polymers have a molecular weight from about 100 or 120 Daltons to about 5000 or 10000 Daltons, or from about 300 Daltons to about 5000 Daltons. In other embodiments, the implementation of the polymer is a polyethylene glycol with a molecular weight of from about 100 to about 5000 Daltons or with a molecular weight of from about 300 to about 5000 Daltons. In some embodiments, the polymer is a 750 Dalton polyethylene glycol (PEG(750)). Polymers can also be determined by the amount of monomers they contain; in a preferred embodiment of the present invention polymers of at least about three monomers are used, such PEG polymers are composed of three monomers (approximately 150 Daltons).

Other hydrophilic polymers that may be suitable for use in the present invention include polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyhydroxypropyl methacrylamide, polymethacrylamide, polydimethylacrylamide, and cellulose derivatives such as hydroxymethylcellulose or hydroxyethylcellulose.

In some embodiments, the composition used in the present invention contains a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of esters of acrylic and methacrylic acids, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and their copolymers, celluloses, polypropylene, polyethylenes , polystyrene, polymers of lactic acid and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acids, polycyanoacrylates and their combinations, mixtures or copolymers.

Cyclodextrins are cyclic oligosaccharides consisting of 6, 7, 8 glucose units, denoted by the Greek letters α, β or γ, respectively. Glucose units are linked by a-1,4-glucosidic bonds. Due to the chair conformation of the carbohydrate units, all secondary hydroxyl groups (at C-2, C-3) are located on one side of the ring, while the primary hydroxyl groups at C-6 are located on the other side. As a result, the outer surfaces are hydrophilic, making the cyclodextrins water soluble. In contrast, the cavities of cyclodextrins are hydrophobic because they are lined with C-3 and C-5 hydrogens and ether-like oxygen atoms. These matrices provide complexation with a variety of relatively hydrophobic compounds, including, for example, steroidal compounds such as 17a-estradiol (see, for example, van Uden et al., Plant Cell Tiss. Org. Cult., 38:1-3-113 (1994)). Complex formation occurs due to van der Waals interactions and due to the formation of hydrogen bonds. For a general overview of the chemistry of cyclodextrins, see Wenz, Agnew. Chem. Int. Ed. Engl., 33:803-822 (1994).

The physicochemical properties of cyclodextrin derivatives are highly dependent on the nature and degree of substitution. For example, their solubility in water ranges from insoluble (for example, triacetyl-beta-cyclodextrin) to 147% (w/v) soluble (G-2 -beta-cyclodextrin). In addition to this, they are soluble in most organic solvents. The properties of cyclodextrins make it possible to control the solubility of the various components of the formulations by increasing or decreasing their solubility.

A variety of cyclodextrins and methods for their preparation have been described. For example, Parmeter (I) et al. (US patent No. 3453259) and Gramera, et al. (US patent No. 3459731) described electrically neutral cyclodextrins. Other derivatives include cyclodextrins with cationic properties [Parmeter (II), US patent No. 3453257], insoluble cross-linked cyclodextrins (Solms, US patent No. 3420788) and cyclodextrins with anionic properties [Parmeter (III), US patent No. 3426011]. Among the derivatives of cyclodextrins with anionic properties, carboxylic acids, phosphorous acids, phosphinic acids, phosphonic acids, phosphoric acids, thiophosphoric acids, thiosulfinic acids and sulfonic acids have been added to the original cyclodextrin [see. Parameter (III), supra]. In addition, derivatives of sulfoalkyl ethers cyclodext have been described.

- 38 040983 Rina Stella, et al. (US patent No. 5134127).

Liposomes are composed of at least one lipid bilayer membrane containing an aqueous internal compartment. Liposomes can be characterized by membrane type and size. Small unilamellar vesicles (SUVs) contain a single membrane and typically have a diameter between 0.02 and 0.05 µm; larger unilamellar vesicles (LUV) are usually larger than 0.05 µm. Oligolamellar large vesicles and multilamellar vesicles contain many usually concentric, membranous layers and are typically larger than 0.1 µm. Liposomes with multiple non-concentric membranes, i.e. Several smaller vesicles contained within a larger vesicle are called multivesicular vesicles.

In one aspect of the methods of the invention, formulations are used comprising liposomes comprising an oligomer of the present invention, wherein the liposomal membrane is formulated to provide the liposome with increased carrying capacity. Alternatively or additionally, the compound of the present invention may be contained within or adsorbed to the liposome bilayer of the liposome. The oligomer of the present invention can aggregate with the lipid surfactant and be transported into the interior of the liposome; in these cases, the liposome membrane is formulated to withstand the damaging effects of the active agent and surfactant aggregate.

According to one embodiment of the methods of the invention, the lipid bilayer of the liposome contains lipids derivatized with polyethylene glycol (PEG) such that the PEG chains extend from the inner surface of the lipid bilayer to the outer space encapsulated by the liposome and extend from the outer region of the lipid bilayer to the environment.

The active substances contained within the liposomes of the presented methods are in a solubilized form. Aggregates of surfactant and active agent (such as emulsions or micelles containing the active agent of interest) can be trapped in the interior of liposomes in accordance with the present invention. The action of the surfactant is to disperse and solubilize the active agent and may be selected from any suitable aliphatic, cycloaliphatic, or aromatic surfactant, including, but not limited to, biocompatible lysophosphatidylcholines (LPCs) of varying chain lengths (e.g., from about C14 to about C20). Polymer-derivatized lipids such as PEG lipids can also be used to form micelles, as they will act to inhibit micelle/membrane fusion and the addition of the polymer to the surfactant molecules will lower the critical micelle concentration (CMC) of the surfactant. which promotes the formation of micelles. Preferred are surfactants with CMC in the micromolar range; surfactants with higher CMC can be used to obtain micelles enclosed in liposomes according to the present invention.

Liposomes used in accordance with the methods of the invention can be obtained by any of a variety of techniques known in the art. See, for example, US patent No. 4235871; published application according to the PCT No. WO 96/14057; New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990), pages 33-104; Lasic DD, Liposomes from physics to applications, Elsevier Science Publishers BV, Amsterdam, 1993. For example, liposomes of the present invention can be prepared by diffusing a hydrophilic polymer-derivatized lipid into preformed liposomes, for example by exposing preformed liposomes to micelles composed of lipid graft polymers. , with lipid concentrations corresponding to the final molar percentage of derivatized lipid that is required in the liposome. Liposomes containing a hydrophilic polymer can also be formed by homogenization, lipid layer hydration, or extrusion techniques, as is known in the art.

In another exemplary formulation procedure, the active ingredient is first dispersed by sonication in lysophosphatidylcholine or other low CMC surfactant (including polymer-grafted lipids) that readily solubilizes hydrophobic molecules. The resulting micellar active ingredient suspension is then used to rehydrate a dry lipid sample which contains the appropriate mole percentage of polymer-grafted lipid or cholesterol. The suspension of lipid and active ingredient is then injected into liposomes using extrusion techniques as known in the art, and the resulting liposomes are separated from the unencapsulated solution by standard column separation.

In one aspect of the methods of the invention, liposomes are prepared so as to obtain substantially homogeneous sizes within a selected size range. One effective way to obtain the desired dimensions includes extruding an aqueous suspension of liposomes through a series of polycarbonate membranes with a selected uniform pore size; the pore size of the membrane will approximately correspond to the largest sizes of liposomes obtained by extrusion through such a membrane. See, for example, US Pat. No. 4,737,323 (April 12, 1988). In some embodiments, reagents such as DharmaFECT® and Lipofectamine® can be used to introduce polynucleotides or proteins into cells.

- 39 040983

The release characteristics of the formulation used in the methods of the invention depend on the encapsulated substance, the concentration of the encapsulated drug, and the presence of release modifiers. For example, release can be made pH dependent, for example by using a pH sensitive coating that only releases at low pH as in the stomach or high pH as in the intestine. An enteric coating may be used to prevent release prior to passage through the stomach. Multiple coatings or mixtures of cyanamide encapsulated in various materials can be used to obtain an initial release in the stomach followed by a late release in the intestine. Release can also be controlled by the inclusion of salts or blowing agents that can increase water uptake or drug release by diffusion from the capsule. Excipients that modify the solubility of the drug can also be used to control the release rate. You can also include agents that enhance the destruction of the matrix or release from the matrix. Depending on the compound, they may be added to the drug, added as a separate phase (ie, in particulate form), or may be co-dissolved in the polymer phase. In most cases, the amount should be between 0.1 and thirty percent (w/w polymer). Types of degradation enhancers include inorganic salts such as ammonium sulfate and ammonium chloride, organic acids such as citric acid, benzoic acid and ascorbic acid, inorganic bases such as sodium carbonate, potassium carbonate, calcium carbonate, zinc carbonate and zinc hydroxide, and organic bases such as protamine sulfate, spermine, choline, ethanolamine, diethanolamine and triethanolamine; and surfactants such as Tween® and Pluronic®. In particulate form, pore-forming agents are added that add microstructure to the matrices (ie, water-soluble compounds such as inorganic salts and sugars). The additive range is typically between one and thirty percent (w/w polymer).

Absorption can also be controlled by changing the retention time of the particles in the gastrointestinal tract. This can be achieved, for example, by coating the particle or by choosing a mucosally adhesive polymer as the encapsulating material. Examples include most polymers with free carboxyl groups such as chitosan, celluloses and especially polyacrylates (as used herein, polyacrylates refers to polymers containing acrylate groups and modified acrylate groups such as cyanoacrylates and methacrylates).

The oligomer can be formulated into a formulation contained within, or taken to be released by, a surgical or medical device or implant. In certain aspects, the implant may be coated or otherwise treated with an oligomer. For example, hydrogels or other polymers, such as biocompatible and/or biodegradable polymers, can be used to coat an implant with compositions of the present invention (ie, the composition can be adapted for use with a medical device by using a hydrogel or other polymer). Polymers and copolymers for coating medical devices with an agent are well known in the art. For example, implants include, but are not limited to, stents, drug-eluting stents, sutures, prostheses, vascular catheters, dialysis catheters, vascular grafts, prosthetic heart valves, pacemakers, implantable cardioverter defibrillators, IV needles, connection devices and bone formations such as pins, screws, plates and other devices, and matrices with artificial tissues for wound healing.

In addition to the methods provided herein, the oligomers used in accordance with the invention may be formulated for administration by any convenient route for medical or veterinary use in analogy to other pharmaceuticals. Antisense oligomers and their respective formulations can be administered alone or in combination with other therapeutic approaches in the treatment of inflammation.

According to the methods of the invention, delivery routes for the antisense oligomer include, but are not limited to, various systemic routes of administration, including oral and parenteral routes, such as intravenous, subcutaneous, intraperitoneal, and intramuscular, as well as inhalation, transdermal, pulmonary, and topical delivery. The appropriate route can be determined by one skilled in the art as appropriate for the condition of the patient being treated. For example, a suitable route for delivery of an antisense oligomer in the treatment of a skin condition may include topical application, while delivery of an antisense oligomer for the treatment of a respiratory condition (eg, COPD) may include inhalation, intranasal, or pulmonary delivery. The oligomer can also be delivered directly to the site of inflammation due to infection or to the bloodstream.

The antisense oligomer can be administered in any convenient carrier that is physiologically acceptable. Such a composition may include any of a variety of standard pharmaceutically acceptable carriers used by those of ordinary skill in the art. Examples include, but are not limited to, saline, phosphate buffered saline (PBS), water, aqueous ethanol, emulsions such as oil/water emulsions or triglyceride emulsions,

- 40 040983 tablets and capsules. The choice of a suitable physiologically acceptable carrier will vary depending on the chosen route of administration.

In some of the cases noted above, liposomes can be used to facilitate uptake of an antisense oligonucleotide into cells (see, for example, Williams, S.A., Leukemia 10(12):19801989, 1996; Lappalainen et al., Antiviral Res., 23:119, 1994; Uhlmann et al., Antisense oligonucleotides: a new therapeutic principle, Chemical Reviews, vol. 90, no. 4, pp. 544-584, 1990; Gregoriadis, G., Chapter 14, Liposomes, Drug Carriers in Biology and Medicine, pp. 287-341, Academic Press, 1979). Hydrogels can also be used as vehicles for introducing an antisense oligomer, for example, as described in PCT Application Publication No. WO 93/01286 or PCT Application No. US 1992/005305. Alternatively, oligonucleotides can be administered in microbeads or microparticles (see, for example, Wu, G.Y. and Wu, C.H., J. Biol. Chem., 262:4429-4432 (1987)). Alternatively, the use of gas-filled microbubbles in combination with antisense oligomers can increase delivery to target tissues, as described in US Pat. No. 6,245,747.

Sustained release compositions may also be used. They may include semi-permeable polymer matrices in the form of molded articles such as films or microcapsules.

In some embodiments, the antisense compounds may be administered in an amount and manner effective to produce a peak blood concentration of at least 200-400 nM of the antisense oligomer. Typically, one or more doses of the antisense oligomer are administered, usually at regular intervals over a period of about one to two weeks. Preferred doses for oral administration are about 1-100 mg of oligomer per 70 kg. In some cases, doses greater than 100 mg oligomer/patient may be necessary. For intravenous administration, preferred doses are from about 1 to 500 mg of oligomer per 70 kg. The antisense oligomer can be administered at regular intervals over a short period of time, such as daily for two weeks or less. However, in some cases, the oligomer is administered intermittently over a longer period of time. The introduction may be sequential or simultaneous with the introduction of an antibiotic or other therapeutic treatment. The treatment regimen can be adjusted (dose, frequency, route, etc.) as indicated based on the results of immunoassays, other biochemical tests, and physiological examination of the patient to be treated.

All publications and patent applications mentioned in the present description are incorporated herein by reference to the same extent as if each individual publication or patent application were specifically and separately indicated for inclusion by reference.

The various embodiments described above may be combined to provide additional embodiments. Interim US Patent Application 62/330027, filed April 29, 2016, is incorporated herein in its entirety by reference. These and other changes may be made to these embodiments in light of the above detailed description. In general, in the following claims, the terms used are not to be construed as limiting the specific embodiments disclosed in the specification and claims, but are to be construed as including all possible embodiments, together with the full scope of equivalents to which such claims fall.

Accordingly, the claims are not limited to the present description.

Although the previous invention has been described in some detail by way of illustration and example for the purposes of clarity of understanding, in light of the ideas of the present description, it will be obvious to those of ordinary skill in the art that certain changes and modifications can be made to this invention without departing from the spirit. or the scope of the appended claims. The following examples are given by way of illustration and not by way of limitation. Those skilled in the art will readily recognize a variety of non-critical parameters that can be changed or modified to produce substantially identical results.

- 41 040983

Sequence listing

Name Sequences SEQID NO:

LMNA exon 11 GGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGAGTA CAACCTGCGCTCGCGCACCGTGCTGTGCGGGACCTGCG GGCAGCCTGCCGACAAGGCATCTGCCAGCGGCTCAGGA GCCCAGGTGGGCGGACCCATCTCCTCTGGCTCTTCTGC CTCCAGTGTCACGGTCACTCGCAGCTACCGCAGTGTGG GGGGCAGTGGGGGTGGCAGCTTCGGGGACAATCTGGTC ACCCGCTCCTACCTCCTGGGCAACTCCAGCCCCCGAAC CCAG 1 HGPS exon 11 GGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGAGTA CAACCTGCGCTCGCGCACCGTGCTGTGCGGGACCTGCG GGCAGCCTGCCGACAAGGCATCTGCCAGCGGCTCAGGA GCCCAGGTGGGTGGACCCATCTCCTCTGGCTCTTCTGC CTCCAGTGTCACGGTCACTCGCAGCTACCGCAGTGTGG GGGGCAGTGGGGGTGGCAGCTTCGGGGACAATCTGGTC ACCCGCTCCTACCTCCTGGGCAACTCCAGCCCCCGAAC CCAG 2 Pr11-1 CTGAGCCGCTGGCAGATGCCTTGTC 3 Pr11-2 GAGGAGATGGGTCCACCCACCTGGG 4 g tat RRRQRRKKR 5 Tat RKKRRQRRR 6 R ₉ F ₂ RRRRRRRRRFF 7 r ₅ f ₂ r ₄ RRRRRFFRRRR 8 _r4 RRRR 9 r ₅ RRRRR 10 _R6 RRRRRR eleven _r7 RRRRRRR 12 _r8 RRRRRRRR 13 _r9 RRRRRRRRR 14 (RX) 8 RXRXRXRXRXRXRXRX 15 (RXR) ₄ RXRRXRRXRRXR 16 (RXR)5 RXRRXRRXRRXRRXR 17 (RXRRBR)2 RXRRBRRXRRBR 18 (RAR) ₄ F ₂ RARRARRRAR F F 19 (RGR) ₄ F ₂ RGRRGRGRGRGRFF 20 (RFF) ₃ R RFFRFFFRFR 21 (RXR) _4XB RXRRXRRXRRXRXB 22 (RFF) ₃ RXB RFFRFFFFRXB 23 (RFF) _3RG RFFFRFFRG 24 R ₆ G RRRRRRG 25

X is 6-aminohexanoic acid;

B is β-alanine;

F is phenylalanine;

G is glycine;

R is arginine;

Q is glutamine;

K is lysine.

Each of SEQ ID NOs: 5-25 may further contain an R ^a group attached to the amino terminus, where R ^a is selected from H, acetyl, benzoyl and stearoyl. In some embodiments, R ^a is acetyl.

Examples

Materials.

1. HGPS mouse model.

The human BAC clone, RP11-702H12 (RPCI-11 Human BAC Library, BCPAC Resource Center at the Oakland Children's Hospital Research Institute, Oakland, CA, USA), contains a 164.4 kb insert. n. genomic DNA from chromosome 1q, including the LMNA gene (25.4 kb) and three others

- 42 040983 known UBQLN4, MAPBPIP and RAB25 genes. Recombinogenic targeting of the BAC clone RP11-702H12 was performed using a shuttle fragment containing the G608G mutation generated by PCR from the genomic DNA of the HGPS fibroblast cell line AG11498 (Coriell Cell Repositories, NIA collection). Transgenic mouse model with human BACG608G for the expression of the HGPS mutant human LMNA protein named progerin in all tissues. Mice show much of the same pathology as HGPS patients. In the heterozygous state, mice showed a loss of vascular smooth muscle cells (VSMC) in the main arteries with a decrease in unresponsive vascular elasticity. Homozygous mice show a more progressive loss of VSMC with adventitial thickening, generalized lipodystrophy, tight, dehydrated skin, thinning hair, kyphosis, joint contracture, and limitation of movement. These mice with two copies of the transgene died prematurely at 6-8 months of age.

2. RRMO.

Compound Targeting sequence (TS) TS SEQ ID NO: 5 3' CRR CPP SEQ ID NO PPMO1 CTGAGCCGCTGGCAGATGCCTTGTC 3 EG3 ^— Gly ^- Rg ^- Ac eleven RRMO 2 GAGGAGATGGGTCCACCCACCTGGG 4 EG3 -Gly-R ₆ -Ac eleven

Gly denotes a glycine linker attached to the nitrogen atom of the ring of the 3'-terminal morpholine subunit by an amide bond at the carboxyl of glycine, and also attached to the carboxyl end of the CPP peptide by an amide bond at the NH2 of glycine. R is arginine and Ac is acetyl.

Example. Analysis of ddpcr of mice with hgps followed by treatment with LMNA-targeting PPMO.

Droplet digital PCR (dsPCR) experiments were performed to measure the expression levels of progerin and wild-type LMNA in HGPS transgenic mice followed by treatment with PPMO1 (SEQ ID NO: 3) and PPMO2 (SEQ ID NO: 4). A total of 37 mice were divided into the following study groups.

Group (number of mice) Test compound Dose per injection (mg/kg) Treatment regimen Route of administration 1 (7) saline solution 0 2x per week V.V. in the tail vein 2(4) PPMO1 60 2x per week V.V. in the tail vein 3 (7) PPMO1 20 2x per week V.V. in the tail vein 4 (4) PPMO1 7 2x per week V.V. in the tail vein 5 (4) RRMO2 60 2x per week V.V. in the tail vein 6 (7) RRMO2 20 2x per week V.V. in the tail vein 7(4) RRMO2 7 2x per week V.V. in the tail vein

Mice were dosed according to the table above starting at four weeks of age and sacrificed 12 weeks later. RNA was extracted from the quadriceps heart and aorta using the standard Trizol procedure (Ambion). From 0.5 μg of total RNA, cDNA was prepared using the standard iScript™ cDNA synthesis procedure (Bio-Rad) and analyzed for splicing inhibition by dsPCR. The experimental results are shown in Fig. 1-4.

-

Claims (8)

Literature. Sao, K., C. D. Blair, et al. (2011). Progerin and telomere dysfunction collaborate to trigger cellular senescence in normal human fibroblasts. J Clin Invest. Egholm, M., 0. Buchardt, et al. (1993). PNA hybridizes to complementary oligonucleotides obeying the Watson-Crick hydrogen-bonding rules. Nature 365(6446): 566-8. Kinali, M., V. Arechavala-Gomeza, et al. (2009). Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a singleblind, placebo-controlled, dose-escalation, proof-of-concept study. Lancet Neurol 8(10): 918-28. Osorio, F. G., C. L. Navarro, et al. (2011). Splicingdirected therapy in a new mouse model of human accelerated aging. Sci Transl Med 3(106): 106ral07. Scaffidi, P. and T. Misteli (2005). Reversal of the cellular phenotype in the premature aging disease Hutchinson Gilford progeria syndrome. Nat Med 11(4): 440-5. Svasti, S., T. Suwanmanee, et al. (2009). RNA repair restores hemoglobin expression in IVS2-654 thalassemic mice. Proc Natl Acad Sci USA 106(4): 1205-10. CLAIM 1. Antisense oligomer compound of formula (III) or a pharmaceutically acceptable salt thereof, wherein each Nu is a nucleotide base and taken together form a targeting sequence (5' to 3') selected from - 44 040983 a) SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) where Z is 23; And b) SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) where Z is 23; and R ^a is acetyl. 2. Antisense oligomer compound according to claim 1 represented by formula (IV) (IV) or a pharmaceutically acceptable salt thereof, wherein each Nu is a nucleotide base and taken together form a targeting sequence (5' to 3'), the targeting sequence being SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC), a Z is 23. - 45 040983 3. Antisense oligomer compound according to claim 1 represented by formula (IV) or a pharmaceutically acceptable salt thereof, wherein each Nu is a nucleotide base and taken together form a targeting sequence (5' to 3'), the targeting sequence being SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG), a Z is 23. - 46 040983 4. An antisense oligomer compound according to claim 1, which is 5. An antisense oligomer compound according to claim 1, which is - 47 040983 and 6. An antisense oligomer compound, or a pharmaceutically acceptable salt thereof, selected from 7. An antisense oligomer compound according to any one of claims 1 to 6, which is a pharmaceutically acceptable salt with 0.6 HCl. 8. A pharmaceutical composition comprising an antisense oligomer compound of any -