EA038300B1 - IL-1Ra CDNAs - Google Patents

Abstract

The invention relates to compositions and methods for treatment of degenerative conditions of large weight-bearing joints, such as osteoarthritis, by intra-articular delivery of a codon-modified IL-1Ra encoding gene.

Description

Related applications

This application claims priority in accordance with U.S. Provisional Application No. 62/431336, filed December 7, 2016, and U.S. Provisional Application No. 62/486944, filed April 18, 2017, the entire disclosures of which are incorporated herein by reference.

Governmental support

The present invention was made with government support from the National Institutes of Health in accordance with AR048566. The state has certain rights in the present invention.

Prior art of the present invention

Osteoarthritis (OA) is a degenerative, severe pathological condition of the supporting joints. The pathology of OA is marked by gradual intractable erosion of the articular cartilage, the development of osteophytes at the border of the joints, sclerotic proliferation of subchondral bone tissue, synovitis, and in many cases synovitis and joint effusion. OA is incurable, difficult to regulate, and often progresses to dysfunctional joint failure. In horses, osteoarthritis is not only a problem for older individuals, but also for young horses.

Brief disclosure of the present invention

There is strong evidence that interleukin-1 (IL-1) acts as an intra-articular mediator of loss, pain and inflammation of joint tissue in pathological conditions of large supporting joints such as osteoarthritis (OA). Its natural inhibitor, an antagonist of the IL-1 receptor (IL-1Ra), is promising as an effective treatment, but clinical use is slowing down due to the difficulty of achieving and maintaining effective concentrations of IL-1Ra using standard drug delivery methods.

The present disclosure relates at least in part to the development of codon-modified genes encoding horse IL-1Ra (eqIL-1Ra) and human IL-1Ra (hIL-1Ra), and the discovery that intra-articular delivery of a codon-modified gene encoding eqIL -1Ra, results in significant increases in steady-state eqIL-1Ra levels in synovial fluid, e.g., more than 100 times baseline over a period of at least 6 months in equine subjects, and results in decreased lameness, joint effusion and synovitis in equine model OA. The codon-modified gene encoding eqIL-1Ra provides higher levels of eqIL-1Ra expression as compared to the native or endogenous gene, with no change in the amino acid sequence of the eqIL-1Ra protein. Likewise, the expression of IL1Ra using the codon-modified human IL-1Ra cDNA was approximately 2-4 times that of the native human IL-1Ra sequence. The present disclosure also relates to the discovery that, significantly different from healthy joints, transgenic expression after treatment is much higher in the affected synovium, especially in areas of inflammation and synovitis, compared to healthy or unaffected tissue. This phenomenon leads to the fact that the highest levels of IL1Ra are formed in animals with the most severe general pathology.

As a result of the delivery of IL-1Ra cDNA into cells that are resident in the tissues of the joints (for example, in humans, horses, or other animals), and the provision of high levels of independent expression, the biosynthetic apparatus of modified cells is aimed at overproduction and continuous secretion of the transgenic IL-1Ra protein into the synovial fluid and surrounding tissue. Thus, the affected joint becomes an endogenous focus of long-term increased production of IL-1Ra, eliminating the need for repeated use of the protein, while providing the highest concentration of the therapeutic drug specifically in the focus of the disease.

Accordingly, in accordance with some aspects, the present disclosure provides a recombinant nucleic acid comprising a codon-modified gene encoding IL-1Ra. In some embodiments, the IL-1Ra is equine. In some embodiments, the IL-1Ra is human. In some embodiments, the codon sequence of the modified gene encoding horse IL-1Ra is SEQ ID NO: 2. In some embodiments, the codon sequence of the modified gene encoding human IL-1Ra is SEQ ID NO: ten.

In some embodiments, the recombinant nucleic acid comprising a codon-modified gene encoding human eqIL-1Ra or IL-1Ra further comprises a Kozak sequence immediately upstream of the translation initiation site of the codon-modified gene. In some embodiments, the Kozak sequence and the gene encoding eq-IL-1Ra are SEQ ID NO: 3. In some embodiments, the Kozak sequence and the gene encoding human IL-1Ra are SEQ ID NO : 11. In some embodiments, the Kozak sequence further increases the level of IL expression

- 1 038300

Human 1Ra (hIL-1Ra) or eqIL-1Ra in joints (eg, human joints or equine joints, respectively).

In some embodiments, the recombinant nucleic acid containing the codon-modified eqIL-1Ra or hIL-1Ra gene further comprises a promoter upstream of the codon-modified gene encoding eqIL-1Ra or hIL-1Ra. In some embodiments, the promoter is a cytomegalovirus (CMV) immediate early promoter / enhancer. In some embodiments, the CMV immediate early promoter / enhancer has the sequence SEQ ID NO: 4.

In order to deliver a codon-modified gene encoding IL-1Ra, and to ensure continuous expression of the eqIL-1Ra protein in the joint over a long period, the use of an adeno-associated virus has been contemplated. Accordingly, in accordance with some aspects, provided herein is a recombinant adeno-associated virus (rAAV) particle comprising any of the nucleic acids disclosed herein. In some embodiments, the rAAV particle is self-complementary (i.e., the scAAV particle).

In some embodiments, the rAAV particle is of serotype 2.5. In some embodiments, the rAAV particle is serotype 2. In some embodiments, the rAAV particle containing the codon-modified eqIL-1Ra is AAV2.5. In some embodiments, the rAAV particle containing the codon-modified hIL-1Ra is AAV2. In accordance with some embodiments, the rAAV particle containing the codon-modified eqIL-1Ra is AAV2. In some embodiments, the rAAV particle containing the codon-modified hIL-1Ra is AAV2.5.

In accordance with some aspects, provided herein is a method for treating a degenerative condition of large supporting joints. This method provides for the introduction to a subject in need thereof, any of the rAAV particles disclosed in this document. In accordance with some embodiments, a method of treating a degenerative condition of large supporting joints comprises administering to a subject in need thereof a therapeutically effective amount of any of the rAAV particles disclosed herein.

In some embodiments, the degenerative condition of the large supporting joints is osteoarthritis. In some embodiments, the subject is a horse. In some embodiments, the subject is a human. In some embodiments, any of the rAAV particles disclosed herein are administered to a subject by intra-articular injection. In some embodiments, the equine subject is administered any of the rAAV particles disclosed herein that contains codon-modified equine IL-1Ra. In accordance with some embodiments, the human subject is administered any of the rAAV particles disclosed herein that contains codon-modified human IL-1Ra.

Brief Description of Drawings

The following drawings form part of the present description and are included to further demonstrate certain aspects of the present disclosure, which may be better understood by reference to one or more of these drawings in conjunction with a detailed description of specific embodiments presented herein. It should be understood that the data illustrated in the drawings does not in any way limit the scope of the present disclosure.

FIG. 1 depicts the codon-modified horse IL-1Ra cDNA sequence. This sequence of native horse IL-1Ra cDNA is shown above (SEQ ID NO: 1) and the modified sequence is shown below (SEQ ID NO: 2). The bases are numbered from the ATG translation initiation site to the translation termination codon. Nucleotide substitutions used for modification are indicated using colon characters. The sequence at the bottom indicates the Kozak consensus sequence (17) inserted immediately upstream of the translation initiation site. The modified sequence containing the Kozak consensus sequence is SEQ ID NO: 3.

FIG. 2A-2D depict in vitro and in vivo expression of the eqIL-1Ra transgene. FIG. 2A shows the level of eqIL-1Ra in conditioned media 48 h after transfection of equine synovial fibroblasts with the Hpa-trs-sk plasmid based on the scAAV vector containing the coding sequences for GFP, native eqIL-1Ra, codon-modified eqIL-1Ra (Opt) and codon modified eqIL-1Ra with Kozak leader sequence (K + Opt). n = 3 transfections. FIG. 2B depicts the level of eqIL-1Ra in conditioned media following infection of equine synovial fibroblasts with increasing doses of scAAV.eqIL-1Ra packaged in serotype 2.5. Viral genomes (vg) per cell in the case of scAAV.eqIL-1Ra are shown on the right. Parallel infection with 10 ⁵ vg / cell scAAV. GFP was used as negative control, n = 3 infections. FIG. 2C iso

- 2,038300 anatomical positions of the intercarpal (IC) and metacarpophalangeal (MCP) joints of the horse's forelimbs (arrowheads) (right) are marked. Horse wrist x-ray showing the intercarpal joint (arrow), the radius carpus (RC), and the forearm (*). FIG. 2D depicts the eqIL-1Ra level in e Growth Factor Rev 13, 323-340 (2002), saline, or scAAV.eqIL-1Ra at vg doses shown to the right of the respective graphs (n = 6 joints). Error bars represent ± SEM.

FIG. 3A-3O depict the locations and phenotypes of cells transduced with scAAV.GFP after intra-articular injection into healthy joints and joints affected by OA. Intercarpal (IC) joints of 3 healthy horses and 3 horses with late stage naturally occurring OA, injected with 5 x 10 ¹² vg scAAV.GFP. After two weeks, joint tissues were harvested and analyzed for fluorescence. Opposing joint-forming surfaces of exemplary healthy intercarpal joints (FIG. 3A) and inter-body joints affected by OA (FIG. 3B). The arrows in FIG. 3B denotes whole-body cartilage erosion; proliferation of osteophytes (*). FIG. 3C-3D depicts expression of scAAV.GFP in the villous synovium of a healthy joint. FIG. 3E-3F depict GFP expression on the synovial surface of an OA joint. FIG. 3C and 3E show freshly sampled tissues at 10x; in fig. 3D-3F shows cross-sections in paraffin at 20x. FIG. 3G-3H depicts the expression of scAAV.GFP in freshly harvested cartilage tissue sliced from a healthy joint. FIG. 31 depicts GFP activity in healthy cartilage chips after 48 exposure to explant culture. FIG. 3J-3K depicts GFP activity in freshly harvested cartilage cut from an OA joint. FIG. 3L depicts GFP activity in cartilaginous tissue affected by OA from an area with visible erosion. (Fig. 3G, 3I, 3J, 3L 10x; Fig. 3H, 3K 20x). FIG. 3M depicts GFP expression in cartilage clusters from a joint affected by OA (paraffin section). FIG. 3N depicts GFP activity in freshly harvested osteophyte tissue (10x). FIG. 30 depicts an exemplary expression of GFP in freshly harvested synovium tissue taken from the forearm carpal joint located immediately proximal to the intercarpal joint into which scAAV.GFP was injected. These images are a combination of 6 animals in both groups. A wide range of exposure times was used to record varying fluorescence intensities at different magnifications in burned tissue samples of various thicknesses and compositions. The contrast and brightness of the individual panels were adjusted in a linear fashion for a uniform appearance and to reflect the fluorescence intensities observed by direct microscopic examination.

FIG. 4A-4H depict GFP expression in tissues of horses affected by OA following intra-articular gene delivery by scAAV. Additional areas of interest based on the results described in FIG. 2. Intercarpal joints of 3 horses with late stage naturally occurring OA, injected with 5x 10 ¹² vg scAAV.GFP, and two weeks later, joint tissues were collected and analyzed for fluorescence. The expression of GFP in tissues with pathological changes characteristic of the formed OA was shown. FIG. 4A and 4B show GFP expression in inflamed synovial tissue by direct fluorescence microscopic examination of freshly harvested tissue. FIG. 4A is at 5x and FIG. 4B is shown at 20x. FIG. 4C and 4D depict GFP activity in OA cartilage from areas with visible erosion. Both are shown at 5x magnification. FIG. 4E-4G depicts GFP activity in chondrocyte clusters. FIG. 4E depicts direct fluorescence in freshly sampled chips (40x). FIG. 4F and 4G show paraffin sections (20x and 40x respectively). FIG. 4G depicts chondrocytes in several clusters, changing morphology in combination with the destruction of the surrounding matrix. FIG. 4H shows GFP expression in freshly harvested osteophyte tissue (20x).

FIG. 5A-5G depict intra-articular delivery and expression of the scAAV.eqIL-1Ra gene in an OCF horse model of OA. FIG. 5A is a schematic representation of an osteochondral fragment (OCF) efficacy study. A total of 20 horses were divided equally into two groups. After osteochondral injury in the radial carpal bone was surgically obtained, the animals in the Treated group received an injection of 5x10 ¹² vg scAAV.eqIL-1Ra into the joint space; animals of the Control group received an equal volume of saline solution. Synovial fluids from both intercarpal joints, peripheral blood and urine were collected every second week (*). FIG. 5B depicts the mean eqIL-1Ra levels in synovial fluid of OCF joints from the Treated and Control groups. The dashed line indicates the average expression of AAV.eqIL-1Ra in healthy joints resulting from the administration of the same dose of virus (see Fig. 5C) (n = 10). FIG. 5C depicts a graph representing the level of eqIL-1Ra in synovial fluid in a joint with OCF of each individual in the Treated group. Each line represents a different animal. FIG. 5D depicts the mean urinary eqIL-1Ra level for both the Treated and Control groups (n = 10). FIG. 5E depicts the mean eqIL-1Ra level in serum obtained from peripheral blood for 9 out of 10 animals in both the Treated and Control groups (n = 10). FIG. 5F image

- 3,038,300 wives serum eqIL-1Ra levels from the remaining horses in both the Treated and Control groups, which was> 25x greater than the other 18 animals in the pre-treatment study. FIG. 5G depicts the titers of neutralizing antibodies to AAV2.5 in the peripheral blood serum of synovial fluids of joints with OCF injected with scAAV.eqIL-1Ra (n = 10). Error bars represent ± SEM.

FIG. 6A-6B depict changes in lameness and PGE2 levels in joint synovial fluid after treatment with scAAV.eqIL-1Ra. FIG. 6A depicts the relative change in mean visual indices of lameness in the Treated and Control groups during exercise (left). Relative change in forelimb lameness (vector sum) based on the Lameness Locator® Inertial Motion Sensor Analysis System (right). In both cases, week 1 mean lameness scores were assigned a value of 1. FIG. 6B depicts the mean PGE ₂ levels in synovial fluid of joints with OCF in both the Treated and Control groups. Error bars represent ± SEM; * P <0.05.

FIG. 7A-7B depict MR imaging scoring in the case of tissue abnormalities in OCF joints treated with scAAV.eqIL-1Ra. Both intercarpal joints of all horses were scanned by MR imaging prior to treatment (week 0) and at the end of the experimental protocol (week 12). Images were assessed for synovial fluid effusion, synovial proliferation, osteochondral injury severity (OCF size), radial carpal bone marrow edema, radial carpal tunnel and third carpal bone sclerosis, and joint edema and fibrosis on a scale of 0 to 10, where 0 = normal and 10 = severe pathology. FIG. 7A depicts exemplary images based on axial and sagittal images (PD and PD-FS, respectively) of joints with OCF from one horse in the Treated group and in the Control group. White arrows represent: CE, capsular effusion; ME - bone marrow edema; OCF, osteochondral fragment; SE - synovial effusion. The black arrow in the sagittal image at week 12 for the control joint denotes hyperintense signal and incomplete OCF repair. FIG. 7B depicts a covariate analysis of major articular pathologies associated with the OCF model in the Treated and Control groups at the endpoint (week 12) using pretreatment indices (week 0) as baseline (left). The total MRI indices in the case of joints with OCF were calculated based on the values of the individual MRI pathologies (right, cross-hatching). The cumulative MRI indices based on functioning joints in the Sham group represent baseline pathology levels in opposing intercarpal joints. Error bars represent ± SEM; * P <0.05.

FIG. 8A-8D depict the assessment of arthroscopy and histological sections of OCF joints for tissue pathology changes associated with scAAV.eqIL-1Ra treatment. Both intercarpal joints of horses in the Treated and Control groups were examined arthroscopically after osteochondral lesion formation (week -2) and at the endpoint (week 12). Images were scored for OCF size and local cartilage damage, synovitis, joint cartilage damage (overall), and ligament inflammation. At the endpoint, the osteochondral fragment and local synovial tissue were removed, cut into sections and stained with H&E or toluidine blue and classified. FIG. 8A depicts a covariate analysis of arthroscopic scores of major articular pathologies associated with the OCF model in the Treated and Control groups at week 12 using indices at week -2 as baseline (left). Total arthroscopic indices for joints with OCF were calculated based on the values of individual pathologies (right, cross-hatched columns). The summary indices based on the functioning intercarpal joints located on different sides of the Imitation group represent the pathology of the baseline in the intact joints. FIG. 8B depicts illustrative arthroscopic images of osteochondral lesions in Treated and Control horses during education (week -2) and at the endpoint (week 12). FIG. 8C depicts the mean histological indices of selected tissue pathologies in selected OCF tissues (left). Total histological indices calculated from individual tissue indices (right). FIG. 8D depicts illustrative microscopic images of bone repair in the Treated and Control groups. Error bars represent ± SEM; * P <0.05.

FIG. 9A-9B depict associations between eqIL-1Ra expression and joint pathology. FIG. 9A depicts cumulative MRI plots in the Treated horses immediately prior to scAAV.eqIL-1Ra injection versus synovial fluid qIL-1Ra levels for OCF at week 2 (left) and mean eqIL-1Ra levels at weeks 2-12 (right ). In the case of both plots, the arrow represents data from one horse with unusually high eqIL1Ra expression at week 2 relative to the other 9 animals (see FIG. 5C). The solid lines show plots with the best fit lines for the data points of all 10 animals. The dotted lines show the best fit line plots calculated with no outliers. Shown are the Pearson correlation coefficients (r) for the MRI index and eqIL-1Ra level as a drop-down point

- 4,038,300 data (all), and without it (9/10). FIG. 9B is a graph of all MRI scores immediately before injection versus cumulative MRI endpoint for OCF joints for each of the horses in the Treated (gray) and Control (black) groups. The solid lines show the graphs with the best fit lines for each group. The corresponding equations of the straight lines and the Pearson correlation coefficients are also shown. * P <0.05.

FIG. 10 depicts the secretion of human IL-1Ra in HEK293 cells transfected with scAAV vector plasmids containing native or codon-modified human IL-1Ra cDNA.

FIG. 11 depicts the secretion of human IL-1Ra in human osteosarcoma cells transfected with scAAV vector plasmids containing native or modified human IL-1Ra cDNA. Error bars indicate SEM.

FIG. 12 depicts the secretion of human IL-1Ra in primary human synovial fibroblasts infected with AAV2 capsids containing native and codon-modified human IL1Ra cDNA, n = 3 infections; error bars indicate + SEM.

FIG. 13 depicts the sequence alignment of the native human IL-1Ra cDNA (upper sequence; SEQ ID NO: 9) and the modified IL-1Ra GeneArt cDNA sequence (lower sequence; SEQ ID NO: 10) with the Kozak consensus sequence (underlined) immediately above the ATG translation initiation site at position 1. The differences between the two sequences are indicated by colon characters. As indicated under the sequence alignments, 105 out of 534 nucleotides in the native IL-1Ra cDNA sequence were altered in the modification. The modified sequence containing the Kozak consensus sequence is SEQ ID NO: 11.

Detailed Disclosure of the Present Invention

IL-1Ra is a promising therapeutic agent for the treatment of diseases associated with degenerative pathological conditions of large supporting joints, such as osteoarthritis (OA), as it is a natural antagonist of IL-1, which is associated with intra-articular cartilage loss, pain and inflammation. At the same time, the delivery of IL-1Ra to the disease focus, i.e., joints, is problematic. Maintaining a therapeutically effective level of IL-1Ra in the affected joint for an extended period of time is even more problematic. It should be noted that endogenous IL-1Ra is expressed at low levels in horses. In fact, exogenous expression of IL-1Ra using a wild-type nucleotide sequence that encodes the eqIL-1Ra protein also does not contribute to high levels of IL-Ra in joints.

As a solution to this problem, the inventors of the present disclosure have developed a codon-modified nucleic acid sequence that encodes eqIL-1Ra, which has the same amino acid sequence as the wild-type eqIL-1Ra protein, but results in higher levels of endogenous expression of IL-1Ra. An additional modification was made to include the Kozak sequence just upstream of the translation initiation site. The inclusion of this Kozak sequence leads to an additional increase in the level of expression of the eqIL-1Ra protein. Delivery of the developed codon-modified gene encoding IL-1Ra into joints was achieved by using AAV particles as carriers. Surprisingly, it was found that there is a high correlation between the level of pathology in the joint at the time of injection and the subsequent production of IL-1Ra. Surprisingly, it has been found that diseased tissue expresses higher levels of eqIL-1Ra as a result of the disclosed method of treatment than tissue that is not affected.

The present inventors have also developed a codon-modified human IL-1Ra (hIL-1Ra) with and without Kozak leader sequences, which results in the secretion of IL-1Ra at levels that are about 2-4 times higher than that resulting from the use of native cDNA hIL-1Ra.

Nucleic acid containing a codon-modified gene encoding horse IL-1Ra

Provided herein is a recombinant nucleic acid containing a codon-modified gene encoding horse IL-1Ra (eqIL-1Ra). In some embodiments, the nucleotide sequence mismatch between a codon-modified gene encoding eqIL-1Ra and an endogenous (or wild-type or native) gene encoding eqIL-1Ra is 10-30% (e.g., 15-25%, 17- 23%, 19-21%, 10-15%, 15-20%, 2025% or 25-30%). In other words, 10-30% of the nucleotides encoding eqIL-1Ra are codon-modified. In some embodiments, the codon-modifying gene encoding eqIL-1Ra exhibits 20.2% mismatch compared to the wild-type gene encoding eqIL-1Ra. SEQ ID NO: 1 is the nucleotide sequence of the wild type gene encoding eqIL-1Ra. SEQ ID NO: 2 is a codon-modified sequence encoding eqIL-1Ra. 108 out of 534 nucleotides of SEQ ID NO: 2 are mismatched compared to SEQ ID NO: 1, which corresponds to a mismatch of 20.2% (FIG. 1).

- 5 038300

Nucleotide sequence of the endogenous gene encoding eqIL-1Ra:

ATGGAAATCCGCAGGCGTTCTGTCAGACACCTAATCTCTCTCCTCCTTTTCTTGTTCTACTCA

GAGACAGCCTGCCACCCTTTGGGGAAGAGACCCTGCAAGATGCAAGCCTTCAGAATCTGGG

ATGTTAACCAGAAGACCTTCTACATGAGGAATAACCAACTAGTTGCTGGATACTTGCAAGAA

TCAAATACTAAATTACAAGAGAAGATAGATGTGGTGCCCATTGAGCCTGATGCTCTATTCCT GGGACTCCATGGGAGGAAGCTGTGCCTGGCCTGTGTCAAGTCTGGTGATGAGATTAGGTTCC

AATTGGAGGCAGTTAACATCACTGACCTGAGCAAGAACAAGGAGGAGAACAAGCGCTTCAC

CTTCATCCGCTCAAACAGTGGCCCCACCACCAGCTTCGAGTCTGCCGCCTGCCCTGGCTGGTT

CCTCTGCACGGCGCAGGAGGCAGACCGGCCCGTCAGCCTCACCAACAAGCCCAAAGAGTCC

TTCATGGTCACCAAGTTCTACCTCCAGGAGGACCAGTAG (SEQ IDNO: 1)

An example of the nucleotide sequence of a codon-modified gene encoding eqIL1Ra:

ATGGAAATCAGGCGCAGAAGCGTGCGCCACCTGATCAGCCTGCTGCTGTTCCTGTTCTACAG

CGAGACAGCCTGCCACCCCCTGGGCAAGAGGCCCTGCAAGATGCAGGCCTTCAGGATCTGG

GACGTGAACCAGAAAACCTTCTACATGCGCAACAACCAGCTGGTGGCCGGATACCTGCAGG

AAAGCAACACCAAGCTGCAGGAAAAGATCGACGTCGTCCCCATCGACCCGACGCCCTGTTC

CTGGGCCTGCACGGCAGAAAGCTGTGCCTGGCCTGCGTGAAGTCCGGCGACGAGATCAGGT

TTCAGCTGGAAGCCGTGAACATCACCGACCTGAGCAAGAACAAAGAGGAAAACAAGCGCTT CACCTTCATCAGAAGCAACAGCGGCCCCACCACCAGCTTCGAGAGCGCCGCTTGCCCCGGCT GGTTCCTGTGTACAGCCCAGGAAGCCGACAGGCCCGTCAGCCTGACCAACAAGCCCAAAGA AAGCTTCATGGTCACCAAGTTCTATCTGCAAGAAGATCAGTAA (SEQ ID NO: 2)

In some embodiments, transduction of a cell with a codon-modified gene encoding eqIL-1Ra results in eqIL-1Ra protein levels that are 5-200 times higher (e.g., 5-200, 10-150, 15-120, 20-100, 30-80, 35-60, 40-50 times higher) compared to the situation when a similar cell is transduced with an endogenous (or native or wild-type) gene encoding eqIL-1Ra. The wild-type gene encoding eqIL-1Ra is a gene that is native or endogenous or found in horses.

Kozak sequence

In some embodiments, the codon-modified gene encoding eqIL-1Ra is preceded by a Kozak sequence. In some embodiments, the Kozak sequence immediately precedes the translation initiation site of the codon-modified gene encoding eqIL-1Ra. In some embodiments, the Kozak sequence is 1-50 nucleotides upstream of the translation initiation site of the codon-modified gene encoding eqIL-1Ra. In some embodiments, the Kozak sequence is GCCACC. SEQ ID NO: 3 is an example of a codon-modified gene encoding eqIL-1Ra immediately preceded by a Kozak sequence.

An example of the nucleotide sequence of a codon-modified gene encoding eqIL-1Ra (Kozak sequence is underlined):

GCCACCATGGAAATCAGGCGCAGAAGCGTGCGCCACCTGATCAGCCTGCTGCTGTTCCTGTT

CTACAGCGAGACAGCCTGCCACCCCCTGGGCAAGAGGCCCTGCAAGATGCAGGCCTTCAGG

ATCTGGGACGTGAACCAGAAAACCTTCTACATGCGCAACAACCAGCTGGTGGCCGGATACC TGCAGGAAAGCAACACCAAGCTGCAGGAAAAGATCGACGTCGTCCCCATCGACCCGACGCC CTGTTCCTGGGCCTGCACGGCAGAAAGCTGTGCCTGGCCTGCGTGAAGTCCGGCGACGAGAT CAGGTTTCAGCTGGAAGCCGTGAACATCACCGACCTGAGCAAGAACAAAGAGGAAAACAAG CGCTTCACCTTCATCAGAAGCAACAGCGGCCCCACCACCAGCTTCGAGAGCGCCGCTTGCCC CGGCTGGTTCCTGTGTACAGCCCAGGAAGCCGACAGGCCCGTCAGCCTGACCAACAAGCCC AAAGAAAGCTTCATGGTCACCAAGTTCTATCTGCAAGAAGATCAGTAA (SEQ IDNO: 3)

In some embodiments, transduction of a cell with a codon-modified gene encoding eqIL-1Ra with a Kozak sequence results in eqIL-1Ra protein levels that are 5-200 times higher (e.g., 5-200, 10-150, 15 -120, 20-100, 30-80, 35-60, 40-50 times higher) compared to the situation when a similar cell is transduced with an endogenous gene encoding eqIL-1Ra. A similar cell is a cell that has the same genetic profile and is cultured and processed in the same way, except that one variable affecting the cell is different, such as the follower

- 6 038300 ness to IL-1Ra DNA, which is used for its transfection.

Nucleic acid containing a codon-modified gene encoding human IL-1Ra

Also provided herein are recombinant nucleic acids containing a codon-modified gene encoding human IL-1Ra. In some embodiments, the nucleotide sequence mismatch between a codon-modified gene encoding human IL-1Ra and an endogenous (or wild-type or native) gene encoding human IL-1Ra is 10-30% (e.g., 15-25 %, 17-23%, 19-21%, 10-15%, 15-20% 20-25% or 25-30%). In other words, 10-30% of the nucleotides encoding human IL-1Ra are codon-modified. In some embodiments, the codon-modifying gene encoding human IL-1Ra exhibits 19.6% mismatch compared to the wild-type gene encoding human IL-1Ra. SEQ ID NO: 9 is the nucleotide sequence of the wild type gene encoding human IL-1Ra. SEQ ID NO: 10 is an example of a codon-modified sequence encoding human IL-1Ra. 105 out of 534 nucleotides of SEQ ID NO: 10 are mismatched compared to SEQ ID NO: 9, which corresponds to a mismatch of 19.6% (see Fig. 13).

An example of the nucleotide sequence of an endogenous gene encoding human IL-1Ra: ATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCACTCTCCTCCTCTTCCTGTTCCATTCA

GAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATCTGGG ATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCTGGATACTTGCAAGGA CCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCTCTGTTCTT GGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAGACCAGACTCC AGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGACAAGCGCTTCGC CTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCCTGCCCCGGTTGGTT CCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAATATGCCTGACGAAGGC GTCATGGTCACCAAATTCTACTTCCAGGAGGACGAGTAG (SEQ ID NO: 9)

An example of the nucleotide sequence of a codon-modified gene encoding human IL-1Ra:

ATGGAAATCTGCAGAGGCCTGCGGAGCCACCTGATTACCCTGCTGCTGTTCCTGTTCCACAG

CGAGACAATCTGCCGGCCCAGCGGCCGGAAGTCCAGCAAGATGCAGGCCTTCCGGATCTGG GACGTGAACCAGAAAACCTTCTACCTGCGGAACAACCAGCTGGTGGCCGGATACCTGCAGG GCCCCAACGTGAACCTGGAAGAGAAGATCGACGTGGTGCCCATCGAGCCCCACGCCCTGTTT CTGGGCATCCACGGCGGCAAGATGTGCCTGAGCTGCGTGAAGTCCGGCGACGAGACAAGAC TGCAGCTGGAAGCCGTGAACATCACCGACCTGAGCGAGAACCGGAAGCAGGACAAGAGATT CGCCTTCATCAGAAGCGACAGCGGCCCCACCACCAGCTTTGAGAGCGCCGCCTGCCCCGGCT GGTTCCTGTGTACAGCCATGGAAGCCGACCAGCCCGTGTCCCTGACAAACATGCCCGACGAG GGCGTGATGGTCACCAAGTTCTATTTTCAAGAAGATGAGTAA (SEQ ID NO: 10)

In some embodiments, the codon-modified gene encoding human IL-1Ra is preceded by a Kozak sequence. In some embodiments, the Kozak sequence immediately precedes the translation initiation site of a codon-modified gene encoding human IL-1Ra. In some embodiments, the Kozak sequence is 1-50 nucleotides upstream of the translation initiation site of the codon-modified gene encoding human IL-1Ra. In some embodiments, the Kozak sequence is GCCACC. SEQ ID NO: 11 is an example of a codon-modified gene encoding human IL-1Ra immediately preceded by a Kozak sequence.

An example of the nucleotide sequence of a codon-modified gene encoding human IL-1Ra (Kozak sequence is underlined):

GCCACCATGGAAATCTGCAGAGGCCTGCGGAGCCACCTGATTACCCTGCTGCTGTTCCTGTT CCACAGCGAGACAATCTGCCGGCCCAGCGGCCGGAAGTCCAGCAAGATGCAGGCCTTCCGG ATCTGGGACGTGAACCAGAAAACCTTCTACCTGCGGAACAACCAGCTGGTGGCCGGATACC TGCAGGGCCCCAACGTGAACCTGGAAGAGAAGATCGACGTGGTGCCCATCGAGCCCCACGC CCTGTTTCTGGGCATCCACGGCGGCAAGATGTGCCTGAGCTGCGTGAAGTCCGGCGACGAGA CAAGACTGCAGCTGGAAGCCGTGAACATCACCGACCTGAGCGAGAACCGGAAGCAGGACA AGAGATTCGCCTTCATCAGAAGCGACAGCGGCCCCACCACCAGCTTTGAGAGCGCCGCCTGC CCCGGCTGGTTCCTGTGTACAGCCATGGAAGCCGACCAGCCCGTGTCCCTGACAAACATGCC CGACGAGGGCGTGATGGTCACCAAGTTCTATTTTCAAGAAGATGAGTAA (SEQ III NO: 11)

In some embodiments, transduction of a cell with a codon-modified gene encoding human IL-1Ra with a Kozak sequence results in a

- 7,038300 development of human IL-1Ra protein levels that are 1.1-50 times higher (for example, 1.1-3, 1.4-10, 1.5-30, 2-30, 2-50, 2-4, 2.5-5, 3-8, 5-20 or 30-50 times higher) compared to the situation when a similar cell is transduced with an endogenous gene encoding eqIL-1Ra.

Promoter

A promoter is typically a region of a nucleic acid that initiates transcription of a nucleic acid encoding a product.

Any of a variety of promoters can be used to achieve exogenous expression levels of eqIL-1Ra or hIL-1Ra. The specified promoter may be, for example, a constitutive promoter, tissue-specific promoter, inducible promoter or synthetic promoter.

The recombinant nucleic acid described herein can contain one or more constitutive promoters, such as viral promoters or promoters from mammalian genes, which are generally active in stimulating transcription. Non-limiting examples of constitutive viral promoters include the immediate early promoter / enhancer of herpes simplex virus (HSV), thymidine kinase (TK), Rous sarcoma virus (RSV), monkey virus 40 (SV40), mouse mammary tumor virus (MMTV), Ad El A and cytomegalovirus (CMV). Non-limiting examples of other constitutive mammalian promoters include housekeeping gene promoters, examples of which are the β-actin promoter (eg, the chicken β-actin promoter) and the elongation factor 1α (EF-1a) promoter.

In some embodiments, the promoter in any of the recombinant amino acids disclosed herein is a disease controlled promoter. A disease controlled promoter is a promoter that promotes the expression of Il-1Ra encoded by a codon-modified gene to which the promoter is linked in diseased cells or tissue at levels that are higher than those in unaffected cells or tissue. In some embodiments, the disease controlled promoter in any of the recombinant amino acids disclosed herein is a cytomegalovirus (CMV) immediate early promoter / enhancer. In accordance with some embodiments, inclusion of the CMV immediate early promoter / enhancer results in 1.5-200 times higher (e.g., 1.5-150, 2-120, 5-100, 10-80, or 20-50 times higher higher) levels of eqIL-1Ra or hIL-1Ra expression in diseased tissue compared to unaffected tissue. In some embodiments, the diseased and unaffected tissue are located in the same joint of the subject. In some embodiments, the diseased and unaffected tissue are in the same subject's body, but in different joints. In some embodiments, diseased and unaffected tissue are found in different subjects. The sequence of the CMV immediate early promoter / enhancer is known in the art and described by Schmidt et al. (Molecular and Cellular Biol., 1990, 10: 4406).

In some embodiments, the CMV immediate early promoter / enhancer sequence is SEQ ID NO: 4. In some embodiments, the CMV immediate early promoter / enhancer sequence is SEQ ID NO: 4, such that said the site provides 20-50% (for example, 20, 30, 40, 50, 60, 70, 80, 90, 95, 99 or 100%) of the activity of SEQ ID NO: 4.

Example nucleotide sequence of CMV immediate early promoter / enhancer: TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTG

GCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATG ACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGT TCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGAC CGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATA GGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACA TCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCT GGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAG TCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTT GACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCA AAATCAACGGGACTTTCCAAAATGTCGTAACAACTGCGATCGCCCGCCCCGTTGACGCAAAT GGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAG ATC (SEQ GO NO: 4)

The promoter can be located upstream (e.g., 0 bp to -100 bp, -30 bp, -75 bp, or -90 bp) of the transcription initiation site a nucleic acid encoding a product or a translation initiation site may be located in a promoter. In some embodiments, the promoter is located immediately upstream of the Kozak sequence, or 90 bp. above the Kozak sequence. The promoter can be 100-1000 base pairs in length

- 8 038300 or 50-2000 base pairs of nucleotides.

rAAV for delivery of human eqIL-1Ra or IL-1Ra

Recombinant adeno-associated (rAAV) particles are used as a carrier for the delivery of a transgene encoding human eqIL-1Ra or IL-1Ra. AAV has proven to be one of the most favorable gene therapy carriers in clinical applications. Its advantages are related to its increased safety, low immunogenic profile of transduced cells, and its ability to provide long-term effective expression of transgenes in joint tissues. Recent advances in AAV technology, including the development of self-complementary (double-stranded) vectors and improved methods for obtaining high titer of viruses, have further enhanced its promise for demanded clinical applications.

In some embodiments, the serotype of the rAAV particle used to deliver any of the nucleic acids disclosed herein to a horse or human joint is serotype 2. In some embodiments, the serotype of the rAAV particle used to deliver any of the nucleic acids acids disclosed herein in a horse or human joint is serotype 2.5 and it is self-complementary (scAAV2.5). scAAV2.5 is a second generation AAV vector that is responsible for the formation of both a new capsid sequence (chimeric) and a unique vector structure (duplex). The hybrid serotype 2.5 AAV has the same tissue tropism as serotype 2, but is characterized by reduced reactivity against neutralizing antibody to AAV2. In some embodiments, the serotype of the rAAV particle used to deliver any of the nucleic acids disclosed herein to a horse or human joint is serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or a hybrid or modified or engineered AAV capsid serotype.

In some embodiments, the rAAV particle is self-complementary in that it contains a region of nucleic acid that is complementary to another region of nucleic acid, thereby initiating the formation of a double-stranded nucleic acid structure contained in the particle.

In some embodiments, a highly efficient adenoviral vector is used as a vehicle to deliver any of the transgenes encoding human eqIL-1Ra or IL1Ra disclosed herein.

It should be understood that other gene delivery vehicles, such as lentivirus, can be used as a vehicle to deliver any of the transgenes encoding human eqIL-1Ra or IL-1Ra disclosed herein. Various methods of gene delivery are known in the art, see, for example, Nayerossadat et al. (Adv Biomed Res. 2012; 1:27), which are incorporated herein by reference in their entirety, and can be used as a delivery vehicle for any of the transgenes encoding human eqIL-1Ra or IL-1Ra disclosed herein ...

Particle packing methods rAAV

Non-limiting methods for producing rAAV particles that contain a nucleic acid containing a codon-modified gene encoding human eqIL-1Ra or IL-1Ra are described herein. Other methods are also known in the art and are commercially available (see, for example, Zolotukhin et al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and publications US patent applications US20070015238 and US20120322861, which are incorporated herein by reference; Li et al., J. Virol, 2012, v. 86 (15), and plasmids and kits from ATCC and Cell Biolabs, Inc.) ... For example, a plasmid containing a codon-modified gene encoding human eqIL-1Ra or IL-1Ra can be combined with one or more helper plasmids, such as those containing the rep gene (eg, encoding Rep78, Rep68, Rep52, and Rep40) and the cap gene (encoding VP1, VP2 and VP3, including the modified VP2 region described herein) and transfected into recombinant cells such that the rAAV particle can be packaged and then purified.

In some embodiments, the packaging is in a helper or producer cell, such as a mammalian or insect cell. Non-limiting examples of mammalian cells include, but are not limited to, HEK293 cells, COS cells, HeLa cells, BHK cells, or CHO cells (see, for example, ATCC® CRL-1573 ™, ATCC® CRL1651 ™, ATCC® CRL-1650 ™, ATCC® CCL-2, ATCC® CCL-10 ™ or ATCC® CCL-61 ™). Illustrative insect cells include, but are not limited to, Sf9 cells (see, eg, ATCC® CRL1711 ™). The helper cell may contain the rep and / or cap genes that encode a Rep and / or Cap protein for use in the method described herein. In some embodiments, the packaging is carried out in vitro.

In some embodiments, a plasmid containing a gene encoding IL-1Ra is combined with one or more helper plasmids, for example, which contain

- 9 038300 the rep gene of the first serotype and the cap gene of the same or a different serotype, and is transfected into helper cells in such a way that the rAAV particle is packaged.

In accordance with some embodiments, one or more helper plasmids include a first helper plasmid containing a rep gene and a cap gene, and a second helper plasmid containing one or more of the following helper genes: E1a gene, E1b gene, E4 gene. E2a gene and VA gene. For clarity, helper genes are genes that encode helper proteins E1a, E1b, E4, E2a and VA. In some embodiments, the rep gene is a rep gene derived from AAV3, AAV5, or AAV6, and the cap gene is derived from AAV2, AAV3, AAV5, or AAV6, and may include gene modifications to produce a modified capsid protein as described herein. document. In some embodiments, the cap gene is modified such that one or more of the VP1, VP2, and VP3 proteins are not expressed. In some embodiments, the cap gene is modified such that VP2 is not expressed. Methods for making such modifications are known in the art (Lux et al. (2005) J Virology 79: 11776-87).

Helper plasmids and methods for producing such plasmids are known in the art and are commercially available (see, for example, plasmids pDF6, pRep, pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG (R484E / R585E) and pDP8.ape from PlasmidFactory, Bielefeld, Germany; other products and services from Vector Biolabs, Philadelphia, PA; Cellbiolabs, San Diego, CA; Agilent Technologies, Santa Clara, CA; and Addgene, Cambridge, MA; pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adenoassociated Virus Vectors, Human Gene Therapy, Vol. 9, 2745-2760; Kern, A. et al. (2003), Identification of a Heparin-Binding Motif on AdenoAssociated Virus Type 2 Capsids, Journal of Virology, Vol. 77, 11072-11081; Grimm et al. (2003), Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1 to 6, Molecular Therapy, Vol. 7, 839-850; Kronenberg et al. (2005), A Conformational C hange in the Adeno-Associated Virus Type 2 Capsid Leads to the Exposure of Hidden VP1 N Termini, Journal of Virology, Vol. 79, 5296-5303; and Moullier, P. and Snyder, R.O. (2008), International efforts for recombinant adenoassociated viral vector reference standards, Molecular Therapy, Vol. 16, 1185-1188). Plasmids that encode the coding regions for wild-type AAV specific serotypes are also known and available. For example, pSub201 is a plasmid that contains the coding regions of the wild-type AAV2 genome (Samulski et al. (1987), J Virology, 6: 3096-3101).

An illustrative non-limiting method for making rAAV particles is described below. One or more helper plasmids have been created or obtained, which contain ORF rep and cap for AAV of the required serotype, as well as VA genes of adenovirus E2A (DBP) and E4 under the control of transcription of their native promoters. In some embodiments, one or more helper plasmid contains rep genes of the first serotype (e.g., AAV3, AAV5, and AAV6), cap genes (which may or may not belong to the first serotype), and optionally one or more VA genes of adenovirus E2A (DBP ) and E4 under the control of transcription of their native promoters. In some embodiments, one or more helper plasmids comprise an ORF cap (and optionally an ORF rep) for the AAV of the desired serotype, as well as the adenovirus E2A (DBP) and E4 VA genes under the transcriptional control of their native promoters. The ORF cap may also contain one or more modifications to produce the modified capsid protein described herein. HEK293 cells (available from ATCC®) are transfected with CaPO ₄ mediated transfection, lipids or polymer molecules such as polyethyleneimine (PEI), helper plasmid (s) and a plasmid containing the nucleic acid vector described herein. HEK293 cells are then incubated for at least 60 hours to obtain rAAV particles. Alternatively, HEK293 cells are transfected using the methods described above with an AAV-ITR containing any of the recombinant nucleic acids described herein, a helper plasmid containing genes encoding the Rep and Cap proteins, and coinfected with a helper virus. Helper viruses are viruses that facilitate the replication of AAV. Examples of helper viruses are adenovirus and herpes virus.

Alternatively, in another example, stable Sf9-based producer cell lines are infected with one recombinant baculovirus containing any of the recombinant nucleic acids provided herein. As a further alternative, in another example, HEK293 or BHK cell lines are infected with HSV containing a nucleic acid vector and optionally one or more HSV helper containing the rep and cap ORFs described herein and the VA genes of the adenovirus E2A (DBP) and E4 under control of transcription of their native promoters. HEK293, BHK or Sf9 cells are then incubated for at least 60 hours to obtain rAAV particles. The rAAV particles are then purified using any method known in the art or described herein, for example, iodixanol step gradient, CsCl gradient, chromatography, or polyethylene glycol (PEG) precipitation.

Pharmaceutical compositions

This document provides a pharmaceutical composition containing one of the particles

- 10 038300 rAAV disclosed in this document. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable carrier that facilitates delivery of rAAV particles containing nucleic acid encoding human eqIL-1Ra or IL-1Ra into a subject's joint. The term carrier refers to a diluent, adjuvant, auxiliary, or vehicle with which rAAV is administered.

Pharmaceutical carriers can be sterile liquids such as water or oils, including those based on petroleum oils such as mineral oil, vegetable oils such as peanut oil, soybean oil and sesame oil, animal fats or oils of synthetic origin. Saline solutions (eg, sterilized pyrogen-free saline solution) and aqueous solutions of dextrose and glycerol can be used as liquid carriers. USP grade carriers and excipients are particularly useful for delivering rAAV particles to mammalian subjects. Such compositions may further optionally contain a liposome, lipid, lipid complex, microsphere, microparticle, nanosphere, or nanoparticle, or may otherwise be formulated for administration to cells, tissues, organs, or the body of a subject in need thereof. Methods for preparing such compositions are well known and can be found, for example, in Remington: The Science and Practice of Pharmacy, 22nd edition, Pharmaceutical Press, 2012.

Pharmaceutical forms of rAAV particle compositions suitable for injection use include sterile aqueous solutions or dispersions. In some embodiments, the form is sterile and fluid to the extent that there is an easy passage through the needle. In some embodiments, the form is stable under the conditions of manufacture and storage and is protected from the contaminating action of microorganisms such as bacteria and fungi. In some embodiments, the form is sterile. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (eg, glycerin, propylene glycol and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Suitable fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the desired particle size in the case of dispersion, and by using surfactants.

In the case of the administration of aqueous solutions for injection, the solution can be suitably buffered, if necessary, and the liquid diluent is first rendered isotonic with a sufficient amount of saline or glucose. For example, a single dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of hypodermoclysis fluid or infused into the intended site (see, for example, Remington's Pharmaceutical Sciences 15th Edition, pages 1035-1038 and 1570- 1580). Some variation in the dose will be carried out in a certain way depending on the condition of the subject to be treated. The person in charge of administration will in any case determine the appropriate dose for the individual subject. In addition, when administered to mammals, the formulations must meet the standards of sterility, pyrogenicity, and general safety and purity generally accepted in the veterinary sciences.

Typically, such compositions may contain at least about 0.1% therapeutic agent (e.g., rAAV particles) or more, although the percentage of active ingredient (s) can of course vary and may conveniently range from about 1 or 2% and up to about 70% or 80% or more by weight or volume of the entire composition. Naturally, the amount of therapeutic (therapeutic) agent (s) (eg, rAAV particles) in each therapeutically useful composition can be prepared such that a suitable dose is obtained in any specified unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, shelf life of the product, and other pharmacological aspects will be considered by one skilled in the art of preparing such pharmaceutical formulations, and thus a variety of dosages and treatment regimens may be preferred.

Method of treatment

Provided herein is a method for treating a degenerative pathological condition of large supporting joints, said method comprising administering intra-articularly to a subject any of the rAAV particles disclosed herein.

In some embodiments, the subject is a mammal (eg, human or horse). In some embodiments, the subject is a horse. In some embodiments, the subject is a human.

In some embodiments, the degenerative condition of the large supporting joints is caused by acute trauma (eg, injury or traumatic stress) or chronic erosive disease. In accordance with some embodiments, the degenerative condition of the large supporting joints is wasp

- 11 038300 theoarthritis (OA). Equine OA is also known as degenerative joint disease (DJD). OA in horses can be caused by trauma to a joint, either acutely or sustained shock loads. Immobilization or improper shoeing can also lead to OA in horses.

In some embodiments, any of the rAAV particles or pharmaceutical compositions is administered to the joint in need of treatment by intra-articular injection. The joints most commonly affected by arthritis and thus needing treatment in horses include the knee joint, fetlock joint, coronary joint, heel joint, and fetal joint (in which case it is often called annular toad). In some embodiments, the joint in need of treatment is a metacarpophalangeal (MCP) or intercarpal (IC) joint. Accordingly, in some embodiments, the recombinant gene (eg, in rAAV) is delivered directly (eg, injected) into one of these joints. At the same time, in accordance with some embodiments, the composition can be delivered systemically.

It should be understood that any of the rAAV particles described herein can be used to treat any pathological condition in which prolonged production of an IL-1 inhibitor would provide a beneficial effect. In some embodiments, the pathological condition in which long-term production of an IL-1 inhibitor would provide a beneficial effect is gout, pseudogout, or pain and inflammation associated with gout or pseudogout. Other non-limiting examples of pathological conditions in which long-term production of an IL-1 inhibitor would provide a beneficial effect include rheumatoid arthritis, juvenile arthritis, Still's disease, polyarthritis, chronic infant neurological articular cutaneous syndrome, vasculitis, systemic lupus erythematosus, psoriatic arthropathy, connective tissue disorder, immune reconstitution syndrome, diffuse vasculitis, Schnitzler syndrome, amyloidosis, hematophagocytic syndrome, Macle-Wells syndrome, osteoporosis, polychondritis, ocular hypertension, ankylosing spondylitis, Erdheim-Chester disease, tissue crush injury, Sapho syndrome, multiple injuries cytolytic hepatitis, scleroderma, amitrophic lateral sclerosis, tumor necrosis factor receptor-associated periodic syndrome, anti-inflammatory therapy, autoimmune disorder, mild disorder, bone marrow disorder, psoriasis, immune system disorder, Castleman disease, pyrexia, interferon gamma receptor deficiency, cryopyrin-associated periodic syndromes, dermatomyositis, Sjogren's syndrome, fever urticaria, polymyalgia rheumatica, elevated blood levels of immunoglobulin D, breast cancer, inflammation, and Reiter's syndrome. In accordance with some embodiments, a method of treating a condition in which prolonged production of an IL-1 inhibitor (e.g., gout or pseudogout) would provide a beneficial effect comprises administering to a subject in need thereof any of the rAAV particles disclosed herein intra-articularly ... In accordance with some embodiments, a method of treating a pathological condition comprises administering to a subject in need thereof any of the rAAV particles disclosed herein extra-articularly.

In some embodiments, any of the rAAV particles described herein are used to treat a persistent inflammatory condition (eg, an inflammatory condition in connective tissue). In some embodiments, the persistent inflammatory condition causes lameness (eg, tendonitis or laminitis). In some embodiments, the chronic inflammation to be treated occurs in the liver, intestinal tissue, or lung tissue. It should be understood that any of the pathological conditions mentioned above can be considered a degenerative pathological condition of the large supporting joints.

Treat disease, as the term is used herein, means reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject. The compositions described herein above or elsewhere in this document are typically administered to a subject in a therapeutically effective amount, in other words, in an amount capable of producing the desired result. This desired result will depend on the active agent to be administered. For example, a therapeutically effective amount of rAAV particles can be the number of particles capable of transferring a codon-modified gene encoding eqIL-1Ra or a codon-modified gene encoding hIL-1Ra into a horse or human joint, respectively. A therapeutically effective amount can be an amount that is capable of treating a disease, such as OA. As is well known in the veterinary sciences, the dose for any subject depends on many factors, including the size, body surface area, age of the subject, the particular composition to be administered, the active (s) ingredient (s) in the composition, and the time and route of administration. , general health and other medicinal products subject to concurrent

- 12 038300 menstrual administration. Treatment can be assessed by a clinician practitioner using standard techniques in the art or skills and experience gained in the art (eg, assessing inflammation in a joint).

In some embodiments, administering or administering means providing a substance to a subject in a manner that is pharmacologically acceptable.

In some embodiments, 1x 10 ¹⁰ to 1x 10 ¹³ viral genomes (vg) (e.g., 5x10 ¹⁰ to 5x10 ¹² vg, 1 x 10 ¹¹ to 1 x 10 ¹² vg, or 2x10 ⁿ to 9x10 ⁿ vg) injected at a time into the joint to be treated. In some embodiments, the volume of the pharmaceutical composition or rAAV to be injected is 1-20 ml (eg, 2-15, 512, or 5-10 ml).

In some embodiments, rAAV particles containing a codon-modified gene encoding eqIL-1Ra are administered to a horse joint on a regular basis, for example, after 3 months, after 6 months, or after a year, or after 2-5 years. In some embodiments, rAAV particles containing a codon-modified gene encoding IL-1Ra are introduced into a human joint on a regular basis, for example, after 3 months, after 6 months, or after a year, or after 2-5 years. In some embodiments, rAAV particles containing a codon-modified gene encoding eqIL-1Ra or hIL-1Ra are introduced into a horse or human joint multiple times (e.g., 2, 3, 4, 5, 6, 7, 8, 9 , 10, 13, 14, 15 or 20 times), either at regular intervals or at irregular intervals. In some embodiments, an rAAV containing a codon-modified gene encoding eqIL-1Ra or a codon-modified gene encoding hIL-1Ra is introduced into a joint only once. In some embodiments, an rAAV containing a codon-modified gene encoding eqIL-1Ra or a codon-modified gene encoding hIL-1Ra is introduced into a horse or human joint only if disease symptoms return or worsen. In some embodiments, an rAAV containing a codon-modified gene encoding eqIL-1Ra or a codon-modified gene encoding hIL-1Ra is introduced into a horse or human joint immediately after a condition (e.g., OA) is diagnosed ( for example, within 1 month or 1 year after diagnosis). In some embodiments, an rAAV containing a codon-modified gene encoding eqIL-1Ra or a codon-modified gene encoding hIL-1Ra is introduced into a horse or human joint before a degenerative condition is diagnosed, but after a complication (e.g., damage), which could lead to a degenerative pathological condition. In some embodiments, an rAAV containing a codon-modified gene encoding eqIL-1Ra or a codon-modified gene encoding hIL-1Ra is introduced into a horse or human joint immediately after (e.g., within a month) of an injury that could lead to a degenerative pathological condition. In some embodiments, an rAAV containing a codon-modified gene encoding eqIL-1Ra or a codon-modified gene encoding hIL-1Ra is introduced into a horse or human joint when the first signs of joint disease are observed. Non-limiting symptoms of a degenerative condition of large supporting joints include limping or lameness, joint swelling, decreased rotation of the joints, and joint stiffness or decreased mobility.

Since there is a high correlation between the level of pathology (for example, the total MRI index) during injection of rAAV containing a codon-modified gene encoding eqIL-1Ra, or a codon-modified gene encoding hIL-1Ra, and subsequent production of IL-1Ra (see Example 2), treatment can be started after trauma, but before the diagnosis of a degenerative disease (eg, OA) is delivered. Without further detailed consideration, it is believed that one skilled in the art based on the foregoing description can utilize the present disclosure to its fullest extent. Thus, the following specific embodiments are to be considered as illustrative only and in no way limiting the remainder of the disclosure. All publications cited herein are incorporated by reference for the purposes or subject matter of the invention as referenced herein.

In accordance with some embodiments, injection of rAAV containing a codon-modified gene encoding eqIL-1Ra or a codon-modified gene containing hIL1Ra into the affected joint results in a higher level of IL-1Ra production compared to injection of rAAV containing a codon-modified a gene encoding eqIL-1Ra or a codon-modified gene encoding hIL-1Ra in an unaffected or healthy joint. In some embodiments, the production of IL-1Ra in the affected joint is 1.150 times higher (e.g., 1.1-2, 2-4, 2-10, 5-10, 5-20, 10-20, 20- 30 or 30-50 times higher) compared to an unaffected or healthy joint.

Examples of

Example 1 scAAV-mediated delivery of the IL-1Ra gene for the treatment of osteoarthritis: transient ex

- 13 038300 compression and biodistribution in a horse model.

The data described below show that scAAV can provide long-term expression of eqIL-1Ra in a horse joint using a codon-modified gene encoding eqIL-1Ra and a Kozak sequence.

Studies were performed aimed at the metacarpophalangeal (mcp) joints of the horse's forelimb. Since these joints carry 60-65% of the horse's body weight during locomotion, they are also highly susceptible to OA due to injury and overuse.

In order to characterize the patterns of therapeutic transgene expression and its relative safety after intra-articular delivery, dosing and transient expression studies were performed using the equine IL-1Ra ortholog cDNA. Using the most effective dose of the vector and green fluorescent protein (GFP) as a cytological reporter gene, the bioavailability of the vector after delivery to healthy joints and joints with naturally occurring OA was investigated, with particular attention to the effect of the disease on local transduced cell populations and systemic dispersal of viral genomes.

Animals used in the study

The animals used in this study were donated to the University of Florida, or purchased from local farms and training centers. Endpoints for each study parameter were pre-determined as described below. No animals were excluded from data analysis. All animal procedures were performed in accordance with both the NIH Laboratory Animal Care and Use Guidelines and the University of Florida Institutional Animal Care and Use Committee. Unless otherwise indicated, horses were housed in groups in large open horse pens with full access to movement.

Constructing and Retrieving AAV Vectors

In order to minimize the immune recognition of the IL-1Ra transgene product and create a pharmacokinetic profile for the transfer of the homologous IL-1Ra gene using the AAV vector, DNA sequences encoding the equine IL-1Ra ortholog were used as a therapeutic reporter. In order to maximize the expression of the transgenic protein, the native to DNA eqIL-1Ra codon was modified and the Kozak consensus sequence was inserted immediately upstream of the translation initiation codon (FIG. 1). In this construct, expression of the transgene is driven by the CMV immediate early promoter / enhancer. The AAV vectors were packaged in the AAV2.5 capsid at the Vector Department of the University of Florida or the Vector Department of the University of North Carolina at Chapel Hill using the methods previously described.

The cDNAs encoding GFP and modified eqIL-1Ra were inserted into the Sac II and Not I sites of the expression cassette of the pHpa-trs-SK plasmid, a self-complementary (double-stranded DNA) variant of the AAV vector based on the AAV2 genome. In this construct, expression of the transgene is driven by the CMV immediate early promoter / enhancer. The AAV vectors were packaged in the AAV2.5 capsid at the Vector Department of the University of Florida or the Vector Department of the University of North Carolina at Chapel Hill.

In vivo dosing and expression

To analyze the expression of transgenes in vivo, 6 healthy horses that reached skeletal maturity at the age of 2-7 years were used. Experiments were performed using both the MCP joints and the intercarpal joints of both forelimbs of each animal. Two weeks prior to vector injection, synovial fluid was aspirated from each joint by arthrocentesis to establish baseline eqIL-1Ra levels. At the time of injection, randomized volumes of 5 or 10 ml of lactated Ringer's solution containing 0.5x10 ¹⁰ , 5x10 ⁿ and 5x10 ¹² vg scAAV.eqIL-1Ra were delivered to 4 forelimb joints of each animal. This strategy was used to provide the highest estimate of interindividual variability in transgene expression in animals at appropriate doses using a minimum number of subjects. After injection, the animals were quarantined for 24 hours and closely monitored by a team of veterinarians. On days 7, 14 and 30 after injection and once a month thereafter for a total of 6 months, synovial fluid, peripheral blood and urine were collected from each animal to measure the eqIL-1Ra content by ELISA. Synovial fluid, peripheral blood and urine will be collected up to 1 year in a separate experiment to assess the duration of the effect of codon-modified IL-1Ra injection into joints.

ELISA for determination of horse IL-1Ra

Horse IL-1Ra levels were determined using specific ELISA (R&D Systems). Samples of synovial fluid from joints from both the Treated and Control groups were diluted 1: 1 with buffered saline containing hyaluronidase at 50 U / ml and incubated at 37 ° C for 30 minutes before measuring the protein content. Two-fold serial dilutions of reagent-diluted (R&D Systems) synovial fluid samples were prepared over a wide range to provide variability in assay results. Each series of dilutions was performed in duplicate and each diluted sample was analyzed in the wells at three stages. Average values calculated

- 14 038300 based on readings with the boundaries of the standard curves of the respective analyzes.

Biodistribution of the vector in vivo

In order to determine the systemic biodistribution of the AAV vector after intra-articular injection into the intercarpal joints, 3 healthy horses and 3 horses with late stage naturally occurring OA were injected with 5x10 ¹² vg scAAV.GFP diluted in 5 ml of lactated Ringer's solution. After two weeks, the animals were sacrificed and dissected. No significant damage to organs other than the musculoskeletal system was found. Tissue was removed from the injected intercarpal joint, adjacent forearm carpal joint, adjacent quadriceps muscle, ipsilateral MCP joint, contralateral intercarpal joint and adjacent quadriceps muscle, brain, heart, lung, liver, and spleen. Tissues farthest from the injection site were removed first, and care was taken to minimize sample cross-contamination. Portions of each sample were plated in DMEM with 10% FBS for subsequent analysis of GFP expression, either by inverted fluorescence microscopy of freshly harvested tissue, or after paraffin sectioning and immunohistochemical staining. The rest of the tissues were placed in RNALater (Ambion) and stored at -80 ° C for subsequent isolation of genomic DNA (gDNA).

For vector genome analysis, gDNA was extracted from stored tissue samples using a Qiagen DNeasy Blood and Tissue Assay Kit (Qiagen) according to the manufacturer's instructions. GDNA concentrations were determined using a NanoDrop spectrophotometer (Thermo Scientific). Quantitative real-time PCR was performed using 100 ng gDNA and an Eppendorf RealPlex thermal cycler (Eppendorf). Primers were designed to anneal the sequences in the CMV promoter of the vector expression cassette. The forward and reverse primer sequences were 5'-CACGCTGTTTGACCTCCATAGAAGACAC (SEQ ID NO: 5) and 5'-TTCTTTGATTTGCACCACCACCGGATCCG (SEQ ID NO: 6), respectively. For each set of reactions, a standard curve was generated using serial dilutions of plasmid DNA pHpa-tr-sk. PNR reactions specific for horse β-actin (forward primer 5'-CCAGCACGATGAAGATCAAG (SEQ ID NO: 7) and reverse primer 5'-GTGGACAATGAGGCCAGAAT (SEQ ID NO: 8)) and without template DNA were used as positive and negative controls respectively. All gDNA samples were analyzed in triplicate. To study the sample-specific inhibition reaction, aliquots of gDNA samples were labeled with pHpa-trs-SK vector DNA at 100 copies / μg gDNA. If 40 copies / μg or more of labeled DNA was detected, then the gDNA sample was considered acceptable.

Immunohistochemical analysis

Tissue samples from the biodistribution study, characterized by visible GFP activity, were fixed in paraformaldehyde, processed for histological analysis and embedded in paraffin. Sections cut to a thickness of 5 µm and placed on charged microscopic preparations were dewaxed and heat-mediated antigen unmasking was performed.

Microscopic preparations were blocked with 10% normal serum, then incubated for 1 hour at room temperature with rabbit anti-GFP antibody at a dilution of 1: 200 (Abcam), followed by biotinylated secondary antibody (Invitrogen) for 30 minutes at room temperature at a dilution of 1 : 500. Microscopic preparations were enclosed with DAPI (Vector Laboratories) and examined using a fluorescence microscope.

Construction and characterization of the scAAV.eqIL-1Ra vector in vitro u in vivo In a previous study involving scAAV delivery of human IL-1Ra cDNA to a horse joint, transgene expression was found to steadily decline after a peak 1–2 weeks post injection. , and after 7 weeks, human IL-1Ra was not detectable in synovial fluids by ELISA. This was due to the immune recognition of transduced cells expressing a xenogeneic transgene product. Although it was possible to obtain measurable levels of horse IL1Ra expression using the recombinant adenoviral vector, protein expression from the native cDNA was relatively low overall. Thus, in order to minimize immune recognition of the IL-1Ra transgene product and maximize expression of the IL-1Ra orthologous codon cDNA, horses were modified and synthesized with both (SEQ ID NO: 3) and without 5 'phosphorylation (SEQ ID NO: 2) and without the presence of the Kozak leader sequence immediately upstream of the translation initiation site. After insertion of the vector plasmid scAAV (pHpa-trs-sk), both modified constructs resulted in a 30-50-fold increase in expression compared to the native sequence in transient transfection assays (Fig. 2A). Since the construct containing the Kozak sequence consistently provided the highest levels of eqIL1Ra expression, it was chosen for viral packaging and in vivo studies.

Previous data have shown that human synovial fibroblasts in culture have a preference for infection with AAV2. Considering the promising transition to research in humans, the vector construct eqIL-1Ra was packaged with the AAV2.5 capsid, which supports tropism

- 15 038300

AAV2, however, is characterized by reduced reactivity with the neutralizing antibody to AAV2 prevalent in the human population. Infection cultures of synovial fibroblasts horse dose range AAV2.5 vector resulted in extremely high expression eqIL-1Ra, which exceeded 10 ug / ml at the level of May ¹⁰ viral genomes (vg) / cell (FIG. 2B). The production of eqIL-1Ra did not exceed the background level in parallel control cultures infected at a level of 10 ⁵ vg / cell with the vector AAV2.5 containing GFP.

To determine the effect of vector dose on scAAV.eqIL-1Ra expression after intra-articular delivery, an approach designed to provide an understanding of intra- and inter-individual variability in animals using a minimum number of animals was followed. In each of the 6 horses, scAAV.eqIL-1Ra injections at 3 different doses ( ^{5x10 10} , 5x10 ⁿ and 5x10 ¹² vg; FIG. 2D) were randomly distributed between the intercarpal joints and MCP joints of both forelimbs. The remaining joint was injected with an equivalent volume of the delivery vehicle (lactated Ringer's solution) and acted as a negative control. Periodically thereafter, over a predetermined time interval of ~ 6 months, synovial fluid was aspirated from each of the forelimb joints, and peripheral blood and urine were collected. The eqIL-1Ra content in biological fluids was measured using commercially available ELISA kits and interpreted in relation to pre-injection values.

Despite receiving AAV in 3 joints of the forelimb, no side effects were observed in the acute phase or at any time point during the protocol. In control joints injected with vehicle liquid alone, eqIL-1Ra in synovial fluid remained at pre-injection levels (<1 ng / ml) throughout (FIG. 2B). In the joints injected with the virus, dose-dependent increases in eqIL-1Ra in synovial fluid were observed for 2-4 weeks after injection, with mean levels ranging from ~ 6 ng / ml at 5x10 ¹⁰ vg to ~ 40 ng / ml at 5x10 ¹² vg. Peak eqIL-1Ra production occurred between 4 and 8 weeks post injection for the remainder of the study (FIG. 2B). In contrast to the almost linear relationship between the vector dose and eqIL-1Ra expression observed in culture, a 100-fold increase in the vector dose compared to the studied range in vivo resulted in only a ~ 10-fold increase in IL-1Ra expression. Moreover, increasing the dose from 5x1ο ¹¹ to 5x10 ¹² vg only led to an increase in eqIL-1Ra in the synovial fluid by 1.5 times. Thus, it is possible that these values correspond to the maximum or are near it.

Expression of the AAV2.5 transgene in healthy joints and joints with OA

Since the dose of 5x10 ¹² vg scAAV.eqIL-1Ra consistently provided the highest production of eqIL-1Ra intra-articularly, and, apparently, was reasonably safe, it was chosen for further characterization in vivo. In order to determine the effect of the OA environment on the local and systemic distribution of the AAV vector and transduced cell populations, the scAAV vector construct containing the GFP coding sequence was packed into the AAV2.5 capsid. Then 5x10 ¹² vg scAAV.GFP was injected into one intercarpal joint of 3 healthy horses and 3 horses with advanced naturally occurring OA (Fig. 3A-3B). After two weeks, the horses were sacrificed and tissues were harvested from the injected joints and sites throughout the body.

Similar to the previously studied AAV serotypes, the synovium was the predominant site of GFP expression in each of the healthy joints. Examination of freshly collected tissue samples showed an excess of fluorescent cells in the entire lining of the articular capsule, which were often concentrated in more thickened villous areas (Fig. 3C-3D). GFP activity was noticeable in articular cartilage chips, but was weak and limited in scattered isolated cells (Fig. 3G-3H). In contrast, GFP activity in the synovium affected by OA was much higher than in healthy joints. These samples often showed brilliant fluorescence, even at low magnifications (FIG. 3E). The density of fluorescent cells was noticeably higher along the entire synovial lining, however, especially in areas with inflammation and synovitis (Fig. 3F and 4A-4B). Similar to healthy joints, fluorescent cells were almost exclusively confined to the synovium and subsynovial layer, and were only rarely observed in supporting fibrous tissues.

The cartilaginous tissue affected by OA showed the most pronounced increase in GFP activity, since populations of brightly fluorescent cells were easily visible in all of the extracted chips (Fig. 3J-3K). The shavings extracted from the entire thickness of the erosions often contained local areas of intense fluorescence (Fig. 3L and 4C-4D), and also often contained cells with a fusiform morphology, which corresponded to dedifferentiation to fibrochondrocytes (20). The higher magnification indicated that GFP expression was noticeable in the majority of the resident chondrocyte population, but was particularly pronounced in the chondrocyte clusters characteristic of OA cartilage (FIGS. 3M and 4E-4G). Inclusions of brightly fluorescent cells were also visible on the surfaces of osteophytes extracted at the margins of OA-affected joints (Figs. 3N and 4H).

Both in the case of healthy joints and in the case of joints affected by OA, into which the vein was injected

- 16 038300 rus, the wrist forearm synovium was the only tissue outside the intercarpal joint that was characterized by fluorescence. Despite being located in close proximity to the injection site (FIG. 2C), only a few fluorescent cells were observed, and only in a few recovered samples (FIG. 30).

In a related observation, it was found that GFP expression in healthy cartilage chips (barely discernible when removed) was significantly increased 48 hours after incubation in the explant culture, such that brightly fluorescent cells appeared throughout the matrix in each sample (Fig. 3I). This indicated that a large percentage of chondrocytes were actually transduced by the virus in situ, but could not express the fluorescent reporter protein above the visible threshold level in the context of a healthy joint.

Biodistribution AAV2.5

In order to assess the emigration of the AAV vector from the joint after intra-articular injection, total DNA was isolated from tissue samples and analyzed for the content of vector genomes using quantitative PCR. As shown in table. 1, the systemic distribution of vector genomes was mainly in accordance with the apparent activity of GFP. In all animals, the tissues from the joints into which the virus was injected had the highest content of vector genomes. Although there was significant variation between individuals, on average, the content of vector DNA in the synovium was ~ 30-50 times higher than in cartilaginous tissue, while there were no significant differences between OA-affected and normal joints. ... A measurable but significantly lower content of vector genomes was found in the synovium of the adjacent forearm carpal joint in horses from both groups. Outside the wrist, one healthy animal had a low number of vector genomes in the liver; however, the liver and spleen from one animal in the OA group were also positive for the content of the vectors. In aggregate, both under normal and pathological conditions,> 99.7% of the identified vector AAV genomes were located in the joint tissues. These results indicated that the vector was mainly contained in the joint, and, despite the fact that the environment of OA could enhance transgenic expression intra-articularly, apparently, it did not significantly affect the extra-articular dispersal of vectors.

Table 1. Distribution of AAV.GFP genomes after injection into the intercarpal joint of healthy horses and horses with naturally occurring OA

Healthy OA

Textile Horse 1 Horse b2 Horse b3 Horse b4 Horse 5 Horse 6 Synovium, intercarpal 178,313 66.022 16,460 212,262 15,590 142,033 joint ± 559 ± 167 ± 114 ± 237 ± 280 ± 720 Cartilage tissue, intercarpal joint 3.349 ± 989 ± 1726 ± 2499 ± 887 ± 6 177 ± 43 109 59 69 19 55 Forearm wrist joint 159 ± 86 202 ± 9 But. But. But. 84 ± 16 Periarticular muscle tissue Synovial membrane But. But. But. But. But. But. contralateral intercarpal joint But. But. But. But. But. But. Contralateral quadriceps muscle But. But. But. But. But. But. Ipsilateral MCP But. But. But. But. But. But. Brain But. But. But. But. But. But. Heart But. But. But. But. 380 ± But. But. Liver But. But. 45 ± 5 15 But. But. Lung But. But. But. But. 277 ± But. But. Spleen But. But. But. 64 But. But.

Values represent vector genome copies per microgram of genomic DNA and represent the average of at least triplicate ± SEM. Tissues and locations are shown with reference to the injected joint. N.o., undefined.

The studies described in this example have shown that in a large mammalian joint, genetically modified cells can maintain increased levels of protein synthesis during

- 17,038300 months. Articular pathologies such as acute trauma or chronic erosive disease could lead to a significant increase in viral transduction and expression of transgenes. Moreover, in both healthy and affected joints, most of the vector DNA was retained in the joint tissues, and local overproduction of IL-1Ra in the bloodstream was not detected. Based on these data, it can be assumed that genetically modified cells can maintain elevated levels of protein synthesis for more than 6 months (for example, up to 1 year, up to 2 years, up to 5 years, or up to 10 years).

Horse model benefits

Local AAV-mediated gene transfer has been previously investigated in human joints in connection with the treatment of rheumatoid arthritis (26) and entered a phase II study (27). Unfortunately, measuring the transgenic protein (tumor necrosis factor α antagonist) produced in the joints was not part of the protocol, and no information is available regarding the level and duration of transgenic expression achieved in human joints. At the same time, given its relationship with therapeutic efficacy, this information will be decisive for effective clinical use.

To this end, the use of the equine system has proven to be particularly informative, allowing the AAV vector to carry genes to be investigated at the appropriate treatment scale in humans and in the context of naturally occurring OA. The ability to sequentially aspirate synovial fluid provides direct quantification of intra-articular transgene expression and provides informative pharmacokinetic profiles. In addition, the use of outbred animals, their varying responses to osteochondral injury, inherent differences in behavior, and healing ability provide adequate mimics of the variability associated with treatment in humans in a clinical setting.

Gene expression patterns

Significantly higher expression of the GFP reporter was observed in connection with cellular and morphological changes in the joint, characteristic of advanced OA. In the synovium, chronic inflammatory stimulation induces hyperplasia, angiogenesis, leukocyte infiltration, and fibrous thickening. While AAV-mediated GFP expression appeared to be consistently higher in the synovium of OA-affected joints, fluorescence was particularly pronounced in areas of synovitis, where increased cell saturation promoted an increase in the density of target cells susceptible to AAV transduction.

The most notable increase in GFP expression in OA-affected joints occurred in articular cartilage. In stark contrast to cartilage tissue from healthy joints, where GFP + cells were extremely rare and fluorescence was barely noticeable, an excess of brightly fluorescent cells was observed in all shavings extracted from joints affected by OA, with the most pronounced increases observed in areas with obvious signs erosion. Although the loss of matrix integrity appears to have facilitated the penetration and diffusion of vector particles into cartilaginous tissue affected by OA, the present study suggests that much of the increased expression of transgenes in cartilage (and synovium) results from inflammatory and stress-induced activation of the immediate early promoter of cytomegalovirus (CMV).

Chondrocytes in healthy cartilaginous tissue mainly exist in an undisturbed resting state. In OA, the destruction of the cartilage matrix reduces its protective properties, causing excessive mechanical stress on local chondrocytes. Such abnormal efforts lead to the stimulation of signaling from nuclear factor kB (NF-kB) and stress-induced mitogen-activated protein kinases (MAPK), which directs the metabolism under normal conditions of resting chondrocytes into a highly active state. Activated chondrocytes undergo a marked change in phenotype; they become proliferative, secrete high levels of inflammatory cytokines, and release proteolytic enzymes that further degrade the local matrix. Although the CMV immediate-early promoter is generally considered a high-level constitutive promoter, transcription from this element is known to be susceptible to NF-kB as well as signaling from p38 and other stress-activated protein kinases. In a native virus, the involvement of these pathways is required to activate the CMV immediate early promoter and initiate viral replication. Similarly, inflammation and cellular stress can significantly increase the expression of transgenes under its control (40, 43-45). In this regard, cartilage tissue affected by OA is enriched in stress-activated chondrocytes that inhabit high-density eroded sites. GFP expression was also pronounced in areas of chondrocyte proliferation and clustering, as well as on the surfaces of osteophytes, which arise as a result of sustained activation of osteochondral progenitors during the transition from cartilaginous tissue to the synovium. A pronounced activation of GFP expression was also observed in cartilage tissue chips from healthy joints after incubation in an explant culture. Since no additional vector was added to these chips, this induction was due to vector DNA already present in the chondrocytes. Thus, this should reflect a significant increase in metabolic

- 18 038300 and transcriptional activity in transduced chondrocytes as a result of stress against the background of extraction and / or changes in growth conditions.

Thus, while a number of reports describe the production of synthetic inflammation-inducible promoter systems for gene therapy applications, the CMV immediate early promoter, at least in the context of OA and a large mammalian joint, appears to be naturally regulated by disease. In addition, the regional differences in GFP expression observed in cartilaginous tissue affected by OA indicate the prospect of an AAV vector and an expression cassette driven by the CMV promoter, it is preferable to direct expression in the area of articular cartilage under conditions of the greatest pathological stress. This lays the foundation for the development of targeted chondroprotective and regenerative strategies.

Taken together, data from this study demonstrated that scAAV can provide long-term expression of a homologous therapeutic transgene in a large mammalian joint. In addition, gene delivery appears to be significantly more efficient in the context of OA, promoting increased expression in synovial tissues and in articular cartilage.

Example 2. scAAV-mediated delivery of the IL-1Ra gene for the treatment of osteoarthritis: pharmacokinetics and efficacy in a horse model.

This example describes the delivery of eqIL-1Ra by rAAV in a horse model of osteochondral fragment (OCF) OA. The data indicate that gene therapy with recombinant AAV can efficiently deliver anti-arthric proteins to human-sized joints. Unlike any existing treatment for OA, this approach is characterized by the ability to block pain symptoms and erosive progression of the disease.

Animals used in the study

The animals used in this study were donated to the University of Florida, or purchased from local farms and training centers. To investigate efficacy in the OCF model, animal performance and evaluators were provided with anonymized information regarding treatment group allocation. One horse initially assigned to the Treated group was sacrificed in the middle of the experimental protocol due to pneumonia resulting from complications during recovery from anesthesia. This animal was then replaced to replenish the number of subjects required for statistical analysis. Endpoints for each study parameter were pre-determined as described below. All data presented is based on 10 Treated and 10 Control animals that completed the experiment protocol; no animals were excluded from data analysis. The discussion of outlier data points is clearly described in the word document and in the figures. All animal procedures were performed in accordance with both the NIH Laboratory Animal Care and Use Guidelines and the University of Florida Institutional Animal Care and Use Committee. Unless otherwise indicated, horses were housed in groups in large open horse pens with full access to movement.

Constructing and Retrieving AAV Vectors

In order to minimize the immune recognition of the IL-1Ra transgene product and create a pharmacokinetic profile for the transfer of the homologous IL-1Ra gene using the AAV vector, DNA sequences encoding the equine IL-1Ra ortholog were used as a therapeutic reporter. In order to maximize the expression of the transgenic protein, the native eqIL-1Ra (57, 58) cDNA was codon-modified (16) (GeneArt) and the Kozak consensus sequence (17) was inserted just upstream of the translation initiation codon (Fig. 1). In this construct, transgene expression is driven by the CMV immediate early promoter / enhancer (30). The AAV vectors were packaged in the AAV2.5 capsid (18, 19) at the University of Florida Department of Vectors or the Department of Vectors of the University of North Carolina at Chapel Hill using the methods described previously (7).

ELISA for the determination of IL-1 β, IL-1Ra and PGE ₂ horses

Horse IL-1Ra (R&D Systems), PGE ₂ (R&D Systems) and horse IL-13 (GenWay) levels were analyzed by specific ELISA. Samples of synovial fluid from joints of both the Treated and Control groups were diluted 1: 1 with buffered saline containing hyaluronidase at 50 U / ml and incubated at 37 ° C for 30 min before measuring the protein content. Two-fold serial dilutions in reagent-diluted (R&D Systems) serum and synovial fluid samples were prepared over a wide range to ensure variability in assay results. Each series of dilutions was performed in duplicate and each diluted sample was analyzed in the wells at three stages.

Mean values were calculated based on the readings with the boundaries of the standard curves of the respective analyzes.

Efficiency Research in the OCF Model

Twenty purebred horses, ages 2 to 9, of different sexes, were used for this phase of the study. The animals were healthy, with no lameness or radiological signs.

- 19 038300 diseases of the wrist joints. Before induction, the equine disease models were treadmill trained for 5 days / week for 3 weeks. On each training day, the horses were forced to trot (4-5 m / sec) for 2 min, gallop (~ 9 m / sec) for 2 min, and trot again for 2 min. Before subsequent use, animals were randomly assigned to equal treatment and control groups.

After treadmill training under general anesthesia, arthroscopic examination was performed bilaterally in both intercarpal joints. During the procedure, an 8 mm osteochondral injury was performed in one randomly distributed joint medially from the radial carpal bone using an osteoma aligned perpendicular to the articular surface (14). The specified fragment was left attached to the capsular tissues. In order to simulate natural damage (59), surgical cleansing of the original bone was performed (14). The contralateral joint in each horse acted as a simulated functioning internal control. All horses were stabled for 7 days after surgery and provided with appropriate veterinary care.

Two weeks after surgery, after surgical disinfection of the forelimb joints, the OCF joint of horses assigned to the Treated group received an injection of 5x 10 ¹² vg scAAV.eqIL-1Ra suspended in lactated Ringer's solution in a total volume of 5 ml. Horses in the Control group received 5 ml of Virus-free lactated Ringer's solution. One week after injection, the horses were returned to the 5 day / week treadmill training program described above for 10 weeks. During training, horses underwent weekly studies and assessments of lameness. At the end of the 10-week training period, a final arthroscopic examination was performed on both intercarpal joints. This fragment was removed and the lesion in the original bone was surgically cleared and repaired. After recovery, the animals were returned to the herd for research. Arthroscopic images were collected during arthroscopic procedures. X-ray and MR images were performed immediately before arthroscopic procedures and prior to treatment at week 0. Every other week during the entire protocol, peripheral blood and urine were collected and synovial fluid was aspirated from both intercarpal joints.

Assessment of lameness

Forelimb lameness was assessed weekly for 10 weeks after the functional period of treadmill training using both subjective and objective methods. Subjective visual assessments of lameness were performed by two qualified evaluators who were appropriately provided with anonymized information using horses on a treadmill while walking and trotting (~ 4 m / s) according to the guidelines of the American Association of Hippological Practitioners. The scoring system was as follows: 0, no lameness; 1, lameness is difficult to detect and invisible on a consistent basis; 2, lameness is difficult to notice when walking or trotting in a straight line, but it is noticeable under certain circumstances; 3, lameness is noticeable on a consistent basis when trotting under all circumstances; 4, lameness is noticeable when walking; 5, lameness results in minimal weight bearing during movement and / or at rest or complete inability to move.

In order to objectively assess gait, the Lameness Locator® (Lameness Locator®; Equinosis) inertial motion sensor analysis system was used, which was developed specifically for the detection and assessment of lameness in horses (22, 23). For each weekly session, at least 3 measurements were taken at a trot speed on a treadmill of ~ 4 m / s. Each measurement was calculated based on a minimum of 30 continuous steps. Lameness was calculated as a vector sum using the mean maximum head height (HDmax) and mean minimum head height (HDmin) between left and right steps for each step in each dimension (22, 23). HDmax is the difference between the maximum head position that occurs after the right forelimb returns to its original position and that that occurs after the left forelimb returns to its original position. HDmin is the difference in the minimum head height that occurs during the return of the right forelimb to its original position and that that is formed during the return of the left forelimb to its original position. For each session, the average HDmax and HDmin values from at least 3 measurements were used to calculate the vector sum (VS) as follows:

VS = NHDmax ² + HDmin ² (22, 23)

For both subjective and objective assessments, week 1 lameness values were used as baseline levels for each horse. Subsequent measurements for each horse were calculated as percent change from baseline.

MR imaging and evaluation

MR studies of both wrists were performed using a Toshiba Titan (Japan) 1.5 Tesla high-field unit. Under general anesthesia, the animals were placed in a lying position on the left side, with

- 20 038300 each wrist was in partial flexion (15-25 °) in a quadrature transmit / receive knee coil (QD Knee). The MR coil and sequences were selected and modified to be clinically useful in live horses (24), and include sagittal and axial proton density (PD), dorsal T2-weighted, axial T2 shortened tau inverse recovery (STIR) , sagittal proton density with suppression of signal from adipose tissue (PD-FS) and sagittal gradient echo with purification with suppression of signal from adipose tissue (SPGR-FS). The cumulative detection time was approximately one hour and twenty minutes for all sequences in both limbs. MR images for each horse were examined by three evaluators who were provided with anonymized information regarding treatment group allocation. After describing an image of 6 MR sequences for each intercarpal joint and time point, indices were determined for the predominant pathologies associated with the model, including synovial fluid effusion, synovial proliferation, severity of osteochondral injury, articular cartilage injury, bone marrow edema in the radial carpal bone. sclerosis of the radius of the carpal bone and third bone of the wrist, edema of the joint capsule and capsular fibrosis, using a scale from 0 to 10, where 0 meant normal and 10 meant severe pathology (60, 61). The assessment was based on the involvement of the intercarpal joint only. The endpoints for each pathology are the average of 3 evaluators.

The total indices of MR pathology were determined based on the sum of individual pathologies (60, 61).

Arthroscopic evaluation

Both intercarpal joints of horses in the Treated and Control groups were examined and visualized arthroscopically after osteochondral lesion formation and again at the endpoint of the experimental protocol. The digital images collected during the procedures were scored by three evaluators who were provided with impersonal information regarding the size of the lesion and the extent of fragment repair, the integration of the marginal zone of damage by the surrounding cartilage tissue, the appearance of the superficial cartilage in general, and the appearance of the synovium, and ligaments. Based on the criteria of Dymock et al. (62) used a grading system from 0 to 10, where 0 was normal and 10 was severe.

Histological examination

The osteochondral fragment and synovium tissue removed during arthroscopy at the endpoint were fixed in paraformaldehyde, decalcified, and embedded in paraffin. Consecutive sections 5 μm thick were placed on charged microscopic preparations, dewaxed, rehydrated, and blocked in a 3% peroxide / methanol mixture for 10 min at room temperature. Alternating sections at sites of interest were stained with hematoxylin and eosin (H&E) and toluidine blue, respectively. The slice series were analyzed and classified by two evaluators, who were provided with anonymized information, using a classification system adapted from McIlwraith et al. (63). Briefly, the integrity of the articular cartilage was scored based on evidence of chondrocyte necrosis, clustering, fibrillation, and / or focal cell loss. The synovial membrane was assessed and graded based on signs of vascularization, intimal hyperplasia, subintimal edema, and / or subintimal fibrosis. Leukocyte infiltration was assessed in points on the same scale as the value of inflammation. Ultimately, subchondral bone and repair surface were assessed for matrix quality, osteochondral lesions, bone remodeling, and osteochondral dissection. The total index was calculated based on the sum of the individual indices.

Measurement of neutralizing antibodies targeting the capsid. The methods were adapted based on those described by Li et al. (64). The synovial fluid was digested with hyaluronidase as described for ELISA, and the blood serum was incubated at 56 ° C for 30 min to inactivate the complement. Using serum-free medium, a series of 2-fold serial dilutions were prepared from previously prepared blood serum or synovial fluid. The diluted samples were mixed with ~ 1x 10 ⁹ vg scAAV.eqIL-1Ra packed in AAV2.5 capsid in a total volume of 250 μl and incubated for 1 h at 37 ° C in order to bind antibodies. The mixtures were then added to confluent cultures of equine synovial fibroblasts in 24-well plates containing 250 μl of culture medium (500 μl / well total volume). After incubation for 48 h under standard culture conditions, conditioned media were collected and analyzed for eqIL-1Ra content by ELISA. NAb titers were indicated as the reciprocal of the maximum dilution capable of reducing by 50% the eqIL-1Ra levels produced by AAV.eqIL-1Ra infected cells preincubated as described above, but without biological fluids.

Statistical analysis

The analyzes consisted of Student's t-tests for independent samples, analysis of covariance of Student's t-tests with baseline indices acting as covariates, and correlation analyzes. In most cases, one-sided tests were used, since a pri

- 21,038300 ori hypothesized that horses receiving scAAV.eqIL-1Ra treatment would have lower mean values based on the diagnostic scores used, thereby indicating tail direction. The experimental design was a two-sample repetitive measurement design using horses randomly assigned to treatment groups (Treated or Control). Data were analyzed using Student's t-tests in several independent samples. With a Type I error of 0.05, 80% power and an effect size d = 1.3 (large), a total of 20 horses were required in the study to show the treatment effect at any time. Because correlations between baseline measurements and repeated measurements were expected to occur, the study power exceeded 80% with baseline measurements included as covariates.

Efficacy of scAAV.eqIL-1Ra in an OA model with an osteochondral fragment In order to assess the functionality of AAV-mediated expression of IL-1Ra, an OCF OA model adapted from Frisbie et al. Was used. (fourteen). For this study (plotted in the graph in Fig. 5A) 20 healthy purebred horses were randomly assigned to equal groups: Treated and Control. In one intercarpal joint of each animal, an 8 mm osteochondral lesion was performed atroscopically in the medial part of the radial carpal bone. The contralateral joint was examined in parallel arthroscopically and acted as a simulated functioning internal control. Two weeks after surgery (study day 0), the OCF joint of the horses in the Treated group was injected with 5x10 ¹² vg scAAV.eqIL-1Ra. Horses in the Control group received a similar volume of saline injection. One week later (the time allotted for the onset of IL-1Ra transgenic expression), the horses were scheduled for sports training for 10 weeks, which, in the context of osteochondral injury, induce pathologies corresponding to early OA.

At the end of sports training, the intercarpal joints of the animals were assessed arthroscopically, and the osteochondral fragment and the adjacent synovium were removed for analysis. The lesion was surgically cleaned and repaired, and after recovery, the animals were returned to the herd for research.

Local and systemic levels of eqIL-1Ra after intra-articular injection of the vector ELISA measurement of synovial fluids from joints with OCF group Treated patients showed a significant increase in eqIL-1Ra levels throughout the 12-week study. Achieving an average level of 214 ng / ml two weeks after injection, eqIL-1Ra production was ˜4 times greater than when measured in healthy joints injected with the same dose of virus (FIG. 5B). During the training protocol, the expression of eqIL-1Ra gradually decreased, and at week 12 it was ~ 59 ng / ml, which was close to the expression observed in normal joints. In synovial fluids from joints with OCF of the Control group, as well as from simulated functioning joints of both groups, IL-1Ra remained at levels before treatment during the study and did not exceed 1 ng / ml. Despite the fact that the average levels of eqIL-1Ra in the joints of the Treated group were characterized by fairly smooth dynamics, the expression in individual animals was highly variable (Fig.5C), especially at the earliest time point, when the expression was characterized by more than 230-fold range of variation more than in one animal it exceeded 930 ng / ml. At the end of the study, much of the early variation disappeared, and the range of variation narrowed to ~ 30-fold, with the highest expression occurring at 119 ng / ml.

In order to analyze the leakage of the transgenic protein from the joint, the eqIL-1Ra content in urine and peripheral blood serum was measured at each time point. The level of eqIL-1Ra in urine remained consistently low (<3 ng / ml), with no significant differences between the Treated and Control groups (Fig. 5D). Likewise, the mean eqIL-1Ra serum level remained less than 4 ng / ml for 9 out of 10 horses in both groups (Fig. 5E). Prior to injection, one horse from each of the Treated and Control groups had serum eqIL-1Ra levels that exceeded 100 ng / ml for no apparent reason (Fig. 5F). Although circulating eqIL-1Ra levels in these animals subsequently increased to> 500 ng / ml, no concomitant increase in eqIL-1Ra was observed in the synovial fluid of the OCF joint of the Control horse or in simulated functioning joints of this horse or another. , also the level of eqIL-1Ra in each stably remained below 1 ng / ml. The level of endogenous IL-1 in synovial fluids remained below the detection level (16 pg / ml) in all biological fluids throughout the study. These results indicated that under these treatment conditions, transgenic expression of eqIL-1Ra is functionally limited to the joint and does not increase IL-1Ra levels systemically. In contrast, an increase in serum eqIL-1Ra 200 times higher than normal did not have a noticeable effect on eqIL-1Ra content in synovial fluids.

In support of the results of other authors (27), an increase in mean levels of neutralizing antibodies to AAV2.5 (NAb) over time was observed in both serum and synovial fluid of horses treated with the vector (Fig. 5G). The NAb titer in the synovial fluids of the joints into which the vector was injected was consistently higher than in the blood. No NAb in animal fluids of the Control group

- 22 038300 was not detected at any point in time.

Reduced lameness associated with treatment with scAAV.eqIL-1Ra

To assess the effect of treatment on joint pain, forelimb lameness was assessed using the lameness index and by motion analysis using wireless detection of attached inertial sensors (22, 23). Lameness was plotted against time as the average percentage relative to the start of training at week 1 after injection. Relative to the Control group, animals in the Treated group showed a gradual but progressive decrease in lameness as measured by both methods, which peaked at 36% (P = 0.03) improvement at week 10 based on visual assessment (Fig.6A, left panel) and 40% (P = 0.04) improvement at weeks 10 and 11 based on motion analysis (FIG. 6A, right panel). Consistent with the reduction in joint pain based on these functional parameters, measurement of prostaglandin E2 (PGE2) in articular lining fluids was> 50% reduction in the Treated versus Control group starting at week 4 until the end of the protocol (FIG. 6B).

ScAAV.eqIL-1Ra delivery enhances acute osteochondral injury repair

Radiographic abnormalities were observed in all joints with OCF two weeks after surgery and at the endpoint; however, the anatomical complexity of the wrist joint, combined with the variability in position between imaging sessions, did not allow for uniform temporal comparisons in horses. Magnetic resonance (MR) images taken at the same time points provided a clearer picture of the changes in joint pathology associated with each osteochondral injury, facilitating pre-treatment and endpoint comparisons at 12-week intervals for each individual. (24). In all cases, MR imaging changes were mainly found medially, near the surgically generated fracture (FIG. 7A). Two weeks after injury, a well-defined high-intensity signal defined the boundaries of each fragment in the radial carpal bone and was accompanied, to varying degrees, in joints with OCF, increased density of adjacent bone tissue, regional fluid accumulation in the bone marrow (bone marrow edema), joint effusion, synovial hyperplasia , as well as fibrous expansion and edema of the joint capsule. Using predetermined indices (week 0) for these pathologies as baseline levels, analysis of covariance using MR images at the endpoint was performed for each horse to assess the effects of treatment on joint morphology. As reflected in FIG. 7A7B, both groups were characterized by equivalent changes in the joint capsule, with a similar decrease in capsular edema and increased fibrous induration, which was associated mainly with arthroscopic procedure and fluid infusion and, to a lesser extent, with osteochondral injury. Consistent with the anti-inflammatory properties of IL-1Ra injected intra-articularly, the OCF joints in the Treated group were characterized by significantly reduced joint effusion (34%, P = 0.008) and synovial proliferation (27%, P = 0.008) compared to the Control group (Fig. 7B). The Treated group also had a 32% (P = 0.01) increase in fracture repair and a 36% (P = 0.02) decrease in bone marrow edema. Among the major pathologies induced by OCF, the joints in the Treated group had a 25% (P = 0.001) decrease in the overall pathology index compared to the Control group (Fig. 7B).

Arthroscopic images taken during OCF acquisition and at the endpoint (immediately before surgical repair of the fragment) were also provided in anonymized form for the assessment of pathologies. Analysis of covariance was performed using pretreatment indices (week 2) as baseline (FIGS. 8A-8B). As shown in FIG. 8A, these results were in general agreement with those obtained from MR images. Animals in the Treated group were characterized by a significant increase in the repair of osteochondral damage (29%, P = 0.03) and articular cartilage adjacent to the fracture (17%, P = 0.02). Despite the presence of tendencies towards an improvement in the total indices for the cartilage tissue and the normalization of ligamentous inflammation, they did not reach statistical significance in an individual relation. At the same time, in the aggregate, among all pathological parameters, the joints with OCF in the Treated group were characterized by a 24% (P = 0.04) improvement in the total indices of arthroscopic pathology (Fig. 8A). According to these data, in 8/10 horses in the Treated group, osteochondral lesions recovered to the extent that extraction of the original fragment with a medical chisel was required. In contrast, in 7/10 horses in the Control group, the repaired tissue was spongy and soft during the indentation hardness test, and the fragment was easily removed using arthroscopic forceps.

Histological examination of the extracted fragments and adjacent tissues of the synovium was characterized by significant differences in the quality of the repaired tissue at the border with damage to OCF (Fig. 8B-8C). According to the results of arthroscopy and MRI, in the treated group, the bone tissue at the interface looked more mature, with higher mineralization and formation of lamellar bone tissue with detectable osteons (Fig. 8D). Repaired fabric in

- 23 038300 group Control mainly consisted of primary immature bone tissue. Although there was a trend towards improvement in cartilage tissue, the indices were slightly outside the range of statistical significance (P = 0.06). Moderate reductions in mean indices of synovial infiltration and fibrosis were also observed, but these were also not statistically significant. Based on the evaluated criteria, the joints of the Treated group showed a 24% (P = 0.003) normalization of the overall pathology index compared to the untreated Control group (Fig. 8C).

Association between eqIL-1Ra levels and articular pathology

Observing increased GFP activity in joints of horses with naturally occurring OA (see Example 1), the association between eqIL-1Ra expression in joints with the OCF treated group and the severity of articular pathology at the time of injection was studied. Comparing each animal pooled MRI scores at week 0 with peak synovial fluid eqIL-1Ra levels at week 2 post injection (FIG.9A, left panel) and mean eqIL-1Ra levels during the 10-week study (FIG.9A, right panel), no significant correlation was noted in all 10 horses. At the same time, if a horse with eqIL-1Ra expression of 930 ng / ml at week 2 was considered as a sharp outlier, then a high direct correlation was found between articular pathology upon injection and the level of eqIL-1Ra produced at week 2 (r = 0 , 80, P = 0.01), as well as average levels of eqIL-1Ra at all time points (r = 0.69, P = 0.03). Thus, for 90% of the animals, there was a significant direct association between articular pathology during treatment and the amount of transgenic IL-1Ra produced in the joint.

Interestingly, in the OCF-treated joints of the treated group, mean IL-1Ra levels in synovial fluid over the 10-week study ranged from ~ 6 to 159 ng / ml, with no significant correlation with therapeutic effect observed. A plot of the cumulative MRI indices of each horse immediately before injection versus those at the endpoint illustrated the effect of AAV.eqE.-1Ra treatment versus saline (FIG. 9B). Using the most consistent lineage formulas for the Treated and Control groups, a sustained 24-25% improvement using scAAV.eqIL-1Ra was assessed regardless of baseline pathology. Given that animals with the worst overall pathology scores generally produced the highest levels of eqIL-1Ra (FIG. 9A), a fairly consistent treatment effect was observed in all animals of the Treated group, regardless of the specific amount of IL-1Ra produced. Taking into account the variability in the expression of transgenes among animals (Fig.5A-5G and 9A), these data indicate that for each animal, the level of IL-1Ra produced in each of the joints receiving scAAV.eqIL-1Ra reached the maximum level of efficacy in the specified model system.

These studies have shown that in a large mammalian joint, direct intra-articular AAV-mediated gene delivery can lead to an increase in steady-state levels of the secreted homologous therapeutic gene product (IL-1Ra) in synovial fluids by more than 50 times compared to the endogenous background value. Despite the variable expression among the joints of the Treated group in the context of acute osteochondral injury, the long-term increase in IL-1Ra provided a significant beneficial effect such that a single administration of AAV.IL-1Ra two weeks after injury resulted in a decrease in joint pain and intra-articular inflammation and increased endogenous repair of damaged bone tissue and adjacent cartilage tissue.

Taken together, these data demonstrate that AAV can provide long-term therapeutically relevant expression of IL-1Ra in joints proportional to the size of the human knee and, when applied shortly after injury, may protect against the symptomatic development of an acute pre-OA model. In addition, no side effect on the vector or transgene was observed, and at least in the equine system, intra-articular expression of IL-1Ra provided no apparent risk of systemic immunosuppression.

Similar to the report by Ishihara et al. (27) observed an increase in the NAb titer after delivery of the vector, both in the synovial fluid and in the blood serum. At the same time, given the apparent transduction efficiency of articular chondrocytes, which are likely to represent a relatively stable cell population, frequent re-introduction of vectors may not be necessary. In addition, since the titer of primary antibodies is reduced, circulating NAbs at a lower titer may be unable to inhibit the supra-physiological bolus of AAV virions delivered intra-articularly.

Gene expression patterns

Standard drug delivery methods provide the practitioner with an acceptable degree of control so that a given dose can be administered to achieve a predicted effect. Under the modern system of concepts, the cells of the articular tissues are genetically modified with the help of a recombinant virus with the aim of continuous synthesis and secretion of the anti-arthric protein, IL-1Ra, in the joint space and local tissues. At the same time, since the amount of transgenic IL-1Ra produced at any given time reflects the joint synthesis of modified cells present in the joint, the levels can vary significantly (both in

- 24 038300 both at the individual level and at the interindividual level) based on the nature of cell populations, initially modified by the virus and providing changes in their composition and metabolic activity.

In this regard, the data of the present study on the horse joint showed that the pathological status of the joint during treatment has a significant direct effect on the expression of transgenes. Delivery of AAV.IL-1Ra to inflamed joints with acute osteochondral injury resulted in a ~ 5-fold increase in mean IL-1Ra levels as compared to those observed in healthy joints. Despite the fact that the level of IL-1Ra in synovial fluid was in more than 100-fold range in joints with OCF two weeks after treatment, in 9 out of 10 animals there was a high direct correlation between the level of pathology (total MRI index) during injection and subsequent production of IL-1Ra. Consistent with the reduction in inflammation and healing of the fissure, the increased expression of IL-1Ra similarly gradually decreased and at the 12-week endpoint reached levels produced in normal joints.

IL-1Ra as a therapeutic gene in OA

In the joints treated with scAAV.eqIL-1Ra, an average normalization of pathology of ~ 25% was observed in relation to the Control group. Consistent with its role as an anti-inflammatory agent (49), long-term overexpression of eqIL-1Ra resulted in increased mobility and decreased joint effusion and synovitis. Although there was a protective effect in the cartilage adjacent to the injury, the effect did not extend to the entire joint. In this acute injury model, degeneration of cartilage tissue distal to the osteochondral injury was moderate, making any treatment-related changes difficult to detect. Regarding the ability of this treatment to inhibit cartilage erosion, it is assumed that the efficacy and safety of local delivery of scAAV.eqIL-1Ra in a chronic OA model over a 12-month time frame would indicate that long-term expression of IL-1Ra leads to a more distant chondroprotective effect.

Interestingly, despite a decrease in PGE ₂ in synovial fluid, the Treated group was characterized by significantly increased osteochondral fracture repair compared to the Control group. This result, apparently, contradicts the literature data indicating the vital functions of cyclooxygenase-2 and prostaglandins in fracture repair (50, 51). However, these molecules mainly contribute to the acute inflammatory phase of bone tissue healing, which begins to complete approximately 7-14 days after injury, followed by repair processes associated with cell differentiation and matrix synthesis (52). Despite the fact that acute inflammation is required to initiate the repair process, chronic inflammation can prevent activation of the Wnt / β-catenin pathway and osteoblast differentiation, which inhibits bone tissue repair (53, 54). Thus, as a result of vector injection two weeks after surgery, the decrease in inflammatory signaling due to overexpression of IL-1Ra probably promoted osteoblast differentiation during the repair phase, leading to increased healing. In the appropriate order, treatment with AAV.IL-1Ra in a similar time period after joint injury can provide therapeutic / prophylactic effects in post-traumatic OA, combining inflammation reduction and enhancement of tissue repair with promising subsequent chondroprotection.

Despite the intra-articular expression of IL-1Ra in a wide range, no correlation was observed between the content of eqIL-1Ra in the synovial fluid and the therapeutic effect. This has been associated with the mechanism of action of IL-1Ra as a competitive inhibitor of the IL-1 receptor type 1 (4). Due to the efficiency of signal transduction with the participation of IL-1, IL-1Ra must be present in a 100-1000-fold excess compared to IL-1 in order to completely inhibit its activity (55, 56). In joints with OCF, the level of IL-1 in the synovial fluid was below the detection limit (16 pg / ml). Thus, in most of the treated joints, IL-1Ra was present in a 6000-fold excess of at least 400-fold excess in the least-expressed joints.

Since IL-1Ra does not exhibit any known agonistic effect (4), upon availability, IL-1 receptors become occupied, and additional IL-1Ra may not provide an additional effect. Taking these aspects into account, the sustained ~ 24-25% normalization of joint pathology observed in the Treated group appears to reflect the maximum effect achieved in this disease model with this IL-1Ra delivery route.

Overall, these data suggested that IL-1Ra is particularly useful for intra-articular gene therapy for OA. It does not require complex regulation, but only synthesis levels above the therapeutic threshold. When achieved, overproduction has little visible side effect, and thus is resistant to the wide variation associated with virus-mediated gene delivery in vivo. The data indicate that the delivery of the IL-1Ra gene is unlikely to lead to the cure of OA, but is only able to block the signaling component of IL-1 in an extremely complex disease involving large-scale pathologies and processes mediated at the tissue and body level. However, since IL-1 is

- 25 038300 is a primary factor influencing the inflammatory cascade, and plays an important role in a variety of erosive processes in OA, which are mediated at the cellular level, it has the prospect of providing a significant beneficial effect to patients in a wide range of severity of diseases.

Taken together, the data from this study indicate that gene therapy with recombinant AAV can provide safe, long-term, effective delivery of anti-arthritic protein to human-sized joints. Moreover, AAV.IL-1Ra, used shortly after joint injury, can lead to a decrease in symptomatic development in the acute model of pre-OA. Unlike any existing treatment, this approach is characterized by the ability to block pain symptoms and erosive progression of the disease. Based on these results, it can be concluded that AAV.IL-1Ra combines efficacy with an appropriate level of safety, providing a profile that supports clinical research in human and equine OA.

Example 3. Obtaining codon-modified human IL-1Ra cDNA cDNA of human interleukin-1 receptor antagonist (IL-1Ra), which provided the highest expression (secretion) of IL-1Ra genetically.

modified cells were obtained for clinical use in a gene therapy protocol. To this end, the native cDNA sequence was codon-modified using human optimization algorithms from two DNA synthesis companies, GeneScript and GeneArt. Two modified IL-1Ra sequences were ordered from GeneArt, with and without the Kozak consensus sequence immediately upstream of the translation initiation site. After the synthetic cDNA was obtained, all three were inserted into the Sac II and Not I sites of the expression cassette of the pHpa-trs-SK plasmid, a self-complementary (double-stranded DNA) variant of the AAV vector based on the AAV2 genome, and transformed into Sure II bacterial cells. In this construct, transgene expression was driven by the CMV immediate early promoter / enhancer. After validation of the respective inserts, cultures were obtained from 3 new constructs on an industrial scale, as well as two pre-existing constructs based on the scAAV vector containing a) the native human IL-1Ra cDNA, and b) the coding sequence for green fluorescent protein (GFP). Plasmids from each culture were isolated and purified twice using cesium chloride gradients. The concentrations of each DNA preparation were determined using a spectrophotometer and visualization in agarose gels.

In order to determine the relative expression of the IL-1Ra protein from each construct, equivalent amounts of each plasmid were transfected into HEK 293 cells at ~ 70% confluence. After about 48 hours, the conditioned medium was removed from each culture and the human IL-1Ra content was determined by ELISA using commercially available kits. FIG. 10 depicts the average levels from three transfections using each plasmid construct. As expected, no detectable level of IL-1Ra was observed in cultures receiving the scAAV.GFP plasmid. The expression of IL-1Ra from 3 codon-modified cDNAs exceeded that from the native sequence by ~ 2-4 times. While the expression of IL-1Ra from both constructs synthesized by GeneArt exceeded that from GeneScript, the cDNA from GeneArt with the Kozak consensus sequence provided the highest expression of IL-1Ra.

In order to confirm the results observed in 293 cells (Fig. 10) in another cell line, equal numbers of scAAV vector plasmids containing the codon-modified IL1Ra cDNA from GeneArt (with and without the Kozak leader sequence) were transfected into human osteosarcoma cell cultures (OS) at ~ 75% confluence. Parallel cultures of OS cells were transfected with scAAV vector plasmids containing the coding sequences for GFP or native human IL-1Ra. After about 48 hours, the conditioned culture medium was removed and the IL-1Ra content was determined using a commercially available ELISA. FIG. 11 depicts the average levels from three transfections using each plasmid. Similar to that observed in 293 cells (Fig. 10), the expression of human IL-1Ra from OS cells receiving the modified constructs was significantly higher than that from the native human sequence with the modified Kozak sequence, resulting in the highest levels generally.

In order to study the expression level of modified human IL-1Ra cDNA in the context of virus-mediated gene delivery, vector plasmids scAAV containing coding sequences for a) GFP, b) native human IL-1Ra, and c) codon-modified human IL-1Ra sequence with leader sequence Kozak from GeneArt (opt + K), packaged in AAV2 capsid. The titers of the corresponding viral preparations were determined using both PCR and slot blot analyzes. Cultures of primary human synovial fibroblasts were infected with both viral preparations of IL-1Ra in the dose range from 10 ³ to 10 ⁵ DNase-resistant viral genomes (vg) per cell. Parallel infection with 10 ⁵ vg / cell scAAV. GFP was used as negative control. 5 days after infection, the medium conditioned with the infected cultures was removed and analyzed for IL-1Ra content by ELISA. As shown in FIG. 12, cells infected with a codon-modified human IL-1Ra vector

- 26 038300 ka, produced higher levels of transgenic human IL-1Ra at all viral doses.

FIG. 13 depicts the alignment of the native to human IL-1Ra DNA and the codon-modified IL-1Ra sequence containing the underlined Kozak sequence. Alignment showed that the modification changed 105 of 534 nucleotides in the native IL-1Ra cDNA sequence. Despite the fact that the DNA sequence was changed in order to increase the translation and expression of IL-1Ra RNA, the amino acid sequence of the translated protein was identical to the native protein.

Literary sources

1. R. F. Loeser, S. R. Goldring, C. R. Scanzello, M. B. Goldring, Osteoarthritis: a disease of the joint as an organ. Arthritis Rheum 64.1697-1707 (2012).

2. S. A. Olson, P. Home, B. Furman, J. Huebner, M. Al-Rashid, V. B. Kraus, F. Guilak, The role of cytokines in posttraumatic arthritis. J Am Acad Orthop Surg 22,29-37 (2014).

3. M. Kapoor, J. Martel-Pelletier, D. Lajeunesse, J. P. Pelletier, H. Fahmi, Role of proinflammatory cytokines in the pathophysiology of osteoarthritis. Nat Rev Rheumatol 7.33-42 (2011).

4. W. P. Arend, M. Malyak, C. J. Guthridge, C. Gabay, Interleukin-1 receptor antagonist: role in biology.

Annu Rev Immunol 16.27-55 (1998).

5. X. Chevalier, P. Goupille, AD Beaulieu, FX Burch, WG Bensen, T. Conrozier, D. Loeuille, AI Kivitz, D. Silver, B. E. Appleton, Intraarticular injection of anakinra in osteoarthritis of the knee: a multicenter, randomized, double-blind, placebo-controlled study. Arthritis Rheum 61,344-352 (2009).

6. I. D. Kay, E. Gouze, T. I. Oligino, I. N. Gouze, R. S. Watson, P. P. Levings, M. L. Bush, A. Dacanay, D.

M. Nickerson, P. D. Robbins, C. H. Evans, S. C. Ghivizzani, Intra-articular gene delivery and expression of interleukin-IRa mediated by self-complementary adeno-associated vims. J Gene Med 11.605-614 (2009).

7.R.S. Watson, T. A. Broome, P. P. Levings, B. L. Rice, I. D. Kay, A. D. Smith, E. Gouze, I. N. Gouze, E.

A. Dacanay, W. W. Hauswirth, D. M. Nickerson, A. I. Dark, P. T. Colahan, S. C. Ghivizzani, scAAV-mediated gene transfer of interleukin-1-receptor antagonist to synovium and articular cartilage in large mammalian joints.

Gene Ther 20.670-677 (2013).

8.C H. Evans, S. C. Ghivizzani, P. D. Robbins, Arthritis gene therapy and its tortuous path into the clinic.

TranslRes 161.205-216 (2013).

9. H. Madry, M. Cucchiarini, Advances and challenges in gene-based approaches for osteoarthritis. J Gene

Med 15.343-355 (2013).

10. K. R. Vincent, B. P. Conrad, B. I. Fregly, Η. K. Vincent, The pathophysiology of osteoarthritis: a mechanical perspective on the knee joint. PMR 4, S3-9 (2012).

11. L. R. Goodrich, A. I. Nixon, Medical treatment of osteoarthritis in the horse - a review. Vet J 171.51-69 (2006).

12. D. M. McCarty, P. E. Monahan, R. I. Samulski, Self-complementary recombinant adeno-associated vims (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther 8, 1248-1254 (2001).

13. DM McCarty, H. Fu, PE Monahan, C. E. Toulson, P. Naik, RI Samulski, Adeno-associated vims terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther 10.2112-2118 (2003).

14. D. D. Frisbie, S. C. Ghivizzani, P. D. Robbins, C. H. Evans, C. W. Mcllwraith, Treatment of experimental equine osteoarthritis by in vivo delivery of the equine interleukin-1 receptor antagonist gene. Gene Ther 9, 12-20 (2002).

15. E. Gouze, I. N. Gouze, G. D. Palmer, C. Pilapil, C. H. Evans, S. C. Ghivizzani, Transgene persistence and cell turnover in the diarthrodial joint: implications for gene therapy of chronic joint diseases. Mol Ther 15,11 120 (2007).

16. S. Fath, A. P. Bauer, M. Liss, A. Spriestersbach, B. Maertens, P. Hahn, C. Ludwig, F. Schafer, M. Graf, R.

Wagner, Multiparameter RNA and codon optimization: a standardized tool to assess and enhance autologous mammalian gene expression. PLoS One 6, el7596 (2011).

17. M. Kozak, Interpreting cDNA sequences: some insights from studies on translation. Mamm Genome 7, 563-574 (1996).

- 27 038300

18. C. Li, N. Diprimio, D. E. Bowles, M. L. Hirsch, A. E. Monahan, A. Asokan, J. Rabinowitz, M. Agbandje McKenna, R. J. Samulski, Single Amino Acid Modification of Adeno-Associated Virus Capsid Changes Transduction and Humoral Immune Profiles. J Virol, (2012).

19. D. E. Bowles, S. W. McPhee, C. Li, S. J. Gray, J. J. Samulski, A. S. Camp, J. Li, B. Wang, A. E. Monahan, J. E. Rabinowitz, J. C. Grieger, L. Govindasamy, M. Agbandje-McKenna, X. Xiao, R. J. Samulski, Phase 1 gene therapy for Duchenne muscular dystrophy using a translational optimized AAV vector. Mol Ther 20.443-455 (2012).

20. L. J. Sandell, T. Aigner, Articular cartilage and changes in arthritis. An introduction: cell biology of osteoarthritis. Arthritis Res 3, 107-113 (2001).

21. A. Ishihara, J. S. Bartlett, A. L. Bertone, Inflammation and immune response of intra-articular serotype 2 adeno-associated virus or adenovirus vectors in a large animal model. Arthritis 2012,735472 (2012).

22. K. G. Keegan, C. G. MacAllister, D. A. Wilson, C. A. Gedon, J. Kramer, Y. Yonezawa, H. Maki, P. F. Pai, Comparison of an inertial sensor system with a stationary force plate for evaluation of horses with bilateral forelimb lameness. Am J Vet Res 73,368-374 (2012).

23. KG Keegan, DA Wilson, J. Kramer, SK Reed, Y. Yonezawa, H. Maki, PF Pai, MA Lopes, Comparison of a body-mounted inertial sensor system-based method with subjective evaluation for detection of lameness in horses ... Am J Vet Res 74,17-24 (2013).

24. M. D. Winter, The basics of musculoskeletal magnetic resonance imaging: terminology, imaging sequences, image planes, and descriptions of basic pathologic change. Vet Clin North Am Equine Pract 28.599616 (2012).

25. L. R. Goodrich, J. N. Phillips, C. W. Mcllwraith, S. B. Foti, J. C. Grieger, S. J. Gray, R. J. Samulski, Optimization of scAAVIL-lra In Vitro and In Vivo to Deliver High Levels of Therapeutic Protein for Treatment of Osteoarthritis. Mol Ther Nucleic Acids 2, e70 (2013).

26. PJ Mease, K. Hobbs, A. Chalmers, H. El-Gabalawy, A. Bookman, E. Keystone, DE Furst, P. Anklesaria, AE Heald, Local delivery of a recombinant adenoassociated vector containing a tumour necrosis factor alpha antagonist gene in inflammatory arthritis: a phase 1 dose-escalation safety and tolerability study. Ann Rheum Dis 68.1247-1254 (2009).

27. PJ Mease, N. Wei, EJ Fudman, AJ Kivitz, J. Schechtman, RG Trapp, KF Hobbs, M. Greenwald, A. Hou, SA Bookbinder, GE Graham, CW Wiesenhutter, L. Willis, EM Ruderman, JZ Forstot, MJ Maricic, K. H. Dao, C. H. Pritchard, DN Fiske, FX Burch, A. M. Prupas, P. Anklesaria, A. E. Heald, Safety, tolerability, and clinical outcomes after intraarticular injection of a recombinant adeno-associated vector containing a tumor necrosis factor antagonist gene: results of a phase 1/2 Study. J Rheumatol 37,692-703 (2010).

28. C. R. Scanzello, S. R. Goldring, The role of synovitis in osteoarthritis pathogenesis. Bone 51,249-257 (2012).

29. R. Rollin, F. Marco, JA Jover, JA Garcia-Asenjo, L. Rodriguez, L. Lopez-Duran, B. Fernandez Gutierrez, Early lymphocyte activation in the synovial microenvironment in patients with osteoarthritis: comparison with rheumatoid arthritis patients and healthy controls. Rheumatol Int 28,757-764 (2008).

30. E. V. Schmidt, G. Christoph, R. Zeller, P. Leder, The cytomegalovirus enhancer: a pan-active control element in transgenic mice. Mol Cell Biol 10.4406-4411 (1990).

31. R. Lane Smith, M. C. Trindade, T. Ikenoue, M. Mohtai, P. Das, D. R. Carter, S. B. Goodman, D. J. Schurman, Effects of shear stress on articular chondrocyte metabolism. Biorheology 37.95-107 (2000).

32. F. Berenbaum, Signaling transduction: target in osteoarthritis. Curr Opin Rheumatol 16,616-622 (2004).

- 28 038300

33. C. J. Malemud, Protein kinases in chondrocyte signaling and osteoarthritis. Clin Orthop Relat Res, S145151 (2004).

34. S. Rigoglou, A. G. Papavassiliou, The NF-kB signaling pathway in osteoarthritis. Int J Biochem Cell Biol 45.2580-2584 (2013).

35. Μ. B. Goldring, K. B. Maren, Cartilage homeostasis in health and rheumatic diseases. Arthritis Res Ther 11.224 (2009).

36. Μ. B. Goldring, Chondrogenesis, chondrocyte differentiation, and articular cartilage metabolism in health and osteoarthritis. Ther Adv Musculoskelet Dis 4.269-285 (2012).

37. R. Liu-Bryan, R. Terkeltaub, Emerging regulators of the inflammatory process in osteoarthritis. Nat Rev Rheumatol 11, 35-44 (2015).

38. P. Loser, G. S. Jennings, M. Strauss, V. Sandig, Reactivation of the previously silenced cytomegalovirus major immediate-early promoter in the mouse liver: involvement of NFkappaB. J Virol 72,180-190 (1998).

39. R. A. Johnson, S. M. Huong, E. S. Huang, Activation of the mitogen-activated protein kinase p38 by human cytomegalovirus infection through two distinct pathways: a novel mechanism for activation of p38. J Virol 74,1158-1167 (2000).

40. R. U. Svensson, J. M. Barnes, O. W. Rokhlin, A. B. Cohen, M. D. Henry, Chemotherapeutic agents upregulate the cytomegalovirus promoter: implications for bioluminescence imaging of tumor response to therapy. Cancer Res 67,10445-10454 (2007).

41. J. L. Meier, M. J. Keller, J. J. McCoy, Requirement of multiple cis-acting elements in the human cytomegalovirus major immediate-early distal enhancer for viral gene expression and replication. J Virol 76.313326 (2002).

42. X. F. Liu, X. Wang, S. Yan, Z. Zhang, M. Abecassis, M. Hummel, Epigenetic control of cytomegalovirus latency and reactivation. Viruses 5, 1325-1345 (2013).

43. W. Bruening, B. Giasson, W. Mushynski, H. D. Durham, Activation of stress-activated MAP protein kinases up-regulates expression of transgenes driven by the cytomegalovirus immediate / early promoter. Nucleic Acids Res 26.486-489 (1998).

44. M. Ramanathan, G. Hasko, S. J. Leibovich, Analysis of signal transduction pathways in macrophages using expression vectors with CMV promoters: a cautionary tale. Inflammation 29.94-102 (2005).

45. A. J. Simpson, G. A. Cunningham, D. J. Porteous, C. Haslett, J. M. Sallenave, Regulation of adenovirusmediated elafin transgene expression by bacterial lipopolysaccharide. Hum Gene Ther 12.1395-1406 (2001).

46. A. V. Miagkov, A. W. Varley, R. S. Munford, S. S. Makarov, Endogenous regulation of a therapeutic transgene restores homeostasis in arthritic joints. J Clin Invest 109,1223-1229 (2002).

47. M. Khoury, J. Adriaansen, MJ Vervoordeldonk, D. Gould, Y. Chemajovsky, P. Bigey, C. Bioquel, D. Scherman, PP Tak, C. Jorgensen, F. Apparailly, Inflammation-inducible anti-TNF gene expression mediated by intra-articular injection of serotype 5 adeno-associated virus reduces arthritis. J Gene Med 9,596-604 (2007).

48. F. A. van de Loo, A. S. de Hooge, R. L. Smeets, A. C. Bakker, Μ. B. Bennink, O. J. Amtz, L. A. Joosten, A. M. van Beuningen, P. K. van der Kraan, A. W. Varley, W. B. van den Berg, An inflammation-inducible adenoviral expression system for local treatment of the arthritic joint. Gene Ther 11,581-590 (2004).

49. KA Elsaid, L. Zhang, Z. Shaman, C. Patel, TA Schmidt, GD Jay, The impact of early intra-articular administration of interleukin-1 receptor antagonist on lubricin metabolism and cartilage degeneration in an anterior cruciate ligament transection model ... Osteoarthritis Cartilage 23,114-121 (2015).

- 29 038300

50. X. Zhang, E. M. Schwarz, D. A. Young, J. E. Puzas, R. N. Rosier, R. J. O'Keefe, Cyclooxygenase-2 regulates mesenchymal cell differentiation into the osteoblast lineage and is critically involved in bone repair. J Clin Invest 109, 1405-1415 (2002).

51. P. Geusens, P. J. Emans, J. J. de Jong, J. van den Bergh, NS AIDs and fracture healing. Curr opin

Rheumatol 25.524-531 (2013).

52. L. Claes, S. Recknagel, A. Ignatius, Fracture healing under healthy and inflammatory conditions. Nat rev

Rheumatol 8,133-143 (2012).

53. Μ. M. Matzelle, M. A. Gallant, K. W. Condon, N. C. Walsh, C. A. Manning, G. S. Stein, J. B. Lian, D. B.

Burr, E. M. Gravallese, Resolution of inflammation induces osteoblast function and regulates the Wnt signaling pathway. Arthritis Rheum 64,1540-1550 (2012).

54. J. Chang, F. Liu, M. Lee, B. Wu, K. Ting, J. N. Zara, C. Soo, K. Al Hezaimi, W. Zou, X. Chen, D. J.

Mooney, C. Y. Wang, NF-kB inhibits osteogenic differentiation of mesenchymal stem cells by promoting β-catenin degradation. Proc Natl Acad Sci USA 110.9469-9474 (2013).

55. W. P. Arend, H. G. Welgus, R. C. Thompson, S. P. Eisenberg, Biological properties of recombinant human monocyte-derived interleukin 1 receptor antagonist. J Clin Invest 85,1694-1697 (1990).

56. W. P. Arend, The balance between IL-1 and IL-IRa in disease. Cytokine Growth Factor Rev 13,323-340 (2002).

57. R. D. Howard, C. W. Mcllwraith, G. W. Trotter, J. K. Nyborg, Cloning of equine interleukin 1 receptor antagonist and determination of its lull-length cDNA sequence. Am J Vet Res 59,712-716 (1998).

58. H. Kato, T. Ohashi, H. Matsushiro, T. Watari, R. Goitsuka, H. Tsujimoto, A. Hasegawa, Molecular cloning and functional expression of equine interleukin-1 receptor antagonist. Vet Immunol Immunopathol 56,221-231 (1997).

59. Μ. K. Boyce, T. N. Trumble, C. S. Carlson, D. M. Groschen, K. A. Merritt, Μ. P. Brown, Non-terminal animal model of post-traumatic osteoarthritis induced by acute joint injury. Osteoarthritis Cartilage 21,746-755 (2013).

60. C. E. Kawcak, D. D. Frisbie, N. M. Werpy, R. D. Park, C. W. Mcllwraith, Effects of exercise vs experimental osteoarthritis on imaging outcomes. Osteoarthritis Cartilage 16,1519-1525 (2008).

61. D. D. Frisbie, C. E. Kawcak, C. W. Mcllwraith, N. M. Werpy, Evaluation of polysulfated glycosaminoglycan or sodium hyaluronan administered intra-articularly for treatment of horses with experimentally induced osteoarthritis. Am J Vet Res 70.203-209 (2009).

62 D. C. Dymock, Μ. P. Brown, K. A. Merritt, T. N. Trumble, Concentrations of stromal cell-derived factor-1 in serum, plasma, and synovial fluid of horses with osteochondral injury. Am J Vet Res 75,722-730 (2014).

63. C. W. Mcllwraith, D. D. Frisbie, C. E. Kawcak, C. J. Fuller, M. Hurtig, A. Cruz, The OARSI histopathology initiative - recommendations for histological assessments of osteoarthritis in the horse. Osteoarthritis

Cartilage 18 Suppl 3, S93-105 (2010).

64. C. Li, M. Hirsch, A. Asokan, B. Zeithaml, H. Ma, T. Kafri, RJ Samulski, Adeno-associated virus type 2 (AA V2) capsid-specific cytotoxic T lymphocytes eliminate only vector-transduced cells coexpressing the AAV2 capsid in vivo. J Virol 81.7540-7547 (2007).

Other options for implementation

All of the characteristics disclosed herein can be combined in any combination. Each characteristic disclosed herein may be replaced by an alternative characteristic designed to fulfill the same, equivalent, or similar purpose. Thus, unless explicitly indicated otherwise, each disclosed characteristic is only an example of a representative sequence of equivalent or similar characteristics. From the above description, a person skilled in the art can easily establish the necessary characteristics of the present disclosure, and without deviating from its essence and scope, can make various changes and modifications of the present disclosure to adapt it to different uses and conditions. Thus, other embodiments are also within the scope of the claims.

- 30 038300

Equivalents

Although embodiments of the present invention have been described and illustrated herein, those skilled in the art will readily envisage a variety of means and / or structures for performing a function and / or obtaining results and / or one or more of the advantages described herein. and each of such variations and / or modifications is described within the scope of the embodiments of the present invention described herein. More generally, it will be easy for those skilled in the art to understand that all parameters, dimensions, materials, and configurations described herein are illustrative, and that actual parameters, dimensions, materials and / or configurations will depend on the particular application or areas. applications for which the idea (s) of the present invention are used. Those skilled in the art will understand many equivalents to the specific embodiments of the present invention as described herein, or by routine experimentation alone, they will be able to establish such equivalents. Thus, it should be understood that the foregoing embodiments are provided by way of example only and that within the scope of the appended claims and their equivalents, embodiments of the present invention may be practiced other than as specifically described and presented in the claims. Embodiments of the present invention are directed to each individual characteristic, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such properties, systems, products, materials and / or methods, if such properties, systems, products, materials, kits and / or methods are not mutually contradictory, are included within the scope of this disclosure.

All definitions defined and used in this document are to be understood for purposes of control over dictionary definitions, definitions in documents incorporated by reference and / or the usual meanings of defined terms.

All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

The singular, as used herein in the description and in the claims, unless clearly indicated to the contrary, are to be understood to mean at least one.

The phrase and / or used in this document in the description and in the claims, should be understood as meaning either or both together of the elements so combined, for example, elements that are jointly present in some cases and separately present in other cases. Several elements listed with the phrase and / or are to be understood in the same way, for example, as one or more of the elements thus combined. Other elements may optionally be present other than those specifically defined by a condition and / or associated or unrelated to those specifically defined. Thus, by way of a non-limiting example, reference to A and / or B when used in connection with an open formulation such as containing may refer, in one embodiment, to A only (and elements other than B are not necessarily included); in accordance with another embodiment, only to B (this optionally includes elements other than A); in accordance with yet another embodiment, both A and B (other elements are not necessarily included); etc.

As used in the present description and in the claims, the term or is to be understood as having the same meaning as and / or as defined above. For example, when separating items in a list, the phrase either or and / or will be understood to include, ie, include at least one, but also include more than one, a series or list of items, and optionally additional unlisted items. Only terms that clearly indicate the opposite, such as only one of, or exactly one of, when used in the claims, consisting of will refer to the inclusion of exactly one element from the row or list of elements. Generally, the term or as used in this document will only be construed to indicate exclusionary alternatives (i.e., one or the other, but not both) in the event that it is preceded by exclusivity terms such as either, one of, only one of or exactly one of. The term consisting essentially of, when used in the claims, will have its usual meaning as used in the field of patent law.

Used in this document in the description and in the claims, a phrase at least in relation to a list of one or more elements should be understood as meaning at least one element selected from any one or more elements in the list of elements, but not necessarily including at least one of each and every element specifically represented in the list of elements and not excluding any combination of elements in the list of elements. This definition also allows for the possibility that they may not necessarily be present.

- 31 038300 to identify elements other than those specifically defined in the list of elements to which the phrase at least one belongs, whether or not they are related to these specially defined elements. Thus, as a non-limiting example, at least one of A and B (or, which is equivalent to at least one of A or B, or, which is equivalent to at least one of A and / or B) may refer according to with one embodiment to at least one, optionally including more than one, A, wherein B is not present (and optionally including elements other than B); in accordance with another embodiment, to at least one, optionally including more than one, B, while A is not present (and optionally including elements other than A); in accordance with yet another embodiment, at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

It should also be understood that, unless expressly indicated otherwise, in any methods claimed herein that involve more than one step or step, the order of the steps or steps of the method is not necessarily limited to the order in which the steps or steps of the method are mentioned.

In the claims, as well as in the description above, all transitional phrases such as containing, including, bearing, having, containing, including, containing, consisting of, etc. should be understood as open, i.e. they mean inclusion but not limitation. Only transitional phrases consisting of and consisting essentially of will be closed or semi-closed transitional phrases, respectively, as set out in the Patent Examination Guidelines of the United States Patent Office, Section 2111.03. It should be understood that the embodiments described herein are also contemplated that also use an open transition phrase (e.g., comprising), in accordance with alternative embodiments such as consisting of and consisting essentially of, the characteristic is described using an open transition phrases. For example, if the present disclosure describes a composition comprising A and B, then the present disclosure also provides alternative embodiments of a composition consisting of A and B and a composition consisting essentially of A and B.

Claims (26)

CLAIM 1. A pharmaceutical composition for delivery to a subject of a codon-modified gene encoding IL-1Ra, which contains a recombinant adeno-associated virus (rAAV) particle containing a recombinant nucleic acid containing a codon-modified gene encoding human IL-1Ra, and a pharmaceutically acceptable carrier, where the level of expression of IL-1Ra in human cells is higher with this optimized sequence compared to the wild-type IL1Ra sequence. 2. A pharmaceutical composition for delivery to a subject of a codon-modified gene encoding IL-1Ra, which contains a recombinant adeno-associated virus (rAAV) particle containing a recombinant nucleic acid containing a codon-modified gene encoding horse IL-1Ra (eqIL-1Ra), and a pharmaceutically acceptable carrier, wherein the codon-modified gene comprises SEQ ID NO: 2. 3. The pharmaceutical composition of claim 1, wherein the codon-modified gene comprises SEQ ID NO: 10. 4. The pharmaceutical composition of claim 3, wherein the codon-modified gene has the sequence SEQ ID NO: 10. 5. A pharmaceutical composition according to any one of the preceding claims, wherein the recombinant nucleic acid further comprises a Kozak sequence immediately upstream of the translation initiation site of a codon-modified gene encoding IL-1Ra, wherein the Kozak sequence is GCCACC. 6. The pharmaceutical composition of claim 5, wherein the recombinant nucleic acid comprises SEQ ID NO: 3 or SEQ ID NO: 11. 7. A pharmaceutical composition according to any one of the preceding claims, further comprising a promoter upstream of a codon-modified gene encoding IL-1Ra. 8. The pharmaceutical composition of claim 7, wherein the promoter is a cytomegalovirus (CMV) immediate early promoter / enhancer. 9. A pharmaceutical composition according to any one of the preceding claims, wherein the rAAV is serotype 2 or 2.5. 10. A pharmaceutical composition according to any one of the preceding claims, wherein the rAAV is self-complementary (scAAV2 or scAAV2.5). 11. A pharmaceutical composition according to any one of the preceding claims, wherein the pharmaceutically acceptable carrier is a sterile liquid. - 32 038300 12. The pharmaceutical composition of claim 9, wherein the sterile liquid comprises water, oil, or saline. 13. A pharmaceutical composition according to any one of the preceding claims, further comprising a liposome, lipid, lipid complex, microsphere, microparticle, nanosphere or nanoparticle. 14. A method of treating a degenerative pathological condition of large supporting joints, said method comprising administering to a subject in need thereof, a composition according to any one of claims 1, 3-13 intra-articularly, wherein the subject is a human. 15. A method of treating a degenerative pathological condition of large supporting joints, said method comprising administering to a subject in need thereof, a composition according to any one of claims 2, 5-13 intra-articularly, wherein the subject is a horse. 16. The method according to claims 14-15, wherein the degenerative pathological condition of the large supporting joints is osteoarthritis. 17. The method of treatment according to claims 14-16, which is characterized by a decrease in the level of synovial effusion, inflammation of the joint, the total MRI index of joint pathology and the level of damage to cartilage tissue. 18. The method according to any one of claims 14-17, characterized in that from 1x10 ¹⁰ to 1x10 ¹³ viral genomes (vgs) are introduced into the joint. 19. The method of claim 18, wherein 1x10 ¹⁰ to 9x1011 viral genomes (vgs) are injected into the joint. 20. The method of claim 18, wherein 1x10 ¹⁰ to 5x1011 viral genomes (vgs) are injected into the joint. 21. The method of claim 18, wherein 5x10 ¹⁰ to 5x1011 viral genomes (vgs) are injected into the joint. 22. A method according to any one of claims 14-21, wherein the volume administered to the joint is 1-20 ml. 23. The method of claim 22, wherein the volume administered to the joint is 5-20 ml. 24. The method of claim 22, wherein the volume administered to the joint is 1-10 ml. 25. The method of claim 22, wherein the volume administered to the joint is 5-10 ml. 26. A method according to any one of claims 12 to 23, wherein the rAAV particle is administered by intra-articular injection.