EA040572B1 - CHANGES IN GENE EXPRESSION IN CART CELLS AND THEIR APPLICATIONS - Google Patents

Description

Cross-reference to related application

This application claims priority under 35 U.S.C. 119(e) based on US Provisional Application No. 62/073651, filed October 31, 2014, and hereby incorporated by reference in its entirety.

Federally sponsored research or development statement

This invention was made with government support CA120409 from the National Institutes of Health. The government has certain rights to the invention.

State of the art prior to the invention

Adoptive cell transfer (ACT) using modified chimeric antigen receptor (CAR) T cells has been shown to be a promising strategy for the treatment of malignant tumors (Louis et al., 2011, Blood, 118:6050-6056; Kochenderfer et al., 2010 , Blood, 116: 3875-3886 and Porter et al., 2011, N. Engl. J. Med., 365: 725-733).

The safety concerns associated with the insertion of lentiviral or retroviral vectors are a major concern regarding the modification of cells used for ACT. Some advances have been made to eliminate targeted or non-targeted unwanted side effects, such as transfection of T cell RNA with the T cell receptor (TCR) or electroporation of CAR RNA (Zhao, 2006, Mol. Ther., 13:151-159; Mitchell et al. ., Smits et al., 2004, Leukemia, 18:1898-1902). As a result of minimizing RNA and T cell dosing, such methods allow the efficient introduction of many genes into cells. However, the main limitation of transient CAR expression is the suboptimal effector activity and functionality of RNA transfected T cells. Multiple T cell infusions and/or significant use of low dose chemotherapy have been used to improve CAR function (Barrett et al., 2013, Hum. Gene Ther., 24(8): 717-27).

Various attempts have been made to improve the effector activity and functionality of CARs while eliminating the need for combination therapies and additional cravings. The increase in RNA during the transfection process has a negative impact on T cell function, especially in vivo antitumor activities (Barrett et al., 2011, Hum. Gene Ther., 22:1575-1586). Alternative constructs that fuse an anti-CD3 antibody antigen fragment with an anti-tumor antibody antigen fragment have also been tested in cancer treatment clinical trials (Bargou et al., 2008, Science, 321:974-977; Klinger et al., 2012, Blood , 119: 6226-6233). Unfortunately, such constructs were largely limited in functionality due to short half-life, poor accessibility to target cell sites, and lack of proper long-term signaling function.

Clinical studies of TCRs have been hampered by low expression levels of transduced TCRs, as well as α- and β-chain mismatches. Because four TCRs can potentially be expressed on the cell surface when a T cell transcribes chains of two different TCRs (native alpha/beta, exogenous alpha/beta, and native/exogenous mismatched heterodimers), significant barriers to the use of this approach are apparent. In studies conducted to date, in preclinical studies, it has been clearly demonstrated that TCR mismatches can potentially induce dangerous self-antigen recognition.

Although early clinical data on TCR and CAR T cells obtained in the treatment of malignant tumors showed promising results, the risk to the patient is high, and T cells of some patients are not active enough for effective treatment even after TCR or CAR redirection. , initiating the modification of allogeneic donor-derived T cells. However, the endogenous αβ T cell receptor on infused allogeneic T cells can recognize major and minor histocompatibility antigens in the recipient, resulting in graft versus host disease (GVHD). As a result, most of the current clinical trials using autologous CAR T cell infusion rely on immunological tolerance to prevent TCR-mediated detrimental recognition of normal tissues after adoptive cell transfer. This approach has achieved early clinical success but is time and cost limited in the production of personalized T cell products. Thus, there is a need for safer methods for modifying T cells while avoiding the time and cost associated with manufacturing personalized T cell products.

The essence of the invention

As described herein, the present invention relates to compositions and methods for producing a modified T cell with a nucleic acid capable of altering the gene expression of an endogenous gene selected from the group consisting of TCR α-chain, TCR β-chain, beta-2 microglobulin, the molecule HLA, CTLA-4, PD1 and FAS, and additionally containing a nucleic acid encoding a chimeric antigen receptor (CAR).

- 1 040572

One aspect of the invention relates to a modified T cell containing a nucleic acid capable of suppressing the gene expression of an endogenous gene selected from the group consisting of TCR α-chain, TCR β-chain, beta-2-microglobulin, HLA molecule, CTLA-4 , PD1 and FAS; and a nucleic acid encoding a chimeric antigen receptor (CAR) containing an antigen-binding domain, a transmembrane domain, and an intracellular domain of a costimulatory molecule.

In another aspect, the invention relates to a method for producing a modified T cell containing an introduced nucleic acid capable of suppressing the gene expression of an endogenous gene selected from the group consisting of TCR α-chain, TCR β-chain, beta-2-microglobulin, HLA molecule, CTLA-4, PD1 and FAS in T cell; and an introduced nucleic acid encoding a chimeric antigen receptor (CAR) containing an antigen-binding domain, a transmembrane domain.

In yet another aspect, the invention provides a method of treating a disease or condition associated with increased immunity in an individual, comprising administering an effective amount of a pharmaceutical composition containing a modified T cell described herein to an individual in need thereof.

In another aspect, the invention provides a method of treating a condition in an individual, comprising administering to the individual a therapeutically effective amount of a pharmaceutical composition comprising a modified T cell as described herein.

In another aspect, the invention relates to a method of stimulating a T cell-mediated immune response to a target cell or tissue in an individual, comprising administering to the individual an effective amount of a pharmaceutical composition comprising a modified T cell described herein.

In yet another aspect, the invention provides a method of adoptive cell transfer therapy comprising administering an effective amount of a pharmaceutical composition comprising a modified T cell as described herein to an individual in need thereof to prevent or treat an immune response that is unfavorable in the individual.

In another aspect, the invention relates to the use of a modified T cell as described herein in the manufacture of a medicament for the treatment of an immune response in an individual in need thereof.

In another aspect, the invention relates to a composition containing a modified T cell obtained by the method described in the present description.

In another aspect, the invention relates to a pharmaceutical composition containing a modified T-cell obtained by the method described in the present description.

In various embodiments of the above aspects or any other aspect of the invention described herein, a nucleic acid capable of repressing the expression of a gene selected from the group consisting of antisense RNA, antagonistic RNA, siRNA, shRNA, and a CRISPR system such as the pAd5/ F35-CRISPR.

In one embodiment, the CAR antigen binding domain comprises an antibody selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, a single chain variable fragment, and antigen binding fragments thereof. In another embodiment, the CAR antigen-binding domain specifically binds to an antigen on a target cell. In yet another embodiment, the intracellular CAR domain contains dual signaling domains.

In another embodiment, the modified T cell described herein further comprises an exogenous nucleic acid encoding a costimulatory molecule such as CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1, and PD1L. In one embodiment, a method for producing a modified T cell as described herein further comprises electroporation of an RNA encoding a co-stimulatory molecule into a T cell. In certain embodiments, where the co-stimulatory molecule is CD3, CD3 contains at least two different CD3 chains, such as CD3 zeta chain and CD3 epsilon chain.

In another embodiment, the T cell is derived from the group consisting of peripheral blood mononuclear cells, cord blood cells, a purified T cell population, and a T cell line.

In yet another embodiment, the method for producing a modified T cell as described herein further comprises expanding the T cell. In one embodiment, expansion of the T cell comprises culturing the T cell with a factor selected from the group consisting of flt3-L, IL-1, IL-3, and c-kit ligand.

In yet another embodiment, the method for producing a modified T cell as described herein further comprises cryopreserving the T cell. In another embodiment, the method described herein further comprises thawing the cryopreserved T cell prior to introducing the nucleic acid into the T cell.

- 2 040572

In one embodiment, administration of the nucleic acid is selected from the group consisting of expanded T cell transduction, expanded T cell transfection, and expanded T cell electroporation.

In yet another embodiment, the method described herein further comprises expanding Klf4, Oct3/4, and Sox2 in T cells to induce T cell pluripotency.

In various embodiments of the above aspects, or any other aspect of the invention as defined herein, the invention relates to administering a modified T cell to an individual. In one embodiment, the subject is suffering from a condition such as an autoimmune disease. In certain embodiments, the autoimmune disease is selected from the group consisting of acquired immune deficiency syndrome (AIDS), alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behçet's disease, cardiomyopathy, celiac disease herpetiformis-dermatitis; chronic fatigue and immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy (CIPD), scarring pemphigoid, cold agglutinin disease, CREST syndrome, Crohn's disease, Degos disease, juvenile dermatomyositis, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, disease Graves, Guillain-Barré syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, insulin-dependent diabetes mellitus, juvenile chronic arthritis (Still's disease), juvenile rheumatoid arthritis, Meniere's disease, mixed connective tissue disease, multiple sclerosis , myasthenia gravis, pernicious anemia, periarteritis nodosa, polychondria, polyglandular syndromes, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's syndrome, syn Reiter's drome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma (progressive systemic sclerosis (PSS), also known as systemic sclerosis (SS)), Sjögren's syndrome, stiff man syndrome, systemic lupus erythematosus, Takayasu's arteritis, temporal arteritis/giant cell arteritis, ulcerative colitis, uveitis, vitiligo, Wegener's granulomatosis, and any combination thereof.

In another embodiment, the condition is a cancer, such as a cancer selected from the group consisting of breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, and any combination thereof.

In another embodiment, the method described herein further comprises inducing lysis, such as antibody-dependent cellular cytotoxicity (ADCC), target cells or tissues.

Brief description of the drawings

The following detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, the drawings show embodiments which are currently preferred. However, it should be understood that the invention is not limited to the precise arrangements and means of the embodiments shown in the drawings.

Fig. 1 containing FIG. 1A-1C is an illustration of the CRISPR construct and targeting of the αβ CD3 TCR complex in 293T cells. In FIG. 1A shows CRISPR gRNA target regions at the TCR-α and -β genomic constant region locus. Each exon is shown as a block. Black blocks represent coding regions. Gray columns represent non-coding regions. Thirteen gRNAs were designed to target exon 1 of the TCRa (TRAC) constant region, 10 gRNAs targeted a conserved sequence in exon 1 of constant regions 1 (TRBC1) and 2 (TRBC2)TCRe, and 10 gRNAs targeted exon 1 of the microglobulin beta gene -2. In FIG. 1B shows a characteristic gRNA backbone sequence. The gRNA PCR products were obtained by overlap PCR and cloned into the MSGV vector with the T7 promoter. In FIG. 1C shows Sanger sequencing results showing that many peaks are present in TRAC and TRBC TCR 293T genomic PCR products after transfection of CAS9 mRNA and gRNA into cells.

In FIG. 2 containing FIG. 2A-2E demonstrate disruption of the αβ CD3 TCR complex in primary T cells. Fig. 2A is a table showing the parameters used to electroporate CAS9 mRNA and gRNA into BTX830 primary T cells. 360 At 1 ms with 2 mm cuvettes, the best mean fluorescence intensity (MFI) and electroporation efficiency on day 3 were driven to stimulate primary T cells. Fig. 2B is a panel of graphs demonstrating that T cells incubated at 32°C 5% CO ₂ are characterized by significantly

- 3 040572 greater MFI than normal conditions 37°C 5% CO2. Fig. 2C is a schematic illustration of a CRISPR system transfected into primary T cells. CAS9 mRNA and gRNA were electroporated into T cells three days after primary T cell stimulation with beads. T cells were then cultured with 100 IU/ml IL-2 and some cells were incubated at 32° C. 5% CO ₂ for 1 day and then for another 7 to 9 days. CD3 expression was analyzed by flow cytometry on days 7-9 after electroporation. Fig. 2D is a panel of graphs showing that the target efficiency at 37°C was approximately 2.5 times higher than at 32°C. Fig. 2E is a panel of graphs showing the reduction in CD3 expression on day 6 after electrotransfer of varying amounts and ratios of CAS9 and TCRe-targeted gRNA. CD3 expression was analyzed by staining for CD3. Representative data on fluxes on day 6 after electroporation are given. The quadrant represents the percentage of CD3-negative cells in T cell populations.

In FIG. 3 containing FIG. 3A-3D demonstrate that TCR ^neg alpha or beta knockout in T cells can be enriched by depletion of TCR ^pos T cells. Fig. 3A is a panel of graphs showing CD3 expression before and after depletion of TCR ^neg alpha or beta knockout microbeads in T cells. Flow cytometry demonstrates CD3 expression. The numbers in the lower right quadrant represent the percentage of CD3-negative cells in the T cell populations. Fig. 3B is a panel of sequencing plots demonstrating that many peaks were observed in CD3 ^neg T cell enriched genomic PCR products. Fig. 3C is a panel of graphs showing spectrum analysis of CD4 and CD8 T cells after enrichment with CD3 microbeads in CRISPR-modified alpha-chain single-knockout, beta-chain double-knockout T cells. The data demonstrate that the ratio of the CD8 T cell population increased as a result of the CRISPR modification, which confirms that the CD8 T cell can be modified more easily than the CD4 T cell. In FIG. 3D shows the results of deletions and insertions introduced into the TCR alpha and beta locus after CRISPR modification.

In FIG. 4 containing FIG. 4A-4C demonstrate that multiple gRNA electrotransfers significantly improve the targeting performance of the CRISPR system in primary T cells. Fig. 4A is a panel of graphs demonstrating that multiple gRNA electroporations significantly improved target efficiency. Electroporation of T cells up to three times within 24 h resulted in the highest target efficiency, approximately 80%. In the initial experiment, only 15% of the target TCR efficacy was obtained in T cells. After electrotransfer of CAS9 mRNA into T cells, sustained expression of CAS9 was observed. A likely reason for the low efficiency of cleavage may be due to the rapid destruction of gRNA. Received higher CD3-negative populations. Fig. 4B is a panel of graphs dismantling that capping impairs gRNA function, while early gRNA administration in the second round resulted in higher efficiency. Fig. 4C is a panel of graphs demonstrating that multiple electrotransfers of gRNA directed to TRAC and TRBC in ND221 result in a cleavage ratio of approximately 64.5% and 57.5%, respectively.

In FIG. 5 containing FIG. 5A and 5B demonstrate that TCR ^neg T cells can be propagated under various stimulatory conditions. Fig. 5A is a panel of graphs demonstrating that TCR ^neg T cells regain CD3 expression after reintroduction of TCR alpha and beta chains into TCR ^neg T cells. CD3 and Vb13.1 were detected after electroporation of TCR alpha and beta chains in TCR ^neg T cells. The expression level of CD3 was comparable to that of TCR ^pos T cells. Fig. 5B is a panel of graphs showing the multiplicity after various conditions used to stimulate TCR ^neg T cells. REP PBMC resulted in an approximately 500-fold increase in reproduction, while CD3/CD28 beads or aAPC K562 restimulation resulted in an approximately 25-58-fold increase in reproduction.

In FIG. 6 containing FIG. 6A and 6B show the characteristics of TCR ^neg T cells after expression under various conditions. Fig. 6A is a panel of graphs showing the phenotype characteristics of TCR ^neg T cells after expression under various conditions. Fig. 6B is a panel of graphs showing the phenotype characteristics of TCR ^neg T cells after expression under various conditions.

In FIG. 7 containing FIG. 7A-7C show expanded TCR ^neg T cells with high antitumor activity after in vitro redirection. Fig. 7A is a panel of graphs demonstrating that TCR ^neg T cells can be redirected by introducing anti-NYESO 1G4 TCR into cells. Compared to the CAS9 mimic group, when redirected by TCR1G4, TCR ^neg T cells showed higher levels of Vb13.1 expression due to less mismatch between exogenous and endogenous TCR alpha and beta chains. Fig. 7B is a panel of graphs demonstrating that TCR1G4 redirected TCR ^neg T cells had high degranulation activity when co-cultured with a tumor (Nalm6-ES0) cell line. Fig. 7C is a graph demonstrating that TCR ^neg T cells redirected

- 4 040572

TCR 1G4 had high cytotoxicity against tumor cell lines.

Fig. 8 is a panel of illustrations demonstrating that targeted TCR ^{neg T} cells suppress tumor growth in NSG mice after redirection.

In FIG. 9 containing FIG. 9A-9D demonstrated that HLA-CLASS I elimination was obtained as a result of degradation of beta-2 microglobin. In FIG. 9A shows sequencing data for CRISPR capable of disrupting the beta-2 microglobin locus in HEK293 cells. Fig. 9B is a panel of graphs showing that a bHLA-CLASS I negative T cell population was generated by degradation of beta-2 microglobin. Fig. 9C is a panel of graphs demonstrating that cIFNg improved the target efficacy of beta-2 microglobin in primary T cells. Fig. 9D is a panel of graphs showing that HLA-CLASS I ^neg T cells were enriched as a result of microbead depletion.

Fig. 10 is a panel of graphs demonstrating the simultaneous knockout of HLACLASS I and TCR in primary T cells. CD4 and CD8 T cells were stimulated with Dynabeads CD3/CD28 beads. Three days after stimulation, expanded T cells were electroporated with CAS9 mRNA together with the TCR constant region (TRBC) and beta-2 microglobin, which targeted gRNA. TCR expression and beta-2 microglobin expression were assessed using an anti-CD3 monoclonal antibody (mAb) and an anti-beta-2 microglobin mAb six days after electroporation. The numbers represent the percentage of the population in each quadrant.

In FIG. 11 containing FIG. 11A-11D show triple knockout of HLA-CLASS I and TCR alpha and beta chains in primary T cells. Fig. 11A is a panel of graphs showing that CD4 and CD8 T cells were stimulated with Dynabeads CD3/CD28 beads. Three days after stimulation, expanded T cells were electroporated with CAS9 mRNA together with the constant region of the TCR alpha, beta chain (TRAC, TRBC) and beta-2 microglobin, which directed the gRNA. TCR expression and HLA-CLASS I expression were assessed using an anti-CD3 monoclonal antibody (mAb) and an anti-beta-2 microglobin mAb six days after electroporation. The numbers represent the percentage of the population in each quadrant. Figure 11B is a diagram illustrating the isolation of triple knockout T cells for HLA-CLASS I and TCR alpha and beta chains. Figure 11C is a panel of graphs showing electroporation efficiency tested by GFP expression. Figure 11D is a panel of graphs showing the re-introduction of TCR alpha and beta chains into TCR ^neg T cells as measured by flow cytometry. In total TCR ^neg T cells, approximately 64% alpha negative and approximately 14% beta negative populations were observed.

In FIG. 12 containing FIG. 12A-12D show FAS knockout in 293T cells. Figure 12A is an image showing multiple peak Sanger sequencing results when FAS is knocked out in 293T cells. Figure 12B is a panel of graphs showing FACS data showing that CRISPR disrupted surface FAS protein expression. Figure 12C is a panel of images showing that the FAS protein was replaced by GFP after CRISPR homologous recombination. Figure 12D is a panel plot of FACS data showing percent homologous recombination with CRISPR.

In FIG. 13 shows FAS knockout in primary T cells. The FACS data illustrate that CRISPR abolishes surface FAS protein expression.

In FIG. 14 containing FIG. 14A and 14B demonstrate PD1 knockout in 293T cells and primary T cells. Figure 14A is an image showing the results of multiple peak Sanger sequencing when PD1 is targeted in 293T cells. Figure 14B is a panel of graphs showing FACS data expression on the surface of the CRISPR-disrupted PD1 protein.

In FIG. 15 containing FIG. 15A and 15B show CTLA4 knockout in 293T cells and primary cells such as CCD1079-SK. Figure 15A is an image showing the results of multiple peak Sanger sequencing when CTLA4 was targeted in 293T cells. Figure 15B is an image showing sequence data after limiting dilution and single cell expansion. Sanger sequencing results indicate deletions and insertions at the CTLA4 genomic locus.

In FIG. 16 shows the PPP2r2d knockout at 293T. Sanger sequencing data indicated that PPP2r2d was targeted by CRISPR in 293T cells.

In FIG. 17 containing FIG. 17A and 17B demonstrate the production of iPSCs from FAS knockout T cells. Fig. 17A is a panel of images showing the morphological change during the reprogramming process of FAS ^neg T cells into iPSCs. Formation of a characteristic morphology of embryonic stem cells, indicating that FAS ^neg T cells can be induced into a pluripotent state. Fig. 17B is a graph demonstrating that FAS ^neg T cells were reprogrammed into iPSCs at approximately 5-fold efficiency compared to wild-type counterparts. It has been reported that p53-deficient cell lines are easier to reprogram due to obstruction of the apoptosis pathway. FAS knockout may facilitate the reprogramming process through a similar mechanism.

In FIG. 18 containing FIG. 18A and 18B demonstrate the generation of iPSCs from CD3 ^neg T cells. Figure 18A is a panel of images demonstrating the ES-like morphology generated by CD3 ^neg TCR alpha or beta chain knockout T cells under certain reprogramming conditions. The morphology remains constant after several passages. Fig. 18B is a series of graphs demonstrating that CD3 ^neg T cell reprogramming was approximately 5 times more efficient than wild-type analogs, suggesting that TCR knockout may play a role in T cell reprogramming or affect cell viability. after infection with the Sendai virus.

Fig. 19 is a graph showing endogenous T cell receptor (TCR) siRNA knockdown and the addition of a second disulfide bond and the removal of N-glycosylation to the beta chain.

In FIG. 20 containing FIG. 20A and 20B show TCR knockout by CAS9 RNA and gRNA. Six days after electroporation, cells were analyzed for TCR expression by assessing CD3.

Fig. 21 is an illustration showing the results of PCR sequencing after CD3 microbead depletion.

Fig. 22 is a panel of graphs showing CD3 re-expression four hours after NY-ESO-1 TCR RNA electroporation.

Fig. 23 containing FIG. 23A-23D is a panel of graphs demonstrating that endogenous TCR knockdown enhanced transgene expression and electroporated TCR RNA function in T cells. In FIG. 23A shows TCR expression by T cells, electroporated TCR siRNA (open bar graph), control siRNA (dotted open bar graph), and T cells without any siRNA (filled). In FIG. 23B shows transgene expression (TCR vb13.1) of wild-type (wt) or TCR-modified (SD) NY-ESO-1 TCR RNA Tcells, electroporated TCR siRNA, control siRNA, or no siRNA. In FIG. 23C shows NY-ESO-1 TCR tetramer staining of NY-ESO-1 wild-type (wt) or TCR-modified (SD) T cells, electroporated TCR siRNA, control siRNA, or no siRNA. In FIG. 23D shows specific lysis of an HLA-A2/NY-ESO-1 positive tumor line by electroporated TCR siRNA knockdown, TCR RNA NY-ESO-1 wild-type T cells.

Fig. 24 is a graph showing the fluorescence of tumor cells after injection of T cells in a mouse model. Ten million Nalm6-CBG-ESO-GFP (green nutcracker) tumor cells that expressed NY-ESO-1 and GFP were injected intravenously into NOD/SCID mice. Five days after tumor inoculation, CBR-transduced and electroporated RNA T cells were injected as indicated in the various groups, and tumor cells were detected by fluorescence.

Fig. 25 is a panel of images demonstrating the fluorescence of injected tumor cells and TCR hybrid T cells in mouse models over an extended period of time.

Fig. 26 is a panel of images demonstrating the production of generic CAR19 T cells. The upper part of Fig. is an illustration of a protocol for obtaining universal CAR19 T cells. The graph on the left shows the percentage of CAR19 positive T cells after transduction of the CAR19 gene using lentivirus. The right panel of the graphs shows the percentage of single TCR-negative and double TCR/HLA-A negative T cells before and after sorting.

Fig. 27 is a panel of graphs and a table showing the fold expansion of CD19 positive cells after stimulation with irradiated CD19 presenting K562 cells.

Fig. 28A is a panel of graphs showing endogenous and transgenic gene expression in expanded K562-CD19 cells.

Fig. 28B is a panel of graphs demonstrating that endogenous TCR expression remains negative in single TCR negative cells, while TCR and HLAA expression remains negative in dual TCR/HLA-A negative T cells after K562-CD19 stimulated expansion.

Fig. 29A is a panel of graphs showing that most of the expanded universal CAR19 T cells are CD45RO positive and express CD28 at moderate expression levels.

Fig. 29B is a panel of graphs demonstrating that most expanded universal CAR19 T cells retained high levels of CD62L expression and low expression of CCR7.

Fig. 30A is a graph demonstrating that editing the CRISPR gene had no effect on the antitumor activity of universal CAR19 T cells in vitro.

Fig. 30V is a panel of graphs demonstrating that negative one by one

- 6 040572

TCR CAR19 T cells and double TCR/HLA-A negative CAR19 T cells have robust lytic capacity when sensitized by Nalm6 tumor cells.

Fig. 30C is a panel of graphs showing cytokine secretion as part of the high antitumor activity of such cells.

Fig. 30D is a panel of graphs showing single TCR ablation or double TCR and HLA-A ablation in CAR19 T cells that had similar proliferation kinetics after sensitization with Nalm6 tumor cells.

Fig. 31 is a panel of images demonstrating that editing the CRISPR gene had no effect on the antitumor activity of universal CAR19 T cells in vivo. All mice receiving unmanipulated T cells and mice infused with transduced GFP using lentivirus wild-type T cells died within 3 weeks of tumor cell infusion. Objective tumor regression was observed for mice treated with CAR19 T cells. CRISPR-edited single TCR negative or double TCR/HLA-A negative universal CAR19 T cells had similar antitumor activity.

Fig. 32A is a panel of graphs demonstrating that single TCR ablation or double TCR and HLA-A ablation in T cells drastically reduces alloreactivity.

Fig. 32B is a panel of graphs showing the elimination of HLA-A activated NK cells with a long co-culture period (5 days).

Fig. 32C is a graph showing that no side activity was observed when cells were stimulated with whole blood allogeneic PBMC for 24 hours in the IFNr Eispot assay.

Fig. 33 is a panel of graphs demonstrating that FAS ablation increased the antitumor activity of CAR19 T cells. Received FAS-negative CAR19 T cells. FAS ablation was confirmed by flow cytometry analysis. The CAR19 gene expression of FAS-negative T cells was comparable to wild-type T cells. Even after incubation with Nalm6 tumor cells for a short period of 4 h, CD107a expression was significantly upregulated in FAS-negative CAR19 T cells compared to the wild-type counterpart.

Fig. 34A is a graph demonstrating that ablation of FAS in CAR19 T cells increased the survival and proliferation of CART cells under antigenic conditions in vitro. FAS-negative CAR19 T cells proliferated faster than wild-type CAR19 T cells when cells were stimulated with high levels of CD19+ K562 cells.

Fig. 34B is a panel of graphs showing that FAS-negative CAR19 T cells had reduced levels of apoptosis as measured by annexin V staining.

Fig. 35A is a graph demonstrating that ablation of FAS in CAR19 T cells increased the function of CART cells in an animal model. As observed in vitro, FAS-negative T cells were characterized by increased proliferation compared to wild-type T cells.

Fig. 35B is a panel of images demonstrating that the FAS-negative CAR19 group had better antitumor activity compared to the wild-type group.

Fig. 35C is a graph showing significant differences in bioluminescence data between the FAS-negative CAR19 group and the wild type group.

Fig. 36 is a panel of graphs showing the generation of PD1 negative PSCA-CAR T cells. Ablation of PD1 was confirmed by flow cytometry analysis. PD1 negative cells were enriched by microbead depletion. Wild-type T cells or PD1-negative PSCA-CAR T cells were expanded by stimulation with irradiated PC3 tumor cells presenting the PSCA antigen. PSCA-CAR positive cells were enriched after expression.

Fig. 37 is a panel of graphs demonstrating that PD1 ablation and CD137 expression in PSCA-CAR T cells increased CART cell activation under antigenic conditions in vitro.

Fig. 38A is a panel of images demonstrating PD1 ablation on the NSG PC3-PSCA-PDL1 in vivo model. PSCA-CAR T cells showed increased antitumor activity of CART cells in vivo compared to the wild type group.

Fig. 38B is a graph showing the difference in tumor burden between the PD1 negative group and the wild type group.

Fig. 39 is a panel of histological images demonstrating that TCR or TCR/HLA-I ablated T cells do not cause graft versus host disease (GVHD). Mice treated with double or triple knockout CART cells did not develop any signs of GVHD. In contrast, 3 out of 4 wild-type CD19 CART mice developed GVHD at day 65, which was confirmed by histological analysis of various organs.

Fig. 40A is a graph showing the percent survival of animals injected with T-cells ablated with TCR or TCR/HLA-I. Mice were irradiated at sublethal doses and injected. Four out of 5 mice treated with wild-type T cells died from GVHD within 60 days of the study. The PBS-treated, T-cell treated, single TCR ablated and dual TCR/HLA-I ablated groups did not show any signs of GVHD.

Fig. 40B is a panel of graphs showing body weights of mice treated with wild type T cells treated with PBS, TCR ablated T cells, or TCR/HLA-I dual ablation.

Fig. 41A is a panel of images demonstrating the improved antitumor activity of generic CART cells after blocking the PD1 and Fas CRISPR/Cas9 pathways. Better antitumor activity was detected in PD1 knockout universal CD19-CART cells when they were injected into Nalm6-PDL1 bearing mice.

Fig. 41B is a graph showing quantitative bioluminescence data from mice treated with various CRISPR/Cas9 edited T cells.

Fig. 42 is a panel of illustrations showing a one-time system for obtaining universal CART cells. Because gRNAs are prone to degradation, a simplified one-shot method for constitutively expressing gRNAs together with CARs in a single lentiviral vector has been developed.

Fig. 43 is a panel of graphs demonstrating efficient gene ablation by a single acting system. After electrotransfer of Cas9 mRNA, various amounts of CD3 ablation were observed.

Fig. 44A is a panel of images showing morphological changes during the iPSC reprogramming process from a Fas knockout T cell. The formation of a characteristic morphology of embryonic stem cells, indicating that it is possible to induce a pluripotent state in FAS-negative T cells.

Fig. 44B is a graph showing FAS-negative T cells reprogrammed into iPSCs at approximately 5-fold efficiency compared to wild-type counterparts. It has been reported that cell lines deficient in p53 are easier to reprogram due to obstruction of the apoptosis pathway. FAS knockout can facilitate the reprogramming process by using a similar mechanism.

Fig. 45A is a panel of images demonstrating the ES-like morphology of iPSCs from CD3-negative TCR knockout TCR alpha or beta T cells under various reprogramming conditions. The morphology remained constant after several passages.

Fig. 45B is a graph demonstrating that reprogramming of CD3-negative T cells was approximately 5-fold less efficient than wild-type analogs, suggesting that TCR knockout may play a role in the T-cell reprogramming process or affect cell viability after Sendai virus infection.

Fig. 45C is a panel of images showing phosphatase staining of CD3-negative iPSC cells.

Fig. 46 is a panel of graphs showing the induction of endogenous pluripotent stem cell genes in various T-iPSC cell lines.

Fig. 47A is a panel of images showing immunostaining for Tra-1-60 and SSEA4 expression.

Fig. 47B is an image showing Fas TiPSC knockout confirmation by Sanger sequencing.

Fig. 48A is a panel of graphs showing gene ablation in naive T cells with a distinct Cas9 variant. CD3 knockout was performed using dCas9 and FokI-Cas9.

Fig. 48B is a panel of graphs showing that two gRNAs required ablation of the dCas9 and FokI-Cas9 genes.

Fig. 48C is an image showing rare side effects in gene-modified T cells using CRISPR/cas9.

Fig. 49 is a panel of images demonstrating the strategy for introducing CRISPR/Cas9 into T cells. On the left is a schematic representation of gRNA under the control of the T7 promoter. On the right is a schematic representation of the generation of gene-edited antigen-specific T cells using the CRISPR system. T cells were electroporated with Cas9 mRNA and gene-targeting gRNA 3 days after stimulation with CD3/CD28 beads and then cultured for 24 h at 32°C in the presence of IL2 before returning to normal culture conditions of 37°C. T cells with disrupted specific gene were sorted on day 8 and redirected using CAR or TCR via gene transfer by lentiviral transduction or mRNA electroporation.

Fig. 50A is a panel of graphs showing CRISPR/Cas9 mediated efficient TCR destruction in T cells. CD3 expression of CRISPR/Cas9 edited T cells cultured at 37°C or 32°C.

- 8 040572

Fig. 50B is a panel of graphs showing CD3 expression editable

CRISPR/Cas9 T cells cultured after sequential CRISPR RNA electroporation.

Fig. 51A is a panel of graphs showing the efficient disruption of the CRISPR gene that occurred in T cells. Expression of CD3 T cells transfected with CRISPR using various ratios of Cas9:gRNA (upper and middle panels) and amounts of total CRISPR RNA (lower panel).

Fig. 51B is a table showing target potency calculated by flow cytometry and clonal sequencing.

Fig. 52 is an image showing the amount of disruption of a gene targeted by TCR as measured by T7 selective mismatch nuclease assay on DNA amplified from cells. The calculated amount of disruption of the target gene in TRAC and TRBC is shown below. The arrows indicate the expected bands.

Fig. 53A is a depiction of insertion-deletion mutations (in gene disruption) observed by PCR amplicon clonal sequence analysis following CRISPR-mediated recombination of TCR α and β loci.

Fig. 53B is a diagram of a human locus encoding TCR α- and β CRISPR gRNA targeting sites in the genomic locus of the TCR α- and β-chain constant region. Each exon is shown as a block. Arrow: gRNA sense strand targeting the site; blue arrow: antisense strand of gRNA targeting the site. Multiple peaks in the Sanger sequencing results indicate CRISPR-mediated NHEJ events at the TRAC and TRBC genomic loci.

Fig. 54 is a panel of graphs showing CD3 expression in purified TCR ^nes cells.

Fig. 55 is a panel of graphs demonstrating TCR/CD3 redirection ^{of nes} cells via TCR 1G4 (α- and β) electrotransfers or CAR19 mRNA.

Fig. 56 is a graph showing expansion of TCR/CD3 ^nes cells after 10 days using various stimulation conditions.

Fig. 57 is a panel of graphs demonstrating that CRISPR/Cas9 editing does not impair the antitumor efficacy of primary T cells.

The phenotypes of TCR/CD3 ^nes cells were demonstrated after four different propagation methods.

Fig. 58 is a panel of graphs showing the relative expression of CD19CAR after electrotransfer of CD19-CAR RNA into Cas9 MOCK and TCR/CD3 ^nes cells.

Fig. 59A is a panel of graphs demonstrating that no significant functional difference was observed between CD19-CAR redirected Cas9 MOCK cells and TCR/CD3 ^nes cells, as confirmed by analysis of CD107 release after incubation with Nalm6 target cells. Representative data from 3 independent experiments are shown. Bars, standard error.

Fig. 59B is a graph demonstrating that no significant functional difference was observed between CD19-CAR redirected Cas9 MOCK cells and TCR/CD3 ^nes cells, as confirmed by cytotoxicity assay after incubation with Nalm6 target cells. Representative data from 3 independent experiments are presented. Bars, SE=root mean square error.

Fig. 59C is a panel of graphs demonstrating that no significant functional difference was observed between redirected CD19-CAR Cas9 MOCK cells and TCR/CD3 ^nes cells, as confirmed by IL2 and IFNy secretion after incubation with Nalm6 target cells. Representative data from 3 independent experiments are presented. Bars, SE=root mean square error.

Fig. 59D is a panel of images of NOD/scid/yc(-/-)(n=12) mice injected with 1x106 Nalm6 tumor cells (i.v.), mice randomly divided into three groups. Cas9 MOCK cells and TCR/CD3 ^nes T cells (10x106) expressing CD19-CAR after electroporation were injected i.v. every 4 days for a total volume of three injections (arrows). Mice treated with T cells electroporated without RNA served as controls. Received images of surviving animals, as indicated. Imaging was started 1 day prior to T cell treatment. Bars, SE=root mean square error, EP=electroporation; E:T=effector to tumor ratio; arrow, time point of T-cell infusion; ns - no significant difference. ****P < 0.0001, nc by two-way ANOVA plus Bonferroni's post hoc test.

Fig. 59E is a graph showing the luminosity of fluorescent cells.

Fig. 60 is a panel of graphs showing double and triple gene ablation with CRISPR/Cas9 to generate universal effector cells. Destruction of HLA-I gRNA,

- 9 040572 directionally acting on B2M.

Fig. 61 is a flow chart of the protocol for obtaining universal effector cells, as described in the present description.

Fig. 62 is a panel of graphs demonstrating that TCR ablation suppressed non-specific cytolytic activity. Tumor cell lines 624mel-CBG and PC3-CBG were incubated with PHA-pretreated or non-PHA-pretreated T cells at an effector to target ratio of 20:1 for 24 h and cytotoxicity was calculated based on luciferase assay. Data are mean+SD; n=3.

Fig. 63 is a panel of graphs showing the Elispot IFNy assay to measure TCR and TCR/HLA disruption alloreactivity by stimulation with gene ablated T cells with irradiated allogeneic PBMCs (left panel) or co-culturing with allogeneic PBMCs with irradiated T cells, where gene ablation was performed. Specific spots are shown on the y-axis as spots formed in the presence of stimulants minus spots formed only by the effector. **P < 0.01 according to the Mann-Whitney test.

Fig. 64 is a panel of graphs demonstrating that disruption of endogenous CRISPR/Cas9 TCR improved TCR redirected T cell function. Expression of Vb13.1 and CD3 is present in T cells transfected with Cas9 mRNA alone (Cas9 Mock) or in CD3 ^neg T cells with disrupted endogenous TCR only α (α KO), only β (β KO), double α- and β (α+β KO) that electroporated RNA α (1G4α, 2 μg), β (1G4β, 2 μg) or RNA α + β (1G4 α+β, 2+2 μg) NY-ESO-1 TCR.

Fig. 65A is a panel of graphs demonstrating upregulation of CD107a expression by Tcells electroporated with (1G4) α/β TCR RNA with single TCR α or β knockout or double TCR α+β knockout stimulated with an HLA-A2/NY-ESO-1 positive line. cells (Nalm6-ESO) or a control Nalm6 cell line.

Fig. 65B are graphs demonstrating the Nalm6-ESO lytic capacity of electroporated RNA TCR α+β (1G4 TCR) T cells with single TCR α or β knockout or double α+β knockout demonstrated in (a) in the CTL assay on based on luciferase.

Fig. 66 is a panel of graphs showing Vbeta and CD3 expression in α+β double TCR disrupted T cells (TCR ^neg T cells) electroporated with two different NY-ESO-1 TCR RNAs (1G4 TCR, 10 μg or 8F TCR, 10 μg ) compared to control Cas9 Mock T cells.

Fig. 67A is a panel of graphs demonstrating upregulation of CD107a expression in CD8+ T cells electroporated with NY-ESO-1 RNA TCR (1G4 TCR or 8F TCR) with double TCR knockout stimulated with HLA-A2/NY-ESO-1 positive lines. Nalm6-ESO, 624-mel or U266 cells. Nalm6 was used as a negative control.

Fig. 67B is a panel of graphs showing cytokine production (IL-2 and TNF-α) of electroporated RNA TCR NY-ESO-1 (1G4 TCR or 8F TCR) TCR double knockout T cells after HLA-A2/NY-ESO-stimulation. 1-positive cell lines Nalm6-ESO or U266; melanoma cells were used as a negative control.

Fig. 68 is a panel of images demonstrating the production of generic CART cells with a combination of lentivirus gene transfer and CRISPR/Cas9 electroporation. A flowchart for obtaining universal CD19-CART cells is shown. T cells were transduced with lentiviral CD19-CAR on day 1 post-stimulation, and Cas9 mRNA and gRNA targeting TCR α-chains and TCR β-chains and B2M were electroporated in T cells 2 days later. Prior to restimulation for expansion, the TCR and HLA-I double negative cell population was enriched.

Fig. 69 is a panel of graphs showing CD19-CAR expression in gene-modified lenti-CD19-CAR cells expanded by CD3/CD28 bead stimulation after 1G4 TCR electroporation.

Fig. 70 is a panel of graphs showing the phenotype of CD19-CAR T cells.

Fig. 71 is a graph showing CD107a release in TCR-negative and TCR/HLA-I double negative CD19-CAR T cells. Representative data from 3 independent experiments are presented. Bars, SE=root mean square error.

Fig. 72 is a panel of graphs showing cytokine secretion by TCR-negative and TCR/HLA-I double negative CD19-CAR T cells. Representative data from 3 independent experiments are presented. Bars, SE=root mean square error.

Fig. 73 is a graph showing the tumor lytic capacity of TCR-negative and double TCR/HLA-I negative CD19-CAR T cells. Representative data from 3 independent experiments are presented. Bars, SE=root mean square error.

Fig. 74 panel of graphs showing CFSE-labeled CD19-CAR and non-transduced T cells incubated with K562 and K562-CD19 tumor target cells in a ratio of 1 to 10 for 72 hours.

- 10 040572

Fig. 75A is a graph showing BLI from mice treated with a single injection on day 7 expressing CD19-CAR and GFP using a lentiviral vector; nz, no significant difference by two-way analysis of variance plus Bonferroni's post hoc test. Tumors were established in NSG mice (n=4 per group) by intravenous injection of 1x10 ⁶ Nalm6 cells. Beginning on day 7, T cells (1×10 ⁷ ) expressing lentivirus (LV) transduced CD19-CAR were infused as a single injection. As controls, T cells expressing the GFP LV protein were injected.

Fig. 75B is a graph showing the overall survival of mice treated with LV-GFP, LV-CD19-CAR, LV-CD19-CAR-TCR/CD3 ^neg and LV-CD19-CAR-TCR/HLA-I ^neg T cells. nz, there is no significant difference according to the long-range Cox-Mantel test.

Fig. 76 is a panel of images demonstrating that gene-modified CAR T cells retained antitumor efficacy and did not induce GVHD. Tumors were established in NSG mice (n=4 per group) by intravenous injection of 1x10 ⁶ Nalm6 cells. Beginning on day 7, T cells (2×10 ⁷ ) expressing LV-CD19-CAR were infused as a single injection. As controls, T cells expressing the GFP LV protein were injected. Imaging was started 1 day prior to T cell treatment. On day 65, organs were harvested from randomly selected mice from different treatment groups and used for immunohistochemical staining for CD3. Fig. 77 is a series of schematic vectors showing the pAd5F35-CRISPR construct targeting PD1, Fas, and the TCR alpha chain.

Fig. 78 is an illustration showing the construction of Penton-modified pAd5F35-CRISPR with ScFv anti-CD3 antibody and schematic delivery of pAd5F35-CRISPR for chimeric antigen receptor knockin/knockout in T cells in vitro and in vivo.

Fig. 79A is a graph showing Sanger sequencing of PCR products flanking PDI-γΡΗΚ directed to the site. Adenovirus-pAd5F35-CRISPR-PD1 virus was transduced into MD231 cells. After 3 days, genomic DNA was extracted and PCR was performed.

In FIG. 79B shows target event sequences in MDA231 cells after adenovirus-CRISPR manipulation. The PD1 PCR products were cloned into the TOPO vector and sequenced.

Fig. 80 is a table demonstrating that reducing gRNA usage improved T cell fold and only slightly reduced knockout efficiency.

Fig. 81 is a table showing the parameters used to optimize electroporation conditions to obtain high CD3/B2M knockout efficiency with improved T cell expansion. Compared to standard electroporation (EP) conditions in a 2 mm cuvette (EP No. 10-13) or a 4 mm cuvette. High CD3/B2M knockout efficiency was observed with improved T cell multiplicity (EP Nos. 1 and 5).

Fig. 82 is a table demonstrating the optimization of EP conditions to obtain the maximum multiplicity with acceptable knockout efficiency.

Fig. 83 is a table showing further optimization of the EP conditions to obtain the maximum multiplicity with acceptable knockout efficiency.

In FIG. 84 is a schematic representation of the procedure for T cell stimulation, lentivirus transduction, and CRISPR electroporation.

Fig. 85 is a table showing the number of T cells (upper table) and multiplicity (lower table) after the electroporation and culture procedure.

Fig. 86 is a panel of graphs showing mean T cell expansion. Expansion fold of T cells transduced with CD19 CAR only (TD only) or transduced with CD19 CAR and edited by CRISPR (TD/KO) (left panel). The multiplication rate of T cells on day 10 is shown in the right graph.

Fig. 87 is a panel of flow cytometric data plots showing CD3/B2M/CAR expression on day 8 of expanded T cells.

Figure 88 is a panel of graphs showing CD3/B2M expression after CD3+ T cell depletion.

Fig. 89 is a panel of graphs showing CD3/B2M expression at day 11 in CD19 CAR TD (transduced)/electroporated CRISPR CD3-depleted T cells; CD19 CAR TD/electroporated CRISPR T cells and CD19 CAR TD T cells. Non-transduced ND4 63 (NOTD) was used as a negative control. Fig. 90 is a panel of graphs showing CD19 CAR expression at day 11 in CD19 CAR TD (transduced)/electroporated CRISPR CD3-depleted T cells; CD19 CAR TD/electroporated CRISPR T cells and CD19 CAR TD T cells. Transduced ND463 (NOTD) was used as a negative control.

Fig. 91 is a panel of graphs showing CD3/B2M/CAR expression at day 11 in CD19 CAR TD (transduced)/electroporated CRISPR CD3 T-depleted cells; CD19 CAR TD/CRISPR electroporated T cells and CD19 CAR TD T cells. As

- 11 040572 negative controls used non-transduced ND463 (NOTD). Fig. 92 is a table summarizing CD3/B2M/CAR expression in CD19 CAR TD (transduced)/electroporated CRISPR CD3-depleted T cells; CD19 CAR TD/CRISPR electroporated T cells and CD19 CAR TD T cells. Fig. 93 is a panel of graphs demonstrating upregulation of CD107a expression in CD19 CAR TD (transduced)/electroporated CRISPR CD3-depleted T cells; CD19 CAR TD/CRISPR electroporated T cells and CD19 CAR TD T cells. Fig. 94 is a panel of graphs showing T cell lytic activity on day 11. FIG. 95 is a panel of graphs showing T cell cytokine production on day 11. FIG. 96 is a panel of graphs showing T cell expansion. No abnormal growth of T cells was observed.

Detailed Description Definitions

Unless otherwise defined, all technical and scientific terms used in the present description have the same meaning as generally understood by a person skilled in the art to which the invention belongs. While any methods and materials similar or equivalent to those described herein may be used in the practice to test the present invention, preferred substances and methods are described herein. In describing and claiming the present invention, the following terminology is used.

It should also be understood that the terminology used in the present description is only intended to describe specific embodiments and is not limiting.

The singular forms are used herein to refer to one or more than one (eg, at least one) grammatical construct in the singular form. By way of example, element means one element or more than one element.

As used herein approximately, when referring to a measurable value such as amount, duration of time, etc., is intended to include changes of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and yet more preferably ±0.1% of the specified value, because such changes are suitable for carrying out the described methods.

As used herein, activation refers to the state of a T cell that has been sufficiently stimulated to induce detectable cell proliferation. Activation may also be associated with induced cytokine production and detectable effector functions. The term activated T cells specifically refers to T cells that undergo cell division.

As used herein, the term antibody refers to an immunoglobulin molecule that specifically binds to an antigen. The antibodies may be intact immunoglobulins derived from natural sources or from recombinant sources, and may be immunoreactive portions of intact immunoglobulins. Typically, antibodies are tetramers of immunoglobulin molecules. The antibodies of the present invention may exist in various forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab) ₂ , as well as single chain antibodies (scFv) and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, in Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci USA 85:5879-5883; Bird et al., 1988, Science 242: 423-426).

The term antibody fragment refers to the region of an intact antibody and refers to the variable regions of an intact antibody that determine antigen binding. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, scFv-based antibodies, and polyspecific antibodies formed from antibody fragments.

As used herein, an antibody heavy chain refers to the larger of the two types of polypeptide chains found in all antibody molecules in their natural conformations. As used herein, an antibody light chain refers to the smaller of the two types of polypeptide chains found in all antibody molecules in their natural conformations. Light α- and β-chains refer to the two main isotypes of the light chain of the antibody.

As used herein, the term "synthetic antibody" refers to an antibody that is produced using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be construed as meaning an antibody that is made by synthesizing a DNA molecule encoding an antibody, and where the DNA molecule expresses an antibody protein, or an amino acid sequence defining the antibody, where the DNA or amino acid sequence is made using synthetic DNA technology or an amino acid sequence that is available and well known in the field.

- 12 040572

As used herein, the term antigen or Ag is defined as a molecule that elicits an immune response. Such an immune response may include the formation of antibodies or the activation of specific immunocompetent cells, or both. A person skilled in the art will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. In addition, antigens can be obtained from recombinant or genomic DNA. One of skill in the art will appreciate that any DNA that contains nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response thus encodes an antigen, as the term is used herein. In addition, one of skill in the art will appreciate that such an antigen is not necessarily encoded by the entire nucleotide sequence of a gene alone. It is easy to understand that the present invention relates to, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. In addition, one of skill in the art will appreciate that an antigen is not necessarily encoded in its entirety by a gene. It is easy to understand that the antigen can be obtained by synthesis or can be isolated from a biological sample. Such a biological sample may include, but is not limited to, a tissue sample, a tumor sample, a cell, or a biological fluid.

As used herein, the term antitumor effect refers to a biological effect, which may be manifested as a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with a cancerous condition. The antitumor effect can also be manifested in the ability of the peptides, polynucleotides, cells and antibodies of the invention to prevent the occurrence of a tumor in the first place.

The term self-antigen in accordance with the present invention means any self-antigen that is recognized by the immune system as foreign. Self antigens include, but are not limited to, cellular proteins, phosphoproteins, cell surface proteins, cellular lipids, nucleic acids, glycoproteins, including cell surface receptors.

As used herein, the term autoimmune disease is defined as a disorder that results from an autoimmune response. Autoimmune disease is the result of an inadequate and excessive response to a self-antigen. Examples of autoimmune diseases include, but are not limited to, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, type I diabetes, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain's syndrome -Barré, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthropathies, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, ulcerative colitis.

As used herein, the term autologous is intended to refer to any substance derived from the same individual that is subsequently reintroduced to the individual.

Allogeneic refers to a transplant obtained from another animal of the same species.

Xenogeneic refers to a transplant obtained from an animal of a different species.

As used herein, the term cancer is defined as a disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, etc. In certain embodiments, the cancer is medullary thyroid carcinoma.

As used herein, the term chimeric antigen receptor or CAR refers to an artificial T cell receptor that is engineered to be expressed on an effector cell of the immune system and specifically bind to an antigen. CAR can be used as an adoptive cell transfer therapy. T cells are harvested from a patient and modified to express receptors specific to a particular form of antigen. In certain embodiments, CARs are expressed, for example, with specificity for a tumor associated antigen. CARs may also contain an intracellular activating domain, a transmembrane domain, and an extracellular domain containing a tumor-specific antigen-binding region. In certain aspects, CARs comprise fusions of single chain variable fragments (scFv) derived from monoclonal antibodies fused to the transmembrane and intracellular domain of CD3 zeta. The specificity of CAR constructs can be derived from receptor ligands (eg, peptides). In certain embodiments, a CAR can target cancers by redirecting the specificity of a T cell expressing a CAR specific for tumor associated antigens.

The term cleavage refers to the breaking of covalent bonds, such as in the backbone of a nucleic acid molecule. Cleavage can be initiated in a variety of ways, including, but not limited to, enzymatic or chemical hydrolysis of the phosphodiester bond. Single-strand cleavage and double-strand cleavage are possible. Double strand cleavage can occur as a result of two different single strand cleavage events. Cleavage of DNA can lead to the formation of blunt ends or sticky ends. In certain embodiments, fusion polypeptides can be used to target cleaved double-stranded DNA.

As used herein, the term conservative sequence modifications is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of an antibody containing an amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications in an antibody of the invention can be carried out by standard methods known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are substitutions in which an amino acid residue is replaced with an amino acid residue containing the same side chain. Families of amino acid residues containing similar side chains that have been defined in the art. Such families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (eg, threonine, valine, isoleucine), and aromatic side chains (eg, tyrosine, phenylalanine , tryptophan, histidine). Thus, one or more amino acid residues in the CDR regions of an antibody can be replaced with other amino acid residues from the same side chain family, and the modified antibody can be tested for antigen binding using the functional assays described herein.

''Costimulatory ligand', as the term is used herein, includes a molecule on an antigen presenting cell (e.g., aARC, dendritic cell, B cell, etc.) that specifically binds to a cognate costimulatory molecule on a T cell, thus providing a signal that, in addition to the primary signal provided, for example, by binding of the TCR/CD3 complex to the peptide-loaded MHC molecule, mediates a T cell response including, but not limited to, proliferation, activation, differentiation, and the like. The costimulatory ligand may include, but is not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), molecule intercellular adhesion (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin-beta receptor, 3/TR6, ILT3, ILT4, HVEM, agonist or antibody that binds to Toll-like receptor , and a ligand that specifically binds to B7-H3. A costimulatory ligand also includes, but is not limited to, an antibody that specifically binds to a costimulatory molecule present on a T cell, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS , operably linked lymphocyte antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds to CD83.

A costimulatory molecule refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, the MHC class I molecule, BTLA, and the Toll-like receptor.

As used herein, a co-stimulatory signal refers to a signal that, when combined with a primary signal, such as TCR/CD3 ligation, results in T cell proliferation and/or up- or down-expression of key molecules.

The term CRISPR/CAS, clustered regularly spaced short palindromic repeats and their associated system, or CRISPR refers to DNA loci containing short repeats of basic sequences. Each repeat is followed by short segments of spacer DNA from the previously exposed virus. Bacteria and archaea have evolved adaptive immune defenses called CRISPR-CRISPR-associated (Cas) systems, in which short RNA is used to directly destroy foreign nucleic acids. In bacteria, the CRISPR system provides adaptive immunity against invasive foreign DNA through RNA-guided DNA cleavage.

In the type II CRISPR/Cas system, short segments of foreign DNA, called spacers, are integrated into CRISPR genomic loci and are transcribed and processed into short CRISPR RNAs (crPHKs). These crRNAs bind to complementary trans-activating crRNAs (tracrPHKs) and direct sequence-specific cleavage and silencing of pathogenic DNA by Cas proteins. In a recent work, it was shown that for target recognition by the Cas9 protein, a seed sequence in crRNA and containing a sequence of a motif adjacent to the protospacer (PAM) consisting of a conserved dinucleotide upstream of the sgRNA binding region is necessary.

To direct Cas9 to cleave sequences of interest, crRNA-tracrPHK fusion transcripts, hereinafter referred to as guide RNA or rRNA, can be constructed from the human U6 polymerase III promoter. CRISPR/CAS-mediated genome editing and regulation has drawn attention to its transformational potential for basic science, cell engineering, and therapeutics.

The term CRISPRi refers to a CRISPR system for silencing specific gene sequences or inhibiting gene expression, such as at the transcriptional level.

A disease is a health condition of an animal in which the animal cannot maintain homeostasis and in which, if the disease state does not improve, the health of the animal continues to deteriorate. In contrast, a disorder in an animal is a health condition in which the animal is able to maintain homeostasis, but in which the animal's health is less favorable than it would be in the absence of the disorder. If left untreated, the disorder does not necessarily cause further deterioration in the health of the animal.

As used herein, the term downregulation refers to downregulation or elimination of the expression of one or more genes.

An effective amount or a therapeutically effective amount is used interchangeably herein and refers to an amount of a compound, compound, substance or composition as described herein that is effective to produce a particular biological result or provides a therapeutic or prophylactic benefit. Such results may include, but are not limited to, antitumor activity as determined by any means suitable in the art.

Encoding refers to the characteristic property of specific nucleotide sequences in a polynucleotide, such as a gene, cDNA, or mRNA, serving as templates for the synthesis of other polymers and macromolecules in biological processes, containing a specific nucleotide sequence (e.g., gRNA, tRNA, and mRNA) or a specific amino acid sequence and possessing the biological properties resulting from it. Thus, a gene encodes a protein if the transcription and translation of the mRNA corresponding to such a gene leads to the formation of a protein in a cell or other biological system. A coding strand whose nucleotide sequence is identical to that of an mRNA, and which is generally listed in sequence listings, and a non-coding strand used as a template for transcription of a gene or cDNA may be referred to as encoding a protein or other product of such a gene or cDNA.

As used herein, endogenous refers to any substance from an organism, cell, tissue, or system, or produced in an organism, cell, tissue, or system.

As used herein, the term exogenous refers to any substance introduced from the body, cell, tissue, or system, or produced outside the body, cell, tissue, or system.

As used herein, the term propagate refers to an increase in number, as in an increase in the number of T cells. In one embodiment, the number of T cells that are propagated ex vivo is increased compared to the number originally present in culture. In another embodiment, the number of T cells that are expanded ex vivo is increased relative to other cell types in culture. As used herein, the term ex vivo refers to cells that have been removed from a living organism (eg, a human) and grown outside the body (eg, in a culture dish, test tube, or bioreactor).

As used herein, the term expression is defined as the transcription and/or translation of a particular nucleotide sequence under the control of its promoter.

An expression vector refers to a vector containing a recombinant polynucleotide containing expression control sequences operably linked to a nucleotide sequence to be expressed.

The expression vector contains suitable cis-acting elements for expression; other elements for expression may be delivered by the host cell or in an in vitro expression system. Expression vectors include all expression vectors known in the art, such as cosmids, plasmids (eg, naked or contained in liposomes), and viruses (eg, Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that introduce a recombinant polynucleotide.

As used herein, homologous refers to the identity of a follower.

- 15 040572 subunit of two polymeric molecules, for example two nucleic acid molecules, such as two DNA molecules or two RNA molecules, or two polypeptide molecules. When the position of a subunit in two molecules is occupied by the same monomeric subunit; for example, if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology of two sequences directly depends on the number of matches or homologous positions; for example, if half (eg, five positions in a polymer ten subunits long) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (eg, 9 out of 10) match or are homologous, then the two sequences are 90% homologous.

Humanized forms of non-human antibodies (e.g., mice) are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antibody antigen-binding subsequences) that contain the minimum sequence obtained from non-human immunoglobulin. Advantageously, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from the complementarity determining region (CDR) of the recipient are replaced with residues from a CDR from a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some cases, Fv framework region (FR) residues of a human immunoglobulin are replaced with corresponding non-human residues. In addition, humanized antibodies may contain residues that are not found in either the recipient antibody or the imported CDR or framework sequences. Such modifications are made to further improve and optimize antibody performance. In general, a humanized antibody contains substantially all of at least one and typically two variable domains wherein all or substantially all of the CDR regions correspond to non-human immunoglobulin regions and all or substantially all of the FR regions are immunoglobulin sequence regions. person.

The humanized antibody also optimally comprises at least an immunoglobulin constant region (Fc) region, typically a human immunoglobulin constant region region. For a more detailed description, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.

Fully human refers to an immunoglobulin, such as an antibody, where the entire molecule is human or consists of an amino acid sequence identical to the form of the human antibody.

As used herein, identity refers to the sequence identity of a subunit of two polymer molecules, in particular two amino acid molecules, such as the identity of two polypeptide molecules. When two amino acid sequences contain the same residues in the same positions; for example, if a position in each of two polypeptide molecules is occupied by arginine, then they are identical at that position. Identity, or the extent to which two amino acid sequences contain the same residues at the same positions when aligned, is often expressed as a percentage. The identity of two amino acid sequences depends directly on the number of matches or identical positions; for example, if half (eg, five positions in a polymer ten amino acids long) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (eg, 9 out of 10) match or are identical, the two amino acid sequences are 90% identical.

As used herein, the term immunoglobulin or Ig is defined as a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes referred to as BCR (B cell receptor) or antigen receptor. The five members of this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is a primary antibody found in body secretions such as saliva, tears, breast milk, gastrointestinal secretions, and mucous secretions from the respiratory and genitourinary tracts. IgG is the most common circulating antibody. IgM is the main immunoglobulin produced in the primary immune response in most individuals. It is the most effective immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in protection against bacteria and viruses. IgD is an immunoglobulin that does not have a known antibody function, but can serve as an antigen receptor. IgE is an immunoglobulin that mediates immediate-type hypersensitivity by causing the release of mediators from mast cells and basophils when exposed to an allergen.

As used herein, the term immune response is defined as a cellular response to an antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce the formation of antibodies and/or activated lymphocytes to remove the antigen.

As used herein, an induced pluripotent stem cell or iPS cell refers to a pluripotent stem cell that is derived from adult cells, such as T cells. Expression of reprogramming factors such as Klf4, Oct3/4 and Sox2 in adult cells transforms cells into pluripotent cells capable of proliferating and differentiating into many cell types.

As used herein, educational material includes a publication, record, chart, or any other medium of expression that can be used to communicate the applicability of the compositions and methods of the invention. The training material of the kit according to the invention can, for example, be attached to a container that contains the nucleic acid, peptide and/or composition of the invention, or supplied together with a container that contains the nucleic acid, peptide and/or composition. Alternatively, the training material may be delivered separately from the container so that the recipient shares the training material and the connection.

Distinguished means altered or removed from the natural state. For example, a nucleic acid or peptide naturally found in a living animal is not isolated, but the same nucleic acid or peptide, partially or completely separated from the accompanying substances of its natural state, is isolated. An isolated nucleic acid or protein may exist in a substantially purified form, or may exist in a non-natural environment such as, for example, a host cell.

As used herein, the term knockdown refers to a decrease in the expression of one or more genes.

As used herein, the term knockout refers to the elimination of the expression of one or more genes.

As used herein, lentivirus belongs to a genus in the family Retroviridae. Lentiviruses are unique among retroviruses in that they are able to infect non-dividing cells; they can deliver a significant amount of genetic information to the DNA of the host cell, thus they represent one of the most efficient vector methods for delivering genes. HIV, SIV and FIV are examples of lentiviruses. Vectors derived from lentiviruses provide a means to obtain significant levels of gene transfer in vivo.

As used herein, the term modified refers to an altered state or structure of a molecule or cell of the invention. Molecules can be modified in any way, including chemically, structurally and functionally. Cells can be modified by the introduction of nucleic acids.

As used herein, the term modulating is meant to mediate a detectable increase or decrease in the level of response in an individual compared to the level of response in an individual with no treatment or compound, and/or compared with the level of response in an otherwise identical but untreated individual. . The term includes diverting and/or influencing a native signal or response, thereby mediating a favorable therapeutic response in an individual, preferably a human.

In the context of the present invention, the following abbreviations are used for the most frequently occurring nucleic acid bases. A refers to adenosine, C refers to cytosine, G refers to guanosine, T refers to thymidine, and U refers to uridine.

Unless otherwise indicated, a nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate variants of each other and that encode the same amino acid sequence. The phrase a nucleotide sequence encoding a protein or RNA may also include introns in cases where such a nucleotide sequence encoding a protein may, in some embodiments, contain intron(s).

The term operably linked refers to a functional relationship between a regulatory sequence and a heterologous nucleic acid sequence that results in the expression of the latter. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is operably linked to the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. In general, operably linked DNA sequences are contiguous and optionally link two protein coding regions in the same reading frame.

The term tumor antigen overexpression or tumor antigen overexpression is intended to refer to an abnormal level of expression of a tumor antigen in a cell from a disease site, such as a solid tumor, in a particular tissue or organ of a patient relative to the level of expression in a normal cell from such tissue or organ. Patients suffering from solid tumors or hemoblastosis characterized by tumor antigen overexpression can be determined by standard assays known in the art.

Parenteral administration of an immunogenic composition includes, for example, subcutaneous (SC), intravenous (IV), intramuscular (IM), or intrasternal injection or infusion methods.

- 17 040572

As used herein, the term polynucleotide is defined as a chain of nucleotides. In addition, nucleic acids are polymers of nucleotides. Thus, as used herein, nucleic acids and polynucleotides are interchangeable. One skilled in the art has general knowledge that nucleic acids are polynucleotides that can be hydrolyzed to monomeric nucleotides. Monomeric nucleotides can be hydrolyzed to nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences that are produced by any means available in the art, including, without limitation, recombinant methods, i.e. cloning nucleic acid sequences from a recombinant library or cell genome using conventional cloning technology and PCR™, and the like, and synthetic methods.

As used herein, the terms peptide, polypeptide, and protein are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limitation on the maximum number of amino acids that a protein or peptide sequence may contain. Polypeptides include any peptide or protein containing two or more amino acids connected to each other by peptide bonds. As used herein, the term refers to short chains, which are also commonly referred to in the art as, for example, peptides, oligopeptides, and oligomers, and long chains, which are commonly referred to in the art as proteins, which are of many types. Polypeptides include, for example, among other biologically active fragments, essentially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

As used herein, the term promoter is defined as a DNA sequence recognized by the cell's synthesis machinery or input synthesis machinery, necessary to initiate specific transcription of a polynucleotide sequence.

As used herein, the term promoter/regulatory sequence means a nucleic acid sequence that is necessary for the expression of a gene product operably linked to a promoter/regulatory sequence. In some cases, such a sequence may be a core promoter sequence, and in other cases, such a sequence may also contain an enhancer sequence and other regulatory elements that are necessary for the expression of the gene product. The promoter/regulatory sequence may, for example, be a sequence that expresses the gene product in a tissue-specific manner.

A constitutive promoter is a nucleotide sequence which, when operably linked to a polynucleotide that encodes or defines a gene product, causes the production of the gene product in a cell under most or all of the cell's physiological conditions.

An inducible promoter is a nucleotide sequence which, when operably linked to a polynucleotide that encodes or defines a gene product, causes the production of the gene product in a cell essentially only when an inducing factor that corresponds to the promoter is present in the cell.

A tissue-specific promoter is a nucleotide sequence which, when operably linked to a polynucleotide that encodes or defines a gene, causes the production of the gene product in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

The Sendai virus belongs to the genus of the Paramyxoviridae family. Sendai viruses are negative single-stranded RNA viruses that do not integrate into the host genome or change the genetic information of the host cell. Sendai viruses have a very wide host range and are not pathogenic to humans. Used as a recombinant viral vector, Sendai viruses are capable of transient but strong gene expression.

The signal transduction pathway refers to the biochemical relationship of various signal transduction molecules that play a role in signal transmission from one part of the cell to another part of the cell. The phrase cell surface receptor includes molecules and complexes of molecules capable of receiving a signal and transmitting a signal across the plasma membrane of a cell.

Single chain antibodies refer to antibodies produced by recombinant DNA technologies in which immunoglobulin heavy and light chain fragments are linked to the Fv region via a designed amino acid sequence. There are various ways to obtain single-chain antibodies, including the methods described in US patent No. 4694778; Bird, (1988) Science, 242:423-442; Huston et al., (1988) Proc. Natl. Acad. sci. USA 85:5879-5883; Ward et al. (1989) Nature 334:54454; Skerra et al., (1988) Science, 242:1038-1041.

- 18 040572

As used herein, the term specifically binds in relation to an antibody to mean an antibody that recognizes a specific antigen but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to an antigen from one or more species. However, such cross-species reactivity does not in itself alter the classification of an antibody as specific. In another example, an antibody that specifically binds to an antigen can also bind to other allelic forms of the antigen. However, such cross-reactivity does not in itself alter the classification of an antibody as specific. In some cases, the terms specific binding or specific binding may be used in relation to the interaction of an antibody, protein or peptide with a second chemical compound, which means that the interaction depends on the presence of a particular structure (eg, antigenic determinant or epitope) on the chemical compound; for example, an antibody recognizes and binds to a specific protein structure, but not to proteins in general. If the antibody is specific for an A epitope, the presence of a molecule containing the A epitope (or free unlabeled A) in a reaction mixture containing labeled A and antibody will reduce the amount of labeled A bound to the antibody.

By the term stimulation is meant the primary response induced by the binding of a stimulatory molecule (eg, TCR/CD3 complex) to its cognate ligand, thereby mediating a signaling event such as, but not limited to, signaling through the TCR/CD3 complex. Stimulation may mediate altered expression of certain molecules, such as decreased TGF-beta expression and/or rearrangement of cytoskeletal structures, and the like.

A stimulatory molecule, as the term is used herein, means a molecule on a T cell that specifically binds to a cognate stimulatory ligand present on an antigen presenting cell.

As used herein, a stimulatory ligand means a ligand that, when present on an antigen presenting cell (e.g., aARC, dendritic cell, B cell, etc.), can specifically bind to a cognate binding partner (referred to herein as stimulatory molecule) on the T cell, thus mediating the T cell's primary response, including, but not limited to, activation, initiation of an immune response, proliferation, and the like. Stimulation ligands are well known in the art and include, but are not limited to, a class I MHC molecule loaded with a peptide, an anti-CD3 antibody, an anti-CD28 superagonist antibody, and an anti-CD2 superagonist antibody.

The term subject is intended to include living organisms in which an immune response can be elicited (eg, mammals). As used herein, the individual or patient may be a human or non-human mammal. Non-human mammals include, for example, livestock and domestic animals such as mammals that are sheep, cattle, pigs, dogs, cats, and mice. Preferably the individual is a human.

As used herein, a substantially purified cell is one that is substantially free of other cell types. A substantially purified cell also refers to a cell that has been separated from other cell types with which it is normally associated in its natural state. In some cases, a population of substantially purified cells refers to a homogeneous population of cells. In other cases, the term simply refers to a cell that has been separated from the cells with which it is naturally associated in its natural state. In certain embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.

A target site or target sequence refers to a nucleic acid genomic sequence that defines the position of a nucleic acid to which a binding molecule can specifically bind under conditions sufficient for binding to occur.

As used herein, the term T cell receptor or TCR refers to a complex of membrane proteins that are involved in the activation of T cells in response to antigen presentation. The TCR is responsible for the recognition of antigens associated with major histocompatibility complex molecules. The TCR consists of a heterodimer of alpha (α) and beta (β) chains, although in some cells the TCR consists of gamma and delta (γ/δ) chains. TCRs can exist in alpha/beta and gamma/delta forms, which are structurally similar but have distinct anatomical locations and functions. Each chain consists of two extracellular domains, a variable and a constant domain. In certain embodiments, a TCR can be modified on any cell containing a TCR, including, for example, a helper T cell, a cytotoxic T cell, a memory T cell, a regulatory T cell, a natural killer T cell, and a gamma delta T cell. .

As used herein, the term therapeutic means treatment and/or prophylaxis. The therapeutic effect is obtained as a result of suppression, remission or elimination of the condition.

- 19 040572 disease.

As used herein, the term transfected or transformed or transduced refers to the process by which an exogenous nucleic acid is transferred or introduced into a host cell. A transfected or transformed or transduced cell is a cell that has been transfected, transformed or transduced with an exogenous nucleic acid. A cell includes the primary cell under investigation and its progeny.

To treat a disease, as the term is used herein, means to reduce the occurrence or severity of at least one sign or symptom of a disease or disorder from which an individual suffers.

As used herein, the phrase under transcriptional control or operably linked means that the promoter is in a specific location and orientation relative to the polynucleotide to control the initiation of transcription by the RNA polymerase and the expression of the polynucleotide.

A vector is a composition of matter that contains an isolated nucleic acid and that can be used to deliver the isolated nucleic acid into a cell. Various vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides linked to ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term vector includes an autonomously replicating plasmid or virus. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of the nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai virus vectors, adenovirus vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, and the like.

Ranges: Throughout this description, various aspects of the invention may be presented in range format. It should be understood that the description in range format is for convenience and brevity only and should not be construed as an inflexible limitation on the scope of the invention. Thus, the description of a range should be interpreted to specifically describe all possible subranges, as well as the individual numerical values within that range. For example, a range description such as 1 to b should be interpreted to specifically describe subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 up to 6, and so on, as well as individual numbers in that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the width of the range.

Description

Generic T cells that eliminate graft-versus-host disease (GVHD) are highly desirable in clinical settings. However, the use of allogeneic T cells carries the risk of being rejected by the host's immune system through recognition of HLA-A molecules. Targeting strategies for manipulating many genes are complex, and attempts result in low efficiency in T cells without preventing GVHD and graft-versus-host disease at the same time.

The FAS receptor/FAS ligand (FAS/FASL) apoptosis signaling pathway negatively regulates T cell function. PD1 and CTLA4 are two major inhibitory signal transduction pathways in T cells. Increased antitumor immunity that results from antibody-mediated blockade

CTLA-4, PD-1 or PD-L1 confirms the possibility of improving the efficacy of immunotherapies by inhibiting these pathways. The invention relates to the production of modified T cells, where the α- and β-chain of TCR, beta-2-microglobulin, the HLA molecule, CTLA-4, PD-1 and/or FAS are depleted in order to obtain modified T cells with reduced immunogenicity.

The present invention relates to methods and compositions for producing a modified T cell by knocking down endogenous gene expression and expression of a modified T cell receptor or chimeric antigen receptor. In certain embodiments, the invention relates to a method for producing a modified T cell. Such a modified T cell may be included in a therapeutic composition and administered to a patient in need thereof.

Knockdown of endogenous gene expression

The present invention relates to a decrease in the expression of an endogenous gene in a T cell, such as a decrease in the expression of the alpha and/or beta chain of the T cell receptor (TCR), beta-2-microglobulin, CTLA-4, FAS, PD1 or major complex protein histocompatibility, such as the HLA molecule. In one embodiment, the gene down-expressing T cell has reduced immunogenicity in an allogeneic environment. In another embodiment, the T cell with reduced immunogenicity expresses a modified TCR or CAR for targeted effector activity.

In one aspect, the invention relates to a method for producing a modified T cell comprising an insertable nucleic acid into a T cell capable of repressing the expression of an endogenous

- 20 040572 gene, where the gene is selected from the group consisting of TCR α-chain, TCR β-chain, beta-2-microglobulin, HLA molecule, CTLA-4, PD1 and FAS. Suppressing the expression of an endogenous gene that is involved in generating an immune response to a cell, such as a TCR α chain, a TCR β chain, a beta-2 microglobulin, or an HLA molecule, reduces immune-mediated rejection of the modified T cell. For example, suppression of expression of endogenous TCR, MHC, or beta-2-microglobulin genes results in elimination of the presentation of alloantigens on the surface of the T cell, which can cause rejection by the host's immune system. Also, suppression of an endogenous gene that regulates inhibitory signal transduction pathways in T cells, such as CTLA-4, PD1 and/or FAS, increases the antitumor efficacy of the modified T cell when exposed to an immunosuppressive microenvironment.

In one aspect, a nucleic acid capable of repressing endogenous gene expression is introduced, such as by electroporation, transfection, or transduction with a lentivirus or other viruses, into a T cell. In another aspect, the invention provides a modified T cell comprising an electroporated nucleic acid capable of repressing the expression of an endogenous gene. In yet another aspect, the modified T cell comprises an electroporated nucleic acid capable of repressing the expression of an endogenous TCR gene. In another aspect, a composition containing a modified T cell is prepared by the method described herein. In another aspect, the invention relates to a pharmaceutical composition containing a modified T cell or a modified T cell obtained by the method described in the present description, and a pharmaceutically acceptable carrier.

A nucleic acid capable of regulating the expression of an endogenous gene can suppress the expression of an endogenous gene. In one embodiment, the nucleic acid capable of repressing endogenous gene expression is selected from the group consisting of antisense RNA, antagonistic RNA, siRNA, shRNA, and a CRISPR system. Expression of an endogenous gene can be suppressed, knocked down, reduced and/or inhibited, for example, by antisense RNA, antagonistic RNA, siRNA, shRNA, CRISPR system, etc.

CRISPR/Cas

The CRISPR/Cas system is a simple and efficient system for inducing targeted genetic changes. For target recognition by the Cas9 protein, a seed sequence in the guide RNA (gRNA) and a protospacer motif (PAM) adjacent to the protospacer motif (PAM) consisting of a conserved dinucleotide upstream of the gRNA-binding region are required. Thus, a CRISPR/CAS system can be designed to cleave virtually any DNA sequence by reconstructing gRNA in cell lines (such as 293T cells), primary cells, and CAR T cells. The CRISPR/CAS system can simultaneously target multiple genomic loci by co-expressing one CAS9 protein with two or more gRNAs, making it the only system suitable for multi-gene editing or synergistic activation of target genes.

One example of a CRISPR/CAS system used to inhibit gene expression, CRISPRi, is described in U.S. No. 2014/0068797. CRISPRi induces permanent gene disruption that uses the RNA-driven Cas9 endonuclease to introduce DNA double-strand breaks that trigger error-prone repair pathways resulting in frameshift mutations. Catalytically dead Cas9 has no endonuclease activity. When co-expressed with guide RNA, a DNA recognition complex is obtained that specifically interferes with transcriptional elongation, RNA polymerase binding, or transcription factor binding. Such a CRISPRi system effectively suppresses the expression of target genes.

Destruction of the CRISPR/Cas gene occurs when a nucleic acid guide sequence specific for the target gene is introduced into the cell, the Cas endonuclease is introduced into the cell, and a complex is formed that allows the Cas endonuclease to introduce a double strand break in the target gene. In one embodiment, the CRISPR system comprises an expression vector such as, but not limited to, the pAd5F35-CRISPR vector. In one embodiment, a modified T cell is produced by introducing a Cas expression vector and a nucleic acid guide sequence specific for a gene in the T cell. In another embodiment, the Cas expression vector induces expression of the Cas9 endonuclease. Other endonucleases may also be used, including but not limited to T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, other nucleases known in the art, and any combination thereof. .

In one embodiment, induction of a Cas expression vector comprises exposing a T cell to an agent that activates an inducible promoter in the Cas expression vector. In such an embodiment, the Cas expression vector contains an inducible promoter, such as a promoter that is induced by exposure to an antibiotic (eg, tetracycline or a tetracycline derivative, eg, doxycycline). However, it should be understood that other inducible promoters can be used. An inducing agent may be a selective condition (e.g., exposure to an agent, e.g., an antibiotic) that results in

- 21 040572 to the induction of an inducible promoter. This results in the expression of the Cas expression vector.

The nucleic acid guide sequence is specific for a gene and targets that gene for double strand breaks induced by Cas endonuclease. The nucleic acid guide sequence sequence may be located at a gene locus. In one embodiment, the length of the nucleic acid guide sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides.

The guide nucleic acid sequence may be specific for any gene, such as a gene that reduces immunogenicity or reduces sensitivity to an immunosuppressive microenvironment. In one embodiment, the gene may include a sequence specific for a T cell receptor (TCR) chain (such as alpha, beta, gamma and/or delta chain), beta-2 microglobulin, FAS, PD1, major histocompatibility complex protein (such as a class I HL molecule and/or a class II HL molecule), CTLA-4, or any combination thereof.

A guide nucleic acid sequence includes a RNA sequence, a DNA sequence, a combination thereof (a combined RNA-DNA sequence), or a sequence with synthetic nucleotides. The nucleic acid guide sequence may be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence contains a single guide RNA.

T cell receptor

Adoptive immunotherapy with T-cells carrying antigen-specific TCRs has the potential to be used in therapy for the treatment of cancer and certain chronic viral infections. Genetic engineering of T cells with a specific TCR has the advantage of redirecting the T cell to an intracellular antigen. Given that most oncogenic proteins are intracellular, the development of a panel of TCRs specific to an oncogenic protein is very attractive.

The present invention also relates to a modified T cell with reduced gene expression as described herein and an exogenous T cell receptor (TCR). In one aspect, the invention relates to a method for producing a modified T cell comprising an administered nucleic acid encoding a modified T cell receptor (TCR) having affinity for a surface antigen on a target cell in the T cell, and a nucleic acid capable of regulating the expression an endogenous gene selected from the group consisting of TCR α-chain, TCR β-chain, beta-2-microglobulin, PD1 and FAS, wherein the T cells are capable of expressing the modified TCR.

In another aspect, the invention provides a modified T cell comprising an exogenous nucleic acid encoding a modified T cell receptor (TCR) having affinity for a surface antigen on a target cell, and a nucleic acid capable of repressing the expression of an endogenous gene selected from the group, consisting of TCR α-chain, TCR β-chain, beta2-microglobulin, PD1, and FAS, wherein the T cell expresses the modified TCR and wherein the endogenous gene expression in the T cell is reduced. The invention also relates to a population of cells containing a modified T cell described in the present description.

The T cell receptor is a complex of membrane proteins that are involved in the activation of T cells in response to antigen presentation. TCR stimulation is triggered by major histocompatibility complex (MHC) molecules on antigen-presenting cells, which present antigenic peptides to T cells and bind to TCR complexes, inducing a series of intracellular signaling cascades.

The TCR typically consists of six different membrane-bound chains that form a TCR heterodimer responsible for ligand recognition. TCR exists in alpha/beta and gamma/delta forms, which are structurally similar but have distinct anatomical locations and functions. In one embodiment, the TCR comprises a TCR alpha chain and a TCR beta chain, since a nucleic acid encoding a TCR contains a nucleic acid encoding a TCR alpha chain and a TCR beta chain. In another embodiment, the TCR alpha chain or TCR beta chain or both chains are characterized by at least one N-deglycosylation.

Each chain consists of two extracellular domains, a variable and a constant domain. In one embodiment, the TCR contains at least one mouse constant region. The constant domain is proximal to the cell membrane, followed by a transmembrane domain and a short cytoplasmic tail. In one embodiment, the modified TCR contains a cytoplasmic domain containing a co-stimulatory signaling domain, such as the 4-1BB co-stimulatory signaling domain. The variable domain facilitates the identification of the particular antigen and MHC molecule for which the TCR has binding specificity. In turn, the specificity of the T cell for the unique antigen-MHC complex lies in the specific TCR expressed by the T cell.

- 22 040572

Each of the constant and variable domains may contain an intrachain disulfide bond. In one embodiment, the TCR contains at least one disulfide bond. The variable domains contain highly polymorphic loops similar to the complementarity determining regions (CDRs) of antibodies. Diversity of TCR sequences is obtained by somatic permutation of related variable (V), diverse (D), linking (J), and constant genes.

Functional polypeptides with alpha and gamma chains are formed by rearranged V-J-C regions, while beta and delta chains are composed of V-D-J-C regions. The extracellular constant domain contains a membrane proximal region and an immunoglobulin region.

In one embodiment, the TCR includes wild type TCR, high affinity TCR, and chimeric TCR. When the TCR is modified, it may have a higher affinity for the target cell surface antigen than the wild-type TCR. In embodiments where the TCR is a chimeric TCR, the TCR may contain chimeric domains because the TCR contains a costimulatory signaling domain at the C-terminus of at least one of the chains. In another embodiment, the TCR may contain a modified chain, such as a modified alpha or beta chain. Such modifications may include, but are not limited to, N-deglycosylation, an altered domain (such as an engineered variable region to target a particular antigen or increase affinity), the addition of one or more disulfide bonds, a chain or chain fragment derived from another species, and any their combination.

In one embodiment, the TCR is specific for a target cell antigen. The target cell surface antigen may include any type of ligand that defines the surface of the target cell. For example, a target cell surface antigen can be selected to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state. Thus, examples of cell surface markers that can act as ligands for the antigen-binding domain of TCRs, including TCRs associated with viral, bacterial and parasitic infections, autoimmune disease, and malignant cells. In one embodiment, the target cell surface antigen includes any tumor-associated antigen (TAA) and a viral antigen, a cell disease-associated antigen, or any fragment thereof.

The target cell antigen may include any protein that can be processed and presented by major histocompatibility complexes. For example, the target antigen may be associated with a particular disease state. Thus, examples of parasitic infections that can act as TCR targets include cellular markers associated with viral, bacterial and parasitic infections, autoimmune disease, and malignant cells. In one embodiment, the target antigen comprises any of tumor associated antigens (TAA) and viral antigens, or any fragment thereof.

In one aspect, the invention relates to a population of modified T cells comprising a nucleic acid encoding a modified T cell receptor (TCR) having affinity for a surface antigen on a target cell and a nucleic acid capable of repressing the expression of an endogenous gene selected from the group , consisting of TCR α-chain, TCR β-chain, beta-2-microglobulin, HLA molecule, CTLA-4, PD1 and FAS, where T cells are able to express the modified TCR.

Methods for constructing and expressing T cell receptors include, but are not limited to, generating TCR heterodimers that contain a native disulfide bridge that connects the respective subunits (Garboczi et al., (1996), Nature, 384(6605): 134-41; Garboczi et al., (1996), J. Immunol., 157(12): 5403-10 Chang et al., (1994), PNAS USA, 91: 11408-11412, Davodeau et al. J. Biol. Chem., 268(21): 15455-15460; Golden et al., (1997), J. Imm. Meth., 206: 163-169; US Pat. No. 6,080,840).

Chimeric antigen receptor (CAR)

The present invention also relates to a modified T cell with reduced gene expression, as described in the present description, and CAR. Thus, the present invention relates to a modified T cell containing a CAR or a nucleic acid encoding a CAR, where the CAR contains an antigen-binding domain, a transmembrane domain and an intracellular domain.

In one aspect, the invention relates to a method for producing a modified T cell containing an administered nucleic acid capable of downregulating the expression of an endogenous gene selected from the group consisting of TCR α-chain, TCR β-chain, beta-2-microglobulin, HLA molecule, CTLA4, PD1 and FAS in a T cell, and a nucleic acid encoding a chimeric antigen receptor (CAR) in a T cell, wherein the CAR contains an antigen binding domain, a transmembrane domain, and an intracellular domain of a costimulatory molecule.

In another aspect, the invention relates to a modified T cell comprising a nucleic acid capable of downregulating endogenous gene expression and a nucleic acid encoding a chi

- 23 040572 dimensional antigen receptor (CAR), where the reduced gene expression is selected from the group consisting of TCR α-chain, TCR β-chain, beta-2-microglobulin, HLA molecule, CTLA-4, PD1 and FAS, and where CAR contains an antigen-binding domain, a transmembrane domain and an intracellular domain of a costimulatory molecule. In one embodiment, the modified T cell further comprises an exogenous nucleic acid encoding a modified TCR having affinity for a surface antigen on the target cell, as described elsewhere herein. The invention also relates to a population of cells containing a modified T cell described in the present description.

One or more domains or a fragment of a CAR domain may belong to a person. In one embodiment, the present invention relates to a CAR wholly owned by a person. Nucleic acid sequences encoding the desired domains can be obtained by recombinant methods known in the art, such as, for example, screening libraries from cells expressing the gene, obtaining a gene from a vector known to contain such a gene, or isolating directly from cells and tissues containing such a gene by standard methods. Alternatively, the gene of interest may be obtained by synthesis rather than as a cloned molecule.

Examples of CARs are described in US Pat. Nos. 8,911,993; 8,906,682; 8,975,071; 8,916,381;

Antigen binding domain

In one embodiment, the CAR contains an antigen-binding domain that binds to an antigen on a target cell. Examples of cell surface markers that can act as an antigen that binds to the antigen-binding domain of CAR include cell surface markers associated with viral, bacterial and parasitic infections, autoimmune disease, and malignant cells.

The choice of antigen-binding domain depends on the type and number of antigens that are presented on the surface of the target cell. For example, an antigen binding domain can be selected to recognize an antigen that acts as a cell surface marker on a target cell associated with a particular disease state.

In one embodiment, the antigen-binding domain binds to a tumor antigen, such as an antigen that is specific for the tumor or cancer of interest. In one embodiment, the tumor antigen of the present invention comprises one or more cancer antigenic epitopes.

An antigen-binding domain may include any domain that binds to an antigen and may include, but is not limited to, a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a non-human antibody, and any fragment thereof. Thus, in one embodiment, the antigen-binding domain portion comprises a mammalian antibody or fragment thereof.

An antigen binding domain may bind to one or more antigens such as, but not limited to, CD19, CD123, CD22, CD30, CD171, CS-1 (also referred to as CD2 subgroup 1, CRACC, SLAMF7, CD319, and 19A24); lectin-like molecule 1 C type (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRvIII); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); a member of the TNF-receptor family of B-cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAca-Ser/Thr)); prostate specific membrane antigen (PSMA); tyrosine kinase-like receptor orphan 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor associated glycoprotein 72 (TAG72); CD38; CD44v6; cancer embryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); the alpha-2 subunit of the interleukin-13 receptor (IL-13Ra2 or CD213A2); mesothelin; interleukin 11 alpha receptor (IL-11Ra); prostate stem cell antigen (PSCA); serine protease 21 (testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis system antigen (Y); CD24; platelet growth factor receptor beta (PDGFR-beta); stage-specific embryonic antigen 4 (SSEA-4); CD20; alpha folate receptor; tyrosine protein kinase receptor ERBB2 (Her2/neu); cell surface-associated mucin 1 (MUC1); epidermal growth factor receptor (EGFR); neuronal cell adhesion molecule (NCAM); prostasis; acid phosphatase of the prostate (PAP); mutant elongation factor 2 (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); proteasome beta type 9 subunit (prosome, multicatalytic protease), (LMP2); glycoprotein 100 (gp100); an oncogenic fusion protein consisting of a clustered punctate break region (BCR) and murine leukemia virus Abelson oncogene (Ab1) homologue 1 (bcr-ab1); tyrosinase; receptor 2 A type ephrin (EphA2); fucosyl GM1; sial-Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); ganglioside o-acetyl-GD2 (OAcGD2); beta folate receptor; endothelial tumor marker 1 (TEM1/CD248); antigen related endothelial

- 24 040572 tumor marker 7 (TEM7R); claudin 6 (CLDN6); thyroid-stimulating hormone receptor (TSHR); group 5 G-protein coupled receptor class C, member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide region of glycoceramide globoH (GloboH); breast differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); hepatitis A virus cell receptor 1 (HAVCR1); adrenoreceptor beta 3 (ADRB3); pannexin 3 (PANX3); G-protein coupled receptor 20 (GPR20); lymphocyte antigen complex 6, locus K 9 (LY6K); olfactory receptor 51E2 (OR51E2); protein TCR gamma alternative reading frame (TARP); Wilms tumor protein (WT1); cancer/testes antigen 1 (NY-ESO-1); cancer/testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); variant 6 translocation of the ETS gene located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); member 1A of the X antigen family (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); cancer-testicular antigen 1 for melanoma (MAD-CT-1); cancer testicular antigen 2 in melanoma (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); mutant p53; protein; telomerase; prostate carcinoma tumor antigen 1 (PSTA-1 or galectin 8), melanoma antigen recognized by T-cells 1 (MelanA or MART1); mutant rat sarcoma antigen (Ras); human telomerase reverse transcriptase (hTERT); translocation breakpoints in sarcoma; melanoma apoptosis inhibitor (ML-IAP); ERG (transmembrane protease ETS fusion gene, series 2 (TMPRSS2)); N-acetylglucosaminyltransferase V (NA17); paired domain protein Pax-3 (PAX3); androgen receptor; cyclin B1; a v-myc homologue derived from the avian myelocytomatosis neuroblastoma viral oncogene (MYCN); a member of the C family of Ras homologues (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 1B1 (CYP1B1); CCCTC-binding factor-like antigen (zinc finger protein) (BORIS or Brother of the Regulator of Imprinted Sites), squamous cell carcinoma antigen recognized by T-cells 3 (SART3); paired domain protein Pax-5 (PAX5); proacrosin binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); kinase anchor protein 4 (AKAP-4); X point tear 2 in synovial sarcoma (SSX2); glycation end products receptor (RAGE-1); renal common antigen 1 (RU1); renal common antigen 2 (RU2); legumain; E6 human papillomavirus (HPV E6); E7 human papillomavirus (HPV E7); intestinal carboxylesterase; mutant heat shock protein 70-2 (mut hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); an IgA receptor Fc fragment (FCAR or CD89); a member of subfamily 2 A of the leukocyte immunoglobulin-like receptor (LILRA2); a member of the f family of CD300-like molecules (CD300LF); a member of the A family of 12 type C lectin domains (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like, hormone receptor-like 2 antigen (EMR2); lymphocytic antigen 75 (LY75); glypican 3 (GPC3); Fc receptor-like antigen 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1).

In some cases, it is preferable to obtain the antigen binding domain from the same species for which the CAR will ultimately be used. For example, for use in humans, it may be preferred that the CAR antigen-binding domain comprise a human antibody, a humanized antibody as described elsewhere herein, or a fragment thereof.

It is also preferred that the antigen binding domain be operably linked to another CAR domain, such as a transmembrane domain or an intracellular domain, as described elsewhere herein, for expression in a cell. In one embodiment, a nucleic acid encoding an antigen-binding domain is operably linked to a nucleic acid encoding a transmembrane domain and a nucleic acid encoding an intracellular domain.

transmembrane domain

With respect to the transmembrane domain, CARs can be designed to contain a transmembrane domain that connects the antigen-binding domain of the CAR to an intracellular domain. In one embodiment, the transmembrane domain is naturally associated with one or more domains in the CAR. In some instances, the transmembrane domain can be selected or modified by amino acid substitution to eliminate the binding of such domains to transmembrane domains of the same or different surface membrane proteins to minimize interaction with other membranes of the receptor complex.

The transmembrane domain can be obtained from a natural or synthetic source. When the source is natural, the domain can be derived from any membrane-bound or transmembrane protein. The transmembrane regions that find particular use in the present invention can be derived (i.e., they may contain at least transmembrane regions) from the T cell receptor alpha, beta, or zeta chain, CD28, CD3 epsilon, CD45 , CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. In some cases, a range of human hinge regions can be used, also including the Ig (immunoglobulin) hinge region.

- 25 040572 people.

In one embodiment, the transmembrane domain may be synthetic, in which case it contains predominantly hydrophobic residues such as leucine and valine.

Preferably, a triplet of phenylalanine, tryptophan and valine occurs at each end of the synthetic transmembrane domain.

intracellular domain

The intracellular domain or otherwise the cytoplasmic domain of CAR is responsible for the activation of the cell in which CAR is expressed. Thus, the term intracellular domain is intended to include any portion of the intracellular domain sufficient to transduce an activating signal. In one embodiment, the intracellular domain includes a domain responsible for effector function. The term effector function refers to a specialized function of a cell. The effector function of the T cell, for example, may be cytolytic activity or helper activity, including the secretion of cytokines.

In one embodiment, the intracellular CAR domain includes a domain responsible for signal activation and/or transduction. The intracellular domain may convey signal activation via protein-protein interactions, biochemical changes, or other response to alter the cell's metabolism, shape, gene expression, or other cellular response to activation of the chimeric intracellular signaling molecule.

Examples of an intracellular domain for use in the invention include, but are not limited to, the cytoplasmic region of the T cell receptor (TCR) and any costimulatory molecule that acts in concert to initiate signal transduction following antigen receptor interaction, as well as any derivative or variant of these elements, and any a synthetic sequence that has the same functionality. In one embodiment, the intracellular CAR domain contains dual signaling domains. Dual signal domains may contain a fragment or domain from any of the molecules described in the present description.

Examples of an intracellular domain include a fragment or domain of one or more molecules or receptors, including but not limited to TCR, CD3-zeta, CD3-gamma, CD3-delta, CD3-epsilon, CD86, total FcR-gamma, FcR- beta (Fc-epsilon R1b), CD79a, CD79b, Fc-gamma R11a, DAP10, DAP12, T cell receptor (TCR), CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, operably linked lymphocyte antigen 1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, ligand that specifically binds to CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8-alpha, CD8-beta, IL2R-beta, IL2R-gamma, IL7R-alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE/RANKL, DNAM1 (CD226) , SLAMF4 (CD244, 2B4), CD84, CD96 (tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, NKp44, NKp30, NKp46, NKG2D, other costimulatory molecules described herein description, any derivative, variant or fragment thereof, any synthetic costimulatory molecule sequence that has the same functional ability, and any combination thereof.

In one embodiment, the CAR intracellular domain comprises any portion of a costimulatory molecule, such as at least one signaling domain from CD3, CD27, CD28, ICOS, 4-1BB, PD-1, T cell receptor (TCR), any derivative thereof. or a variant, any synthetic sequence thereof that has the same functionality, and any combination thereof.

A spacer domain can be inserted between the antigen binding domain and the CAR transmembrane domain or between the intracellular domain and the CAR transmembrane domain. As used herein, the term spacer domain generally refers to any oligo- or polypeptide that functions by linking a transmembrane domain to an antigen-binding domain or an intracellular domain in a polypeptide chain. In one embodiment, the spacer domain may comprise up to 300 amino acids, preferably 10 to 100 amino acids, and most preferably 25 to 50 amino acids. In another embodiment, a short oligo- or polypeptide linker, preferably 2 to 10 amino acids in length, can form a link between the transmembrane domain and the intracellular domain of CAR. An exemplary linker includes a glycine-serine doublet.

human antibodies

It may be preferable to use human antibodies or fragments thereof using bispecific antibodies or CAR antigen-binding domains. Wholly human antibodies are particularly desirable for therapeutic treatment in human subjects. Human antibodies can be generated by a number of methods known in the art.

- 26 040572 bov, including phage display methods using a library of antibodies derived from human immunoglobulin sequences, including improvements to these methods. See also US Pat. incorporated herein by reference in its entirety. A bespecifically antibody can also includes an antibody wherein the heavy and light chains are encoded by a nucleotide sequence derived from one or more human DNA sources.

Human antibodies can also be generated using transgenic mice that are unable to express functional endogenous immunoglobulins but that can express human immunoglobulin genes. For example, human immunoglobulin heavy and light chain gene complexes can be introduced into mouse embryonic stem cells randomly or by homologous recombination. Alternatively, human variable, constant and diversity regions can be introduced into mouse embryonic stem cells in addition to human heavy and light chain genes. Mouse immunoglobulin heavy and light chain genes can be made non-functional alone or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. For example, homozygous deletion of the antibody heavy chain J segment (JH) gene in chimeric and germline mutant mice has been described as resulting in complete inhibition of endogenous antibody production. Modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then crossed to produce homozygous offspring that express human antibodies. Transgenic mice are routinely immunized with a selected antigen, eg, a complete or portion of a polypeptide of the invention. Antibodies directed against the selected target can be obtained from immunized transgenic mice using conventional hybridoma technology. Human immunoglobulin transgenes carried by transgenic mice undergo rearrangement during B cell differentiation and then undergo class switching and somatic mutation. Thus, therapeutically useful IgG, IgA, IgM and IgE antibodies, including but not limited to IgGl (gamma 1) and IgG3, can be obtained in this manner. For a review of this technology for producing human antibodies, see Lonberg and Huszar (Int. Rev. Immunol., 13:65-93 (1995)). For a detailed description of this technology for producing human antibodies and human monoclonal antibodies, and protocols for producing such antibodies, see, for example, PCT Publication Nos. WO 98/24893, WO 96/34096 and WO 96/33735 and US Pat. 5569825, 5661016, 5545806, 5814318 and 5939598, each of which is fully incorporated into the present description by reference. In addition, companies such as Abgenix, Inc. (Freemont, Calif.) and Genpharm (San Jose, Calif.) may be committed to providing human antibodies directed against a selected antigen using technology similar to the technology described above. For a specific discussion of the transfer of the human germline immunoglobulin gene array to germline mutant mice, which results in the production of human antibodies upon antigen challenge, see, for example, Jakobovits et al., Proc. Natl. Acad. sci. USA 90:2551 (1993); Jakobovits et al. Nature 362:255-258 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993) and Duchosal et al., Nature, 355:258 (1992).

Human antibodies can also be obtained from phage display libraries (Hoogenboom et al., J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581-597 (1991); Vaughan et al., Nature Biotech. 14:309 (1996)). Phage display technology (McCafferty et al., Nature, 348:552-553 (1990)) can be used to generate human antibodies and antibody fragments in vitro from immunoglobulin variable (V) gene repertoires from immunized donors. In accordance with this method, antibody V domain genes are cloned in frame into the major or minor coat protein gene of a filamentous bacteriophage, such as M13 or fd, and provided as functional antibody fragments on the surface of the phage particle. Because the filamentous particle contains a copy of the single-stranded DNA of the phage genome, selections based on the functional properties of the antibody also result in the selection of the gene encoding the antibody having those properties. Thus, the phage mimics some of the properties of the B cell. Phage display can be done in a variety of formats; for a review see, for example, Johnson Kevin S. and Chiswell David J., Current Opinion in Structural Biology, 3:564-571 (1993). For phage display, multiple sources of V-gene segments can be used. Clackson et al., Nature, 352:624-628 (1991) isolated a heterogeneous array of anti-oxazolone antibodies from a small randomized combinatorial library of V genes derived from the spleens of immunized mice. A repertoire of V genes can be constructed from immunized human donors, and antibodies to a diverse array of antigens (including self antigens) can be isolated essentially by the methods described by Marks et al., J. Mol. Biol., 222: 581-597 (1991) or Griffith et al., EMBO J., 12:725-734 (1993). See also US Pat. Nos. 5,565,332 and 5,573,905, each of which is incorporated herein by reference in its entirety.

Human antibodies can also be generated by activated B cells in vitro (see US Pat. Nos. 5,567,610 and 5,229,275, each of which is incorporated herein by reference in its entirety). Human antibodies can also be produced in vitro by hybridoma methods such as

- 27 040572 as, but not limited to, the methods described by Roder et al. (Methods Enzymol., 121:140-167 (1986)).

Humanized antibodies

Alternatively, in certain embodiments, the non-human antibody may be humanized, where specific sequences or regions of the antibody are modified to increase similarity to an antibody naturally produced in humans. For example, in the present invention, an antibody or fragment thereof may comprise a non-human mammalian scFv. In one embodiment, the antigen-binding domain portion is humanized.

The humanized antibody can be obtained by various methods known in the art, including, but not limited to, CDR transplantation (see, for example, European patent No. EP 239400; international publication No. WO 91/09967 and US patents No. 5225539, 5530101 and 5585089, each of which is incorporated herein by reference in its entirety), veneering or surface modification (see, for example, EP 592106 and EP 519596; Padlan, 1991, Molecular Immunology, 28(4/5): 489-498; Studnicka et al., 1994, Protein Engineering, 7(6): 805-814; and Roguska et al., 1994, PNAS, 91:969-973, each of which is incorporated herein by reference in its entirety), strand permutation (see ., for example, US patent No. 5565332, which is incorporated herein by reference in its entirety) and the methods described, for example, in US patent application publication No. US 2005/0042664, US patent application publication No. US 2005/0048617, US patent No. 6407213 , US patent No. 5766886, international publication No. WO 9317105, Tan et al., J. Immunol., 169:1119-25 (2002), Caldas et al., Protein Eng., 13(5):353-60 (2000), Morea et al., Methods , 20(3):267-79 (2000), Baca et al., J. Biol. Chem., 272(16): 10678-84 (1997), Roguska et al., Protein Eng., 9 (10): 895-904 (1996), Couto et al., Cancer Res., 55 (23 Supp) :5973s-5977s (1995), Couto et al., Cancer Res., 55(8):1717-22 (1995), Sandhu J S, Gene, 150(2): 409-10 (1994) and Pedersen et al. , J. Mol. Biol., 235 (3): 959-73 (1994), each of which is incorporated herein by reference in its entirety. Generally, framework residues in framework regions are replaced with the corresponding residue from the CDR of the donor antibody to alter, preferably improve, antigen binding. Such framework substitutions are identified by methods well known in the art, such as modeling interactions between CDRs and framework residues to identify framework residues important for antigen binding, and sequence comparisons to identify unusual framework residues at specific positions. (See, for example, Queen et al. US Pat. No. 5,585,089 and Riechmann et al., 1988, Nature, 332:323, which are hereby incorporated by reference in their entirety.)

A humanized antibody contains one or more amino acid residues introduced into it from a source that does not belong to a human. Such non-human amino acid residues are generally referred to as import residues, which are typically taken from the imported variable domain. Thus, humanized antibodies contain one or more CDRs from non-human immunoglobulin molecules and framework regions from a human. Humanization of antibodies is well known in the art and can essentially be carried out by the method of Winter et al. ; Verhoeyen et al., Science, 239:1534-1536 (1988)) by replacing the rodent CDRs or CDR sequences with the corresponding human antibody sequences, i. CDR grafting (EP 239.400; PCT Publication No. WO 91/09967 and US Pat. Nos. 4,816,567; 6,331,415; 5,225,539; 5,530,101; In such humanized chimeric antibodies, substantially less than an intact human variable domain was replaced with the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which such CDR residues and possibly some framework (FR) residues have been replaced with residues from similar regions in rodent antibodies. Antibody humanization can also be carried out by vining or surface modification (EP 592.106; EP 519596; Padlan, 1991, Molecular Immunology, 28(4/5): 489-498; Studnicka et al., Protein Engineering, 7(6): 805-814 (1994) and Roguska et al., PNAS, 91: 969-973 (1994)) or chain permutation (US Pat. No. 5,565,332), the contents of which are incorporated herein by reference in their entirety.

The choice of human variable domains, both light and heavy chain, to be used for the production of humanized antibodies is reduced to antigenicity. According to the so-called maximum match method, a rodent antibody variable domain sequence is screened against a complete library of known human variable domain sequences. The human sequence that is closest to the rodent sequence is then adopted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol., 151:2296 (1993); Chothia et al., J. Mol. Biol., 196:901 (1987), the contents of which are incorporated herein by reference in their entirety). Another method uses a specific framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same scaffold can be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993), the content of which is fully incorporated into the present description by reference).

Antibodies can be humanized while maintaining high affinity for the target antigen and other favorable biological properties. In accordance with one aspect of the invention, humanized antibodies are generated by a method for analyzing parental sequences and various conceptual humanized products using three-dimensional models of parental sequences and humanized sequences. Three-dimensional immunoglobulin models are widely available and well known to those skilled in the art. Computer programs are available that illustrate and reproduce probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. The study of these reproductions allows the analysis of the most likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e. analysis of residues that affect the ability of the candidate immunoglobulin to bind the target antigen. Thus, it is possible to select and combine FR residues from the recipient and import sequences so as to obtain the desired characteristics of the antibody, such as increased affinity for the target antigen. In general, CDR residues directly and most significantly affect antigen binding.

The humanized antibody retains the same antigenic specificity as the original antibody. However, certain humanization methods can increase the binding affinity and/or specificity of an antibody to a target antigen, directed evolution methods as described by Wu et al., J. Mol. Biol., 294:151 (1999), the contents of which are hereby incorporated by reference in their entirety.

Other molecules

The present invention also relates to a modified T cell described in the present description, additionally containing a costimulatory molecule or a nucleic acid encoding a costimulatory molecule. In one embodiment, the modified T cell of the invention further comprises an exogenous nucleic acid encoding a costimulatory molecule such that the modified T cell expresses the costimulatory molecule. The nucleic acid can be introduced into a T cell by T cell transduction, T cell transfection, or T cell electroporation. In another embodiment, the costimulatory molecule is selected from CD3, Cd27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L. In another embodiment, the co-stimulatory molecule comprises CD3 and contains at least two different CD3 chains, such as CD3 zeta chain and CD3 epsilon chain.

In another embodiment, the modified T cell further comprises Klf4, Oct3/4 and/or Sox2 or a nucleic acid encoding Klf4, Oct3/4 and/or Sox2 to induce T cell pluripotency. T cell pluripotency can be induced by expression of Klf4, Oct3/4 and Sox2. Klf4, Oct3/4 and Sox2 can be expressed by nucleic acid, viral vector(s) or RNA molecule(s). In one embodiment, a viral vector encoding Klf4, Oct3/4, and Sox2 is introduced into a T cell to induce pluripotency. In another embodiment, a Sendai virus vector is introduced into the T cell to induce pluripotency, wherein the Sendai virus vector encodes Klf4, Oct3/4 and Sox2.

Introduction of nucleic acids

Methods for introducing nucleic acids into a cell include physical, biological and chemical methods. Physical methods for introducing a polynucleotide, such as RNA, into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. RNA can be introduced into target cells by commercially available methods that include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or Gene Pulser II (BioRad , Denver, Colo.), Multiporator (Eppendort, Hamburg Germany) RNA can also be introduced into cells using cationic liposome-mediated transfection using lipofection, using polymer encapsulation, using peptide-mediated transfection, or using biolistic particle-based delivery systems. such as gene guns (see, for example, Nishikawa et al., Hum. Gene Ther., 12 (8): 861-70 (2001).

Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for introducing genes into mammalian cells, such as human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, US Pat. Nos. 5,350,674 and 5,585,362.

Chemical methods for introducing a polynucleotide into a host cell include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, granules, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloid system for use as a carrier in vitro and in vivo is a liposome (eg, an artificial membrane vesicle).

- 29 040572

Suitable lipids can be obtained from commercial sources. For example, dimyristylphosphatidylcholine (DMPC) can be obtained from Sigma, St. Louis, MO; dicetyl phosphate (DCP) is available from K and K Laboratories (Plainview, NY); cholesterol (Choi) can be obtained from Calbiochem-Behring; Dimyristylphosphatidylglycerol (DMPG) and other lipids are available from Avanti Polar Lipids, Inc. (Birmingham, AL). The original solutions of lipids in chloroform or chloroform/methanol can be stored at approximately -20°C. Chloroform is used only as a solvent, because it evaporates more easily than methanol. Liposome is a general term including various monolayer and multilayer lipid carriers formed by the formation of closed lipid bilayers or aggregates. Liposomes can be characterized as containing vesicular structures with a phospholipid bilayer membrane and an internal aqueous environment. Multilayer liposomes contain several lipid layers separated by an aqueous medium. They form spontaneously when phospholipids are suspended in excess aqueous solution. The lipid components undergo self-rearrangement before forming closed structures and trapping water and solutes between lipid bilayers (Ghosh et al., 1991 Glycobiology, 5:505-10). However, compositions that have other structures in solution than normal vesicular structure are also included. For example, lipids can take on a micellar structure or exist only as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also provided.

Regardless of the method used to introduce exogenous nucleic acids into the host cell or otherwise expose the cell to an inhibitor of the present invention, a number of assays can be performed to confirm the presence of nucleic acids in the host cell. Such assays include, for example, molecular biological assays well known to those skilled in the art such as Southern and Northern blotting, RT-PCR, and PCR; biochemical assays, such as detecting the presence or absence of a particular peptide, for example, by immunological methods (ELISA and Western blots) or by the assays described herein to identify agents within the scope of the invention.

In one embodiment, a nucleic acid encoding a T cell receptor (TCR) having affinity for a surface antigen on a target cell is introduced into expanded T cells. The nucleic acid encoding a TCR may be the same or a separate nucleic acid that is capable of repressing the expression of an endogenous TCR gene. A nucleic acid encoding a TCR may be introduced into a T cell simultaneously or sequentially with a nucleic acid capable of repressing the expression of an endogenous TCR gene. In one embodiment, a nucleic acid encoding a TCR is introduced prior to a nucleic acid capable of repressing the expression of an endogenous TCR gene.

In addition, nucleic acids can be administered by any means such as transduction of expanded T cells, transfection of expanded T cells, and electroporation of expanded T cells. One nucleic acid can be introduced in one way and another nucleic acid can be introduced into T cells in a different way.

PHK

In one embodiment, the nucleic acids delivered to the T cell are RNA. In another embodiment, the RNA is an mRNA that contains an in vitro transcribed RNA or a synthetic RNA. RNA is produced by in vitro transcription using a polymerase chain reaction (PCR) template. DNA of interest from any source can be directly converted by PCR into a template for in vitro mRNA synthesis using suitable primers and RNA polymerase. The DNA source may be, for example, a genomic DNA sequence, plasmid DNA, phage DNA, cDNA, synthetic DNA, or any other suitable DNA source. A desirable template for in vitro transcription is a chimeric membrane protein. By way of example, the template encodes an antibody, an antibody fragment, or a portion of an antibody. As another example, the matrix contains an extracellular domain containing the single chain variable domain of an antibody, such as an anti-CD3 antibody, and an intracellular domain of a costimulatory molecule. In one embodiment, the chimeric membrane protein RNA template encodes a chimeric membrane protein containing an extracellular domain containing an antigen-binding domain derived from an antibody to a co-stimulatory molecule and an intracellular domain derived from a portion of the CD28 intracellular domain and 4-1BB.

PCR can be used to generate a template for in vitro transcription of mRNA, which is then introduced into cells. PCR methods are well known in the art. Primers for use in PCR are designed to contain regions that are substantially complementary to regions of DNA to be used as a PCR template. Substantially complementary, as used herein, refers to nucleotide sequences where most or all of the bases in the primer sequence are complementary, or one or more bases are not complementary or are mismatched. Substantially complementary sequences are capable of annealing or hybridizing to

- 30 040572 putative target DNA under the annealing conditions used for PCR. Primers can be designed to be substantially complementary to any portion of the DNA template. For example, primers can be designed to amplify a portion of a gene that is normally transcribed in cells (open reading frame), including the 5' and 3' UTRs. Primers can also be designed to amplify a portion of a gene encoding a particular domain of interest. In one embodiment, the primers are designed to amplify the human cDNA coding region, including all or portions of the 5' and 3' UTRs. Suitable primers for PCR are prepared by synthetic methods that are well known in the art. Forward primers are primers that contain a region of nucleotides that are essentially complementary to nucleotides in the DNA template that are located upstream of the DNA sequence to be amplified. The above is used in the present description to indicate the location 5 to the DNA sequence to be amplified relative to the coding strand. Reverse primers are primers that contain a region of nucleotides that are essentially complementary to a double-stranded DNA template that are located below the DNA sequence to be amplified. Below is used in the present description to denote the localization 3' to the DNA sequence to be amplified, relative to the coding strand.

You can also use chemical structures that have the ability to increase the stability and/or efficiency of RNA translation. The RNA preferably contains 5' and 3' UTRs. In one embodiment, the length of the 5'-UTR is from zero to 3000 nucleotides. The length of the 5'- and 3'-UTR sequences to be added to the coding region can be varied in various ways, including, but not limited to, designing PCR primers that anneal to different regions of the UTR. Using this approach, a person skilled in the art can modify the length of the 5'- and 3'-UTRs necessary to obtain optimal translation efficiency after transfection of the transcribed RNA.

The 5' and 3' UTRs may be natural, endogenous 5' and 3' UTRs with respect to the gene of interest. Alternatively, UTR sequences that are not endogenous to the gene of interest can be added by introducing UTR sequences into the forward and reverse primers, or by any other modifications to the template. The use of UTR sequences that are not endogenous to the gene of interest may be useful in modifying the stability and/or efficiency of RNA translation. For example, it is known that AU-rich elements in 3'-UTR sequences can decrease mRNA stability. Thus, the 3'-UTR can be selected or designed to increase the stability of the transcribed RNA based on the properties of the UTR, which are well known in the art.

In one embodiment, the 5'-UTRs may contain the Kozak sequence of an endogenous gene. Alternatively, when a 5'-UTR that is not endogenous to the gene of interest is added by PCR as described above, the Kozak consensus sequence can be reconstructed by adding the 5'-UTR sequence.

Kozak sequences may increase the efficiency of translation of some RNA transcripts, but do not appear to be necessary for all RNAs to ensure efficient translation. Kozak sequence requirements for many and RNA are known in the art. In other embodiments, the 5'UTR can be derived from an RNA virus whose RNA genome is stable in cells. In other embodiments, various nucleotide analogs can be used to prevent exonuclease degradation of mRNA in the 3'- or 5'-UTR.

To allow synthesis of RNA from a DNA template without the need for gene cloning, a transcription promoter should be attached to the DNA template in the 3'-5' direction of the sequence to be transcribed. When a sequence is added to the 5' end of the forward primer that functions as a promoter for RNA polymerase, the RNA polymerase promoter becomes incorporated into the PCR product upstream of the open reading frame to be transcribed. In one embodiment, the promoter is a T7 polymerase promoter, as described elsewhere in this specification. Other suitable promoters include, but are not limited to, the T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for the T7, T3 and SP6 promoters are known in the art.

In one embodiment, the mRNA contains a 5' cap and a 3' poly(A) tail that determine ribosome binding, translation initiation, and cellular stability of the mRNA. On a circular DNA template, such as plasmid DNA, RNA polymerase forms a long concatemeric product that is not suitable for expression in eukaryotic cells. Transcription of plasmid DNA linearized at the 3'-UTR end results in a normal-sized mRNA that is not efficient in eukaryotic transfection even though it is polyadenylated after transcription.

On a linear DNA template, phage T7 RNA polymerase can extend the 3' end of the transcript

- 31 040572 beyond the last base of the matrix (Schenborn and Mierendorf, Nuc. Acids Res., 13:6223-36 (1985);

Nacheva and Berzal-Herranz, Eur. J. Biochem., 270: 1485-65 (2003).

The generally accepted method for integrating polyA/T fragments into a DNA template is molecular cloning. However, a polyA/T sequence integrated into plasmid DNA can cause plasmid instability, and therefore plasmid DNA templates derived from bacterial cells are often highly contaminated with deletions and other aberrations. This makes cloning methods not only laborious and time consuming, but often unreliable. It is for this reason that a method is highly desirable that allows the construction of DNA templates with 3 polyA/T fragments without cloning.

The polyA/T DNA transcription template segment can be obtained during PCR by using a reverse primer containing a polyT tail, such as a 100T tail (may be 505,000 T) or after PCR by any other method, including, but not limited to, DNA ligation or in vitro recombination. Poly(A) tails also provide RNA stability and reduce its degradation. As a rule, the length of the poly(A) tail positively correlates with the stability of the transcribed RNA. In one embodiment, the poly(A) tail is 100 to 5000 adenosines.

Poly(A) RNA tails can be further extended after in vitro transcription using a poly(A) polymerase such as E. coli polyA polymerase (E-PAP). In one embodiment, increasing the length of the poly(A) tail from 100 nucleotides to 300 to 400 nucleotides results in an approximately twofold increase in the efficiency of RNA translation. In addition, the attachment of different chemical groups to the 3' end can increase the stability of the mRNA. Such attachment may contain modified/artificial nucleotides, aptamers and other compounds. For example, ATP analogs can be introduced into the tail of the poly(A) using poly(A) polymerase. ATP analogs can further increase the stability of RNA.

5'-caps also impart stability to RNA molecules. In a preferred embodiment, the RNA produced by the methods described herein contains a 5' cap. The 5' cap is provided using methods known in the art and described herein (Cougot et al., Trends in Biochem. Sci., 29: 436-444 (2001); Stepinski et al., RNA, 7:1468- 95 (2001); Elango et al., Biochim. Biophys. Res. Commun., 330: 958-966 (2005)).

RNA produced by the methods described herein may also contain an internal ribosome binding site (IRES) sequence. The IRES sequence can be any viral, chromosomal, or engineered sequence that initiates cap-independent ribosome-mRNA binding and facilitates translation initiation. Any solute suitable for cell electroporation may be administered, which may contain factors that facilitate cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants, and surfactants.

RNA transfection

In certain embodiments, the RNA encoding the TCR is electroporated into cells. In one embodiment, the RNA encoding the TCR is an in vitro transcribed RNA.

The described methods can be used to modulate T cell activity in basic research and therapy in the field of cancer, stem cells, acute and chronic infections, and autoimmune diseases, including evaluating the ability of a genetically modified T cell to destroy a malignant target cell.

The methods also provide the ability to control the level of expression over a wide range by changing, for example, the promoter or the amount of RNA introduced, which allows individual control of the level of expression. In addition, the PCR-based mRNA production method greatly facilitates the construction of mRNAs with different structures and combinations of their domains.

One advantage of the RNA transfection methods of the invention is that RNA transfection is essentially temporary and does not involve a vector. The RNA transgene can be delivered to and expressed in a lymphocyte after a brief activation of the cell in vitro, as a minimal expression cassette without the need for any additional viral sequences. Under these conditions, integration of the transgene into the host cell genome is unlikely. Cell cloning is not mandatory due to the efficiency of RNA transfection and its ability to uniformly modify the entire lymphocyte population.

The genetic modification of T cells with in vitro transcribed RNA (IVT-RNA) uses two different strategies that have been consistently tested in various animal models.

Cells are transfected with in vitro transcribed RNA by lipofection or electroporation. It is desirable to stabilize the IVT-RNA using various modifications to obtain long-term expression of the transferred IVT-RNA.

Several IVT vectors are known in the literature that are used in a standardized manner as a template for in vitro transcription and that have been genetically modified such that stabilized RNA transcripts are produced. Current protocols used in the art are based on a plasmid vector with the following structure: a 5'-RNA polymerase promoter allowing for RNA transcription followed by a gene of interest that is 3'- and/or 5'-flanked untranslated regions (UTRs), and a 3'-polyadeny cassette containing 50-70 nucleotides A. Prior to in vitro transcription, the circular plasmid is linearized downstream of the polyadenyle cassette by type II restriction enzymes (sequence recognition corresponds to the cleavage site). Thus, the polyadenyl cassette corresponds to the last poly(A) sequence in the transcript. As a result of this procedure, some nucleotides remain as part of the enzymatic cleavage site after linearization and lengthen or mask the poly(A) sequence at the 3' end. It is still not clear whether such a non-physiological sticky end affects the amount of protein produced intracellularly from such a construct.

RNA has several advantages over more traditional plasmid or virus based approaches. No transcription is required for gene expression from a RNA source, and the protein product is rapidly produced after transfection. In addition, due to the fact that RNA has to access only the cytoplasm and not the nucleus, and thus characteristic transfection methods lead to very high transfection rates. In addition, in plasmid-based approaches, it is necessary that the promoter directing the expression of the gene of interest be active in the cells under study.

In another aspect, the RNA construct is delivered to cells by electroporation. See, for example, the formulations and methodology for electroporation of nucleic acid constructs into mammalian cells as outlined in US 2004/0014645, US 2005/0052630A1, US 2005/0070841A1, US 2004/0059285A1, US 2004/0092907A1. Various parameters, including the electric field strength required for electroporation of any known cell type, are generally known in the relevant research literature, as well as various patents and applications in the field. See, for example, U.S. Patent No. 6,678,556, U.S. Patent No. 7,171,264, and U.S. Patent No. 7,173,116. Devices for the therapeutic use of electroporation are commercially available, such as the MedPulser™ DNA Electroporation Therapeutic System (Inovio/Genetronics, San Diego, Calif.), and described in patents such as US patent No. 6567 694, US patent No. 6516223, US patent No. 5993434, US patent No. 6181964, US patent No. 6241701 and US patent No. 62 334 82; electroporation can also be used to transfect cells in vitro, as described, for example, in US 20070128708A1. Electroporation can also be used to deliver nucleic acids to cells in vitro. Thus, electroporation-mediated introduction of nucleic acids into cells, including expression constructs using any of the many electroporation devices and systems known to those skilled in the art, provides promising new means of delivering a RNA of interest to a target cell.

In one embodiment, the method includes electroporation of the RNA encoding the alpha and beta chain of the TCR. The alpha and beta chains of TCRs can be encoded on the same or separate RNA. When alpha and beta are encoded by a separate RNA, the RNA can be electroporated together.

In another embodiment, the method may further include electroporation of a nucleic acid encoding a costimulatory molecule. The co-stimulatory nucleic acid molecule can be electroporated together with the TCR RNA.

Sources of T cells

Prior to propagation, a source of T cells is obtained from the individual. Non-limiting examples of individuals include humans, dogs, cats, mice, rats, and their transgenic species. Preferably the individual is a human. T cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, and tumors. In certain embodiments, any number of T cell lines available in the art can be used. In certain embodiments, T cells can be obtained from a unit of blood collected from an individual using any number of methods known to one of skill in the art, such as ficoll separation. In one embodiment, cells are obtained from the individual's circulating blood by apheresis or leukapheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. Cells harvested by apheresis can be washed to remove the plasma fraction and placed in an appropriate buffer or medium such as phosphate buffered saline (PBS) or a wash solution that does not contain calcium and may not contain magnesium or may not contain many if not all divalent cations for subsequent processing steps. After washing, the cells can be resuspended in various biocompatible buffers such as, for example, Ca-free, Mg-free PBS. Alternatively, unwanted components of the apheresis sample can be removed and the cells directly resuspended in culture media.

In another embodiment, T cells are isolated from peripheral blood by erythrocyte lysis and monocyte depletion, eg, by PERCOLL™ gradient centrifugation.

Alternatively, T cells can be isolated from the umbilical cord. In any case, a particular subpopulation of T cells can be further isolated by positive or negative selection methods.

Cord blood mononuclear cells thus isolated can be depleted of cells expressing certain antigens, including, but not limited to, CD34, CD8, CD14, CD19, and CD56. The depletion of such cells can be carried out using an isolated antibody, a biological sample containing an antibody such as ascites, an antibody bound to a physical substrate, and an antibody bound to a cell.

Enrichment of a population of T cells by negative selection can be carried out using a combination of antibodies directed to surface markers unique to cells undergoing negative selection. A preferred method is cell sorting and/or selection by negative magnetic immune adhesion or flow cytometry, which uses a mixture of monoclonal antibodies directed to cell surface markers present on negatively selected cells. For example, to enrich CD4+ cells by negative selection, the mixture of monoclonal antibodies typically includes antibodies against CD14, CD20, CD11b, CD16, HLA-DR, and CD8.

In order to isolate the desired population of cells by positive or negative selection, the concentration and surface area of cells (eg, particles such as beads) can be varied. In certain embodiments, it may be desirable to significantly reduce the volume in which the beads and cells are mixed with each other (ie, to increase the concentration of cells), to maximize the contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells/mL is used. In one embodiment, a concentration of 1 billion cells/mL is used. In a further embodiment, more than 100 million cells/ml are used. In a further embodiment, a cell concentration of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/mL is used. In yet another embodiment, a cell concentration of 75, 80, 85, 90, 95, or 100 million cells/ml is used. In additional embodiments, concentrations of 125 or 150 million cells/ml can be used. The use of high concentrations can lead to increased cell yield, cell activation and cell proliferation.

T cells can also be frozen after a washing step that does not require a monocyte removal step. Without wishing to be bound by theory, the freezing step and subsequent thawing step provide a more uniform product by removing granulocytes and to some extent monocytes in the cell population. After a washing step that removes plasma and platelets, the cells can be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and are useful in this context, in a non-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing medium. The cells are then frozen to -80° C. at a rate of 1° per minute and stored in the gas phase of a liquid nitrogen storage tank. You can use other methods of controlled freezing, as well as uncontrolled freezing directly at -20°C or in liquid nitrogen.

In one embodiment, the T cell population is contained in cells such as peripheral blood mononuclear cells, cord blood cells, a purified T cell population, and a T cell line. In another embodiment, the peripheral blood mononuclear cells comprise a population of T cells. In yet another embodiment, the purified T cells contain a population of T cells.

Chimeric membrane protein

Typically, T cells are propagated by contact with a surface containing an agent attached thereto that stimulates the CD3/TCR complex-associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the T cells. The present invention relates to a novel method for expanding a population of T cells, comprising electroporation of T cells with RNA encoding a chimeric membrane protein and cultivation of the electroporated T cells, where the electroporated T cells in the population are expanded at least 10-fold. The chimeric membrane protein of the invention contains an extracellular and an intracellular domain. The extracellular domain contains a target-specific binding element, such as an antibody. In one embodiment, the chimeric membrane protein comprises an anti-CD3 single chain variable fragment (scFv) and an intracellular domain derived from the intracellular domain portion of CD28 and 4-1BB.

Expression of the chimeric membrane protein allows interaction with other cells in the population, such as cells that express CD3, to stimulate and activate the proliferation of electroporated T cells. Without wishing to be bound by any particular theory, cells that express CD3 may come into contact with and bind to a chimeric membrane protein that is expressed on the surface of electroporated T cells. At least one T-34040572 cell expressing the chimeric membrane protein interacts with another cell expressing CD3. This interaction stimulates the multiplication of electroporated T cells.

In one embodiment, T cells are expanded prior to endogenous gene silencing. In another embodiment, the modified T cells are propagated.

Extracellular domain

The present invention relates to an extracellular domain containing an antigen-binding domain derived from an antibody directed against a costimulatory molecule. A co-stimulatory molecule may include any molecule that co-stimulates T cells, such as, but not limited to, CD3, CD28, or a combination thereof. In one embodiment, the extracellular domain may comprise an antigen-binding domain derived from an anti-CD3 antibody, an anti-CD28 antibody, or combinations thereof. In another embodiment, the extracellular domain contains a single chain variable fragment (scFv) against CD3.

In another embodiment, the extracellular domain may comprise any portion of an antibody that binds to an antigen, including, but not limited to, the antigen-binding domain of a synthetic antibody, human antibody, humanized antibody, single domain antibody, single chain variable fragments, and fragments thereof. In some cases, it is preferred that the extracellular domain be obtained from the same species for which the chimeric membrane protein will ultimately be used. For example, for use in humans, it is preferred that the extracellular domain of the chimeric membrane protein contains a human antibody or fragment thereof. Thus, in one embodiment, the extracellular domain portion comprises a human antibody, or fragment thereof, as described elsewhere herein. Alternatively, in certain embodiments, the extracellular domain portion comprises a non-human antibody that is humanized as described elsewhere herein.

intracellular domain

The intracellular domain or cytoplasmic domain contains a costimulatory signaling region. A costimulatory signaling region refers to the intracellular domain of a costimulatory molecule. Costimulatory molecules are cell surface molecules, other than antigen receptors or their ligands, that are essential for an effective lymphocyte response to an antigen.

The cytoplasmic domain or intracellular signaling domain of the chimeric membrane protein is responsible for activating at least one of the effector functions of the T cell. Generally, while the entire intracellular signaling domain may be used, in many cases it is not necessary to use the entire chain. Where a truncated portion of the intracellular signaling domain is used, such a truncated portion may be used in place of the intact strand, provided that it converts the effector functional signal. The intracellular signaling domain contains any truncated portion of the intracellular signaling domain sufficient to convert the effector functional signal.

Non-limiting examples of intracellular signaling domains for use in a chimeric membrane protein include any portion of the intracellular domain of CD28, 4-1BB, T cell receptor (TCR), co-stimulatory molecules, any derivative or variant of such sequences, any synthetic sequence with the same functionality, and any their combination. In one embodiment, the intracellular domain comprises a portion of the intracellular domain of CD28 and 4-1BB.

Other domains of the chimeric membrane protein

Between the extracellular domain and the transmembrane domain of the chimeric membrane protein, or between the cytoplasmic domain and the transmembrane domain of the chimeric membrane protein, a spacer domain, such as an oligo or polypeptide, can be introduced that functions to link the transmembrane domain to the extracellular domain or to the cytoplasmic domain in the polypeptide chain. The spacer domain may contain up to 300 amino acids, preferably 10 to 100 amino acids, and most preferably 25 to 50 amino acids.

In certain embodiments, the chimeric membrane protein further comprises a transmembrane domain. In some embodiments, the chimeric membrane protein further comprises a hinge domain. In one embodiment, the RNA encoding the chimeric membrane protein further comprises a transmembrane and hinge domain, such as a CD28 transmembrane domain and a CD8 alpha hinge domain.

Reproduction of T cells

As demonstrated by the data described herein, T cell expansion by the methods described herein can be increased approximately 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold , 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, 2000 times, 3000 times, 4000 times, 5000 times, 6000 times, 7000 times, 8000 times, 9000 times, 10,000 times, 100,000 times, 1,000,000 times, 10,000,000 times or more, and any and all whole or fractional numbers in that range. In one embodiment, the T cells multiply in the range of about 20 to about 50 times.

After culturing, T cells can be incubated in the cell culture medium in the culture device for a certain period of time or until the cells reach confluence or high cell density for optimal passage before transferring the cells to another culture device. The culture device may be any culture device conventional for in vitro cell culture. Before transferring the cells to another culture device, the confluence level is preferably 70% or more. More preferably, the confluency level is 90% or more. The time period may be any time suitable for in vitro cell culture. The T cell medium can be changed during T cell culture at any time. Preferably, the T cell medium is changed approximately every 2 to 3 days. The T cells are then harvested from the culture medium, after which the T cells can be used immediately or cryopreserved for storage for use at any time later. In one embodiment, the invention relates to cryopreservation of expanded T cells. Cryopreserved T cells are thawed prior to the introduction of nucleic acids into the T cell.

In another embodiment, the method includes isolating T cells and expanding the T cells. In another embodiment, the invention further includes cryopreservation of T cells prior to expansion. In yet another embodiment, cryopreserved T cells are thawed for electroporation of the RNA encoding the chimeric membrane protein.

Another method for expanding ex vivo cells is described in US patent No. 5199942 (included in the present description by reference). Reproduction, such as described in US patent No. 5199942, may be an alternative or addition to other methods of reproduction described in the present description. Briefly, ex vivo cultivation and expansion of T cells involves the addition of cell growth factors such as those described in US Pat. No. 5,199,942 or other factors such as flt3-L, IL-1, IL-3 and c kit. In one embodiment, expansion of T cells comprises culturing T cells with a factor selected from the group consisting of flt3-L, IL-1, IL-3, and c-kit ligand.

The culture step as described herein (contacting agents as described herein or after electroporation) can be very short, such as less than 24 hours, such as 1, 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours. described herein) may be longer, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more days.

Various terms are used to describe cells in culture. Cell culture generally refers to cells harvested from a living organism and grown under controlled conditions. Primary cell culture is a culture of cells, tissues or organs obtained directly from the body and prior to the first subculturing. Cells are expanded in culture when they are placed in a growth medium under conditions that facilitate cell growth and/or division, resulting in a larger population of cells. When cells are propagated in culture, the rate of cell proliferation is generally measured by the amount of time it takes for the number of cells to double, otherwise known as the doubling time.

Each cycle of subculture is designated as a passage. When cells are subcultured, they are designated as seeded. A particular cell population or cell line is in some instances designated or characterized by the amount of time it has been passaged. For example, a cultured cell population that has been plated ten times may be referred to as a P10 culture. The primary culture, i.e., the first culture after cell isolation from the tissue, is designated P0. After the first subculture, the cells are described as a secondary culture (P1 or passage 1). After the second subculture, the cells become tertiary culture (P2 or passage 2), and so on. Those skilled in the art will appreciate that there may be many population doublings during the seeding period; thus the number of culture population doublings is greater than the number of passages. Cell proliferation (ie, the number of population doublings) during the period between passages depends on many factors, including, but not limited to, seeding density, substrate, medium, and time between passages.

In one embodiment, cells can be cultured for several hours (from about 3 hours) to about 14 days, or any integer number of hours in that range. Conditions suitable for culturing T cells include suitable media (e.g., minimal maintenance or RPMI 1640 or, X-vivo 15, (Lonza)), which may contain factors necessary for proliferation and viability, including serum (e.g., fetal calf or human serum), interleukin 2 (IL-2), insulin, IFN-gamma, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-beta and TNF -α, or any other cell growth supplement known to the person skilled in the art. Other cell growth additives include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetylcysteine and

- 36 040572

2-mercaptoethanol. Medium may include RPMI 1640, AIM-V, DMEM, MEM, α-MEM, F-12, X-Vivo 15 and X-Vivo 20, Optimizer with added amino acids, sodium pyruvate and vitamins, without serum or supplemented with an appropriate amount of serum ( or plasma) or a certain set of hormones, and/or an amount of cytokine(s) sufficient for the growth and reproduction of T cells. Antibiotics, such as penicillin and streptomycin, are administered only to experimental cultures, not to cell cultures that must be infused into an individual. Target cells are maintained under conditions necessary to support growth, eg at a suitable temperature (eg 37° C.) and atmosphere (eg air plus 5% CO ₂ ).

The medium used for culturing T cells may contain an agent that can co-stimulate T cells. For example, an agent that can stimulate CD3 is an anti-CD3 antibody, and an agent that can stimulate CD28 is an anti-CD28 antibody. This is because, as demonstrated by the data described herein, a cell isolated by the methods described herein can be propagated approximately 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, 2000 times, 3000 times, 4000 times, 5000 times, 6000 times , 7000 times, 8000 times, 9000 times, 10000 times, 100000 times, 1000000 times, 10000000 times or more. In one embodiment, T cells are expanded in the range of about 20 times to about 50 times or more by culturing an electroporated population.

In one embodiment, the method includes introducing a nucleic acid encoding a T cell receptor (TCR) having affinity for a surface antigen on a target cell into expanded T cells and electroporating RNA encoding a costimulatory molecule into T cells, where the electroporated T cells cells are able to express TCR and a co-stimulatory molecule.

In another embodiment, the method further comprises stimulating proliferating T cells with at least one costimulatory molecule selected from the group consisting of CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1, and PD1L. The stimulation may include co-electroporation of an RNA encoding a costimulatory molecule. In such an embodiment, the expanded T cells further electroporate or co-electroporate the RNA encoding CD3. CD3 contains at least two different CD3 chains, such as the CD3 zeta chain and the CD3 epsilon chain.

In another embodiment, the T cell expansion method may further comprise isolating the expanded T cells for further uses. In yet another embodiment, the expansion method may further comprise subsequent electroporation of the expanded T cells followed by culturing. Subsequent electroporation may involve introducing a nucleic acid encoding an agent, such as transduction of expanded T cells, transfection of expanded T cells, or electroporation of expanded T cells with a nucleic acid encoding a TCR, into a population of expanded T cells, where the agent further stimulates the T cell . The agent may stimulate T cells, such as by stimulating further reproduction, effector function, or other T cell function. In one embodiment, the nucleic acid agent is coelectroporated with the RNA of a chimeric membrane protein. In another embodiment, the nucleic acid means, such as TCR RNA, is electroporated after culturing the electroporated population. In a further embodiment, a nucleic acid agent, such as TCR RNA, is electroporated into expanded T cells that have been cryopreserved.

Therapy

The modified T cells described herein can be administered in compositions for therapy. The composition may contain a pharmaceutical composition and further contain a pharmaceutically acceptable carrier. A therapeutically effective amount of a pharmaceutical composition containing modified T cells may be administered.

In one aspect, the invention relates to a method of inducing a T cell-mediated immune response to a target cell or tissue in an individual, comprising administering to the individual an effective amount of the modified T cell. In this embodiment, the T cell is modified as described elsewhere in the present specification. Modified T cells can be administered to induce lysis of a target cell or tissue, for example, where the induced lysis is antibody-dependent cellular cytotoxicity (ADCC).

In another aspect, the invention provides a method of adoptive cell transfer therapy comprising administering an effective amount of a pharmaceutical composition comprising a modified T cell as described herein to an individual in need thereof to prevent or treat an immune response that is unfavorable to the individual.

In yet another embodiment, a method of treating a disease or condition associated with increased immunity in an individual, comprising administering an effective amount of a pharmaceutical composition containing a modified T cell described in the present description,

- 37 040572 to the individual in need.

Modified T cells, obtained as described in the present description, may be homogeneous and have the function of T cells. In addition, modified T cells can be administered to an animal, preferably a mammal, even more preferably a human, to provide suppression of an immune response, such as the immune response common in autoimmune diseases such as diabetes, psoriasis, rheumatoid arthritis, multiple sclerosis, GVHD, increased induction allograft tolerance, graft rejection, and the like. In addition, the cells of the present invention can be used to treat any condition in which a reduced or otherwise inhibited immune response, especially a cell-mediated immune response, is desirable to treat or alleviate a disease. In one aspect, the invention relates to the treatment of a condition, such as an autoimmune disease in an individual, comprising administering to the individual a therapeutically effective amount of a pharmaceutical composition comprising a modified T cell as described herein.

Examples of an autoimmune disease include, but are not limited to, acquired immune deficiency syndrome (AIDS, which is a viral disease with an autoimmune component), alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune disease of the internal ear (AIED), autoimmune lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behçet's disease, cardiomyopathy, celiac disease dermatitis herpetiformis; chronic fatigue and immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy (CIPD), scarring pemphigoid, cold agglutinin disease, CREST syndrome, Crohn's disease, Dego's disease, juvenile dermatomyositis, discoid lupus, mixed primary cryoglobulinemia, fibromyalgia fibromyositis, Graves' disease , Guillain-Barré syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, insulin-dependent diabetes mellitus, juvenile chronic arthritis (Still's disease), juvenile rheumatoid arthritis, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, pernicious anemia, periarteritis nodosa, polychondria, polyglandular syndromes, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever adku, rheumatoid arthritis, sarcoidosis, scleroderma (progressive systemic sclerosis (PSS), also known as systemic sclerosis (SS)), Sjögren's syndrome, stiff man syndrome, systemic lupus erythematosus, Takayasu's arteritis, temporal arteritis/giant cell arteritis, ulcerative colitis, uveitis , vitiligo and Wegener's granulomatosis.

T cells obtained as described herein can also be modified and used to treat inflammatory disorders. Examples of inflammatory disorders include, but are not limited to, chronic and acute inflammatory disorders. Examples of inflammatory disorders include Alzheimer's disease, asthma, atopic allergy, allergy, atherosclerosis, bronchial asthma, eczema, glomerulonephritis, graft versus host disease, hemolytic anemias, osteoarthritis, sepsis, stroke, tissue and organ transplantation, vasculitis, diabetic retinopathy, and ventilator-induced lung damage.

In another embodiment, the modified T cell described herein can be used to produce a medicament for treating an immune response in an individual in need thereof.

The cells of the invention can be administered at doses and routes and at times to be determined in preclinical and clinical studies and trials. Cell compositions can be administered multiple times at doses within these ranges. Administration of the cells of the invention may be combined with other methods useful in treating the desired disease or condition, as determined by those skilled in the art.

The cells of the invention to be administered may be autologous, allogeneic, or xenogeneic to the individual being treated.

The introduction of cells according to the invention can be carried out by any conventional method known to experts in this field. The cells of the present invention can be administered to an individual by aerosol inhalation, injection, ingestion, blood transfusion, implantation, or transplantation. The compositions described herein can be administered to a patient transarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (IV) injection, or intraperitoneally. In other cases, the cells of the invention are injected directly into a site of inflammation in an individual, a local site of disease in an individual, a lymph node, an organ, a tumor, and the like.

The cells described herein can also be administered using any number of templates. The present invention uses such matrices in a new context of action as an artificial lymphoid organ to maintain, preserve or modulate the immune system,

- 38 040572 usually by modulating T cells. Thus, matrix compositions and formulations that have been shown to be useful in tissue culture technology can be used in the present invention. Thus, the type of matrix that can be used in the compositions, devices and methods of the invention is practically unlimited and can include both biological and synthetic matrices. In one specific example, the compositions and devices described in US Pat. The matrices have features commonly associated with biocompatibility when administered to a mammalian host. Matrices can be formed from natural and/or synthetic materials. The matrices may not be biodegradable in cases where it is desirable to leave permanent structures or removable structures in the animal body, such as an implant; or may be biodegradable. The matrices may take the form of sponges, implants, tubes, Telfa pads, fibers, hollow fibers, lyophilized components, gels, powders, porous compositions, or nanoparticles. Additionally, matrices can be designed to provide sustained release of seeded cells or produced cytokine or other active agent. In certain embodiments, the matrix of the present invention is flexible and resilient and can be described as a semi-rigid framework that is permeable to substances such as inorganic salts, aqueous liquids, and dissolved gaseous agents, including oxygen.

The matrix is used in the present description, as an example of a biocompatible substance. However, the present invention is not limited to matrices and thus, where the term matrix or matrices appears, these terms should be read to include devices and other substances that provide cell retention or cell passage, are biocompatible, and are capable of allowing macromolecules to pass directly through substance, because the substance itself is a semi-permeable membrane, or it can be used in combination with a specific semi-permeable substance.

Pharmaceutical compositions

Pharmaceutical compositions of the present invention may contain a modified T cell as described herein in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may contain buffers such as neutral buffered saline, phosphate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (eg aluminum hydroxide); and preservatives. The compositions of the present invention are preferably formulated for intravenous administration.

Pharmaceutical compositions of the present invention may be administered according to the disease to be treated (or prevented). The amount and frequency of administration is determined by such factors as the condition of the patient and the type and severity of the patient's disease, although suitable doses may be determined by clinical trials.

When an immunologically effective amount, an anti-immune response effective amount, an immune response-suppressing effective amount, or a therapeutic amount is indicated, the physician may determine the exact amount of the compositions of the present invention to be administered, taking into account individual differences in age, weight, immune response, and condition of the patient. (individual). In general, it can be stated that a pharmaceutical composition containing the modified T cells described herein can be administered at a dose of ¹⁰⁴ to ¹⁰⁹ cells/kg body weight, preferably 105 to 106 cells/kg body weight, including all integer values in these ranges. The T cell compositions can also be administered multiple times at these doses. Cells can be administered using infusion techniques that are well known in immunotherapy (see, for example, Rosenberg et al., New Eng. J. of Med. 319: 1676, 1988). One skilled in the art can readily determine the optimal dosage and treatment regimen for a particular patient by monitoring the patient for signs of disease and thus adjusting treatment.

In certain embodiments, it may be desirable to administer activated T cells to an individual and then redraw blood (or perform apheresis), activate T cells from it according to the present invention, and re-infuse the patient with these activated and expanded T cells. This process can be repeated many times every few weeks. In certain embodiments, T cells can be activated from 10 ml to 400 ml blood draws. In certain embodiments, T cells are activated from 20, 30, 40, 50, 60, 70, 80, 90, or 100 ml blood draws. Without wishing to be bound by theory, the use of such a multiple draw/multiple infusion protocol may result in the exclusion of certain T cell populations.

In certain embodiments of the present invention, cells expanded and modified using the methods described in the present description, or other known in this field

- 39 040572 methods, where T cells are expanded to therapeutic levels, administered to the patient in combination with (for example, before, simultaneously or after) any number of appropriate treatments, including, but not limited to, treatment with agents such as antiviral therapy, treatment with cidofovir and interleukin 2, cytarabine (also known as ARA-C), or natalizumab for patients with MS, or treatment with efalizumab for patients with psoriasis, or other treatments for patients with PML. In further embodiments, the T cells of the invention may be used in combination with chemotherapy, radiotherapy, immunosuppressive agents such as cyclosporine, azathioprine, methotrexate, mycophenolate, and FK506, antibodies, or other immunodestructive agents such as CAMPATH, anti-CD3 antibodies, or other therapies. based on antibodies, cytoxin, fludarabine, cyclosporine, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines and irradiation. These drugs inhibit calcium-dependent calcineurin phosphatase (cyclosporine and FK506) or inhibit p70S6 kinase, which is important for growth factor-induced signaling (rapamycin). (Liu et al., Cell, 66: 807-815, 1991; Henderson et al., Immun., 73: 316-321, 1991; Bierer et al., Curr. Opin. Immun., 5:763-773, 1993). In a further embodiment, cell compositions of the present invention are administered to a patient in combination with (e.g., before, concurrently, or after) bone marrow transplantation, T-cell ablative therapy using chemotherapeutic agents such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide or antibodies such as OKT3 or CAMPATH. In another embodiment, the cell compositions of the present invention are administered following B cell ablative therapy, such as agents that interact with CD20, such as Rituxan. For example, in one embodiment, individuals may receive standard treatment with high doses of chemotherapy followed by transplantation of peripheral blood stem cells. In certain embodiments, after transplantation, individuals receive an infusion of expanded immune cells of the present invention. In a further embodiment, the expanded cells are administered before or after surgery.

The dose of the above treatments to be administered to a patient varies depending on the precise nature of the condition being treated and the recipient of the treatment. Dose scaling for human administration can be performed in accordance with accepted practice in the art. The dose of CAMPATH, for example, is typically in the range of about 1 to about 100 mg for an adult patient, typically administered every day for a period of 1 to 30 days. The preferred daily dose is from 1 to 10 mg per day, although higher doses up to 40 mg per day can be used in some cases (described in US patent No. 6120766).

It should be understood that the method and compositions that will be useful in the present invention are not limited to the specific compositions indicated in the examples. The following examples are formulated to provide those skilled in the art with a thorough understanding and description of how to obtain and use the cells, propagation and culture methods, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors consider to be their own. invention.

In the practice of the present invention, unless otherwise indicated, conventional methods of molecular biology (including recombinant methods), microbiology, cell biology, biochemistry and immunology are used, which are within the competence of a person skilled in the art. Such methods are fully described in literature such as Molecular Cloning: A Laboratory Manual, Fourth Edition (Sambrook, 2012); Oligonucleotide Synthesis (Gait, 1984); Culture of Animal Cells (Freshney, 2010); Methods in Enzymology Handbook Methods in Enzymology (Weir, 1997); Gene Transfer Vectors for Mammalian Cells (Miller and Calos, 1987); Short Protocols in Molecular Biology (Ausubel, 2002); Polymerase Chain Reaction: Principles, Applications and Troubleshooting, (Babar, 2011); Current Protocols in Immunology (Coligan, 2002). These methods can be used to obtain polynucleotides and polypeptides according to the invention and as such they can be considered in the implementation and practice of the invention. Particularly suitable methods of specific embodiments are discussed in the sections that follow.

Experimental examples

The invention is further described in detail by reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise indicated. Thus, the invention should not be considered in any way to be limited to the following examples, but rather should be considered to include any and all changes that will become apparent as a result of the teachings provided herein.

Without further description, it is believed that one skilled in the art can, using the foregoing description and the following illustrative examples, make and use the compounds of the present invention and practice the claimed methods. Thus, the following illustrative examples specifically indicate the preferred embodiments of the present invention, and should not be construed as limiting how

- 40 040572 or the rest of the invention.

The materials and methods used in these experiments are described below.

Primary human lymphocytes.

Primary lymphocytes were stimulated with microbeads coated with anti-CD3 and CD28 stimulatory antibodies (Life Technologies, Grand Island, NY, Catalog) as described (Human gene therapy, 2011, 22(12):1575-1586). T cells were cryopreserved on day 10 in a solution of 90% fetal calf serum and 10% dimethyl sulfoxide (DMSO) at 1 x 10 ⁸ cells/vial.

NALM-6 was purchased from the German DSMZ Cell Collection (DSMZ catalog code: ACC 128). K562 and PC3 were purchased from the American Type Culture Collection. The 624mel melanoma line was obtained from the Surgery Branch (NCI/NIH). All cell lines were cultured as directed and routinely tested for mycoplasma contamination and confirmed as negative.

Preparation of TCR constructs for mRNA electroporation and transduction with lentivirus. 1G4 NYESO-1 TCR with various mutations (1G4 and 8F) and CAR (PSCA or CD19) were synthesized and/or amplified by PCR based on sequencing information provided in relevant publications (The Journal of experimental medicine, 2005, 201 (8): 1243 -1255; J. Immunol., 2008, 180(9):61166131) and subcloned into pGEM.64PHK vector or pTRPE lentiviral vectors.

Obtaining Primary Human T Cells

Primary human CD4 and CD8 T cells were isolated from healthy volunteer donors after leukapheresis by negative selection using RosetteSep kits (Stem Cell Technologies, Vancouver BC, Canada). All samples were collected according to a protocol approved by the expert board of the University organization, and written informed consent was obtained from each donor.

CRISPR design and construction

Cas9 DNA was synthesized by PCR, then introduced into the PGEM vector. gRNA was selected at GN19 with a PAM NGG region, with some selected from N20 with a PAM NGG region. All gRNAs contained complementary sequences containing more than 13 erroneous base pairs, with possible excluded sections of non-target mRNAs (Table 1). The gRNA was constructed as shown in FIG. 1A and synthesized by overlapping PCR. All gRNA PCR products were ligated into the MSGV vector. In vitro transcribed CAS9 and gRNA targeting the constant regions of the α-, β-chains of TCR and beta-2 microglobin. The gRNA is designed to target a sequence in exon 1 of the a TCR constant region, a consensus sequence common to exon 1 of constant regions 1 and 2 of β TCR, beta-2-microglobulin, or PD1. The gRNA coding sequences were assembled using overlap PCR and cloned into the MSGV vector containing the T7 promoter. These plasmids were linearized with EcoRI. gRNA was transcribed in vitro. Cas9 and RNA were transcribed in vitro using the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies, Carlsbad, CA). mRNA was stored at -80°C in disposable nuclease-free vials. The gRNA guide sequences used for animal studies were as follows:

TRAC-gRNA: TGTGCTAGACATGAGGTCTA, SEQ ID NO:1

TRBC-gRNA: GCAGTATCTGGAGTCATTGA, SEQ ID NO:2

B2M-gRNA: CGCGAGCACAGCTAAGGCCA, SEQ ID NO:3 PDl-rPHK: GGCGCCCTGGCCAGTCGTCT, SEQ ID NO:4 FAS-gRNA: GAGGGTCCAGAATGCCCAGCA, SEQ ID NO:5

flow cytometry.

The following monoclonal antibodies and reagents were used with the specified specificity and appropriate isotype controls. From BD Biosciences (San Jose, CA): APC-conjugated anti-CD3 (555335), FITC anti-CD8 (555366), PE anti-CD8 (555635), FITC anti-CD27 (555440), PE anti-CD107 (555801), anti-beta-2-microglobin PE (551337), anti-HLA FITC (555552); Biolegend (San Diego, CA) : FITC anti-CD45RO(304204), APC anti-CD62L(304814), APC anti-CCR7(353214), and Beckman Coulter (Pasadena, CA): PE anti-Vb13.1 (IM2021U). Data were recorded on FACS Accuri (BD Biosciences, San Jose, CA) using CellQuest version 3.3 (BD Biosciences, San Jose, CA) and analyzed with FCS Express version 3.00 (De Novo Software, Los Angeles, CA) or FlowJo version 7.6. 1 Tree Star, Inc. Ashland, OR).

Propagation of primary T cells

Primary human T cells were cultured in RPMI 1640 supplemented with 10% FCS, 100 U/mL penicillin, 100 g/mL streptomycin sulfate, 10 mM Hepes, and stimulated with anti-CD3/anti-CD28 antibody-coated magnetic beads on a cell-to-bead basis. 1:3. Cells were counted and fed every 2 days and after T cells were at rest, as determined by reduced growth kinetics and cell size, T cells were used for functional assays or cryopreserved.

- 41 040572

Obtaining CD3-negative T cells.

Supercoiled plasmids were linearized with SpeI and EcoRI, respectively. gRNA was transcribed in vitro with the T7 MCcript™ Standard mRNA Production System (Cambio, C-MSC100625, Cambridge, England) . All mRNAs (Cas9, TCRα, TCRe and CAR) were transcribed in vitro using the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies, AM1345, Carlsbad, CA). Prior to electroporation, T cells were stimulated with Dynabead CD3/CD28 for three days. Ten million primary T cells were subjected to bead clearance prior to electrotransfer of 20 μg Cas9, 10 μg gRNA molecules into cells at 360 V, 1 ms with BTX830, followed by a second and/or third electrotransfer of 10 μg gRNA. Also, T cells were washed three times with OPTI-MEM and resuspended in OPTI-MEM (Invitrogen) at a final concentration of 1-3x10 ⁸ cells/ml. Then 0.1 ml of cells were mixed with 10 μg of RNA IVT (or as indicated) and electroporated in a 2 mm cuvette. Ten million primary T cells were subjected to bead clearing prior to electrotransfer of 20 μg Cas9 and 10 μg gRNA molecules into cells using a BTX830 (Harvard Apparatus BTX) at 360 V and 1 ms; this process was followed by a second and third electrotransfer of 5 μg gRNA 12 to 24 h later.

After electroporation, cells were immediately placed in 2 ml of prewarmed culture media and cultured at 37°C, 5% CO ₂ or 32°C, 5% CO ₂ for 1 day, then returned to 37°C, 5% CO ₂ .

Double destruction of TCR α and β or triple destruction of TRAC, TRBC and B2M.

To obtain TCR α and β double knockout T cells, Cas9 mRNA was co-electroporated with two different gRNAs directed to the TCR α-chain (TRAC) and the TCR β-chain (TRBC). TCR α- and β double-knockout T cells could be purified in 2 steps: 1) depletion of TCR-positive and α-chain single-knockout cells with anti-CD3 antibody microbeads after electroporation of TCR 1G4 α-chain RNA, and 2) depletion of cells with one TCR β-chain knockout by anti-CD3 antibody microbeads after RNA electroporation of the TCR β-chain. For triple disruption of TRAC, TRBC and B2M, T cells were electroporated with Cas9 mRNA and gRNA directed to TCR α and β chains and beta 2 microglobulin 3 days after stimulation with anti-CD3/CD28 antibody beads. The HLAI-negative cell population was enriched on day 9 and electroporated with TCR α-chain RNA. The TCR-negative population was enriched on day 10. Five days later, these cells were electroporated with TCR β-chain RNA and the TCR-negative cell population was sorted the following day to obtain universal T cells. On day 18, TCR or CAR RNA was electroporated into universal T cells to obtain universal effector cells. At each step, the expression of TCR and HLA-1 molecules was confirmed.

Obtaining universal CART cells.

Universal CART cells were generated by a combination of CD19 or PSCCAR lentivirus transduction with RNA CRISPR/gRNA electroporation. 1 day after stimulation with anti-CD3/CD28 antibody beads, T cells were transduced with lentivirus-CD19 or PSCCAR. After 2 days, Cas9 and gRNA directed to the α-, β-chain of TCR, B2M, PD1 were electroporated into T cells. Six days after CRISPR delivery, CD3, HLA-I, PD1 negative T cells were sorted by microbead depletion.

Enrichment of CD3-negative T cells.

Cells washed with Auto MACS buffer were incubated for 30 min with CD3 microbeads (Miltenyi Biotec, 130-050-101, Auburn, CA) at 4°C. After washing twice, the cells were passed through an LD column (MiltenyiBiotec, 130-042-901, Auburn, CA) and a fraction of the filtrate was collected for further use. CD3 expression of CD3-negative T cells was restored by co-electroporation of α- and β 1G4TCR mRNA and cells expanded using the Rapid Expansion Protocol (REP), Dynabead CD3/CD28, or K562-based aAPC.

Obtaining and propagation of CD3-negative T-cells.

CD3-negative T cells were characterized by expression of CD3, electrotransfer-reconstituted exogenous in vitro transcribed mRNA of 1G4TCR alpha chain and TCR beta chain (5 μg for each chain). These cells were propagated using a single rapid propagation protocol (REP). PBMCs from three different donors: ND052 105x106, ND405 83x106, ND410 136x106 were irradiated then mixed together to give a total of 324x106 PBMCs. The PBMCs were resuspended in a final volume of 90 ml, then R10 was added to 300 ml, mixed and divided into two T150 ml flasks. OCT was added to a final concentration of 30 ng/mL. On day 2, IL-2 was added up to 50 U/ml. On day 5, cells were counted and fed every 2 days, and after the T cells were at rest, as determined by reduced growth kinetics and cell size, they were used for functional analyzes or cryopreserved.

Sanger sequencing.

The level of genomic degradation of TCR α-chain (TRAC), TCR β-chain 1 (TRBC1), and TCR β-chain 2 (TRBC2) in T cells was determined using the Surveyor Nuclease assay (Transge-42 040572 nomics, Omaha , N.E.). The target destruction percentage was quantified by densitometry. The PCR primers used to amplify the target locus were:

TRAC straight, 5'-TCATGTCCTAACCCTGATCCCTCTT-3' SEQ ID NO: 6

TRAC reverse, 5'-TTGGACTTTTCCCAGCTGACAGA-3' SEQ ID NO:7

TRBC total straight, 5'-TACCAGGACCAGACAGCTCTTAGA-3' SEQ ID

NO: 8

TRBC common reverse, 5'-TCTCACCTAATCTCCTCCAGGCAT-3' SEQ ID

NO: 9

The PCR products were purified and ligated with TOPO cloning vector (Invitrogen), then transformed into E. coli. One clone was punctured and sequenced to calculate insertion-deletion mutations.

Obtaining siRNA and CRISPRi for electroporation. Duplex RNA directed to TCR constant regions for alpha (5'rArGrGrArGrGrArUrUrCrGrGrArArCrCrCrArArUrCrArCrUrGrArC-3' SEQ ID

NO:10 and 5'-rCrArGrUrGrArUrUrGrGrGrUrUrCrCrGrArArUrCrCrUrCCT-3'

SEQ ID NO:11) or beta (5'rArCrCrUrCrCrUrUrCrCrCrArUrUrCrArCrCrArCrCrArGrCrUrC-3' SEQ ID NO:12 and 5'-rGrCrUrGrGrUrGrGrGrUrGrArArUrGrGrGrArArGrGrArGGT-3' SEQ ID NO:13) were designed using Custom RNAI Design Tool, DNAIntegirated Design ) and synthesized siRNA (Integrated DNA Technologies, Coralville, IA). siRNA for TCR alpha and beta were mixed and electroporated into stimulated T cells to knock down endogenous TCR.

Transcription of mRNA in vitro and electroporation of T cells.

T7 mscript systems kit (CellScript) was used to obtain in vitro transcribed RNA (IVT). CD3/CD28 bead stimulated T cells were electroporated with RNA IVT using BTX EM830 (Harvard Apparatus BTX) as previously described (Cancer research., 2010, 70(22):9053-9061). Briefly, T cells were washed three times and resuspended in OPTI-MEM (Invitrogen) at a final concentration of 1-3x108 cells/ml. Then 0.1 ml of cells were mixed with 10 μg of RNA IVT (or as indicated) and electroporated in a 2 mm cuvette.

ELISA assays.

Target cells, various tumor cell lines expressing CD19, were washed and suspended at 1x10 ⁶ cells/ml in R10 medium (RPMI 1640 supplemented with 10% fetal calf serum; Invitrogen). 100 μl of each target cell type was added in duplicate to a 96 well round bottom plate (Corning). Effector T cells were washed and resuspended at 1x106 cells/ml in R10 medium, and then 100 μl of T cells were combined with target cells in the indicated wells. In addition, wells containing T cells alone were prepared as a control. The plates were incubated at 37° C. for 18-20 hours. After incubation, the supernatant was collected and subjected to ELISA analysis (eBioscience).

CD107a staining.

Cells were seeded at a 1:1 effector cell:T cell ratio (1x10 ⁵ effectors to 1x105 targets) in 160 μl of complete RPMI medium in a 96-well plate. 20 µl of phycoerythrin-labeled anti-CD107a antibody (BD Biosciences, 555801) was added and the plate was incubated at 37°C for 1 hour before adding Golgi Stop (2 µl of Golgi Stop in 3 ml of RPMI medium, 20 µl/well; BD Biosciences, 512092KZ) and incubating the plate for another 2.5 hours. Then, 5 μl of anti-CD8 FITC antibody and 5 μl of anti-CD3 APC antibody were added and incubated at 37° C. for 30 minutes. After incubation, the samples were washed with FACS buffer and analyzed by flow cytometry.

Luciferase based CTL assay.

Received tumor cells Nam16-CBG and used in a modified version of the analysis of cytotoxic T-lymphocytes based on luciferase. Briefly, the click beetle green luciferase (CBG) gene was cloned into the pELNS vector, packaged in a lentivirus, transduced into Nam16 tumor cells, and sorted for CBG expression. The resulting Nam16-CBG cells were washed and resuspended at 1x105 cells/ml in R10 medium and 100 µl of CBG labeled cells were incubated with various ratios of T cells (e.g. 30:1, 15:1, etc.) overnight at 37 °C. 100 μl of the mixture was transferred to a 96-well white luminometer plate. 100 µl of the substrate was added to the cells and the luminescence was immediately determined. Results are shown as percent cytolysis based on luciferase activity in wells with tumor cells but not T cells (% cytolysis=100((RLU from well with co-culture of effector and target cell)/(RLU from well with target cells) x100 )).

Xenograft studies in mice.

- 43 040572

The studies were performed as previously described, with certain modifications (Human gene therapy 2011, 22(12):1575-1586; Proceedings of the National Academy of Sciences of the United States of America 2009, 106(9):3360-3365) . Briefly, NOD/SCID gamma (NSG) mice aged 6-10 weeks were injected subcutaneously with 1x106 PC3-CBG tumor cells in the right flank on day 0, and the same mice received SK-OV3-CBG tumor cells (5x106 cells/mouse , sc) in the left flank on day 5. Mice were treated with T cells via the tail vein on day 23 after PC3-CBG tumor inoculation such that the volume of both tumors was approximately 200 mm ³ . Lentivirus-transduced T cells were injected at 1x10 ⁷ cells/mouse (10M) or 3x106 cells/mouse (3M). Briefly, for the Nalm6 tumor model, NOD/SCID gamma (NSG) mice aged 6 to 10 weeks were injected with 1x106 green click beetle (CBG) transduced Nalm6 (Nalm6-CBG) cells via the tail vein on day 0. Treatment with T- cells were started on day 7 after tumor inoculation. For the PC3-PDL1 solid tumor model, NOD/SCID gamma (NSG) mice aged 6 to 10 weeks were injected subcutaneously with 1x106 transduced PSCA, PD-L1 and CBG (PC3-PSCA-PDL1-CBG) PC3 tumor cells in the right flank for a day 0. Mice were treated with T cells via the tail vein on day 22 after PC3-PDL1-CBG tumor inoculation such that the tumor volume was approximately 200 mm ³ . T cells were injected at 2x106 cells/mouse (2M). Animals were randomly distributed and divided into groups depending on the initial size of the tumor. All animals were included in the experiments and tumors were assessed in a blind mode for all conducted animal experiments.

Method for T cell stimulation, lentivirus transduction and CRISPR electroporation.

In FIG. 84 shows the method used to stimulate, transduce with lentivirus, and electroporate CRISPR T cells. On day 0 received T cells from 3 donors (100x106 cells/donor). Cells were stimulated with anti-CD3/CD28 antibody beads in a T-cell:bead ratio of 1:3. The cell concentration was adjusted to 0.5χ10 ⁶ /ml using 100 ml/flask. On day 1, stimulated T cells were transduced with CD19 CAR lentivirus at a multiplicity of infection (MOI) of 2. 50 ml (25x106 cells) of T cells were stored as unmodified T cells (group 9). On day 3, the beads were removed, the cells were washed 2x in Opti-MEM and the transduced T cells from each donor were divided into two groups, CART/under simulated EP conditions (10 ml, 50x1067 ml) and CART/CRISPR (10 ml, 50x1067 ml). The cells were then electroporated with RNA CAS9 (1 EP) at 500 V/1 ms with 120 μg RNA CAS9/400 μl T cells. Then, after electroporation, cells of groups 1, 3, 5 and 7 were separated by culturing T cells in half of the new medium and half of the cultured medium. On day 4, cells were washed twice and resuspended in Opti-MEM at 50x10 ⁶ /ml. 20 µg of TRBC4 and B2M gRNA were electroporated into 400 µl of T cells. After electroporation, cells were cultured at 1x106 cells/ml in half fresh medium and half cultured medium. On days 5 and 7, cells were separated and resuspended in half fresh medium and half cultured medium. On day 8, CD3+ cells were removed from groups 2, 4 and 6 by means of a low density column. CD3 T cells were resuspended at 0.5-1x106 cells/ml in half fresh medium and half cultured medium and cultured to expand the cells. On day 11, T cells were harvested and 25x105 cells from three donors were sent for karyotyping. The remaining cells were divided into aliquots and frozen.

The results of the experiments are described below.

Example 1 Disruption of the TCR-CD3 complex on T cells using CRISPR.

Thirteen gRNAs directed to the TCR α-chain constant regions, 10 gRNAs directed to the TCR β-chain constant regions, and 10 RNAs directed to the beta-2-microglobin gene (FIGS. 1A-1C and FIGS. 9A-9D) were designed and tested in 293T cells. Primary human T cells were grown ex vivo for three days with Dynabead with anti-CD3/CD28 antibodies for three days. Because transient expression of CRISPR is sufficient to mediate gene knockout, a hit-and-run delivery strategy for transient expression of CRISPR was developed by using electrotransfer of in vitro transcribed RNA encoding CAS9 and gRNA (FIG. 2C).

To measure TCR expression, a CD3-specific mAb was used, which is present on the cell surface only when the TCR antibody is expressed. Six days after electrotransfer, flow cytometry analysis revealed that CRISPR targeting TRBC abolished CD3 expression on primary T cells at levels of 13.7 (FIG. 2D) in donor ND147. TCR knockout efficiency correlated with the amount of electrotransported mRNA (FIG. 2D). Although RNA electrotransfer in primary T cells was well tolerated, a slight decrease in cell viability was observed, which correlated with increased amounts of RNA introduced. It has been reported that ZFN and TALEN mediated gene disruption is more efficient when cells are temporarily subjected to moderate hypothermia. A similar phenomenon was observed with this CRISPR system.

After electrotransfer, T cells were cultured for 1 day at 32°C. CRISPR-mediated destruction of CD3 was 2.5-fold higher when electroporated T cells were cultured at 32°C rather than at 37°C. Using this approach, 5.43% and 16.7% of electroporated T cells lost CD3 expression using CRISPR targeting TRAC and

TRBC, respectively (Fig. 2D, bottom panel). No change in CD3-negative cell levels was observed in the CAS9 sham samples and no significant reduction in viability (as measured by trypan blue) was observed.

When the gRNA was electrotransferred for the second and third time, the efficiency of elimination of CD3 expression on primary T cells at levels was significantly higher.

Targeting TRAC: at levels reaching 77% after the third time of gRNA electrotransfer (Fig. 4A),

Targeting TRAC or TRBC at levels as high as 64.5% or 57.5%, respectively, after the second gRNA electrotransfer with a slight decrease in viability (Fig. 4C).

To confirm that the electroporated T cells were genetically modified at the putative gRNA target sites (α or β TCR loci), Sanger sequencing was performed using specific oligonucleotide primers flanking the target sites in TRAC, TRBC1 or TRBC2. Multiple peaks in these PCR products from target sites were present only after CRISPR electrotransfer, and the percentage of destruction correlated with the loss of CD3 expression on the cell surface (FIGS. 1C and 3B). These experiments in primary T cells confirmed that CRISPRs designed to target TRAC or TRBC resulted in permanent disruption of TCR αβ expression as assessed by Sanger sequencing and confirmed by CD3 flow cytometry analysis.

Example 2 TCR enrichment of αβ-negative T cells.

For further clinical applications, fast and reliable methods for isolating sources of TCR disrupted populations can be used. To begin addressing this problem, the TCR/CD3 ^neg population was enriched by negative selection using clinically approved paramagnetic beads and a depletion column. With one step of depletion, the CD3 ^nes population increased by 99% (FIG. 3A). The CD3 ^nes population could not be enriched from non-transfected control cells.

Successive depletion steps resulted in >99% enrichment, with no displacement of CD4 or CD8 T cell subpopulations (Figure 3C). The sequencing results also demonstrated that deletions and insertions were introduced into the TCR alpha and beta loci after CRISPR modification (FIG. 3D).

Example 3 Production of HLA-CLASS I ^nes T cells by CRISPR.

To test the ability of CRISPR to induce knockout of HLA-CLASS I expression of allogeneic T cells, gRNAs directed to beta-2-microglobin were constructed. The beta-2-microglobin locus can be manipulated by CRISPR in 293 T cells (FIG. 9A). The data demonstrated that the destruction of beta-2-microglobin abolished the expression of HLA-CLASS I on the surface of the T cell (Fig. 9B).

IFN-gamma significantly improved, approximately 10-fold, the target potency of beta-2 microglobin in T cells (FIG. 9C). Multiple electrotransfers of beta-2-microglobin gRNA produced a 66% beta-2-microglobin negative population (FIG. 11A).

For further clinical applications of allograft transplantation, fast and reliable methods for isolating sources of HLA-CLASS I null populations are needed. clinically approved anti-PE paramagnetic microbeads and depletion columns. With one step of HLA-CLASS I depletion, the ^neg population was increased to 99%. The HLA-CLASS Ineg population could not be enriched from non-transfected control cells. Analysis of the HLA-CLASS I repertoire in HLA-CLASS-enriched Ineg T cells by flow cytometry confirmed elimination of HLA-CLASS I expression on the cell surface (FIG. 9D).

Example 4 CD3 ^neg T cells can be grown in various ways

CD3 ^neg T cells restored CD3 expression after electrotransfer of in vitro transcribed mRNA of the alpha and beta chains of exogenous 1G4-TCR (5 μg each). These cells were propagated: (1) by a single rapid propagation protocol (REP), then tested for activity and specificity. PBMCs were obtained from three different donors: ND052 105x106, ND405 83x106, ND410 136x106. The cells appeared after irradiation, then they were mixed with each other and received a total of 324x106 PBMC. RNA was electrotransferred into 2x106 cells. CD3 ^neg -T was resuspended in a final volume of 90 ml and R10 medium was added to a total volume of 300 ml. Cells were divided into 2 T150 ml flasks. OCT was added to a final concentration of 30 ng/mL. On day 2, IL-2 was added up to 50 U/ml. Starting on day 5, cells were counted and fed every 2 days and after the T cells were at rest, as determined by reduced growth kinetics and cell size, they were used for functional assays or cryopreserved.

- 45 040572

After a single REP, CO3ped T cells were expanded to a 500-fold increase in numbers. These cells were expanded: (2) stimulated with magnetic beads, coated with anti-CD3 antibody/anti-CD28 antibody in a cell to bead ratio of 1:3.

After a single REP, CD3neg T cells were expanded to a 500-fold increase in numbers. These cells were expanded: (3) co-stimulated with irradiated K562-CD19 and K562/86/64/A2(2D11) in an equal mixture at a concentration of 1x10 ⁶ /ml.

After a single REP, CO3ped T cells were expanded to a 500-fold increase in numbers. These cells were propagated: (4) co-cultured with irradiated K562-CD19 and K562/86/64/A2(2D11) in an equal mixture at a concentration of 1x10 ⁶ /ml with 30 ng/ml OCT.

After a single REP, CO3ped T cells were expanded to a 500-fold increase in numbers. These cells were propagated: (5) co-cultured with irradiated K562-CD19 and K562/86/64/A2(2D11) in an equal mixture at a concentration of 1x10 ⁶ /ml with 1 mg/ml NY-ESO peptide.

Example 5 Redirection of TCR ^neg -T cells by TCR electrotransfer.

To test the function of TCR ^neg -T cells, these cells were redirected by TCR electrotransfer. As a result of the introduction of the TCR alpha chain and the TCR beta chain, these cells expressed high levels of TCR. Expression of Vb13.1 was significantly higher in TCR ^neg T cells after electrotransfer compared to the CAS9 control under sham conditions (FIG. 7A). When cells were co-cultured with the Nalm-6 NY-ESO leukemic cell line, HLA-A2 and NY-ESO positive cells showed high levels of 107a, indicating increased degranulation activity (FIG. 7B). Cytolysis assay also showed high toxicity to this cell line (FIG. 7C). This indicates that these cells are probably safer than traditional clinical trials with T cells expressing CAR and TCR, as these cells do not trigger GVHD and have less side toxicity compared to normal T cells treated with TCR.

Some reports have demonstrated that T cells can be genetically edited with ZFN or TALEN to eliminate the expression of endogenous αβ TCR. The methods and compositions described herein for selectively depleting T cells expressing an unwanted αβ TCR also include incomplete knockout of endogenous TCR to treat GVHD and inhibit the negative impact of endogenous TCR on CAR function (e.g., through competition for transcription factors). Thus, a genetic approach was developed using artificial ZFNs to permanently disrupt the sequences of the α- and β-constant regions in T cells, thus abolishing TCR expression.

ZFN and TALEN are artificial restriction enzymes obtained by fusing the DNA binding domain with the DNA cleavage domain. When ZFN and TALEN do not work effectively, it is often difficult to determine the cause. The inefficiency may reflect a problem with the design, with access to the target sequence, or with a delivery problem. Simultaneously, the targeting efficacy of ZFN tends to be low in T cells, making it difficult to manipulate many genes at once.

Separate ZFN and TALEN, the CRISPR/CAS system has recently become known as a potentially simple and effective alternative to ZFN and TALEN for introducing targeted genetic changes. In the latest work, it was demonstrated that for target recognition by the Cas9 protein, a seed sequence in crRNA and a protospacer-adjacent motif (PAM) consisting of a conserved dinucleotide upstream of the ssRNA-binding region are required. Thus, the CRISPR/CAS system can be retargeted to cleave virtually any DNA sequence via ssRNA reconstruction. The data described herein demonstrate the possibility of gene editing by CRISPR/CAS in 293T cells and primary T cells. The CRISPR/CAS system can simultaneously target many genomic loci by co-expressing one CAS9 protein with two or more gRNAs, making this system uniquely suited for multiplex gene editing or synergistic activation of target genes. By introducing various gRNAs together with CAS9 in T cells, many genes can be destroyed simultaneously.

Example 6 Triple knockout of HLA class I and TCR α-, β-chain by CRISPR

To work towards ready-to-use allogeneic T-cell therapies for cancer and infectious diseases, cell-based therapies have been developed by infusion of T-cells to restore immunity against pathogens and cancers. The amount of time required to produce T cells with the desired properties and in sufficient quantities ex vivo is often inconsistent with the therapeutic window for patients. In addition, autologous T cells from patients with advanced disease may be dysfunctional and tolerant to desired antigens.

To overcome this problem, patients can be administered by infusion with allogeneic T cells to avoid immune-mediated rejection caused by host T cells recognizing incompatible major or minor histocompatibility antigens of the injected cells. For expansion

- 46 040572 fields of application of T-cell therapy and for further allograft transplantation, it is possible to obtain fast and reliable methods for isolating sources of populations with destroyed TCR and HLA-I class.

ZFN and TALEN contain a zinc finger DNA-binding domain designed to bind a specific DNA sequence fused to the cleavage domain of the FokI endonuclease. The design and construction of ZFN and TALEN is very complex and time consuming if more than one gene needs to be manipulated, as it is necessary to influence the genes one by one. With the CRISPR system described herein, efficient and time-saving gene disruption can be obtained.

To address this issue, CAS9 was electrotransferred with three different gRNAs targeting TRAC, TRBC, and beta-2-microglobin. Cells were labeled with anti-beta-2-microglobin PE antibody and enriched in the HLA-I class ^ population by negative selection using clinically approved anti-PE paramagnetic microbeads and a depletion column. Using one step of HLA-I class depletion, the I-population was increased to 99% (FIG. 9D). The were cells were then re-introduced with TCR alpha chain and HLA-I class ^nes CD3 ^{The nes} population was enriched in microbeads (FIG. 11). Five days later, the TCR beta chain was re-introduced into the cells and the HLA-CLASS I ^neg CD3 ^neg population was again enriched with microbeads. Two days later, TCR was was electrotransferred into these triple knockout cells. One day after electrotransformation, cells were stimulated with Dynabead CD3/CD28. The cells were then subjected to delivery by lentivirus specific for the TCR antigen and culture expansion the following day.

Example 7 FAS, PD1, CTLA4, PPP2R2D knockout by CRISPR

The apoptotic FAS receptor/FAS ligand (FAS/FASL) signaling pathway has been extensively studied and well characterized in T cells. PD1 and CTLA4 are two major inhibitory signal transduction pathways in T cells that have also been extensively investigated. Direct evidence for a possible therapeutic effect of targeting these pathways has come from studies in preclinical mouse tumor models demonstrating enhanced antitumor immunity after antibody-mediated blockade of CTLA-4, PD-1, or PD-L1. Similar antibodies have been developed for use in humans, and early clinical data have shown promising results. Ppp2r2d knockdown can also inhibit T cell apoptosis and increase T cell proliferation as well as cytokine production. Ppp2r2d is a putative target for improving human T cell function.

To solve this problem, CAS9 and three different gRNAs targeting FAS, PD1, CTLA4, PPP2r2d were electrotransferred into T cells. Sanger sequencing data showed that these FAS, PD1, CTLA4, PPP2r2d loci were modified by CRISPR. FAS was also replaced by GFP with homologous recombination triggered by CRISPR. The FACS data showed that it abolished FAS and PD1 expression on the surface.

Example 8 Generation of IPS Cells with Genetically Modified and Primary T Cells

Progress in adoptive T-cell therapy for cancer and infectious diseases has been hampered by the lack of readily available and antigen-specific human T-lymphocytes. Pluripotent stem cells can provide an unlimited source of T-lymphocytes. To solve this problem, the expression of FAS, PD1, CTLA4, PPP2r2d was disrupted in primary cells and T cells.

Sendai virus was used to reprogram primary cells and T cells. There are many ways to obtain iPSCs, including virus-mediated gene transduction and chemical induction. Although lentiviral and retroviral vectors require insertion into the host chromosomes to express reprogramming genes, DNA-based vectors such as those based on adenovirus, adeno-associated virus and plasmid vectors exist episomally and do not require insertion. However, they can be inserted into the host's chromosomes at certain frequencies, and the reprogramming efficiency is relatively low. Similarly, mRNA-based reprogramming is complex and has been shown to be very inefficient.

In contrast to these methods, the Sendai virus does not integrate into the host genome or change the genetic information of the host cell. Sendai virus also has reprogramming potential comparable to gene transduction based on lentivirus and retrovirus.

0.1 million wild-type, FAS ^neg , CD3 ^neg T cells knockout of TCR alpha chain and TCR beta chain were seeded in each well in a 24-well plate. Cells were stimulated with CD3/CD28 beads. On day 3 post-stimulation, the beads were removed, the cells were resuspended in 1 ml of prewarmed complete T-cell medium, and then incubated with a calculated volume of CytoTune Sendai virus containing a polycistronic vector for the expression of hKlf4, hOct3/4 and hSox2 in cells (Lifetechnologies, Carlsbad , SA). The treated T cells were seeded in 24-well plates and centrifuged at 2250 rpm for 90 minutes at room temperature. An additional 1 ml of complete T cell medium was added to each well and the plate was incubated overnight at 37° C. in a humidified atmosphere of 5% CO2.

One day after transduction, the Sendai virus was removed by washing the T cells with fresh complete medium and the cells were cultured for 2 days. The medium was replaced by half every day. On day 3 post-infection, cells were transferred to MEF feeder plates and cultured in T cell medium without any cytokines. Four days after infection, cells were cultured in standard hES medium. The medium was changed every day. Around day 7, ES-like colonies were observed. Cells were cultured in hES conditioned medium from day 15 and cultures were continued for an additional 10 days. Colonies were pinned approximately 25-30 days after transduction.

Around day 4, cell clumps formed on the feeder cells, indicating the start of the reprogramming process. During the process of reprogramming into iPSCs, T cells went through significant morphological changes. Around day 12, large clumps of cells with free margins began to appear. Around day 18, the T cells had transformed into characteristic ES-like colonies with well-defined margins. A characteristic morphology of embryonic stem cells was observed, indicating that FAS ^neg , CD3 ^neg TCR alpha chain knockout and TCR beta chain knockout T cells were induced into a pluripotent state under various reprogramming conditions (FIGS. 17A and 18A).

FAS-negative T cells were more easily reprogrammed into iPSCs at approximately 5 times their wild-type counterparts (FIG. 17B). Similarly, the reprogrammed CD3 ^neg T cell was approximately 5 times more efficient than wild-type counterparts (FIG. 18B). It has been reported that p53 deficient cell lines are easier to reprogram because the apoptotic pathway is spatially hampered. FAS knockout additionally induced resistance to apoptosis. Although the loss of TCR expression makes T cells less healthy, this indicates that apoptosis plays an important role in the reprogramming process.

Example 9 TCR knockout in siRNA T cells

Fig. 19 is a graph showing the production of IFN-gamma TCR NY-ESO-1 wild-type (wt) or modified NY-ESO-1 TCR with a second disulfide bond and beta chain de-Nglycosylation (S/SD). RNA was electroporated into endogenous T cell receptor (TCR) siRNA knockdown T cells. IFN-gamma was detected by ELISA, then T cells were stimulated with an HLA-A2 positive cell line activated with a specific NYESO-1 peptide, p156-165, for 18 hours.

In FIG. 20 containing FIG. 20A and 20B show knockdown of TCR alpha by co-electroporation of CAS9 RNA and gRNA. Six days after electroporation, cells were analyzed for TCR expression as measured by CD3.

In FIG. 21 shows Sanger sequencing. The results show multiple peaks in CD3-negative enriched T cells with electroporated mRNA and CAS9 gRNA to knockdown TCR alpha (TRAC-5) or TCR beta (TRBC-7).

Fig. 22 is a panel of graphs demonstrating that endogenous TCR beta (TRB-7) knockdown CD3-negative T cells re-expressed CD3 4 hours after RNA electroporation of NY-ESO-1 TCR alpha and beta (1G4LY95 TCR). Normal T cells (ND424 beads) were used as controls, which were approximately 100% CD3 positive with 5.25% expression of the endogenous TCR vbl3.1.

Fig. 23 containing FIG. 23A-23D is a panel of graphs demonstrating that endogenous TCR knockdown increased transgene expression and electroporated RNA TCR T cell function. In FIG. 23A shows the expression of TCR T cells, electroporated TCR siRNA (filled open histogram), control siRNA (dotted open histogram), and T cells without any siRNA (filled histogram). In FIG. 23B shows expression of wild-type (wt) NY-ESO-1 TCR transgene (TCR vbl3.1) or modified electroporated RNA TCR (SD) T-cell TCR siRNA, control siRNA or no siRNA. In FIG. 23C shows NY-ESO-1 TCR tetramer staining of NY-ESO-1 wild-type (wt) or TCR-modified (SD) electroporated RNA T cells with TCR siRNA, control siRNA, or no siRNA. In FIG. 23D shows specific lysis of an HLA-A2/NY-ESO-1 positive tumor line by T cells electroporated with siRNA for TCR knockdown, wild-type NY-ESO-1 TCR RNA.

Fig. 24 is a graph showing the fluorescence of tumor cells after T cell injection in a mouse model. Ten million Nalm6-CBG-ESO-GFP (green click beetle) tumor cells that expressed NY-ESO-1 and GFP were intravenously injected into NOD/SCID mice. Five days after tumor inoculation, transduced CBR (red click beetle) and electroporated RNA T cells were injected as indicated in different groups and monitored for tumor growth by bioluminescent imaging (BLI).

In FIG. 25 shows bioluminescent imaging of mice from two groups treated with RNA CAR CD19BBZ T-cells or modified TCR RNA NY-ESO-1 at different time points.

- 48 040572

Example 10 Generic CAR19 T Cells Produced by Combination of Transduction with Lentivirus and Disruption of the TCR-CD3 Complex on T Cells Using CRISPR

As shown in FIG. 26, a primary T cell was stimulated with anti-CD3/CD28 antibody beads on day 0 and then lenti-CAR19 was transduced. More than 70% of the cells were CAR19 positive as detected by flow cytometry. Because transient expression of CRISPR is sufficient to mediate gene knockout, a hit-and-run delivery strategy for transient expression of CRISPR was developed using electrotransfer of an in vitro transcribed RNA encoding CAS9 and RNA directed to the constant regions of the TCR α-chain, TCR β-chain, and gene beta-2-microglobulin, day 3. T cells were cultured for 24 hours at 32°C after electrotransfer, then returned to normal conditions.

A monoclonal antibody specific for CD3 was used to measure TCR expression. CD3 was chosen because only CD3 is present on the cell surface when TCRs are expressed. The CRISPR constructs were electroporated into primary T cells (FIG. 26). Single TCR negative and TCR/HLA-A double negative cells were expanded by exposure to CD19 presenting K562 cells resulting in >100-fold expansion (FIG. 27).

After expansion, the cells remained single TCR negative or TCR/HLA-A double negative, and the CAR19 positive population was enriched. Endogenous TCR expression remained negative in single TCR negative cells, while TCR and HLA-A expression remained negative in TCR/HLA-A double negative T cells after K562-CD19 stimulated expansion (FIG. 28A). CAR19 positive cells were enriched by K562-CD19 stimulated expansion (FIG. 28B).

Most of the expanded universal T cells were CD45RO positive (FIG. 29A) and retained high levels of CD62L expression (FIG. 29B), medium levels of CD28 expression (FIG. 29A) and low levels of CCR7 expression (FIG. 29B).

Editing the CRISPR gene had no effect on the antitumor activity of universal CAR19 T cells in vitro (FIG. 30A). TCR or TCR/HLA-A depletion had minimal effect on CAR19 expression and antitumor activity (FIGS. 30B and 30C). Single TCR negative and double TCR/HLA-A negative CAR19T had reliable lytic capacity when stimulated with Nalm6 tumor cells (FIG. 30B). The release of CD107a and the secretion of cytokines also demonstrated the high antitumor activity of the universal cells (Fig. 30C). CAR19 T cells with single TCR ablation or dual TCR and HLA-A ablation had similar proliferation kinetics after stimulation with CD19 expressing cells (Fig. 30D).

To test the antitumor activity of CRISPR/CAS9 edited CAR19 T cells, TCR single negative, TCR double negative, and HLA-A negative, CAR19 T cells were infused into NSG mice harboring Nalm6 tumor cells. All mice treated with unmanipulated T cells and mice infused with lentivirus-transduced GFP wild-type T cells died within 3 weeks of tumor cell infusion. Objective tumor regression was observed for mice treated with CAR19 T cells (FIG. 6). CRISPR/CAS9 was found to have no effect on in vivo cytolytic activity against CAR19 T cell tumors, thus confirming the benefit of the combination of lentiviral gene transfer and CRISPR/CAS9 for T cell therapy.

Complete ablation of the TCR α- and β-chains and the HLA-A molecule on T cells completely abolished non-specific cytolysis when the cells were stimulated with HLA-mismatched tumor cell lines (FIG. 32A). Elimination of HLA-A molecules activated NK cells after a long co-culture period (5 days). No side activity was observed when these cells were stimulated with allogeneic whole blood PBMCs 24 hours later in the IFNr Elispot assay. The absence of side activity confirms that T cells may play a major role in acute immune responses after the discovery of allogeneic cells. All results suggest that CRISPR/CAS9-edited TCR α- and β-chains and HLA-A molecules (triple negative) may serve as a source of universal donor effector cells.

CAS9 and various FAS-targeted gRNAs were electrotransferred into T cells. FASneg cells were sorted and then transduced with lentivirus with CAR19. Flow cytometry and Sanger sequencing data demonstrated that FAS had been modified by CRISPR (FIG. 33). The CAR19 gene expression of FAS-negative T cells was comparable to wild type. Even after a short period of incubation with Nalm6 tumor cells, CD107a expression was significantly increased in FAS-negative CAR19 T cells compared to similar wild-type cells even after 4 h of co-culture.

Some reports have shown that even weak antigenic stimuli can trigger FAS activation to promote T cell proliferation (Rethi, et al, Blood, vol. 112(4):1195-1204, 2008). Of note, FAS-negative CAR19 T cells proliferated much faster than wild-type CAR19 T cells when cells were stimulated with high levels of CD19+ K562 cells. This allows

- 49 040572 suggest that FAS/FASL triggers apoptosis instead of activation at high levels of antigenic conditions (FIG. 34A). FAS-negative CAR19 T cells also showed reduced levels of apoptosis as measured by annexin V staining (FIG. 34B).

As observed in vitro, the FAS-negative T cell was characterized by increased proliferation compared to the wild-type T cell. Similar proliferation results were observed when an accurate CAR19 T cell count assay was performed after cell infusion into Nalm6 bearing mice. For FASneg CAR19 groups showed high antitumor activity compared to the wild type group (Fig. 35B). This difference is illustrated in the graph of Fig. 35C showing the bioluminescence data of these two groups. These data indicate that FAS ablation in CART cells increased their antitumor activity.

CAS9 and various PD1-targeting gRNAs were electrotransferred into T cells after lentivirus transduction with PSCA-CAR. PD1 knockout cells were confirmed by surface expression of PD1 after stimulation with CD3/CD28 beads (FIG. 36). PD1 negative cells were enriched by microbead depletion and then stimulated with PSCA antigen presenting PC3 tumor cells. PSCACAR-positive cells were enriched in the wild type group and in the PD1 negative group. After incubation with PC3-PSCA-PDL1 tumor cells, PD1 expression rapidly increased on the surface of wild-type PSCA-CAR T cells, with very low levels of PD1 expression detected on PD1-negative PSCA-CAR T cells (Fig. 37). PD1-negative PSCA-CAR T cells also showed significantly increased and sustained high levels of expression of CD137 (FIG. 37), a marker of T cell activation, indicating that the inhibitory PD1/PDL1 signaling pathway was blocked.

When tested in the PC3-PSCA-PDL1 NSG model in vivo, a significant increased antitumor activity was detected in the PD1-negative PSCA-CAR T cell group compared to the wild-type group (FIGS. 38A and 38B), confirming the therapeutic value of PD1 ablation for CART. -cell therapy.

To test the effect on graft-versus-host disease (GVHD) of CRISPR engineered generic CART cells, NSG mice with Nalm6 leukemia were given a high dose of T cells. Mice were treated with double or triple knockout CART cells and did not show any signs of developing GVHD. In contrast, 3 of 4 wild-type CD19 CART mice developed GVHD at day 65, as confirmed by histological analysis of various organs (FIG. 39).

In another experiment, cells were resuspended in FBS and injected intravenously into mice after sublethal irradiation. Clinical GVHD was monitored 2 to 3 times per week. Four of the 5 mice treated with wild-type T cells died during the 60 day study, while the PBS-treated, T-cell-treated single TCR ablation and dual TCR/HLA-I ablation groups showed no signs of GVHD. Mice receiving wild-type T cells lost body weight. However, the PBS-treated, single TCR-ablated and dual-ablated TCR/HLA-I groups did not gain much weight during the study (FIGS. 40A and 40B).

T cells were treated with Cas9 and gRNA directed to CD3, B2M and PD1 or Fas after CD19-CAR transduction with lentivirus. Triple knockout universal CART cells were injected into mice bearing Nalm6-PDL1 tumors. High antitumor activity was observed in mice treated with PD1/CD3/HLA-I triple-knockout cells compared to CD3/HLA-I double-knockout cells, further suggesting the therapeutic value of blocking the PD1 signaling pathway (FIGS. 41A and 41B) . These data provide a way to improve the processing of generic CART cells using CRISPR/Cas9.

Due to the fact that gRNAs are subject to degradation, a simplified one-step method for obtaining universal CART cells has been developed. rRNAs were co-expressed constitutively with CAR in a single lentiviral vector. Naive T cells were transduced with lentivirus encoding gRNA and CAR one day after stimulation with Dynabead CD3/CD28. Cells were electroporated with Cas9 mRNA on day 3 (FIG. 42). This system allowed the manipulation of multiple genes using a single vector (FIG. 42). CD3 expression was confirmed by flow cytometry on day 6. For T cells treated with the single acting system, persistent gene ablation of up to 90% was demonstrated in each of the different Cas9 mRNA groups (FIG. 43).

Progress in adoptive T-cell therapy for cancer and infectious diseases has been hampered by the lack of readily available antigen-specific human T-lymphocytes. Pluripotent stem cells can provide an unlimited source of T-lymphocytes. To solve this problem, the expression of FAS, PD1, CTLA4, PPP2r2d was disrupted in primary cells and T cells.

Sendai virus was used to reprogram primary cells and T cells. There are many methods available for obtaining iPSCs, including virus-mediated gene transduction and chemical induction. Although lentiviral and retroviral vectors require insertion into the host chromosomes to express reprogramming genes, DNA-based vectors such as adenovirus, adeno-associated virus and plasmid vectors exist episomally and do not require insertion. however, they can be inserted into the host's chromosomes at certain frequencies, and the reprogramming efficiency is relatively low. Similarly, mRNA-based reprogramming is complex and has been shown to be very inefficient.

In contrast, the Sendai virus does not integrate into the host genome or change the genetic information of the host cell. Sendai virus also has reprogramming potential comparable to gene transduction based on lentivirus and retrovirus.

In each well of a 24-well plate, 0.1 million wild-type T cells, FASneg, CD3neg T-cells with TCR knockout alpha and beta chain knockout were seeded. Cells were stimulated with CD3/CD28 beads. On day 3 post-stimulation, the beads were removed, the cells were resuspended in 1 ml of prewarmed complete T-cell medium, and then incubated with a calculated volume of CytoTune Sendai virus containing a polycistronic vector for the expression of hKlf4, hOct3/4 and hSox2 in cells (Lifetechnologies, Carlsbad, CA). The treated T cells were seeded in 24-well plates and centrifuged at 2250 rpm for 90 minutes at room temperature. An additional 1 ml of complete T cell medium was added to each well and the plate was incubated overnight at 37°C in a humidified atmosphere of 5% CO ₂ .

One day after transduction, the Sendai virus was removed by washing the T cells with fresh complete medium and the cells were cultured for 2 days. The medium was replaced by half every day. On day 3 post-infection, cells were transferred to MEF feeder plates and cultured in T cell medium without any cytokines. Four days after infection, cells were cultured in standard hES medium. The medium was changed every day. Around day 7, ES-like colonies were observed. Cells were cultured in hES conditioned medium from day 15 and cultures were continued for an additional 10 days. Colonies were pinned approximately 25-30 days after transduction.

Around day 4, cell clumps formed on the feeder cells, indicating the start of the reprogramming process. During the process of reprogramming into iPSCs, T cells went through significant morphological changes. Around day 12, large clumps of cells with free margins began to appear. FAS-negative T cells were reprogrammed into iPSCs at about 5-fold potency of wild-type analogs (FIG. 44B). It has been reported that p53 deficient cell lines are easier to reprogram due to blocking of the apoptosis pathway. FAS knockout can facilitate the reprogramming process using a similar mechanism.

An ES-like morphology was observed for iPSCs reprogrammed from CD3 ^neg T cells with either alpha or beta knockout TCR knockout (FIG. 45A). The morphology remained constant after several passages. Reprogramming of CD3-negative T cells was about 5-fold less efficient than wild-type analogs (Fig. 45B), suggesting that TCR knockout may play a role in T-cell reprogramming or affect cell viability after virus infection. Sendai. Fig. 45C is a panel of images showing phosphatase staining of CD3-negative iPSC cells.

A characteristic embryonic stem cell morphology was observed, indicating that a pluripotent state was induced in FASneg, CD3 ^neg T cells with TCR alpha and beta knockout under various reprogramming conditions. Although the loss of TCR expression makes T cells less healthy, the data described herein suggest that apoptosis plays an important role in the reprogramming process.

Induction of endogenous pluripotent stem cell genes was also detected in various T-iPSC cell lines (FIG. 46). Immunostaining for Tra-1-60 and SSEA4 expression further indicated the stem cell phenotype of T-iPSC cells (Fig. 47A). Fas knockout in T-iPSC was confirmed by Sanger sequencing (FIG. 47B).

dCas9 and FokI-Cas9 have been reported to have less side activity. T cells were evaluated for their ability to be edited by a modified version of the CRISPR/dCAS9 and CRISPR/FokICAS9 systems (FIG. 48A). Flow cytometry data showed that primary T cells were edited by CRISPR/dCAS9 and CRISPR/FokI-CAS9 (FIG. 48B). For the CRISPR/dCAS9 gene knockout system, increased specificity was demonstrated with at least one gRNA pair making the knockout event more precise and more specific.

To test CRISPR/CAS9 side events in T cells, a Surveyor analysis of non-target sites was performed. For the tested genes, no significant cleavage was observed at the genomic loci (FIG. 48C).

Example 11 Multiplex genome editing

CART cells were generated using the CRISPR/Cas9 system to simultaneously disrupt multiple genomic loci. CART cells were deficient in the expression of endogenous TCR and

- 51 040572 HLA class I (HLA-I) molecules, for use as allogeneic universal CART cells. The T cell receptor (TCR) α chain, TCR β chain, and beta-2-microglobulin (B2M) genes were degraded with high efficiency by coelectroporation of mRNA encoding Cas9 with gRNAs directed to these genes. Generic TCR or CART cells were generated by a combination of lentiviral (LV) CAR delivery and CRISPR RNA electroporation to destroy endogenous TCR and B2M genes simultaneously. In addition, disruption of endogenous PD1 increased the efficacy of CAR-based therapy in a solid tumor model.

Delivery of multiple gRNAs disrupts genes in primary human T cells with high efficiency without compromising effector function.

Efficient multiplex genomic editing is essential to obtain universal T cells that are deficient in TCR, HLA, and other genes. Optimized CRISPR/PHK gRNA electroporation to obtain efficient gene disruption in T cells. First, Cas9 and gRNA were coelectroporated with RNA produced using an in vitro transcription system (Fig. 49, left), and a hit-and-run delivery strategy was developed to transiently deliver Cas9 mRNA and gRNA to T cells by electroporation (Fig. 49, right).

In the initial experiment, targeting the a constant region (TRAC) or the β constant region (TRBC) of the TCR with a single electroporation resulted in 1-3% CD3 negative (CD3 ^neg ) T cells, respectively (FIG. 50A, top graphs). To determine whether temporary exposure to moderate hypothermia could provide more efficient gene disruption, cells were edited at 37 or 32°C. CRISPR-mediated destruction of TRAC and TRB increased 4-fold when T cells were cultured for 24 h at 32° C. after Cas9/rRNA co-electroporation (FIG. 50A, bottom graphs). The optimal Cas9:gRNA molecular ratio for maximum disruption efficiency was 1:1 to 2:1, and gene disruption efficiency correlated with the amount of electrotransported mRNA (FIG. 51A).

Compared to mRNAs, gRNAs are more susceptible to rapid degradation, potentially limiting targeted efficacy. Thus, multiple sequential gRNA electroporations were tested after the primary Cas9/gRNA electroporation. A marked increase in the frequency of degradation at the protein level was observed as 82.4% of the cells were CD3 ^neg after electroporation of the third gRNA (Fig. 50B). Clonal sequencing showed that the genomic target efficiency reached 89.4% after the third gRNA electroporation (FIG. 51B). Surveyor analysis confirmed a cleavage ratio of 81.7 and 49.3% at the TRAC and TRBC genomic loci, respectively, after the third electroporation of rRNAs (Fig. 52). Numerous peaks in the Sanger sequencing data flanking the TRAC and TRBC target regions confirmed that the genomic reading frame had shifted below the target regions (FIG. 53A). The occurrence of insertions or deletions (insertion-deletion mutations) caused by mediated NHEJ by CRISPR/Cas9 was confirmed by clonal sequencing (FIG. 53B). The TCR/CD3 ^neg population with disrupted TCR was enriched to 99% (99.70+0.20%) by one step CD3 negative selection (FIG. 54).

To develop methods for expanding TCR/CD3 ^neg -T cells TCR/CD3 ^neg -T cells were co-electroporated with HLA-A2 restricted RNA 1G4 NY-ESO-1 TCR (α+β) to restore CD3 expression (Fig. 55, left panel) . Following T cell stimulation/expansion methods, the following parameters were compared: 1) Rapid T cell expansion protocol (REP) using PBMCs as feeder cells, 2) Dynabead with anti-CD3/CD28 antibodies (beads), or 3) presenting an artificial antigen OKT3-loaded K562-based cells that express ligands for CD28 and 4-1BB (K562 aAPC). TCR/CD3 ^neg T cells were also electroporated with CD19 CAR RNA (FIG. 55, right panel) and then stimulated with irradiated K562 aAPCs that expressed CD19 (K562-CD19). Multiplicity values of 751.0±217.1, 35.7±9.3, 46.3±8.5, and 57.5±5.0 were obtained for REP, beads, K562 aAPC, and K562-CD19, respectively, after a single stimulation for 10 days (Fig. 56).

To test whether editing the CRISPR/Cas9 gene would affect the phenotype and function of T cells, the phenotype of TCR/CD3 ^neg T cells expanded in various ways was analyzed and it was demonstrated that all expanded cells remained CD3-negative, and most maintained a high level of CD27 (79.8% to 93.4%) consistent with the central memory cell phenotype (Fig. 57). The expanded TCR/CD3 ^neg T cells were electroporated a second time with CD19 CAR mRNA to test their antitumor activities. CAR expression on the surface of TCR/CD3 ^neg -T cells was equivalent to that of the control group (FIG. 58). When TCR/CD3 ^neg CD19 CAR T cells were stimulated with CD19+ Nalm6 leukemic cells, the enhancement of CD107a expression (Fig. 59A), cytokine secretion (Fig. 59C), and cytolytic activity (Fig. 59B) of CD19 CAR+ TCR/CD3 ^neg -T cells was equivalent to that of wild-type control cells. CD19 CAR TCR/CD3 ^neg T cells were infused into NSG mice bearing Nalm6 to test their antitumor activity in vivo. Tumor regression was marked with a potency equivalent to that of 9 similar wild-type CART1 cells (FIGS. 59D and 59E). The results indicate that CRISPR/Cas9 editing of the endogenous TCR did not adversely affect function.

- 52 040572 primary T cells for adoptive immunotherapy.

Decreased alloreactivity of T-cells with triple destruction of TCR α, β and B2M

Destruction of both TCR α and β chains is essential to prevent TCR mismatch-associated toxicity for adoptive immunotherapy with TCR redirected T cells, and B2M is essential for assembly and expression of the HLA-I complex. In light of this, a triple disruption of the α- and β-chain of TCR and B2M was developed to obtain universal T cells. First tested the ability to eliminate the expression of HLA-I on T cells by destroying B2M. T cells were electroporated with B2M directed RNA Cas9/gRNA. This resulted in a double negative B2M and HLA-I population of 79.9%. The HLA-I ^nes population could be further enriched by negative selection (FIG. 60).

To obtain triple knockout T cells lacking the α-, β-chains of TCR and B2M, Cas9 mRNA was co-electroporated with three different gRNAs targeting TRAC, TRBC and B2M. As a result, the double negative for CD3 and HLA-I cell population was 65.4% (Fig. 61). After enrichment in double and triple knockout cells, TCR α- and β-chains, and B2M triple-knockout T cells lost non-specific cytolysis of HLA mismatched tumor cell lines (FIG. 62). No response was observed when these cells were stimulated with allogeneic irradiated whole blood PBMCs in the IFNy Elispot assay (FIG. 63, left panel). Ablation of HLA-I molecules also drastically reduced alloreactivity, as confirmed by co-culture of allogeneic PBMCs with irradiated B2M-degraded cells (FIG. 63, right panel). The above results suggest that triple-negative T cells that do not contain the α- and β-chains of TCR and B2M can probably happen as a source of universal T cells for adoptive immunotherapy, preventing rejection by the host immune system, while being unable to cause graft-versus-host disease.

Improved antitumor activity of reprogrammed TCR T cells with disrupted endogenous TCR. T cells with CRISPR/Cas9 mediated disruption of TCR α- and β-chains showed increased TCR transgene expression on the cell surface after redirection using NY-ESO-1 TCR (1G4). Expression of the transgenic TCR was 67.6%, 78.8%, or 94.3% for a single TCR α- or β-chain knockout or α/β double-knockout, respectively, compared to 46.8% for wild-type T cells. Improved TCR transgene expression resulted in increased T cell function, as evidenced by increased antigen-specific CD107a expression (FIG. 65A) and increased cytotoxicity (FIG. 65B), especially for α/β double knockout T cells.

In a separate experiment, α/β double knockout T cells were transfected with distinct NY-ESO1 TCR (8F). Relative to 1G4 TCR, for this 8F TCR showed higher significant improvements in TCR transgene expression (Figure 66; 60.1% for TCR/CD3 ^nes versus 44.7% (with ~5% endogenous baseline TCR Vβ8) for T wild-type cells (Cas9 under mimic T-cell conditions)) and function (CD107a expression in Fig. 67A and cytokine production in Fig. 67B). These results highlight the differential impact of endogenous TCR on transgenic TCR expression and function.

Generic CART cells retain antitumor efficacy and do not cause GVHD.

Universal CD19 CART cells were generated by a combination of LV CD19 CAR transduction with RNA Cas9/gRNA electroporation (FIG. 68). The cells were expanded and the remaining CD3 ^nes cells had high levels of CD19 CAR expression (FIG. 69). Most of the expanded T cells were CD45RO positive and retained a high level of CD62L expression and an average level of CD28 expression corresponding to the status of the central memory cells (figure 70). For expanded double negative TCR/HLA-I CD19 CART, sustained in vitro antitumor activities were demonstrated such as CD107a release (FIG. 71), cytokine secretion (FIG. 72), lytic capacity (FIG. 73), and proliferation (FIG. 74) , which were as high as in wild-type CD19 CART cells.

T cells were infused into NSG mice harboring Nalm6 multiple leukemia. Mice treated with CART cells with destroyed endogenous TCR (LV-CD19 CAR TCR ^nes ) or with simultaneous destruction of TCR and HLA-I (LV-CD19 CAR TCR/HLA-I ^nes ) showed tumor regression similar to tumor regression in mice, treated with wild-type CD19 CART cells (LV-CD19 CAR) (FIGS. 75A and 75B), confirming that TCR destruction alone or together with B2M had no effect on the antitumor activity of CART cells.

To test the GVHD effect of engineered T cells, NSG mice with Nalm6 leukemia were given a high dose of T cells (20 x 10 ⁶ /mouse). As shown in FIG. 76, mice treated with CD19 CART cells with TCR destruction alone (LV-CD19 CAR TCR/CD3 ^nes ) or both TCR and B2M destruction (LV-CD19 CAR TCR/HLA-I ^nes ) showed similar tumor regression compared to with regression of the tumor CD19 CAR-T wild-type cells (LV-CD19 CAR). Mice treated with double or triple knockout CAR T cells did not develop any signs of GVHD. In contrast, 3 of 4 wild-type CD19 CART (LV-CD19 CAR) mice developed GVHD at day 65, which was confirmed by histological analysis of various organs. Thus, destruction of TCR alone or together with HLA-I did not affect the in vivo antitumor activity of CART cells, while eliminating alloreactivity.

Delivery by adenovirus CRISPR to primary T cells. The CRISPR/Cas9 system has been rapidly adapted for gene regulation and gene editing in model organisms and cell lines. Viral vectors may be particularly useful for extending the applicability of CRISPR to other cell types, including dividing and quiescent primary cells. Adenovirus, namely a second-generation fiber-modified adenovirus encoding Cas9, and single guide RNA (gRNA) molecules were used to deliver the Cas9 nuclease to the PD1, Fas, and TRAC loci (FIG. 77). Adenovirus-mediated transduction of CRISPR into tumor cells (FIG. 78) resulted in high target mutagenesis rates of up to approximately 71% (FIGS. 79A and 79B). Adenovirus appears to provide a valuable platform for introducing CRISPR into human T cells, regardless of their resting status. This approach will help explore the possible application of CRISPR gene regulation and editing in various experimental settings.

Electroporation Optimization

CD3 and B2M knockout efficiency and T cell expansion were assessed after electroporation (EP) of Cas9 and gRNA in 4 mm cuvettes and 2 mm cuvettes. For standard conditions, EP with 2 mm cuvette (360 V/1 ms, 1st EP - 20 µg Cas9 PHK+10 µg gRNA/100 µl T cells, 2nd EP 5 µg gRNA/100 µl T cells) showed the highest percent knockout of CD3 and B2M, 81.8% and 88.6%, respectively, with T cell expansion of approximately 2.7-fold (EP#1) compared to approximately 18.8-fold expansion of control EP T cells (EP#12 ). Reducing the dose of gRNA dose (EP#2-5) significantly increased T-cell proliferation, but only slightly affected the efficiency of CD3 and B2M knockout. See fig. 80. Standard EP conditions with 4 mm cuvette resulted in a significant reduction in CD3 and B2M knockout efficiency (EP#8), suggesting that EP conditions (voltage or/and pulse width) need to be further optimized for use with 4 mm cuvettes.

Compared to standard electroporation (EP) conditions in a 2 mm cuvette (EP# 10-13) or 4 mm cuvette. High CD3/B2M knockout efficiency was observed with improved T cell multiplicity (EP#1 and 5). See fig. 81.

To further optimize the EP conditions to obtain the maximum multiplicity of T cells with a CD3/B2M knockout efficiency of more than 60%, different EP conditions and amounts of RNA were tested. The results showed that multiplicity improved with a relatively high CD3/B2M knockout efficiency (63.5% for CD3 and 84.8% for B2M) for EP #4 (400 B/2 ms/120 μg CAS9 RNA) for EP#1 and (500 V/1 ms/20 μg gRNA) for EP #2. See FIG. 82.

Additional experiments were performed to optimize the EP conditions. The results show that compared to the most favorable test condition (EP#1 in FIG. 82) using 500 V/1 ms/120 μg CAS9 RNA (EP#1) and 500 V/1 ms/20 μg gRNA (EP#1) 2) resulted in increased CD3/B2M knockout efficiency and T cell expansion (EP#3). See fig. 83.

Large scale electroporation and reproduction

Experiments were conducted to determine if large scale electroporation could lead to high knockout and breeding efficiency. On day 0, anti-CD3/CD28 antibody beads were used to stimulate T cells derived from 3 donors (100 x 106 cells/donor concentrated to 0.5 x 10 ⁶ /ml). On day 1, stimulated T cells were transduced with CD19 CAR lentivirus. 50 ml (25x106 cells) of T cells were kept as unmodified T cells (group 9). On day 3, the beads were removed and the transduced T cells from each donor were divided into two groups, CART/under simulated EP conditions (10 ml, 5x106) and CART/CRISPR (10 ml, 50x106). Cells were then electroporated with RNA CAS9 (1st EP) and cell groups 1, 3, 5 and 7 were separated. On day 4, gRNA was electroporated into T cells and cultured at 1x106 cells/ml. On days 5 and 7, the cells were separated. On day 8, CD3+ cells were removed from group 2, 4, and 6. On day 11, T cells were harvested and 25x105 cells from three donors were sent for karyotyping.

Table 1. Experimental groups

Group No. Donor T cells 1 ND391 CART/MOSK ER 2 ND391 CART/CRISPR 3 ND463 CART/MOSK EP 4 ND463 CART/CRISPR 5 ND463 UNMOD 6 ND469 CART/MOSK ER 7 ND469 CART/CRISPR

The number of T cells (upper table of Fig. 85) and multiplicity (lower table of Fig. 85) were evaluated after the electroporation and culture procedure. Multiplicity of T cells transduced with one CD19 CAR (one TD) or transduced with CD19 CAR and edited

- 54 040572

CRISPR (TD/KO) is shown in the left graph of FIG. 86 and the T cell multiplicity on day 10 is shown in the right graph of FIG. 86. As a result of optimization of electroporation conditions and doses

CAS9/gRNA showed approximately 60-70% CD3/B2M knockdown efficiency and approximately

30-fold expansion of T cells after 10 days (Fig. 87 shows the expression of CD3/B2M/CAR on day 10).

Eight days after stimulation with CD3/CD28 beads and RNA CRISPR electroporation, CD3 positive T cells were removed. In FIG. 88 shows CD3/B2M expression in three donor populations on day 8. On day 11, T cells were subjected to FACS staining to detect CD3, B2M and CAR expression. Non-transduced ND463 (NOTD) was used as a negative control. In FIG. 89 shows CD3 and B2M expression in CD19 CAR TD (transduced)/electroporated CRISPR, CD3-depleted T cells; CD19 CAR TD/electroporated CRISPR T cells and CD19 CAR TD T cells. In FIG. 90 shows CAR expression in CD19 CAR TD/CRISPR electroporated, CD3-depleted T cells; CD19 CAR TD/electroporated CRISPR T cells and CD19 CAR TD T cells. In FIG. 91 shows CD3/B2M/CAR expression at day 11 in CD19 CAR TD (transduced)/electroporated CRISPR, CD3-depleted T cells; CD19 CAR TD/electroporated CRISPR T cells and CD19 CAR TD T cells. In FIG. 92 summarizes the expression of CD3/B2M/CAR in various groups of T cells.

On day 11, different groups of T cells, as indicated in FIG. 93 were stimulated with CD19 positive cell lines, Raji or Nalm6. K562 was used as a CD19 negative control. Four hours after co-cultivation, an increase in CD107a expression was detected in each of the T cell groups, except for the negative controls.

On day 11, the cytolytic capacity of the T cells was tested as indicated in FIG. 94 using cytotoxic lymphocyte (CTL) fluorescent assay after co-culture of T cells with CD19 positive target cells, Nalm6-CBG. Also on day 11, T cell cytokine production was analyzed by stimulation of groups of T cells with Nalm6 target cells, see FIG. 95.

T cells were cultured in medium containing 100 U/ml IL-2 for up to 26 days. The results shown in FIG. 96 indicate that no abnormal T cell growth was observed for CRISPR-edited T cells from three donors.

As one of the most attractive applications of the CRISPR/Cas9 system, multiplex genome editing is very promising for advancing T cell-based adoptive immunotherapy. However, the low target efficiency of DNA transfection limits the use of multiplex genome editing in primary T cells. A hit-and-run delivery strategy has been developed to introduce CRISPR into T cells via co-electroporation of Cas9 mRNA and gRNA. Combining up to three steps of gRNA electroporation with temporary exposure to moderate hypothermia has typically yielded a target efficiency of >80% at the protein level for a single gene disruption. A more encouraging triple disruption of the gene TRAC, TRBC and B2M resulted in a double negative CD3 and HLA-I of approximately 65% without any purification and selection. The results also demonstrate that enrichment to >99% purity of disrupted T cells was easily obtained using clinically approved paramagnetic beads and that purified T cells were expanded up to 500-fold in 10 days. The expanded T cells retained the disrupted gene phenotype and exhibited traits consistent with central memory T cells. Destroyed T cells did not cause GVHD, which confirms that they can be used as allogeneic CAR T cells. Of note, gene-edited T cells have demonstrated anti-tumor activities in vitro and in mouse models of various tumors that are as effective or more effective than non-gene-edited T cells. Thus, the method described in the present description for obtaining synthetic cells can be easily translated into modern production processes in accordance with the principles of GMP.

The data described herein demonstrate that CRISPR/Cas9 is a powerful tool for multiplex genome editing in primary human T cells. Previous reports have demonstrated that T cells can be genetically edited with ZFN or TALEN to eliminate the expression of endogenous TCR α and β chains to prevent GVHD. Due to the complexity of targeting strategies to manipulate many genes via zinc finger nucleases (ZFN) and the TAL effector nuclease TALEN in T cells, previous studies have been unable to prevent GVHD and graft versus host disease simultaneously in preclinical animal models. NK cell activation can also be abolished by ablation of stimulatory NK ligands by CRISPR/Cas9 or by expression of non-classical class I HLA molecules such as HLA-E, which could potentially protect universal T cells from NK cell-mediated rejection.

As a result, using the CRISPR multiplex technology, it is possible to effectively obtain universal CART cells on a clinical scale with high antitumor activity and a decrease in

Claims (32)

female alloreactivity. This approach can be incorporated into modern GMP manufacturing processes and has a high potential for transition given the successful transition of adoptive transfer therapy with ZFN for HIV/AIDS. It is possible that generic CAR and TCR T cells will provide an alternative to autologous T cells. In fact, it is possible that universal CAR and TCR T cells with disabled checkpoint molecules may be more effective and have a wider range of applications compared to current CART-based therapies using autologous T cells against malignant tumors and infectious diseases. Other embodiments Enumeration of the list of elements in any definition of a variable in the present description includes definitions of such a variable as any one element or a combination (or subcombination) of the reducible elements. The listing of embodiments herein includes such embodiment as any single embodiment or in combination with any other embodiments or parts thereof. The description of each and every patent, patent application, and publication cited in this specification is hereby incorporated by reference in its entirety. While the invention has been disclosed with reference to specific embodiments, those skilled in the art will appreciate that other embodiments and variations of the present invention be developed without departing from the true spirit and scope of the invention. The appended claims are to be construed as including all such embodiments and equivalent modifications. CLAIM 1. Modified T cell containing: (a) a nucleic acid capable of repressing the expression of a FAS gene that is endogenous to a T cell; or a nucleic acid containing the sequence represented by SEQ ID NO: 5; and (b) a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular domain of the first costimulatory molecule. 2. The modified T cell of claim 1, wherein the nucleic acid capable of repressing gene expression is selected from the group consisting of antisense RNA, antagonistic RNA, siRNA, shRNA, and CRISPR system gRNA. 3. The modified T cell of claim 2, wherein the CRISPR system comprises the pAd5/F35-CRISPR vector. 4. The modified T cell of claim 1, wherein the CAR antigen binding domain comprises an antibody selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, a single chain variable fragment, and antigen binding fragments thereof. 5. The modified T cell of claim 1, wherein the CAR antigen-binding domain specifically binds to an antigen on the target cell. 6. The modified T cell of claim 1, wherein the intracellular CAR domain contains dual signaling domains. 7. The modified T cell of claim 1 further comprising an exogenous nucleic acid encoding a second costimulatory molecule. 8. The modified T cell of claim 7 wherein the costimulatory molecule is selected from the group consisting of CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L. 9. The modified T cell of claim 8, wherein the CD3 contains at least two different CD3 chains. 10. The modified T cell of claim 9, wherein the at least two different CD3 chains are at least the CD3 zeta chain and the CD3 epsilon chain. 11. The method for obtaining a modified T cell according to claim 1, including introducing into the T cell: (a) a nucleic acid capable of repressing the expression of a FAS gene that is endogenous to the T cell; or a nucleic acid containing the sequence represented by SEQ ID NO: 5; and (b) a nucleic acid encoding a chimeric antigen receptor (CAR), thereby obtaining a modified T cell. 12. The method of claim 11, wherein the nucleic acid capable of repressing gene expression is selected from the group consisting of antisense RNA, antagonistic RNA, siRNA, shRNA, and gRNA of the CRISPR system. 13. The method of claim 12, wherein the CRISPR system comprises the pAd5/F35-CRISPR vector. 14. The method according to claim 11, where the CAR antigen-binding domain contains an antibody selected from the group, - 56 040572 consisting of a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, a single chain variable fragment, and antigen-binding fragments thereof. 15. The method of claim 11 wherein the CAR antigen binding domain specifically binds to an antigen on the target cell. 16. The method of claim 11 wherein the intracellular CAR domain contains dual signaling domains. 17. The method of claim 11, wherein the T cell is derived from the group consisting of peripheral blood mononuclear cells, cord blood cells, a purified T cell population, and a T cell line. 18. The method of claim 11, further comprising expanding the T cell, thereby obtaining expanded T cells. 19. The method of claim 18, wherein the step of expanding the T cell comprises culturing the T cell with a factor selected from the group consisting of flt3-L, IL-1, IL-3, and c-kit ligand. 20. The method of claim 11 further comprising cryopreserving the T cell, thereby obtaining cryopreserved T cells. 21. The method of claim 20 further comprising thawing the cryopreserved T cell prior to introducing the nucleic acid of (a) and/or (b) into the T cell. 22. The method of claim 18, wherein the administration of the nucleic acid of (a) and/or (b) is selected from the group consisting of expanded T cell transduction, expanded T cell transfection, and expanded T cell electroporation. 23. The method of claim 11 further comprising electroporation of the RNA encoding the second costimulatory molecule into the T cell. 24. The method of claim 23 wherein the second costimulatory molecule is selected from the group consisting of CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L. 25. The method of claim 11 further comprising expressing Klf4, Oct3/4, and Sox2 in the T cell to induce T cell pluripotency. 26. A method of treating a disease or condition associated with increased immunity in an individual, comprising administering an effective amount of a pharmaceutical composition containing a modified T cell according to claim 1 to an individual in need thereof. 27. A method of treating a condition in an individual, comprising administering to the individual a therapeutically effective amount of a pharmaceutical composition comprising the modified T cell of claim 1, wherein the condition is an autoimmune disease or cancer. 28. The method of claim 27, wherein the autoimmune disease is selected from the group consisting of acquired immune deficiency syndrome (AIDS), alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease (AIED). ), autoimmune lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behcet's disease, cardiomyopathy, celiac disease herpetiform dermatitis; chronic fatigue and immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy (CIPD), scarring pemphigoid, cold agglutinin disease, CREST syndrome, Crohn's disease, Dego's disease, juvenile dermatomyositis, discoid lupus, mixed primary cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, insulin-dependent diabetes mellitus, juvenile chronic arthritis (Still's disease), juvenile rheumatoid arthritis, Meniere's disease, mixed connective tissue disease, disseminated sclerosis, myasthenia gravis, pernicious anemia, periarteritis nodosa, polychondria, polyglandular syndromes, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma (progressive systemic sclerosis (PSS), also known as systemic sclerosis (SS)), Sjögren's syndrome, stiff man syndrome, systemic lupus erythematosus, Takayasu's arteritis, temporal arteritis/giant cell arteritis, ulcerative colitis, uveitis, vitiligo, Wegener's granulomatosis, and any combination thereof. 29. The method of claim 27, wherein the condition is cancer. 30. The method of claim 29, wherein the cancer is selected from the group consisting of breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, malignant brain tumors, lymphomas, leukemia, lung cancer, and any combination thereof. 31. A method of stimulating a T cell-mediated immune response to a target cell or target tissue in an individual, comprising administering to the individual an effective amount of a pharmaceutical composition comprising the modified T cell of claim 1. 32. The method of claim 31, further comprising inducing lysis of the target cell or tissue. -