EA040558B1 - BACTERIA WITH REDUCED VIRULENCE FOR THE TREATMENT OF MALIGNANT SOLID TUMORS - Google Patents

Description

(57) The present invention provides a recombinant strain of Gram-negative bacteria with attenuated virulence for use in a method of treating a malignant solid tumor in a subject.

Field of invention

The present invention relates to recombinant strains of gram-negative bacteria with attenuated virulence for use in a method of treating a malignant solid tumor in a subject.

State of the art

The main problem in the treatment of malignant solid tumors is the delivery of therapeutic molecules to cancer cells in sufficient quantities while reducing damage to non-specific cells and tissues. The most common treatment approaches (surgery, chemotherapy and radiotherapy) all too often fail in treating patients and are characterized by significant side effects such as nausea and diarrhea. Thus, several other treatment strategies are being developed, including angiogenesis inhibitors and immunotherapeutic agents.

To reduce damage to non-carcinogenic tissues, approaches that provide targeted drug delivery are of great interest. For example, antibodies are used that recognize the surface structures of tumor cells and, in the optimal case, selectively bind to tumor cells. To improve the mechanism of action of such antibodies, they can be conjugated with therapeutic agents or lipid vesicles containing drugs. One problem with the use of such vesicles is the proper release of the active agent. Even more challenging is the delivery of therapeutic proteins or peptides, especially when targeting intracellular mechanisms. Attempts to solve the problem of delivering therapeutic proteins to eukaryotic cells involve many alternative methods, including the use of cell penetrating peptides (CPP) or similar technologies, as well as various nanoparticle-based methodologies. The disadvantage of all these technologies is the low efficiency and the fact that the cargo absorbed by the cell by endocytosis is more likely to be degraded in lysosomes as a result. In addition, the conflict between the need to ensure the stability of the carrier associated with the cargo in the human body and the requirement to ensure destabilization and release in the target cell is an inherent problem of such technologies. Various bacteria such as Escherichia coli, Vibrio cholerae, Salmonella enterica, Listeria monocytogenes, Pseudomonas aeruginosa and Bifidobacteria have been shown to replicate in malignant solid tumors when injected into a region distal to the tumor. Currently, only Bacillus Calmette-Guerin (BCG derived from Mycobacterium bovis) is used in clinical practice. BCG is administered to treat superficial bladder cancer, although the underlying molecular mechanism remains largely unknown. An optimal bacterial strain for the treatment of malignant solid tumors would specifically accumulate and proliferate in the tumor region and be killed in non-specific regions. In this sense, an optimal bacterial carrier for a cancer-targeting agent should provide significant accumulation in the desired site of action and be minimally present in non-specific areas. Development of such a bacterial strain for the treatment of malignant solid tumors, capable of, for example, delivering a cargo produced in bacteria to a site of action inside cancer cells, i.e. outside of bacteria, remains the main problem.

The essence of the invention

The present invention provides attenuated virulence recombinant gram-negative bacterial strains for use in a method of treating a malignant solid tumor in a subject. In some embodiments, the present invention provides recombinant strains of gram-negative bacteria with weakened virulence and their use for the treatment of malignant solid tumors in a subject, and these recombinant strains of gram-negative bacteria with weakened virulence allow translocation of various type III effectors, as well as type IV effectors, viral proteins and, most importantly, functional eukaryotic proteins into malignant solid tumor cells.

In a first aspect, the present invention provides a virulence-attenuated recombinant Gram-negative bacterium strain transformed with a vector comprising a 5' to 3' promoter;

a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter;

a second DNA sequence encoding a heterologous protein fused in-frame to the 3' end of said first DNA sequence for use in a method for treating a malignant solid tumor in a subject in which a recombinant gram-negative bacterium strain with attenuated virulence accumulates in a malignant solid tumor, wherein said method comprises administering to said subject said recombinant

- 1 040558 strain of gram-negative bacteria with weakened virulence, and while the specified recombinant strain of gram-negative bacteria with weakened virulence is administered in an amount sufficient to treat the specified subject.

Similarly, the present invention provides a method of treating a malignant solid tumor in a subject, wherein said recombinant gram-negative bacterium strain with attenuated virulence accumulates in the malignant solid tumor, said method comprising administering to said subject a recombinant strain of gram-negative bacterium with attenuated virulence transformed with a vector containing in the direction from 5' to 3' the promoter;

a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter;

a second DNA sequence encoding a heterologous protein fused in-frame to the 3' end of said first DNA sequence, wherein said recombinant strain of gram-negative bacterium with attenuated virulence is administered in an amount sufficient to treat said subject.

Similarly, the present invention provides for the use of a recombinant gram-negative bacterium strain of attenuated virulence transformed with a vector containing in the 5' to 3' direction a promoter;

a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter;

a second DNA sequence encoding a heterologous protein fused in-frame to the 3' end of said first DNA sequence to produce a medicament for the treatment of a malignant solid tumor in a subject, wherein said recombinant Gram-negative bacterium strain with attenuated virulence accumulates in said malignant solid tumor .

In a further aspect, the present invention provides a recombinant gram-negative bacterial strain of attenuated virulence, wherein said recombinant gram-negative bacterial strain of attenuated virulence is defective in the production of at least one bacterial effector protein virulent to eukaryotic cells, or defective in the production of at least one bacterial protein that is part of a secretion system mechanism for use in a method of treating a malignant solid tumor in a subject, wherein said recombinant gram-negative bacterium strain with attenuated virulence accumulates in said malignant solid tumor, said method comprising administering said recombinant gram-negative bacterium strain with attenuated virulence to said subject, and wherein said recombinant Gram-negative bacterium strain with attenuated virulence is administered in an amount to residual for the treatment of the specified subject.

Similarly, the present invention provides a method of treating a malignant solid tumor in a subject, wherein said recombinant gram-negative bacterium strain with attenuated virulence accumulates in said malignant solid tumor, said method comprising administering a recombinant strain of gram-negative bacterium with attenuated virulence to said subject, said recombinant strain gram-negative bacterium with weakened virulence is defective in the production of at least one bacterial effector protein that is virulent against eukaryotic cells, or defective in the production of at least one bacterial protein that is part of the mechanism of the secretion system, and at the same time the specified recombinant strain of gram-negative bacteria with weakened virulence is administered in an amount sufficient to treat the specified subject.

Similarly, the present invention provides the use of a recombinant strain of gram-negative bacterium with attenuated virulence, wherein said recombinant strain of gram-negative bacterium with attenuated virulence is defective in the production of at least one bacterial effector protein virulent against eukaryotic cells, or defective in the production of at least one bacterial protein that is part of the mechanism of the secretion system, to obtain a drug for the treatment of a malignant solid tumor in a subject, while the specified recombinant strain of gram-negative bacteria with attenuated virulence accumulates in a malignant solid tumor.

In a further aspect, the present invention provides a pharmaceutical composition comprising a recombinant gram-negative bacterium strain of attenuated virulence transformed with a vector containing a 5' to 3' promoter;

- 2 040558 a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter;

a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence; and a pharmaceutically acceptable carrier for use in a method of treating a malignant solid tumor in a subject in which a recombinant strain of Gram-negative bacteria with attenuated virulence accumulates in a malignant solid tumor, said method comprising administering to the subject's body said pharmaceutical composition and the pharmaceutical composition is administered in an amount sufficient to treat the subject.

Similarly, the present invention provides a method for treating a malignant solid tumor in a subject in which a recombinant strain of gram-negative bacteria with attenuated virulence accumulates in a malignant solid tumor, comprising administering to the body of the subject a pharmaceutical composition containing a recombinant strain of gram-negative bacteria with attenuated virulence, transformed with a vector, containing in the direction from 5' to 3' the promoter;

a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter;

a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence; and a pharmaceutically acceptable carrier, wherein the pharmaceutical composition is administered in an amount sufficient to treat the subject.

Similarly, the present invention provides the use of a pharmaceutical composition comprising a recombinant gram-negative bacterium strain of attenuated virulence transformed with a vector containing in the 5' to 3' direction a promoter;

a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter;

a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence; and a pharmaceutically acceptable carrier for the preparation of a medicament for the treatment of a malignant solid tumor in a subject in which a recombinant gram-negative bacterium strain with attenuated virulence accumulates in a malignant solid tumor.

In a further aspect, the present invention provides a pharmaceutical composition comprising a recombinant attenuated virulence Gram-negative bacterium strain and a pharmaceutically acceptable carrier, wherein said recombinant attenuated Gram-negative bacterium strain is defective in the production of at least one bacterial effector protein virulent to eukaryotic cells. , or defective in the production of at least one bacterial protein that is part of the mechanism of the secretion system, for use in a method of treating a malignant solid tumor in a subject, while said recombinant strain of gram-negative bacteria with attenuated virulence accumulates in a malignant solid tumor, and this method includes the introduction said pharmaceutical composition into a subject's body, wherein said pharmaceutical composition is administered in an amount sufficient to treat said about the subject.

Similarly, the present invention provides a method for treating a malignant solid tumor in a subject, wherein a recombinant gram-negative bacterium strain of attenuated virulence accumulates in a malignant solid tumor, said method comprising administering to said subject a pharmaceutical composition comprising a recombinant strain of gram-negative bacterium with attenuated virulence, defective by the production of at least one bacterial effector protein that is virulent against eukaryotic cells, or defective by the production of at least one bacterial protein that is part of the mechanism of the secretion system; and a pharmaceutically acceptable carrier, wherein said pharmaceutical composition is administered in an amount sufficient to treat said subject.

Similarly, the present invention provides the use of a pharmaceutical composition comprising a recombinant Gram-negative bacterium strain of attenuated virulence, defective in the production of at least one bacterial effector protein virulent to eukaryotic cells, or defective in the production of at least one bacterial protein that is part of mechanism of the secretion system; And

A pharmaceutically acceptable carrier for the preparation of a medicament for the treatment of a malignant solid tumor in a subject, wherein said recombinant Gram-negative bacterium strain with attenuated virulence accumulates in said malignant solid tumor.

Brief description of the drawings

Fig. 1. Characterization of T3SS protein delivery.

(A) Schematic representation of T3SS-dependent protein secretion into the environment (in vitro secretions) (left) or into eukaryotic cells (right). I: type 3 secretion system is shown, II: refers to proteins secreted into the environment, III: proteins translocated across the membrane into the cytosol of eukaryotic cells (VII), VI: shows a fragment of two bacterial membranes into which T3SS is inserted and the cytosol of a bacterial cell below it, IV: is a fusion protein attached to the N-terminal fragment of YopE1_ ₁₃₈ (V).

(B) In vitro secretion of I: Y. enterocolitica E40 wild type, II: Y. enterocolitica AHOPEMT asd, or III: Y. enterocolitica AHOPEMT asd+pBadSi_2, revealed by Western blotting of total bacterial lysates (IV) and supernatant of precipitated cultures ( V) using an anti-YopE antibody.

Fig. 2. Study of the characteristics of T3SS protein delivery to epithelial cells.

(A) Anti-Myc immunofluorescent staining of HeLa cells infected at an MOI of 100 for 1 hour I: Y. enterocolitica AHOPEMT asd or II: Y. enterocolitica AHOPEMT asd pBad_Si2.

(B) Quantification of the intensity of immunofluorescent staining with antibodies against Myc (A) of the content of HeLa cells. Data pooled from n=20 regions, error rates mean standard error of the mean. I: not infected, II: Y. enterocolitica AHOPEMT asd or III: Y. enterocolitica AHOPEMT asd+pBad_Si2. The y-axis indicates the intensity of staining with anti-Myc antibodies (arbitrary units). The x-axis shows the infection time in minutes.

(C) Quantitative determination of the intensity of immunofluorescent staining with anti-Myc antibodies in cell contents. HeLa cells were infected for 1 h with Y. enterocolitica AHOPEMT asd+pBad_Si2 at the MOI indicated on the x-axis. Data pooled from n=20 regions. The error rates mean the standard error of the mean. The Y-axis shows the intensity of staining with anti-Myc antibodies (c.u.).

Fig. 3. The T3SS-based protein delivery modification localizes the YopE ₁ fusion protein. ₁₃₈ (EGFP) in the cell nucleus.

EGFP signal in HeLa cells infected with I: Y. enterocolitica AHOPEMT asd or II: Y. enterocolitica AHOPEMT asd AyopB carrying plasmid III: +YopE1_ ₁₃₈ -EGFP or IV: +YopE1. ₁₃₈ -EGFP-NLS, with an MOI of 100. The EGFP signal is shown in Figures a. Nuclei are colored in illustrations b for localization comparison.

Fig. 4. Modification of protein delivery based on T3SS provides for the removal of the appendage YopE1_ ₁₃₈ .

HeLa cells were simultaneously infected with two different strains of Y. enterocolitica by simply mixing the two bacterial suspensions. One strain delivers the TEV protease attached to YopE1_ ₁₃₈ while the other strain delivers the desired protein attached to YopE1_ ₁₃₈ with a linker containing a double cleavage site for the TEV protease. Upon delivery of the protein to the eukaryotic cell, the TEV protease must cleave the YopE1_ ₁₃₈ appendage from the desired protein.

(A) HeLa cells lysed with digitonin, not infected (II) or after infection (MOI=100) for 2 h I: Y. enterocolitica ANOREMT asd and III: +pBadSi_2, IV: +YopE1_ ₁₃₈ -2x TEV- cleavage site Flag-INK4C, V: +YopE1_ ₁₃₈ -2x TEV-Flag-INK4C cleavage site, and further treated overnight with purified TEV protease, and VI: +YopE1_ ₁₃₈ -2x TEV-FlagINK4C cleavage site, and second strain +YopE1_ ₁₃₈ - TEV was analyzed by Western blotting using an anti-INK4C antibody (shown in Figures a) for the presence of YopE ₁ _ ₁₃₈ -2x the TEV-Flag-INK4C cleavage site or its cleaved form, Flag-INK4C. As a loading control, a Western blot of anti-actin antibodies was performed (shown in illustration b). In one case (V), lysed cells were incubated overnight with purified TEV protease.

(B) Actin-normalized quantification of the intensity of anti-INK4C antibody staining (shown in (a.u.) on the y-axis) of the data in Figure (A) to scale the full-length YopE1_ ₁₃₈ -2x TEV-Flag-INK4C cleavage site, where sample IV is taken as 100%. I: Y. enterocolitica ANOREMT asd and IV: +YopE1_ ₁₃₈ -2x TEV-Flag-INK4C cleavage site, V: +YopE1_ ₁₃₈ -2x TEV-Flag-INK4C cleavage site, and further treated overnight with purified TEV protease, and VI : +YopE1_ ₁₃₈ -2x TEV-Flag-INK4C cleavage site, and the second strain YopE1_ ₁₃₈ -TEV. Data were pooled from n=2 independent experiments. Error rates mean standard error of the mean.

(C) HeLa cells lysed with digitonin, not infected (II) or after infection (MOI=100) for 2 h I: Y. enterocolitica ANOREMT asd and III: +pBadSi_2, IV: +YopE1_ ₁₃₈ -2x

- 4 040558 TEV-ETl-Myc, V: +YopE1_ ₁₃₈ -2x TEV-ET1-Myc cleavage site and further treated overnight with purified TEV protease, and VI: +YopE1_ ₁₃₈ -2x TEV-ETI-Myc cleavage site, and a second strain, + _{YopE1_138} -TEV, were analyzed by Western blotting using an anti-Myc antibody (shown in Figures a) for the presence of _{YopE1_138-2x} the TEV- _ET1Myc cleavage site or its ET1-Myc cleavage. As a loading control, a Western blot of anti-actin antibodies was performed (shown in illustration b). In one case (V), lysed cells were incubated overnight with purified TEV protease.

Fig. 5. Delivery of bacterial effector proteins to eukaryotic cells.

(A) HeLa cells were infected with I: Y. enterocolitica AHOPEMT asd carrying II: pBad_Si2 or III: YopE1_ ₁₃₈ -SopE at an MOI of 100 for the time indicated above in the images (2, 10, or 60 min). After fixation in cells, the actin cytoskeleton was stained.

(B) HeLa cells were left uninfected (II) or infected with I: Y. enterocolitica AHOPEMT asd bearing III: YopE1. _{. _} the actin cytoskeleton (shown in illustration a) and then stained for the presence of the YopE1_ ₁₃₈ -SopE-Myc fusion protein using an anti-Myc antibody (shown in illustration b).

Fig. 6. Delivery of bacterial effector proteins to eukaryotic cells.

(A) Western blotting of phospho-p38 (a), total p38 (b), and actin (c) on HeLa cells left uninfected (II) or infected for 75 min I: Y. enterocolitica AHOPEMT asd bearing III: pBad_Si2 or IV: YopE1_ ₁₃₈ -OspF at an MOI of 100. Cells were stimulated with TNFa for the last 30 post-infection as indicated (+ means TNFa added, - means no TNFa treatment).

(B) Western blotting of phospho-Akt T308 (a), and S473 (b), and actin (c) on HeLa cells left uninfected (II) or infected for 22.5 or 45 min (indicated under blotting results ) I: Y. enterocolitica AHOPEMT asd bearing III: pBad_Si2, IV: YopE1_ ₁₃₈ -SopE or V: YopE1_ ₁₃₈ -SopB at an MOI of 100.

(C) cAMP levels (in fmol/well, shown on y-axis) in HeLa cells left uninfected (I) or infected for 2.5 h V: Y. enterocolitica AHOPEMT asd +YopE1_ ₁₃₈ -BepA, VI: Y enterocolitica AHOPEMT asd + YopE ₁ . ₁₃₈ -BepA _E305 . _end , VII: Y. enterocolitica AHOPEMT asd+YopE1_ ₁₃₈ BepG _B id or VIII: Y. enterocolitica AHOPEMT asd+pBad_Si2 at an MOI of 100. As a positive control to samples II (1 µg/ml), III (25 µg/ ml) or IV (50 µg/ml) added cholera toxin (CT) for 1 hour. Data pooled from n=3 independent experiments, error rates mean standard error of the mean. Statistical analysis was performed using an unpaired two-tailed t-test (ns means non-significant change, ** means p value<0.01, *** means <0.001 value).

Fig. 7. Delivery of human tBid to eukaryotic cells induces intense apoptosis.

(A) Western blotting of p17 cleaved caspase 3 (a) and actin (b) in HeLa cells left uninfected (II) or infected for 60 min I: Y. enterocolitica AHOPEMT asd bearing III: pBad_Si2, IV: YopE1_ ₁₃₈ -Bid or V: YopE1_ ₁₃₈ -t-Bid at an MOI of 100. In some cases, cells were treated with VI: 0.5 μM staurosporine or VII: 1 μM staurosporine.

(B) HeLa cells lysed with ligtonin and left uninfected (II) or after infection for 1 h I: Y. enterocolitica AHOPEMT asd bearing III: pBad_Si2, IV: YopE1_ ₁₃₈ -Bid or V: YopE1_ ₁₃₈ -t-Bid at an MOI of 100 was analyzed by Western blot using an anti-Bid antibody (a) comparing endogenous levels of Bid (denoted as Z) with the level of translocated YopE1. ₁₃₈ -Bid (marked as X) or YopE1_ ₁₃₈ -tBid (marked as Y). As a loading control, a Western blot of anti-actin antibodies was performed (shown in illustration b). In some cases, cells were treated with VI: 0.5 μM staurosporine or VII: 1 μM staurosporine.

(C) HeLa cells were left uninfected (I) or infected at an MOI of 100 for 1 h II: Y. enterocolitica AHOPEMT asd+pBad_Si2, III: Y. enterocolitica AHOPEMT asd+YopE ₁ _ ₁₃₈ -Bid, IV: Y. enterocolitica AHOPEMT asd + YopE1_ ₁₃₈ -tBid. In some cases, cells were treated with V: 0.5 μM staurosporine or VI: 1 μM staurosporine. After fixation in cells, the actin cytoskeleton was stained (gray).

Fig. 8. tBid-dependent phosphoproteome.

HeLa cells were infected for 30 min with Y. enterocolitica AHOPEMT asd+YopE ₁ _ ₁₃₈ -t-Bid at an MOI of 100 and Y. enterocolitica AHOPEMT asd+pBad_Si2 as a control.

(A) Graphical representation of the tBid phosphoproteome. Proteins containing phosphoproteins, the regulation of which was significantly dependent on tBid (grey) (q value <0.01), as well as known proteins associated with apoptosis (dark gray), are presented in the STRING network of known and predicted protein-protein interactions (high confidence, score 0.7). Only proteins with at least one bond in STRING are shown.

- 5 040558 (B) Confocal images of HeLa cells infected with Y. enterocolitica ΔΗΟΡΕΜΤ asd+pBad_Si2 (I) or Y. enterocolitica ΔΗΟΡΕΜΤ asd+YopE ₁ - ₁₃₈ -t-Bid (II) revealed the induction of an apoptotic phenotype upon delivery of tBid. Cell nuclei were stained with Hoechst stain (a), F-actin phalloidin (b), tubulin with anti-tubulin antibody (c), and mitochondria with mitochondrial tracing stain (d). Scale bar: 40 µm.

Fig. 9. Description of the delivery toolkit based on type III secretion.

(A) Vector maps of the pBad_Si1 and pBad_Si2 cloning plasmids used to generate hybrid constructs with YopE _1-138 . SycE chaperone and YopE _1-138 hybrid driven by native Y. enterocolitica promoter. The two plasmids differ only in the presence of EGFP, induced by arabinose and present in pBad_Si1.

(B) Polylinker directly after the yopE ₁ fragment. ₁₃₈ on plasmids pBad_Si1 and pBad_Si2.

Fig. 10. Study of the characteristics of T3SS protein delivery to different cell lines.

Immunofluorescent staining with antibodies against Myc Swiss 3T3 fibroblasts (a), Jurkat cells (b) and HUVEC cells (c), left uninfected (II) or infected with Y. enterocolitica ΔΗΟΡΕΜΤ asd+pBad_Si2 (I) at the MOI indicated above the images (MOI 25, 50, 100, 200 and 400 for HUVEC cells) for 1 hour.

Fig. 11. Dependence of delivery of bacterial effector proteins to eukaryotic cells on T3SS.

HeLa cells lysed with digitonin after infection at an MOI of 100 for the time indicated above the blotting results (0, 5, 15, 10, 60 and 120 min) Y. enterocolitica ΔHOPEMTasd ΔyopB+YopE ₁ . ₁₃₈ -SopE-Myc (I) or Y. enterocolitica ΔΗΟΡΕΜΤ asd + YopE ₁ . ₁₃₈ -SopE-Myc (II) was analyzed by Western blot using anti-Myc antibodies. The size corresponding to YopE _1-138 SopE-Myc is indicated as a, while the size of the endogenous c-Myc protein is indicated as b.

Fig. 12 and 13. T3SS-dependent secretion of various other proteins into the culture supernatant.

In vitro secretion experiment I: Y. enterocolitica ΔΗΟΡΕΜΤ asd+YopE _1-138 attached to protein as indicated. The protein content of the total bacterial lysates (A) and the supernatant of the precipitated cultures (B) was analyzed by Western blotting using an anti-YopE antibody. The numbers given are the molecular weight in kDa at the corresponding height.

Fig. 14A-14N. Y. enterocolitica and S. enterica strains used in this study.

The list of Y. enterocolitica and S. enterica strains used in this study contains information on background strains, plasmids, and proteins for T3SS-dependent delivery encoded by the respective plasmids. In addition, information is provided on the oligonucleotides used to construct the corresponding plasmid, plasmid backbone, and antibiotic resistance markers.

Fig. 15. Delivery of mouse tBid, mouse Bid BH3, and mouse Bax BH3 to B16F10 cells induces extensive apoptosis.

B16F10 cells not infected (I) or after infection (MOI=50) for 2.5 h Y. enterocolitica ΔΗΟΡΕΜΤ asd and II: +pBadSi_2, III: +YopE ₁ - ₁₃₈ -tBid mice after codon optimization for Y. enterocolitica , IV: +YopE ₁ - ₁₃₈ -Bid BH ₃ mice after codon optimization for Y. enterocolitica or V: +YopE _1-138 -Bax BH ₃ mice after codon optimization for Y. enterocolitica. After fixation in cells, the actin cytoskeleton and nuclei were stained (gray).

Fig. 16. Delivery of mouse tBid, mouse Bid BH3, and mouse Bax BH3 to D2A1 cells induces extensive apoptosis.

D2A1 cells not infected (I) or after infection (MOI=50) for 2.5 h Y. enterocolitica ΔΗΟΡΕΜΤ asd and II: +pBadSi_2, III: +YopE ₁ - ₁₃₈ -tBid mice after codon optimization for Y. enterocolitica , IV: +YopE ₁ - ₁₃₈ -Bid BH ₃ mouse after codon optimization for Y. enterocolitica or V: +YopE1-138-Bax mouse BH3 after codon optimization for Y. enterocolitica. After fixation in cells, the actin cytoskeleton and nuclei were stained (gray).

Fig. 17. Delivery of mouse tBid, mouse Bid BH3, and mouse Bax BH3 to HeLa cells induces extensive apoptosis.

HeLa cells not infected (I) or after infection (MOI=50) for 2.5 h Y. enterocolitica ΔΗΟΡΕΜΤ asd II: +pBadSi_2, III: +YopE ₁ - ₁₃₈ -tBid mouse after codon optimization for Y. enterocolitica, IV: +YopE ₁ - ₁₃₈ -Bid mouse BH3 after codon optimization for Y. enterocolitica or V: +YopE ₁ - ₁₃₈ -Bax mouse BH3 after codon optimization for Y. enterocolitica. After fixation in cells, the actin cytoskeleton and nuclei were stained (gray).

Fig. 18. Delivery of mouse tBid, mouse Bid BH3, and mouse Bax BH3 to 4T1 cells induces extensive apoptosis.

4T1 cells not infected (I) or after infection (MOI=50) for 2.5 h Y. enterocolitica ΔΗΟΡΕΜΤ asd II: +pBadSi_2, III: +YopE ₁ - ₁₃₈ -tBid mice after codon optimization for Y. enterocolitica, IV: +YopE ₁ - ₁₃₈ -Bid BH3 mouse after codon optimization for Y. enterocolitica or V: +YopE ₁ - ₁₃₈ -Bax

- 6 040558

Mouse BH3 after codon optimization for Y. enterocolitica. After fixation in cells, the actin cytoskeleton and nuclei were stained (gray).

Fig. 19. Delivery of tBid mouse S. enterica grown under conditions of SPI-1 T3SS induction into eukaryotic cells induces apoptosis.

(A) Western blotting of p17 cleaved caspase 3 in HeLa cells left uninfected (I) or infected for 4 hours III: S. enterica aroA bearing IV: SteA1. ₂₀ -t-Bid, V: SteA _FL -Bid, VI: SopE1. ₈₁ -t-Bid or VII: SopE ₁ _ ₁₀₅ -t-Bid with an MOI of 100. For this experiment, all strains of S. enterica aroA were grown under SPI-1 T3SS induction conditions. In some cases, cells were treated with II: 1 μM staurosporine. The numbers given are the molecular weight in kDa at the corresponding height.

Fig. 20. Delivery of tBid mouse S. enterica grown under conditions of SPI-2 T3SS induction into eukaryotic cells induces apoptosis.

(A) Western blotting of p17 cleaved caspase 3 in HeLa cells left uninfected (I) or infected for 4 h III: S. enterica aroA bearing IV: SteA ₁ _ ₂₀ -t-Bid, V: SteA _FL - Bid, VI: SopE1. ₈₁ -t-Bid or VII: SopE ₁ _ ₁₀₅ -t-Bid with an MOI of 100. For this experiment, all S. enterica aroA strains were grown under SPI-2 T3SS induction conditions. In some cases, cells were treated with II: 1 μM staurosporine. The numbers given are the molecular weight in kDa at the corresponding height.

Fig. 21. S. enterica T3SS-dependent secretion of various cell cycle proteins into culture supernatant.

In vitro secretion experiment of S. enterica aroA+SteA _FL (I, III, V, VII) or _SopE1-105 (II, IV, VI, VIII) attached to proteins from the following list. I and II: Ink4a-MycHis; III and IV: Ink4c-MycHis; V and VI: Mad2-MycHis; VII and VIII: Cdk1-MycHis. The protein content of the supernatant of the precipitated cultures (A) and total bacterial lysates (B) was analyzed by Western blotting using an anti-Myc antibody. The numbers given are the molecular weight in kDa at the corresponding height.

Fig. 22. T3SS-dependent secretion of various known cell cycle-influencing proteins into the culture supernatant.

In vitro secretion experiment I: Y. enterocolitica AHOPEMT asd+pBad_Si2. II-VII: Y. enterocolitica AHOPEMT asd+YopE1_ ₁₃₈ attached to peptides from the following list: II: Ink4A ₈₄ . ₁₀₃ ; III: p107/RBL1657-662; IV: p21 _M i-i6odi49a; V: p21145-160D149A; VI: p21 _P -zz; VII: cyclin D2139.147. Protein content in the supernatant of the precipitated cultures (A) and total bacterial lysates (B) was analyzed by Western blot using anti-YopE antibody. The numbers given are the molecular weight in kDa at the corresponding height.

Fig. 23. Attachment of the T3SS-delivered protein to ubiquitin allows removal of the YopE1-138 appendage.

HeLa cells were infected with a strain delivering the desired protein fused to YopE _1-138 with directly attached ubiquitin (YopE _1-138 -Ubi). Upon delivery of the protein to the eukaryotic cell, endogenous ubiquitin-specific proteases must cleave the YopE1-138-Ubi appendage from the desired protein. HeLa cells lysed with digitonin and not infected (I) or after infection (MOI=100) for 1 h II: Y. enterocolitica ANOREMT asd+YopE _1-138 -Flag-INK4C-MycHis or III: +YopE _1-138 - Flag-ubiquitin-INK4C-MycHis was analyzed by Western blot using an anti-INK4C antibody for the presence of IV: YopE _1-138 -Flag-ubiquitin-INK4C-MycHis or V: YopE _1-138 Flag-INK4C-MycHis, cleaved form VI: INK4C-MycHis and VII: endogenous INK4C.

Fig. 24. Virulence plasmid Yersinia enterocolitica W227 - pYV.

Plasmid virulence Yersinia size 69673 p. (pYV) strain W227 shown to scale. The T3SS effector proteins, replication origin, and arsenic resistance markers (encoded by the arsC, B, R, and H genes) are designated: I: replication origin, II: yopO, III: yopP, IV: yopQ, V: yopT, VI: sycT, VII: yopM, VIII: yopD, IX: yopB, X: sycD, XII: yopH, XIII: sycH, XIV: sycE, XV: yopE, XVI: yadA, XVII-XVXX: arsC, B, R, and H.

Fig. 25. Validation of yor deletion by in vitro secretion assay.

In vitro secretion assay I: Y. enterocolitica AyopH, O, P, E, M, T asd, II: Y. Enterocolitica MRS40 d.t., III: Y. enterocolitica AyopH, O, P, E, M, T asd +p-yopE. The marks on the right indicate the height of specific Yop proteins: IV: YopO, V: YopH, VI: YopM, VII: YopE.

Fig. 26. Dose escalation study in immunocompetent mice: mouse weight.

Mice were weighed daily after iv challenge with the bacteria. I: time, days, II: weight in grams, III: Y. enterocolitica AyopH, O, P, E, M, T asd, TV: S. enterica AaroA administered intravenously in the indicated amount (10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ CFU per animal).

Fig. 27. Dose escalation study in immunocompetent mice: blood count.

The amount in the blood at the indicated time was evaluated by serial dilution and counting of the obtained colony forming units (CFU). I: time, day, II: CFU per ml, III: Y. enterocolitica AyopH,

- 7 040558

O, P, E, M, Ta asd, IV: S. enterica AaroA administered i.v. in the indicated amount (10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ CFU per animal).

Fig. 28. Dose escalation study in immunocompetent mice: liver counts.

The amount in the liver at the indicated time was assessed by homogenization of the organ, serial dilution and calculation of the obtained colony forming units (CFU). I: time, day, II: CFU per g, III: Y. enterocolitica AyorH, O, P, E, M, T asd, IV: S. enterica AaroA, administered intravenously in the indicated amount (10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ CFU per animal).

Fig. 29. Dose escalation study in immunocompetent mice: lung count.

The number in the lungs at the indicated time was assessed by homogenization of the organ, serial dilution and calculation of the obtained colony forming units (CFU). I: time, day, II: CFU per g, III: Y. enterocolitica AyorH, O, P, E, M, T asd, IV: S. enterica AaroA, administered intravenously in the indicated amount (10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ CFU per animal).

Fig. 30. Dose escalation study in immunocompetent mice: amount in spleen.

The amount in the spleen at the indicated time was assessed by homogenization of the organ, serial dilution and counting of the obtained colony forming units (CFU). I: time, day, II: CFU per g, III: Y. enterocolitica AyorH, O, P, E, M, T asd, IV: S. enterica AaroA, administered intravenously in the indicated amount (10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ CFU per animal).

Fig. 31. Biodistribution of Y. enterocolitica subsp. palearctica in a mouse B16F10 melanoma allograft model: appearance scoring.

I: time, days, II: assessment, III: Y. enterocolitica MRS40 d.t., IV: Y. enterocolitica AuorH, O, P, E, M, T. Arrows indicate the day of intravenous infection of 2x10 ⁵ bacteria.

Fig. 32. Biodistribution of Y. enterocolitica subsp. palearctica in a B16F10 melanoma allograft mouse model: behavioral scoring.

I: time, days, II: assessment, III: Y. enterocolitica MRS40 d.t., IV: Y. enterocolitica AuorH, O, P, E, M, T. Arrows indicate the day of intravenous infection of 2x10 ⁵ bacteria.

Fig. 33. Biodistribution of Y. enterocolitica subsp. palearctica in a B16F10 melanoma allograft mouse model: mice mass.

Mice were weighed daily after iv challenge with the bacteria. I: time, days, II: body weight in grams, III: Y. enterocolitica MRS40 d.t., IV: Y. enterocolitica AyopH, O, P, E, M, T. Arrows indicate the day of intravenous infection 2x10 ⁵ bacteria.

Fig. 34. Biodistribution of Y. enterocolitica subsp. palearctica in a mouse B16F10 melanoma allograft model: biodistribution of Y. enterocolitica AyopH, O, P, E, M, T.

The number in the organs at the indicated time was assessed by homogenization of the organ, serial dilution and calculation of the obtained colony forming units (CFU). I: Y. enterocolitica AyopH, O, P, E, M, T, II: cfu per gram of tissue, III: day 1, IV: day 4, V: blood, VI: spleen, VII: liver, VIII: lungs, IX: tumor. * Denotes mouse without visible tumor.

Fig. 35. Biodistribution of Y. enterocolitica subsp. palearctica in a mouse B16F10 melanoma allograft model: biodistribution of Y. enterocolitica MRS40 d.t.

The number in the organs at the indicated time was assessed by homogenization of the organ, serial dilution and calculation of the obtained colony forming units (CFU). I: Y. enterocolitica MRS40 dt, II: CFU per gram of tissue, III: day 1, IV: day 4, V: blood, VI: spleen, VII: liver, VIII: lungs, IX: tumor.

Fig. 36. Biodistribution of Y. enterocolitica subsp. palearctica in a mouse 4T1 breast cancer allograft model: biodistribution of Y. enterocolitica AyopH, O, P, E, M, T.

The number in the organs on day 8 after infection was assessed by homogenization of the organ, serial dilution and calculation of the obtained colony forming units (CFU). I: Y. enterocolitica AyopH, O, P, E, M, T, II: CFU per gram of tissue, III: blood, IV: spleen, V: liver, VI: lungs, VII: tumor.

Fig. 37. Delivery of synthetic proteins with enhanced proapoptotic activity.

Delivery of single synthetic proteins containing single or tandem repeats of BH3 domains derived from the pro-apoptotic t-Bid or Bax proteins results in the induction of enhanced apoptosis in 4T1 and B16F10 cancer cells. 4T1 (I) or B16P10 (II) cells were infected with Y. enterocolitica AyopH, O, P, E, M, T, encoding pBad-MycHisA IV: YopE ₁ . ₁₃₈ -extended BH3 domain tBid, V: YopE ₁ . ₁₃₈ -linker-tBid BH3, VI: YopE1_ ₁₃₈ -tBid BH3, VII: YopE1_ ₁₃₈ -(tBid BH3) ₂ , VIII: YopE1_ ₁₃₈ -tBid BH3 Bax BH3 or IX: YopE1. ₁₃₈ -Bax BH3 - tBid BH3. Bacteria added to cells (MOI) titrations were performed for each strain, cell numbers were determined, and IC50 was calculated using non-linear regression. MOI IC50 (III) is indicated.

Fig. 38. Induction of apoptosis by synthetic pro-apoptotic proteins encoded by pYV.

Delivery of a single or tandem repeat of the BH3 Bid domain encoded by pYV leads to the induction of apoptosis in 4T1 and B16F10 cancer cells. 4T1 (I) or B16F10 (II) cells were infected with Y. enterocolitica AHOPEMT+IV: pYV-YopE1. ₁₃₈ -BH3-Bid or V: + _{pYV -} YopE1_ ₁₃₈ -(BH3-Bid) ₂ , or VI: Y. entero- 8 3 h. Titration of bacteria added to cells (MOG) was performed for each strain, the number of cells was determined and IC50 (III) was calculated using non-linear regression.

Fig. 39. Tumor colonization by intravenous injections of Y. enterocolitica AyopH, O, P, E, M, T in the 4T1 breast cancer allograft model.

The number of bacteria in tumors is indicated in colony forming units (CFU) per gram of tissue (III). The number was estimated in tumors at 8 (I) and 14 days (II) after infection. Each dot represents a single mouse. The horizontal dotted line indicates the limit of detection.

Fig. 40. Biodistribution of IV injected Y. enterocolitica AyopH, O, P, E, M, T in the 4T1 breast cancer allograft model.

The number of bacteria in the blood (I), spleen (II), liver (III), lungs (IV) and tumor (V) is indicated in colony forming units (CFU) per gram of tissue (III) or per ml of blood (VI). The number was estimated at 14 days after infection. Each dot represents a single mouse. The horizontal dotted line indicates the limit of detection. * Denotes a mouse with a large lung metastasis.

Fig. 41. Delay of tumor progression in wild-type Balb/C mice with s.c. allografts of 4T1 breast cancer cells.

Wild-type Balb/C mice with s.c. allografts of 4T1 breast cancer cells were injected i.v. with I: PBS or II: 1x10 ⁷ Y. enterocolitica dHOPEMT+pYV-YopE _1-138 (BH3-Bid)2 after tumor size reached 150 -250 mm ³ . The day of intravenous administration of bacteria was designated as day 0. Tumor volume was measured on the following days (III; days 0 to 9 after intravenous injection of bacteria) with a caliper. Relative tumor volume normalized to day 0 tumor volume is indicated (IV) in mm ³ . The mean value is denoted by symbols, the reported error rates indicate the standard error of the mean.

Statistical significance was measured by two-way analysis of variance, * denotes p<0.05, ** denotes p<0.005.

Fig. 42. Tumor progression in wild-type Balb/C mice with s.c. allografts of 4T1 breast cancer cells.

Wild-type Balb/C mice with s.c. allografts of 4T1 breast cancer cells were injected i.v. with I: PBS or II: 1 x 10 ⁷ Y. enterocolitica dHOPEMT after the tumor had reached a size of 150-250 mm ³ . The day of intravenous administration of bacteria was designated as day 0. Tumor volume was measured on the following days (III; days 0 to 9 after intravenous injection of bacteria) with a caliper. Relative tumor volume normalized to day 0 tumor volume is indicated (IV) in mm ³ . The mean value is denoted by symbols, the reported error rates indicate the standard error of the mean.

Detailed description of the invention

The present invention relates to recombinant strains of gram-negative bacteria with attenuated virulence for use in a method of treating a malignant solid tumor in a subject.

The following definitions are used to interpret this description. Where applicable, singular terms also include plural forms and vice versa. It should be understood that the terminology used here is for the sole purpose of describing particular embodiments and is not intended to be limiting.

The term gram-negative bacterium strain as used herein includes the following bacteria:

Aeromonas sahnonicida, Aeromonas hydrophila, Aeromonas veronii,

Anaeromyxobacter dehalogenans, Bordetella bronchiseptica, Bordetella parapertussis, Bordetella pertussis, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia cepacia, Burkholderia mallei, Burkholderia pseudomallei, Chlamydia muridarum, Chlamydia trachmoatis, Chlamydophila abortus, Chlamydophila pneumoniae, Chromobacterium violaceum, Citrobacter rodentium, Desulfovibrio vulgaris, Edwardsiella tarda , Endozoicomonas elysicola, Erwinia amylovora, Escherichia albertii, Escherichia coli, Lawsonia intracellularis, Mesorhizobium loti, Myxococcus xanthus, Pantoea agglomerans, Photobacterium damselae, Photorhabdus luminescens, Photorabdus temperate,

- 9 040558

Pseudoalteromonas spongiae, Pseudomonas aeruginosa, Pseudomonas plecoglossicida, Pseudomonas syringae, Ralstonia solanacearum, Rhizobium sp, Salmonella enterica and other Salmonella sp. Shigella flexneri and other species of Shigella sp, Sodalis glossinidius, Vibrio alginolyticus, Vibrio azureus, Vibrio campellii, Vibrio caribbenthicus, Vibrio harvey, Vibrio parahaemolyticus, Vibrio tasmaniensis, Vibrio tubiashii, Xanthomonas axonopodis, Xanthomonas campestris, Xanthomiarsinoryzae, enterolisinoryzae Yersinia pseudotuberculosis.

Preferred Gram-negative bacterial strains of the present invention include the Enterobacteriaceae and Pseudomonadaceae families. The gram-negative bacterium strain of the present invention is generally used to deliver heterologous bacterial T3SS proteins to eukaryotic cells in vitro and/or in vivo, preferably in vivo.

The term "recombinant strain of gram-negative bacterium with attenuated virulence" as used herein refers to a recombinant strain of gram-negative bacterium with attenuated virulence transformed with a vector. The vector that can be used according to the present invention is, for example, an expression vector, a vector for insertion into a chromosome or virulence plasmid, or a DNA or RNA fragment for insertion or modification of a chromosome or virulence plasmid. The virulence of such a recombinant Gram-negative bacterium strain is usually attenuated by the deletion of a bacterial effector protein having virulence activity transported by one or more of the bacterial proteins that are part of the mechanism of secretion systems. Such effector proteins are delivered by mechanisms of secretion systems to host cells, where they can exhibit their virulent activity against various proteins and cellular mechanisms of the host. A large number of different effector proteins are known to be transported by secretion systems of various types and have a wide repertoire of biochemical activity that modulates the functions of host regulatory molecules. The virulence of the recombinant Gram-negative bacterium strain used in the present invention can be further attenuated by the absence of a siderophore normally or occasionally produced by the Gram-negative bacterium strain, such that said strain does not produce a siderophore, e.g., is defective in siderophore production. Thus, in a preferred embodiment, the methods of the present invention employ a recombinant strain of Gram-negative bacterium with attenuated virulence, characterized by the absence of the siderophore normally or episodically produced by the Gram-negative bacterium strain, such that said strain does not produce a siderophore, e.g., is defective in siderophore production; more preferably, the methods of the present invention use a strain of Yersinia, in particular Y. enterocolitica MRS40 ΔyopH, O, P, E, M, T, characterized by the absence of a siderophore normally or occasionally produced by a Gram-negative bacterium strain, such that said strain does not produce a siderophore, for example, is defective in siderophore production. The recombinant strain of gram-negative bacterium with reduced virulence used in the methods of the present invention preferably does not produce at least one, preferably at least two siderophores, for example, is defective in the production of at least one, more preferably at least two siderophores; more preferably, the virulence-attenuated recombinant Gram-negative bacterium strain used in the methods of the present invention does not produce siderophores.

The terms siderophore, iron siderophore, or iron chelator, used interchangeably herein, refer to compounds with a high affinity for iron, such as small compounds with a high affinity for iron. The siderophores of gram-negative bacteria are, for example, enterobactin and dihydroxybenzoylserine synthesized by Salmonella, Escherichia, Klebsiella, Shigella, Serratia (but used by all enterobacteria), pyoverdins synthesized by Pseudomonas, vibrobactin synthesized by Vibrio, acinetobactin and acinetoferrin Acinetobacter, Yersinia bactin and Yersinia synthesized , ornibactin synthesized by Burkholderia, salmochelin synthesized by Salmonella, aerobactin synthesized by Escherichia, Shigella, Salmonella and Yersinia, alkaligin synthesized by Bordetella, busicaberin synthesized by Vibrio.

Siderophores include hydroxamate, catecholate, and mixed-ligand siderophores. Several siderophores are currently approved for use in humans, primarily for the treatment of iron overload. Preferred siderophores are deferoxamine (also known as desferrioxamine B, desferoxamine B, DFO-B, DFOA, DFB or desferal), desferrioxamine E, deferasirox (exjade, desirox, defriget, desifer) and deferiprone (ferriprox).

The terms gram-negative bacterial strain deficient in the production of an amino acid necessary for growth and auxotrophic mutant are used interchangeably herein and refer to gram-negative bacterial strains unable to grow in the absence of at least one exogenous essential amino acid or its precursor. Amino acid, by product

- 10 040558 which strain is defective, is, for example, aspartate, meso-2,6diaminopimelic acid, aromatic amino acids or leucine-arginine [1]. Such a strain can be obtained, for example, by deleting the aspartate-beta-semialdehyde dehydrogenase (Δasd) gene. Such an auxotrophic mutant cannot grow in the absence of exogenous meso-2,6-diaminopimelic acid [2]. Mutation, for example, deletion of the aspartate-beta-semialdehyde dehydrogenase gene herein, is preferred for a Gram-negative bacterium strain defective in the production of an amino acid necessary for growth according to the present invention.

The term Gram-negative bacterial strain defective in the production of adhesion proteins that bind to the surface or extracellular matrix of a eukaryotic cell refers to mutant strains of Gram-negative bacteria that do not express at least one adhesion protein compared to the adhesion proteins expressed by the corresponding wild-type strain. Adhesion proteins may include, for example, long polymeric adhesion molecules, such as pili/fimbriae or non-fimbriae adhesins. Pili adhesins include type 1 pili (e.g. E. coli Fim pili with FimH adhesin), P pili (e.g. Pap pili with E. coli PapG adhesin), type 4 pili (specifically pilin protein, e.g. P. aeruginosa) or carlin (Csg proteins with CsgA adhesin S. enterica). Non-fimbriae adhesins include three-membered autotransporter adhesins, such as Y. enterocolitica YadA, BpaA (B. pseudomallei), Hia (H. influenzae), BadA (B. henselae), NadA (N. meningitidis), or UspA1 (M catarrhalis), as well as other autotransporter adhesins, such as AIDA-1 (E. coli), as well as other adhesins / invasins, such as InvA Y. enterocolitica or intimin (E. coli) or members of the Dr family or the Afa family (E. coli) . The terms YadA and InvA as used herein refer to Y. enterocolitica proteins. The autotransporter YadA [3] binds to various forms of collagen as well as fibronectin, while the invasin InvA [4] binds to eukaryotic cell membrane β-integrins. If the gram-negative bacterium strain is a Y. enterocolitica strain, then this strain is preferably defective in InvA and/or YadA.

As used herein, the family Enterobacteriaceae includes a family of Gram-negative, rod-shaped, facultative anaerobic bacteria found in soil, water, plant and animal organisms that are frequently pathogenic in vertebrates. Bacteria of this family have a similar physiology and demonstrate the conservatism of functional elements and genes of the corresponding genomes. Being oxidase-negative, all members of this family ferment glucose and most reduce nitrate. The Enterobacteriaceae bacteria of the present invention may be any of the bacteria in this family and specifically includes bacteria of the following genera:

Escherichia, Shigella, Edwardsiella, Salmonella, Citrobacter, Klebsiella, Enterobacter, Serratia,

Proteus, Erwinia, Morganella, Providencia or Yersinia, but are not limited to.

In more specific embodiments, said bacterium is of the species

Escherichia coli, Escherichia blattae, Escherichia fergusonii, Escherichia hermanii, Escherichia vuneris, Salmonella enterica, Salmonella bongori, Shigella dysenteriae, Shigella Iflexneri, Shigella boydii, Shigella sonnet, Enterobacter aerogenes, Enterobacter gergoviaeglomera , Klebsiella oxytoca, Serratia marcescens, Yersinia pseudotuberculosis, Yersinia pestis, Yersinia enterocolitica, Erwinia amylovora, Proteus mirabilis, Proteus vulgaris, Proteus penneri, Proteus hauseri, Providencia alcalifaciens or Morganella morganii.

Preferably, the gram-negative bacterium strain is selected from the group consisting of the genera

Yersinia, Escherichia, Salmonella, Shigella, Pseudomonas, Chlamydia, Erwinia, Pantoea,

Vibrio, Burkholderia, Ralstonia, Xanthomonas, Chromobacterium, Sodalis, Citrobacter,

Edwardsiella, Rhizobiae, Aeromonas, Photorhabdus, Bordetella and Desulfovibrio, more preferably from the group consisting of the genera Yersinia, Escherichia, Salmonella and Pseudomonas, most preferably from the group consisting of the genera Yersinia and Salmonella.

The term Yersinia as used herein includes all Yersinia species, including Yersinia enterocolitica, Yersinia pseudotuberculosis, and Yersinia pestis. Preferred is Yersinia enterocolitica.

The term Salmonella as used herein includes all Salmonella species, including Salmonella enterica and S. bongori. Preferred is Salmonella enterica.

The term promoter as used herein refers to a nucleotide sequence that regulates the expression of a transcription unit. The promoter region is a regulatory region capable of binding RNA polymerase in the cell and initiating transcription of the downstream (in

- 11 040558

3'-direction) of the coding sequence. The promoter region contains the transcription initiation site (determined for convenience by mapping using the S1 nuclease), as well as protein-binding domains (consensus sequences) responsible for RNA polymerase binding, as well as the hypothetical -35 region and the Pribnow box. The term operably linked when describing the relationship between two regions of DNA simply means that they are functionally related to each other and located on the same nucleic acid fragment. A promoter is functionally linked to a structural gene if it controls the transcription of this gene and is located on the same nucleic acid fragment as this gene. Typically, the promoter is functional in the specified Gram-negative bacterium strain, i. the promoter is capable of expressing the fusion protein of the present invention without additional genetic manipulation or expression of additional proteins. In addition, a functional promoter should not be antagonistic to bacterial T3SS in vivo.

The term delivery as used herein refers to the transport of a protein from a recombinant gram-negative bacterial strain with attenuated virulence into a eukaryotic cell, including the steps of expressing the heterologous protein in the recombinant gram-negative bacterial strain with attenuated virulence, secreting the expressed protein(s) from such recombinant gram-negative bacterial strain with attenuated virulence and translocation of the protein(s) secreted(s) by such a recombinant strain of attenuated gram-negative bacterium into the cytosol of a eukaryotic cell. Accordingly, the terms delivery signal or secretion signal, as used interchangeably herein, refer to a polypeptide sequence that can be recognized by the secretion and translocation system of a gram-negative bacterial strain and that directs the delivery of a protein from a gram-negative bacterial strain to eukaryotic cells.

The term bacterial effector protein delivery signal as used herein refers to a bacterial effector protein delivery signal that is functional in a recombinant strain of Gram-negative bacteria, i. allowing a heterologous protein to be expressed in a recombinant Gram-negative bacterium strain for secretion from such a recombinant Gram-negative bacterium strain using a secretion system, for example a type III secretion system, or for translocation by such a recombinant Gram-negative bacterium strain into the cytosol of a eukaryotic cell using a secretion system, for example a type III secretion system. The term bacterial effector protein delivery signal as used herein also includes a fragment of the bacterial effector protein delivery signal, i. a shortened version of the delivery signal, eg a delivery signal comprising up to 10, preferably up to 120, more preferably up to 50, even more preferably up to 100, in particular up to 140, amino acids of a delivery signal, eg a natural delivery signal. Thus, a nucleotide sequence, for example a DNA sequence encoding a bacterial effector protein delivery signal, may encode a full-length delivery signal or a fragment thereof, said fragment typically containing up to 30, preferably up to 60, more preferably up to 150, even more preferably up to 300, in particular up to 420, nucleotides.

As used herein, the term protein secretion refers to the transport of a heterologous protein into the external environment across the cell membrane of a recombinant Gram-negative bacterium strain with attenuated virulence. Protein translocation refers to the transport of a heterologous protein from a recombinant strain of gram-negative bacterium with attenuated virulence across the plasma membrane of a eukaryotic cell into the cytosol of such a eukaryotic cell.

The term bacterial protein that is part of the mechanism of the secretion system as used herein refers to bacterial proteins that are important components of the bacterial type 3 secretion system (T3SS), the type 4 secretion system (T4SS) and the type 6 secretion system (T6SS), preferably T3SS. Without these proteins, the corresponding secretion system cannot translocate proteins into host cells, even if all other components of the secretion system and the bacterial effector protein to be translocated are encoded and produced.

The term bacterial effector protein as used herein refers to bacterial proteins transported by secretion systems, eg bacterial proteins that are part of the mechanism of secretion systems into host cells. Such effector proteins are delivered by the secretion system to the host cell, where they exhibit, for example, virulent activity against various host proteins and cellular machinery. A large number of different effector proteins are known to be transported by secretion systems of various types and have a wide repertoire of biochemical activity that modulates the functions of host regulatory molecules. The secretion systems include the type 3 secretion system (T3SS), the type 4 secretion system (T4SS), and the type 6 secretion system (T6SS). Some effector proteins (eg Shigella flexneri IpaC) also belong to the class of bacterial proteins that are part of the mechanisms of secretion systems and allow protein translocation. The attenuated recombinant gram-negative bacterium strain used herein generally contains bacterial proteins that are important components of the bacterial type 3 secretion system (T3SS), type 4 secretion system

- 12 040558 (T4SS) and/or type 6 secretion systems (T6SS), preferably type 3 secretion systems (T3SS).

The term T6SS effector protein, or T6SS bacterial effector protein, as used herein refers to proteins naturally introduced by T6S systems into the cytosol of eukaryotic cells or bacteria, and to proteins naturally secreted by T6S systems capable of, for example, forming pores for translocation. in the eukaryotic membrane. The term T4SS effector protein, or T4SS bacterial effector protein, as used herein refers to proteins naturally introduced by T4S systems into the cytosol of eukaryotic cells and to proteins naturally secreted by T4S systems capable of, for example, forming a pore for translocation in the membrane. eukaryotes. The term T3SS effector protein, or T3SS bacterial effector protein, as used herein refers to proteins naturally introduced by T3S systems into the cytosol of eukaryotic cells and to proteins naturally secreted by T3S systems capable of, for example, forming a pore for translocation in the membrane. eukaryotes, including pore-forming translocators (eg YopB and YopD Yersinia), and top proteins (eg LcrV Yersinia). Preferably, proteins are used that are naturally introduced by T3S systems into the cytosol of eukaryotic cells. These virulence factors should paralyze or reprogram the eukaryotic cell to have a beneficial effect on the pathogen. T3S effectors have a wide repertoire of biochemical activity, modulate the function of key host regulatory molecules [5, 6], and include

AvrA, AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrDl, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, AvrRpml, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS, ExoT, GogB, GtgA, GtgE, GALA protein family, HopAB2, HopAOl, Hopll, HopMl, HopNl, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, HopUl, HsvB, IcsB, IpaA, IpaB, IpaC, IpaH, IpaH7.8, IpaH9.8, IpgBl, IpgB2, IpgD, LcrV, Map, OspCl, OspE2, OspF, OspG, OspI, PipB, PipB2, PopB, PopP2, PthXol, PthXo6, PthXo7, SifA, Siffi, SipA/SspA, SipB, SipC/SspC, SipD/SspD, SlrP, SopA, SopB/SigD, SopD, SopE, SopE2, SpiC/SsaB, SptP, SpvB, SpvC, SrfH, SrfJ, Sse, SseB, SseC, SseD, SseF, SseG, SseFSrfH, SseJ, SseKl, SseK2, SseK3, SseL, SspHl, SspH2, SteA, SteB, SteC, SteD, SteE, TccP2, Tir, VirA, VirPphA, VopF, XopD, YopB, YopD YopE, YopH, YopJ, YopM, YopO, YopP, YopT, YpkA.

The term recombinant gram-negative bacterial strain with attenuated virulence accumulating in malignant solid tumor or recombinant gram-negative bacterial strain with attenuated virulence accumulating in malignant solid tumor, as used herein, refers to a recombinant gram-negative bacterial strain with attenuated virulence that replicates in malignant solid tumor, that thereby increasing the number of bacteria of a given recombinant gram-negative bacterium strain with attenuated virulence in a malignant solid tumor. Surprisingly, it has been found that a recombinant Gram-negative bacterium strain with attenuated virulence, upon administration to a subject, specifically accumulates in a malignant solid tumor, i. specifically accumulates in an organ where a malignant solid tumor is present, and the number of bacteria of a recombinant strain of gram-negative bacteria with attenuated virulence in organs without malignant solid tumors is low or not detectable.

In the case of extracellular bacteria, such as Yersinia, the bacteria mainly accumulate in the extracellular space between the tumor cells. Bacteria that grow inside cells, such as Salmonella, mainly invade tumor cells and reside inside such cells, although accumulation outside the cells is also possible. The number of bacteria of the recombinant Gram-negative bacterium strain with attenuated virulence accumulating in a malignant solid tumor may, for example, be in the range of 10 ⁴ to 10 ⁹ bacteria per gram of tumor tissue.

The term malignant solid tumor, or malignant solid tumor indication, as used herein, refers to an abnormal collection of tissue, usually free of cysts or fluid areas. Solid tumors can be benign (not cancerous) or malignant (cancerous). Malignant solid tumors are treated using the methods of the present invention. Different types of malignant solid tumors are named according to the type of cells that form them. Examples of malignant solid tumors are sarcomas, carcinomas and lymphomas. Leukemias (cancers of the blood) usually do not form malignant solid tumors (as defined by the National Cancer Institute NTH). Malignant solid tumors include pathological collections of cells that can originate from various types of tissues, such as the liver, colon, colon and rectum, skin, breast, pancreas, cervix, uterus, bladder, gallbladder, kidney, larynx , lips, mouth, esophagus, ovary, prostate, stomach, testis, thyroid, or lung, and thus include malignant solid tumors of the liver, colon, colon, rectum, skin,

- 13 040558 breast, pancreas, cervix, uterus, bladder, gallbladder, kidney, larynx, lips, mouth, esophagus, ovary, prostate, stomach, testis, thyroid or lung . Preferred malignant solid tumors that can be treated with the methods of the present invention are malignant solid tumors derived from the skin, breast, liver, pancreas, bladder, prostate and colon, and thus are malignant solid tumors skin, breast, liver, pancreas, bladder, prostate and colon. Equally preferred malignant solid tumors that can be treated with the methods of the present invention are malignant solid tumors associated with liver cancer, such as hepatocellular carcinoma.

The term bacterial effector protein virulent to eukaryotic cells as used herein refers to bacterial effector proteins transported by secretion systems into host cells, where they exhibit their virulent activity against various host proteins and cellular mechanisms. A large number of different effector proteins are known that are transported by secretion systems of various types and have a wide repertoire of biochemical activity that modulates the functions of host regulatory molecules. The secretion systems include the type 5 secretion system (T3SS), the type 4 secretion system (T4SS), and the type 6 secretion system (T6SS). Importantly, some effector proteins that are virulent against eukaryotic cells (eg, IpaC Shigella flexneri) also belong to the class of bacterial proteins that are part of the mechanisms of secretion systems. If a bacterial effector protein that is virulent to eukaryotic cells is also essential to the function of secretion mechanisms, that protein is excluded from this definition. T3SS effector proteins virulent to eukaryotic cells are YopE, YopH, YopJ, YopM, YopO, YopP, YopT Y. Enterocolitica or OspF, IpgD, IpgB1 Shigella flexneri or SopE, SopB, SptP Salmonella enterica, or ExoS, ExoT, ExoU, ExoY P. aeruginosa, or Tir, Map, EspF, EspG, EspH, EspZ E. coli. T4SS effector proteins virulent against eukaryotic cells include proteins such as

LidA, SidC, SidG, SidH, SdhA, SidJ, SdjA, SdeA, SdeA, SdeC, LepA, LepB, WipA, WipB,

YlfA, YlfB, VipA, VipF, VipD, VpdA, VpdB, DrrA, LegL3, LegL5, LegL7, LegLC4,

LegLC8, LegC5, LegG2, CeglO, Ceg23, Ceg29 Legionella pneumophila or BepA, BepB, BepC, BepD, BepE, BepF, BepG Bartonella henselae or VirD2, VirE2, VirE3, VirF Agrobacterium tumefaciens or CagA H. pylori or pertussis toxin B ordetella pertussis . T6SS effector proteins virulent against eukaryotic cells are proteins such as the Vibrio cholerae VgrG proteins (eg VgrG1).

The term T3SS effector protein virulent to eukaryotic cells or bacterial effector protein T3SS virulent to eukaryotic cells, as used herein, refers to proteins naturally introduced by T3S systems into the cytosol of eukaryotic cells and to proteins in vivo. secreted by T3S systems, capable, for example, of forming a pore for translocation in the membrane of eukaryotes, which are virulence factors in relation to eukaryotic cells, i.e. to proteins that paralyze or reprogram a eukaryotic cell with a beneficial effect on the pathogen. Effectors have a wide repertoire of biochemical activity, modulate the function of key host regulatory mechanisms, such as phagocytosis and the actin cytoskeleton, inflammatory signaling pathways, apoptosis, endocytosis, or secretory pathways [5, 6], and include

AvrA, AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrDl, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, AvrRpml, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS, ExoT, GogB, GtgA, GtgE, GALA protein family, HopAB2, HopAOl, Hopll, HopMl, HopNl, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, HopUl, HsvB, IcsB, IpaA, IpaH, IpaH7.8, IpaH9.8, IpgBl, IpgB2, IpgD, LcrV, Map, OspCl,OspE2, OspF, OspG, OspI, PipB, PipB2, PopB, PopP2, PthXol, PthXo6, PthXo7, SifA, Siffi, SipA/SspA, SlrP, SopA, SopB/SigD, SopD, SopE, SopE2, SpiC/ SsaB, SptP, SpvB, SpvC, SrfH, SrH, Sse, SseB, SseC, SseD, SseF, SseG, Ssel/SrfH, SseJ, SseKl, SseK2, SseK3, SseL, SspHl, SspH2, SteA, SteB, SteC, SteD, SteE, TccP2, Tir, VirA, VirPphA, VopF, XopD, YopE, YopH, YopJ, YopM, YopO, YopP, YopT, YpkA.

Yersinia T3SS effector genes virulent against eukaryotic cells that can be deleted/mutated from, for example, Y. enterocolitica are YopE, YopH, YopM,

- 14 040558

YopO, YopP (also known as YopJ) and YopT [7]. Appropriate eukaryotic virulent effector genes can be deleted/mutated from Shigella flexneri (e.g. OspF, IpgD, IpgB1), Salmonella enterica (e.g. SopE, SopB, SptP), P. aeruginosa (e.g. ExoS, ExoT, ExoU, ExoY) or E. coli (e.g. Tir, Map, EspF, EspG, EspH, EspZ). The nucleotide sequences of these genes are available to those skilled in the art, for example, from the Genebank database (yopH, yopO, yopE, yopP, yopM, yopT from NC_002120 GI: 10955536; S. flexneri effector proteins from AF386526.1 GI: 18462515; effectors S. enterica from NC_016810.1 GI: 378697983 or FQ312003.1 GI: 301156631 P. aeruginosa effectors from AE004091.2 GI: 110227054 or CP000438.1 GI: 115583796 and E. coli effector proteins from 5.2115 5.2115) .

For the purposes of the present invention, genes are denoted in lowercase italic letters, in contrast to proteins. If genes (denoted in lowercase italics) follow the name of a bacterial species (eg, E. coli), they refer to a mutation of the corresponding gene in the bacterium of the corresponding species. For example, YopE refers to the effector protein encoded by the yopE gene. Y. enterocolitica; yopE refers to Y. enterocolitica with a mutation in the yopE gene.

As used herein, the terms polypeptide, peptide, protein, polypeptide, and peptide are used interchangeably to refer to a series of amino acid residues connected to each other by peptide bonds between an alpha-amino group and a carboxyl group of adjacent residues. Preferred are proteins whose amino acid sequence contains at least 10 amino acids, more preferably at least 20 amino acids.

In accordance with the present invention, a heterologous protein includes naturally occurring proteins or fragments thereof, as well as artificially engineered proteins or fragments thereof. As used herein, the term heterologous protein refers to a protein or fragment thereof other than the T3SS effector protein or its N-terminal fragment to which it can be attached. In particular, heterologous protein as used herein refers to a protein or fragment thereof that does not belong to a proteome, i.e. a complete natural set of proteins of a specific recombinant strain of gram-negative bacteria with attenuated virulence proposed and used in the present invention, for example, not belonging to the proteome, i.e. a complete natural set of proteins of a particular strain of bacteria of the genera Yersinia, Escherichia, Salmonella or Pseudomonas. Typically, a heterologous protein is of animal origin, including human origin. Preferably the heterologous protein is a human protein. More preferably, the heterologous protein is selected from the group consisting of proteins involved in apoptosis or regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR related proteins, nanobodies and hybrid constructs of nanobodies, T3SS bacterial effectors, T4SS bacterial effectors, and viral proteins. In a particularly preferred case, the heterologous protein is selected from the group consisting of proteins involved in apoptosis or regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR-related proteins, nanobody hybrid constructs, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins. Even more preferred are heterologous proteins selected from the group consisting of proteins involved in apoptosis or the regulation of apoptosis, cell cycle regulators, and ankyrin repeat proteins. Most preferred are proteins involved in apoptosis or regulation of apoptosis, eg heterologous proteins from animals, preferably human, involved in apoptosis or regulation of apoptosis.

In some embodiments, the Gram-negative bacterium strain vector of the present invention comprises two second DNA sequences encoding identical or two different heterologous proteins independently attached to the 3' end of said first DNA sequence in frame.

In some embodiments, the Gram-negative bacterium strain vector of the present invention comprises three second DNA sequences encoding identical or three different heterologous proteins independently attached to the 3' end of said first DNA sequence in frame.

The molecular weight of the heterologous protein expressed by the virulence-attenuated recombinant Gram-negative bacterium is typically 1 to 150 kDa, preferably 1 to 120 kDa, more preferably 1 to 100 kDa, most preferably 15 to 100 kDa.

In some embodiments, the Gram-negative bacterial strain vector of the present invention comprises repeating domains of a heterologous protein, or two or more domains of different heterologous proteins, fused to the 3' end of said first DNA sequence in frame.

The term heterologous proteins belonging to the same functional class of proteins as used herein refers to heterologous proteins having the same function, e.g. heterologous proteins having enzymatic activity, heterologous proteins acting in the same pathway, e.g. cell cycle or having a

- 15 040558 common specific function, for example belonging to the same class of bacterial effector proteins. Functional protein classes are, for example, proteins involved in apoptosis or regulation of apoptosis, proteins acting as cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR related proteins , hybrid constructs of nanobodies and nanobodies, bacterial T3SS effectors, bacterial T4SS effectors, and viral proteins cooperating in biological processes that provide virulence to eukaryotic cells.

In accordance with the present invention, the heterologous protein domain includes natural protein domains as well as engineered protein domains. As used herein, the term heterologous protein domain refers to a heterologous protein domain that is not the domain of the T3SS effector protein, or a non-domain domain containing an N-terminal fragment of such a protein to which it can be attached to form a fusion protein. In particular, a heterologous protein domain as used herein refers to a heterologous protein domain that does not belong to a proteome, i.e. a complete natural set of proteins of a particular recombinant strain of gram-negative bacteria proposed and used in the present invention, for example, not belonging to the proteome, i.e. a complete natural set of proteins of a particular strain of bacteria of the genera Yersinia, Escherichia, Salmonella or Pseudomonas. Typically, the heterologous protein domain is of animal origin, including human origin. Preferably the heterologous protein domain is a human protein domain. More preferably, the heterologous protein domain is a protein domain selected from the group consisting of proteins involved in apoptosis or regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR-related proteins, nanobodies and nanobody hybrid constructs, T3SS bacterial effectors, T4SS bacterial effectors, and viral proteins. In a particularly preferred case, the heterologous protein domain is a protein domain selected from the group consisting of proteins involved in apoptosis or regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR related proteins, nanobody fusion constructs , T3SS bacterial effectors, T4SS bacterial effectors, and viral proteins. Even more preferred are heterologous protein domains selected from the group consisting of proteins involved in apoptosis or the regulation of apoptosis, cell cycle regulators, and ankyrin repeat proteins. Most preferred are domains of proteins involved in apoptosis or regulation of apoptosis, eg animal proteins involved in apoptosis or regulation of apoptosis, preferably domains of heterologous human proteins involved in apoptosis or regulation of apoptosis.

The term repeat domains of a heterologous protein as used herein refers to a fusion protein consisting of multiple repeats of a heterologous protein domain, wherein said domains may be directly attached to each other or a variable linker may be inserted between the domains, e.g. a linker of 1 to 30 length, preferably 2 to 15, more preferably 3 to 10 amino acids. Preferably, repeat identical domains or repeat domains with an amino acid sequence identity of more than 80%, usually more than 85%, preferably more than 90%, even more preferably more than 95%, especially more than 96%, especially more than 97%, especially more than 98% and most preferably more than 99%. In addition, domains with an amino acid sequence identity of 100% are preferred. Preferably two repeat domains, more preferably two identical repeat domains or two repeat domains with greater than 90% amino acid sequence identity, preferably greater than 95%, most preferably 100%, are within the fusion protein described herein. The present invention also contemplates more than two, eg three, four, five or six, repeat domains.

The term two or more domains of different heterologous proteins as used herein refers to a fusion protein consisting of one or more repeats of at least two domains of different heterologous proteins, e.g. two domains of heterologous proteins with an amino acid sequence identity of 80% or less, preferably 60% or less, more preferably 40% or less, and these different domains can be directly attached to each other or a variable linker can be inserted between the domains, for example a linker with a length of 1 to 30, preferably 2 to 15, more preferably 3 to 10 amino acids. In the preferred case, two domains of different heterologous proteins are in the composition of the hybrid protein described in this document. The present invention also contemplates more than two, eg three, four, five or six domains of various heterologous proteins.

The molecular weight of the heterologous protein domain expressed by the recombinant Gram-negative bacterium strain is typically 1 to 50 kDa, preferably 1 to 30 kDa, more preferably 1 to 20 kDa, most preferably 1 to 10 kDa.

In accordance with the present invention, proteins involved in apoptosis or the regulation of apoptosis

- 16 040558 include Bad, Bcl2, Bak, Bmt, Bax, Puma, Noxa, Bim, Bcl-xL, Apafl, caspase 9, caspase 3, caspase 6, caspase 7, caspase 10, DFFA, DFFB, ROCK1, APP, CAD , ICAD, CAD, EndoG, AIF, HtrA2, Smac/Diablo, Arts, ATM, ATR, Bok/Mtd, Bmf, Mcl-1(S), IAP family, LC8, PP2B, proteins 14-3-3, PKA, PKC, PI3K, Erk1/2, p90RSK, TRAF2, TRADD, FADD, Daxx, caspase 8, caspase 2, RIP, RAIDD, MKK7, INK, FLIPs, FKHR, GSK3, CDK and their inhibitors, e.g. the INK4 family (pl6(Ink4a ), pl5(Ink4b), p18(Ink4c), p19(Ink4d)) and the Cip1/Waf1/Kip1-2 family (p21(Cipl/Waf1), p27(Kip1), p57(Kip2)), but are not limited to them. Preferably Bad, Bmt, Bcl2, Bak, Bax, Puma, Noxa, Bim, Bcl-xL, Caspase 9, Caspase 3, Caspase 6, Caspase 7, Smac/Diablo, Bok/Mtd, Bmf, Mcl-1( S), LC8, PP2B, TRADD, Daxx, caspase 8, caspase 2, RIP, RAIDD, FKHR, CDK and their inhibitors, e.g. the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d )), most preferably Bim, Bid, truncated Bid, FADD, caspase 3 (and its subunits), Bax, Bad, Akt, CDK and their inhibitors, e.g. the INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c ), p19(Ink4d)) [8-10]. Additional proteins involved in apoptosis or regulation of apoptosis include DIVA, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bid and tBid, Egl-1, Bcl-Gs, Cytochrome C, Beclin, CED-13, BNIP1, BNIP3, Bcl-B, Bcl-W, Ced-9, A1, NR13, Bfl-1, caspase 1, caspase 2, caspase 4, caspase 5, caspase 8.

Proteins involved in apoptosis or the regulation of apoptosis are selected from the group consisting of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of pathways that prevent apoptosis, and inhibitors of signaling or metabolic pathways that promote survival. Proapoptotic proteins include those selected from the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apafl, Smac/Diablo , BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, cytochrome C, FADD, the caspase and CDK families and their inhibitors, e.g. the INK4 family (pl6(Ink4a), p15(Ink4b), p18(Ink4c ), p19(Ink4d)), or selected from the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Egl -1, Apaf1, Smac/Diablo, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, cytochrome C, FADD and the caspase family. Preferred are Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Egl-1, Apaf1, BNIP1, BNIP3, Bcl-Gs, beclin 1, Egl-1 and CED-13, Smac/Diablo, FADD, caspase family, CDKs and their inhibitors, e.g. INK4 family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)). Equally preferred are Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apaf1, BNIP1, BNIP3, Bcl-Gs, becklin 1, Egl-1 and CED-13, Smac/Diablo, FADD, caspase family.

Anti-apoptotic proteins include proteins selected from the group consisting of Bcl-2, Bcl-Xl, Bcl-B, Bcl-W, Mcl-1, Ced-9, A1, NR13, the IAP family and Bfl-1. Preferred are Bcl-2, Bcl-Xl, Bcl-B, Bcl-W, Mcl-1, Ced-9, Al, NR13 and Bfl-1. Inhibitors of pathways that prevent apoptosis include proteins selected from the group consisting of Bad, Noxa and Cdc25A. Bad and Noxa are preferred.

Inhibitors of survival signaling and metabolic pathways include proteins selected from the group consisting of PTEN, ROCK, PP2A, PHLPP, JNK, p38. Preferred are PTEN, ROCK, PP2A and PHLPP.

In some embodiments, the heterologous proteins involved in apoptosis or the regulation of apoptosis are selected from the group consisting of BH3 domain-only proteins, caspases, and intracellular death or apoptosis control signaling pathway proteins. Proteins containing only the BH3 domain are preferred.

Proteins containing only the BH3 domain include those selected from the group consisting of Bad, Bim, Bid and tBid, Puma, Bik/Nbk, Bod, Hrk/Dp5, BNIP1, BNIP3, Bmf, Noxa, Mcl-1, Bcl- Gs, Beclin 1, Egl-1 and CED-13. Bad, Bim, Bid and tBid are preferred, especially tBid.

Caspases selected from the group consisting of caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10 include protein. Caspase 3, caspase 8 and caspase 9 are preferred.

Intracellular death or apoptosis control signaling pathway proteins include proteins selected from the group consisting of FADD, TRADD, ASC, BAP31, GULP1/CED-6, CIDEA, MFG-E8, CIDEC, RIPK1/RIP1, CRADD, RIPK3/RIP3, Crk, SHB, CrkL, DAXX, families 14-3-3, FLIP, DFF40 and 45, PEA-15, SODD. FADD and TRADD are preferred.

In some embodiments, the Gram-negative bacterial strain and/or vector of the present invention comprises two heterologous proteins involved in apoptosis or regulation of apoptosis, where one protein is a pro-apoptotic protein and the other protein is an inhibitor of an apoptosis-preventing pathway, or one protein is a pro-apoptotic protein, and the other protein is an inhibitor of signaling and metabolic pathways that promote survival.

The proapoptotic proteins of the present invention generally have an alpha helical structure, preferably a hydrophobic helix surrounded by amphiphilic helices, and generally contain at least one of BH1, BH2, BH3 or BH4 domains, preferably at least one BH3 domain. Proapoptotic proteins according to the present invention usually do not have enzymatic activity.

The anti-apoptotic proteins of the present invention typically have an alpha helical

- 17 040558 structure (preferably their structure is a hydrophobic helix surrounded by amphiphilic helices) and contain a combination of different BH1, BH2, BH3 and BH4 domains, preferably a combination of different BH1, BH2, BH3 and BH4 domains, where BH1 and BH2 domains are present, more preferably BH4-BH3-BH1-BH2, BH1-BH2, BH4-BH1-BH2 or BH3-BH1-BH2 (N-terminal to

C-end). In addition, the invention covers proteins containing at least one BIR domain.

The anti-apoptosis pathway inhibitors of the present invention typically have an alpha helical structure (preferably a hydrophobic helix surrounded by amphiphilic coils) and typically contain a single BH3 domain.

Each of the BH1, BH2, BH3, or BH4 domains typically contains from about 5 to about 50 amino acids. Thus, in some embodiments, heterologous proteins involved in apoptosis or regulation of apoptosis are selected from the group consisting of heterologous proteins involved in apoptosis or regulation of apoptosis that are from about 5 to about 200, preferably from about 5 to about 150 , more preferably from about 5 to about 100, most preferably from about 5 to about 50, in particular from about 5 to about 25 amino acids.

In some embodiments, the Gram-negative bacterial strain of the present invention is transformed with two domains of a heterologous protein involved in apoptosis or regulation of apoptosis, preferably two repetitive, more preferably two identical repeat domains of a protein involved in apoptosis or regulation of apoptosis, or two domains of different proteins involved in apoptosis or regulation of apoptosis. apoptosis or regulation of apoptosis, most preferably two identical repeat domains of a protein involved in apoptosis or regulation of apoptosis. In some embodiments, the Gram-negative bacterial strain of the present invention is transformed with two domains of heterologous proteins involved in apoptosis or regulation of apoptosis, one of which is a pro-apoptotic protein domain and the other is a protein domain that is an inhibitor of an apoptosis-preventing pathway, or one of them. is a pro-apoptotic protein domain, and the other domain is a protein domain that is an inhibitor of survival signaling and metabolic pathways.

A particularly preferred domain is the BH3 domain of the apoptosis inducer tBid, more specifically a BH3 domain containing a sequence selected from the group consisting of SEQ ID NO: 217, 218, 219 and 220, preferably SEQ ID NO: 219 or SEQ ID NO: 220.

Equally preferred is the Bax apoptosis regulator BH3 domain, more specifically the Bax domain containing a sequence selected from the group consisting of SEQ ID NOs: 221, 222, 223 and 224, preferably SEQ ID NOs: 223 or SEQ ID NOs: 224. Sequences human and mouse are shown in SEQ ID NO: 217-224, however, the BH3 domains of tBid and Bax of all other animal species are also equally included in the present invention.

In some embodiments, the repeat domains of the heterologous proteins are a BH3 domain of the apoptosis inducer tBid, more specifically the BH3 repeat domains of the apoptosis inducer tBid contained in SEQ ID NO: 219, or SEQ ID NO: 220, or SEQ ID NO: 202, even more preferably two tBid apoptosis inducer BH3 repeat domain, most preferably the tBid apoptosis inducer BH3 repeat domain contained in SEQ ID NO: 219 or SEQ ID NO: 220 or SEQ ID NO: 202, in particular the tBid apoptosis inducer BH3 repeat domain contained in the sequence of SEQ ID NO: 202. Thus, in a preferred embodiment, the Gram-negative bacterial strain or vector according to the present invention contains a second DNA sequence encoding two BH3 repeat domains, more preferably two BH3 repeat domains of the apoptosis inducer tBid. These two repeating domains can be connected by a linker of 1-30 amino acids, preferably 2-15 amino acids, more preferably 3-10 amino acids.

In some embodiments, said two or more different heterologous protein domains are heterologous protein domains belonging to the same functional protein class, preferably different heterologous proteins of said two or more domains are different heterologous proteins from a class of proteins involved in apoptosis or regulation of apoptosis. In a preferred embodiment, said two or more different heterologous protein domains are the BH3 domain of the apoptosis inducer tBid and the BH3 domain of the apoptosis regulator Bax, in particular the combined BH3 domains of SEQ ID NOS: 203 and 211. The two different heterologous protein domains can be connected by a linker of 1-30 amino acids, preferably 2-15 amino acids, more preferably 3-10 amino acids.

In some embodiments, the heterologous proteins are a prodrug converting enzyme. In these embodiments, the virulence-attenuated recombinant gram-negative bacterium expresses, preferably expresses and secretes, a prodrug-converting enzyme. A prodrug converting enzyme as used herein includes enzymes that convert nontoxic prodrugs to a toxic drug,

- 18 040558 preferably enzymes selected from the group consisting of cytosine deaminase, purine nucleoside phosphorylase, thymidine kinase, beta-galactosidase, carboxylesterases, nitroreductase, carboxypeptidases and beta-glucuronidases, more preferably enzymes selected from the group consisting of cytosine deaminase, purine nucleoside phosphorylase, thymidine kinase and beta-galactosidase.

The term protease cleavage site as used herein refers to a specific amino acid motif in an amino acid sequence, such as the amino acid sequence of a protein or fusion protein, that is cleaved by a specific protease that recognizes the amino acid motif. For a review, see [11]. Exemplary protease cleavage sites are amino acid motifs cleaved by a protease selected from the group consisting of enterokinase (light chain), enteropeptidase, PreScission protease, human rhinovirus protease (HRV 3C), TEV protease, TVMV protease, factor Xa protease, and thrombin.

The corresponding proteases recognize the following amino acid motifs:

Asp-Asp-Asp-Asp-Lys: enterokinase (light chain)/enteropeptidase;

Leu-Glu-Val-Leu-Phe-Gln/Gly-Pro: PreScission protease/human rhinovirus protease (HRV 3C);

Glu-Asn-Leu-Tyr-Phe-Gln-Ser and modified motifs based on Glu-X-X-Tyr-X-Gln-Gly/Ser (where X is any amino acid) recognized by the TEV (tobacco mosaic virus) protease;

Glu-Thr-Val-Arg-Phe-Gln-Ser: TVMV protease;

Ile-(Glu or Asp)-Gly-Arg: factor Xa protease;

Leu-Val-Pro-Arg/Gly-Ser: thrombin.

Protease cleavage sites herein include ubiquitin. Thus, in some preferred embodiments, ubiquitin is used as a protease cleavage site that can be N-terminally cleaved by specific ubiquitin processing proteases, e.g. ubiquitin processing, called deubiquitinizing enzymes. Ubiquitin is processed at the C-terminus by a group of endogenous ubiquitin-specific C-terminal proteases (deubiquitinizing enzymes, DUB). Cleavage of DUB ubiquitin presumably occurs at the very C-terminus of ubiquitin (after G76).

The individual, subject, or patient is a vertebrate. In some embodiments, said vertebrate is a mammal. Mammals include, but are not limited to, primates (including humans and non-human primates) and rodents (eg, mice and rats). In preferred embodiments, the subject is a human.

The term mutation in this document is a general term and includes changes in one or more base pairs. Such mutations may include substitutions, frameshift mutations, deletions, insertions, and truncations.

The term nuclear localization signal as used herein refers to an amino acid sequence marking a protein for import into the nucleus of a eukaryotic cell and preferably including a viral nuclear localization signal, such as NLS derived from the SV40 large T antigen (PPKKKRKV).

The term polylinker as used herein refers to a short DNA sequence containing multiple restriction sites for cleavage by restriction endonucleases, e.g.,

- 19 040558

Acll, Hindin, SspI, MluCI, Tsp509I, Pcil, Agel, BspMI, BfuAI, SexAI, MluI, BceAI, HpyCH4IV, HpyCH4III, Bael, BsaXI, AflIII, Spel, Bsrl, BmrI, Bglll, Afel, Alul, Stul, Seal, Clal, BspDI, ΡΙ-SceI, Nsil, Asel, Swal, CspCI, Mfel, BssSI, BmgBI, Pmll, Dralll, Alel, EcoP15I, PvuII, AlwNI, BtsIMutl, TspRI, Ndel, Nlalll, CviAII, Fatl, MslI, FspEI, Xcml, BstXI, PflMI, BccI, Ncol, BseYI, Faul, Smal, Xmal, TspMI, Nt.CviPII, LpnPI, Acil, Sadi, BsrBI, MspI, Hpall, ScrFI, BssKI, StyD4I, BsaJI, BslI, Btgl, Neil, Avril Mnll BbvCI Nb.BbvCI Nt BbvCI Sbfl BpulOI Bsu36I EcoNI HpyAV BstNI PspGI Styl Bcgl Pvul BstUI EagI Rsrll BsiEI BsiWI BsmBI Hpy99I MspAlI MspJI , SgrAI, Bfal, BspCNI, Xhol, Earl, Acul, PstI, Bpml, Ddel, Sfcl, AflII, BpuEI, Smll, Aval, BsoBI, MboII, BbsI, XmnI, BsmI, Nb.BsmI, EcoRI, Hgal, Aatll, Zral , Tthllll PflFI, PshAI, AhdI, DrdI, Eco53kl, SacI, BseRI, Piel, Nt.BstNBI, Mlyl, Hinfl, EcoRV, Mbol, Sau3AI, DpnII BfuCI, Dpnl, BsaBI, Tfil, BsrDI, Nb.BsrDI, Bbvl, BtsI , Nb.B tsI, BstAPI, SfaNI, SphI, NmeAIII, Nael, NgoMIV, Bgll, AsiSI, BtgZI, HinPlI, Hhal, BssHII, Notl, Fnu4HI, Cac8I, Mwol, Nhel, Bmtl, SapI, BspQI, Nt.BspQI, BlpI, Tsel, ApeKI, Bspl286I, Alwl, Nt.AlwI, BamHI, FokI, BtsCI, Haelll, Phol, Fsel, Sfil, Nari, KasI, Sfol, PluTI, Asci, Ecil, BsmFI, Apal, PspOMI, Sau96I, NlalV, Kpnl, Acc65I, Bsal, HphI, BstEII, Avail, BanI, BaeGI, BsaHI, Banll, Rsal, CviQI, BstZ17I, BciVI, Sall, Nt.BsmAI, BsmAI, BcoDI, ApaLI, Bsgl, AccI, Hpyl66II, Tsp45I, Hpal, Pmel, Hindi, BsiHKAI, Apol, NspI, BsrFI, BstYI, Haell, CviKI-1, EcoO109I, PpuMI, I-Ceul, SnaBI, I-Scel, BspHI, BspEI, Mmel, TaqaI, Nrul, Hpyl88I, Hpy188III, Xbal, Bell, HpyCH4V, FspI, PI-PspI, MscI, BsrGI, Msel, Pad, Psil, BstBI, Dral, PspXI, BsaWI, BsaAI, Eael, preferably Xhol, Xbal, Hindlll, Ncol, Notl, EcoRI, EcoRV, BamHI, Nhel, SacI, Sall , BstBI.

The term polylinker as used herein further refers to a short DNA sequence used for recombination phenomena, for example in the Gateway cloning strategy or for methods such as Gibson assembly or cloning in a TOPO system.

The term wild-type strain or wild-type Gram-negative bacterium strain as used herein refers to a natural variant or a natural variant containing genetic modifications that allow the use of vectors, such as deletions in restriction endonuclease or antibiotic resistance genes. These strains contain chromosomal DNA and also in some cases (eg Y. enterocolitica, S. flexneri) an unmodified virulence plasmid.

The term wild-type strain of Yersinia as used herein refers to a natural variant (e.g., Y. enterocolitica E40), a natural variant containing genetic modifications to allow the use of vectors, such as deletions in the genes for restriction endonucleases or antibiotic resistance (e.g., Y. enterocolitica MRS40, derived from Y. enterocolitica E40 and sensitive to ampicillin). These strains contain chromosomal DNA as well as an unmodified virulence plasmid (called pYV).

Y. enterocolitica subspecies palearctica belongs to low pathogenic strains of Y. enterocolitica, which differ from highly virulent strains of the enterocolitica subspecies [12, 13]. Y. enterocolitica subsp. palearctica in contrast to Y. enterocolitica subsp. enterocolitica does not contain a high pathogenicity island (HPI). This HPI encodes an iron-binding siderophore called yersiniabactin [14]. The absence of yersiniabactin in Y. enterocolitica subsp. palearctica makes this subspecies less pathogenic and dependent on the induction of systemically available iron for persistent infection, for example, in the liver or spleen [14]. Iron can be made available to bacteria in an individual's body, for example, by pretreatment with deferoxamine, an iron chelator used to treat iron overload in patients [15].

The term contain is generally used in the sense of including, in other words, allowing for the presence of one or more features or components.

The term approximately refers to the value range of ±10% of the set value. For example, the phrase approximately 200 includes ±10% of 200 or 180 to 220.

In one aspect of the present invention, a virulence-attenuated recombinant Gram-negative bacterium strain transformed with a vector comprising a 5' to 3' promoter;

a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter;

- 20 040558 a second DNA sequence encoding a heterologous protein fused in-frame to the 3' end of said first DNA sequence for use in a method for treating a malignant solid tumor in a subject in which a recombinant gram-negative bacterium strain with attenuated virulence accumulates in the malignant solid tumor, and the specified method includes introducing into the body of the subject of the specified recombinant strain of gram-negative bacteria with attenuated virulence and the recombinant strain of gram-negative bacteria with attenuated virulence is administered in an amount sufficient to treat the subject.

In a further aspect of the present invention, there is provided a recombinant gram-negative bacterial strain of attenuated virulence, wherein said recombinant gram-negative bacterial strain of attenuated virulence is defective in the production of at least one bacterial effector protein virulent to eukaryotic cells, or defective in the production of at least one a bacterial protein that is part of the mechanism of the secretion system for use in a method of treating a malignant solid tumor in a subject in which a recombinant strain of gram-negative bacteria with attenuated virulence accumulates in a malignant solid tumor, and this method includes the introduction of the specified recombinant strain of gram-negative bacteria with attenuated virulence in the subject's organism and a recombinant gram-negative bacterium strain of attenuated virulence are administered in an amount sufficient to treat the subject that. Preferred is a recombinant strain of Gram-negative bacterium with attenuated virulence, wherein said recombinant strain of Gram-negative bacterium with attenuated virulence is defective in the production of at least one bacterial effector protein virulent against eukaryotic cells, for use in a method of treating a malignant solid tumor in a subject, in in which a recombinant gram-negative bacterium strain with attenuated virulence accumulates in a malignant solid tumor, said method comprising administering said recombinant gram-negative bacterium strain with attenuated virulence to the body of a subject and the recombinant gram-negative bacterium strain with attenuated virulence is administered in an amount sufficient to treat the subject.

In one embodiment of the present invention, a recombinant Gram-negative bacterial strain of attenuated virulence, defective in the production of at least one bacterial effector protein virulent to eukaryotic cells, or defective in the production of at least one bacterial protein that is part of the mechanism of the secretion system, is transformed a vector containing in the direction from 5' to 3' the promoter;

a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter;

a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence.

In one embodiment of the present invention, a recombinant gram-negative bacterial strain with attenuated virulence, or a recombinant gram-negative bacterial strain with attenuated virulence, defective in the production of at least one bacterial effector protein virulent to eukaryotic cells, or defective in the production of at least one bacterial protein , which is part of the mechanism of the secretion system, is transformed with a vector containing in the direction from 5' to 3' the first DNA sequence encoding the delivery signal of the bacterial effector protein or its fragment;

a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence.

Preferably, the DNA sequence encoding the heterologous protein is flanked 3' by a DNA sequence, a homologous chromosome DNA sequence, or an endogenous virulence plasmid at the 3' end of the bacterial effector protein delivery signal, or a fragment thereof. More preferably, this DNA sequence, which flanks the homologous protein at the 3' end, is homologous to the DNA sequence and is located within 10 kb. on a chromosome or endogenous virulence plasmid at the 3' end of the bacterial effector protein delivery signal, or a fragment thereof. In particular, this nucleotide sequence, which flanks the homologous protein at the 3' end, is homologous to the DNA sequence and is within the same operon on the chromosome or endogenous virulence plasmid as the bacterial effector protein delivery signal or fragment thereof. In this embodiment, the transformation is usually performed such that the combined first and second DNA sequences are inserted by homologous recombination into an endogenous virulence plasmid or chromosome, preferably into an endogenous virulence plasmid of a recombinant, virulence-attenuated strain of Gram-negative bacteria, and the combined first and second the DNA sequences are operably linked to the promoter of an endogenous virulence plasmid or chromosome, such as a chromosomal pathogenicity island. Preferably, the combined first and second DNA sequences are operably linked to an endogenous virulence plasmid promoter. In this embodiment, the first DNA sequence contains a bacterial effector protein delivery signal or a fragment thereof, preferably a fragment thereof, providing homologous recombination at a homologous site on the chromosome or endogenous virulence plasmid, as a result of which the second DNA sequence is placed in frame at the 3'-end a delivery signal on a chromosome or endogenous virulence plasmid operably linked to an endogenous promoter.

In a further embodiment of the present invention, a recombinant gram-negative bacterial strain with attenuated virulence, or a recombinant gram-negative bacterial strain with attenuated virulence, defective in the production of at least one bacterial effector protein virulent to eukaryotic cells, or defective in the production of at least one bacterial protein , which is part of the mechanism of the secretion system, is transformed with a nucleotide molecule, preferably a DNA nucleotide molecule, containing a nucleotide sequence encoding a heterologous protein, and a nucleotide sequence homologous or identical to a nucleotide sequence encoding a bacterial effector protein delivery signal, or homologous or identical to a nucleotide sequence encoding a fragment bacterial effector protein delivery signal, wherein the bacterial effector protein delivery signal encodes a chromosome ma or endogenous virulence plasmid of a recombinant strain of gram-negative bacteria with attenuated virulence. Preferably, a nucleotide sequence homologous or identical to the nucleotide sequence of the bacterial effector protein delivery signal or a fragment thereof is located at the 5' end of the nucleotide sequence encoding the heterologous protein. More preferably, the nucleotide sequence encoding the heterologous protein is flanked 3' by a nucleotide sequence, a homologous chromosome DNA sequence, or an endogenous virulence plasmid at the 3' end of the bacterial effector protein delivery signal, or a fragment thereof. Even more preferably, the nucleotide sequence that flanks the homologous protein at the 3' end is homologous to a DNA sequence located within 10 kb. on a chromosome or endogenous virulence plasmid at the 3' end of the bacterial effector protein delivery signal, or a fragment thereof. In particular, this nucleotide sequence, which flanks the homologous protein at the 3' end, is homologous to the DNA sequence and is within the same operon on the chromosome or endogenous virulence plasmid as the bacterial effector protein delivery signal or fragment thereof. In this embodiment, transformation is typically performed such that a nucleotide sequence encoding a heterologous protein is inserted into an endogenous virulence plasmid or chromosome of a recombinant gram-negative bacterial strain with attenuated virulence at the 3' end of the delivery signal of a bacterial effector protein that encodes the chromosome or endogenous virulence plasmid , and the expression and secretion of a heterologous protein attached to the delivery signal.

If the recombinant gram-negative bacterial strain with attenuated virulence is a Yersinia strain, then the endogenous virulence plasmid for insertion is pYV (Yersinia virulence plasmid). If the recombinant gram-negative bacterial strain of attenuated virulence is a Salmonella strain, the endogenous insertion location is one of the gene clusters called SpiI or SpiII (for Salmonella pathogenicity island), at the position where the effector protein would otherwise be encoded, or alternatively one of the Salmonella virulence plasmids (SVP).

The first and second DNA sequences or nucleotide molecules are preferably inserted into the endogenous virulence plasmid at the native site of the bacterial effector protein, e.g. the native site of the virulence factor, preferably if the virulence attenuated recombinant gram-negative bacterial strain is a Yersinia strain, at the native site of YopE or another Yop (YopH , YopO, YopP, YopM, YopT), preferably to the native site of YopE, or, if the recombinant strain of attenuated gram-negative bacteria is a Salmonella strain, to the native site of an effector protein encoded by SpiI, SpiII or another gene, preferably to the native site of the effector protein encoded by SpiI or SpiII, more preferably to a native SopE or SteA site. The first and second DNA sequences or nucleotide molecules are operably linked to a native bacterial effector protein promoter present on an endogenous virulence plasmid, for example, if the recombinant gram-negative bacterium strain of attenuated virulence is a Yersinia strain, with a native gene promoter from the Yersinia virulon described below, more preferably with a native YopE promoter or another Yop promoter (YopH, YopO, YopP, YopM, YopT), preferably with a native YopE promoter, or if the recombinant attenuated gram-negative bacterial strain is

- 22 040558 Salmonella strain, with a native promoter of pathogenicity island SpiI or SpiII or an effector protein encoded by another gene as described below, more preferably with a native SopE promoter,

InvB or SteA.

In one embodiment of the present invention, the recombinant gram-negative bacterium strain with attenuated virulence is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella and Pseudomonas. In one embodiment, the virulence attenuated recombinant Gram-negative bacterium strain is selected from the group consisting of the genera Yersinia and Salmonella. The recombinant gram-negative bacterium strain with attenuated virulence is preferably a Yersinia strain, more preferably a Yersinia enterocolitica strain. Most preferred is Yersinia enterocolitica E40 (0:9, biotype 2) [16] or strains derived from it that are susceptible to ampicillin, such as Y. enterocolitica MRS40 (also known as Y. enterocolitica subsp. palearctica MRS40) as described in [17 ]. Y. enterocolitica E40 and derived from it Y. enterocolitica MRS40 described in [17] are identical to Y. enterocolitica subsp. palearctica E40 and its descendant Y. enterocolitica subsp. palearctica MRS40 described in [12, 14, 18]. In addition, the recombinant gram-negative bacterium strain with attenuated virulence is preferably a Salmonella strain, more preferably a Salmonella enterica strain. Most preferred is the Salmonella enterica serovar Typhimurium SL1344 described in the Public Health Culture Collection England (NCTC 13347).

In some embodiments of the present invention, the recombinant gram-negative bacterium strain of attenuated virulence is a non-siderophore-producing strain, eg, defective in siderophore production, preferably non-siderophore-producing, eg, defective in the production of any siderophore. Such a strain is, for example, Y. enterocolitica subsp. palearctica MRS40 described in [14, 17], which does not produce yersiniabactin and is preferred.

In one embodiment of the present invention, the bacterial effector protein delivery signal comprises a bacterial effector protein or an N-terminal fragment thereof.

In one embodiment of the present invention, the bacterial effector protein delivery signal is a T3SS bacterial effector protein, or an N-terminal fragment thereof, containing a T3SS bacterial effector protein, or an N-terminal fragment thereof, wherein the T3SS effector protein, or an N-terminal fragment thereof, may contain a binding site chaperone. The bacterial effector protein T3SS or its N-terminal fragment containing the chaperone binding site is particularly useful as a delivery signal in the present invention. The preferred T3SS effector protein or N-terminal fragment thereof is selected from the group consisting of

SopE, SopE2, SptP, YopE, ExoS, SipA, SipB, SipD, SopA, SopB, SopD, IpgBl, IpgD, SipC,

SifA, SseJ, Sse, Srffi, YopJ, AvrA, AvrBsT, YopT, YopH, YpkA, Tir, EspF, TccP2, IpgB2,

OspF, Map, OspG, OspI, IpaH, SspHl, VopF, ExoS, ExoT, HopAB2, XopD, AvrRpt2,

HopAOl, HopPtoD2, HopUl, GALA protein families, AvrBs2, AvrDl, AvrBS3, YopO, YopP, YopE, YopM, YopT, EspG, EspH, EspZ, IpaA, IpaB, IpaC, VirA, IcsB, OspCl, OspE2, IpaH9.8, IpaH7.8, AvrB, AvrD, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, VirPphA, AvrRpml, HopPtoE, HopPtoF, HopPtoN, PopB, PopP2, AvrBs3, XopD, and AvrXv3.

The more preferred T3SS effector protein or N-terminal fragment thereof is selected from the group consisting of ^So P ^E > SptP, YopE, ExoS, SopB, IpgBl, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE, YopM , YopT, and the most preferred effector protein T3SS or its N-terminal fragment is selected from the group consisting of ^SopE ' ^So P ^B ' ^S P ^tP ' ^Os P ^F ' ^Yo P ^H , YopO, YopP, YopE, YopM, YopT , especially YopE or its N-terminal fragment.

Equally preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of

- 23 040558

SopE, SopE2, SptP, SteA, SipA, SipB, SipD, Sop A, SopB, SopD, IpgBl, IpgD, SipC,

SifA, SifB, SseJ, Sse, SrfH, YopJ, AvrA, AvrBsT, YopH, YpkA, Tir, EspF, TccP2, IpgB2,

OspF, Map, OspG, OspI, IpaH, VopF, ExoS, ExoT, HopAB2, AvrRpt2, HopAOl, HopUl, GALA protein families, AvrBs2, AvrDl, YopO, YopP, YopE, YopT, EspG, EspH, EspZ, IpaA, IpaB, IpaC, VirA, IcsB, OspCl, OspE2, IpaH9.8, IpaH7.8, AvrB, AvrD, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, VirPphA, AvrRpml, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, PopB, PopP2, AvrBs3, XopD and AvrXv3.

An equally preferred T3SS effector protein or N-terminal fragment thereof is selected from the group consisting of ^So P ^E ' ^S P ^tP ' ^SteA ' ^So P ^B > Ipg ^B E IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO , YopP, YopE, YopT, and the most preferred effector protein T3SS or its N-terminal fragment is selected from the group consisting of IpgBl, SopE, SopB, SptP, SteA, SifB, OspF, IpgD, YopH, YopO, YopP, YopE and YopT, especially SopE, SteA or YopE or their N-terminal fragment, more preferably SteA or YopE or their N-terminal fragment, most preferably YopE or its N-terminal fragment. In some embodiments, the T3SS bacterial effector protein delivery signal encoded by the first DNA sequence comprises the T3SS bacterial effector protein or an N-terminal fragment thereof, wherein the N-terminal fragment contains at least the first 10, preferably at least the first 20, more preferably at least the first 100 amino acids of the bacterial effector protein T3SS.

In some embodiments, the T3SS bacterial effector protein delivery signal encoded by the first DNA sequence comprises a T3SS bacterial effector protein or an N-terminal fragment thereof, wherein the T3SS bacterial effector protein or an N-terminal fragment thereof contains a chaperone binding site.

Preferred T3SS effector proteins or their N-terminal fragments containing a chaperone binding site include the following combinations of the chaperone binding site and the T3SS effector protein or N-terminal fragment thereof: SycE-YopE, InvB-SopE, SicP-SptP, SycT-YopT, SycO -YopO, SycN/YscB-YopN, SycH-YopH, SpcS-ExoS, CesF-EspF, SycD-YopB, SycD-YopD. More preferred are SycE-YopE, InvB-SopE, SycT-YopT, SycO-YopO, SycN/YscB-YopN, SycH-YopH, SpcS-ExoS, CesF-EspF. Most preferred is YopE or its N-terminal fragment containing the SycE chaperone binding site, e.g. the N-terminal fragment of the YopE effector protein containing the 138 N-terminal amino acids of the YopE effector protein, herein designated YopE _1-138 and shown in SEQ ID NO: 2, or SopE or an N-terminal fragment thereof containing an InvB chaperone binding site, e.g. an N-terminal fragment of the SopE effector protein containing the 81 or 105 N-terminal amino acids of the SopE effector protein, referred to herein as SopE _1-81 or SopE _1-105 respectively and shown in SEQ ID NO: 142 or 143.

In one embodiment of the present invention, the recombinant gram-negative bacterial strain of attenuated virulence is a Yersinia strain and the T3SS bacterial effector protein delivery signal encoded by the first DNA sequence comprises a YopE effector protein or an N-terminal fragment, preferably a Y. enterocolitica YopE effector protein or its N- end fragment. The SycE binding site is preferably contained in the N-terminal fragment of the YopE effector protein. In this regard, the N-terminal fragment of the YopE effector protein can contain 12, 16, 18, 52, 53, 80, or 138 N-terminal amino acids [19-21]. Most preferred is an N-terminal fragment of the YopE effector protein containing the 138 N-terminal amino acids of the YopE effector protein, such as that described in Forsberg and Wolf-Watz [22], designated herein as YopE _1-138 and shown in SEQ ID NO : 2.

In one embodiment of the present invention, the recombinant gram-negative bacterial strain with attenuated virulence is a Salmonella strain and the T3SS bacterial effector protein delivery signal encoded by the first DNA sequence comprises a SopE or SteA effector protein or an N-terminal fragment thereof, preferably a SopE effector protein, or SteA Salmonella enterica, or its N-terminal fragment. The chaperone binding site is preferably contained in the N-terminal fragment of the SopE effector protein. In this regard, the N-terminal fragment of the SopE effector protein may contain 81 or 105 N-terminal amino acids. Most preferred is a full-length SteA and an N-terminal SopE effector protein fragment containing the 105 N-terminal amino acids of the effector protein, such as those described in SEQ ID NO: 142 or 143.

One skilled in the art is familiar with methods for identifying effector protein polypeptide sequences capable of delivering the protein. For example, one such method is described by Sory et al. [16]. Briefly, polypeptide sequences of, for example, various fragments of Yop proteins can be linked in frame to a reporter enzyme, for example, the calmodulin-activated adenylate cyclase (or Cya) domain of Bordetella pertussis cyclolysin. Delivery of the Yop-Cya fusion protein into the cytosol of eukaryotic cells is indicated by the appearance of

- 24 040558 cyclase activity in infected eukaryotic cells, leading to the accumulation of cAMP. Using this approach, a person skilled in the art can optionally determine the minimum sequence requirements, i.e. the minimum length of a continuous amino acid sequence capable of delivering a protein (see, for example, [16]). Accordingly, preferred delivery signals according to the present invention consist of at least the minimum amino acid sequence of the T3SS effector protein capable of delivering the protein.

The present invention provides recombinant strains of gram-negative bacteria with attenuated virulence for use in a method of treating a malignant solid tumor in a subject, wherein said recombinant strain of gram-negative bacteria with attenuated virulence is defective in the production of at least one bacterial effector protein virulent against eukaryotic cells, accumulates in a malignant solid tumor. In some embodiments, recombinant strains of attenuated gram-negative bacteria are defective in producing at least one, preferably at least two, more preferably at least three, even more preferably at least four, especially at least five, more preferably at least six, most preferably all bacterial effector proteins virulent to eukaryotic cells, ie. recombinant strains of gram-negative bacteria with reduced virulence are defective in the production of at least one, preferably at least two, more preferably at least three, even more preferably at least four, in particular at least five, more preferably at least six, most preferably all functional bacterial effector proteins virulent to eukaryotic cells, so that the resulting recombinant strain of gram-negative bacterium with attenuated virulence produces less bacterial effector proteins or produces bacterial effector proteins to a lesser extent compared to the bacterial effector proteins normally produced by the strain gram-negative wild-type bacterium without attenuation of virulence, or so that the resulting recombinant strain of gram-negative bacteria with attenuated virulence no longer produces functional bacterial effects vector proteins virulent against eukaryotic cells.

In some embodiments, a recombinant strain of gram-negative bacterium with attenuated virulence for use in a method of treating a malignant solid tumor in a subject is defective in the production of all eukaryotic cell virulent effector proteins, the bacterial effector protein delivery signal is the T3SS bacterial effector protein delivery signal, and the heterologous protein is selected from the group consisting of proteins involved in apoptosis or regulation of apoptosis.

In accordance with the present invention, such a mutant strain of Gram-negative bacteria, i. such a recombinant Gram-negative bacterial strain of attenuated virulence defective in the production of at least one bacterial effector protein virulent to eukaryotic cells, such as such a mutant Yersinia strain, can be obtained by introducing at least one mutation in at least one gene encoding effector. Such genes encoding effectors preferably include YopE, YopH, YopO/YpkA, YopM, YopP/YopJ and YopT, provided that it concerns a strain of Yersinia. Such genes encoding effectors preferably include

AvrA, CigR, GogB, GtgA, GtgE, PipB, Siffi, SipA/SspA, SipB, SipC/SspC, Siffi,

SipA/SspA, SipB, SipC/SspC, SipD/SspD, SlrP, SopB/SigD, SopA, SpiC/SsaB, SseB,

SseC, SseD, SseF, SseG, Ssel/SrfH, SopD, SopE, SopE2, SspHl, SspH2, PipB2, SifA,

SopD2, SseJ, SseKl, SseK2, SseK3, SseL, SteC, SteA, SteB, SteD, SteE, SpvB, SpvC, SpvD,

SrfJ, SptP, provided that it concerns a strain of Salmonella. In the most preferred case, all genes encoding effectors are removed. The skilled artisan can use any number of standard techniques to generate mutations in these T3SS effector genes. In Sambrook et al. a general description of such techniques is given. See Sambrook et al. [23]. In accordance with the present invention, it is possible to obtain a mutation in the promoter region of a gene encoding an effector, eliminating the expression of such an effector gene. In addition, it is possible to obtain a mutation in the coding region of a gene encoding an effector, abolishing the catalytic activity of the encoded effector protein. The catalytic activity of an effector protein normally refers to the function of the effector protein against the target cell, eg toxicity.

Such activity is regulated by catalytic motifs in the catalytic domain of the effector protein. Approaches for identifying the catalytic domain and/or catalytic motifs of an effector protein are known to those skilled in the art. See, for example, [24, 25].

- 25 040558

Accordingly, one of the preferred mutations according to the present invention is the deletion of the entire catalytic domain. Another preferred mutation is a frameshift mutation in the gene encoding the effector such that the protein product expressed from the frameshift gene lacks the catalytic domain. Most preferred is a mutation that deletes the entire coding region of the effector protein. The present invention also contemplates other mutations, such as small deletions or base pair substitutions, produced in the catalytic motifs of an effector protein and resulting in the destruction of the catalytic activity of that effector protein. Mutations obtained in the genes of functional bacterial effector proteins can be introduced into a particular strain in various ways. One such method involves cloning the mutated gene into a suicide vector capable of introducing the mutated sequence into the strain via allelic substitution. An example of such a suicide vector is described in [26].

Thus, it is possible to successfully introduce mutations obtained in a plurality of genes into a gram-negative bacterium strain to obtain a polymutant, such as a recombinant strain with six mutations. The order in which these mutated sequences are introduced is not important. Under some circumstances, it may be desirable to mutate only some, but not all of the effector genes. Accordingly, the present invention further contemplates polymutant Yersinia strains that are not Yersinia strains with six mutations, such as strains with two mutations, three mutations, four mutations and five mutations. For protein delivery, the secretion and translocation systems of a given mutant strain must be intact.

A preferred recombinant, virulence-attenuated Gram-negative bacterium strain of the present invention is a six-mutant Yersinia strain in which the effector-coding genes are mutated such that the resulting Yersinia strain no longer produces functional effector proteins. This strain of Yersinia with six mutations is designated AyopH, O, P, E, M, T for Y. enterocolitica. As an example, such a strain with six mutations can be obtained from a Y. enterocolitica MRS40 strain to form Y. enterocolitica MRS40 AyopH, O, P, E, M, T (also known herein as Y. enterocolitica subsp. palearctica MRS40 AyopH, O , P, E, M, T), which is preferred. Equally preferred is Y. enterocolitica MRS40 AuopH, O, P, E, M, T Aasd (also known herein as Y. enterocolitica subsp. palearctica MRS40 AuopH, O, P, E, M, T Aasd).

The vectors that can be used according to the present invention for the transformation of a strain of gram-negative bacteria, as known in the art, depend on the strains of gram-negative bacteria used. The promoter, heterologous protein and protease cleavage site described herein can be used in the vector of a recombinant Gram-negative bacterium strain with attenuated virulence. Vectors that can be used in accordance with the present invention include expression vectors (including synthetic or otherwise derived modified versions of endogenous virulence plasmids), vectors for insertion into the chromosome or virulence plasmid, and DNA fragments for insertion into the chromosome or virulence plasmid. Expression vectors that can be used, for example, in strains of Yersinia, Escherichia, Salmonella or Pseudomonas, are, for example, plasmids pUC, pBad, pACYC, pUCP20 and pET. Vectors for insertion into a virulence chromosome or plasmid which can be used, for example, in strains of Yersinia, Escherichia, Salmonella or Pseudomonas, are, for example, pKNGl0l. DNA fragments for insertion into a chromosome or virulence plasmid refer to methods used, for example, in strains of Yersinia, Escherichia, Salmonella or Pseudomonas, for example genetic engineering using lambda phage Red recombinase. Vectors for insertion into a chromosome or virulence plasmid, or DNA fragments for insertion into a chromosome or virulence plasmid, can insert the first, second, and/or third DNA sequences of the present invention such that the first, second, and/or third DNA sequences become operably linked to an endogenous promoter of a recombinant strain of a gram-negative bacterium with a weakened virulence. Thus, when using a vector for insertion into a virulence chromosome or plasmid, or a DNA fragment for insertion into a chromosome or virulence plasmid, an endogenous promoter can be located on endogenous bacterial DNA (chromosomal or plasmid DNA) and a vector for insertion into a chromosome or virulence plasmid or DNA fragment for an insertion into a chromosome or virulence plasmid will only contain the first and second DNA sequences. Alternatively, when using a vector for insertion into a chromosome or virulence plasmid, or a nucleotide molecule, for example, a DNA sequence for insertion into a chromosome or virulence plasmid, the endogenous promoter and delivery signal of the bacterial effector protein can be located on the endogenous bacterial DNA (chromosomal or plasmid DNA) and the vector for insertion into a chromosome or virulence plasmid, or a nucleotide molecule, eg a DNA sequence for insertion into a chromosome or virulence plasmid, will only contain a nucleotide molecule, eg a DNA sequence encoding a heterologous protein. Thus, the promoter need not be contained in the vector,

- 26 040558 used to transform a recombinant gram-negative bacterium strain with attenuated virulence, i.e. a recombinant gram-negative bacterium strain of attenuated virulence according to the present invention can be transformed with a promoter-free vector.

In a preferred embodiment, the vector of the present invention comprises, in a 5' to 3' direction, a first DNA sequence encoding a bacterial effector protein delivery signal or fragment thereof;

a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence.

A preferred vector, eg a preferred expression vector for Yersinia, is selected from the group consisting of pBad_Si_1 and pBad_Si_2. pBad_Si2 was constructed by cloning the SycE-YopE ₁ fragment. ₁₃₈ containing the endogenous YopE and SycE promoter from purified pYV40 to the KpnI/HindIII site of pBad-MycHisA (Invitrogen). Additional modifications include removal of the NcoI/BglII fragment from pBad-MycHisA by hydrolysis, treatment with a Klenow fragment and re-ligation. Subsequently, the following cleavage sites were added at the 3'-end of YopE1_ ₁₃₈ : XbaI-XhoI-BstBI(HindIII). pBad_Si1 is identical to pBad_Si2 but encodes EGFP amplified from pEGFP-C1 (Clontech) at the NcoI/BglII site under the control of an arabinose inducible promoter. Equally preferred is the use of modified versions of the endogenous Yersinia pYV virulence plasmid encoding heterologous proteins as fusions with the T3SS signal sequence.

A preferred vector, eg a preferred expression vector for Salmonella, is selected from the group consisting of pSi_266, pSi_267, pSi_268 and pSi_269. Plasmids pSi_266, pSi_267, pSi_268, and pSi_269 containing the corresponding endogenous promoter and a _{SteA1_20} (pSi_266) fragment, a full-length SteA sequence (pSi_267), a _SopE1-81 (pSi_268) fragment, or a SopE1 fragment. ₁₀₅ (pSi_269) was amplified from S. enterica SL1344 genomic DNA and cloned into the NcoI/KpnI site of pBadMycHisA (Invitrogen).

The vectors of the present invention may contain elements of other sequences, such as a 3' termination sequence (including a stop codon and a poly-A sequence) or a gene conferring drug resistance to select for transformants that receive the vector.

The vectors according to the present invention can be transformed using a number of known methods into a recombinant gram-negative bacterium strain with attenuated virulence. For purposes of the present invention, transformation methods for introducing a vector include, but are not limited to, electroporation, calcium phosphate-mediated transformation, conjugation, or combinations thereof. For example, the vector can be transformed into a first bacterial strain by a standard electroporation procedure. Such a vector can then be transferred from the first bacterial strain to the desired strain by conjugation; this process is also called mobilization. The selection of transformants (eg strains of gram-negative bacteria that received the vector) can be performed, for example, using antibiotics. These techniques are well known in the art. See, for example, [16].

In accordance with the present invention, the vector promoter of the recombinant gram-negative bacterial strain with attenuated virulence can be the native promoter of the T3SS effector protein of the corresponding strain or compatible bacterial strain, or the promoter used in expression vectors that can be used, for example, in a strain of Yersinia, Escherichia, Salmonella or Pseudomonas, such as pUC and pBad. Such promoters are the T7 promoter, the Plac promoter, or the Arabinose-inducible Ara-bad promoter. If the recombinant gram-negative bacterium strain with attenuated virulence is a Yersinia strain, the promoter may be derived from the Yersinia virulon gene. The Yersinia virulon gene belongs to the pYV Yersinia plasmid genes, whose expression is controlled by both temperature and contact with the target cell. Such genes include genes encoding secretory mechanism elements (Ysc genes), genes encoding translocators (YopB, YopD and LcrV), genes encoding control elements (YopN, TyeA and LcrG), genes encoding T3SS effector chaperones (SycD, SycE, SycH, SycN, SycO, and SycT), and genes encoding effectors (YopE, YopH, YopO/YpkA, YopM, YopT, and YopP/YopJ), as well as other proteins encoded by pYV, such as VirF and YadA.

In a preferred embodiment of the present invention, the promoter is a native promoter of a gene encoding a functional T3SS effector. If the recombinant gram-negative bacterium strain with attenuated virulence is a Yersinia strain, the promoter is selected from YopE, YopH, YopO/YpkA, YopM and YopP/YopJ. More preferably, the promoter is a YopE or SycE promoter.

If the recombinant gram-negative bacterium strain with attenuated virulence is a Salmonella strain, the promoter may be derived from pathogenicity island SpiI or SpiII or an effector protein encoded by another gene. Such genes include genes encoding secretory mechanism elements, genes encoding translocators, genes encoding control elements, genes encoding T3SS effector chaperones, and genes encoding effectors, as well as other proteins encoded by SPI-1 or SPI- 2. In a preferred embodiment of the present invention, the promoter is a native promoter of a gene encoding a functional T3SS effector. If the recombinant strain of attenuated gram-negative bacterium is a Salmonella strain, the promoter is selected from any of the effector proteins. More preferably, the promoter is a SopE, InvB or SteA promoter.

In one embodiment of the present invention, the vector, such as an expression vector, contains a DNA sequence encoding a protease cleavage site. Obtaining a functional and generally operable cleavage site ensures cleavage of the delivery signal after translocation. Since the delivery signal may interfere with the correct localization and/or function of the translocated protein in the target cell, the introduction of a protease cleavage site between the delivery signal and the desired protein ensures that nearly native proteins are initially delivered to eukaryotic cells. The protease cleavage site is preferably an amino acid motif cleaved by a protease or a catalytic motif thereof selected from the group consisting of enterokinase (light chain), enteropeptidase, PreScission protease, human rhinovirus (HRV 3C) protease, TEV protease, TVMV protease, factor Xa protease and thrombin, more preferably an amino acid motif cleaved by the TEV protease. An equally preferred protease cleavage site is an amino acid motif cleaved by the protease or its catalytic domain selected from the group consisting of enterokinase (light chain), enteropeptidase, PreScission protease, human rhinovirus 3C protease, TEV protease, TVMV protease, factor Xa protease , a ubiquitin processing protease called the desubiquitinizing enzyme, and thrombin. Most preferred is an amino acid motif cleaved by a TEV protease or a ubiquitin processing protease.

Thus, in a further embodiment of the present invention, the heterologous protein is cleaved from the bacterial effector protein delivery signal by the T3SS protease. Preferred cleavage methods are those in which

a) the protease is translocated into a eukaryotic cell with the attenuated recombinant gram-negative bacterium strain described herein expressing the delivery signal of the bacterial effector protein T3SS and the protease as a heterologous protein; or

b) the protease is expressed constitutively or transiently in the eukaryotic cell.

In general, a recombinant gram-negative bacterium strain of attenuated virulence used to deliver a desired protein to a eukaryotic cell and a recombinant gram-negative bacterium strain of attenuated virulence translocating a protease into a eukaryotic cell are different.

In one embodiment of the present invention, the vector contains an additional DNA sequence encoding a labeling molecule or an acceptor site for a labeling molecule. An additional DNA sequence encoding a labeling molecule or an acceptor site for a labeling molecule is typically attached to the 5' or 3' end of the second DNA molecule. The preferred labeling molecule or acceptor site for the labeling molecule is selected from the group consisting of enhanced green fluorescent protein (EGFP), coumarin, coumarin ligase acceptor site, resorufin, resorufin ligase acceptor site, tetracysteine motif used with FlAsH/ReAsH dye (Life Technologies). Most preferred are resorufin and the acceptor site of resorufin ligase or EGFP. The use of a labeling molecule or an acceptor site for a labeling molecule should result in the attachment of the labeling molecule to the desired heterologous protein, which should then be delivered without further purification to the eukaryotic cell and allow tracking of the protein, for example, by live cell microscopy.

In one embodiment of the present invention, the vector contains an additional DNA sequence encoding a peptide marker. An additional DNA sequence encoding a peptide marker is usually attached to the 5' or 3' end of the second DNA molecule. The preferred peptide marker is selected from the group consisting of a Myc marker, a His marker, a Flag marker, a HA marker, a Strep marker, or a V5 marker, or a combination of two or more markers from these groups. Most preferred are a Myc marker, a Flag marker, a His marker, and a combination of Myc and His markers. The use of a peptide marker should lead to the possibility of tracking the labeled protein, for example, by immunofluorescence or Western blotting using antibodies against the marker. In addition, the use of a peptide marker provides affinity purification of the desired protein after secretion into the culture supernatant or after translocation into eukaryotic cells, and in in both cases, a purification method suitable for the respective marker is used (eg, metal chelate affinity purification using the His marker, or anti-Flag antibody purification using the Flag marker).

In one embodiment of the present invention, the vector contains an additional sequence

- 28 040558 DNA value encoding the nuclear localization signal (NLS). An additional DNA sequence encoding a nuclear localization signal (NLS) is typically attached to the 5' or 3' end of a second DNA molecule, said additional DNA sequence encoding a nuclear localization signal (NLS). The preferred NLS is selected from the group consisting of the NLS of the SV40 large T antigen and its derivatives [27] as well as other viral NLSs. Most preferred are the NLS of the SV40 large T antigen and its derivatives.

In one embodiment of the present invention, the vector contains a polylinker. The polylinker is usually located at the 3'end of the first DNA sequence and/or at the 5'end or 3'end of the second DNA sequence. The vector may contain one or more than one polylinker. The preferred polylinker is selected from the group of restriction enzymes consisting of XhoI, XbaI, HindIII, NcoI, NotI, EcoRI, EcoRV, BamHI, NheI, SacI, SalI, BstBI. Most preferred are XbaI, XhoI, BstBI and HindIII.

The fusion protein expressed from the first, second, and optional third DNA sequences of the vector is also referred to as a fusion protein, i.e. a hybridoma of a delivery signal and a heterologous protein. The fusion protein may also contain, for example, a delivery signal and two or more different heterologous proteins.

The present invention contemplates methods for delivering the heterologous proteins described herein above to cancerous solid tumor cells. Proteins can be delivered, ie. translocate, into a malignant solid tumor cell during the introduction of a recombinant strain of gram-negative bacteria with attenuated virulence in the body of the subject, or deliver, i. translocate into the malignant solid tumor cell later, for example, after the recombinant strain of gram-negative bacterium with weakened virulence of the region reaches the malignant solid tumor region and/or reaches the malignant solid tumor region and replicates as described above. The time of delivery can be controlled, for example, by using a promoter used to express heterologous proteins in a recombinant gram-negative bacterium strain with attenuated virulence. In the first case, the expression of the heterologous protein may be driven by a constitutive promoter or, more preferably, by the endogenous promoter of the bacterial effector protein. In the case of delayed protein delivery, expression of the heterologous protein can be driven by an artificially inducible promoter, such as an arabinose-inducible promoter. In this case, after the bacteria reach the desired area and accumulate there, the subject needs to be injected with arabinose. After that, arabinose induces the expression of the delivered protein by bacteria.

Thus, in one embodiment, a method for delivering a heterologous protein to malignant solid tumor cells comprises:

i) culturing a recombinant gram-negative bacterium strain with attenuated virulence as described herein;

ii) contacting the malignant solid tumor cell with a recombinant gram-negative bacterial strain with attenuated virulence according to i), wherein the fusion protein comprising the bacterial effector protein delivery signal and the heterologous protein is expressed by the recombinant gram-negative bacterial strain with attenuated virulence and translocated into the malignant solid tumor cell; and optionally iii) cleaving the fusion protein such that the heterologous protein is cleaved from the bacterial effector protein delivery signal within the cancerous solid tumor cell.

In some embodiments, at least two fusion proteins, each containing a bacterial effector protein delivery signal and a heterologous protein, are expressed by a virulence-attenuated recombinant Gram-negative bacterium strain and translocated into a eukaryotic cell using the methods of the present invention.

A recombinant Gram-negative bacterial strain of attenuated virulence can be cultured such that a fusion protein is expressed containing a bacterial effector protein delivery signal and a heterologous protein according to methods known in the art (e.g., FDA, Bacteriological Analytical Manual (BAM), chapter 8: Yersinia enterocolitica). A recombinant gram-negative bacterium strain of attenuated virulence can preferably be cultured in brain heart broth, for example at 28°C. To induce the expression of T3SS and, for example, genes dependent on the YopE/SycE promoter, bacteria can be grown at 37°C.

In one embodiment, malignant solid tumor cells are contacted with two recombinant gram-negative bacterium strains of attenuated virulence according to i), wherein the first recombinant strain of gram-negative bacterium with attenuated virulence expresses a first fusion protein containing the bacterial effector protein delivery signal T3SS and a first heterologous protein, and a second recombinant gram-negative bacterium strain with attenuated virulence expresses a second fusion protein containing a signal

- 29 040558 delivering a bacterial effector protein and a second heterologous protein so that the first and second fusion proteins are translocated into a malignant solid tumor cell. In this embodiment, co-infection of, eg, malignant solid tumor cells with two bacterial strains is provided as a validated method for delivering, eg, two different fusion proteins to single cells to consider their functional interaction.

In addition, a number of assays may be used by those skilled in the art to determine whether a fusion protein has been successfully delivered. For example, a fusion protein can be detected by immunofluorescence using antibodies that recognize an attached marker (eg, a Myc marker). The determination can also be based on the enzymatic activity of the delivered protein, for example in the assay described in [16].

The present invention also provides a pharmaceutical composition comprising a recombinant gram-negative bacterium strain with attenuated virulence for use in a method of treating a malignant solid tumor in a subject, wherein said recombinant gram-negative bacterium with attenuated virulence accumulates in the malignant solid tumor.

The recombinant gram-negative, attenuated virulence bacteria can be formulated into a pharmaceutical composition with a suitable pharmaceutically acceptable carrier for convenient and effective administration in an amount sufficient to treat a subject. A unit dosage form of a recombinant gram-negative bacterium with reduced virulence or an administered pharmaceutical composition may, for example, contain recombinant gram-negative bacteria with reduced virulence in an amount of from about 10 ⁵ to about 10 ⁹ bacteria per ml, preferably from about 106 to about 10 ⁸ bacteria per ml, more preferably about 10 ⁷ to about 10 ⁸ bacteria per ml, most preferably about 10 ⁸ bacteria per ml.

By the terms an amount sufficient to treat a subject or an effective amount, as used herein on an equal footing, is meant an amount of one or more species of bacteria that is high enough to make a significant positive change in the condition being treated, but low enough to avoid serious side effects (when reasonable benefit/risk ratio) as part of a thorough medical evaluation. The effective amount of bacteria will depend on the particular goal being achieved, the age and physical condition of the subject being treated, the duration of treatment, the nature of the concurrent therapy, and the particular bacterium used. Thus, the effective amount of bacteria should be the minimum amount that provides the desired effect. Typically, about 10 ⁵ to about 10 ⁹ bacteria are administered to the subject, for example, from about 10 ⁵ to about 10 ⁹ bacteria/m ² body surface, preferably from about 106 to about 10 ⁸ bacteria, for example, from about 106 to about 10 ⁸ bacteria/m ² body surface, more preferably about 10 ⁷ to about 10 ⁸ bacteria, such as about 10 ⁷ to about 10 ⁸ bacteria/m ² body surface, most preferably 10 ⁸ bacteria, such as 10 ⁸ bacteria/m ² body surface.

A single dose of a recombinant gram-negative bacterium strain with attenuated virulence administered to a subject, such as a human for the treatment of a malignant solid tumor, is typically from about 10 ⁴ to about 10 ¹⁰ bacteria, for example from about 10 ⁴ bacteria/m ² body surface to about 10 ¹⁰ bacteria/ m ^{2 of} body surface, preferably from about 10 ⁵ to about 10 ⁹ bacteria, for example from about 10 ⁵ to about 10 ⁹ bacteria/m ^{2 of} body surface, more preferably from about 106 to about 10 ⁸ bacteria, for example from about 106 to about 10 ⁸ bacteria/m ² body surface, even more preferably about 10 ⁷ to about 10 ⁸ bacteria, eg about 10 ⁷ to about 10 ⁸ bacteria/m ² body surface, most preferably 10 ⁸ bacteria, eg 10 ⁸ bacteria/m ² , body surface based on the total number of recombinant gram-negative nye bacteria with attenuated virulence.

Examples of substances capable of serving as pharmaceutical carriers are carbohydrates such as lactose, glucose and sucrose; starch, such as corn starch and potato starch; cellulose and its derivatives, for example sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetates; powdered tragacanth; malt; gelatin; talc; stearic acid; magnesium stearate; calcium sulfate; calcium carbonate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols such as propylene glycol, glycerin, sorbitol, mannitol and polyethylene glycol; agar; alginic acids; pyrogen-free water; isotonic saline; cranberry extracts and phosphate buffer solution; skimmed milk powder; as well as other non-toxic compatible substances used in pharmaceutical formulations, such as vitamin C, estrogens and echinacea. Moisturizers and lubricants, such as sodium lauryl sulfate, as well as colorants, flavors, lubricants, excipients, tabletting agents, stabilizers, antioxidants, and preservatives may also be present in the compositions.

Methods for administering the recombinant, attenuated gram-negative bacteria to a subject can be selected from the group consisting of intravenous, intratumoral, intraperitoneal, and oral administration. Although the present invention should not be limited to any particular route of administration, intravenous or intratumoral administration of bacteria or pharmaceutical compositions is preferred.

Depending on the route of administration, it may be necessary to coat active ingredients containing bacteria with a material to protect said organisms from the action of enzymes, acids, and other environmental conditions that may inactivate said organisms. In order to introduce bacteria by a method other than parenteral administration, they should be coated with or administered with a material to prevent inactivation. For example, bacteria can be administered together with enzyme inhibitors or in liposomes. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DFP) and trasylol. Liposomes include water in oil in water P40 emulsions, as well as conventional liposomes and liposomes of a specific design that transport bacteria, such as Lactobacillus, or their metabolic products to a target within the body of a host subject. One bacterium can be administered alone or in combination with a second, different bacterium. Any number of different bacteria can be used together. The term in combination with is understood together, almost simultaneously or sequentially. The compositions can also be administered as a tablet, pill or capsule, for example a lyophilized capsule containing the bacteria or pharmaceutical compositions of the present invention, or as a frozen solution of the bacteria or pharmaceutical compositions of the present invention containing DMSO or glycerol. Another preferred form of use includes the preparation of a lyophilized capsule of bacteria or pharmaceutical compositions according to the present invention. Another preferred form of application includes the preparation of a thermally dried capsule of bacteria or pharmaceutical compositions according to the present invention.

Recombinant Gram-negative bacteria with reduced virulence or an administered pharmaceutical composition can be administered by injection. Forms suitable for use by injection include sterile aqueous solutions (when the agent is soluble in water) or dispersions and sterile powders for the preparation of sterile injectable solutions or dispersions for immediate administration. In all cases, the dosage form must be sterile and fluid to the extent that it is easy to exit the syringe. It must be stable under the conditions of production and storage. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (eg glycerol, propylene glycol, liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by using coatings, such as lecithin, by maintaining the desired particle size in the case of a dispersion. In many cases, it is preferable to include isotonic agents, such as carbohydrates or sodium chloride, in the composition. Long-term absorption of compositions administered by injection can be achieved through the use of agents in the composition that delay absorption, for example, aluminum monostearate and gelatin.

In some embodiments of the present invention, a recombinant gram-negative bacterium strain with attenuated virulence is administered to a subject together with a siderophore. These siderophores are preferred. Siderophores that can be used for co-administration are siderophores including hydroxamate, catecholate and mixed ligand siderophores. Preferred siderophores are deferoxamine (also known as desferrioxamine B, desferoxamine B, DFO-B, DFOA, DFB or desferal), desferrioxamine E, deferasirox (exjade, desirox, defriget, desifer) and deferiprone (ferriprox), deferoxamine being more preferred. Deferoxamine is a bacterial siderophore produced by the actinobacterium Streptomycespilosus and commercially available, for example, from Novartis Pharma Schweiz AG (Switzerland).

Co-administration with siderophore can be performed before, simultaneously with, or after administration of a virulence-attenuated recombinant Gram-negative bacterium strain. Siderophore is preferably administered prior to administration of the recombinant gram-negative bacterium strain of attenuated virulence, more preferably at least 1 hour, preferably at least 6 hours, more preferably at least 12 hours, especially at least 24 hours prior to administration. a recombinant strain of Gram-negative bacterium with attenuated virulence to a subject. In a particular embodiment, the subject is pre-treated with desferoxamine 24 hours prior to infection with a recombinant, virulence-attenuated strain of Gram-negative bacterium to promote bacterial growth. Typically, siderophore is co-administered in a single dose of about 0.5x10'5 moles to about 1x10'3 moles, more preferably about 1x10'5 moles to about ^1x10'4 moles, preferably about 3.5x10'5 moles to about 1, 1x10'4 mol per kg of body weight. Typically, desferoxamine is co-administered in a single dose of about 20 mg to about 60 mg, preferably about 20 mg to about mg/kg of body weight.

The regimens for administering the recombinant, attenuated gram-negative bacterium strain or pharmaceutical composition described herein, as known to those skilled in the art, will depend on the particular goal being achieved, the age and physical condition of the subject being treated, the duration of treatment, the nature of concomitant therapy, and the particular bacterium used. The recombinant Gram-negative bacterium strain of attenuated virulence is usually administered to a subject according to an administration schedule (administration/dosing regimen) consisting of a single dose every 2-20 days, preferably every 6-10 days, more preferably every 7-9 days, preferably according to the regimen. administration consisting of a single dose every 2-8 weeks, preferably every 2-6 weeks, more preferably every 3-4 weeks. The period of introduction is usually from about 20 to about 60 days, preferably about 30-40 days. Alternatively, the administration period is typically from about 8 to about 32 weeks, preferably from about 8 to about 24 weeks, more preferably from about 12 to about 16 weeks.

In a further embodiment, the present invention provides a kit for the treatment of malignant solid tumors, preferably in humans. Such kits will generally contain an attenuated recombinant Gram-negative bacterium strain or pharmaceutical composition as described herein and instructions for use of the kit. In some embodiments, the kits include a holder, package, or container divided into compartments for one or more containers, such as vials, test tubes, and the like, each of the containers containing one or more of the individual elements used in the method described in this document. Suitable containers include, for example, bottles, vials, syringes and test tubes. In other embodiments, the container is made from various materials, such as glass or plastic.

Examples

Example 1

A. Materials and methods.

Bacterial strains and growth conditions. The strains used in this study are listed in FIG. 14A-14N. E. coli Top 10, used for purification and cloning of plasmids, and E. coli Sm10 λ pir, used for conjugation, as well as E. coli BW19610 [28], used for propagation of pKNG101, were grown routinely on LB-agar plates. and in LB broth at 37°C. Ampicillin was used at a concentration of 200 μg/ml (Yersinia) or 100 μg/ml (E. coli) for selection for expression vectors. Streptomycin was used at a concentration of 100 μg/ml for selection for suicide vectors. Y. enterocolitica MRS40 (O:9, biotype 2) [17] derived from E40 without ampicillin resistance [16] and strains derived from it were routinely grown on brain heart extract medium (BHI; Difco) at CT . For all strains of Y. enterocolitica, nalidixic acid (35 μg/ml) was added, and for all strains of Y. enterocolitica asd, an additional 100 μg/ml of meso2,6-diaminopimelic acid (mDAP, Sigma Aldrich) was added. S. enterica SL1344 was routinely grown on LB agar plates and in LB broth at 37°C. Ampicillin was used at a concentration of 100 μg/ml to select for expression vectors in S. enterica.

Genetic manipulations with Y. enterocolitica.

Genetic manipulations with Y. enterocolitica have been described [29, 30]. Briefly, mutators were designed to modify or delete genes in pYV plasmids or on the chromosome by 2-fragment overlap PCR using purified pYV40 plasmid or genomic DNA as template, resulting in flanking sequences of 200-250 bp. on both sides of the deleted or modified part of the corresponding gene. The resulting fragments were cloned into pKNG101 [26] in E. coli BW19610 [28]. After sequence confirmation, the plasmids were transformed into E. coli SmlO λ pir, from where the plasmids were mobilized into the appropriate strain of Y. enterocolitica. Mutants carrying the inserted vector were propagated for several generations without selection pressure. Sucrose was then added to select clones that had lost the vector. Finally, mutants were detected by colony PCR. Specific mutators (pSi_408, pSi_419) are listed in Table. 3.

Construction of plasmids.

Plasmid pBad_Si2 or pBad_Si1 (FIG. 9) was used to clone N-terminal 138 YopE amino acid fusion proteins (SEQ ID NO: 2). pBad_Si2 was constructed by cloning the SycE-YopE ₁ fragment. ₁₃₈ containing the endogenous YopE and SycE promoter from purified pYV40 to the KpuI/HindIII site of pBad-MycHisA (Invitrogen). Additional modifications included the removal of the NcoI/BglII fragment from pBad-MycHisA by hydrolysis, treatment with a Klenow fragment and re-ligation. A bidirectional transcription terminator (BBa_B1006; iGEM fund) was cloned into the KpnI site and treated with a Klenow fragment (pBad_Si2) or a BglII site (pBad_Si1). Further along the 3'-end

- 32 040558

YopE _1-138 added the following cleavage sites: Xbal-XhoI-BstBI-(Hindll) (FIG. 9B). pBad_Si1 was identical to pBad_Si2 but encoded EGFP amplified from pEGFP-C1 (Clontech) at the NcoI/BglII site under the control of an arabinose inducible promoter. Plasmids pSi_266, pSi_267, pSi_268 and pSi_269 containing the corresponding endogenous promoter and a SteA _1-20 fragment (pSi_266), a full-length SteA sequence (pSi_267), a SopE _1-81 fragment (pSi_268), or a SopE _1-105 fragment (pSi_269) were amplified from S. enterica SL1344 genomic DNA and cloned into the NcoI/KpnI site of pBadMycHisA (Invitrogen).

Full-length genes or their fragments were amplified using the specific primers listed in Table 1 below. 1 and cloned as fusions with YopE _1-138 into plasmid pBad_Si2 or in the case of z-BIM (SEQ ID NO: 21) into pBad_Si1 (see Table 2 below). For hybrids with SteA or SopE, synthetic DNA constructs were digested with KpnI/HindII and cloned into pSi_266, pSi_267, pSi_268 or pSi_269, respectively. In the case of bacterial species genes, purified genomic DNA (S. flexneri M90T, Salmonella enterica subsp. enterica serovar Typhimurium SL1344, Bartonella henselae ATCC 49882) was used as a template. For human genes, the universal cDNA library (Clontech) was used unless otherwise noted (FIGS. 14A-14N), zebrafish genes were amplified from the cDNA library (donated by M. Affolter). The ligated fragments were cloned into E. coli Top10. The sequenced plasmids were introduced by electroporation into the desired Y. enterocolitica or S. enterica strain under standard E. coli electroporation conditions.

Table 1 Primer No. Si_:sequence

285: CATACCATGGGAGTGAGCAAGGGCGAG

286: GGAAGATCTttACTTGTACAGCTCGTCCAT

287: CGGGGTACCTCAACTAAATGACCGTGGTG

288: GTTAAAGCTTttcgaatctagactcgagCGTGGCGAACTGGTC

292: CAGTctcgagCAAAATTSTAAAAAAAATASTATTSSAC

293: cagtTTCGAATTAATTTGTATTGCTTTGACGG

296: CAGTctcgagACTAACATAACACTATCCACCCAG

297: GTTAAAGCTTTCAGGAGGCATTCTGAAG

299: CAGTctcgagCAGGCCATCAAGTGTGTG

00: cagtTTCGAATCATTTTCTCTTCCTCTTCTTC A

301: CAGTctcgagGCTGCCATCCGGAA

02: cagtTTCGAATCACAAGACAAGGCACCC

06: GTT AAAGCTTGGAGGC ATTCTGAAGatacttatt

07: CAGTctcgagCAAATACAGAGCTTCTATCACTCAG

308: GTTAAAGCTTTCAAGATGTGATTAATGAAGAAATG

317: cagtTTCGAACCCATAAAAAAGCCCTGTC

318: GTTAAAGCTTCTACTCTATCATCAAACGATAAAATGg

- 33 040558

324: CAGTctcgagTTCACTCAAGAAACGCAAA

339: cagtTTCGAATTTTCTCTTCCTCTTCTTCAcg

341: cgtaTCTAGAAAAATGATGAAAATGGAGACTG

342: GTTAAAGCTTttaGCTGGAGACGGTGAC

346: CAGTctcgagTTCCAGATCCCAGAGTTTG

347: GTTAAAGCTTTCACTGGGAGGGGG

351: CAGTctcgagctcgagTTATCTACTCATAGAAACTACTTTTGCAG

52: cgcGGATCCtcagtgtctctgcggcatta

353: CATTTATTCCTCTAGTTAGTCAcagcaactgctgctcctttc

54: gaaaggagcagcagttgctgTGACTAACTAGGAGGAATAAATG

355: cgattcacggattgctttctC ATT ATTCCCTCCAGGT ACTA

5 6: T AGT AC CTGGAGGG A AT A AT Gagaaagcaatccgtgaatcg

5 7: cgtaTCT AGAcggctttaagtgcgacattc

364: cgtaTCTAGACTAAAGTATGAGGAGAGAAAATTGAA

365: GTTAAAGCTTTCAGCTTGCCGTCGT

367: CGTAtctagaGACCCGTTCCTGGTGC

369: cgtaTCTAGAccccccaagaagaagc

373: GTTAAAGCTTGCTGGAGACGGTGACC

386: CGTAtctagaTCAGGACGCTTCGGAGGTAG

87: CGT AtctagaATGGACTGTGAGGTC AAC AA

389: CGTAtctagaGGCAACCGCAGCA

391: GTTAAAGCTTTCAGTCCATCCCATTTCTg

403: CGTAtctagatctggaatatccctggaca

406: GTTAAAGCTTgtctgtctcaatgccacagt

410: CAGTctcgagATGTCCGGGGTGGTg

413: cagtTTCGAATC ACTGC AGC ATGATGTC

417: CAGTctcgagAGTGGTGTTGATGATGACATG

420: cagtTTCGAATTAGTGATAAAAATAGAGTTCTTTTGTGAG

423: C AGTctcgagATGCACATAACTAATTTGGGATT

424: cagtTTCGAATTATACAAATGACGAATACCCTTT

425: GTTAAAGCTTttacaccttgcgcttcttcttgggcggGCTGGAGACGGTGAC

428: CGT AtctagaATGGACTTC AAC AGGAACTTT

429: CGTAtctagaGGACATAGTCCACCAGCG

- 34 040558

430: GTTAAAGCTTTCAGTTGGATCCGAAAAAC

433: CGTAtctagaGAATTAAAAAAAACACTCATCCCA

434: CGTAtctagaCCAAAGGCAAAAGCAAAAA

435: GTTAAAGCTTTTAGCTAGCCATGGCAAGC

436: CGTAtctagaATGCCCCGCCCC

437: GTTAAAGCTTCTACCCACCGTACTCGTCAAT

8: CGT AtctagaATGTCTGAC ACGTCC AGAGAG

9: GTTAAAGCTTTCATCTTCTTTCGCAGGAAAAAAG

445: cgcGGATCCttatgggttctcacagcaaaa

446: CATTTATTCCTAGTTAGTCaaggcaacagccaatcaagag

447: ctcttgattggctgttgcctTGACTAACTAGGAGGAATAAATG

448: ttgattgcagtgacatggtgCATTATTCCCTCCAGGTACTA

449: TAGTACCTGGAGGGAATAATGcaccatgtcactgcaatcaa

450: cgtaTCTAGAtagccgcagatgttggtatg

451: CGTAtctagaGATCAAGTCCAACTGGTGG

463: CAGTctcgaggaaagcttgtttaaggggc

464: cagtTTCGAAttagcgacggcgacg

476: GTTAAAGCTTttACTTGTACAGCTCGTCCAT

477: CGTAtctagaGTGAGCAAGGGCGAG

478: CAGTctcgagATGGAAGATTATACCAAAAATAGAGAAA

479: GTTAAAGCTTCTACATCTTCTTAATCTGATTGTCCa

482: CGTAtctagaATGGCGCTGCAGCt

483: GTTAAAGCTTTCAGTCATTGACAGGAATTTTg

486: CGTAtctagaATGGAGCCGGCGGCG

487: GTTAAAGCTTTCAATCGGGGATGTCTg

492: CGT AtctagaATGCGCGAGGAGAAC AAGGG

493: GTTAAAGCTTTCAGTCCCCTGTGGCTGTGc

494: CGTAtctagaATGGCCGAGCCTTG

495: GTTAAAGCTTttaTTGAAGATTTGTGGCTCC

504:CGTAtctagaGAAAATCTGTATTTTTCAAAGTGAAAATCTGTATTTTTCAAAGTATG CCCCGCCCC

505: GTTAAAGCTTCCCACCGTACTCGTCAATtc

- 35 040558

508:CGTAtctagaGAAAATCTGTATTTTTCAAAGTGAAAATCTGTATTTTTCAAAGTATG

GCCGAGCCTTG

509: GTTAAAGCTTTTGAAGATTTGTGGCTCCc

511 :CGTAtctagaGAAAATCTGT ATTTTC AAAGTGAAAATCTGT ATTTTC AAAGTGTG AGCAAGGGCGAG

512: CGTAtctagaGAAAATCTGTATTTTC AAAGTGAAAATCTGT ATTTTC AAAGTCCG CCGAAAAAAAAACGTAAAGTTGTGAGCAAGGGCGAG

513 :GTTAAAGCTTTttAAACTTTACGTTTTTTTTTCGGCGGCTTGTACAGCTCGTCCAT

515 :CGT AtctagaGAAAATCTGT ATTTTC AAAGTGAAAATCTGT ATTTTC AAAGTGAT TATAAAGATGATGATGATAAAATGGCCGAGCCTTG

5 8: CGTATCTAGAATGACCAGTTTTGAAGATGC

559:GTTAAAGCTTTCATGACTCATTTTCATCCAT

561:CGTATCTAGAATGAGTCTCTTAAACTGTGAGAACAG

562:GTTAAAGCTTCTACACCCCCGCATCA

580: catgccatggATTTATGGTCATAGATATGACCTC

585: CAGTctcgagATGCAGATCTTCGTCAAGAC

586: GTTAAAGCTTgctagcttcgaaACCACCACGTAGACGTAAGAC

588: cagtTTCGAAGATTATAAAGATGATGATGATAAAATGGCCGAGCCTTG

612: CGGGGTACCatgaggtagcttatttcctgataaag

613: CGGGGT ACCataattgtccaaaatagttatggtagc

614: catgccatggCGGCAAGGCTCCTC

615: cggggtaccTTTATTTGTCAACACTGCCC

616: cggggtaccTGCGGGGTCTTTTACTCG

677:TTACTATTCGAAGAAATTATTCATAATATTGCCCGCCATCTGGCCCAAATTGG

TGATGAAATGGATCATTAAGCTTGGAGTA

678:TACTCCAAGCTTAATGATCCATTTCATCACCAATTTGGGCCAGATGGCGGGCA

ATATTATGAATAATTTCTTCGAATAGTAA

682:TTACTACTCGAGAAAAAACTGAGCGAATGTCTGCGCCGCATTGGTGATGAAC

TGGATAGCTAAGCTTGGAGTA

683:TACTCCAAGCTTAGCTATCCAGTTCATCACCAATGCGGCGCAGACATTCGCTC

AGTTTTTTCTCGAGTAGTAA

725: TTACTATTCGAAGAAATTTATTCATAATATTGCC

726: T ACTCC AAGCTT ACGGTTGAAT ATT ATGATCC ATTTC ATC ACC AATTTGG

727: TTACTATTCGAAGCCGGTGGTGCCGAAGAAATTATTCATAATATTGCCC

728: T ACTCC AAGCTTAATGATCC ATTTC ATC A

733:TTACTACTCGAGGGTGCCATCGATGCCGAAGAAATTATTCATAATATTGCCCG

734:TACTCCTTTCGAAGGCACCATGATCCATTTCATCACCAATTTGG

735:TACTCCTTTCGAATTAATGATCCATTTCATCACCAATTTG

736:TTACTACTCGAGGGTGCCATCGATGCCAAAAAACTGAGCGAATGTCTGCG

737: TACTCCTTTCGAAGGCACCGCTATCCAGTTCATCACCAATG

738:TACTCCTTCGAATTAGCTATCCAGTTCATCACCAATG

- 36 040558

cloned fusion proteins

table 2

Protein for delivery with T3SS Seq. ID. no. squirrel Plasmid framework Name of the resulting plasmid Primer Y. Si_Nr.: Seq. ID no. primer YopEl-138-MycHis 3 pBadMycHisA (Invitrogen) pBad_Si_l 285/286 (EGFP), 287/288 (sycEYopEl138) 44/45 and 46/47 YopEl-138-MycHis 3 pBadMycHisA (Invitrogen) pBad_Si_2 287/288 (sycEYopEl138) 46/47 YopEl-138-IpgBl 4 pBad_Si_2 pSi_16 292/293 48/49 YopEl-138-SopE 5 pBad_Si_2 pSi_20 296/297 50/51 YopEl-138-Racl Q61L 26 pBad_Si_2 pSi_22 299/300 52/53 YopEl-138-RhoA Q61E 27 pBad_Si_2 pSi_24 301/302 54/55 YopEl-138-SopEMycHis 135 pBad_Si_2 pSi_28 296/306 50/56 YopEl-138-SopB 6 pBad_Si_2 pSi_30 307/308 57/58 YopEl-138-FADD 28 pBad_Si_2 pSi_37 367/386 76/79 YopEl-138-OspF 7 pBad_Si_2 pSi_38 317/318 59/60 YopEl-138-BepG 715-end 136 pBad_Si_2 pSi_43 324/351 61/67 YopEl-138-Racl Q61L-MycHis 137 pBad_Si_2 pSi_51 299/339 52/62 YopEl-138-Slmbl- VhH4 32 pBad_Si_2 pSi_53 341/342 63/64 YopEl-138-Bad 29 pBad_Si_2 pSi_57 346/347 65/66

- 37 040558

YopEl-138-SptP 8 pBad_Si_2 pSi_64 364/365 74/75 YopEl-138-NLS- Slmbl-VhH4 33 pBad_Si_2 pSi_70 369/342 77/64 YopEl-138-Bid 24 pBad_Si_2 pSi_85 387/391 80/82 YopEl-138-t-Bid 25 pBad_Si_2 pSi_87 389/391 81/82 YopEl-138-caspase 3pl7 22 pBad_Si_2 pSi_97 403/406 83/84 YopEl-138-GPCR GNA12 thirty pBad_Si_2 pSi_103 410/413 85/86 YopEl-138-caspase 3pl0/12 23 pBad_Si_2 pSi_106 417/420 87/88 YopEl-138-IpgD 9 pBad_Si_2 pSi_lll 423/424 89/90 YopEl-138-Slmbl- VhH4-NLS 34 pBad_Si_2 pSi_112 341/425 63/91 YopEl-138-z-Bid 19 pBad_Si_2 pSi_116 428/430 92/94 YopEl-138-z-t-Bid 20 pBad_Si_2 pSi_117 429/430 93/94 YopEl-138-BepA E305 end eleven pBad_Si_2 pSi_118 433/435 95/97 YopEl-138-BepA 10 pBad_Si_2 pSi_119 434/435 96/97 YopEl-138-ETl 36 pBad_Si_2 pSi_120 436/437 98/99 YopEl-138-z-BIM 21 pbad_Si_l pSi_121 438/439 100/101 YopEl-138-VhH4 nanobody recognizing EGFP 31 pBad_Si_2 pSi_124 451/373 108/78 YopEl-138 protease TEV S219V 42 pBad_Si_2 pSi_132 463/464 109/110 YopEl-138-EGFP 37 pBad_Si_2 pSi_140 477/476 112/111 YopEl-138-Cdkl 14 pBad_Si_2 pSi_143 478/479 113/114 YopEl-138-Mad2 15 pBad_Si_2 pSi_145 482/483 115/116 YopEl-138-Ink4A 16 pBad_Si_2 pSi_147 486/487 117/118 YopEl-138-Ink4B 17 pBad_Si_2 pSi_150 492/493 119/120 YopEl-138-Ink4C 18 pBad_Si_2 pSi_151 494/495 121/122 YopEl-138-TIFA 13 pBad_Si_2 pSi_153 558/559 131/132 YopEl-138-2x website TEV-ET1 41 pBad_Si_2 pSi_156 504/505 123/124 YopEl-138-2x website TEV-EGFP-NLS 39 pBad_Si_2 pSi_159 511/513 127/129 YopEl-138-2x website TEV-NLS-EGFP 38 pBad_Si_2 pSi_160 512/476 128/111 YopEl-138-2x website TEV-INK4C 40 pBad_Si_2 pSi_161 508/509 125/126 YopEl-138-2x website TEV - Flag - INK4C 43 pBad_Si_2 pSi_164 515/509 130/126 YopEl-138-Traf6 mice 12 pBad_Si_2 pSi_166 561/562 133/134

- 38 040558

YopEl-138 mouse BH3 tBid fragment after codon optimization for Y. enterocolitica 138 pBad_Si_2 pSi_318 677/678 148/149 YopEl-138 mouse VIS VAC fragment after codon optimization for Y. enterocolitica 139 pBad_Si_2 pSi_322 682/683 150/151 SteAl-20 140 pBadMycHisA (Invitrogen) pSi_266 580/612 152/153 SteA 141 pBadMycHisA (Invitrogen) pSi_267 580/613 152/154 SopEl-81 142 pBadMycHisA (Invitrogen) pSi_268 614/615 155/156 SopEl-105 143 pBadMycHisA (Invitrogen) pSi_269 614/616 155/157 SteAl-20-tBid mice after codon optimization for S. enterica 144 pSi_266 pSi_270 synthetic construct / SteA-tBid mice after codon optimization for S. enterica 145 pSi_267 pSi_271 synthetic construct / SopEl-81-tBid mouse after codon optimization for S. enterica 146 pSi_268 pSi_272 synthetic construct / SopEl-105-tBid mouse after codon optimization for S. enterica 147 pSi_269 pSi_273 synthetic construct / YopEl-138-Ink4A 84-103 after codon optimization for Y. enterocolitica 158 pBad_Si_2 pSi_362 745/746 172/173

- 39 040558

YopEl-138- P107/RBL1 657-662 after codon optimization for Y. enterocolitica [AAA02489.1] 159 pBad_Si_2 pSi_363 747/748 174/175 ΥορΕ1-138-ρ21 141- 160 after codon optimization for Y. enterocolitica [AAN13967.1] 160 pBad_Si_2 pSi_364 749/750 176/177 ΥορΕ1-138-ρ21 145- 160 after codon optimization for Y. enterocolitica [AAN13967.1] 161 pBad_Si_2 pSi_366 753/754 178/179 YopEl-138-p21 17- 33 after codon optimization for Y. enterocolitica [AAN13967.1] 162 pBad_Si_2 pSi_367 755/756 180/181 YopEl-138-cyclin D2 139-147 after codon optimization for Y. enterocolitica (CAA48493.1) 163 pBad_Si_2 pSi_368 757/758 182/183 SteA-Ink4a-MycHis 164 pSi_267 pSi_333 703/704 184/185 SopEl-105-Ink4aMycHis 165 pSi_269 pSi_334 703/704 184/185 SteA-Ink4c-MycHis 166 pSi_267 pSi_335 PCR1: 705/706; PCR2: 707/708; PCR c overlapping: 705/708 186/187, 188/189 SopEl-105-Ink4c- mychis 167 pSi_269 pSi_336 PCR1: 705/706; PCR2: 707/708; PCR with blocking 186/187, 188/189

- 40 040558

anemia: 705/708 SteA-Mad2-MycHis 168 pSi_267 pSi_337 709/710 190/191 SopEl-105-Mad2MycHis 169 pSi_269 pSi_338 709/710 190/191 SteA-Cdkl-MycHis 170 pSi_267 pSi_339 711/712 192/193 SopEl-105-Cdkl- mychis 171 pSi_269 pSi_340 711/712 192/193 YopEl-138-tBid mouse after codon optimization for Y. enterocolitica 194 pBad_Si_2 pSi_315 synthetic construct / YopEl-138ubiquitin 195 pBad_Si_2 pSi_236 585/586 197/198 YopEl-138ubiquitin-FlagINK4C-MycHis 196 pSi_236 pSi_237_II 588/509 199/126 YopEl-138 (mouse BH3 tBid fragment after codon optimization for Y. enterocolitica), ready for insertion of additional domains 200 pBad_Si_2 pSi_357 733/735 204/205 YopEl-138 (fragment of VIS VAC mouse after codon optimization for Y. enterocolitica), ready for insertion of additional domains 201 pBad_Si_2 pSi_358 736/738 206/207 YopEl-138 (fragment of VIZ tBid mouse after codon optimization for Y. enterocolitica)2 202 pSi_357 pSi_371 733/734 204/208 ΥορΕ1-(138- Fragment of VIZ tBid mouse after optimization 203 pSi_358 pSi_373 733/734 204/208

- 41 040558

codons for Y. enterocolitica - Fragment of VIS VAC mouse after codon optimization for Y. enterocolitica ΥθρΕ1-138 enlarged fragment of mouse tBid VIS after codon optimization 209 pBad_Si_2 pSi_353 725/726 212/213 YopEi-138-10 AKlinker - mouse VIZ tBid fragment after codon optimization for Y. enterocolitica 210 pBad_Si_2 pSi_354 727/728 214/215 ΥορΕ1-(138fragment VIZ Vah mouse after codon optimization for Y. enterocolitica - Fragment of VIZ tBid mouse after codon optimization for Y. enterocolitica 211 pSi_357 pSi_374 736/737 206/216

Table 3

Mutators for genetic modification

Construct T mutator To insert into: Plasmid framework Name of the resulting plasmid Primer s, Si_Nr.: Primers, Seq.Id No. used with outgoing strain m YopEl-138tBID BH3 pYV pKNGlOl pSi_408 Synthetic gene / / YopEi-138(tBID BH3) ₂ pYV pKNGlOl pSi_419 Synthetic gene / Mutated strain pSi_408

Yop secretion.

Regulon Yop was induced by shifting the cultivation temperature by 37°C in BHI-Ox (conditions that allow secretion) [31]. A carbon source (glucose, 4 mg/ml) was added.

Fractions of total cells and the supernatant were separated by centrifugation at 20800 g for 10 min at 4°C. Cellular sediment was taken as a fraction of total cells. The proteins in the supernatant were precipitated with 10% w/v. trichloroacetic acid for 1 h at 4°C. After centrifugation (20800 g for 15 min) and removal of the supernatant, the precipitate obtained was washed in ice-cold acetone overnight. The samples were re-centrifuged, the supernatant was discarded, and the pellet was air-dried and resuspended in 1x SDS loading dye.

Secreted proteins were analyzed by SDS-PAGE; in each case, proteins secreted by 3x10 ⁸ bacteria were loaded onto the lane. Detection of specific secreted proteins by immunoblotting was performed using 12.5% SDS-PAGE. For protein detection in total cells, 2×10 ⁸ bacteria were loaded per lane unless otherwise noted, proteins were resolved in 12.5% SDS-PAGE, and then immunoblot detection was performed.

- 42 040558

Immunoblotting was performed using rat monoclonal antibodies against YopE (MIPA193-13A9; 1:1000 [32]). Antiserum was pre-absorbed twice against Y. enterocolitica AHOPEMT asd to reduce background staining. Detection was performed using horseradish peroxidase conjugated anti-rat secondary antibodies (1:5000; Southern biotech) prior to staining development with ECL chemiluminescent substrate (LumiGlo, KPM).

Cell cultures and infections.

HeLa Cc12, swiss 3T3, 4T1, B16F10, and D2A1 fibroblasts were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FCS and 2 mM L-glutamine (cDMEM). HUVEC was isolated and cultivated as described in [33]. Jurkat and 4T1 cells were cultured in RPMI1640 supplemented with 10% FCS and 2 mM L-glutamine. Y. enterocolitica was grown in BHI supplemented overnight at RT, diluted with fresh BHI to an OD ₆₀₀ of 0.2 and grown for 2 h at RT, then the temperature was changed to 37°C using a water bath shaker on the next 30 minutes or 1 hour in case of EGFP delivery. Finally, bacteria were harvested by centrifugation (6000 rcf, 30 s) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. S. enterica was grown in LB supplemented overnight at 37°C, diluted 1:40 with fresh LB medium and grown for 2.5 h at 37°C (SpI T3SS induction conditions) or overnight culture further incubated at 37°C (conditions for the induction of SpiII T3SS). Finally, bacteria were harvested by centrifugation (6000 rcf, 30 s) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. Cells seeded in 96-well (for immunofluorescent assay) or 6-well (for Western blot) plates were infected at the indicated MOI in DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. After adding the bacteria, the plates were centrifuged for 1 min at 1750 rpm and placed at 37° C. for the indicated time. Bacteria outside the cells were killed with gentamicin (100 mg/ml) if indicated. In the case of immunofluorescent analysis, infection analysis was stopped by adding 4% PFA for fixation. For Western blotting, cells were washed twice with ice-cold PBS and Phospho-safe buffer (Novagen) was added to lyse the cells. After incubation on ice, the cells were centrifuged (16000 rcf, 25 min, 4°C). The supernatant was collected and analyzed for total protein by Bradford BCA analysis (Pierce) prior to SDS-PAGE and Western blotting using anti-Phospho-Akt antibodies (Ser473 and T308 from Cell Signaling), anti-actin antibody (Millipore) , antibodies against Bid (Cell Signaling), antibodies against Myc (Santa Cruz), antibodies against p38 (Cell Signaling), antibodies against phospho-p38 (Thr180/Tyr182; Cell Signaling), antibodies against p17 caspase 3 (Cell Signaling) and antibodies vs. Ink4C (Cell Signaling).

Western blotting of proteins transposed with T3SS from infected cells.

HeLa cells in 6-well plates were infected with an MOI of 100 as described above. In the case of co-infection with a strain of Y. enterocolitica translocating the TEV protease, the OD ₆₀₀ for the strains was set and the two bacterial suspensions were mixed in a 1:1 ratio in vitro (unless otherwise indicated) before being added to the cells. At the end of the infection, the cells were washed twice with ice-cold PBS and collected by scraping into a small volume of ice-cold PBS. After centrifugation (16000 rcf, 5 min, 4° C.), the pellet was dissolved in 0.002% digitonin supplemented with a mixture of protease inhibitors (Roche complete, Roche). Dissolved pellets were incubated on ice for 5 min and then centrifuged (16000 rcf, 25 min, 4°C). The supernatant was collected and analyzed for total protein by Bradford BCA analysis (Pierce) prior to SDS-PAGE and Western blotting using anti-Myc (Santa Cruz, 9E11) or anti-Ink4C (Cell Signaling) antibodies.

Immunofluorescent analysis.

Cells seeded in 96-well plates (Corning) were infected as described above and washed three times with PBS after fixation with 4% PFA. Cells were then blocked with 5% goat serum in PBS 0.3% Triton X-100 for 1 h at RT. The primary antibody (against Myc, Santa Cruz, 1:100) was diluted with PBS with 1% BSA and 0.3% Triton X-100 and the cells were incubated overnight at 4°C. Cells were washed four times with PBS and then a secondary antibody (AF 488 anti-mouse, Life Technologies, 1:250) diluted in PBS with 1% BSA and 0.3% Triton X-100 was added. If necessary, Hoechst stain for DNA (Life Technologies, 1:2500) and/or actin (Dy647-phalloidin, DyeOmics) was included. In some cases, only DNA and/or actin stain was used immediately after washing with PFA. Cells were incubated for 1 h at RT, washed three times with PBS and analyzed by automated image analysis as described below.

Automated microscopy and image analysis.

Images were automatically acquired on an ImageXpress Micro (Molecular devices, Sunnyvale, USA). Anti-Myc antibody staining intensity was quantified using MetaXpress (Molecular devices, Sunnyvale, USA). Areas with cells, excluding areas of nuclei and areas containing bacteria, were selected manually (circles in the image 40 pixels in size) and the average intensity was recorded.

Stimulation of TNFa and Western blotting of phospho-p38.

- 43 040558

HeLa cells seeded in 6-well plates were infected at an MOI of 100 as described above. Gentamicin was added 30 min after infection, and 45 min after infection with TNFa (10 ng/ml). 1 h 15 min after infection, the cells were washed twice with ice-cold PBS and Phospho-safe buffer (Novagen) was added to lyse the cells. After incubation on ice, the cells were centrifuged (16,000 rcf, 25 min, 4°C). The supernatant was collected and analyzed for total protein by Bradford BCA analysis (Pierce) prior to SDS-PAGE and Western blotting using anti-phospho-p38, anti-total p38 (Cell Signaling) and anti-actin (Millipore).

Determination of cAMP levels in infected HeLa cells.

HeLa cells seeded in 96-well plates were infected as described above. 30 min before infection, cDMEM was replaced with DMEM supplemented with 10 mM HEPES, 2 mM L-glutamine, and 100 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma Aldrich). 60 minutes after infection, gentamicin was added and the cells were further incubated at 37° C. for another 90 minutes. The determination of cAMP was performed using a competitive ELISA according to the manufacturer's instructions (Amersham, cAMP Biotrak, RPN225). As a positive control, the indicated amount of cholera toxin (C8052, Sigma Aldrich) was added to cells in DMEM supplemented with 10 mM HEPES, 2 mM L-glutamine, and 100 μM IBMX for 1 h.

Preparation of samples for phosphoproteomic analysis.

For each condition, two 6-well plates of HeLa CCL-2 cells were grown to confluence. Cells were infected for 30 min as described above. At the indicated time points, the plates were placed on ice and washed twice with ice-cold PBS. Samples were then collected in a urea solution [8 M urea (AppliChem), 0.1 M ammonium bicarbonate (Sigma), 0.1% RapiGest (Waters), 1x PhosSTOP (Roche)]. Samples were vortexed for a short period of time, sonicated at 4°C (Hielscher), shaken for 5 min on a thermomixer (Eppendorf) and centrifuged for 20 min at 4°C and 16,000 g. The supernatant was collected and stored at -80°C for further processing. The BCA Protein Assay (Pierce) was used to change the protein concentration.

Enrichment of phosphopeptides.

Disulfide bonds were reduced with tris(2-carboxyethyl)phosphine at a final concentration of 10 mM at 37°C for 1 h. Free thiols were alkylated with 20 mM iodoacetamide (Sigma) at room temperature for 30 min in the dark. Excess iodoacetamide was inactivated with N-acetylcysteine at a final concentration of 25 mM for 10 min at room temperature. Endopeptidase Lys-C (Wako) was added at a final enzyme/protein ratio of 1:200 (w/w) and incubated for 4 h at 37°C. The solution was serially diluted with 0.1 M ammonium bicarbothane (Sigma) to a final concentration of less than 2 M urea and digested overnight at 37° C. with modified sequencing trypsin (Promega) at a protein/enzyme ratio of 50:1. The peptides were desalted on a C18 Sep-Pak cartridge (Waters) and dried in vacuo. Phosphopeptides were isolated from 2 mg of the total mass of peptides using TiO ₂ as described previously [34]. Briefly dried peptides were dissolved in a solution of 80% acetonitrile (ACN) - 2.5% trifluoroacetic acid (TFA) saturated with phthalic acid. The peptides were added to the same amount of equilibrated TiCh (granule size 5 μm, GL Sciences) in a blocked Mobicol centrifuge column (MoBiTec) incubated for 30 min while rotating around the short axis. The column was washed twice with saturated phthalic acid, twice with 80% ACN and 0.1% TFA, and finally twice with 0.1% TFA. Peptides were eluted with 0.3 M NH4OH solution. The eluates were adjusted to pH less than 2.5 with 5% TFA and 2 M HCl. Phosphopeptides were repeatedly desalted on C18 microcentrifuge cartridges (Harvard Apparatus).

LC-MS/MS analysis.

Chromatographic separation of peptides was performed using an EASY nano-LC system (Thermo Fisher Scientific) equipped with a heated RP-HPLC column (75 µm x 45 cm) filled in the laboratory with 1.9 µm C18 resin (Reprosil-AQ Pur, Dr. Maisch) . 1 μg aliquots of a sample of total phosphopeptides were analyzed on an LC-MS/MS cycle using a linear gradient from 98% solvent A (0.15% formic acid) and 2% solvent B (98% cetonitrile, 2% water, 0.15% formic acid) to 30% solvent B for 120 min at a flow rate of 200 nl/min. Mass spectrometric analysis was performed on an LTQ-Orbitrap dual flow mass spectrometer equipped with an ion nanosprayer (manufactured by Thermo Fisher Scientific). Each MS1 scan (recorded on Orbitrap) was followed by collision-induced dissociation (CID, recorded on LTQ) of the 20 most common precursor ions with dynamic exclusion for 30 s. For the analysis of phosphopeptides, the 10 most common precursor ions were subjected to CID with multi-step activation enabled. The total cycle time was approximately 2 s. For MS1, 106 ions were accumulated in the Orbitrap cell for a maximum time of 300 ms and scanned at 60,000 FWHM (at 400 m/z). The MS2 scan was recorded in normal scan mode with a target setting of ¹⁰⁴ ions and an acquisition time of 25 ms. Ions with a single charge and ions with an unassigned state of charge were excluded from the activation of MS2 events.

The normalized target collision energy was 32%, and one microscan was recorded for each spectrum.

Unlabeled quantitation and database search.

The resulting raw files were imported into the Progenesis software tool (Nonlinear Dynamics, version 4.0) for unlabeled quantification using default parameters. MS2 spectra were exported directly from Progenesis in mgf format and searched using the MASCOT algorithm (Matrix Science, version 2.4) using a mock database [35] containing regular and reversed sequences of SwissProt predicted records for Homo sapiens (www.ebi.ac.uk , release date 05/16/2012) and common contaminants (41250 sequences in total) obtained using the SequenceReverser tool from the MaxQuant software (version 1.0.13.13). To identify proteins derived from Y. enterocolitica, samples not enriched in phosphopeptides were searched using the aforementioned database including SwissProt predictive records for Y. enterocolitica (www.ebi.ac.uk, release date 08/15/2013). The margin of error for the precursor ion was set at 10 ppm, and the margin of error for the ion fragment was 0.6 Da. The search criteria were as follows: full trypsin specificity was required (cleavage after lysine or arginine residues if not followed by proline), 2 cleavages were allowed to be skipped, urea methylation (C) was given as a fixed modification, and phosphorylation (S, T, Y) or oxidation (M) - as a variable modification for samples enriched or not enriched with TiO ₂ respectively. Finally, the database search results were exported as an xml file and re-imported into the Progenesis software for MS1 characterization. For quantitative determination of phosphopeptides, a csv file was exported containing the relative number of peaks of all detected components, and for unenriched samples, a csv file was created containing the measurement results for all proteins based on the total intensity of the components of all detected peptides for a given protein. It is important to note that the Progenesis software was configured to group similar sets of peptides with each other and that only non-conflicting peptides with specific single protein sequences in the database were used for protein quantification. Both files were then processed using a proprietary SafeQuant v1.0 R script (unpublished data available at https://github.com/eahrne/SafeQuant/). Briefly, the software was tuned to an identification level at a false positive rate of 1% (based on the number of matches in a mock protein sequence database) and normalized the detected relative number of MS1 peaks (isolated ion chromatogram, XIC) across all samples, i.e. the sum XIC of all confidently identified peptide components was equalized for all cycles of LC-MS. All quantified phosphopeptides/proteins were then assigned relative abundance values at each time point based on the median XIC at that time point. The statistical significance of each ratio was determined by its q value (adjusted p values for the false positive rate) obtained by calculating the p values for the modified t-test [36] and adjusting for multiple tests [37]. The MASCOT algorithm automatically assigned the position of phosphorylated residues (score >10). Annotated spectra with raw MS files and search parameters used were deposited with the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the PRIDE partner archive [38].

Sequence alignment was performed using the ClustalW2-based EMBL-EBI multiple sequence alignment web tool at http://www.ebi.ac.uk/Tools/msa/clustalw2/.

Dose escalation study.

All animal experiments were approved (license 1908; Kantonales Veterinoramt BaselStadt) and performed in accordance with local guidelines (Tierschutz-Verordnung, Basel-Stadt) and the Swiss animal welfare law (Tierschutz-Gesetz). 6 week old C57B1/6 and BALB/c mice were ordered from Janvier Labs. After one week of acclimatization, mice were infected with Y. enterocolitica MRS40 ANOREMT or S. typhimurium AaroA by tail vein injection. Throughout the experiment, mice were assessed for behavior and appearance, as well as measured surface temperature and body weight. The inoculum administered to the mice i.v. was confirmed by seeding the dilutions. On the appropriate days after infection, mice were sacrificed by inhalation of CO ₂ . Immediately thereafter, a blood sample was taken from the heart by aspiration. The liver, spleen, lungs and tumor were removed and their mass was determined. The organs and tumor were homogenized. The CFU in each sample was determined by applying serial dilutions to LB-agar plates containing nalidixic acid (35 μg/ml).

Biodistribution in mouse B16-F10 and 4T1 tumor allografts.

All animal experiments were approved (license 1908; Kantonales Veterinoramt BaselStadt) and performed in accordance with local guidelines (Tierschutz-Verordnung, Basel-Stadt) and the Swiss Animal Welfare Act (Tierschutz-Gesetz). 6 week old C57B1/6 and BALB/c mice were ordered from Janvier Labs. After at least a week of acclimation, mice were anesthetized with isoflurane and 100 μl of B16-F10 or 4T1 cells (1x105-1x106 cells) were injected subcutaneously into the flank of C57B1/6 and BALB/c, respectively. Throughout the experiment, mice were assessed for behavior and appearance, as well as measured surface temperature and body weight.

After the development of tumors, mice were injected with a solution of 8 mg/ml desferal (10 ml/kg) via ip injection. The next day, mice were infected with Y. enterocolitica MRS40 or Y. enterocolitica MRS40 ANOREMT (2x105, 1x106 or 1x10 ⁷ bacteria) by tail vein injection. The inoculum administered to the mice iv was confirmed by seeding the dilutions. In some experiments, tumor progression was monitored by daily measurements of the length and width of the tumor with a digital caliper. Tumor volume was defined as 0.523 x length x width ² . On the appropriate days after infection, mice were sacrificed by inhalation of CO ₂ . Immediately thereafter, a blood sample was taken from the heart by aspiration. The liver, spleen, lungs and tumor were removed and their mass was determined. The organs and tumor were homogenized. The CFU in each sample was determined by applying serial dilutions to LB-agar plates containing nalidixic acid (35 μg/ml).

B. Results.

Protein delivery system based on the secretion of type 3 YopE fusion proteins.

Although the very N-terminus of the Y. enterocolitica YopE T3SS effector (SEQ ID NO: 1) contains a secretion signal important for the heterologous translocase protein [19], the chaperone-binding site (CBS) for its chaperone (SycE) is absent [39]. The authors chose the 138 N-terminal amino acids of YopE (SEQ ID NO: 2) to attach to the delivered proteins, as this has been shown to give the best results for translocation of other heterologous T3S substrates [21]. Since these 138 N-terminal amino acids of YopE contain CBS, the authors further decided to co-express SycE. Fragment SycE-YopE ₁ . ₁₃₈ cloned from a purified Y. enterocolitica pYV40 virulence plasmid contains the endogenous YopE promoter and its SycE chaperone (FIG. 9). Therefore, SycE and any YopE ₁ hydride proteins. ₁₃₈ were induced upon transition to high temperature - from growth at RT to 37°C. The cultivation time at 37°C affected the amount of fusion protein in bacteria. A polylinker (MCS) was added at the 3' end of YopE1_ ₁₃₈ (FIG. 9B), followed by Myc and 6xHis markers and a stop codon.

The background strain was carefully chosen. First, to limit the translocation of endogenous effectors, the authors used a strain of Y. enterocolitica with a deletion of all known effectors - YopH, O, P, E, M, and T (designated ANOREMT) [40]. In addition, the authors used, as needed, an auxotrophic mutant that cannot grow in the absence of exogenous meso-2,6-diaminopimelic acid [41]. This strain was characterized by a deletion of the aspartate-beta-semialdehyde dehydrogenase (Aasd) gene; the Swiss safety agency classified it as biosafety level 1 (amendment to А010088/2). In addition, the authors performed the deletion of the YadA and/or InvA adhesion proteins to expand the choice of background strains. Although the use of yadA or yadA/invA strains reduced the induction of background signaling pathways [42], it also affected the amount of delivered protein [43].

Investigation of delivery characteristics of YopE fusion protein to eukaryotic cells.

In an in vitro secretion assay (see FIG. 1A), protein secretion into the surrounding fluid was artificially induced. After protein precipitation with TCA, a Western blot with anti-YopE antibody was used to determine the amount of protein secreted. Although the wild-type strain secreted full-length YopE, the ANOREMT asd strains did not. In the presence of YopE1. ₁₃₈ -Myc-His (hereinafter referred to as YopE1_ ₁₃₈ -Myc; SEQ ID NO: 3) a small band of YopE was visually detected (FIG. 1B). Therefore, the YopE1_ ₁₃₈ fragment was well secreted under the conditions described herein. To analyze the homogeneity of protein translocation into eukaryotic cells, we infected HeLa cells with a strain encoding YopE1_ ₁₃₈ -Myc and stained the Myc marker with IF (FIGS. 2A and 2B). Although only bacteria were initially stained, cell outlines were visible 30 minutes after injection and became sharper as infection time increased (FIG. 2B). This trend was well reflected in the staining intensity of the Myc marker in HeLa cells (FIGS. 2A and 2B). YopE1_ ₁₃₈ -Myc could be found in any areas of the cells (Fig. 2A), except for the nuclei [44]. Notably, this approach allowed most but not all cells to be reached in a comparable manner. Since Y. enterocolitica is known to infect cells of various species [45], the authors monitored the delivery of YopE1_ ₁₃₈ -Myc to cells of various lines. Equally uniform IF staining with anti-Myc antibodies was observed in infected mouse fibroblasts, Jurkat cells and HUVECs (FIG. 11). Moreover, increasing or decreasing the MOI allowed modulation of the amount of protein delivered (FIG. 2C), although most cells were still affected. Using a low amount of bacteria did not result in a small number of cells with a large amount of delivered protein, but in the fact that most of the cells contained small amounts of delivered protein (Fig. 2C).

- 46 040558

Redirection of T3SS-delivered proteins to nuclei.

Since YopE itself is located in the cytoplasm (FIG. 2A), it is of particular interest to test whether the YopE _1-138 fragment interferes with the localization of nuclear fusion proteins. Therefore, the authors added NLS SV40 to the C-terminus (and N-terminus, obtaining similar results) YopE _1-138 -EGFP (SEQ ID NO: 39 and SEQ ID NO: 38, respectively). While YopE _1-138 -EGFP (SEQ ID NO: 37) resulted in weak staining of the cytoplasm, YopE _1-138 -EGFP-NLS produced a strong EGFP signal in the nuclei of infected HeLa cells (FIG. 3). This shows that the YopE fragment _1-138 is compatible using NLS. Although mCherry is already used in plant pathogens [46], it represents an example of successful delivery of a GFP-like protein by bacteria pathogenic to humans or animals and encoding T3SS. This confirms the high promise of SycE and YopE _1-138 dependent strategies for the delivery of many priority proteins.

Removal of the appendage of YopE _1-138 after translocation of the fusion protein into a eukaryotic cell.

While the YopE _1-138 fragment is highly beneficial for bacterial delivery, it can interfere with the function and/or localization of fusion proteins. Therefore, its removal after protein delivery would be optimal. Therefore, the authors introduced two TEV cleavage sites (ENLYFQS) [47-49] between YopE _1-138 and its fusion partner (ET1-Myc transcription regulator (SEQ ID NO: 36 and 41) [50] and human INK4C (SEQ ID NO : 40 and SEQ ID NO: 43)). To maintain the advantages of the presented method, the authors additionally attached the TEV protease (variant S219V; [51]) to YopE _1-138 (SEQ ID NO: 42) in another strain of Y. enterocolitica. HeLa cells were simultaneously infected with both strains. To analyze only the translocated protein fraction, infected HeLa cells were lysed 2 h after infection (Fig. 4) with digitonin, which is known to not lyse bacteria ([52]; see control in Fig. 11). Western blotting revealed the presence of YopE _1-138 -2x TEV-ET1-Myc cleavage site or YopE _1-138 -2x TEV-Flag-INK4C-Myc cleavage site only when the cells were infected with the respective strain (FIGS. 4A and 4C). Following overnight digestion of this cell lysate with purified TEV protease, a band shift was observed (FIGS. 4A and 4C). This band corresponded to ET1-Myc (FIG. 4C) or Flag-INK4C (FIG. 4A) with N-terminal TEV cleavage site residues, most likely only one serine residue. When cells were co-infected with the TEV protease-delivering strain, similar cleaved fragments of ET1-Myc or Flag-INK4C were seen, indicating functionality of the T3SS-delivered TEV protease and that single cells were infected with both bacterial strains (FIGS. 4A and 4C) . Although cleavage was not complete, most of the translocated protein was cleaved as early as 2 hours post-infection, and even overnight digestion with purified TEV protease did not give better cleavage rates (FIG. 4B). TEV protease-dependent cleavage has been reported to require optimization depending on the fusion protein [53, 54]. Thus, TEV protease-dependent deletion of the YopE _1-138 appendage after translocation provides for the first time the delivery of a nearly native heterologous protein via the T3SS protein with a change in amino acid composition by only one N-terminal amino acid.

An alternative approach to cleavage of the TEV protease dependent YopE fragment is to introduce ubiquitin into the desired fusion protein. In fact, ubiquitin undergoes C-terminal processing by a group of endogenous ubiquitin-specific C-terminal proteases (deubiquitinizing enzymes, DUBs). Since the cleavage is expected to occur at the very C-terminus of ubiquitin (after G76), the desired protein should not contain additional amino acid sequences. This method was tested on YopE _1-138 -ubiquitin-FlagINK4C-MycHis fusion protein. In control cells infected with bacteria expressing YopE _1-138 Flag-INK4C-MycHis, a band corresponding to YopE _1-138 -Flag-INK4C-MycHis was detected, indicating efficient translocation of the fusion protein (FIG. 23). Upon infection of the cells for 1 h with bacteria expressing YopE _1-138 -Flag-INK4C-MycHis, an additional band corresponding to the size of Flag-INK4C-MycHis became visible, indicating cleavage of this part of the fusion protein. This result indicated that incorporation of ubiquitin into the fusion protein provided cleavage of the YopE _1-138 fragment without the need for an exogenous protease.

Translocation of bacterial effectors of type III and IV.

Salmonella enterica SopE is a well-studied guanine nucleotide replacement factor (GEF) that interacts with Cdc42 to stimulate actin cytoskeleton remodeling [55]. While translocation of YopE _1-138 -Myc into HeLa cells had no effect, translocated YopE _1-138 -SopE (SEQ ID NOS: 5 and 135) caused strong changes in the actin network (FIG. 5A). Similar results were obtained for another GEF effector protein, Shigella flexneri IpgB1 (SEQ ID NO: 4). It is noteworthy that the first changes in the actin cytoskeleton were observed as early as 2 min after infection (Fig. 5A). Therefore, it can be concluded that T3SS-dependent protein delivery occurs immediately after initiation of infection by centrifugation. To confirm the strong dependence of transport on T3SS, we performed the deletion of one of the T3SS proteins that form a pore for translocation in the eukaryotic cell membrane (YopB, see [56]) (Fig. 11).

During Salmonella infection following SopE translocation, SptP was translocated, which

- 47 040558 acts as a GTPase activating protein (GAP) for Cdc42 [57]. While translocation of YopE ₁ - ₁₃₈ -SopE-Myc (SEQ ID NO: 135) alone triggered extensive F-actin rearrangement, co-infection with bacteria expressing YopE1_ ₁₃₈ -SptP (SEQ ID NO: 8) abolished this effect depending on doses (FIG. 5B). Anti-Myc staining indicated that this inhibition was not due to a decrease in the YopE1_ ₁₃₈ -SopE-Myc translocation (FIG. 5B). Together, these results indicated that co-infection of cells with two bacterial strains is a reliable way to deliver two different effectors to single cells to examine their functional interaction. The S. flexneri type OspF III effector acts as a phosphothreonine lyase that dephosphorylates p38 and ERK MAP kinases [58]. To test the functionality of the translocated YopE1_ ₁₃₈ OspF (SEQ ID NO: 7), we monitored p38 phosphorylation after stimulation with TNFa. In uninfected cells or cells infected with bacteria expressing YopE1_ ₁₃₈ -Myc, TNFa induced p38 phosphorylation. In contrast, after translocation of YopE1_ ₁₃₈ -OspF, TNFa-induced phosphorylation ceased, demonstrating that the delivered OspF was active against p38 (FIG. 6A).

During Salmonella infection, the SopB type III effector protects epithelial cells from apoptosis by continuously activating Akt [59]. While the translocation of YopE ₁ . ₁₃₈ -Myc or YopE1_ ₁₃₈ -SopE does not affect Akt, YopE1_ ₁₃₈ -SopB translocation (SEQ ID NO: 6) induces pronounced phosphorylation of Akt at T308 and S473, which corresponds to its active form (Fig. 6B). Similar results were obtained for the SopB homologue from S. flexneri (IpgD, SEQ ID NO: 9). The combined results show that the delivery system based on YopE ₁ . ₁₃₈ functions for all T3S effectors tested to date and allows the study of proteins involved in the control of several cellular functions, including the cytoskeleton, inflammation, and cell survival.

A number of bacteria, including Agrobacterium tumefaciens, Legionella pneumophila and Bartonella henselae, use type IV secretion to introduce effectors into cells. The authors tested whether it is possible to translocate the VerA type IV effector from B. henselae into HeLa cells using the developed tool. Full length VerA (SEQ ID NO: 10) and BepA _E305 were cloned. _end (SEQ ID NO: 11) containing the Bid C-terminal domain and infected the cells with the appropriate strain. Since VerA has been shown to induce the production of cyclic AMP (cAMP) [60], cAMP levels are measured in HeLa cells after infection. While translocation of the B. henselae BepG effector Bid domain (SEQ ID NO: 136) could not induce cAMP, full-length VerA and BepA _E305 - _end triggered cAMP production in the expected amount [60] (Fig. 6C). These results indicate that type IV effectors can be efficiently delivered to target host cells using a YopE _1-138 delivery system and are functional.

Translocation of eukaryotic proteins into epithelial cells.

To demonstrate the possibility of human protein translocation via type III secretion _, the authors coupled human apoptosis inducers to be delivered via Y. enterocolitica to YopE _1-138 or to be delivered via S. enterica to _{SteA1_20} , SteA, _SopE1-81 , or SopE _1-105 . We then monitored the translocation of a cell death agonist that interacts with the human BH3 domain (Bid, SEQ ID NO: 24) and is a pro-apoptotic member of the Bcl-2 protein family. It is a mediator of caspase-8-induced mitochondrial damage (CASP8). CASP8 cleaves Bid and the truncated Bid (tBid, SEQ ID NO: 25) is translocated to the mitochondria where it triggers the release of cytochrome c. This leads to the activation of caspase 3 (CASP3) via the intrinsic pathway, during which it is cleaved into subunits of 17 and 12 kDa [61]. While infection with Y. enterocolitica expressing YopE ₁ . ₁₃₈ -Myc or YopE1_ ₁₃₈ -Bid did not induce apoptosis within 1 h, human tBid translocation triggered cell death to a greater extent than the well studied apoptosis inducer staurosporine (FIGS. 7A and 7C). As expected, the 1Bid translocation resulted in the production of the p17 subunit of CASP3 even at higher levels compared to staurosporine (FIG. 7A). To compare the amount of translocated protein with endogenous Bid, HeLa cells were lysed with digitonin and analyzed by Western blotting with anti-Bid antibody (Fig. 7B). YopE ₁ - ₁₃₈ -tBid delivered by T3SS almost reached the endogenous Bid in HeLa cells, although delivered YopE ₁ - ₁₃₈ -Bid was even present in high amounts (2.5-fold) (FIG. 7B). Deep mapping of the proteome and transcriptome of HeLa cells made it possible to estimate a 4.4-fold level of 105 Bid copies per cell [62]. Thus, it can be concluded that T3SS-dependent delivery of human protein allows reaching the level of 105-10 ⁶ protein molecules per cell. These figures correspond to the number of copies of nanobodies per cell translocated by E. coli T3SS [63]. By adjusting the coefficient for MOI and duration of infection to a value of 10, and the coefficient for the time of antibiotic addition and culture time at 37°C before infection to a value of 3.2, one can adjust the number of copies of the delivered protein/cell from several 1000 copies/cell to several 106 copies/cell. Together, these results indicate that the translocated tBid was functional and delivered at a significant level. This confirmed the effectiveness of the translocation tool for studying the role of the protein in the regulation of apoptosis, a central aspect of cell biology.

- 48 040558

We additionally attached mouse tBid (codon-optimized for Y. enterocolitica; SEQ ID NO: 194) or mouse tBid or Bax BH3 domains (codon-optimized for Y. enterocolitica; SEQ ID NO: 138 and 139) to YopE ₁ . ₁₃₈ for delivery by Y. enterocolitica. While infection with Y. enterocolitica AHOPEMT asd did not allow delivery of protein or YopE ₁ for 2.5 hours. ₁₃₈ -Myc was not able to induce apoptosis, translocation of mouse tBid (codon-optimized for Y. enterocolitica; SEQ ID NO: 194) triggered BIO (Fig. 15), D2A1 (Fig. 16), HeLa (Fig. 17) and 4T1 (Fig. 18). Translocation of the mouse BH3 Bid domain codon-optimized for Y. enterocolitica (SEQ ID NO: 138) or mouse Bax codon-optimized for Y. enterocolitica (SEQ ID 139) was also found to induce extensive B16F10 cell death (Fig. 15), D2A1 (Fig. 16), HeLa (Fig. 17), and 4T1 (Fig. 18). Additional versions contained a tandem repeat of the mouse BH3 Bid domain codon-optimized for Y. enterocolitica fused to YopE1. ₁₃₈ (SEQ ID NO: 202), or the addition of a mouse Bid BH3 domain codon-optimized for Y. enterocolitica to a mouse Bax BH3 domain codon-optimized for Y. enterocolitica fused to YopE1. ₁₃₈ (SEQ ID NO: 203).

While infection with S. enterica aroA bacteria for 4 h could not induce apoptosis, mouse tBid translocation triggered apoptosis because mouse tBid translocation resulted in the production of the p17 CASP3 subunit (FIGS. 19 and 20). The rate of apoptosis induction for the SopE fusion proteins was higher than when SpiI T3SS induction conditions were used (FIG. 19), indicating SopE transport exclusively by SpiI T3SS. Mouse 1Bid coupled to SteA1_ ₂₀ was not able to induce apoptosis, most likely because the secretion signal within the 20 N-terminal amino acids of SteA is not sufficient to deliver the fusion protein (FIGS. 19 and 20). Mouse tBid attached to full-length SteA resulted in the induction of apoptosis in HeLa cells (FIGS. 19 and 20) under conditions of induction of both SpiI and SpiII T3SS, indicating that SteA could be transported by both T3SS. It should be noted that even under conditions of SpiII T3SS induction, a partial presence of SpiI T3SS activity is expected, as observed from the activity of SopE fusion proteins under conditions of SpiII T3SS induction (Fig. 20).

In addition to the translocated eukaryotic proteins functionally designed in the present invention, the tool described herein allows the secretion of several other eukaryotic proteins. This includes delivery via Y. enterocolitica (FIGS. 12, 13 and 22) of cell cycle regulation proteins (Mad2 (SEQ ID NO: 15), CDK1 (SEQ ID NO: 14), INK4A (SEQ ID NO: 16), INK4B ( SEQ ID NO: 17) and INK4C (SEQ ID NO: 18)), as well as their fragments (INK4A 84-103 (SEQ ID NO: 158), p107 657-662 (SEQ ID NO: 159), p21 141-160 (SEQ ID NO: 160), p21 145-160 (SEQ ID NO: 161), p21 17-33 (SEQ ID NO: 162) and cyclin D2 139-147 (SEQ ID NO: 163)), proteins associated with apoptosis (Bad (SEQ ID NO: 29), FADD (SEQ ID NO: 28) and pl7 (SEQ ID NO: 22) and p12 caspase 3 (SEQ ID NO: 23), Bid (SEQ ID NO: 19) and t -Bid (SeQ ID NO: 20)) zebrafish, as well as their fragments (tBid BH3 (SeQ ID NO: 138), Bax BH3 (SEQ ID NO: 139)), signal proteins (mice TRAF6 (SEQ ID NO: 12) , TIFA (SEQ ID NO: 13)), GPCRa G subunits (GNA12, shortest isoform, (SEQ ID NO: 30)), nanobodies (vhhGFP4, (SEQ ID NO: 31)) and nanobody hybrid constructs for targeted protein degradation (Slmb-vhhGFP4; (SEQ ID NOs: 32, 33, 34) [64]) (FIGS. 12 and 13), and e small GTPases (Rac1 Q61E (SEQ ID NOS: 26 and 137) and RhoA Q63L (SEQ ID NOS: 27) and a plextrin homologous domain from human Akt (SEQ ID NOS: 35). In addition to the functionally engineered apoptosis-associated proteins (mouse tBid, SEQ ID NO: 144-147), this additionally includes delivery via S. enterica (FIG. 21) of cell cycle regulation proteins (Mad2 (SEQ ID NO: 168-169), CDK1 (SEQ ID NO: 170-171), INK4A (SEQ ID NO: 164-165) and INK4C (SEQ ID NO: 166-167)). Although these proteins have not been functionally confirmed, the possibility of T3SS-dependent secretion of various eukaryotic proteins in combination with the possible removal of the YopE appendage opens up new prospects for the broad applicability of T3SS in cell biology and its therapeutic applications, especially for the treatment of malignant solid tumors.

Phosphoproteomics has revealed the global contribution of transposed proteins to protein phosphorylation.

Phosphorylation is a widespread post-translational modification capable of activating or inactivating biological processes and, therefore, is a suitable target for studying signaling phenomena [65]. Despite this, there is currently no analysis of phosphorylation during apoptosis at the system level. To analyze the effect of human tBid delivered to HeLa cells, the authors used a label-free phosphoproteomic approach based on LC-MS/MS. In three independent experiments, cells were left untreated and infected with ANOREMT asd+YopE ₁ . ₁₃₈ -Mus or ANOREMT asd+YopE1_ ₁₃₈ -tBid within 30 min. Cells were lysed followed by enzymatic digestion, enrichment of phosphopeptides, and quantification and identification of individual phosphopeptides. The authors compared cells infected with ANOREMT asd+YopE ₁ . ₁₃₈ -Myc, with cells infected with ANOREMT asd+YopE1_ ₁₃₈ -tBid, which made it possible to identify 363 tBid-dependent phosphorylation events. Upon delivery of tBid, increased phosphorylation of 286 phosphopeptides was demonstrated, while 77 phosphopeptides were phosphorylated to a lesser extent, which corresponded to 243 different proteins that made up the tBid phosphoproteome. To create a network of protein-protein interactions of the tBid phosphoproteome, the STRING database was used [66]

- 49 040558 (Fig. 8A). In addition, 27 proteins known to be related to mitochondrial apoptosis were added to this network and formed a central cluster. Notably, only a few proteins from the tBid phosphoproteome were associated with this central cluster, indicating a large number of proteins undergoing phosphorylation changes that have not yet been directly associated with apoptotic proteins. To study the biological functions covered by the tBid phosphoproteome, the authors performed a gene ontology analysis using the functional annotation tool Database for Annotation, Visualization, and Integrated Discovery, DAVID, http://david.abcc.nciferf .gov/) [67, 68]. The revealed biological functions show that tBid influenced various cellular processes. Many proteins involved in chromatin rearrangement and transcriptional regulation underwent phosphorylation changes (ie CBX3, CBX5, TRIM28, HDAC1). For example, HDAC1 is a histone deacetylase involved in the regulation of transcription. It has been shown that HDAC1 can modulate the transcriptional activity of the NF-kB protein, which is also involved in apoptosis. The authors additionally identified a cluster of proteins involved in RNA processing, which, as previously shown, plays an important role in the regulation of apoptosis [69]. For example, HNRPK mediates the p53/TP53 response to DNA damage and is required for the induction of apoptosis [70]. In addition, it influenced the phosphorylation of proteins involved in protein translation. Several eukaryotic initiation factors (ie EIF4E2, EIF4B, EIF3A, EIF4G2) underwent changes in phosphorylation, which is consistent with observations of a decrease in total protein synthesis in cells during apoptosis. Notably, phosphorylation of many proteins is involved in cytoskeletal remodeling (eg, tBid delivery affected PXN, MAP1B9). This is consistent with the observation of a strong change in cell morphology upon delivery of tBid (FIG. 8B). Cell contraction and loss of contact was manifested by the observation of phosphorylation of proteins associated with adhesion, for example, ZO ₂ and paxillin. Similarly, nuclear contraction was accompanied by phosphorylation of nuclear lamina proteins such as lamin A/C and lamin B1. Taken together, tBid delivery induced a rapid apoptotic response, as also indicated by disruption of mitochondrial integrity (FIG. 8B). The authors showed that tBid-induced apoptosis affected hundreds of phosphorylation events involved in a variety of cellular processes. Although many of the identified proteins are related to apoptosis, it is known that only a few of them are phosphorylated upon induction of apoptosis. Thus, the phosphoproteomic approach provides a useful resource for further studies of apoptosis.

Translocation of eukaryotic heterologous fusion proteins, consisting of repetitive identical or variable protein domains, into epithelial cells.

To demonstrate the possibility of translocation of heterologous fusion proteins consisting of repetitive identical or variable protein domains via type III secretion, we have coupled mouse apoptosis inducers for delivery via Y. enterocolitica to YopE1_ ₁₃₈ . As a control, we added mouse tBid (codon-optimized for Y. enterocolitica; SEQ ID NO: 194) or mouse tBid or Bax BH3 domains (codon-optimized for Y. enterocolitica; SEQ ID NO: 200 and 201) to _{YopE1_138} for delivery by Y. enterocolitica. The heterologous fusion protein in one instance consisted of a mouse tBid BH3 domain fused to a similar domain, resulting in YopE1. ₁₃₈ -(tBid-BH3) ₂ (SEQ ID NO: 202). In the second case, the heterologous fusion protein consisted of a mouse tBid BH3 domain fused to a mouse Bax BH3 domain, resulting in YopE1. ₁₃₈ -(tBid-BH3)-(Bax-BH3) (SEQ ID NO: 203). In the case of the tBid mouse and the Bax mouse, the codons were optimized for Y. enterocolitica.

While infection with Y. enterocolitica AHOPEMT asd for 4 h, which ensured the delivery of YopE ₁ . ₁₃₈ -Myc did not allow apoptosis to be induced, translocation of the mouse tBid BH3 domain (codon-optimized for Y. enterocolitica; SEQ ID NO: 194) triggered B16F10 and 4T1 cell death with a clear dose-dependent effect on increased multiplicity of infection (MOI). It is noteworthy that the delivered YopE ₁ _ ₁₃₈ -(tBid-BH3)-(Bax-BH3) or YopE1. ₁₃₈ -(tBid-BH ₃ ) ₂ were more active than YopE ₁ . ₁₃₈ -(tBid-BH3) with reduced MOI. This indicates that delivery of repetitive identical domains or a combination of different protein domains may increase the effect on a desired cellular pathway, such as apoptosis.

Weakening of virulence through deletion/mutation of bacterial effector proteins with virulence in relation to eukaryotic cells.

In the case of Y. enterocolitica, virulence was reduced by deletion of six endogenous effector proteins called Yersinia extrinsic proteins (Yop), specifically YopH, O, P, E, M, T (MRS40 pIML421 [yopHA1-352, yopOA65-558, yopP23, yopE21, uorM23, uorT135]) [40]. These Yops are encoded by the Yersinia virulence plasmid (pYV), an approximately 70 kb plasmid encoding the complete type 3 secretion system (T3SS), as well as other virulence factors (FIG. 24). YopH, O, P, E, M and T are six effector proteins delivered to host cells by the third type bacterial secretion system to modulate and suppress the immune system. Each Yop has a specific biochemical activity in the host cell. YopT cleaves the C-terminal cysteine residue of GTPases Rho and thus removes the isoprenyl group that attaches the GTPases to the membrane.

- 50 040558 no. This Rho inactivation due to mislocalization avoids phagocytosis by immune cells such as macrophages and neutrophils [71]. In the same pathway, YopE acts as a GTPases activating protein (GAP) for Rho GTPases, inactivating them. This leads to a decrease in phagocytosis and inhibition of the release of IL-1 beta by immune cells [71]. In addition, YopO acts as a guanidine nucleotide dissociation inhibitor (GDI) by inactivating Rho GTPases. YopO additionally contains a serine/threonine kinase domain that acts in an as yet unclear way on the actin cytoskeleton [71]. YopH is a tyrosine phosphatase that acts on focal contact proteins such as focal adhesion kinase (Fak), paxillin, and others, thereby preventing phagocytosis by macrophages and neutrophils [71]. YopP, called YopJ in Y. pseudotuberculosis or Y. pestis, has been found to inactivate the MAPK/NFkB pathway in immune cells, preventing the release of TNFa and IL-8 from immune cells stimulated by the presence of bacteria. In addition, it was found that YopP induces apoptosis in immune cells, which may be due to the effect on the MAPK pathway, which in the activated state protects cells from apoptosis [71]. The role of YopM is not yet fully understood, but it has been found to be associated with ribosomal kinase S6 1 (RSK1) and protein kinase C-like kinase 2 (PRK2). It seems that YopM can stimulate RSK1 and thereby affect targets located at further stages of the pathways, for example, the course of the cell cycle [71]. Removal of one or more Yops strongly affects the defense mechanism of bacteria against the immune system [72]. Mutations in the respective yor genes were confirmed by PCR of the respective region and by in vitro secretion assay (FIG. 25). In vitro secretion analysis by SDS-PAGE and Coomassie blue staining confirmed the absence of full-length YopH, O, M, and YopE.

In addition, a Y. enterocolitica strain was constructed with deletions in the asd (aspartate semialdehyde dehydrogenase) gene. Mutations in asd led to a complete loss of the ability to grow without the addition of meso-diaminopimelic acid. This made it possible to obtain antibiotic-free plasmid maintenance systems based on the presence of asd in the respective plasmid. Other auxotrophic mutants can be used similarly.

Dose escalation study in healthy mice.

In order to assess overall toxicity, a dose escalation study was performed in healthy immunocompetent mice (C57BL/6). In these experiments, Y. enterocolitica subsp. palearctica MRS40 AyopH, O, P, E, M, T Aasd (replication-deficient due to Aasd and additionally characterized by reduced virulence due to AyopH, O, P, E, M, T) were compared with S. typhimurium AaroA (characterized by reduced growth due to AaroA , as in other publications [73-75]). Acute toxicity after infection was assessed based on weight gain or loss in mice following iv injection of the bacteria. In addition, the number of bacteria in various organs was determined by organ homogenization, serial dilution, and plate plating. Since acute toxicity was assessed and bacterial growth was not of great interest, deferoxamine pretreatment was not performed. Four different bacterial load values were tested for each strain (105, 106, 10 ⁷ , 10 ⁸ cfu per animal). Y. enterocolitica subsp. palearctica MRS40 AyopH, O, P, E, M, T Aasd did not result in weight loss at two lower doses (105, 106 cfu) (Fig. 26). At a dose of 10 ⁷ bacteria, body weight decreased by approximately 6% in the first 24 hours, and then stabilized and continued to grow. Found that at a higher dose, body weight was reduced by 7.5% 48 hours after infection (Fig. 26). Because Y. enterocolitica subsp. palearctica MRS40 AyopH, O, P, E, M, T Aasd could not maintain infection, especially in the absence of pretreatment with desferoxamine, a rapid decrease in the number of bacteria was expected, which was found (Fig. 27-30). However, severe acute toxicity due to, for example, endotoxin shock was not observed even at the highest dose of Y. enterocolitica administered. This pattern differs from growth and infection competent S. typhimurium AaroA, which has been repeatedly used in mouse studies by other investigators [73-75], as well as aroA and aroD double mutants, even used in clinical studies (NCT01099631). Evaluation of appearance and behavior led the authors to euthanize all mice infected with the maximum dose of S. typhimurium AaroA on day 1 post-infection and on day 4 for the 10 ⁷ cfu dose. At the three highest doses, progressive weight loss was observed (FIG. 26), while at the lowest doses, only permanent mild weight loss was induced (FIG. 26). Even at the lowest tested dose of S. typhimurium, AaroA was present in the liver, spleen, and lungs up to day 8 post-infection (FIGS. 27-30). This could reflect the suboptimal biodistribution of S. typhimurium AaroA observed by other researchers [76].

In dose escalation acute toxicity experiments performed in immunocompetent mice, Y. enterocolitica AyopH, O, P, E, M, T Aasd was safely tolerated up to 10 ⁸ bacteria/mouse when administered intravenously. Such a dose can also be used in clinical studies in humans [77], taking into account differences in the body weight of mice and humans by several thousand times. Because mice are known to perceive Gram-negative bacteria in the same way as humans (via TLR4) and respond similarly to the same lipid A stimulus [78], the occurrence of initial toxicity due to lipid A septic shock in human patients is unlikely. with bacterial

- 51 040558 load used so far in clinical studies [77]. In addition, to explain the differences observed in clinical tests with S. enterica VNP20009 [79], it is proposed to take into account the lack of normal immunostimulatory lipid A. Thus, a decrease in the initial bacterial load administered to patients could be more favorable while maintaining wild-type lipid A structures in order to achieve optimal tumor colonization, where a higher load can be obtained due to bacterial replication.

In an area of the body where bacteria are present, an immune response against the bacteria should be triggered. With the accumulation and growth of bacteria in the area of solid tumors [76, 80–82], the immune system in the tumor area should be triggered after the initial spread of bacteria. Despite the need to avoid septic shock and acute toxicity in patients by reducing the initial bacterial load and/or reducing bacterial endotoxicity through lipid A modifications, stimulation of the immune system at the site of the tumor is highly desirable as it promotes the removal of cancerous tissue (immunotherapy, immunosensitization). The current phase II exploratory clinical trial (EudraCT no. 2005-005775-15) with S. enterica is based on this immunotherapeutic effect and the natural toxicity of the bacteria [83]. Immunosensitization is one of the key mechanisms of action of genetically unequipped Salmonella strains in tumors; for example, Salmonella choleraesuis accumulates in tumors and induces neutrophil infiltration and an antitumor immune response [84]. In addition, it has been shown that activation of the immune system in the tumor area does not prevent the repeated use of bacteria in oncotherapy [85].

Thus, the immune response triggered by bacterial anti-cancer agents should be divided into an undesirable acute phase, which should be attenuated, and a desired activation in later stages, which contributes to the destruction of the tumor. This effect can be achieved by administering high doses of bacteria characterized by low endotoxicity, or by administering low doses of bacteria characterized by normal endotoxicity, which increases the ability to colonize and replicate in solid tumors [79].

Biodistribution studies in a mouse melanoma model.

To confirm the efficacy of Gram-negative bacteria with mutation(s) in key virulence factors, such as T3SS effectors, as tumor-specific carriers, tumor allograft studies in mice were performed using the well-established B16F1O melanoma model ([86], ATCC no. CRL-6475). After tumors had reached a certain size (approximately 100-200 mm ^{3 s.c.} ), mice were intravenously infected with 2x105 CFU of Y. enterocolitica subsp. palearctica MRS40 or Y. enterocolitica subsp. palearctica MRS40 AyopH, O, P, E, M, T. To promote bacterial growth, mice were pretreated with desferoxamine 24 h prior to infection. Mice infected with Y. enterocolitica subsp. palearctica wild-type MRS40 showed an increased appearance and behavior score (FIGS. 31, 32) and significant weight loss during the first 48 h post-infection (FIG. 33), prompting the authors to euthanize all mice in this group on day 2 post-infection. infections. In contrast, mice infected with Y. enterocolitica subsp. palearctica MRS40 AyopH, O, P, E, M, T with attenuated virulence, showed no significant weight loss and normal appearance and behavior scores (FIGS. 31-33) even at day 4 post-infection. In mice infected with the wild-type strain (Y. enterocolitica subsp. palearctica MRS40), live bacteria were found in all organs tested, as well as in the blood (Fig. 35). Although wild-type bacteria were found in malignant solid tumors, equal or higher numbers were found in other organs, with the maximum amount in the spleen (Fig. 35). Infection of mice with Y. enterocolitica subsp. palearctica MRS40 AyopH, O, P, E, M, T differed sharply from the above picture in that live bacteria at 1 day after infection were found mainly in a malignant solid tumor, and a small number of bacteria were found in the spleen, liver and lungs. It is noteworthy that on the 4th day after infection, the number of bacteria in a malignant solid tumor increased by several orders of magnitude (reaching more than 108 CFU/g of tumor tissue), while in all other organs the number of bacteria fell below the detection limit (Fig. 34). Thus, the Y. enterocolitica subsp. palearctica MRS40 AyopH, O, P, E, M, T accumulated at day 4 post-infection at a ratio of approximately (at least) a million to one in the area of malignant solid tumor compared to the spleen or liver (when calculating the ratio compared to the limit of detection) .

These results confirm the effectiveness of this strategy of attenuating virulence by mutating key virulence factors to produce a bacterial carrier specific for malignant solid tumors.

Biodistribution studies in a mouse breast cancer model.

To confirm the efficacy of Gram-negative bacteria with mutation(s) in key virulence factors, such as T3SS effectors, as tumor-specific carriers, tumor allograft studies in mice were performed using a well-established modality.

- 52 040558 4T1 Breast Cancer Case (ATCC No. CRL-2539). After the tumors had reached a certain size (approximately 100-200 mm ^{3 s.c.} ), mice were intravenously infected with 2x105 CFU of Y. enterocolitica subsp. palearctica MRS40 ΔγορΗ, O, P, E, M, T. In order to promote bacterial growth, mice were pretreated with desferoxamine 24 h prior to infection. Mice infected with Y. Enterocolitica subsp. palearctica MRS40 ΔuoPH, O, P, E, M, T with attenuated virulence, did not show significant weight loss and normal appearance and behavior scores even at day 8 post-infection. These mice infected with Y. enterocolitica subsp. palearctica MRS40 ΔγορΗ, O, P, E, M, T, live bacteria on the 8th day after infection were found exclusively in a malignant solid tumor (Fig. 36). Thus, the Y. enterocolitica subsp. palearctica MRS40 ΔγορΗ, O, P, E, M, T accumulated on day 8 post-infection in a ratio of approximately (at least) several tens of thousands to one in the area of malignant solid tumor compared to the spleen or liver (when calculating the ratio compared to the limit discovery).

These results confirm the effectiveness of this strategy of attenuating virulence by mutating key virulence factors to produce a bacterial carrier specific for malignant solid tumors.

Obtaining bacteria with enhanced proapoptotic activity.

In the above experiments, it was demonstrated that delivery of pro-apoptotic proteins (e.g., t-Bid (SEQ ID NO: 25) or BIM (SEQ ID NO: 21)) based on T3SS effectively induced mouse and human cell death, including cancer cells, and that this effect can be enhanced using mouse t-Bid after codon optimization for use in bacteria (SEQ ID NO: 138). The enhanced cell killing most likely reflects the increased production and subsequent delivery of the protein by T3SS due to the use of optimal codons.

In order to optimize the delivery of proapoptotic proteins, the strains were transformed with various proapoptotic proteins obtained in accordance with Table. 4.

Table 4

Strains Transformed with Various Proapoptotic Proteins

Strain name Background Strain Protein for delivery with T3SS Plasmid framework Name of the resulting plasmid Primes. Si_Nr.: sustainable YopEl-138 (enlarged fragment of BHZ tBid mouse after optimization codons for Y. enterocolitica) Y. enterocolitica AuorN,O,R,E ,M,T Aasd YopEl-138 enlarged (by 4 AA) fragment of BHZ tBid mice after codon optimization for Y. enterocolitica pBad_Si_2 pSi_353 Nai Amp YopEl-138-10 AK linker (fragment BHZ tBid mouse after codon optimization for Y. enterocolitica) enterocolitica ΔγορΗ,Ο,Ρ,Ε, M,T Aasd YopEl-138-10 AK-linker VNZ tBid mice after codon optimization for Y. enterocolitica pBad_Si_2 pSi_354 727/728 Nai Amp

- 53 040558

Shortening the delivered proteins to key domains required for signal transduction (eg, the BH3 domain of t-Bid (SEQ ID NO: 138 or 200)) can increase cell killing efficiency (FIG. 37). Regardless of theory, this increase in efficiency is likely due to increased production and subsequent delivery of the protein by the T3SS due to the smaller size of the delivered protein. The insertion of a linker between the YopE fragment and the BH3 domain of tBid (SEQ ID NO: 210) reduced the efficiency, as did the increase in the BH3 domain by 4 additional amino acids (SEQ ID NO: 209) (FIG. 37).

In addition, synthetic variants of delivery proteins have been made with repeats of such key domains (e.g., t-Bid BH3 domain (SEQ ID NO: 202)) or combinations of these key domains (e.g., t-Bid BH3 domain and Bax BH3 domain (SEQ ID NO: 203 and 211)). Surprisingly, it was found that tandem repeats of the same or different BH3 domains resulted in increased induction of apoptosis in cancer cell lines (including 4T1 and B16F10 cells; Fig. 37). The IC50 (half-maximum inhibitory concentration), which refers to the number of bacteria per eukaryotic cell (EC) required to kill 50% of such cells, was found to be reduced by delivery of BH3 tBid tandem repeats compared to a single tBid BH3 domain (Fig. 37 ). This result was unexpected since the addition of the second BH3 domain of t-Bid increased the size of the protein. Because of this, lower expression and delivery levels of YopE _1-138 -(tBid BH ₃ ) ₂ (SEQ ID NO: 202) are to be expected compared to YopE _1-138 -tBid BH3 (SEQ ID NO: 138 or 200), which can reach the maximum equivalent level. To enhance cell killing activity, the combined tBid BH3 domains can act simultaneously and in concert upon delivery via T3SS to eukaryotic cells. If only one tBid BH3 domain in the YopE _1-138 -(tBid BH3) ₂ construct were functional, at best one would expect the same potency as YopE _1-138 -tBid BH3. To increase the genetic stability of YopE _1-138 -(tBid BH3) ₂ (SEQ ID NO: 202) for in vivo studies, the authors cloned YopE _1-138 -(tBid BH3) ₂ (SEQ ID NO: 202) by homologous recombination of the virulence plasmid Yersinia pYV in the native YopE site under the control of the native YopE promoter (and using the mutator plasmids pSI_408 and pSI_419). Such mutators contain a DNA sequence encoding the desired protein, flanked by sequences of 200-250 bp. on both sides and corresponding to the site of the corresponding gene in which the insertion is to take place. These plasmids were transformed into E. coli Sm10 λ pir, from where the plasmids were mobilized into the appropriate strain of Y. enterocolitica. Mutants carrying the inserted vector were propagated for several generations without selection pressure. Sucrose was then added to select clones that had lost the vector. Finally, mutants were detected by colony PCR. Endogenous proteins transported by T3SS (called Yersinia extrinsic proteins, Yops) are encoded by this 70 kb Y. enterocolitica plasmid, called Yersinia Virulence Plasmid (pYV), which also encodes the T3SS apparatus.

Yersinia strains encoding YopE _1-138 -(tBid BH3) (SEQ ID NO: 138 or 200) or YopE _1-138 -(tBid BH3) ₂ (SEQ ID NO: 202) on the Yersinia pYV virulence plasmid in the native YopE site under control of the native YopE promoter was evaluated for the ability to induce apoptosis in cancer cells (including 4T1 and B16F10 cells; Fig. 38). The IC50 (half maximum inhibitory concentration), which refers to the number of bacteria per eukaryotic cell (MOI) required to kill 50% of such cells, was found to be reduced when tandem repeats of the tBid BH3 domain were delivered compared to a single tBid BH3 domain when the coding sequences both proteins were located on the Yersinia pYV virulence plasmid in the native YopE site under the control

- 54 040558 native YopE promoter (Fig. 38). This is consistent with the delivery of these proteins located on the expression plasmid (FIG. 37). This result was also unexpected, since the addition of the second BH3 domain of t-Bid increased the size of the protein. Because of this, lower expression and delivery levels of YopE ₁ _ ₁₃₈ -(tBid BH3)2 (SEQ ID NO: 202) are to be expected compared to YopE ₁ . ₁₃₈ tBid BH3 (SEQ ID NO: 138 or 200), which can reach the maximum equivalent level. To enhance cell killing activity, the combined tBid BH3 domains can act simultaneously and in concert upon delivery via T3SS to eukaryotic cells. If only one tBid BH3 domain in the YopE ₁ _ ₁₃₈ -(tBro BH3) ₂ construct were functional, at best one would expect the same potency as YopE _1-138 -tBid BH3. In addition, Yersinia strains encoding YopE ₁ _ ₁₃₈ -(tBid BH3) (SEQ ID NO: 202) on the Yersinia pYV virulence plasmid in the native YopE site under the control of the native YopE promoter were compared for the ability to induce apoptosis in cancer cells delivered by YopE ₁ _ ₁₃₈ -(tBid BH3) ₂ obtained from an expression plasmid (based on pBad-MycHisA). Consistent with increased copy number of pBadMycHisA (20-25 copies) compared to pYV (reported 1-6 copies), delivery of YopE ₁ _ ₁₃₈ -(tBid BH3) ₂ (SEQ ID NO: 202) based on pBad-MycHisA resulted in a slight decrease in IC50 values for 4T1 and B16F10 cells (FIG. 38).

Verification of tumor-specific growth in vivo up to 14 days after the introduction of bacteria.

The tumor colonization experiment with genetically modified Y. enterocolitica was repeated in a synthetic allograft mouse model (4T1 breast cancer model) with bacterial colonization monitored for two weeks. This time, mice were infected with 1x106 colony-forming units (CFU) of Y. enterocolitica AyopH, O, P, E, M, T. Despite obtaining results similar to the B16F10 model in the first days after infection, the authors were able to show that tumor colonization was consistently observed on 8 days to 14 days after infection (Fig. 39). In addition, colonization remained highly specific; only extremely small numbers of bacteria were found in all other organs tested (Fig. 40). These results showed that Y. enterocolitica AyopH, O, P, E, M, T is capable of stable tumor colonization and can prevent its destruction by the immune system.

Efficacy of Y. enterocolitica AHOPEMT in delaying tumor progression.

To assess the effect of YopE ₁ _ ₁₃₈ -(tBid BH3) ₂ (SEQ ID NO: 202) when delivered to tumor cells in vivo, the authors performed studies on wild-type Balb/C mice with s/c allografts of 4T1 breast cancer cells. The aim of the authors was to evaluate the Y. enterocolitica AHOPEMT strain encoding YopE ₁ _ ₁₃₈ -(tBid BH3) ₂ (SEQ ID NO: 202) on the Yersinia pYV virulence plasmid in the native YopE site under the control of the native YopE promoter. Mice were intravenously infected with PBS or 1x107 Y. enterocolitica dHOPEMT+pYV-YopE ₁ _ ₁₃₈ (tBid BH3) ₂ after the tumor had reached a size of 150-250 mm ³ . The day of intravenous administration of bacteria was designated as day 0. Tumor volume was measured on the following days (day 0 to day 9 after intravenous injection of bacteria) with a caliper. Tumor volume was normalized to tumor volume at day 0 to compensate for baseline tumor size heterogeneity. Treatment with Y. enterocolitica AHOPEMT pYV-YopE ₁ _ ₁₃₈ -(tBid BH3) ₂ showed an effect on the progression of tumor growth, with a statistically significant reduction in tumor at 8, 9 and 10 days after bacterial challenge (Fig. 41). Importantly, Y. enterocolitica AHOPEMT alone did not affect tumor progression in the 4T1 cancer mouse model (Fig. 42). These results support the possibility of using such bacteria and their T3SS to influence tumor progression.

- 55 040558

Bibliography

Hoffman, R. M. Tumor-seeking Salmonella amino acids auxotrophs. Curr Opin Biotechnol22, 917-923, doi: 10.1016/j.copbio.2011.03.009 (2011).

Hoang, T. T, Williams, S., Schweizer, H. P. & Lam, J. S. Molecular genetic analysis of the region containing the essential Pseudomonas aeruginosa asd gene encoding aspartate-beta-semialdehyde dehydrogenase. Microbiology 143 (Pt 3), 899-907 (1997).

Skurnik, M. & Wolf-Watz, H. Analysis of the yopA gene encoding the Yopl virulence determinants of Yersinia spp. Mol Microbiol 3, 517-529 (1989).

Isberg, R. R., Voorhis, D. L. & Falkow, S. Identification of invasin: a protein that allows enteric bacteria to penetrate cultured mammalian cells. Cell 50, 769-778 (1987).

Cornelis, G. R. The type III secretion injectisome. Nat Rev Microbiol 4, 811-825, doi:nrmicrol526 [pii]10.1038/nrmicroI526 (2006).

Mota, L. J. & Cornelis, G. R. The bacterial injection kit: type III secretion systems. Ann Med37, 234-249, doi:R673752030212825[pii]10.1080/07853890510037329 (2005).

Trosky, J. E., Liverman, A. D. & Orth, K. Yersinia outer proteins: Yops. Cell Microbiol 10, 557-565, doi: 10.1111/j. 1462-5822.2007.01109.x (2008).

Brenner, D. & Mak, T. W. Mitochondrial cell death effectors. Curr Opin Cell Biol 21, 871-877, doi: S0955-0674(09)00160-4 [pii] 10.1016/j.ceb.2009.09.004 (2009).

Chalah, A. & Khosravi-Far, R. The mitochondrial death pathway. Adv Exp Med Biol 615, 25-45, doi: 10.1007/978-1-4020-6554-5 3 (2008).

Fuchs, Y. & Steller, H. Programmed cell death in animal development and disease. Cell 147, 742-758, doi:S0092-8674(l1)01283-9 [pii] 10.1016/j.cell.2011.10.033 (2011).

Waugh, D. S. An overview of enzymatic reagents for the removal of affinity tags. Protein Expr Purif 80, 283-293, doi:S1046-5928(l1)00203-8 [pii] 10.1016/j.pep.2011.08.005 (2011).

Howard, S. L. et al. Application of comparative phylogenomics to study the evolution of Yersinia enterocolitica and to identify genetic differences relating to pathogenicity. J Bacteriol 188, 3645-3653, doi: 10.1128/JB. 188.10.3645-3653.2006 (2006).

Thomson, N. R. et al. The complete genome sequence and comparative genome analysis of the high pathogenicity Yersinia enterocolitica strain 8081. PLoS Genet 2, e206, doi: 10.13 71 /journal.pgen. 0020206 (2006).

Pelludat, C, Hogardt, M. & Heesemann, J. Transfer of the core region genes of the Yersinia enterocolitica WA-C serotype 0:8 high-pathogenicity island to Y. enterocolitica MRS40, a strain with low levels of pathogenicity, confers a yer siniabactin biosynthesis phenotype and enhanced mouse virulence. Infect Immun 70, 1832-1841 (2002).

Mulder, B., Michiels, T, Simonet, M., Sory, M. P. & Cornelis, G. Identification of additional virulence determinants on the pYV plasmid of Yersinia enterocolitica W227. Infect Immun 57, 2534-2541 (1989).

Sory, M. P. & Cornelis, G. R. Translocation of a hybrid YopE-adenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol Microbiol 14, 583-594 (1994).

Barker, M. R., Neyt, C, Stainier, I. & Cornelis, G. R. The Yersinia Yop virulon: LcrVis required for extrusion of the translocators YopB and YopD. J Bacteriol 180, 1207-1214 (1998).

Neubauer, H, Aleksic, S., Hensel, A., Finke, E. J. & Meyer, H. Yersinia enterocolitica 16S rRNA gene types belong to the same genospecies but form three homology groups. Int J Med Microbiol 290, 61-64, doi: 10.1016/S1438-4221(00)80107-l (2000).

- 56 040558

Feldman, M. E, Muller, S., Wuest, E. & Cornelis, G. R. SycE allows secretion of YopEDHFR hybrids by the Yersinia enterocolitica type III Ysc system. Mol Microbiol 46, 1183-1197, doi:3241 [pH] (2002).

Ramamurthi, K. S. & Schneewind, O. A synonymous mutation in Yersinia enterocolitica yopE affects the function of the YopE type III secretion signal. J Bacteriol 187, 707-715, doi: 10.1128/JB.187.2.707-715.2005 (2005).

Wolke, S., Ackermann, N. & Heesemann, J. The Yersinia enterocolitica type 3 secretion system (T3SS) as a toolbox for studying the cell biological effects of bacterial Rho GTPase modulating T3SS effector proteins. Cell Microbiol 13, 1339-1357, doi:10.1111/j.l4625822.2011.01623.x (2011).

Forsberg, A. & Wolf-Watz, H. Genetic analysis of the yopE region of Yersinia spp.: identification of a novel conserved locus, yerA, regulating yopE expression. J Bacteriol 172, 1547-1555 (1990).

Sambrook, J. (ed David W. Russell) (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001).

Alto, N. M. & Dixon, J. E. Analysis of Rho-GTPase mimicry by a family of bacterial type III effector proteins. Methods Enzymol 439, 131-143, doi: S0076-6879(07)00410-7 [pH] 10.1016/S0076-6879(07)00410-7 (2008).

Alto, N. M. et al. Identification of a bacterial type HI effector family with G protein mimicry functions. Cell 124, 133-145, doi:S0092-8674(05)01229-8

[pH] 10.1016/j.cell.2005.10.031 (2006).

Kaniga, K., Delor, I. & Cornelis, G. R. A wide-host-range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene 109, 137-141, doi:0378-l119(91)90599-7 [pH] (1991).

Yoneda, Y. et al. A long synthetic peptide containing a nuclear localization signal and its flanking sequences of SV40 T-antigen directs the transport of IgM into the nucleus efficiently. Exp Cell Res 201, 313-320 (1992).

Metcalf, W. W., Jiang, W. & Wanner, B. L. Use of the rep technique for allele replacement to construct new Escherichia coli hosts for maintenance of R6K gamma origin plasmids at different copy numbers. Gene 138, 1-7 (1994).

Diepold, A. et al. Deciphering the assembly of the Yersinia type III secretion injectisome. Embo J 29, 1928-1940, doi:emboj201084 [pH]10.1038/emboj.2010.84 (2010).

Iriarte, M., Stainier, I. & Cornelis, G. R. The rpoS gene from Yersinia enterocolitica and its influence on expression of virulence factors. Infect Immun 63, 1840-1847 (1995).

Cornelis, G., Vanootegem, J. C. & Sluiters, C. Transcription of the y op regulon from Y. enterocolitica requires trans acting pYV and chromosomal genes. Microb Pathog 2, 367-379, doi:0882-4010(87)90078-7[pH] (1987).

Grosdent, N., Maridonneau-Parini, I., Sory, M. P. & Cornelis, G. R. Role of Yops and adhesins in resistance of Yersinia enterocolitica to phagocytosis. Infect Immun 70, 4165-4176 (2002).

Dehio, C, Meyer, M., Berger, J., Schwarz, H. & Lanz, C. Interaction of Bartonella henselae with endothelial cells results in bacterial aggregation on the cell surface and the subsequent engulfment and internalisation of the bacterial aggregate by a unique structure, the invasome. J Cell Sci 110 (Pt 18), 2141-2154 (1997).

Bensimon, A. et al. ATM-dependent and -independent dynamics of the nuclear phosphoproteome after DNA damage. Sci Signal 3, rs3, doi: 10.1126/scisignal.20010343/151/rs3 [pH] (2010).

Perkins, D. N., Pappin, D. J, Creasy, D. M. & Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data.

- 57 040558

Electrophoresis 20, 3551-3567, doi: 10.1002/(SICI)15222683(19991201)20:18<3551::AID-ELPS3551>3.0. CO;2-2 [pH]10.1002/(SICI)15222683(19991201)20:18<3551::AID-ELPS3551>3.0. CO;2-2 (1999).

Smyth, G. K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol 3, Article3, doi: 10.2202/1544-6115.1027 (2004).

Ting, L. et al. Normalization and statistical analysis of quantitative of proteomics data generated by metabolic labeling. Mol Cell Proteomics 8, 2227-2242, doi:10.1074/mcp.M800462-MCP200M800462-MCP200 [pH] (2009).

Vizcaino, J. A. et al. The PRteomics IDEntifications (PRTDE) database and associated tools: status in 2013. Nucleic Acids Res 41, D1063-1069, doi: 10.1093/nar/gksl262gksl262 [pH] (2013).

Boyd, A. P., Lambermont, I. & Cornelis, G. R. Competition between the Yops of Yersinia enterocolitica for delivery into eukaryotic cells: role of the SycE chaperone binding domain of YopE. J Bacterial 182, 4811-4821 (2000).

Iriarte, M. & Cornelis, G. R. YopT, a new Yersinia Yop effector protein, affects the cytoskeleton of host cells. Mol Microbiol 29, 915-929 (1998).

Kudryashev, M. et al. In situ structural analysis of the Yersinia enterocolitica injectisome. Elife 2, e00792, doi: 10.7554/eLife.0079200792 [pH] (2013).

Schulte, R. et al. Yersinia enterocolitica invasin protein triggers IL-8 production in epithelial cells via activation of Rei p65-p65 homodimers. FASEB J 14, 1471-1484 (2000).

Mota, L. J., Journet, L., Sorg, I., Agrain, C. & Cornelis, G. R. Bacterial injectisomes: needle length does matter. Science 307, 1278, doi: 307/5713/1278

[pH] 10.1126/science. 1107679 (2005).

Isaksson, E. L. et al. The membrane localization domain is required for intracellular localization and autoregulation of YopE in Yersinia pseudotuberculosis. Infect Immun 77, 4740-4749, doi:IAI.00333-09 [pH] 10.1128/IAI.00333-09 (2009).

Denecker, G. et al. Effect of low- and high-virulence Yersinia enterocolitica strains on the inflammatory response of human umbilical vein endothelial cells. Infect Immun 70, 3510-3520 (2002).

Sharma, S. et al. Deployment of the Burkholderia glumae type III secretion system as an efficient tool for translocating pathogen effectors to monocot cells. Plant J 74, 701712, doi: 10.1111/tpj. 12148 (2013).

Carrington, J. C. & Dougherty, W. G. A viral cleavage site cassette: identification of amino acid sequences required for tobacco etch virus polyprotein processing. Proc Natl AcadSci USA 85, 3391-3395 (1988).

Kapust, R. B., Tozser, J., Copeland, T. D. & Waugh, D. S. The P1' specificity of tobacco etch virus protease. Biochem Biophys Res Commun 294, 949-955, doi: 10.1016/S0006291X(02)00574-0S0006-291X(02)00574-0 [pH] (2002).

Liang, F. L., Gao, H., Maynard, C. A. & Powell, W. A. Expression of a self-processing, pathogen resistance-enhancing gene construct in Arabidopsis. BiotechnolLett 27, 435442, doi: 10.1007/S10529-005-1884-9 (2005).

Weber, W. et al. Macrolide-based transgene control in mammalian cells and mice. Nat Biotechnol20, 901-907, doi: 10.1038/nbt731nbt731 [pH] (2002).

Kapust, R. B. et al. Tobacco etch virus protease: mechanism of autolysis and rational design of stable mutants with wild-type catalytic proficiency. Protein Eng 14, 993-1000 (2001).

Lee, V. T, Anderson, D. M. & Schneewind, O. Targeting of Yersinia Yop proteins into the cytosol of HeLa cells: one-step translocation of YopE across bacterial and

- 58 040558 eukaryotic membranes is dependent on SycE chaperone. Mol Microbiol 28, 593-601 (1998).

Gray, D. C., Mahrus, S. & Wells, J. A. Activation of specific apoptotic caspases with an engineered small-molecule-activated protease. Cell 142, 637-646, doi:S00928674(10)00783-X[pii]10.1016/j.cell.2010.07.014 (2010).

Henrichs, T. et al. Target-directed proteolysis at the ribosome. Proc Natl Acad Sci U S A 102, 4246-4251, doi: 102/12/4246 [pii] 10.1073/pnas.0408520102 (2005).

Hardt, W. D., Chen, L. M., Schuebel, K. E., Bustelo, X. R. & Galan, J. E. S. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells. Cell 93, 815-826, doi:S0092-8674(00)81442-7 [pii] (1998).

Hakansson, S. et al. The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity. Embo J 15, 5812-5823 (1996).

Stebbins, C. E. & Galan, J. E. Structural mimicry in bacterial virulence. Nature 412, 701-705, doi: 10.1038/3508900035089000 [pii] (2001).

Li, H. et al. The phosphothreonine lyase activity of a bacterial type III effector family. Science 315, 1000-1003, doi:315/5814/1000 [pii] 10.1126/science. 1138960 (2007).

Norris, F.A., Wilson, M. P., Wallis, T. S., Galyov, E. E. & Majerus, P. W. SopB, a protein required for virulence of Salmonella dublin, is an inositol phosphate phosphatase. Proc Natl Acad Sci U SA 95, 14057-14059 (1998).

Pulliainen, A. T. et al. Bacterial effector binds host cell adenylyl cyclase to potentiate Galphas-dependent cAMP production. Proc Natl Acad Sci U SA 109, 9581-9586, doi: 1117651109[pii]10.1073/pnas. 1117651109 (2012).

Li, H., Zhu, H., Xu, C. J. & Yuan, J. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94, 491-501, doi:S00928674(00)81590-1 [pii] (1998).

Nagaraj, N. et al. Deep proteome and transcriptome mapping of a human cancer cell line. Mol Syst Biol 7, 548, doi:msb201181[pii]10.1038/msb.2011.81 (2011).

Blanco-Toribio, A., Muyldermans, S., Frankel, G. & Fernandez, L. A. Direct injection of functional single-domain antibodies from E. coli into human cells. PLoS One 5, el5227, doi: 10.1371/journal.pone.OO15227 (2010).

Caussinus, E., Kanca, O. & Affolter, M. Fluorescent fusion protein knockout mediated by anti-GFP nanobody. Nat Struct Mol Biol 19, 117-121, doi:nsmb.2180 [pii]10.1038/nsmb.2180 (2011).

Schmutz, C. et al. Systems-Level Overview of Host Protein Phosphorylation During Shigella flexneri Infection Revealed by Phosphoproteomics. Mol Cell Proteomics 12, 2952-2968, doi:Ml13.029918 [pii]10.1074/mcp.Ml13.029918 (2013).

Szklarczyk, D. et al. The STRING database in 2011: functional interaction networks of proteins, globally integrated and scored. Nucleic Acids Res 39, D561-568, doi:gkq973[pii]10.1093/nar/gkq973 (2011).

Huang da, W., Sherman, B. T. & Lempicki, R. A. Bioinformatics enrichment tools: paths towards the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37, 1-13, doi:gkn923 [pii]10.1093/nar/gkn923 (2009).

Huangda, W. et al. DA VID gene ID conversion tool. Bioinformation 2, 428-430 (2008).

Schwerk, C. & Schulze-Osthoff K. Regulation of apoptosis by alternative pre-mRNA splicing. Mol Cell 19, 1-13, doi:S1097-2765(05)01375-4

[pii] 10.1016/j.molcel.2005.05.026 (2005).

- 59 040558

Papagiannakopoulos, T, Shapiro, A. & Kosik, K. S. MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. Cancer Res 68, 8164-8172, doi:68/19/8164[pii]10.1158/0008-5472.CAN-08-1305 (2008).

Aepfelbacher, M., Trasak, C. & Ruckdeschel, K. Effector functions of pathogenic Yersinia species. Thromb Haemost 98, 521-529 (2007).

Trulzsch, K., Sporleder, T, Igwe, E. I., Russmann, H. A Heesemann, J. Contribution of the major secreted yops of Yersinia enterocolitica 0:8 to pathogenicity in the mouse infection model. Infect Immun 72, 5227-5234, doi: 10.1128/IAI.72.9.5227-5234.2004 (2004).

Cao, H. D. et al. Attenuated Salmonella typhimurium carrying TRAIL and VP3 genes inhibits the growth of gastric cancer cells in vitro and in vivo. Tumori 96, 296-303 (2010).

Massa, P. E., Paniccia, A., Monegal, A., de Marco, A. & Rescigno, M. Salmonella engineered to express CD20-targeting antibodies and a drug-converting enzyme can eradicate human lymphomas. Blood 122, 705-714, doi: 10.1182/blood-2012-12-474098 (2013).

Yoon, W. S., Chae, Y. S., Hong, J. & Park, Y. K. Antitumor therapeutic effects of a genetically engineered Salmonella typhimurium harboring TNF-alpha in mice. Appl Microbiol Biotechnol 89, 1807-1819, doi: 10.1007/s00253-010-3006-4 (2011).

Forbes, N. S., Munn, L. L., Fukumura, D. & Jain, R. K. Sparse initial entrapment of systemically injected Salmonella typhimurium leads to heterogeneous accumulations within tumors. Cancer Res 63, 5188-5193 (2003).

Toso, J. F. et al. Phase I study of the intravenous administration of attenuated Salmonella typhimurium to patients with metastatic melanoma. J Clin Oncol 20, 142152 (2002).

Miller, S. I., Ernst, R K. X-Bader, M. W. LPS, TLR4 and infectious disease diversity. Nat. Rev. microbiol. 3, 36-46, doi:nrmicrol068[pii]10.1038/nrmicrol068 (2005).

Zhang, M., Swofford, C. A. & Forbes, N. S. Lipid A controls the robustness of intratumoral accumulations of attenuated Salmonella in mice. Int J Cancer 135, 647657, doi:10.1002/ijc.28700 (2014).

Clairmont, C. et al. Biodistribution and genetic stability of the novel antitumor agent VNP20009, a genetically modified strain of Salmonella typhimurium. J Infect Dis 181, 1996-2002, doi: 10.1086/315497 (2000).

Lee, C. H., Wu, C. L. & Shiau, A. L. Endostatin gene therapy delivered by Salmonella choleraesuis in murine tumor models. J Gene Med 6, 1382-1393, doi: 10.1002/jgm.626 (2004).

Zheng, L. M. et al. Tumor amplified protein expression therapy: Salmonella as a tumorselective protein delivery vector. Oncol Res 12, 127-135 (2000).

Forbes, N. S. Engineering the perfect (bacterial) cancer therapy. Nat Rev Cancer 10, 785-794, doi:nrc2934[pii]10.1038/nrc2934 (2010).

Lee, C. H., Wu, C. L. & Shiau, A. L. Salmonella choleraesuis as an anticancer agent in a syngeneic model of orthotopic hepatocellular carcinoma. Int J Cancer 122, 930-935, doi:10.1002/ijc.23047 (2008).

Thamm, D. H. et al. Systemic administration of an attenuated, tumor-targeting Salmonella typhimurium to dogs with spontaneous neoplasia: phase I evaluation. Clin Cancer Res 11, 4827-4834, doi: 10.1158/1078-0432.CCR-04-2510 (2005).

Fidler, I. J. Biological behavior of malignant melanoma cells correlated to their survival in vivo. Cancer Res 35, 218-224 (1975).

CLAIM

Claims (12)

1. The use of a recombinant gram-negative bacterium strain with attenuated virulence, transformed with a vector that contains a promoter in the 5' to 3' direction; a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter; a second DNA sequence encoding a heterologous protein fused in frame to the 3' end of said first DNA sequence for treating a malignant solid tumor in a subject, wherein said recombinant Gram-negative bacterium strain with attenuated virulence is capable of accumulating in said malignant solid tumor, wherein said use comprises administering to said subject a reduced virulence recombinant Gram-negative bacterium strain together with a siderophore, wherein said recombinant weakened virulence Gram-negative bacterium strain is Yersinia enterocolitica ΔyopH, O, P, E, M, T, defective in production according to at least one siderophore, and said strain is administered in an amount sufficient to treat said subject. 2. The use according to claim 1, characterized in that in said recombinant gram-negative bacterium strain with weakened virulence, all effector-coding genes encoding bacterial effector proteins virulent against eukaryotic cells are mutated - 60 040558 in such a way that the resulting strain of Yersinia no longer produces functional bacterial effector proteins virulent against eukaryotic cells. 3. Use according to claim 2, characterized in that said bacterial effector protein delivery signal is a T3SS bacterial effector protein delivery signal, wherein said T3SS bacterial effector protein delivery signal comprises the 138 N-terminal amino acids of the Y. enterocolitica YopE effector protein. 4. Use according to any one of claims 1 to 3, characterized in that said heterologous protein is selected from the group consisting of proteins involved in apoptosis or regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, cell signaling pathway proteins, reporter proteins , transcription factors, proteases, small GTPases, GPCR-related proteins, nanobodies and nanobody fusion constructs, T3SS bacterial effectors, T4SS bacterial effectors, and viral proteins. 5. The use of a recombinant gram-negative bacterial strain with attenuated virulence for the treatment of a malignant solid tumor in a subject, wherein said recombinant gram-negative bacterial strain with attenuated virulence is capable of accumulating in said malignant solid tumour, said use comprising administering said recombinant gram-negative bacterial strain with attenuated virulence co-administered with a siderophore to said subject, and wherein said recombinant strain of gram-negative bacterium with weakened virulence is a strain of Yersinia enterocolitica AyopH, O, P, E, M, T, defective in the production of at least one siderophore, and said strain is administered in an amount sufficient to treat said subject. 6. The use according to claim 5, characterized in that said recombinant gram-negative bacterium strain with attenuated virulence is defective in the production of all effector proteins virulent against eukaryotic cells, and said recombinant gram-negative bacterium strain with attenuated virulence expresses a prodrug-converting enzyme. 7. Use according to any one of claims 1 to 6, characterized in that said subject is administered from about 105 to about 10 ⁹ bacteria of said recombinant strain of gram-negative bacterium with reduced virulence. 8. The use according to any one of claims 1 to 7, characterized in that said recombinant Gram-negative bacterium strain of attenuated virulence is administered to said subject in accordance with a dosing regimen consisting of a single dose every 2-20 days over a period of approximately 20-60 days. 9. The use according to any one of claims 1 to 8, characterized in that the number of bacteria of said recombinant strain of gram-negative bacteria with attenuated virulence in organs in which there is no malignant solid tumor is below the detection limit at least 4 days after the last administration of said a recombinant gram-negative bacterium strain with attenuated virulence to said subject. 10. The use according to any one of claims 1 to 9, characterized in that said recombinant gram-negative bacterium strain with attenuated virulence is prepared in the form of a pharmaceutical composition containing a pharmaceutically acceptable carrier. 11. A method of treating a malignant solid tumor in a subject, said method comprising administering to said subject a recombinant gram-negative bacterium strain with attenuated virulence together with a siderophore, said recombinant gram-negative bacterium strain with attenuated virulence being able to accumulate in said malignant solid tumor, and wherein said the recombinant strain of gram-negative bacterium with weakened virulence is a strain of Yersinia enterocolitica AyopH, O, P, E, M, T, defective in the production of at least one siderophore, and said strain is co-administered with a siderophore in an amount sufficient to treat said subject. 12. The method according to claim 11, characterized in that the specified recombinant strain of gram-negative bacteria with weakened virulence transformed with a vector that contains in the direction from 5' to 3' promoter; a first DNA sequence encoding a bacterial effector protein delivery signal operably linked to said promoter;