EA040467B1 - METHOD FOR PRODUCING COMPOUNDS FOR THE TREATMENT OF SPINAL MUSCLE ATROPHY - Google Patents

Description

Introduction

The present invention provides compounds that are modulators of SMN2 gene splicing, their preparation, pharmaceutical compositions containing them, and their use as drugs for the treatment of spinal muscular atrophy (SMA).

In particular, the present invention relates to compounds of formula (I)

^R2

where A, R ¹ , R ² and R ³ are as described here, and their pharmaceutically acceptable salts.

State of the art

Spinal muscular atrophy (SMA), in its broadest sense, is a group of hereditary and acquired diseases of the central nervous system (CNS) characterized by progressive loss of motor neurons in the spinal cord and brainstem, causing muscle weakness and muscle atrophy. The most common form of spinal muscular atrophy is the result of mutations in the survival motor neuron (SMN) gene and is found, with varying degrees of severity, in both young children and adults (Crawford and Pardo, Neurobiol. Dis., 1996, 3: 97).

Infantile spinal muscular atrophy is the most severe form of this neurodegenerative disease. Symptoms include muscle weakness, low muscle tone, weak cry, weakness or tendency to fall, difficulty sucking or swallowing, accumulation of secretions in the lungs or throat, difficulty feeding, and increased susceptibility to respiratory infections. Quite often, the legs are weaker than the arms, and milestones such as lifting the head or being able to sit upright are not achieved. Generally, the earlier symptoms appear, the shorter life expectancy. As soon as the motor neuron cells are destroyed, symptoms begin to appear soon after. Severe forms of the disease are fatal, and no cure is known for all forms. The course of spinal muscular atrophy is directly related to the rate of destruction of motor neuron cells and the severity of the emerging state of weakness. Infants with severe spinal muscular atrophy are often prone to respiratory illness due to weakness in the muscles that support breathing. Children with milder forms of spinal muscular atrophy live much longer, although they may require extensive medical care, particularly those with more severe forms of the disease. The clinical diversity of diseases of spinal muscular atrophy is divided into the following five groups.

(a) SMA type 0 (intrauterine spinal muscular atrophy) is the most severe form of the disease and occurs before birth. Usually, the first symptom of SMA type 0 is reduced fetal mobility, which may be noticed for the first time between 30 and 36 weeks of gestation. After birth, newborns move little and have difficulty swallowing and breathing.

(b) SMA type 1 (infantile spinal muscular atrophy or Werdnig-Hoffmann disease) shows its first symptoms between 0 and 6 months. This type of SMA is also a very severe form. Patients never achieve the ability to sit, and unless assisted ventilation is used, patients usually die within the first 2 years.

(c) SMA type 2 (intermediate spinal muscular atrophy) occurs between 7-18 months of age. Patients achieve the ability to sit without support, but are never able to stand or walk without assistance. The prognosis in this group depends mainly on the degree of respiratory involvement.

(d) SMA type 3 (spinal juvenile muscular atrophy or Kugelberg-Welander disease) is usually diagnosed after 18 months. Patients with type 3 SMA are able to walk independently at some point during the course of the disease, but often become wheelchair-bound in adolescence or adulthood.

(e) SMA type 4 (adult spinal muscular atrophy). Weakness usually manifests itself in the last stage of adolescence in the muscles of the tongue, arms or legs, and then progresses in the muscles of other areas of the body. The course of adult spinal muscular atrophy is much slower and has little or no effect on life expectancy.

The SMN gene was mapped using linkage analysis to a complex region on chromosome 5q. In humans, this region contains an inverted duplication of approximately 500 kb.

- 1 040467 (kb), resulting in two practically identical copies of the SMN gene. Spinal muscular atrophy is caused by an inactivating mutation or deletion of the telomeric copy of the gene (SMN1) on both chromosomes, resulting in loss of function of the SMN1 gene. However, all patients retain a centromeric copy of the gene (SMN2), and the number of copies of the SMN2 gene in patients with spinal muscular atrophy is inversely related to the severity of the disease; that is, patients with less severe spinal muscular atrophy have more copies of SMN2. However, SMN2 is unable to fully compensate for the loss of SMN1 function due to alternative splicing of exon 7 caused by translationally silent C/T mutations in exon 7. As a result, most of the transcripts produced from SMN2 are deficient in exon 7 (SMN2 A7) and encodes a processed Smn protein that has impaired function and is rapidly degraded.

The SMN protein is believed to play a role in RNA processing and metabolism, with a well-defined function of mediating the assembly of a specific class of RNA-protein complexes called snRNPs (small nuclear nucleoproteins). The SMN may have other functions in motor neurons, however, its role in preventing selective motor neuron degeneration is not well understood.

In most cases, spinal muscular atrophy (SMA) is diagnosed based on clinical symptoms and by testing for the presence of at least one copy of the SMN1 gene. However, in about 5% of cases, spinal muscular atrophy is caused by mutation in genes rather than inactivation of SMN1, some of which are known and others not yet understood. In some cases where testing for the SMN1 gene is difficult or does not detect any abnormality, other tests such as electromyography (EMG) or muscle tissue biopsy may be recommended.

Currently, the treatment of patients with spinal muscular atrophy is limited to supportive care, including the use of respiratory, nutritional and rehabilitation measures; and no drug is known that would eliminate the cause of the disease. The currently accepted treatment for spinal muscular atrophy involves preventing and treating the secondary effects of chronic loss of neuromotor units. The main point in the treatment of SMA type 1 is the prevention and early treatment of pulmonary complications, which are the cause of death in most cases. Although some infants with spinal muscular atrophy survive into adulthood, infants with type 1 SMA have a life expectancy of less than two years.

Several mouse models of spinal muscular atrophy have been developed. In particular, the delta exon 7 (Δ7 SMN) SMN model (Le et al., Hum. Mol. Genet, 2005, 14:845) contains both the SMN2 gene and multiple copies of the SMN2 Δ 7 cDNA, and replicates many of the phenotypic features Type 1 SMA. The SMN Δ 7 model can be used both to study SMN2 expression and to assess motor function and lifespan. The C/C allele mouse model (Jackson Laboratory strain #008714, The Jackson Laboratory, Bar Harbor, ME) provides a less severe spinal muscular atrophy disease model in which mice have reduced levels of both full-strand SMN2 mRNA and Smn protein. The mouse phenotype with the C/C allele has the SMN2 gene and an mSMN1-SMN2 gene hybrid that is alternatively spliced but does not show severe muscle weakness. The mouse model with the C/C allele is used to study the expression of SMN2.

As a result of a better understanding of the genetic basis of spinal muscular atrophy, several treatment strategies have been explored, but none of them have shown positive results in clinical trials.

SMN1 gene replacement using viral delivery vectors and cell replacement using differentiated SMN1+/+ stem cells have been shown to be effective in animal models of spinal muscular atrophy. Before these approaches can be applied in humans, further studies are needed to determine the safety and immune response and to justify the requirement to initiate treatment at the neonatal stage.

Correction of alternative SMN2 splicing in cultured cells was also achieved using synthetic nucleic acids as therapeutic agents: (i) antisense oligonucleotides that target elements of the sequence in SMN2 pre-mRNA and shift the direction of the splicing reaction towards the formation of full-length SMN2 mRNA (Passim et al., Sci. Transl. Med., 2011, 3:72ra 18; and Hua et al., Nature, 2011, 478:123) and (ii) transspliced RNA molecules that provide a fully functional RNA sequence that replaces the mutant fragment undergoes splicing and forms a full-length SMN1 mRNA (Coady and Lorson, J Neurosci., 2010, 30:126).

Other approaches being explored include the search for drugs that increase Smn levels, enhance residual Smn function, or compensate for Smn losses. Aminoglycosides have been shown to increase the expression of stabilized Smn produced from SMN2 Δ7 mRNA by promoting translational read through of an aberrant stop codon, but they are characteristic

- 2 040467 have low penetration into the central nervous system and exhibit toxicity upon repeated dosing. Chemotherapeutic agents such as aclarubicin have been shown to increase Smn content in cell culture; however, the toxic properties of these drugs preclude their long-term use in patients with spinal muscular atrophy. Some drugs in clinical trials for the treatment of spinal muscular atrophy include transcription activators such as histone deacetylase (HDAC) inhibitors (eg, butyrates, valproic acid, and hydroxyurea) and mRNA stabilizers (RG3039 mRNA decapitation inhibitor from Repligen) designed to increasing the amount of total RNA transcribed from the SMN2 gene. However, the use of HDAC inhibitors or mRNA stabilizers does not address the underlying cause of spinal muscular atrophy and may cause an overall increase in transcription and gene expression in humans, with possible drug safety concerns.

In an alternative approach, neuroprotective agents such as olesoxime were selected for research. Such strategies are not aimed at the production of functional Smn for the treatment of spinal muscular atrophy, but at finding a way to protect Smn-deficient motor neurons from neurodegeneration.

A system for identifying compounds that increase the incorporation of exon 7 of the SMN gene into RNA transcribed from the SMN2 gene and specific benzooxazole and benzoisoxazole compounds identified by this system are described in international patent application WO 2009/151546 A1. A system designed to detect compounds that produce a stabilized Smn protein from SMN2 Δ7 mRNA and specific isoindolinone compounds identified by this system are described in international patent application WO 2010/019236 A1 and WO 2013/119916 A2.

Despite progress in understanding the genetic basis and pathophysiology of spinal muscular atrophy, there is still a need to identify compounds that alter the course of spinal muscular atrophy, one of the most severe childhood neurological diseases.

Detailed description of the invention

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by a person skilled in the art to which this invention pertains. While methods and materials similar or equivalent to those described herein may be used in the practice or testing of the invention, suitable methods and materials are described below.

All publications, patent applications, patents and other references mentioned in the present invention are incorporated here by reference in their entirety.

The nomenclature used in this application is based on the IUPAC systematic nomenclature, unless otherwise indicated.

All open valences appearing on a carbon, oxygen, sulfur, or nitrogen atom in a structure in the present invention indicate the presence of hydrogen, unless otherwise indicated.

The definitions described here apply whether they are used alone or in combination. It is contemplated that the definitions described herein may be added to form chemically relevant combinations such as heterocycloalkylaryl, haloalkylheteroaryl, arylalkylheterocycloalkyl, or alkoxyalkyl. The last member of the combination is a radical that is linked to the remainder of the molecule. The other members of the combination are attached to the linking radical in reverse order with respect to the literal sequence, i.e. the combination amino- _C1-7 alkyl refers to _{C1_7} alkyl which is a substituted amino, or, for example, the combination arylalkylheterocycloalkyl refers to a heterocycloalkyl radical which is substituted by alkyl which in turn is substituted by aryl.

The term residue refers to an atom or group of chemically bonded atoms that is attached to another atom or molecule through one or more chemical bonds, thus forming part of the molecule. For example, the variables A, R ¹ , R ² and R ³ in formula (I) refer to residues that are attached to the core of the structure of formula (I) via a covalent bond.

When referring to the number of substituents, the term one or more means the range from one substituent to the maximum possible number of substitutions, i.e. replacement of one hydrogen atom until the replacement of all hydrogen atoms by substituents.

The term possible or possibly means that the events or circumstances described below may, but need not, be present, and that the description includes cases where the events or circumstances are present and cases in which they are not.

The term substituent refers to an atom or group of atoms replacing a hydrogen atom on the parent molecule.

The term substituted means that said group bears one or more substituents. If any group can carry several deputies and different possible substitutes are proposed

- 3 040467 whether the substituents are independently selected and do not have to be the same. The term unsubstituted means that the specified group does not bear substituents. The term optionally substituted means that said group is unsubstituted or substituted with one or more substituents independently selected from the group of possible substituents. When referring to the number of substituents, the term one or more means from one substituent up to the maximum possible number of substitutions, i.e. from replacing one hydrogen atom to replacing all hydrogen atoms with substituents.

The terms compound(s) of the present invention and compound(s) of the present invention refer to compounds as disclosed in the present invention and their stereoisomers, tautomers, solvates, and salts (eg, pharmaceutically acceptable salts).

When the compounds of the present invention are solids, the skilled artisan will appreciate that these compounds, and their solvates and salts, may exist in various solid forms, in particular various crystalline forms, each of which is within the scope of the present invention and the particular formulas.

The term pharmaceutically acceptable salts means salts that are not biologically or otherwise undesirable. Pharmaceutically acceptable salts include acid addition salts as well as base addition salts.

The term pharmaceutically acceptable acid addition salt means those pharmaceutically acceptable salts which are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, carbonic acid, phosphoric acid, and organic acids selected from aliphatic, cycloaliphatic, aromatic , araliphatic, heterocyclic, carboxylic and sulfonic organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, gluconic acid, lactic acid, pyruvic acid, oxalic acid, malic acid, maleic acid, maleic acid, succinic acid, fumaric acid acid, tartaric acid, citric acid, aspartic acid, ascorbic acid, glutamic acid, anthranilic acid, benzoic acid, cinnamic acid, mandelic acid, embonic acid, phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, p-toluene lfonic acid and salicylic acid.

The term pharmaceutically acceptable base addition salt means those pharmaceutically acceptable salts which are formed with an organic or inorganic base. Examples of acceptable inorganic bases include sodium, potassium, ammonium, calcium, magnesium, iron, zinc, copper, manganese and aluminum salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines, including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins such as isopropylamine-, trimethylamine-, diethylamine-, triethylamine-, tripropylamine-, ethanolamine-, 2diethylaminoethanol-, trimetamine-, dicyclohexylamine-, lysine-, arginine-, histidine-, caffeine-, procaine-, hydrabamine-, choline-, betaine-, ethylenediamine-, glucosamine-, methylglucamine-, theobromine-, purine- , piperazine-, piperidine-, N-ethylpiperidine-, and polyamine resins.

Stereochemical definitions and conventions used herein generally follow S. P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., Stereochemistry of Organic Compounds, John Wiley & Sons, Inc., New York, 1994. When describing an optically active compound, the prefixes D and L, or R and S, are used to indicate the absolute configuration of the molecule relative to its chiral center(s). Substituents attached to the chiral center in question are ranked according to the Sequence Rule of Cahn, Ingold and Prelog. (Cahn et al. Angew. Chem. Inter. Edit. 1966, 5, 385; errata 511). The prefixes D and L or (+) and (-) are used to denote the sign of the rotation of the plane of polarized light by the compound, with (-) or L indicating that the compound is left-handed. A connection with a (+) or D prefix is dextrorotatory.

The term chiral center means a carbon atom bonded to four dissimilar substituents. The term chiral means the ability to non-impose on a mirror image, although the term achiral refers to embodiments that are superimposed on their mirror image. Chiral molecules are optically active, i.e. they have the ability to rotate the plane of polarized light.

The compounds of the present invention may have one or more chiral centers and may exist in the form of optically pure enantiomers, mixtures of enantiomers such as, for example, racemates, optically pure diastereoisomers, mixtures of diastereoisomers, diastereomeric racemates, or mixtures of diastereomeric racemates. In the case where a chiral center is present in a chemical structure, all stereoisomers associated with that chiral center are intended to be covered by the present invention.

The terms halo, halogen, and halide are used interchangeably in the present invention and refer to fluorine, chlorine, bromine, or iodine. One specific example of a halogen is fluorine.

The term alkyl means a monovalent linear or branched saturated hydrocarbon group containing from 1 to 12 carbon atoms. In private embodiments, alkyl has from 1 to 7

- 4 040467 carbon atoms, and in more specific embodiments from 1 to 4 carbon atoms. Examples of alkyl include methyl, ethyl, propyl, isopropyl, n-butyl, iso-butyl, sec-butyl or tert-butyl. Specific examples of alkyl are methyl and ethyl.

The term haloalkyl means an alkyl group where at least one of the hydrogen atoms of the alkyl group has been replaced by the same or different halogen atoms, in particular fluorine atoms. Examples of haloalkyl include monofluoro, difluoro, or trifluoromethyl, ethyl, or propyl, such as 3,3,3-trifluoropropyl, 2-fluoroethyl, 2,2,2-trifluoroethyl, fluoromethyl, or trifluoromethyl, and the like. The term perhaloalkyl means an alkyl group in which all hydrogen atoms of the alkyl group are replaced by the same or different halogen atoms.

The term bicyclic ring system refers to two rings that are fused to each other through a common single or double bond (annelated bicyclic system), through a sequence of three or more common atoms (bridged bicyclic ring systems), or through one common atom (spiro bicyclic ring system). Bicyclic systems can be saturated, partially unsaturated, unsaturated or aromatic. Bicyclic ring systems may contain heteroatoms selected from N, O and S.

The term cycloalkyl means a monovalent saturated monocyclic or bicyclic hydrocarbon group of 3 to 10 carbon atoms in the ring. In particular embodiments, cycloalkyl means a monovalent saturated monocyclic hydrocarbon group of 3 to 8 ring carbon atoms. Bicyclic means - consisting of two saturated carbocycles sharing one or more carbon atoms. In particular, cycloalkyl groups are monocyclic. Examples of monocyclic cycloalkyls include cyclopropyl, cyclobutanyl, cyclopentyl, cyclohexyl or cycloheptyl. Examples of bicyclic cycloalkyls are bicyclo[2.2.1]heptanyl or bicyclo[2.2.2]octanyl. A specific example of a cycloalkyl is cyclopropyl.

The term heterocycloalkyl means a monovalent saturated or partially unsaturated mono-, bi- or tricyclic ring system containing from 3 to 9 ring atoms, including one, two or three ring heteroatoms selected from N, O and S, and the remaining ring atoms are carbon. In particular embodiments, heterocycloalkyl is a monovalent saturated monocyclic ring system of 4-7 ring atoms containing one, two or three ring heteroatoms selected from N, O and S, and the remaining ring atoms are carbon. Examples of monocyclic saturated heterocycloalkyls are aziridinyl, oxiranyl, azetidinyl, oxetanyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydro-thienyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperazinyl, morpholine-dioxo-dioxo, 1,1 -yl, azepanil, diazepanil, homopiperazinil or oxazepanil. Examples of bicyclic saturated heterocycloalkyls are 8aza-bicyclo[3.2.1]octyl, quinuclidinyl, 8-oxa-3-aza-bicyclo[3.2.1]octyl, 9-azabicyclo[3.3.1]nonyl, 3oxa-9-azabicyclo[3.3 .1]nonyl, or 3-thia-9-azabicyclo[3.3.1]nonyl. Examples of partially unsaturated heterocycloalkyls are dihydrofuryl, imidazolinyl, dihydro-oxazolyl, tetrahydropyridinyl or dihydropyranyl. Specific examples of heterocycloalkyls are 1,4 diazepanyl, hexahydropyrrolo[1,2a]pyrazinyl, piperidinyl, piperaschinyl and pyrrolidinyl. More specific examples of heterocycloalkyl are hexahydropyrrolo[1,2a]pyrazinyl and piperazinyl.

The term N-heterocycloalkyl denotes a heterocycloalkyl radical containing at least one ring nitrogen atom and where the points of attachment of the heterocycloalkyl radical to the rest of the molecule pass through the ring nitrogen atom. Specific examples of N-heterocycloalkyl are 1,4-diazepanyl, hexahydropyrrolo[1,2-a]pyrazinyl, piperidinyl, piperazinyl and pyrrolidinyl. More specific examples of N-heterocycloalkyl are hexadiropyrrolo[1,2-a]pyrazinyl and piperazinyl.

The term basicity with respect to compound is expressed in the present invention as the negative ten-day logarithm of the acidity constant of the conjugate acid (pKa=-log Ka). The greater the pKa of the conjugate acid, the stronger the base (pKa + PKV = 14). In the present invention, an atom or functional group is designated basic if it can accept a proton and if the calculated pKa of the conjugate acid is at least 7, in particular if the calculated pKa of the conjugate acid is at least 7.8, more specifically if the calculated pKa of the conjugate acid is conjugate acid is at least 8. pKa values were calculated in silico as described in F. Milletti et al., J. Chem. inf. Model (2007) 47:2172-2181.

The term alkylene means a linear saturated divalent hydrocarbon group of 17 carbon atoms or a branched saturated divalent hydrocarbon group of 3-7 carbon atoms. Examples of alkylene groups include methylene, ethylene, propylene, 2-methylpropylene, butylene, 2-ethylbutylene, pentylene, hexylene. Specific examples of alkylene are ethylene, propylene, and butylene.

The term amino denotes a group of the formula -NR'R'', where R' and R'' are independently hydrogen, alkyl, alkoxy, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, or as described herein. In quality

- 5 040467 Alternatively, R' and R'', together with the nitrogen atom to which they are attached, can form a heterocycloalkyl. The term primary amino denotes a group in which both R' and R'' are hydrogen. The term secondary amino denotes a group in which R' is hydrogen and R'' is a group other than hydrogen. The term tertiary amino means a group in which both R' and R'' are not hydrogen. Specific secondary and tertiary amines are methylamine, ethylamine, propylamine, isopropylamine, phenylamine, benzylamine dimethylamine, diethylamine, dipropylamine and diisopropylamine.

The term active pharmaceutical ingredient (or API) means a compound or molecule in a pharmaceutical composition that has a specific biological activity.

The terms pharmaceutical composition and pharmaceutical preparation (or formulation) are used interchangeably and refer to a mixture or solution containing a therapeutically effective amount of an active pharmaceutical ingredient together with pharmaceutically acceptable excipients for administration to a mammal, such as a human, in need thereof.

The term pharmaceutically acceptable denotes a characteristic of a material that is useful in the preparation of a pharmaceutical composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable and acceptable in veterinary and human pharmaceutical applications.

The terms pharmaceutically acceptable excipient, pharmaceutically acceptable carrier, and therapeutically inert excipient may be used interchangeably and means any pharmaceutically acceptable ingredient in a pharmaceutical composition that has no therapeutic activity and is non-toxic to the subject to whom it is administered, such as disintegrants, binders, fillers, diluents, buffers. agents, isotonic agents, stabilizers, antioxidants, surfactants, carriers, diluents or lubricants used in the preparation of pharmaceutical products.

The terms individual or subject refer to a mammal. Mammals include, without limitation, domestic animals (eg, cows, sheep, cats, dogs, and horses), primates (eg, humans and non-human primates such as monkeys), rabbits, and rodents (eg, mice and rats). In some embodiments, the individual or subject is a human.

The term "therapeutically effective amount" means the amount of a compound or molecule of the present invention which, when administered to a subject, (i) treats or prevents a particular disease, condition or disorder, (ii) ameliorates, ameliorates or eliminates one or more symptoms of a particular disease, condition or disorder or (iii) prevents or delays the onset of one or more of the symptoms of a particular disease, condition, or disorder described herein. A therapeutically effective amount will vary depending on the compound, the disease state being treated, the severity or treatment of the disease, the age and relative health of the subject, the route and form of administration, the judgment of the attending physician or veterinarian, and other factors.

The term treat or treatment of a disease state includes inhibition of the disease state, ie. stopping the development of the disease state or its clinical symptoms, or alleviating the disease state, i. e. the presence of a temporary or permanent regression of the disease state or its clinical symptoms.

The term spinal muscular atrophy (or SMA) refers to a disease caused by an inactivating mutation or deletion in the SMN1 gene on both chromosomes resulting in loss of function of the SMN1 gene.

Symptoms of spinal muscular atrophy include muscle weakness, low muscle tone, weak cry, weak cough, lethargy or tendency to fall, difficulty sucking or swallowing, difficulty breathing, secretions in the lungs or throat, clenched fists with a sweaty hand, fluttering/trembling tongue, head often tilted to one side, even when lying down, legs usually weaker than arms, legs often in frog-leg position, feeding difficulties, increased susceptibility to respiratory tract infections, bowel/bladder sluggishness, underweight , inability to sit unaided, inability to walk, inability to crawl, and hypotension, areflexia, and multiple congenital contractures (arthrogryposis) associated with loss of anterior horn cells of the spinal cord.

The term treatment of spinal muscular atrophy (SMA) or treat spinal muscular atrophy (SMA) includes one or more of the following effects: (i) reduce or alleviate the severity of spinal muscular atrophy; (ii) delaying the onset of spinal muscular atrophy; (iii) slowing the development of spinal muscular atrophy; (iv) reducing the rate of hospitalization of the subject; (v) reducing the duration of the subject's hospital stay; (vi) increase the survival of the subject; (vii) improve the subject's quality of life; (viii) reduction in the number of symptoms associated with spinal muscular atrophy; (ix) reduce or alleviate the severity of the symptom(s) associated with spinal muscular atrophy; (x) reducing the duration of a symptom associated with spinal muscular atrophy; (xi) preventing the recurrence of a symptom associated with the spinal

- 6 040467 atrophy; (xii) slowing the development or onset of a symptom of spinal muscular atrophy; and/or (xiii) slowing the progression of a symptom associated with spinal muscular atrophy.

More specifically, the term SMA treatment means one or more of the following beneficial effects: (i) reduced loss of muscle strength; (ii) increased muscle strength; (iii) reduce muscle atrophy; (iv) reduce loss of motor function; (v) an increase in the number of motor neurons; (vii) reduce motor neuron loss; (viii) protecting SMN-deficient motor neurons from degeneration; (ix) increase motor function; (x) an increase in lung function; and/or (xi) a reduction in loss of lung function.

In more detail, the term treat SMA refers to the functional ability or maintaining the functional ability of an infant or toddler, to sit unaided, an infant, toddler, child or adult to stand unaided, walk unaided, run unaided, breathe unaided, fall asleep unaided, or swallow unaided.

The term EC1.5 _x value for the production of a full-length SMN2 mRNA minigene (or EC1.5 _x minigene) is defined as the concentration of a test compound that effectively increases the amount of full-length SMN2 mRNA minigene to a level 1.5 times higher than the level in cells, processed by the carrier.

The term EU value ₁ . _5x for Smn protein expression (or EC _1.5x SMN protein) is defined as the concentration of a test compound that effectively produces an amount of Smn protein in the fibroblast cells of _a patient suffering from spinal muscular atrophy that is 1.5 times higher than that produced in the cells, processed by the carrier.

In more detail, the present invention relates to a process for the preparation of compounds of formula (I)

Where

R ¹ is hydrogen or C _1-7 αkil;

R ² is hydrogen, cyano, C _1-7 alkyl, C _1-7 haloalkyl or C _3-8 cycloalkyl;

R ³ is hydrogen, C _1-7 αkyl, or C _3-8 cycloalkyl;

A represents

Where

X is N or CH;

R ⁴ is hydrogen, C _1-7 alkyl or -(CH ₂ ) _m -NR ⁹ R ¹⁰ ;

R ⁵ is hydrogen or C _1-7 alkyl;

R ⁶ is hydrogen or C _1-7 alkyl;

R ⁷ is hydrogen or C _1-7 alkyl;

R ⁸ is hydrogen or C _1-7 alkyl;

R ⁹ and R ¹⁰ are independently selected from hydrogen, C _1-7 alkyl and C _3-8 cycloalkyl;

n is 0, 1 or 2;

m is 0, 1, 2 or 3;

or R ⁴ and R ⁵ together form C _1-7 alkylene;

or R ⁴ and R ⁷ together form C _1-7 alkylene;

or R ⁵ and R ⁶ together form C _2-7 alkylene;

or R ⁵ and R ⁷ together form C _1-7 alkylene;

or R ⁵ and R ⁹ together form C _1-7 alkylene;

or R ⁷ and R ⁸ together form C _2-7 alkylene;

or R ⁷ and R ⁹ together form C _1-7 alkylene;

or R ⁹ and R ¹⁰ together form C _2-7 alkylene;

with the proviso that if X is CH then R ⁴ is -(CH ₂ ) _m -NR ⁹ R ¹⁰ ; And

- 7 040467 with the proviso that if X is N and R ⁴ is -(CH ₂ )m-NR ⁹ R ¹⁰ then m is 2 or 3;

wherein an aromatic nucleophilic substitution reaction is carried out between a compound of formula (VI)

^R2

O(VI) and a compound of formula M-A by heating in a solvent, where A, R ¹ , R ² and R ³ are as defined herein, Y is halogen or trifluoromethanesulfonate, M is hydrogen, sodium or potassium, and where M is bonded to A through the nitrogen atom of A.

A particular embodiment of the present invention relates to a process for the preparation of compounds of formula (I) as defined above, wherein the aromatic nucleophilic substitution reaction is carried out at a temperature of 80 to 200°C.

A particular embodiment of the present invention relates to a process for the preparation of compounds of formula (I) as defined above, wherein the aromatic nucleophilic substitution reaction solvent is selected from dimethyl sulfoxide (DMSO), N-methylpyrrolidone (NMP), and dimethylformamide (DMF).

A particular embodiment of the present invention relates to a process for the preparation of compounds of formula (I) as defined above, wherein M is hydrogen.

A particular embodiment of the present invention relates to a process for the preparation of compounds of formula (I), where R ¹ is C ₁ . ₇ alkyl, in particular methyl.

A particular embodiment of the present invention relates to a process for the preparation of compounds of formula (I) wherein R ² is hydrogen or C ₁ . ₇ alkyl, in particular hydrogen or methyl.

A particular embodiment of the present invention relates to a process for the preparation of compounds of formula (I), where R ³ is hydrogen or C ₁ . ₇ alkyl, in particular hydrogen or methyl.

A particular embodiment of the present invention relates to a process for the preparation of compounds of formula (I), where A is selected from the group:

A particular embodiment of the present invention relates to a process for the preparation of compounds of formula (I), wherein said compound is 7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2- b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one.

Compounds of formula (VI) are suitable as intermediates in the production of compounds of formula (I)

where A, R ¹ , R ² , R ³ and Y are as described here.

- 8 040467

Ways to get.

The compounds of formula (I) as defined above can be obtained in accordance with conventional methods known in the prior art.

As shown in Scheme 1, a commercially available amino-pyridine of formula (II) can be reacted with a malonic ester to give an intermediate of formula (III) wherein Y and R ³ are as described here and R is C1-2αkyl, in particularly methyl. The compound of formula (III) is then treated with a chlorinating agent (such as POCl3, etc.) to give a compound of formula (IV). The compound of formula (IV) is then reacted in a Suzuki cross-coupling reaction with a compound of formula (V) wherein R ¹ and R ² are as described herein and Z is B(OH) 2 or a C _1-7 αkyl boronic acid ester , such as 4,4,5,5-tetramethyl-1,3,2-dioxaborolan2-yl, in the presence of a catalyst (such as (1,1'-bis(diphenylphosphino)ferrocene)palladium(II) dichloride (Pd(dppf )Cl ₂ ) etc.) and a base (such as K ₂ CO ₃ etc.) in a suitable solvent (such as DMF etc.) to give a compound of formula (VI). Finally, the compound of formula (VI) is reacted with compound M-A either in:

a) aromatic nucleophilic substitution reactions (in particular if Y is fluorine) by heating at 80 to 200°C; or

b) Buchwald-Hartwig amination reactions in the presence of a palladium catalyst (eg tetrakis(triphenylphosphine)palladium (Pd(PPh ₃ ) ₄ ) or bis(dibenzylideneacetone)palladium (Pd(dba) ₂ ) by heating at 20 to 100°C ;

in a solvent (for example, dimethyl sulfoxide (DMSO), N-methylpyrrolidone (NMP), or dimethylformamide (DMF)) to obtain a compound of formula (I), where A is as defined herein, M is hydrogen, sodium or potassium, in in particular hydrogen, and where M is bonded to A through the nitrogen atom of A.

Scheme 1.

In one embodiment, the present invention relates to a process for the preparation of compounds of formula (I) as defined above, comprising reacting a compound of formula (VI) with a compound M-A, either in:

a) aromatic nucleophilic substitution reactions (in particular if Y is fluorine) by heating at 80 to 200°C; or

b) Buchwald-Hartwig amination reactions in the presence of a palladium catalyst (eg tetrakis(triphenylphosphine)palladium (Pd(PPh ₃ ) ₄ ) or bis(dibenzylideneacetone)palladium (Pd(dba) ₂ ) by heating at 20 to 100°C ;

in a solvent (for example, dimethyl sulfoxide (DMSO), N-methylpyrrolidone (NMP), or dimethylformamide (DMF)) to obtain a compound of formula (I), where A is as defined herein, M is hydrogen, sodium or potassium, in in particular hydrogen, and where M is bonded to A through the nitrogen atom of A.

- 9 040467

In particular, the compounds of formula (I) and their pharmaceutically acceptable salts can be obtained in accordance with the methods described in the examples of the present invention.

pharmaceutical compositions.

In another embodiment, the present invention provides pharmaceutical compositions or medicaments comprising compounds of the invention and a therapeutically inert carrier, diluent or pharmaceutically acceptable excipient, as well as methods of using the compounds of the invention to prepare such compositions and medicaments.

The compositions are made, dosed and administered in accordance with good medical practice. Factors to consider in this context include the particular disease being treated, the particular mammal being treated, the clinical condition of the patient, the cause of the disorder, site of delivery of the agent, route of administration, mode of administration, and other factors known to physicians.

The compounds of the invention can be administered by any suitable route, including oral, topical (including buccal and sublingual), rectal, vaginal, transdermal, parenteral, subcutaneous, intraperitoneal, intrapulmonary, intradermal, intrathecal and epidural and intranasal, and, if desired, for topical treatment, intravenous administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.

The compounds of the present invention may be administered in any convenient form, such as tablets, powders, capsules, solutions, dispersions, suspensions, syrups, aerosols, suppositories, gels, emulsions, patches, and the like. Such compositions may contain components suitable for pharmaceutical preparations, for example, diluents, carriers, pH modifiers, preservatives, solvents, stabilizers, wetting agents, emulsifiers, sweeteners, colors, flavors, salts for changing the osmotic pressure, buffers, masking agents, antioxidants and additional active agents. They may also contain other therapeutically valuable substances.

Conventional compositions are prepared by mixing a compound of the present invention and a carrier or excipient. Suitable carriers and excipients are well known to those skilled in the art and are detailed in, for example, Ansel H.C. et al., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems (2004) Lippincott, Williams & Wilkins, Philadelphia; Gennaro A.R. et al., Remington: The Science and Practice of Pharmacy (2000) Lippincott, Williams & Wilkins, Philadelphia; and Rowe R.C, Handbook of Pharmaceutical Excipients (2005) Pharmaceutical Press, Chicago. The compositions may also include one or more buffers, stabilizing agents, surfactants, wetting agents, lubricants, emulsifiers, suspending agents, preservatives, antioxidants, light protection agents, lubricants, processing aids, colorants, sweeteners, perfume agents, flavoring agents, solvents. and other known additives to provide an elegant presentation of a drug (eg, a compound of the present invention or a pharmaceutical composition thereof) or aid in the manufacture of a pharmaceutical product (eg, a drug).

The dosage at which the compounds of the invention may be administered can vary widely and will, of course, be tailored to individual requirements in each particular case. In general, in the case of oral administration, a daily dose of 0.01 to 1000 mg of the compound of general formula (I) per person should be appropriate, although the upper limit may also be exceeded if necessary.

An example of a suitable oral dosage form is a tablet containing 100 to 500 mg of a compound of the invention with 30 to 90 mg of anhydrous lactose, 5 to 40 mg of croscarmellose sodium, 5 to 30 mg of polyvinylpyrrolidone (PVP) K30 and 1 to 10 mg magnesium stearate. The powdered ingredients are first mixed together and then mixed with the PVP solution. The resulting composition may be dried, granulated, mixed with magnesium stearate and compressed into tablet form using conventional equipment.

An example of an aerosol formulation can be prepared by dissolving a compound, eg 10 to 100 mg, of the invention in an appropriate buffer solution, eg phosphate buffer, adding an auxiliary agent, eg a salt such as sodium chloride, if necessary. The solution can be filtered, for example using a 0.2 µm filter, to remove impurities and contaminants.

- 10 040467

Application.

As described above, the compounds of formula (I) and their pharmaceutically acceptable salts have valuable pharmacological properties and have been found to enhance incorporation of exon 7 of the SMN1 and/or SMN2 genes into mRNA transcribed from the SMN1 and/or SMN2 genes, thereby increasing SMN protein expression in patients who need it.

The compounds of the present invention can be used either alone or in combination with other drugs, for the treatment or prevention of a disease caused by an inactivating mutation or deletion in the SMN1 gene and/or associated with a loss or defect in the function of the SMN1 gene. These diseases include, without limitation, spinal muscular atrophy (SMA).

A particular embodiment of the present invention relates to pharmaceutical compositions containing compounds of formula (I), as defined above, or their pharmaceutically acceptable salts, as defined above, and one or more pharmaceutically acceptable excipients.

A particular embodiment of the present invention relates to pharmaceutical compositions containing compounds of formula (I) or their pharmaceutically acceptable salts as defined above and one or more pharmaceutically acceptable excipients for the treatment or prevention of a disease caused by an inactivating mutation or deletion in the SMN1 gene and/or associated with loss or defect in the function of the SMN1 gene, in particular for the treatment or prevention of SMA.

A particular embodiment of the present invention relates to compounds of formula (I) or their pharmaceutically acceptable salts, as defined above, for use as therapeutically active substances, especially for use as therapeutically active substances for the treatment or prevention of a disease caused by an inactivating mutation or deletion in the gene SMN1 and/or associated with a loss or defect in the function of the SMN1 gene, in particular for the treatment or prevention of spinal muscular atrophy (SMA).

A particular embodiment of the present invention relates to compounds of formula (I) or their pharmaceutically acceptable salts as defined above for use in the treatment or prevention of a disease caused by an inactivating mutation or deletion in the SMN1 gene and/or associated with a loss or defect in the function of the SMN1 gene, in particular for applications for the treatment or prevention of spinal muscular atrophy (SMA).

A particular embodiment of the present invention relates to a method for treating or preventing a disease caused by an inactivating mutation or deletion in the SMN1 gene and/or associated with a loss or defect in the function of the SMN1 gene, in particular for the treatment or prevention of spinal muscular atrophy (SMA), which comprises administering compounds to a subject formula (I) or their pharmaceutically acceptable salts as defined above.

A particular embodiment of the present invention relates to the use of compounds of formula (I) or their pharmaceutically acceptable salts, as defined above, for the treatment or prevention of a disease caused by an inactivating mutation or deletion in the SMN1 gene and/or associated with a loss or defect in the function of the SMN1 gene, in particular to treat or prevent spinal muscular atrophy (SMA).

A particular embodiment of the present invention relates to the use of compounds of formula (I) or their pharmaceutically acceptable salts as defined above for the preparation of medicaments for the treatment or prevention of a disease caused by an inactivating mutation or deletion in the SMN1 gene and/or associated with a loss or defect in the function of the SMN1 gene, in particular for the treatment or prevention of spinal muscular atrophy (SMA). Such medicinal products contain compounds of formula (I) or their pharmaceutically acceptable salts, as defined above.

Examples

The present invention will be better understood with reference to the following examples. They should not be regarded as limiting the scope of the present invention.

Abbreviations used.

ACN - acetonitrile;

CH ₂ Cl ₂ - dichloromethane (DCM);

DIPEA - diisopropylethylamine;

DMA - dimethylacetamide;

TEA - triethylamine;

CT - room temperature;

B ₂ (pin) ₂ - bis(pinacolato)diboron;

Pd(dppf)Cl ₂ - (1,1'-bis(diphenylphosphino)ferrocene)palladium(II) dichloride;

PPTS - pyridinium p-toluenesulfonate.

Intermediate 1.

7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one.

a) 2-chloro-7-fluoro-pyrido[1,2-а]pyrimidin-4-one

- 11 040467

ABOUT

Oh oh

A mixture of 2-amino-5-fluoropyridine (11.20 g, 0.10 mol) and dimethylmalonate (57.0 ml, 0.50 mol) was heated at 230°C for 1.5 h. After cooling to room temperature, the precipitate was filtered off and washed with ACN (3x) to obtain 7-fluoro-2-hydroxy-4H-pyrido[1,2-a]pyrimidin-4-one as a dark precipitate (14 g), which was immediately used in the next step. MS m/z 181.3 [M+H]+.

A dark mixture of crude 7-fluoro-2-hydroxy-4H-pyrido[1,2-a]pyrimidin-4-one (14 g, ~77 mmol) in POCl ₃ (50 ml) and DIPEA (13.3 ml, 77 mmol) heated at 110° C. for 15 hours. The solvent was removed and the dark residue was treated with ice water, washed with water (3x) and dried to give a brown precipitate. The crude brown precipitate was chromatographed (5% MeOH in CH ₂ Cl ₂ ) to give 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow precipitate (9.84 g, 50% , 2 stages), MS m/z 199.2 [M+H]+.

b) 2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b]pyridazine

6-Chloro-2-methylimidazo[1,2-b]pyridazine mixture (900 mg, 5.37 mmol), 4,4,4',4',5,5,5',5'-octamethyl2,2'-bi (1,3,2-dioxaborolane) (1.36 g, 5.37 mmol, 1.0 equiv.), KOAc (1.05 g, 10.7 mmol) and Pd(dppf)Cl ₂ -CH ₂ Cl ₂ (393 mg, 0.54 mmol) in dioxane (50 ml) was degassed and heated under N2 at 95°C. After 15 h the mixture was diluted with EtOAc, filtered through Celite and concentrated in vacuo to give 2methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b ]pyridazine, which was immediately used in the next step.

c) 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one

ABOUT

To a solution of 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (750 mg, 3.78 mmol) in ACN (36 ml) was added 2-methyl-6-(4,4, 5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b]pyridazine (1.17 g, 4.53 mmol, equiv: 1.2), Pd(Ph ₃ P) ₄ (218 mg, 0.189 mmol, 0.05 equiv.) and an aqueous solution of K2CO3 (3.78 ml, 7.55 mmol, 2.0 equiv.). The mixture was degassed and heated under argon at 105° C. overnight. The reaction mixture was cooled to RT and filtered. The precipitate was washed with Et ₂ O and then with water, dried under vacuum to give 250 mg (22%) of 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2a ]pyrimidin-4-one as a light brown precipitate. MS m/z 296.1 [M+H]+.

Intermediate 2.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin-4-one.

a) 2,8-dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b]pyridazine

In a closed tube, 3,6-dichloro-4-methylpyridazine (27 g, 161 mmol) was suspended in aqueous ammonium solution (25%, 300 ml). The reaction mixture was heated at 110°C for 48 h (turned into a solution after 1 h). After cooling to room temperature, the reaction mixture was poured into CH2Cl2 and the organic phase was separated, dried over Na ₂ SO ₄ , and concentrated in vacuo to give 22.4 g of 6-chloro-4-methyl-pyridazin-3-amine and 6 -chloro-5-methyl-pyridazine-3-amine in the form of a mixture of regioisomers, which were immediately used in the next stage.

A mixture of regioisomers of 6-chloro-4-methyl-pyridazin-3-amine and 6-chloro-5-methyl-pyridazin-3-amine (22.4 g) was suspended in 2-propanol (300 ml). 1-bromo-2,2-dimethoxypropane (36.0 g, 26.6 ml, 193 mmol, 1.2 eq) and PPTS (2.96 g, 11.6 mmol, 0.0725 eq) were added and the resulting solution was heated at 105°C for

- 12 040467 night. The solvent was removed in vacuo and the residue was taken up in CH2C12 and washed with NaHCO3. The organic phases were dried over Na2SO4, concentrated in vacuo and the crude light brown residue was chromatographed (EtOAc/heptane 1/2-1/1) to give 6.1 g alone

6-chloro-2,8-dimethyl-imidazo[1,2-b]pyridazine MS m/z 182.1 [M+H]+ (21%) as a white precipitate and 5.9 g of 6chloro-2,7-dimethyl-imidazo [1,2-b]pyridazine MS m/z 182.1 [M+H] ⁺ (20%) as a white precipitate.

A mixture of 6-chloro-2,8-dimethylimidazo[1,2-b]pyridazine (0.9 g, 4.96 mmol), 4,4,4',4',5,5,5',5'-octamethyl

2,2'-bi(1,3,2-dioxaborolane) (1.26 g, 4.96 mmol, 1.0 equiv.), KOAc (0.97 g, 9.91 mmol) and Pd(dppf)Cl ₂ -CH ₂ Cl ₂ (363 mg , 0.49 mmol) in dioxane (50 mL) was degassed and heated under N2 at 110°C. After 15 hours, the mixture was diluted with EtOAc, filtered through celite and concentrated in vacuo to give 2,8dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1, 2-b]pyridazine, which was immediately used in the next step.

b) 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin-4-one

2,8-dimethyl-6 -(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2b]pyridazine (1.24 g, 4.53 mmol, 1.2 eq.), Pd(Ph ₃ P) ₄ (218 mg, 0.189 mmol, 0.05 equiv.) and an aqueous solution of K2CO3 (3.78 ml, 7.55 mmol, 2.0 equiv.). The mixture was degassed and heated under argon at 100° C. for 6 hours. The reaction mixture was cooled to RT and filtered. The precipitate was washed with Et ₂ O and then with water, dried under vacuum to give 700 mg (60%) of 2-(2,8-dimethylimidazo[1,2b]pyridazin-6-yl)-7-fluoro-pyrido[1, 2-a]pyrimidin-4-one as a light brown precipitate. MS m/z 310.1 [M+H] ⁺ .

Intermediate 3.

7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one a) 2-chloro-7fluoro-9- methyl pyrido[1,2-а]pyrimidin-4-one

A mixture of 5-fluoro-3-methylpyridin-2-amine (3.3 g, 26.2 mmol) and dimethylmalonate (15.0 ml, 0.13 mol, 5.0 equiv.) was heated at 210°C for 1.5 h. After cooling to room temperature, the precipitate was filtered off and washed with ACN (3x) to give 7-fluoro-2-hydroxy-9-methyl-pyrido[1,2a]pyrimidin-4-one as a dark precipitate (2.3 g) which was used immediately in the next step. MS m/z 195.1 [M+H] ⁺ .

A mixture of crude 7-fluoro-2-hydroxy-9-methyl-pyrido[1,2-a]pyrimidin-4-one (2.3 g, 11.8 mmol) in POCl ₃ (7.7 ml, 82.9 mmol) and DIEA (2.07 ml, 11.8 mmol) was heated at 110°C for 15 hours. The solvent was removed and the residue was treated with ice water, washed with water (3x) and dried to give a brown precipitate. The crude brown precipitate was chromatographed (5% MeOH in CH2Cl2) to give 2-chloro-7-fluoro-9-methyl-pyrido[1,2-a]pyrimidin-4-one as a yellow solid (1.77 g, 70% per 2 stages), MS m/z 213.1 [M+H] ⁺ .

b) 7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one

To a solution of 2-chloro-7-fluoro-9-methyl-4H-pyrido[1,2-а]pyrimidin-4-one (2.2 g, 10.3 mmol) in ACN (80 ml) was added 2-methyl-6-( 4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b]pyridazine (3.22 g, 12.4 mmol, 1.2 eq., described above), Pd(Ph ₃ P) ₄ (120 g, 1.03 mmol, 0.1 equiv.) and an aqueous solution of K2CO3 (10.3 ml, 20.7 mmol, 2.0 equiv.). The mixture was degassed and heated under argon at 100° C. for 6 hours. The reaction mixture was cooled to RT and filtered. The precipitate was washed with Et2O and then with water, dried under vacuum to give 1.80 g (56%) of 7-fluoro-9-methyl-2-(2

- 13 040467 methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one in the form of a light brown precipitate. MS m/z 310.1 [M+H]+.

Intermediate 4.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2-a]pyrimidin-4-one

2.8 -dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2yl)imidazo[1,2-b]pyridazine (1.51 g, 5.53 mmol, 1.2 eq., described above) , Pd(Ph ₃ P) ₄ (0.32 g, 0.277 mmol, 0.06 equiv.) and an aqueous solution of K ₂ CO ₃ (4.61 ml, 9.22 mmol, 2.0 equiv.). The mixture was degassed and heated under argon at 100° C. for 6 hours. The reaction mixture was cooled to RT and filtered. The precipitate was washed with Et ₂ O and water, then dried under vacuum to give 0.89 g (60%) of 2(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl -pyrido[1,2-a]pyrimidin-4-one in the form of a light brown precipitate. MS m/z 324.4 [M+H] ⁺ .

Example 1

2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-(4-methylpiperazin-1-yl)pyrido[1,2-a]pyrimidin-4-one

In a closed tube, 7-fluoro-2-(2-methylimida-αzo[1,2-b]pyridαzin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 35 mg, 0.119 mmol) and 1-methylpiperazine (47.5 mg, 0.474 mmol, 4 equiv.) were stirred in DMSO (1 ml) at 120°C overnight. LC-MS showed complete conversion. The solvent was removed in high vacuum. The crude product was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 9/1) to give the title product (25 mg, 56%) as a light yellow solid. MS m/z 376.3 [M+H+].

Example 2

7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methylimidazo[1,2-b ]pyridazin-6-yl)pyrido[1,2-а]pyrimidin-4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 125 mg, 0.426 mmol) and (R)-octahydropyrrolo-[1,2-a]pyαzine (160 mg, 1.27 mmol, 3 equiv.) were stirred in DMSO (5 ml) at 125°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude product was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=98/2 to 95/5) to give the title product (65 mg, 38%) as a light yellow solid. MS m/z 402.5 [M+H+].

Example 3

7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dimethylimidazo[1,2 -b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin- 14 040467

4-one (intermediate 2; 200 mg, 0.647 mmol) and (S)-octahydropyrrolo-[1,2-a]pyrazine (286 mg, 2.26 mmol, 3.5 equiv.) were stirred in DMSO (5 ml) at 125° C during the night. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH2Cl2/MeOH=98/2 to 95/5) to give the title product (115 mg, 43%) as a light yellow solid. MS m/z 416.3 [M+H+].

Example 4

7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dimethylimidazo[1,2b ]pyridazin-6-yl)pyrido[1,2-а]pyrimidin-4-one

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 200 mg, 0.647 mmol), DIPEA (0.113 ml, 0.67 mmol, 1 equiv.) and (R)octahydropyrrolo-[1,2-а]pyrazine (245 mg, 1.95 mmol, 3.0 equiv.) were stirred in DMSO (2.5 ml) at 125° C during the night. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=98/2 to 95/5) to give the title product (132 mg, 49%) as a light yellow precipitate. MS m/z 416.3 [M+H+].

Example 5

7-[(8aS)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dimethylimidazo[1,2b ]pyridazin-6-yl)pyrido[1,2-а]pyrimidin-4-one

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 90 mg, 0.291 mmol), DIPEA (0.05 ml, 0.29 mmol, 1 equiv.) and (S)-8-methyloctahydropyrrolo[1,2-a]pyrazine (81 mg, 0.58 mmol, 2.0 equiv.) were stirred in DMSO (2.5 ml) at 125° C during the night. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (55 mg, 44%) as a light yellow precipitate. MS m/z 430.3 [M+H+].

Example 6

7-[(8aR)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dimethylimidazo[1,2b ]pyridazin-6-yl)pyrido[1,2-а]pyrimidin-4-one

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 90 mg, 0.291 mmol), DIPEA (0.05 ml, 0.29 mmol, 1 equiv.) and (R)-8-methyloctahydropyrrolo[1,2-а]pyrazine (81 mg, 0.58 mmol, 2.0 equiv.) were stirred in DMSO (2.5 ml) at 125° C during the night. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO3 solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo.

The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5

- 15 040467 to 90/10) to give the title product (50 mg, 40%) as a light yellow precipitate. MS m/z 430.4 [M+H+].

Example 7

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5R)-3,5-dimethylpiperazin-1-yl]pyrido[1,2а]pyrimidin-4 -He

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 50 mg, 0.162 mmol), and cis-2,6-dimethylpiperazine (74 mg, 0.647 mmol, 4.0 equiv.) was stirred in DMSO (1.5 ml) at 110°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (32 mg, 49%) as a light yellow solid. MS m/z 404.4 [M+H+].

Example 8

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]pyrido[1,2а]pyrimidin-4-one

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 33 mg, 0.107 mmol), and (S)-2-methylpiperazine (43 mg, 0.427 mmol, 4.0 equiv.) was stirred in DMSO (2 ml) at 120°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH2Cl2 and washed with aqueous saturated NaHCO3 solution. The organic layer was separated and dried over Na2SO4 and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (18 mg, 43%) as a light yellow precipitate. MS m/z 390.3 [M+H+].

Example 9

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]pyrido[1,2а]pyrimidin-4-one

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 85 mg, 0.275 mmol), and (R)-2-methylpiperazine (110 mg, 1.10 mmol, 4.0 eq.) was stirred in DMSO (5 ml) at 120°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na2SO4 and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (35 mg, 33%) as a light yellow solid. MS m/z 390.3 [M+H+].

Example 10

7-(1,4-diazepan-1-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-а]pyrimidin-4-one

- 16 040467

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 33 mg, 0.107 mmol), and 1,4-diazepane (32 mg, 0.320 mmol, 3.0 equiv.) was stirred in DMSO (2 ml) at 120°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (20 mg, 48%) as a light yellow precipitate. MS m/z 390.3 [M+H+].

Example 11.

2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]pyrido[1,2-a]pyrimidin4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 50 mg, 0.169 mmol), and (S)-2-methylpiperazine (68 mg, 0.677 mmol, 4.0 equiv.) was stirred in DMSO (2 ml) at 110°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH2Cl2 and washed with aqueous saturated NaHCO3 solution. The organic layer was separated and dried over Na2SO4 and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (40 mg, 63%) as a light yellow solid. MS m/z 376.2 [M+H+].

Example 12.

2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]pyrido[1,2-a]pyrimidin4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 50 mg, 0.169 mmol), and (R)-2-methylpiperazine (68 mg, 0.677 mmol, 4.0 eq.) was stirred in DMSO (2 ml) at 110°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (48 mg, 75%) as a light yellow precipitate. MS m/z 376.3 [M+H+].

Example 13

7-(1,4-diazepan-1-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 50 mg, 0.169 mmol), and 1,4-diazepane (68 mg, 0.677 mmol, 4.0 equiv.) was stirred in DMSO (2 ml) at 110°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH2Cl2 and washed with aqueous saturated NaHCO3 solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The unrefined residue was cleared

- 17 040467 by column chromatography (SiO2, CH2Cl2/MeOH=95/5 to 90/10) to give the title product (41 mg, 65%) as a light yellow precipitate. MS m/z 376.2 [M+H+].

Example 14

7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4 -He

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 50 mg, 0.169 mmol), and cis-2,6-dimethylpiperazine (77 mg, 0.677 mmol, 4.0 equiv.) was stirred in DMSO (2 ml) at 110°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (41 mg, 62%) as a light yellow solid. MS m/z 390.3 [M+H+].

Example 15

7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methylimidazo[1,2-b ]pyridazin-6-yl)pyrido[1,2-а]pyrimidin-4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 50 mg, 0.169 mmol), and (S)-octahydropyrrolo[1,2-a]pyrazine (85 mg, 0.677 mmol, 4.0 equiv.) were stirred in DMSO (2 ml) at 125°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (36 mg, 53%) as a light yellow precipitate. MS m/z 402.3 [M+H+].

Example 16

7-[(8aS)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methylimidazo[1,2-b ]pyridazin-6-yl)pyrido[1,2-а]pyrimidin-4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 50 mg, 0.169 mmol) and (S)-8a-methyloctahydropyrrolo[1,2-a]pyrazine (95 mg, 0.677 mmol, 4.0 equiv.) were stirred in DMSO (2 ml) at 125°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO2, CH2Cl2/MeOH=95/5 to 90/10) to give the title product (45 mg, 64%) as a light yellow solid. MS m/z 416.3 [M+H+].

Example 17.

7-[(8aR)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methylimidazo[1,2-b ]pyridazin-6-yl)pyrido[1,2-а]pyrimidin-4-one

- 18 040467

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 100 mg, 0.339 mmol) and (R)-8a-methyloctahydropyrrolo[1,2-a]pyrazine (190 mg, 1.35 mmol, 4.0 eq.) were stirred in DMSO (4 ml) at 125°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH2C12 and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH2C12 'MeOH=955 to 90/10) to give the title product (45 mg, 64%) as a light yellow solid. MS m/z 416.3 [M+H+].

Example 18.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-pyrrolidin-1-ylpyrrolidin-1-yl]pyrido[1,2-a]pyrimidine -4-he

In the microwave, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2a]pyrimidin-4-one (intermediate 2; 45 mg, 0.145 mmol), (R)-1,3'-bipyrrolidine dihydrochloride (62 mg, 0.291 mmol, 2.0 eq.) and DIPEA (0.20 ml, 1.16 mmol, 8 eq.) were stirred in NMP (3 ml) at 220°C in for 1 h. The solvent was removed under high vacuum. The residue was dissolved in CH2C12 and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH2C12 'MeOH=98 2 to 90/10) to give the title product (25 mg, 40%) as a light yellow solid. MS m/z 430.3 [M+H+].

Example 19.

7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 50 mg, 0.169 mmol), DIPEA (0.24 ml, 1.35 mmol, 8 equiv.) and 4,7diazaspiro[2.5]octane dihydrochloride (62.7 mg, 0.339 mmol, 2.0 equiv.) were stirred in DMSO (2 ml) at 125°C for 2 days . The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH2C12 MeOH=955 to 90/10) to give the title product (22 mg, 33%) as a light yellow solid. MS m/z 388.3 [M+H+].

Example 20.

7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4 -He

- 19 040467

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 50 mg, 0.162 mmol), DIPEA (0.22 ml, 1.29 mmol, 4 equiv.) and 4,7diazaspiro[2.5]octane dihydrochloride (32 mg, 0.320 mmol, 3.0 equiv.) were stirred in DMSO (2 ml) at 130°C for 48 h The solvent was removed under high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=98/2 to 95/5) to give the title product (12 mg, 18%) as a light yellow precipitate. MS m/z 402.3 [M+H+].

Example 21.

2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-pyrrolidin-1-ylpyrrolidin-1-yl]pyrido[1,2a]pyrimidin-4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 40 mg, 0.135 mmol), DIPEA (0.19 ml, 1.08 mmol, 8 equiv.) and (R)-1,3'bipyrrolidine dihydrochloride (58 mg, 0.271 mmol, 2.0 equiv.) were stirred in DMSO (4 ml) and heated at 220°C for 40 min in the microwave. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=98/2 to 90/10) to give the title product (30 mg, 53%) as a light yellow solid. MS m/z 416.3 [M+H+].

Example 22.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-(3,3-dimethylpiperazin-1-yl)pyrido[1,2-a]pyrimidin-4-one

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 40 mg, 0.129 mmol) and 2,2-dimethylpiperazine (59 mg, 0.517 mmol, 4.0 equiv.) were stirred in DMSO (1.6 ml) at 130°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 9/1) to give the title product (29 mg, 55%) as a light yellow precipitate. MS m/z 404.3 [M+H+].

Example 23.

7-(3,3-dimethylpiperazin-1-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin4-one

- 20 040467

In a closed tube, 7-fluoro-2-(2-methylimida-αzo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 40 mg, 0.135 mmol) and 2,2-dimethylpiperazine (62 mg, 0.542 mmol, 4.0 equiv.) were stirred in DMSO (2 ml) at 130°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH2Cl2 MeOH=955 to 90/10) to give the title product (26 mg, 49%) as a light yellow solid. MS m/z 390.3 [M+H+].

Example 24.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3S)-3-methylpiperazin-1-yl]pyrido[1,2a]pyrimidin-4 -He

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2a]pyrimidin-4-one (intermediate 4; 50 mg, 0.155 mmol) and (S)-2-methylpiperazine (62 mg, 0.619 mmol, 4.0 equiv.) were stirred in DMSO (2 ml) at 125°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (45 mg, 72%) as a light yellow solid. MS m/z 404.3 [M+H+].

Example 25.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3R)-3-methylpiperazin-1-yl]pyrido[1,2a]pyrimidin-4 -He

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2a]pyrimidin-4-one (intermediate 4; 50 mg, 0.155 mmol) and (R)-2-methylpiperazine (62 mg, 0.619 mmol, 4.0 equiv.) were stirred in DMSO (2 ml) at 125°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (40 mg, 70%) as a light yellow precipitate. MS m/z 404.3 [M+H+].

Example 26.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-9-methylpyrido[1,2- a]pyrimidin-4-one

- 21 040467

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2a]pyrimidin-4-one (intermediate 4; 50 mg, 0.155 mmol) and cis-2,6-dimethylpiperazine (70 mg, 0.619 mmol, 4.0 equiv.) were stirred in DMSO (2 ml) at 125°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (26 mg, 40%) as a light yellow precipitate. MS m/z 418.3 [M+H+].

Example 27.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-(3,3-dimethylpiperazin-1-yl)-9-methyl-pyrido[1,2а]pyrimidin-4- He

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2a]pyrimidin-4-one (intermediate 4; 50 mg, 0.155 mmol) and 2,2-dimethylpiperazine (35 mg, 0.309 mmol, 2.0 equiv.) were stirred in DMSO (2 ml) at 125°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO3 solution. The organic layer was separated and dried over Na2SO4 and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (36 mg, 56%) as a light yellow precipitate. MS m/z 418.3 [M+H+].

Example 28.

7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methylpyrido [1,2- a]pyrimidin-4-one

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2a]pyrimidin-4-one (intermediate 4; 50 mg, 0.155 mmol), DIPEA (0.21 ml, 1.24 mmol, 8 equiv.) and 4,7-diazaspiro[2.5]octane dihydrochloride (57 mg, 0.309 mmol, 2.0 equiv.) were stirred in DMSO (2 ml) at 125 °C within 2 days. The solvent was removed in high vacuum. The residue was dissolved in CH2Cl2 and washed with aqueous saturated NaHCO3 solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (17 mg, 26%) as a light yellow solid. MS m/z 416.3 [M+H+].

Example 29.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5S)-3,5-dimethylpiperazin-1-yl]pyrido[1,2-а]pyrimidine -4-he

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimidin4-one (intermediate 2; 50 mg, 0.162 mmol), TEA (0.18 ml, 1.29 mmol, 8 equiv.) and (2S,6S)-2,6dimethylpiperazine dihydrochloride (90 mg, 0.485 mmol, 3.0 equiv.) were stirred in DMSO (2 ml) at 140°C for night. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO3 solution. The organic layer was separated and dried over Na2SO4 and

- 22 040467 concentrated under vacuum. The crude residue was purified by column chromatography (SiO2, CH2Cl2 MeOH=95 5 to 9/1) to give the title product (20 mg, 30%) as a light yellow solid. MS m/z 404.3 [M+H+].

Example 30.

2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-pyrrolidin-1-ulpyrrolidin-1-yl]pyrido [1,2-a]pyrimidine -4-he

Yes J < ^N \—'o

In a closed tube, 2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-ul)-7-fluoro-nurido[1,2-a]pyrimidin4-one (intermediate 2; 50 mg, 0.162 mmol), DIPEA (0.22 ml, 1.29 mmol, 8 equiv.) and (S)-1,3'bipyrrolidine dihydrochloride (103 mg, 0.485 mmol, 3.0 equiv.) were stirred in NMP (2 ml) at 140°C for night. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH2Cl2 MeOH=955 to 9/1) to give the title product (22 mg, 32%) as a light yellow solid. MS m/z 430.3 [M+H+].

Example 31.

2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-pyrrolidin-1-ulpyrrolidin-1-yl]pyrido[1,2а]pyrimidin-4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 75 mg, 0.254 mmol), TEA (0.28 ml, 2.03 mmol, 8 equiv.) and (S)-1,3'bipyrrolidine dihydrochloride (162 mg, 0.762 mmol, 3.0 equiv.) were stirred in NMP (4 ml) and heated at 220°C for 1 hour in the microwave. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH2Cl2 MeOH=95 5 to 90/10) to give the title product (12 mg, 11%) as a light yellow precipitate. MS m/z 416.2 [M+H+].

Example 32.

7-[(3S,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2а]pyrimidin-4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin4-one (intermediate 1; 75 mg, 0.254 mmol), TEA (0.28 ml, 2.03 mmol, 8 equiv.) and (2S,6S)-2,6dimethylpiperazine dihydrochloride (143 mg, 0.762 mmol, 3.0 equiv.) were stirred in DMSO (3 ml) and heated at 140°C during the night. The solvent was removed in high vacuum. The residue was dissolved in CH2Cl2 and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na2SO4 and concentrated in vacuo. The crude residue was purified by column

- 23 040467 chromatography (SiO ₂ , CH2Cl2/MeOH=95/5 to 90/10) to give the title product (10 mg, 10%) as a light yellow precipitate. MS m/z 390.3 [M+H+].

Example 33.

9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]pyrido[1,2-а]pyrimidin-4 -He

In a closed tube, 7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2a]pyrimidin-4-one (intermediate 3; 250 mg, 0.808 mmol), and (S)-2-methylpiperazine (405 mg, 4.04 mmol, 5.0 eq.) was stirred in DMSO (6 ml) and heated at 130°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 85/15) to give the title product (135 mg, 43%) as a light yellow solid. MS m/z 390.3 [M+H+].

Example 34.

9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]pyrido[1,2-a]pyrimidin-4 -He

In a closed tube, 7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one (intermediate 3; 250 mg, 0.808 mmol), and (R)-2-methylpiperazine (405 mg, 4.04 mmol, 5.0 eq.) were stirred in DMSO (6 ml) and heated at 130°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 85/15) to give the title product (100 mg, 32%) as a light yellow solid. MS m/z 390.3 [M+H+].

Example 35.

7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido [1,2-a ]pyrimidin-4-one

In a closed tube, 7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one (intermediate 3; 250 mg, 0.808 mmol), and (2S,6R)-2,6-dimethylpiperazine (461 mg, 4.04 mmol, 5.0 equiv.) were stirred in DMSO (6 ml) and heated at 130°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 85/15) to give the title product (101 mg, 31%) as a light yellow solid. MS m/z 404.3 [M+H+].

Example 36.

7-(3,3-dimethylpiperazin-1-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one

- 24 040467

In a closed tube, 7-fluoro-9-methyl-2-(2-methylimidαzo[1,2-b]pyridazin-6-ul)pyrido[1,2-a]pyrimidin-4-one (intermediate 3; 250 mg, 0.808 mmol) and 2,2-dimethylpiperazine (461 mg, 4.04 mmol, 5.0 equiv.) were stirred in DMSO (6 mL) and heated at 130°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 85/15) to give the title product (120 mg, 36%) as a light yellow solid. MS m/z 404.3 [M+H+].

Example 37.

7-(4,7-diazaspiro[2.5]octan-7-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2а]pyrimidin-4 -He

In a closed tube, 7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one (intermediate 3; 125 mg, 0.404 mmol), K ₂ CO ₃ (223 mg, 1.62 mmol, 4 equiv.) and 4,7-diazaspiro[2.5]octane dihydrochloride (112 mg, 0.606 mmol, 1.5 equiv.) were stirred in DMA (2 ml) and heated at 130°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na ₂ SO ₄ and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (75 mg, 46%) as a light yellow precipitate. MS m/z 402.2 [M+H+].

Example 38.

7-[(3S,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido [1,2-a ]pyrimidin-4-one

In a closed tube, 7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one (intermediate 3; 125 mg, 0.404 mmol), K ₂ CO ₃ (223 mg, 1.62 mmol, 4 equiv.) and (2S,6S)-2,6-dimethylpiperazine dihydrochloride (113 mg, 0.606 mmol, 1.5 equiv.) were stirred in DMA (2 ml) and heated at 130°C overnight. The solvent was removed in high vacuum. The residue was dissolved in CH ₂ Cl ₂ and washed with aqueous saturated NaHCO ₃ solution. The organic layer was separated and dried over Na2SO4 and concentrated in vacuo. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 90/10) to give the title product (50 mg, 31%) as a light yellow precipitate. MS m/z 404.3 [M+H+].

Example 39.

7-[(3R)-3-ethylpiperazin-1-ul]-2-(2-methylimidazo[1,2-b]pyridazin-6-ul)pyrido[1,2-a]pyrimidin4-one

In a closed tube, 7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (intermediate 1; 200 mg , 0.677 mmol), K ₂ CO ₃ (374 mg, 2.71 mmol, 4 equiv.)

- 25 040467 and (R)-2-ethylpiperazine dihydrochloride (238 mg, 0.606 mmol, 1.5 eq.) was stirred in DMA (3 ml) at 100°C for 4 days. The solvent was removed in high vacuum. The crude residue was purified by column chromatography (SiO ₂ , CH ₂ Cl ₂ /MeOH=95/5 to 8/2) to give the title product (168 mg, 64%) as a light yellow solid. MS m/z 390.2 [M+H+].

biological examples.

To further describe and facilitate understanding of the invention, the following non-limiting examples of biological activity testing are provided to more fully illustrate the scope of the invention, but these examples should not be construed as specific limitations on the scope of the invention. For a person skilled in the art it is obvious that such variants of the present invention, which may be known at the moment or will be created in the future, are included in the scope of the present invention defined by the claims. These examples illustrate the in vitro and/or in vivo bioactivity testing of specific compounds described herein and demonstrate the usefulness of the compounds in the treatment of spinal muscular atrophy by enhancing incorporation of exon 7 of the SMN2 gene into mRNA transcribed from the SMN2 gene. The compounds of formula (I) enhance the incorporation of exon 7 of the SMN2 gene into mRNA transcribed from the SMN2 gene and increase the levels of the Smn protein produced from the SMN2 gene, and therefore can be used to treat spinal muscular atrophy in patients in need thereof. These examples further illustrate in vitro and/or in vivo testing of some of the compounds described herein and demonstrate the utility of the claimed compounds in enhancing incorporation of exon 7 of SMN1 into mRNA transcribed from the SMN1 gene. Accordingly, the compounds of formula (I) also enhance the incorporation of exon 7 SMN1 into mRNA transcribed from the SMN1 gene and increase the levels of Smn protein derived from the SMN1 gene.

Example 1 Investigation of SMN2 mRNA minigene splicing in cultured cells by RT-qPCR.

A quantitative reverse transcription polymerase chain reaction (RT-qPCR) assay is used to quantify the level of full-length SMN2 mRNA minigene containing SMN2 exon 7 in a HEK293H cell line stably transfected with said minigene and treated with a test compound. The materials used and the corresponding sources are shown in Table. 1.

Table 1. Materials and their respective sources used for RT-qPCR testing of SMN2 mRNA minigene splicing in cultured cells

Material Source HEK293H cells Life Technologies Inc. (former Invitrogen) Catalog No.: 11631-017 Cells-To-Ct Lysis Buffer Life Technologies Inc. (former Applied Biosystems) Catalog No.: 4399002 DMEM (Dulbecco's Modified Eagle's Medium) Life Technologies Inc. (former Invitrogen) Catalog No.: 11960-044 96 well flat bottom plates Becton Dickinson Catalog No.: 353072 A mixture of enzymes for carrying out RT-PCR Life Technologies Inc. (formerly Applied Biosystems) part # 4388520 (also included in AgPath-ID kit Catalog No.: 4387391) Buffer for RT-PCR Life Technologies Inc. (formerly Applied Biosystems) part # 4388519 (also included in AgPath-ID kit Catalog No.: 4387391) AgPath-ID kit for one-step RT-PCR Life Technologies Inc. (former Applied Biosystems) Catalog No.: 4387391 Thermal cycler Life Technologies Inc. (former Applied Biosystems) 7900HT

The SMN2-A minigene construct was prepared as described in WO 2009/151546 A1 p. 145 paragraph [00400] to p. 147 paragraph [00412] (including FIGS. 1 and 3).

HEK293H cells (10,000 cells/well) stably transfected with the SMN2-A minigene construct were seeded in 200 µl of cell culture medium (DMEM plus 10% FBS with 200 µg/ml hygromycin) in 96-well flat bottom plates, and the tablet immediately starts to rotate,

- 26 040467 in order to ensure adequate dispersion of the cells to form a uniform monolayer of cells. Cells coalesce for at least 4-6 hours. Test compounds are serially diluted 3.16-fold in 100% DMSO to obtain a 7-point concentration curve. Test compound solution (1 μl, 200x in DMSO) is added to each well containing cells and the plate is incubated for 24 hours in a cell culture incubator (37° C., 5% FCC, 100% relative humidity). Carry out two repetitions for each concentration of the test compound. The cells are then lysed in Cells-To-Ct lysis buffer and the lysate is stored at -80°C.

The full-length SMN2-A minigen and GAPDH mRNA are quantified using the following primers and probes shown in Table 1. 2. Primer SMN forward A (SEQ ID NO:1) hybridizes the nucleotide sequence in exon 7 (from nucleotide 22 to nucleotide 40), primer SMN reverse A (SEQ ID NO:2) hybridizes the nucleotide sequence in the coding sequence of firefly luciferase, SMN probe A (SEQ ID NO:3) hybridizes the nucleotide sequence in exon 7 (nucleotide 50 to nucleotide 54) and exon 8 (nucleotide 1 to nucleotide 21). The combination of these three oligonucleotides will only detect SMN1 or SMN2 minigenes (RT-qPCR) and will not detect endogenous SMN1 or SMN2 genes.

table 2

Primer/Probe Sequences Source SMN Forward Primer A SEQID NO. 1: GAAGGAAGGTGCTCACATT PTC ¹ SMN Reverse primer A SEQID NO. 2: TCTTTATGI I I I I GGCGTCTTC PTC ¹ SMN Straight Probe A SEQID NO. 3:6FAM- AAGGAGAAAATGCTGGCAT AGAGCAGC-TAM RA PTC ¹ hGAPDH Reverse Probe SEQID NO. 4: VIC- CGCCTGGTCACCAGGGCTGCT-TAMRA ^LTI2 hGAPDH Forward primer SEQID NO. 5: CAACGGATTTGGTCGTATTGG ^LTI2 hGAPDH Reverse primer SEQID NO. 6: TGATGGCAACAATATCCACTTTACC ^LTI2

¹ primers and probes designed by PTC Therapeutics, Inc.;

² purchased from Life Technologies, Inc. (former Invitrogen).

SMN forward and reverse primers are used at final concentrations of 0.4 μM. The SMN probe is used at a final concentration of 0.15 μM. GAPDH primers are used at final concentrations of 0.2 μM and probe at 0.15 μM.

SMN2-GAPDH minigen mix (15 µl total volume) is prepared by mixing 7.5 µl 2x RT-PCR buffer, 0.4 µl 25x RT-PCR enzyme mix, 0.75 µl 20x GAPDH primer-probe mix, 4.0075 µl of water, 2 µl of 10-fold diluted cell lysate, 0.06 µl of 100 µM SMN forward primer, 0.06 µl of 100 µM SMN reverse primer, and 0.225 µl of 100 µM SMN probe PCR is carried out at the following temperatures for the indicated times : stage 1: 48°C (15 min); stage 2: 95°C (10 min); stage 3: 95°C (15 s); stage 4: 60°C (1 min); then repeat steps 3 and 4 in total for 40 cycles.

Each reaction mixture contains sets of both SMN2-A minigene and GAPDH primer/probes (multiplex method), which allows the levels of two transcripts to be measured simultaneously.

The increase in SMN2mini FL mRNA relative to placebo control cells is determined from real-time polymerase chain reaction data using a modified AACt method (described in Livak and Schmittgen, Methods, 2001, 25:402-8). Amplification efficiency E is calculated from the slope of the amplification curve for SMN2mini FL and GAPDH for each. The relative abundances of SMN2mini FL and GAPDH are then calculated using the formula (1+E) ^-Ct where Ct is the threshold value for each amplicon. The relative content of SMN2mini FL is normalized relative to the content of GAPDH. The normalized content of SMN2mini FL in the samples treated with the test compound is then divided by the normalized content of SMN2mini FL mRNA in cells treated with the control to determine the level of SMN2 FL mRNA relative to the control.

In table. 3 shows EC1 concentrations. _5x for the production of full-strand mRNA of the SMN2 minigene, which was obtained from the 7-point data curve obtained in accordance with the above methodology for specific compounds of the present invention.

Specific compounds of the present invention showed a concentration to obtain a full chain concentration of EC1. _5x to obtain full-strand mRNA of the SMN minigene<1 μM.

- 27 040467

More specific compounds of the present invention showed a concentration to obtain a full chain concentration of EC1. _5x to obtain full-strand mRNA minigene SMNR<0.1 µM.

The most specific compounds of the present invention showed a concentration to obtain a full chain concentration of EC1.5x to obtain a full chain mRNA of the SMNR minigene<0.02 μM.

Table 3. EC _1.5x concentrations for obtaining full-length mRNA of the SMN2 minigene

Example eu _15x mi ni gene (nM) Example eu _15x minigen (nM) Example eu _15x minigen (nM) 1 3.5 14 4.1 27 39.9 2 3.8 15 4 28 5 3 3.2 16 1.1 29 0.3 4 1.8 17 6.4 thirty 3 5 0.6 18 3.6 31 6.7 6 2.8 19 10.2 32 1.6 7 3.7 20 4.3 33 0.5 8 0.3 21 9.6 34 0.9 9 0.1 22 0.9 35 4.7 10 6.4 23 3.4 36 5 eleven 1.4 24 0.4 37 4.4 12 1.2 25 0.5 38 0.3 13 5 26 327 39 0.9

Example 2 Analysis of SMN protein in cultured cells.

Time resolved homogeneous fluorescence (HTRF) SMN assay is used to quantify the level of Smn protein in fibroblast cells from a patient suffering from spinal muscular atrophy treated with test compounds. The materials used and the corresponding sources are shown in Table. 4 below.

Table 4. Materials used and corresponding sources used for the analysis of SMN protein in cultured cells

Material Source Human cells with SMA type 1 GM03813 (Coriell Institute) Protease Inhibitor Blend Roche Applied Science Catalog No. 11836145001 Anti-SMN d2 Blue cap Cisbio Catalog No. 63IDC002-SMN Anti-SMN cryptate Red cap Cisbio Catalog No. 63IDC002-SMN SMN dissolution buffer Cisbio Catalog No. 63IDC002-SMN-Buffer DMEM Life Technologies (formerly Invitrogen) Catalog No. 11960044 RIPA lysis buffer 20 mM Tris-HCI pH 7.5, 150 mM NaCI, 1 mM EDTA, 1% Thermo Scientific NP-40 Surfact-Amps Detergent Solution (Fisher Scientific, Pittsburgh/PA), 1% sodium dioxychlorate dilution buffer 20 mM Tris-HCI pH 7.5, 150 mM NaCI Envision tablet reader Perkin Elmer Model #2103

Cells are thawed and cultured in DMEM-10% FBS for 72 hours. Cells are trypsinized, counted and resuspended to a concentration of 25,000 cells/ml in DMEM-10% FBS. Cell suspensions were seeded at a density of 5000 cells/well in a 96-well microtiter plate and incubated for 3 to 5 hours. Test compounds were serially diluted 3.16-fold in 100% DMSO to obtain a 7-point concentration curve. 1 µl of the test compound solution is transferred to the wells containing the cells and the cells are incubated for 48 hours in a cell culture incubator (37° C., 5% FCC, 100% relative humidity). For each end

- 28 040467 For the test compound, a sample is used in triplicate. After 48 hours, remove the supernatant from the wells and add 25 µl of RIPA lysis buffer containing protease inhibitors to the wells and incubate with shaking at room temperature for 1 hour. a plate in which each well contains 5 µl of antibody solution (1:100 dilution of anti-SMN d2 and anti-SMN cryptate in SMN dissolution buffer). The plate is centrifuged for 1 min to allow the solution to reach the bottom of the wells, then incubated overnight at room temperature. Fluorescence is measured for each well of the plate at 665 and 620 nm on an Envision Multilabel plate reader (Perkin-Elmer).

Calculate the normalized fluorescent signal for each sample, clean well, and vehicle control by dividing the signal at 665 nm by the signal at 620 nm. Signal normalization takes into account possible fluorescence quenching due to the influence of the lysate matrix. Calculate the ΔF value (measurement of Smn protein content) for each sample well by subtracting the normalized mean fluorescence for clean wells from the normalized fluorescence for each sample well and then dividing this difference by the normalized mean fluorescence for clean wells. The resulting ΔF value for each sample well represents the Smn protein content of the samples treated with the test compound. The AF value for each sample well is divided by the ΔF value for the vehicle control wells to calculate the fold increase in Smn protein relative to the vehicle control. In table. 5 shows the concentration values of EC1. _5x for Smn protein expression, which were evaluated from 7 concentration data obtained for each test compound in accordance with the above method for testing biological activity for specific compounds of the present invention.

Specific compounds of the present invention showed the concentration of EC1. _5x for SMN protein expression<1 μM.

More specific compounds of the present invention showed the concentration of EC1. _5x for SMN <100 nM protein expression.

More specific compounds of the present invention showed the concentration of EC1. _5x for SMN <30 nM protein expression.

In table. 6 shows the maximum fold increase in SMN protein, which was estimated from the 7 data obtained for each test compound in accordance with the above method for testing biological activity for specific compounds of the present invention.

Specific compounds of the present invention showed a maximum magnification of >1.5.

Specific compounds of the present invention showed a maximum magnification of >1.7.

Specific compounds of the present invention showed a maximum magnification of >1.8.

Table 5. EC ₁ concentrations. _5x for SMN protein expression

Example EC1.5x SMN protein (nM) Example EC1.5x SMN protein (nM) Example EC1.5x SMN protein (nM) 1 10.8 14 17.6 27 126.5 2 19.8 15 21.2 28 49.7 3 25.6 16 3 29 2.1 4 15.7 17 20.2 thirty 13.6 5 4.1 18 25 31 27.7 6 eleven 19 29.8 32 4 7 15.5 20 37 33 4 8 5.9 21 68.7 34 4.4 9 2.5 22 13.8 35 19.5 10 22.8 23 23.9 36 34.4 eleven 7 24 4.7 37 45 12 7.5 25 11.9 38 3.1 13 3 26 1230 39 15.8

- 29 040467

Table 6. Maximal fold increase in SMN protein

Example Max. magnification magnification. Example Max. magnification magnification. Example Max. magnification magnification. 1 1.84 14 1.86 27 1.57 2 1.76 15 1.94 28 1.72 3 1.81 16 1.83 29 1.81 4 1.76 17 1.98 thirty 1.84 5 1.71 18 1.75 31 1.65 6 1.84 19 1.83 32 1.88 7 1.76 20 1.72 33 1.82 8 1.85 21 1.54 34 1.89 9 1.92 22 1.69 35 1.79 10 1.95 23 1.63 36 1.77 eleven 1.9 24 1.77 37 1.87 12 1.77 25 1.79 38 1.85 13 1.91 26 1.52 39 1.81

CLAIM

1. Process for the preparation of compounds of formula (I)

Claims (8)

CLAIM 1. Process for the preparation of compounds of formula (I) Where R ¹ is hydrogen or C _1-7 alkyl; R ² is hydrogen, cyano, C _1-7 alkyl, C _1-7 haloalkyl or C _3-8 cycloalkyl; R ³ is hydrogen, C _1-7 alkyl, or C _3-8 cycloalkyl; A represents Where X is N or CH; R ⁴ is hydrogen, C _1-7 alkyl or -(CH ₂ )m-NR ⁹ R ¹⁰ ; R ⁵ is hydrogen or C _1-7 alkyl; R ⁶ is hydrogen or C _1-7 alkyl; R ⁷ is hydrogen or C _1-7 alkyl; R ⁸ is hydrogen or C _1-7 alkyl; R ⁹ and R ¹⁰ are independently selected from hydrogen, C _1-7 alkyl and C _3-8 cycloalkyl; n is 0, 1 or 2; m is 0, 1, 2 or 3; or R ⁴ and R ⁵ together form C _1-7 alkylene; or R ⁴ and R ⁷ together form C _1-7 alkylene; or R ⁵ and R ⁶ together form C _2-7 alkylene; or R ⁵ and R ⁷ together form C _1-7 alkylene; or R ⁵ and R ⁹ together form C _1-7 alkylene; or R ⁷ and R ⁸ together form C _2-7 alkylene; or R ⁷ and R ⁹ together form C _1-7 alkylene; or R ⁹ and R ¹⁰ together form C _2-7 alkylene; - 30 040467 provided that if X is CH, then R ⁴ is -(CH ₂ ) _m -NR ⁹ R ¹⁰ ; and with the proviso that if X is N and R ⁴ is -(CH ₂ ) _m -NR ⁹ R ¹⁰ , then w is 2 or 3; wherein an aromatic nucleophilic substitution reaction is carried out between a compound of formula (VI) and a compound of formula M-A by heating in a solvent, where A, R ¹ , R ² and R ³ are as defined here, Y is halogen or trifluoromethanesulfonate, M is hydrogen, sodium or potassium, and where M is associated with A through the nitrogen atom. 2. The method according to claim 1, where the aromatic nucleophilic substitution reaction is carried out at a temperature of from 80 to 200°C. 3. The method according to any one of claims 1 or 2, wherein the solvent for the aromatic nucleophilic substitution reaction is selected from dimethyl sulfoxide, N-methylpyrrolidone and dimethylformamide. 4. Method according to any of pi. 1-3, where M is hydrogen. 5. The method according to any one of claims 1 to 4, wherein R ¹ is methyl. 6. Method according to any of pi. 1-5, where R ² represents hydrogen or methyl. 7. The method according to any one of claims 1 to 6, where R ³ represents hydrogen or methyl. 8. Method according to any of pi. 1-7, where A is selected from the group: