DK2316479T3 - Pharmaceutical compositions comprising the immunologically active herpes simples virus (HSV) protein fragments - Google Patents

Description

Description

TECHNICAL FIELD OF THE INVENTION

[0001] The invention relates to molecules, compositions and methods that can be used for the treatment and prevention of viral infection. More particularly, the invention identifies epitopes of HSV proteins that can be used for methods, molecules and compositions having the antigenic specificity of HSV-specific T cells, and in particular, of CLA+, CD8+ T cells. In addition, the disclosure relates to a method for purifying virus-specific T lymphocytes and for identifying further epitopes useful in the development of diagnostic and therapeutic agents for detecting, preventing and treating viral infection.

BACKGROUND OF THE INVENTION

[0002] HSV-2 infects about 22% of persons in the US. The level of infection is increasing. HSV-2 infection is associated with an increased risk of acquisition of HIV-1 infection, the main cause of AIDS. HSV-2 infection is associated with death or morbidity of infants who are infected in the neonatal period by transit through areas of HSV-2 infection in the cervix or vagina. HSV-2 also causes painful recurrent ulcerations in the genital or rectal areas of some infected persons and as such leads to a very high level of health care utilization and pharmacy costs. There is no licensed preventative vaccine. There are positive data from a phase III clinical trial showing about 40% efficacy to prevent HSV-2 infection, and about 70% efficacy to prevent HSV-2-induced clinical disease (Stanberry, 2002, N. Engl. J. Med. 347(21):1652-1661. However there was only positive efficacy data in the subset of study participants who were female and who were uninfected with HSV type 1 at the time the study started. A very large phase III confirmatory clinical trial in HSV-1 uninfected women only is currently being planned and will take several years.

[0003] Once HSV-2 infection occurs, the virus causes latent infection of the sensory neurons in the ganglia that enervate the area of skin or mucosal infection. Periodically, the virus reactivates from latency in the neurons, travels down their axons, and causes a productive infection of the skin or mucosa in the areas that are enervated by the neuron. Current therapy can decrease this lytic replication in the skin or mucosa. However, current therapy does not remove latent virus from neurons. If the antiviral therapy is not being taken at the time the virus reactivates in the neuron, it will not prevent replication of the virus in the skin or mucosa, and thus is not able to reduce new symptoms or block the chance of shedding of live HSV-2 into the environment and thus transmission of HSV-2. Current therapy can be taken on a continual basis (suppressive therapy), which reduces symptomatic outbreaks and HSV-2 shedding, but as soon as it is stopped, the same underlying pattern of recurrent symptoms and lesions returns.

[0004] There remains a need to identify specific epitopes capable of eliciting an effective immune response to HSV infection. Such information can lead to the identification of more effective immunogenic antigens useful for the prevention and treatment of HSV infection.

SUMMARY OF THE INVENTION

[0005] The disclosure provides HSV antigens, polypeptides comprising HSV antigens, polynucleotides encoding the polypeptides, vectors, and recombinant viruses containing the polynucleotides, antigen-presenting cells (APCs) presenting the polypeptides, immune cells directed against HSV, and pharmaceutical compositions. The pharmaceutical compositions can be used both prophylactically and therapeutically. The disclosure additionally provides methods, including methods for preventing and treating HSV infection, for killing HSV-infected cells, for inhibiting viral replication, for enhancing secretion of antiviral and/or immunomodulatory lymphokines, and for enhancing production of HSV-specific antibody. For preventing and treating HSV infection, for enhancing secretion of antiviral and/or immunomodulatory lymphokines, for enhancing production of HSV-specific antibody, and generally for stimulating and/or augmenting HSV-specific immunity, the method comprises administering to a subject a polypeptide, polynucleotide, recombinant virus, ARC, immune cell or composition of the invention. The methods for killing HSV-infected cells and for inhibiting viral replication comprise contacting an HSV-infected cell with an immune cell of the invention. The immune cell of the invention is one that has been stimulated by an antigen of the invention or by an ARC that presents an antigen of the invention. A method for producing such immune cells is also provided by the invention. The method comprises contacting an immune cell with an ARC, preferably a dendritic cell, that has been modified to present an antigen of the invention. In a preferred embodiment, the immune cell is a T cell such as a CD4+ or CD8+ T cell.

[0006] The disclosure provides a method of identifying an immunologically active antigen of a virus that attacks skin. The method comprises obtaining peripheral blood mononuclear cells (RBMC) from a subject infected with the virus that attacks skin, and isolating lymphocytes from the RBMC that express cutaneous lymphocyte-associated antigen (CLA). The method further comprises identifying CLA-positive lymphocytes that selectively kill cells infected with the virus that attacks skin, and determining the identity of the antigen present in the identified lymphocyte. Accordingly, the antigen whose identity is determined in this manner is the immunoiogicaiiy active antigen of the virus that attacks skin. The invention provides antigens and epitopes of viruses that attack skin, which antigens and epitopes are usefui for eiiciting an immune response to the virus. These compositions can be used to prevent, treat and diagnose virai infection.

[0007] Exampies of viruses that attack skin inciude herpes simpiex virus (HSV), inciuding HSV-1 and HSV-2, human papiiioma virus (HPV), and variceiia zoster virus (VZV). Exampies of HSV antigens that have been identified by the method of the disciosure inciude UL7, UL25, UL26, UL46, US6 or US8 of HSV-2. in addition, immunoiogicaiiy active epitopes within these HSV-2 proteins have been identified, nameiy, 174-186 or 50-192 of UL7, 405-413 or 322-417 of UL25, 475-483 or 404-627 of UL26, 354-362 or 254-722 of UL46, 365-373 or 342-393 of US6, and 518-526 or 503-545 of US8.

[0008] The disciosure further provides a method of enriching a popuiation of iymphocytes for T iymphocytes that are specific to a virus that attacks skin. The method comprises obtaining peripherai biood mononuciear ceiis (PBMC) from a subject infected with the virus that attacks skin, and isoiating iymphocytes from the PBMC that express cutaneous lymphocyte-associated antigen (CLA). The method further com prises isoiating CLA-positive iymphocytes thatseiectiveiy kill cells infected with the virus that attacks skin. The CLA-positive iymphocytes isoiated by seiective cell killing are the T lymphocytes specific to the virus that attacks skin.

[0009] The disclosure additionally provides pharmaceutical compositions comprising the HSV antigens and epitopes identified herein. Also provided is an isolated polynucleotide that encodes a polypeptide of the invention, and a composition comprising the polynucleotide. The disclosure additionally provides a recombinant virus genetically modified to express a polynucleotide of the invention, and a composition comprising the recombinant virus. In preferred embodiments, the virus is a vaccinia virus, canary pox virus, HSV, lentivirus, retrovirus or adenovirus. A composition of the invention can be a pharmaceutical composition. The composition can optionally comprise a pharmaceutically acceptable carrier and/or an adjuvant.

BRIEF DESCRIPTION OF THE FIGURES

[0010] Figures 1A-1C. Representative data showing that HSV-2-specific CD8 T-cells express high levels of CLA and CD28. Figure 1A shows an analysis of PBMC from a person with HSV-2 infection. Each dot is one lymphocyte. The X-axis shows the level of expression of CD8a, as measured with a fluorescent mAb which is specific for CD8a. The Y-axis shows the level of binding by a fluorescently labeled tetramer of the HLA B*0702 molecule bound to a peptide from HSV-2 with the sequence of protein VP22, amino acids 49-57. This reagent, called tetramer B7-RPR, only binds to HSV-2-specific CD8 T-cells. The cells in the upper right quadrant are HSV-2-specific CD8 T-cells. The cells in the lower right quadrant are CD8 T-cells with other specificities. Panel B1 of Figure IB shows an analysis of the cell surface expression of CLA, as detected with a mAb specific for CLA, which is limited to the cells in the upper right quadrant of Figure 1 A. Panel B2 of Figure 1B is similar except that the cells in the lower right quadrant of Figure 1A are analyzed. Panels Cl and C2 of Figure 1C are similar except that the expression of CD28 is analyzed. Overall, the data show that HSV-2-specific CD8 T-cells identified by tetramer B7-RPR express high levels of CLA and CD28.

[0011] Figures 2A-2C. Representative data from a typical human subject showing the physical and antigen expression characteristics of the cells that are sorted to purify HSV-2-specific T-cells from un-manipulated PBMC. The PBMC are stained with three different fluorescently labeled mAb. Figure2Ashows the forward scatter and side scatter characteristics of the PBMC. Each dot is one cell. Box R1 indicates the cells with the physical characteristics of lymphocytes, based on their forward scatter (an index of size) and side scatter (an index of granularity). Figure 2B shows the expression of CD8a, and CD28 amongst the cells in the R1 box in Figure 2A. Only the cells in box R1 are shown in the analysis in Figure 2B. The cells in region R2 have high expression of CD8a and CD28. Figure 2C shows the expression of CLA. Only the cells in region R1 and region R2 are shown in the analysis in Figure 2C. The horizontal bar Ml and the corresponding region R3 indicate the cells that have high expression of CLA. The lymphocytes expressing high levels of CD8a and CD28 and CLA (R1 and R2 and R3) were selected using a Becton Dickinson FacsVantage™ cell sorter and used for subsequent antigen discovery.

[0012] Figure 3. General outline of one example of the process, based on the use of the skin-homing receptor, CLA, to discover vaccine compounds to prevent or treat HSV-2 infection.

[0013] Figures 4A-4B. Representative data from a typical human subject showing that sorting cells that express high levels of CLA leads to the enrichment of HSV-2-specific CTL. PBMC are stained with mAb specific for CD8a, CD28, and CLA, and sorted into two groups of cells. Both groups are high expressers of CD8 and CD28. The groups differ in their expression of CLA. After sorting the cells are expanded as a bulk culture, and are tested for the killing of autologous ("auto"), or HLA class l-mismatched allogeneic ("alio") LCL that have been either infected with HSV-2 or not infected. Figure 4A shows the cytotoxicity of the sorted CD8-high, CD28-high, CLA-low cells. Figure 4B shows the cytotoxicity of the sorted CD8-high, CD28-high, CLA-high cells, which are able to kill autologous HSV-2-infected cells. The results show that cells that were selected on the basis of expression of CD8, CD28, and CLA specifically recognize and kill HSV-2 infected autologous cells, while cells that were selected on the basis of the expression of CD8a, CD28, but low levels of CLA do not recognize and kill HSV-2 Infected autologous cells.

[0014] Figures 5A-5D, Representative graphs showing the ability of nine amino acid-long synthetic peptides, which in each case correspond to the predicted amino acid sequence HSV-2 open reading frame, to allow HSV-2-specific T-lymphocytes clones that were purified by the skin-homing method to recognize and kill HSV-2-infected cells. In each case, increasing concentrations of peptide were incubated with the autologous LCL "target" cells. Concentrations in molarity are shown on the X axis. The Y axis indicates the extent to which the T-cell clone, which had been purified from the blood on the basis of CLA skin-homing receptor expression, killed the peptide-treated target cell. The indicated statistic, ECgg, is a graphical estimate of the concentration in molarity of the HSV-2-encoded peptide that is required to allow 50% of maximal recognition by the HSV-2-specific T-cell clone. Figure 5A: Killing by HSV-2-specific CD8 T-cell clone 10569.1 F3. Peptide is DRLDNRLQL (SEQ ID NO: 1), predicted to be encoded by HSV-2 ORF UL25, amino acids 405-413. Figure 5B: Killing by HSV-2-specific CD8 T-cell clone 6376.1E4. Peptide is GPHETITAL (SEQ ID NO: 2), predicted to be encoded by HSV-2 ORF UL26, amino acids 475-483. Figure 5C: Killing by HSV-2-specific CD8 T-cell clone 5491 .E2. Peptide is ASDSLNNEY (SEQ ID NO: 4), predicted to be encoded by HSV-2 ORF UL46, amino acids 354-362. Figure 5D: Killing by HSV-2-specific CD8 T-cell clone 10569.2B9. Peptide is RRAQMAPKR (SEQ ID NO: 5), predicted to be encoded by HSV-2 ORF US6, amino acids 365-373.

[0015] Figures 6A-6I. Specificity of tetramer staining and detection of HSV-specific cells in PBMC. Figure 6A: Lesion-derived clone 5491.2000.48, specific for HSV-2 VP22 amino acids 49-57, stained with tetramer B7-RPR, comprised of HLA B*0702 and HSV-2 VP22 amino acids 49-57, and anti-CD8a. Figure 6B: Similar analysis of clone negative control clone 5491.2000.48, specific for ICPO amino acids 743-751. Figure 6C: Similar analysis of PBMC from HSV-2-infected, B*0702-bearing subject 7282 stimulated for 12 days with VP22 amino acids 49-57. Figure 6D: Cytotoxicity of a typical clone, 7282.12, derived after sorting the cells in panel c for high expression of CD8aand tetramer binding. Targets were autologous EBV-LCL either untreated (♦), infected with HSV-2 (), or pulsed with peptide VP22 49-57 (·). Among 21 resultant clones, 18 (86%) were cytotoxic towards HLA B7-expressing EBV-LCL pulsed with peptide VP22 49-57 or infected with HSV-2, and each cytotoxic clone stained positive with tetramer B7-RPR. Figure 6E: Clone 5491.2000.81 stains with tetramer B7-APA. Figure 6F: Negative control clone 5491.2000.48 does not stain with tetramer B7-APA. Figure 6G: Clone 5491.2000.81 kills autologous EBV-LCL infected with HSV-2 (A) but not HSV-1 (♦) or uninfected (). Figure 6H: Lysis of autologous EBV-LCL pulsed with peptide ICPO 743-751 by clone 5941.2000.81. Figure 61: Proportion of CD8a-high cells in whole PBMC of HLA B*0702-expressing subjects which bind tetramer B7-RPR, specific for HSV-2 protein VP22, amino acids 49-57. Integers above bars are number of replicate aliquots of PBMC stained in each experiment. Bar heights are mean values. Error bars are standard deviations of the mean. For subjects 6376, 4196, and 5491, experiments were conducted on aliquots of PBMC thawed on two days (A and B) but obtained at a single phlebotomy. The inter-assay and intra-assay variabilities using replicate aliquots of cells were <10%. Controls (con) 1-3 are HSV-2 infected but B*0702-negative; controls 4-6 are HSV-uninfected and B*0702-positiive.

[0016] Figures 7A-7F. CLA expression by circulating CD8+ lymphocytes specific for three human herpesviruses. For HSV-2-specific T-cells, unique subject ID numbers are indicated below the HSV-2 antigens. Figure 7A: Tetramer B7-RPR and anti-CD8a staining of lymphocytes in PBMC from six HSV-2-infected, B*0702 subjects. Subject numbers at top are in same order as Fig. 6E and the percentages of CD8a-high lymphocytes staining with the tetramers are given in Fig. 6E. Quadrant lines are cutoffs for CD8a-high and tetramer binding. Figure 7B: Expression of CLA by CDBa-high lymphocytes that stain with tetramer B7-RPR. Figure 7C: Expression of CLA by CD8a-high lymphocytes that do not stain with tetramer B7-RPR. The percentage of CLA positive cells is indicated for each histogram. Figure 7D: Staining of PBMC from HLA A*0201 subject with tetramers A2-GLA specific for T-cells reactive with HSV-2 VP13/14 551-559 (left), A2-VLE or A2-NVP specific for T-cells reactive with CMV IE-1 316-324 or pp65 595-603, respectively (middle), or A2-CLG or A2-GLC specific for T-cells reactive with EBV LMP2 246-434 or BMLF-1 280-288, respectively (right), and anti-CD8a. For subject 10433, the gates for tetramer-high and tetramer-low CD8+ cells are shown. For CMV and EBV, the dot-plots correspond to lines 5, 1, 12, and 10 of Table 4. The proportion of CD8a-high cells staining with tetramer, and the quadrants indicating cutoffs for CD8a and tetramer binding, are shown. Figure 7E: Expression of CLA by CD8a-high lymphocytes that stain with herpesvirus tetramers. Figure 7F: Expression of CLA by CD8a-high lymphocytes not staining with the indicated tetramers B8-RPR. Percentage of CLA positive cells are indicated.

[0017] Figures 8A-8C. Expression of CLA by in vitro re-stimulated herpesvirus-specific CD8+ T-cells. For HSV-2-specific T-cells, unique subject ID numbers are indicated below the HSV-2 antigens. Figure 8A: PBMC from B*0702-bearing, HSV-2 infected subject 5491 (left two panels) or two different A*0201-bearing subjects (right two panels) stimulated for 13 days with HSV-2 VP22 49-57 (left), HSV-2 ICPO 743-751 (next), or EBV BMLF 280-288 (right two panels). Dot-plots display binding of the relevant tetramers and anti-CD8a. Quadrant lines are cutoffs for CD8a-high and tetramer binding. The percentages of CD8a-high cells that are tetramer-positive are indicated. Figure 8B: Expression of CLA by CD8a-high lymphocytes that stain with HSV-2 or EBV tetramers. Figure 8C: Expression of CLA by CD8a-high lymphocytes that do not stain with tetramer. Percentage of CLA positive cells as in Fig. 7.

[0018] Figures 9A-9B. Expression of cell surface antigens by circulating HSV-2-specific CD8+ T-cells. Figure 9A: PBMC from donor 4196 were gated for lymphocyte size and scatter, high CD8a expression, and binding of tetramer B7- RPR specific for VP22 49-57. Expression of CD28, CD62L, and CCR7 is dispiayed in the indicated histograms. Figure 9B: Simiiardata for CD8a-high lymphocytes from the same donor which did not bind tetramer B7-RPR.

[0019] Figures 10A-10I. CLA and CLA-ligand expression in skin and by lesion-derived cells. Figure 10A: Frozen section of HSV-2 lesion from subject 5491 stained with anti-E-selectin and haematoxylin Original magnification 20X. Figure 10B: Normal skin from subject 5491 stained with anti-E-selectin and haematoxylin. The epidermis is at upper right Original magnification 20X. Figure IOC: HSV-2 lesion stained with anti-CLA. Hair follicle and epidermis at lower left. Original magnification 4X. Figure 10D: Normal skin stained with anti-CLA. Original magnification 20X. Epidermis at right. Figure 10E: HSV-2 lesion stained with hematoxylin and eosin. Figure 10F: Normal skin stained with hematoxylin and eosin. Figure 10G: Lymphocytes expanded for 11 days from the biopsy stained with HSV-2 tetramer B7-RPR (left) or B7-APA (right) and anti-CD8a. Quadrant lines are cutoffs for CD8a-high and tetramer binding. The percentages of CD8a-high cells that are tetramer-positive are indicated. Figure 10H: Expression of CLA by CD8a-high, tetramer-binding cells for tetramer B7-RPR-PE (left) or B7-APA-PE (right). Figure 101: Expression of CLA by CD8a-high, tetramer non-binding cells. Percentages of CLA positive cells as in Fig. 7.

[0020] Figures 11A-11D. Cytotoxicity of PBMC from donor 4 (Figure 11A and 11C) and 1 (11B and 11D), sorted into CD8+ CD28+ CLAhigh (11A and 11B) or CD8+ CD28+ CLAlow (11C and 11D) fractions, and expanded with PHA and IL-2. Effectors were tested against autologous EBV-LCL targets infected with the indicated viruses, or pulsed with VP13/14 peptides amino acids 289-298 or 551-559. Results are percent specific release from CTL assays at effector to target ratios of 40 (solid bars), 20 (open bars) or 10 (vertical striped bars).

[0021] Figures 12A-12D. Enrichment of HSV-2-specific cells in the circulating CLA^’^^' compartment, presented as histograms of cell number vs. fluorescence intensity after sequential, multi-reagent staining. Figure 12A: Binding of anti-CD8a antibody to lymphocytes (gated on forward and side scatter) from subject 6376. Figure 12B: CD8a+ cells from panel A were analyzed for expression of CLA. Figure 12C: CLA+ cells from panel B were analyzed for binding of allophycocyanin (APC)-conjugated tetramer B7-RPR. Figure 12D: CLA- cells from panel B were analyzed for binding of tetramer B7-RPR. Note the Y-axis scales differ for each panel. The percentages of cells recorded as positive are shown in each panel.

[0022] Figures 13A-13F. Cytotoxicity of H LA class l-restricted CD8 clones towards autologous EBV-LCL targets pulsed with the indicated concentrations of HSV-2 peptides. Predicted HSV-2 proteins and amino acid residue numbers are indicated. Results are percent specific release at effector to target ratios of 20.

[0023] Figures 14A-14B. Antigen expression by recombinant viruses. Figure 14A: Cytotoxicity of VP11/12 (gene UL46) and VP13/14 (gene L)L47)-specific CD8 CTL clones against autologous LCL infected with parental HSV-2 HG52, UL47 deletion virus (del47), virus with UL47 re-inserted (47rev), wild-type vaccine (vWT), and vaccinia expressing UL47 (vUL47). Figure 14B: Proliferation ofVP16 (gene L)L48)-specificCD4+T-cell clone 1A.B.25.1 to inactivated virus antigen prepared from the indicated strains and autologous PBMC as APC. Values are mean of triplicate CPM 3H thymidine incorporation minus mean CPM for mock antigen (221 cpm).

[0024] Figures 15A-15C. Properties of atypical clone 2.3D8 selected by CD8a, CD28, and CLA expression. Figure 15A: Cytotoxicity of against autologous EBV-LCL in the presence or absence of HSV-2 infection and blocking anti-HLA mAb. Figure 15B: Comparison of IFN-γ secretion by clone 3D8 and typical class l-restricted clones 1F3 (B*1402/UL25 405-413) and 2B9 (B*27052/gD2 365-373), each from subject 2, after co-cultivation with autologous EBV-LCL treated as indicated, and effect of anti-HLA class I mAb. Figure 15C: Cell-surface expression of lymphocyte markers.

DETAILED DESCRIPTION OF THE INVENTION

[0025] The disclosure is based on discovery of a means by which HSV-2-specific lymphocytes in the blood become programmed to traffic to the skin during episodes of recurrent HSV-2 infection. Specifically, these T-cells have been found to express the glycoprotein epitope termed CLA (cutaneous lymphocyte-associated antigen). The disclosure makes use of this discovery to provide a method to purify HSV-2-specific T-lymphocytes from the blood that are HSV-2-specific based on sorting blood cells by a set of criteria that include the surface expression of CLA, CD8, and the costimulatory molecule CD28. This provides a method of rapid and efficient isolation of HSV-2-specific CD8 T-cells from blood. Afterobtaining these rare cells from the blood, a method of genetic expression cloning can be applied to determine the exact HSV-2 open reading frames (ORFs; antigens), and the exact short peptide sequences (epitopes) encoded by the HSV-2 genome, that are recognized by these HSV-2-specific CD8 T-cells.

[0026] The disclosure provides HSV antigens and epitopes that are useful for the prevention and treatment of HSV infection. Disclosed herein are antigens and/or their constituent epitopes confirmed to be recognized by T-cells derived from herpetic lesions. In some embodiments, T-cells having specificity for antigens of the invention have demonstrated cytotoxic activity against virally infected cells. The identification of immunogenic antigens responsible forT-cell specificity facilitates the development of improved anti-viral therapeutic and prophylactic strategies. Compositions containing antigens or polynucleotides encoding antigens of the invention provide effectively targeted vaccines for prevention and treatment of HSV infection. Available data indicate that boosting of HSV-2-specific immune responses can prevent infection or reduce the symptoms of HSV-2 in persons who are aiready infected. These ceiis can have one or more antivirai effect, including the ability to kill HSV-2-infected cells, thereby reducing the output of infectious HSV-2, and secrete proteins with antiviral properties.

Definitions [0027] All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified. As used in this application, the following words or phrases have the meanings specified.

[0028] As used herein, "polypeptide" includes proteins, fragments of proteins, and peptides, whether isolated from natural sources, produced by recombinant techniques or chemically synthesized. Polypeptides of the invention typically comprise at least about 6 amino acids, and can be at least about 15 amino acids. Typically, optimal immunological potency is obtained with lengths of 8-10 amino acids.

[0029] As used herein, "HSV polypeptide" includes HSV-1 and HSV-2, unless otherwise indicated. References to amino acids of HSV proteins or polypeptides are based on the genomic sequence information regarding HSV-2 (strain HG52) as described in A. Dolan et al., 1998, J. Virol. 72(3):2010-2021.

[0030] As used herein, "substitutional variant" refers to a molecule having one or more amino acid substitutions or deletions in the indicated amino acid sequence, yet retaining the ability to be "immunologically active", or specifically recognized by an immune cell. The amino acid sequence of a substitutional variant is preferably at least 80% identical to the native amino acid sequence, or more preferably, at least 90% identical to the native amino acid sequence. Typically, the substitution is a conservative substitution.

[0031] One method for determining whether a molecule is "immunologically active", or can be specifically recognized by an immune cell, is the cytotoxicity assay described in D.M. Koelle et al., 1997, Human Immunol. 53:195-205. Other methods for determining whether a molecule can be specifically recognized by an immune cell are described in the examples provided hereinbelow, including the ability to stimulate secretion of interferon-gamma or the ability to lyse cells presenting the molecule. An immune cell will specifically recognize a molecule when, for example, stimulation with the molecule results in secretion of greater interferon-gamma than stimulation with control molecules. For example, the molecule may stimulate greater than 5 pg/ml, or preferably greater than 10 pg/ml, interferon-gamma secretion, whereas a control molecule will stimulate less than 5 pg/ml interferon-gamma.

[0032] As used herein, "vector" means a construct, which is capable of delivering, and preferably expressing, one or more gene(s) or sequence(s) of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.

[0033] As used herein, "expression control sequence" means a nucleic acid sequence that directs transcription of a nucleic acid. An expression control sequence can be a promoter, such as a constitutive or an inducible promoter, or an enhancer. The expression control sequence is operably linked to the nucleic acid sequence to be transcribed.

[0034] The term "nucleic acid" or "polynucleotide" refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides.

[0035] As used herein, "antigen-presenting cell" or "ARC" means a cell capable of handling and presenting antigen to a lymphocyte. Examples of APCs include, but are not limited to, macrophages, Langerhans-dendritic cells, follicular dendritic cells, B cells, monocytes, fibroblasts and fibrocytes. Dendritic cells are a preferred type of antigen presenting cell. Dendritic cells are found in many non-lymphoid tissues but can migrate via the afferent lymph or the blood stream to the T-dependent areas of lymphoid organs. In non-lymphoid organs, dendritic cells include Langerhans cells and interstitial dendritic cells. In the lymph and blood, they include afferent lymph veiled cells and blood dendritic cells, respectively. In lymphoid organs, they include lymphoid dendritic cells and interdigitating cells.

[0036] As used herein, "modified" to present an epitope refers to antigen-presenting cells (APCs) that have been manipulated to present an epitope by natural or recombinant methods. For example, the APCs can be modified by exposure to the isolated antigen, alone or as part of a mixture, peptide loading, or by genetically modifying the APC to express a polypeptide that includes one or more epitopes.

[0037] As used herein, "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects. Examples of such salts include, but are not limited to, (a) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; and salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, furmaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acids, naphthalenedisulfonic acids, polygalacturonic acid; (b) salts with polyvalent metal cations such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, and the like; or (c) salts formed with an organic cation formed from N,N’- dibenzylethylenediamine or ethylenediamine; or (d) combinations of (a) and (b) or (c), e.g., a zinc tannate sait; and the like. The preferred acid addition salts are the trifluoroacetate salt and the acetate salt.

[0038] As used herein, "pharmaceutically acceptable carrier" Includes any material which, when combined with an active ingredient, allows the ingredient to retain biological activity and is non-reactive with the subject’s immune system. Examples include, but are not limited to, any of the standard pharmaceutical carriers such as a phosphate buffered saline solution, water, emulsions such as oil/water emulsion, and various types of wetting agents. Preferred diluents for aerosol or parenteral administration are phosphate buffered saline or normal (0.9%) saline.

[0039] Compositions comprising such carriers are formulated by well known conventional methods (see, for example, Remington’s Pharmaceutical Sciences, 18th edition, A. Gennaro, ed.. Mack Publishing Co., Easton, PA, 1990).

[0040] As used herein, "adjuvant" includes those adjuvants commonly used in the art to facilitate the stimulation of an immune response. Examples of adjuvants include, but are not limited to, helper peptide; aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; Freund’s Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Ml); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, NJ); AS-2 (Smith-Kline Beecham); QS-21 (Aquilla); MPL or 3d-MPL (Corixa Corporation, Hamilton, MT); LEIF; salts of calcium, iron or zinc; an insoluble suspension of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid A and quil A; muramyl tripeptide phosphatidyl ethanolamine or an immu-nostimulating complex, including cytokines (e.g., GM-CSF or interleukin-2, -7 or -12) and immunostimulatory DMA sequences. In some embodiments, such as with the use of a polynucleotide vaccine, an adjuvant such as a helper peptide or cytokine can be provided via a polynucleotide encoding the adjuvant.

[0041] As used herein, "a" or "an" means at least one, unless clearly indicated otherwise.

[0042] As used herein, to "prevent" or "protect against" a condition or disease means to hinder, reduce or delay the onset or progression of the condition or disease.

Overview [0043] HSV-2 encodes about 85 proteins using DMA which contains about 85 genes. The genes have names such as UL4, standing for unique long gene 4, or US4, standing for unique short gene 4. The proteins have several overlapping and complex sets of nomenclature that include names such as VP22, standing for virion protein number 22, or ICP35, standing for infected cell protein number 35. Each gene can encode one or more proteins. WO 98/2001 discloses coding sequences of HSV-2 and their use for inducing immunological responses.

[0044] Very little is known about which genes encode proteins that are recognized by HSV-2-specific CD8 T-cells. Each unique clonotype of CD8 T-cell recognizes an 8 to 10 amino acid linear fragment of a protein encoded by HSV-2. Most of these fragments, called epitopes, are 9 amino acids long, but there is no strict upper limit on their length. Each epitope is physically bound to a molecule on the surface of a cell (termed the antigen presenting cells). Typically, the antigen presenting cell is infected with HSV-2, although this is not always the case. In some instances, the antigen presenting cell may phagocytose material from outside the cell that contains non-viable HSV-2 material.

[0045] The HLA molecule, in the case of CD8 T-cell recognition, is a heterodimer composed of a HLA class I heavy chain molecule and the molecule β2 microglobulin. Because there are many different allelic variants of HLA class I molecules in the human population, an HSV-2 epitope peptide that binds to one allelic variant of HLA class I may not bind to another allelic variant. As a consequence, a HSV-2 epitope peptide that is recognized by CD8 T-cells from one person may not be recognized by CD8 T-cells from another person.

[0046] An HSV-2 antigen which has been proven to contain at least one smaller peptide epitope may contain diverse epitopes that are capable of being recognized by CD8 T-cells from many different persons. This pattern has generally been noted for the human immune response to many viruses. The invention described herein relates to the identity of several of HSV-2 protein antigens encoded by HSV-2 genes, and peptide epitopes that are internal fragments of these HSV-2 proteins. These HSV-2 proteins are logical vaccine compounds because they are now proven to stimulate CD8 T-cell responses.

[0047] The identification of which HSV-2 proteins are recognized by HSV-2-specificCD8 T-cells has been significantly limited by the difficulty in obtaining clones of HSV-2-specific CD8 T-cells. It has been estimated that less than 1 in 1000 circulating CD8 T-cells in the blood are HSV-2-specific (Posavad et al 1996). In the cloning process, a single cell is stimulated to divide many times and provide a population of genetically identical cells, which are then used to determine which HSV-2 epitope and parent antigen are being recognized. Obtaining these clones has been problematic and only two examples have been published in which HSV-2-specific CD8 T-cell clones have been obtained from blood samples and the HSV-2 antigens and epitopes that they recognize have been determined. The previously used method involves re-stimulating the very rare HSV-2-specific CD8 T-cells in the blood by using autologous HSV-2-infected LCL. This method is susceptible to bias in the population of the resulting cells, in that only memory CD8 T-cells that recognize HSV-2 antigens that are presented by the LCL may be re-stimulated. In addition, the previous method may lead to the repetitive isolation of genetically identical progeny of the same CD8 T-cell in the original blood sample, purely as a consequence of their replication in cell culture prior to the cloning step. The method of the invention overcomes both of these potential shortcomings.

[0048] The method of the disclosure takes advantage of the cell surface expression of a molecule associated with the homing of T-cells to the skin to rapidly and efficiently purify HSV-2-specific CD8 T-cells from the blood. With this method, it is possible to obtain large panels (up to 20 or more) of HSV-2-specific CD8 T-cells from a small blood specimen in about 2 weeks. This method has been used to isolate several series of HSV-2-specific CD8 T-cell clones. In several examples, blood samples have been obtained from persons who have very mild HSV-2 infection. These people have no symptoms or lesions. The study of the immune response in persons who have no symptoms or lesions can facilitate identification of the immune responses associated with this successful adaptation to the HSV-2 infection and provide rational benchmarks for vaccination or immune therapy.

[0049] T-cell homing to skin includes an adherence step and a cell migration step. In the adherence step, circulating T-cells exhibit rolling adhesion to the inner surface of vascular endothelial cells in the dermis. It is believed that a molecular determinant that is very tightly associated with an antigen termed CLA (cutaneous lymphocyte associated antigen) is the adhesion molecule on the T-lymphocyte. About 5% of circulating CD8 T-lymphocytes express CLA. CLA is defined by the binding of an anti-CLA monoclonal antibody. The molecular determinant that is very tightly associated with CLA is able to bind to E-selectin. E-selectin expression is up-regulated in the dermis on endothelial cells in the presence of inflammation. As demonstrated in the Examples hereinbelow, circulating HSV-2-specific CD8 T-cells preferentially express CLA. About 50-80% of circulating HSV-2-specific CD8 T-cells express CLA (Figure 2). In addition, circulating HSV-2-specific T-cells that recognize the same specific epitope in UL49 also highly (>85%) express the cell surface protein CD28.

[0050] This discovery was used to design a purification procedure to purify HSV-2-specific CD8 T-cells from the blood. Based on an hypothesis that HSV-2-specific CD8 T-cells of diverse fine specificity (recognizing many different antigens) would all express CLA and CD28, cells that express CD8, CD28, and CLA were purified from the blood (Figure 2 shows representative data from an example of cell sorting). The starting specimen contains PBMC, which are whole un-ma-nipulated mononuclear cells from the blood. Many HSV-2-specific T-cell clones were obtained. Expression cloning technology was then used to determine their fine specificity. Fine specificity includes the HSV-2 antigen and peptide epitope that each clone recognized, together with the specific HLA class I allelic variant that was required for the recognition. Figure 3 gives the overall schema for the method.

Purification of Virus-Specific T Lymphocytes [0051] The disclosure provides a method for the rapid and efficient enrichment of cells bearing the skin-homing-associated CLA molecule. This method is useful for identifying and obtaining viral antigens recognized by T-cells that are specific for viruses that attack the skin. Examples include any of the numerous varieties of human papillomavirus (HPV), which causes warts and cervical and penile and anal cancer, members of the pox virus family such as small pox, vaccinia and molluscum contagiosum, and varicella zoster virus (VZV) that causes chicken pox and herpes zoster, as well as herpes simplex virus (HSV). The following describes an embodiment of the method applied to the identification of HSV-2 antigens. Those skilled in the art will appreciate the ease with which the method can be applied to other pathogens that attack the skin.

[0052] Blood is obtained from a person with HSV-2 infection. Infection is typically diagnosed by the presence of antibodies to HSV-2 in the blood. A portion of the blood can be tested to determine which allelic forms of DMA are present at the HLA class I A and B loci. The blood is processed to yield peripheral blood mononuclear cells (PBMC) using conventional techniques. For example, PBMC can be isolated from whole blood samples using different density gradient centrifugation procedures (e.g., Ficoll-Hypaque gradient; Bennett &amp; Breit,1994, J. Leukoc. Biol. 56:236-240).

[0053] A portion of the PBMC are immortalized, typically by infecting them with live Epstein-Barr virus. The resultant cell line, termed LCL, are a convenient antigen presenting cell fortesting candidate HSV-2-specific CD8 CTL clones in a cytotoxicity (cell killing) assay. The LCL are maintained in continuous cell culture using standard methods. A general scheme outlining one embodiment of the method is provided in Figure 3.

[0054] Another portion of the PBMC can be labeled with one or more markers for sorting. One marker is used to detect CLA status, and additional markers can be used to select for other desired lymphocyte features. In a typical embodiment, the PBMC are stained with three monoclonal antibodies (mAb), each of which further comprises a distinct detectable marker. In one embodiment, each mAb is chemically bound to a different fluorescent molecule. The staining can either be done on a fresh preparation of PBMC or can be done on PBMC that have been stored in a cold environment and then resuscitated in a living form.

[0055] In one embodiment, the first mAb binds to the a subunit of CD8, the second mAb binds to CD28, and the third mAb binds to CLA. The cells can be processed with a cell sorter. Cells can be selected and retained on the basis of the following characteristics: 1) when analyzed for forward scatter and side scatter, fall in the distribution characteristic for lymphocytes, 2) express high levels of CD8a, 3) are positive for expression of CD28, and 4) express high levels of CLA.

These cells are sorted into a physiologically compatible cell culture fluid. Figure 2 shows an example of data from a cell sorting procedure.

[0056] In some embodiments, it may be desirable to determine whether or not HSV-2-specific CD8 T-cells have been isolated by this sorting procedure. In this variation of the method, the sorted cells are expanded as a bulk population of mixed cells. A mitogenic substance that causes the lymphocytes to divide, and proper growth media, growth factors, and feeder cells are provided. The resultant expanded cell population can then be tested in a cell killing assay.

[0057] Examples of data from a human subject is shown in Figure 4. In this example, cells with high and low levels of CLA were each expanded separately to study the association of CLA expression and HSV-2-specific killing activity. Only the CLA-high cells showed killing of HSV-2-specific autologous LCL. The CLA-low cells were othenwise sorted on the same criteria (CD8a-high and CD28-high) and cultured and tested in an identical fashion. The CLA-low cells had no killing activity. The fact that the CLA-high cells only killed autologous HSV-2-infected cells, but not non-self or allogeneic HSV-2 infected cells, indicates that typical CD8 HLA class I CTL were present [0058] To isolate HSV-2-specific T-cell clones in another variant of the method, the sorted CLA-high, CD28-high, CD8a-high cells are, immediately after sorting them from PBMC, diluted and plated atone cell per well or lower density into small culture wells. To each well, a combination of inactivated cells, mitogenic substances, and growth factors are added in a liquid medium that enchance the growth of the single live lymphocyte. These clonal cultures are expanded in cell number.

[0059] To test the candidate clones for specificity for HSV-2, standard methods are used. Autologous LCL are either infected overnight with HSV-2 or left uninfected. When the candidate clones are about 2 weeks old and have reached the growth stage of approximately 100,000 cells, a portion of each clone is tested for its ability to kill both the uninfected and HSV-2 infected cells. The desired clones are the clones that do not kill the uninfected autologous LCL but do kill the HSV-2 infected autologous LCL. A standard assay can be used, such as a chromium release cytotoxicity assay.

[0060] Examples of the purification of HSV-2-specific CD8 CTL from blood specimens from eight different HSV-2-infected adult humans are shown in Table 1. For each subject, the number of clones screened in CTL assays and the number positive are indicated. The criteria for being listed as positive are >25% specific release for HSV-2-infected autologous cells, and no appreciable killing of non-infected autologous cells. For most subjects and most clones, HSV-2-specific and HLA class l-restricted CTL activity has been confirmed in more than one assay. The far right column indicates the percentage of all clones that were screened that were HSV-2-specific by killing HSV-2-infected autologous cells.

Table 1: Isolation of HSV-2-specific CD8 CTL clones from blood specimens using the cell sorting method which includes CLA expression as a sorting criteria.

[0061] The clones that meet these criteria can be further expanded in cell number by using standard techniques. For determining theirfine specificity (the identity of the HSV-2 antigen and epitope they recognize), they are typically expanded to at least 200 million cells. These cells can be frozen in aliquots for later use.

Antigen and Epitope Determination [0062] The fine specificity of HSV-2-specific CD8 T-cell clones identified by the above method can be determined using expression cloning, e.g., as described in U.S. Patent No. 6,375,952, issued April 23,2002. The method can include identification of the allelic form of the HLA class I molecule that binds to the HSV-2 epitope. Typically, a fragment of the HSV-2 genome that contains the final epitope is initially identified. This initial fragment usually is predicted to encode a portion of one or more HSV-2 antigens. Table 2 lists exemplary results from the process of epitope discovery resulting from the CLA-based cell sorting method described herein and followed by expression cloning. Figure 3 shows an example of how the methods of CLA-based cell sorting can be combined with expression cloning to identify vaccines for prevention or therapy,

Table 2: DNA sequences of HSV-2 ORFs recognized by HSV-2-specificT-cell clones purified from blood on the basis of CLA expression.

HSV Polypeptides [0063] In one embodiment, the disclosure provides an isolated herpes simplex virus (HSV) polypeptide. The polypeptide comprises a UL7, UL25, UL26, UL46 (VP11/12), US6 (gD2) or US8 (gE2) protein or a fragment thereof. In one embodiment, the fragment comprises amino acids 174-186 or 50-192 of UL7; 405-413 or 322-417 of UL25; 475-483 or 404-627 of U126; 354-362 or 254-722 of UL46; 365-373 or 342-393 of US6; or 518-526 or 503-545 of US6. In the present invention as disclosed in the appended claims, the pharmaceutical composition comprises a fragment of UL25 comprising amino acids 405-413 of UL25. A fragment of the invention consists of less than the complete amino acid sequence of the corresponding protein, but includes the recited epitope. As is understood in the art and confirmed by assays conducted using fragments of widely varying lengths, additional sequence beyond the recited epitope can be included without hindering the immunological response. A fragment of the invention can be as few as 8 amino acids in length, or can encompass 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of the full length of the protein.

[0064] The reference to amino acid residues is made with respect to the proteins of the HSV-2 genome as described in A. Dolan et al., 1998, J. Virol. 72(3):2010-2021. The amino acid sequences of UL7, UL25, UL26, UL46 (VP11/12), UL54 (ICP27), or US6 (gD2) are as follows. UL7 (SEQ ID NO: 7) [0065] 1 madptpadeg taaailkqai agdrslveva egisnqallr macevrqvsd rqprftatsv 61 Irvdvtprgr Irfvldgasd dayvasedyf krcgdqptyr gfavwltan edhvhalavp 121 plvllhrlsl frptdlrdfe Ivcllmylen cprshatpsl fvkvsawlgv varhaspfer 181 vrclllrsch wilntlmcma gvkpfddelv Iphwyraahyl lannpppvls alfcatpqss 241 alqlpgpvpr tdcvaynpag vmgscwnskd Irsalvywwl sgspkrrtss Ifyrfc UL25 (SEQ ID NO: 8) [0066] 1 mdpyypfdal dvwehrrfiv adsrsfitpe fprdfwmlpv fnlpretaae raavlqaqrt 61 aaaaalenaa Iqaaelpvdl errirpieqq vhhiadalea letaaaaaee adaardaear 121 gegaadgaap sptagpaaae mevqivmdp plrydtnlpv dllhmvyagr gaagssgwf 181 gtwyrtiqer tiadfplttr sadfrdgrms ktfmtalvls Iqscgrlyvg qrhysafeca 241 vlclyllyrt theespdrdr apvafgdlla rlpryléurla avigdesgrp qyryrddklp 301 kaqfaaaggr yehgalathv viatlvrhgv Ipaapgdvpr dtstrvnpdd vahrddvnra 361 aaaflarghn Iflwedqtll ratantltal avlrrllang nvyadxldnr Iqlgmlipga 421 vpaeaiarga sgldsgalks gdnnlealcv ayvlplyqad ptveltqlfp glaalcldaq 481 agrplastrr wdmssgarq aalvrltale linrtrtntt pvgeiinahd algiqyeqgp 541 gllaqqarig lasntkrfat fnvgsdydll yflclgfipq ylsva UL26 (SEQ ID NO: 9) [0067] 1 masaemrerl eaplpdravp iyvagflaly dsgdpgelal dpdtvraalp penplpinvd 61 hrarcevgrv lawndprgp ffvgliacvq lervletaas aaiferrgpa Isreerllyl 121 itnylpsvBl stkrrgdevp pdrtlfahva Icaigrrlgt ivtydtslda aiapfrhldp 181 atregvrrea aeaelalagr twapgvealt htllstavnn mmlrdrwslv aerrrqagia 241 ghtylqasek fkiwgaesap apergyktga pgamdtapaa evpapqyavr arqvasssss 301 ssfpapadmn pvsaagapap pppgdgsylw ipashynqlv tgqsaprhpp Itacglpaag 361 tvayghpgag psphyppppa hpypgmlfag pspleaqiaa Ivgalaadrq agglpaaagd 421 hgirgsakrr rheveqpeyd cgrdepdrdf pyypgearpe prpvdsrraa rqasgpheti 481 talvgavtsl qqelahmrar thapygpypp vgpyhhphad tetpaqppry pakavylppp 541 hiappgppls gavpppsypp vavtpgpapp Ihqpspahéih ppppppgptp ppaaslpqpe 601 apgaeagalv nassaahvnv dtaraadlfv sqmmgsr UL46 (VP11/12) (SEQ ID NQ: 10) [0068] 1 mqrrargass Irlarcltpa nlirganagv perrifagcl Iptpegllsa avgvlrqrad 61 dlqpafltga drsvrlaarh hntvpesliv dglasdphyd yirhyasaak qalgevelsg 121 gqlsrailaq ywkylqtwp sgldipddpa gdcdpslhvl Irptllpkll vrapfksgaa 181 aakyaaavag Irdaahrlqq ymffmrpadp srpstdtalr Isellayvsv lyhwaswmlw 241 tadkyvcrrl gpadrrfval sgsleapaet farhldrgps gttgsmqcma Iraavsdvlg 301 hltrlahlwe tgkrsggtyg ivdaivstve vlsivhhhaq yiinatltgy wwasdslnn 361 eyltaavdsq erfcrtaapl fptmtapswa rmelsikswf gaalapdllr sgtpsphyes 421 ilrlaasgpp ggrgavggsc rdkiqrtrrd nappplprar phstpaaprr crrhredlpe 481 pphvdaadrg pepcagrpat yythmagapp rlpprnpapp eqrpaaaarp laaqreaagv 541 ydavrtwgpd aeaepdqmen tyllpdddaa mpagvglgat paadttaaaa v;paeshapra 601 psedadsiye svgedggrvy eeipwvrvye nicprrrlag gaalpgdapd spyieaenpl 661 ydwggsalfs prratrapdp glslspmpar prtnalandg ptnvaalsal Itklkrgrhq 721 sh US6 (gD2) (SEQ ID NO: 11) [0069] 1 mgrltsgvgt aallwavgl rwcakyala dpslkmadpn rfrgknlpvl dqltdppgvk 61 rvyhiqpsle dpfqppsipi tvyyavlera crsvllhaps eapglvrgas dearkhtynl 121 tiawyrmgdn caipitvmey tecpynkslg vcpirtqprw syydsfsavs ednlgflmha 181 pafetagtyl rlvkindwte itqfilehra rasckyalpl rippaaclts kayqqgvtvd 241 sigmlprfip enqrtvalys Ikiagwhgpk ppytstllpp elsdttnatq pelvpedped 301 salledpagt vssqippnwh ipslqdvaph hapaapsnpg liigalagst lavlviggia 361 fwvrrraqma pkrlrlphir dddappshqp l£y US8 (gE2) (SEQ ID NO: 12) [0070] 1 margaglvff vgvwwscla aaprCBwkrv tsgedwllp apaertrahk llwaaeplda 61 cgplrpswva Iwpprrvlet wdaacmrap eplaiayspp fpagdeglya elawrdrvav 121 vneslviyga letdsglytl swglsdear qvaswlwe papvptptpd dydeeddagv 181 tnarrsafpp qppprrppva ppthprvipe vshvrgvtvh metleailfa pgetfgtnvs 241 ihaiahddgp yamdwwmrf dvpsscadmr iyeaclyhpq Ipeclspada pcavsswayr 301 lavrsyagcs rttppprcfa earmepvpgl awlastvnle fqhaapqhag lylcwyvdd 361 hihawghmti staaqyrnav veqhlpqrqp epveptrphv raphpapsar gplrlgavlg 421 aalllaalgl sawacmtcwr rrswravksr asatgptyir vadselyadw ssdsegerdg 481 slwqdpperp dspstngsgf eilsptapsv yphsegrksr rplttfgsgs pgrrhsqasy 541 psvlw [0071] The polypeptide can be a fusion protein. In one embodiment, the fusion protein Is soluble. A soluble fusion protein of the Invention can be suitable for Injection Into a subject and for eliciting an Immune response. Within certain embodiments, a polypeptide can be a fusion protein that comprises multiple polypeptides as described herein, or that comprises at least one polypeptide as described herein and an unrelated sequence. A fusion partner may, for example, assist In providing T helper epitopes (an Immunological fusion partner), preferably T helper epitopes recognized by humans, or may assist In expressing the protein (an expression enhancer) at higher yields than the native recombinant protein. Certain preferred fusion partners are both Immunological and expression enhancing fusion partners. Other fusion partners may be selected so as to Increase the solubility of the protein or to enable the protein to be targeted to desired Intracellular compartments. Still further fusion partners Include affinity tags, which facilitate purification of the protein.

[0072] Fusion proteins may generally be prepared using standard techniques. Including chemical conjugation. Preferably, a fusion protein Is expressed as a recombinant protein, allowing the production of Increased levels, relative to a non-fused protein. In an expression system. Briefly, DNA sequences encoding the polypeptide components may be assembled separately, and ligated Into an appropriate expression vector. The 3’ end of the DNA sequence encoding one polypeptide component is ligated, with or without a peptide linker, to the 5’ end of a DNA sequence encoding the second polypeptide component so that the reading frames of the sequences are in phase. This permits translation into a single fusion protein that retains the biological activity of both component polypeptides.

[0073] A peptide linker sequence may be employed to separate the first and the second polypeptide components by a distance sufficient to ensure that each polypeptide folds into its secondary and tertiary structures. Such a peptide linker sequence is incorporated into the fusion protein using standard techniques weii known in the art. Suitabie peptide iinker sequences may be chosen based on the foiiowing factors: (1) their ability to adopt a flexible extended conformation; (2) their inability to adopt a secondary structure that could interact with functional epitopes on the first and second polypeptides; and (3) the lack of hydrophobic or charged residues that might react with the polypeptide functional epitopes. Preferred peptide linker sequences contain Gly, Asn and Ser residues. Other near neutral amino acids, such as Thr and Ala may also be used in the linker sequence. Amino acid sequences which may be usefully employed as linkers include those disclosed in Maratea et al., 1985, Gene 40:39-46; Murphy et al., 1986, Proc. Natl. Acad. Sci. USA 83:8258-8262; U.S. Patent No. 4,935,233 and U.S. Patent No. 4,751,180. The linker sequence may generally be from 1 to about 50 amino acids in length. Linker sequences are not required when the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.

[0074] The ligated DNA sequences are operably linked to suitable transcriptional or translational regulatory elements. The regulatory elements responsible for expression of DNA are located 5’ to the DNA sequence encoding the first polypeptides. Similarly, stop codons required to end translation and transcription termination signals are present 3’ to the DNA sequence encoding the second polypeptide.

[0075] Fusion proteins are also provided that comprise a polypeptide of the present invention together with an unrelated immunogenic protein. Preferably the immunogenic protein is capable of eliciting a recall response. Examples of such proteins include tetanus, tuberculosis and hepatitis proteins (see, for example, Stoute et al., 1997, New Engl. J. Med., 336:86-9).

[0076] Within preferred embodiments, an immunological fusion partner is derived from protein D, a surface protein of the gram-negative bacterium Haemophilus influenza B (WO 91/18926). Preferably, a protein D derivative comprises approximately the first third of the protein (e.g., the first N-terminal 100-110 amino acids), and a protein D derivative maybe lipidated. Within certain preferred embodiments, the first 109 residues of a Lipoprotein D fusion partner is included on the N-terminus to provide the polypeptide with additional exogenous T-cell epitopes and to increase the expression level in E. coli (thus functioning as an expression enhancer). The lipid tail ensures optimal presentation of the antigen to antigen presenting cells. Other fusion partners include the non-structural protein from influenza virus, NS1 (hemaglu-tinin). Typically, the N-terminal 81 amino acids are used, although different fragments that include T-helper epitopes may be used.

[0077] In another embodiment, the immunological fusion partner is the protein known as LYTA, or a portion thereof (preferably a C-termlnal portion). LYTA is derived from Streptococcus pneumoniae, which synthesizes an N-acetyl-L-alanine amidase known as amidase LYTA (encoded by the LytA gene; Gene 43:265-292, 1986). LYTA is an autolysin that specifically degrades certain bonds in the peptidoglycan backbone. The C-terminal domain of the LYTA protein is responsible for the affinity to the choline or to some choline analogues such as DEAE. This property has been exploited for the development of £. coli C-LYTA expressing plasmids useful for expression of fusion proteins. Purification of hybrid proteins containing the C-LYTA fragment at the amino terminus has been described (see Biotechnology 10:795-798, 1992). Within a preferred embodiment, a repeat portion of LYTA may be incorporated into a fusion protein. A repeat portion is found in the C-terminal region starting at residue 178. A particularly preferred repeat portion incorporates residues 188-305.

[0078] In some embodiments, it may be desirable to couple a therapeutic agent and a polypeptide of the invention, or to couple more than one polypeptide of the invention. For example, more than one agent or polypeptide may be coupled directly to a first polypeptide of the invention, or linkers that provide multiple sites for attachment can be used. Alternatively, a carrier can be used. Some molecules are particularly suitable for intercellular trafficking and protein delivery, including, but not limited to, VP22 (Elliott and O’Hare, 1997, Cell 88:223-233; see also Kim et al., 1997, J. Immunol. 159:1666-1668; Rojas etal., 1998, Nature Biotechnology 16:370; Katoetal., 1998, FEBS Lett. 427(2);203-208; Vives et al., 1997, J. Biol. Chem. 272(25):16010-7; Nagahara et al., 1998, Nature Med. 4(12):1449-1452).

[0079] A carrier may bear the agents or polypeptides in a variety of ways, including covalent bonding either directly or via a linker group. Suitable carriers include proteins such as albumins (e.g., U.S. Patent No. 4,507,234, to Kato et al.), peptides and polysaccharides such as aminodextran (e.g., U.S. Patent No. 4,699,784, to Shih et aL). A carrier may also bear an agent by noncovalent bonding or by encapsulation, such as within a liposome vesicle (e.g., U.S. Patent Nos. 4,429,008 and 4,873,088).

[0080] In general, polypeptides (including fusion proteins) and polynucleotides as described herein are isolated. An "isolated" polypeptide or polynucleotide is one that is removed from its original environment. For example, a naturally occurring protein is isolated if it is separated from some or all of the coexisting materials in the natural system. Preferably, such polypeptides are at least about 90% pure, more preferably at least about 95% pure and most preferably at least about 99% pure. A polynucleotide is considered to be isolated if, for example, it is cloned into a vector that is not part of the natural environment.

[0081] The polypeptide can be isolated from its naturally occurring form, produced by recombinant means or synthesized chemically. Recombinant polypeptides encoded by DNA sequences described herein can be readily prepared from the DNA sequences using anyof a variety of expression vectors known to those of ordinary skill in the art. Expression may be achieved in any appropriate host ceii that has been transformed or transfected with an expression vector containing a DNA moiecuie that encodes a recombinant poiypeptide. Suitabie host ceiis inciude prokaryotes, yeast and higher eukaryotic ceiis. Preferabiy the host ceiis empioyed are E. coli, yeast or a mammaiian ceii iine such as Cos or CHO. Supernatants from the soiubie host/vector systems that secrete recombinant protein or poiypeptide into cuiture media may be first concentrated using a commerciaiiy avaiiabie fiiter. Foiiowing concentration, the concentrate may be appiied to a suitabie purification matrix such as an affinity matrix or an ion exchange resin. Finaiiy, one or more reverse phase HPLC steps can be empioyed to further purify a recombinant poiypeptide.

[0082] Fragments and other variants having iess than about 100 amino acids, and generaiiy iess than about 50 amino acids, may aiso be generated by synthetic means, using techniques weii known to those of ordinary skiii in the art. For exampie, such poiypeptides may be synthesized using any of the commerciaiiy avaiiabie soiid-phase techniques, such as the Merrifieid soiid-phase synthesis method, wherein amino acids are sequentiaiiy added to a growing amino acid chain (Merrifieid, 1963, J. Am. Chem. Soc. 85:2146-2149). Equipment for automated synthesis of poiypeptides is commerciaiiy avaiiabie from suppiiers such as Perkin Eimer/Appiied BioSystems Division (Foster City, CA), and may be operated according to the manufacturer’s instructions.

[0083] Variants of the poiypeptide for use in accordance with the invention can have one or more amino acid substitutions, deietions, additions and/or insertions in the amino acid sequence indicated that resuit in a poiypeptide that retains the abiiity to eiicit an immune response to HSV or FiSV-infected ceiis. Such variants may generaiiy be identified by modifying one of the poiypeptide sequences described herein and evaiuating the reactivity of the modified poiypeptide using a known assay such as a T ceii assay described herein. Poiypeptide variants preferabiy exhibit at ieast about 70%, more preferabiy at ieast about 90%, and most preferabiy at ieast about 95% identity to the identified poiypeptides. These amino acid substitutions inciude, but are not necessariiy iimited to, amino acid substitutions known in the art as "conservative".

[0084] A "conservative" substitution is one in which an amino acid is substituted for another amino acid that hassimiiar properties, such that one skiiied in the art of peptide chemistry wouid expect the secondary structure and hydropathic nature of the poiypeptide to be substantiaiiy unchanged. Amino acid substitutions may generaiiy be made on the basis of simiiarity in poiarity, charge, soiubiiity, hydrophobicity, hydrophiiicity and/or the amphipathic nature of the residues. For exampie, negativeiy charged amino acids inciude aspartic acid and giutamic acid; positiveiy charged amino acids inciude iysine and arginine; and amino acids with uncharged poiar head groups having simiiar hydrophiiicity vaiues inciude ieucine, isoieucine and vaiine; giycine and aianine; asparagine and giutamine; and serine, threonine, phenyia-ianine and tyrosine. Other groups of amino acids that may represent conservative changes inciude; (1) aia, pro, giy, giu, asp, gin, asn, ser, thr; (2) cys, ser, tyr, thr; (3) vai, iie, ieu, met, aia, phe; (4) iys, arg, his; and (5) phe, tyr, trp, his. A variant may aiso, or aiternativeiy, contain nonconservative changes, in a preferred embodiment, variant poiypeptides differ from a native sequence by substitution, deietion or addition of five amino acids or fewer. Variants may aiso (or aiternativeiy) be modified by, for exampie, the deietion or addition of amino acids that have minimai influence on the immunogenicity, secondary structure and hydropathic nature of the poiypeptide.

[0085] One can readiiy confirm the suitabiiity of a particuiar variant by assaying the abiiity of the variant poiypeptide to eiicit an immune response. The abiiity of the variant to eiicit an immune response can be compared to the response eiicited by the parent poiypeptide assayed under identicai circumstances. One exampie of an immune response is a ceiiuiar immune response. The assaying can comprise performing an assay that measures T ceiistimuiation or activation. Exampies of T ceiis inciude CD4 and CD8 T ceiis.

[0086] One exampie of a T ceii stimuiation assay is a cytotoxicity assay, such as that described in Koeiie, DM et ai.. Human immunoi. 1997, 53;195-205. in one exampie, the cytotoxicity assay comprises contacting a ceii that presents the antigenic virai peptide in the context of the appropriate HLA moiecuie with a T ceii, and detecting the abiiity of the T ceii to kiii the antigen presenting ceii. Ceii kiiiing can be detected by measuring the reiease of radioactive ^'Crfrom the antigen presenting ceii. Reiease of ®''Cr into the medium from the antigen presenting ceii is indicative of ceii kiiiing. An exempiary criterion for increased kiiiing is a statisticaiiy significant increase in counts per minute (cpm) based on counting of 5iCr radiation in media coiiected from antigen presenting ceiis admixed with T ceiis as compared to controi media coiiected from antigen presenting ceiis admixed with media.

Poivnucieotides. Vectors. Host Ceiis and Recombinant Viruses [0087] The invention provides poiynucieotides that encode one or more poiypeptides of the invention. The compiete genome sequence of HSV-2, strain HG52, can be found on the NCBi web site (www.ncbi.nih.gov). Accession No. Z86099. The poiynucieotide can be inciuded in a vector. The vector can further comprise an expression controi sequence operabiy iinked to the poiynucieotide of the invention, in some embodiments, the vector inciudes one or more poiynucieotides encoding other moiecuies of interest, in one embodiment, the poiynucieotide of the invention and an additionai poiynucieotide can be iinked so as to encode a fusion protein.

[0088] Within certain embodiments, poiynucieotides may be formuiated so to permit entry into a ceii of a mammai. and expression therein. Such formuiations are particuiariy usefui for therapeutic purposes, as described beiow. Those of ordinary skiii in the art wiii appreciate that there are many ways to achieve expression of a poiynucieotide in a target ceii, and any suitabie method may be empioyed. For exampie, a poiynucieotide may be incorporated into a virai vector such as, but not iimited to, adenovirus, adeno-associated virus, retrovirus, or vaccinia or other poxvirus (e.g., avian pox virus). Techniques for incorporating DNA into such vectors are weii known to those of ordinary skiii in the art. A retrovirai vector may additionaiiy transfer or incorporate a gene for a seiectabie marker (to aid in the identification or seiection of transduced ceiis) and/or a targeting moiety, such as a gene that encodes a iigand for a receptor on a specific target ceii, to render the vector target specific. Targeting may aiso be accompiished using an antibody, by methods known to those of ordinary skiii in the art.

[0089] The disciosure aiso provides a host ceii transformed with a vector of the invention. The transformed host ceii can be used in a method of producing a poiypeptide of the invention. The method comprises cuituring the host ceii and recovering the poiypeptide so produced. The recovered poiypeptide can be purified from cuiture supernatant.

[0090] Vectors of the disciosure can be used to geneticaiiy modify a ceii, either in vivo, ex vivo or in vitro. Several ways of geneticaiiy modifying ceiis are known, inciuding transduction or infection with a virai vector either directly or via a retroviral producer cell, calcium phosphate precipitation, fusion of the recipient cells with bacterial protoplasts containing the DNA, treatment of the recipient cells with liposomes or microspheres containing the DNA, DEAE dextran, receptor-mediated endocytosis, electroporation, micro-injection, and many other techniques known to those of skill. See, e.g., Sambrooket al. Molecular Cloning - A Laboratory Manual (2nd ed.) 1-3,1989; and Current Protocols in Molecular Biology, F.M. Ausubel et al., eds., Greene Publishing Associates, Inc. and John Wiley &amp; Sons, Inc., (1994 Supplement).

[0091] Examples of viral vectors include, but are not limited to retroviral vectors based on, e.g., HIV, SIV, and murine retroviruses, gibbon ape leukemia virus and other viruses such as adeno-associated viruses (AAVs) and adenoviruses. (Miller etal. 1990, Mol. Cell Biol. 10:4239; J. Kolberg 1992, NIH Res. 4:43, and Cornetta et al. 1991, Hum. Gene Then 2:215). Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), ecotropic retroviruses, simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations. See, e.g. Buchscher et al. 1992, J. ViroL 66(5):2731-2739; Johann et aL 1992, J. ViroL 66(5):1635-1640; Sommerfelt et al. 1990, Virol. 176:58-59; Wilson et al. 1989, J. ViroL 63:2374-2378; Miller et al. 1991, J. Virol. 65:2220-2224, and Rosenberg and Fauci 1993 in Fundamental Immunology, Third Edition, W.E. Paul (ed.) Raven Press, Ltd., New York and the references therein; Miller et al. 1990, Mol. Cell. Biol. 10:4239; R. Kolberg 1992, J. NIH Res. 4:43; and Cornetta et al. 1991, Hum. Gene Ther. 2:215.

[0092] in vitro amplification techniques suitable for amplifying sequences to be subcloned into an expression vector are known. Examples of such in vitro amplification methods, including the polymerase chain reaction (PCR), ligase chain reaction (LCR), Qp-replicase amplification and other RNA polymerase mediated techniques (e.g., NASBA), are found in Sambrook et al. 1989, Molecular Cloning - A Laboratory Manual (2nd Ed) 1-3; and U.S. Patent No. 4,683,202; PCR Protocols A Guide to Methods and Applications (Innis et al. eds.) Academic Press Inc. San Diego, CA 1990. Improved methods of cloning in vitro amplified nucleic acids are described in U.S. Patent No. 5,426,039.

[0093] The invention additionally provides a recombinant microorganism genetically modified to express a polynucleotide of the invention. The recombinant microorganism can be useful as a vaccine, and can be prepared using techniques known in the art for the preparation of live attenuated vaccines. Examples of microorganisms for use as live vaccines include, but are not limited to, viruses and bacteria. In a preferred embodiment, the recombinant microorganism is a virus. Examples of suitable viruses include, but are not limited to, vaccinia virus, canary pox virus, retrovirus, lentivirus, HSV and adenovirus.

Compositions [0094] The invention provides compositions that are useful for treating and preventing HSV infection. The compositions can be used to inhibit vital replication and to kill vitally-infected cells. In one embodiment, the composition is a pharmaceutical composition. The composition can comprise a therapeutically or prophylactically effective amount of a polypeptide, polynucleotide, recombinant virus, ARC or immune cell of the invention. An effective amount is an amount sufficient to elicit or augment an immune response, e.g., by activating T cells. One measure of the activation of T cells is a cytotoxicity assay, as described in D.M. Koelle et al., 1997, Human Immunol. 53:195-205. In some embodiments, the composition is a vaccine.

[0095] The composition can optionally include a carrier, such as a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions of the present invention. Formulations suitable for parenteral administration, such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intradermal, intraperitoneal, and subcutaneous routes, and carriers include aqueous isotonic sterile injection solutions, which can contain antioxidants, buffers, bacte-riostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, preservatives, liposomes, microspheres and emulsions.

[0096] The composition of the invention can further comprise one or more adjuvants. Examples of adjuvants include, but are not limited to, helper peptide, alum, Freund’s, muramyl tripeptide phosphatidyl ethanolamine or an immunostim-ulating complex, including cytokines. In some embodiments, such as with the use of a polynucleotide vaccine, an adjuvant such as a helper peptide or cytokine can be provided via a polynucleotide encoding the adjuvant. Vaccine preparation is generally described in, for example, M.F. Powell and M.J. Newman, eds., "Vaccine Design (the subunit and adjuvant approach)," Plenum Press (NY, 1995). Pharmaceutical compositions and vaccines within the scope of the present invention may also contain other compounds, which may be biologically active or inactive. For example, one or more immunogenic portions of other viral antigens may be present, either incorporated into a fusion polypeptide or as a separate compound, within the composition or vaccine.

[0097] A pharmaceutical composition or vaccine may contain DNA encoding one or more of the polypeptides of the invention, such that the polypeptide is generated in situ. As noted above, the DNA may be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid expression systems, bacteria and viral expression systems. Numerous gene delivery techniques are well known in the art, such as those described by Rolland, 1998, Grit. Rev. Therap. Drug Carrier Systems 15:143-198, and references cited therein. Appropriate nucleic acid expression systems contain the necessary DNA sequences for expression in the patient(such as a suitable promoter and terminating signal). Bacterial delivery systems involve the administration of a bacterium (such as Baciiius-Caimette-Guerrin) that expresses an immunogenic portion of the polypeptide on its cell surface or secretes such an epitope. In a preferred embodiment, the DNA may be introduced using a viral expression system (e.g., vaccinia or other pox virus, retrovirus, or adenovirus), which may involve the use of a non-pathogenic (defective), replication competent virus. Suitable systems are disclosed, for example, in Fisher-Floch et aL, 1989, Proc. Natl. Acad. Sci. USA 86:317-321; Flexner etaL, 1989, Ann. My Acad. Sci. 569:86-103; Flexneretal., 1990, Vaccine 8:17-21 ;U.S. Patent Nos.4,603,112,4,769,330, and 5,017,487; WO 89/01973; U .S. Patent No. 4,777,127; GB 2,200,651; EP 0,345,242; WO 91102805; Berkner, 1988, Biotechniques 6:616-627; Rosenfeld et al., 1991, Science 252;431-434; Kolls et al., 1994, Proc. Natl. Acad. Sci. USA 91:215-219; Kass-Eisler et al., 1993, Proc. Natl. Acad. Sci. USA 90:11498-11502; Guzman et al., 1993, Circulation 88:2838-2848; and Guzman et al., 1993, Cir. Res. 73:1202-1207. Techniques for incorporating DNA into such expression systems are well known to those of ordinary skill In the art. The DNA may also be "naked," as described, for example, in Ulmer et al., 1993, Science 259:1745-1749 and reviewed by Cohen, 1993, Science 259:1691-1692. The uptake of naked DNA may be increased by coating the DNA onto biodegradable beads, which are efficiently transported into the cells.

[0098] While any suitable carrier known to those of ordinary skill in the art may be employed in the pharmaceutical compositions of this invention, the type of carrier will vary depending on the mode of administration. Compositions of the present invention may be formulated for any appropriate manner of administration, including for example, topical, oral, nasal, intravenous, intracranial, intraperitoneal, subcutaneous or intramuscular administration. For parenteral administration, such as subcutaneous injection, the carrier preferably comprises water, saline, alcohol, a fat, a wax or a buffer. For oral administration, any of the above carriers or a solid carrier, such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, and magnesium carbonate, may be employed. Biodegradable microspheres (e.g., polylactate polyglycolate) may also be employed as carriers for the pharmaceutical compositions of this invention. Suitable biodegradable microspheres are disclosed, for example, in U.S. Patent Nos. 4,897,268 and 5,075,109.

[0099] Such compositions may also comprise buffers (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide) and/or preservatives. Alternatively, compositions of the present invention may be formulated as a lyophilizate. Compounds may also be encapsulated within liposomes using well known technology.

[0100] Any of a variety of adjuvants may be employed in the vaccines of this invention. Most adjuvants contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, and a stimulator of immune responses, such as lipid A, Bortadeiia pertussis or Mycobacterium tubercuiosis derived proteins. Suitable adjuvants are commercially available as, for example, Freund’s Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Ml); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, NJ); aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; salts of calcium, iron or zinc; an insoluble suspension of acylated tyrosine acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes biodegradable microspheres; monophosphoryl lipid A and quil A. Cytokines, such as GM CSF or interleukin-2, -7, or -12, may also be used as adjuvants.

[0101] Within the vaccines provided herein, the adjuvant composition is preferably designed to induce an immune response predominantly of the ThI type. Fligh levels of Thi-type cytokines (e.g., IFN-γ, IL-2 and IL-12) tend to favor the induction of cell mediated immune responses to an administered antigen. In contrast, high levels of Th2-type cytokines (e.g., IL-4, IL-5, IL-6, IL-10 and TNF-β) tend to favor the induction of humorai immune responses. Foiiowing appiication of a vaccine as provided herein, a patient will support an immune response that inciudesThI- and Th2-type responses. Within a preferred embodiment, in which a response is predominantly Th1-type, the level of Th1-type cytokines will increase to a greater extent than the level of Th2-type cytokines. The levels of these cytokines may be readily assessed using standard assays. For a review of the families of cytokines, see Mosmann and Coffman, 1989, Ann. Rev. Immunol. 7:145-173.

[0102] Preferred adjuvants for use in eliciting a predominantly Thi-type response include, for example, a combination of monophosphoryl lipid A, preferably 3-de-O-acylated monophosphoryl lipid A (3D-MPL), together with an aluminum salt. MPL™ adjuvants are available from Corixa Corporation (see US Patent Nos. 4,436,727; 4,877,611; 4,866,034 and 4,912,094). CpG-containing oligonucleotides (in which the CpG dinucleotide is unmethylated) also induce a predominantly ThI response. Such oligonucleotides are well known and are described, for example, in WO 96/02555. Another preferred adjuvant is a saponin, preferably QS21, which may be used alone or in combination with other adjuvants. For example, an enhanced system involves the combination of a monophosphoryl lipid A and saponin derivative, such as the combination of QS21 and 3D-MPL as described in WO 94/00153, ora less reactogenic composition where the QS21 is quenched with cholesterol, as described in WO 96/33739. Other preferred formulations comprises an oil-in-water emulsion and tocopherol. A particularly potent adjuvant formulation involving QS21, 3D-MPL and tocopherol in an oil-in-water emulsion is described in WO 95/17210. Another adjuvant that may be used is AS-2 (Smith-Kline Beecham). Any vaccine provided herein may be prepared using well known methods that result in a combination of antigen, immune response enhancer and a suitable carrier or excipient.

[0103] The compositions described herein may be administered as part of a sustained release formulation (i.e., a formulation such as a capsule or sponge that effects a slow release of compound following administration). Such formulations may generally be prepared using well known technology and administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site. Sustained-release formulations may contain a polypeptide, polynucleotide or antibody dispersed in a carrier matrix and/or contained within a reservoir surrounded by a rate controlling membrane. Carriersfor use within such formulations are biocompatible, and may also be biodegradable; preferably the formulation provides a relatively constant level of active component release. The amount of active compound contained within a sustained release formulation depends upon the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented.

[0104] Any of a variety of delivery vehicles may be employed within pharmaceutical compositions and vaccines to facilitate production of an antigen-specific immune response that targets HSV-infected cells. Delivery vehicles include antigen presenting cells (APCs), such as dendritic cells, macrophages, B cells, monocytes and other cells that may be engineered to be efficient APCs. Such cells may, but need not, be genetically modified to increase the capacity for presenting the antigen, to improve activation and/or maintenance of the T cell response, to have antiviral effects perse and/or to be immunologically compatible with the receiver (i.e., matched HLA haplotype). APCs may generally be isolated from any of a variety of biological fluids and organs, including tumor and peritumoral tissues, and may be autologous, allogeneic, syngeneic or xenogeneic cells.

[0105] Certain preferred embodiments of the present invention use dendritic cells or progenitors thereof as antigen-presenting cells. Dendritic cells are highly potent APCs (Banchereau and Steinman, Nature 392:245-251, 1998) and have been shown to be effective as a physiological adjuvant for eliciting prophylactic or therapeutic immunity (see Timmerman and Levy, Ann. Rev. Med. 50:507-529, 1999). In general, dendritic cells may be identified based on their typical shape (stellate in situ, with marked cytoplasmic processes (dendrites) visible in vitro) and based on the lack of differentiation markers of B cells (CD19 and CD20), T cells (CD3), monocytes (CD14) and natural killer cells (CD56), as determined using standard assays. Dendritic cells may, of course, be engineered to express specific cell-surface receptors or ligands that are not commonly found on dendritic cells in vivo or ex vivo, and such modified dendritic cells are contemplated by the present invention. As an alternative to dendritic cells, secreted vesicles antigen-loaded dendritic cells (called exosomes) may be used within a vaccine (Zitvogel et al., 1998, Nature Med. 4:594-600).

[0106] Dendritic cells and progenitors may be obtained from peripheral blood, bone marrow, tumor-infiltrating cells, peritumoral tissues-infiltrating cells, lymph nodes, spleen, skin, umbilical cord blood or any other suitable tissue or fluid. For example, dendritic cells may be differentiated ex vivo by adding a combination of cytokines such as GM-CSF, IL-4, IL-13 and/orTNFa to cultures of monocytes harvested from peripheral blood. Alternatively, CD34 positive cells harvested from peripheral blood, umbilical cord blood or bone marrow may be differentiated into dendritic cells by adding to the culture medium combinations of GM-CSF, IL-3, TNFa, CD40 ligand, LPS, flt3 ligand and/or other compound(s) that induce maturation and proliferation of dendritic cells.

[0107] Dendritic cells are conveniently categorized as "immature" and "mature" cells, which allows a simple way to discriminate between two well-characterized phenotypes. However, this nomenclature should not be construed to exclude all possible intermediate stages of differentiation. Immature dendritic cells are characterized as ARC with a high capacity for antigen uptake and processing, which correlates with the high expression of Fey receptor, mannose receptor and DEC-205 marker. The mature phenotype is typically characterized by a lower expression of these markers, but a high expression of cell surface molecules responsible for T cell activation such as class I and class IIMHC, adhesion molecules (e.g., CD54 and CD11) and costimulatory molecules (e.g., CD40, CD80 and CD86).

[0108] APCs may generally be transfected with a polynucleotide encoding a polypeptide (or portion or other variant thereof) such that the polypeptide, or an immunogenic portion thereof, is expressed on the cell surface. Such transfection may take place ex vivo, and a composition or vaccine comprising such transfected cells may then be used for therapeutic purposes, as described herein. Alternatively, a gene delivery vehicle that targets a dendritic or other antigen presenting cell may be administered to a patient, resulting in transfection that occurs in vivo, in vivo and ex vivo transfection of dendritic cells, for example, may generally be performed using any methods known in the art, such as those described in WO 97/24447, or the gene gun approach described by Mahvi et al., 1997, Immunology and Cell Biology 75:456-460. Antigen loading of dendritic cells may be achieved by incubating dendritic cells or progenitor cells with the tumor polypeptide, DNA (naked or within a plasmid vector) or RNA; or with antigen-expressing recombinant bacterium or viruses (e.g., vaccinia, fowipox, adenovirus or lentivirus vectors). Prior to loading, the polypeptide may be covalently conjugated to an immunological partner that provides T cell help (e.g., a carrier molecule). Alternatively, a dendritic cell may be pulsed with a non-conjugated immunological partner, separately or in the presence of the polypeptide.

Administration of the Compositions [0109] Treatment includes prophylaxis and therapy. Prophylaxis or treatment can be accomplished by a single direct injection at a single time point or multiple time points. Administration can also be nearly simultaneous to multiple sites. Patients or subjects include mammals, such as human, bovine, equine, canine, feline, porcine, and ovine animals. Preferably, the patients or subjects are human.

[0110] Compositions are typically administered in vivo via parenteral (e.g. intravenous, subcutaneous, and intramuscular) or other traditional direct routes, such as buccal/sublingual, rectal, oral, nasal, topical, (such as transdermal and ophthalmic), vaginal, pulmonaty, intraarterial, intraperitoneal, intraocular, or intranasal routes or directly into a specific tissue.

[0111] The compositions are administered in any suitable manner, often with pharmaceutically acceptable carriers. Suitable methods of administering cells in the context of the present invention to a patient are available, and, although more than one route can be used to administer a particular cell composition, a particular route can often provide a more immediate and more effective reaction than another route.

[0112] The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time, or to inhibit infection or disease due to infection. Thus, the composition is administered to a patient in an amount sufficient to elicit an effective immune response to the specific antigens and/or to alleviate, reduce, cure or at least partially arrest symptoms and/or complications from the disease or infection. An amount adequate to accomplish this is defined as a "therapeutically effective dose." [0113] The dose will be determined by the activity of the composition produced and the condition of the patient, as well as the body weight or surface areas of the patient to be treated. The size of the dose also will be determined by the existence, nature, and extent of any adverse side effects that accompany the administration of a particular composition in a particular patient. In determining the effective amount of the composition to be administered in the treatment or prophylaxis of diseases such as HSV infection, the physician needs to evaluate the production of an immune response against the virus, progression of the disease, and any treatment-related toxicity.

[0114] For exam pie, a vaccine or other composition containing a subunit HSV protein can include 1-10,000 micrograms of HSV protein per dose. In a preferred embodiment, 10-1000 micrograms of HSV protein is included in each dose in a more preferred embodiment 10-100 micrograms of HSV protein dose. Preferably, a dosage is selected such that a single dose will suffice or, alternatively, several doses are administered over the course of several months. For compositions containing HSV polynucleotides or peptides, similar quantities are administered per dose.

[0115] In one embodiment, between 1 and 10 doses may be administered over a 52 week period. Preferably, 6 doses are administered, at intervals of 1 month, and booster vaccinations may be given periodically thereafter. Alternate protocols may be appropriate for individual patients. A suitable dose is an amount of a compound that, when administered as described above, is capable of promoting an antiviral immune response, and is at least 10-50% above the basal (i.e., untreated) level. Such vaccines should also be capable of causing an immune response that leads to an improved clinical outcome in vaccinated patients as compared to non-vaccinated patients. In general, for pharmaceutical compositions and vaccines comprising one or more polypeptides, the amount of each polypeptide present in a dose ranges from about 0.1 μg to about 5 mg per kg of host. Preferably, the amount ranges from about 10 to about 1000 μg per dose. Suitable volumes for administration will vary with the size, age and immune status of the patient, but will typically range from about 0.1 mL to about 5 mL, with volumes less than about 1 mL being most common.

[0116] Compositions comprising immune cells are preferably prepared from immune cells obtained from the subject to whom the composition will be administered. Alternatively, the immune cells can be prepared from an HLA-compatible donor. The immune cells are obtained from the subject or donor using conventional techniques known in the art, exposed to APCs modified to present an epitope of the invention, expanded ex vivo, and administered to the subject. Protocois for ex vivo therapy are described in Rosenberg et ai., 1990, New Engiand J. Med. 9:570-578. in addition, compositions can comprise APCs modified to present an epitope of the invention.

[0117] Immune cells may generally be obtained in sufficient quantities for adoptive immunotherapy by growth in vitro, as described herein. Culture conditions for expanding single antigen-specific effector cells to several billion in number with retention of antigen recognition in vivo are well known in the art Such in vitro culture conditions typically use intermittent stimulation with antigen, often in the presence of cytokines (such as IL-2) and non-dividing feeder cells. As noted above, immunoreactive polypeptides as provided herein may be used to enrich and rapidly expand antigen-specific T cell cultures in order to generate a sufficient number of cells for immunotherapy. In particular, antigen-presenting cells, such as dendritic, macrophage, monocyte, fibroblast and/or B cells, may be pulsed with immunoreactive polypeptides or transfected with one or more polynucleotides using standard techniques well known in the art. For example, antigen-presenting cells can be transfected with a polynucleotide having a promoter appropriate for increasing expression in a recombinant virus or other expression system. Cultured effector cells for use in therapy must be able to grow and distribute widely, and to survive long term in vivo. Studies have shown that cultured effector cells can be induced to grow in vivo and to survive long term in substantial numbers by repeated stimulation with antigen supplemented with IL-2 (see, for example, Cheever et al., 1997, Immunological Reviews 157:177).

[0118] Administration by many of the routes of administration described herein or otherwise known in the art may be accomplished simply by direct administration using a needle, catheter or related device, at a single time point or at multiple time points.

In Wvo Testing of Identified Antigens [0119] Conventional techniques can be used to confirm the/n v/Vo efficacy of the identified HSV antigens. For example, one technique makes use of a mouse challenge model. Those skilled in the art, however, will appreciate that these methods are routine, and that other models can be used.

[0120] Once a compound or composition to be tested has been prepared, the mouse or other subject is immunized with a series of injections. For example up to 10 injections can be administered over the course of several months, typically with one to 4 weeks elapsing between doses. Following the last injection of the series, the subject is challenged with a dose of virus established to be a uniformly lethal dose. A control group receives placebo, while the experimental group is actively vaccinated. Alternatively, a study can be designed using sublethal doses. Optionally, a dose-response study can be included. The end points to be measured in this study include death and severe neurological impairment, as evidenced, for example, by spinal cord gait. Survivors can also be sacrificed for quantitative vital cultures of key organs including spinal cord, brain, and the site of injection. The quantity of virus present in ground up tissue samples can be measured. Compositions can also be tested in previously infected animals for reduction in recurrence to confirm efficacy as a therapeutic vaccine.

[0121] Efficacy can be determined by calculating the IC^q, which indicates the micrograms of vaccine per kilogram body weight requited for protection of 50% of subjects from death. The IC50 will depend on the challenge dose employed. In addition, one can calculate the LD50, indicating how many infectious units are required to kill one half of the subjects receiving a particular dose of vaccine. Determination of the post mortem viral titer provides confirmation that viral replication was limited by the immune system.

[0122] A subsequent stage oftesting would be a vaginal inoculation challenge. For acute protection studies, mice can be used. Because they can be studied for both acute protection and prevention of recurrence, guinea pigs provide a more physiologically relevant subject for extrapolation to humans. In this type of challenge, a non-lethal dose is administered, the guinea pig subjects develop lesions that heal and recut. Measures can include both acute disease amelioration and recurrence of lesions. The intervention with vaccine or other composition can be provided before or after the inoculation, depending on whether one wishes to study prevention versus therapy.

Methods of Treatment and Prevention [0123] The invention provides a method for treatment and/or prevention of FISV infection in a subject. The method comprises administering to the subject a composition of the invention. The composition can be used as a therapeutic or prophylactic vaccine. In one embodiment, the HSV is HSV-2. Alternatively, the HSV is HSV-1. The invention additionally provides a method for inhibiting HSV replication, for killing HSV-infected cells, for increasing secretion of lymphokines having antiviral and/or immunomodulatory activity, and for enhancing production of herpes-specific antibodies. The method comprises contacting an HSV-infected cell with an immune cell directed against an antigen of the invention, for example, as described in the Examples presented herein. The contacting can be performed in vitro or in vivo. In a preferred embodiment, the immune cell is a T cell. T cells include CD4 and CD8 T cells. Compositions of the invention can also be used as a tolerizing agent against immunopathologic disease.

[0124] In addition, the disclosure provides a method of producing immune cells directed against HSV. The method comprises contacting an immune cell with an HSV polypeptide of the invention. The immune cell can be contacted with the polypeptide via an antigen-presenting cell, wherein the antigen-presenting cell is modified to present an antigen included in a polypeptide of the invention. Preferably, the antigen-presenting cell is a dendritic cell. The cell can be modified by, for example, peptide loading or genetic modification with a nucleic acid sequence encoding the polypeptide. In one embodiment, the immune cell is a T cell. T cells include CD4 and CD8 T cells. Also provided are immune cells produced by the method. The immune cells can be used to inhibit HSV replication, to kill HSV-infected cells, in vitro or in vivo, to increase secretion of lymphokines having antiviral and/or immunomodulatory activity, to enhance production of herpes-specific antibodies, or in the treatment or prevention of HSV infection in a subject.

Methods of Detecting HSV Infection [0125] The disclosure also provides methods and kits for detecting HSV infection in a subject. In one embodiment, the diagnostic assay can be used to identify the immunological responsiveness of a patient suspected of having a herpetic infection and to predict responsiveness of a subject to a particular course of therapy. The assay comprises exposing T cells of a subject to an antigen of the invention, in the context of an appropriate APC, and testing for immunoreactivity by, for example, measuring IFNy, proliferation or cytotoxicity. Suitable assays are described in more detail in the Examples.

[0126] In one embodiment, the disclosure provides a for detecting HSV infection in a subject, wherein the method comprises contacting a biological sample obtained from the subject with a polypeptide of the invention; and detecting the presence of a binding agent that binds to the polypeptide in the sample, thereby detecting HSV infection in the biological sample. Examples of biological samples include, but are not limited to, whole blood, sputum, serum, plasma, saliva, cerebrospinal fluid and urine. In one embodiment, the kit comprises a polypeptide of the invention in combination with a detectable marker. In another embodiment, the kit comprises a monoclonal antibody or a polyclonal antibody that binds with a polypeptide of the invention.

[0127] In another embodiment, the method for detecting HSV infection comprises obtaining a biological sample from a subject, and contacting the sample with at least two oligonucleotide primers in a polymerase chain reaction, wherein at least one of the oligonucleotide primers is specific for a polynucleotide of the invention. The method further comprises detecting a polynucleotide sequence that amplifies in the presence of the oligonucleotide primers in the sample. In one embodiment, the oligonucleotide primer comprises at least about 10 contiguous nucleotides of a nucleic acid sequence disclosed herein, or of a sequence that hybridizes thereto. Alternatively, the method can comprise contacting the sample with an oligonucleotide probe specific for a polynucleotide of the invention, and detecting in the sample a nucleic acid sequence that hybridizes to the oligonucleotide probe. In one embodiment, the oligonucleotide probe comprises at least about 15 contiguous nucleotides of a nucleic acid sequence disclosed herein, or a sequence that hybridizes thereto.

EXAMPLES

[0128] The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope of the invention. Details of the methods used herein are further described in Koelle etaL, 2002, J. Clin. Invest. 110(4):537-48; and Koelle et al., 2001, J. Immunol. 166:4049-4058.

Example 1: Expression of Cutaneous Lymphocyte-Associated Antiaen and Functional E-Selectin Ligand by CD8+ T-cells Specific for a Skin-Tropic Virus [0129] This example demonstrates the use of herpes simplex virus type 2 (HSV-2) as a model system to investigate CD8+ T-cell trafficking to the skin in humans. Using HLA class I tetramers, the example shows that HSV-specific CD8+ T-cells in the peripheral blood express high levels of cutaneous lymphocyte-associated antigen (CLA). In contrast, CD8+ T-cells specific for non skin-tropic herpesviruses lacked CLA expression. CLA-positive HSV-2-specific CD8+ T-cells had the characteristics of central memory cells, expressing CCR7, CD62L, and CD28, and proliferate briskly in response to antigen. CLA is related to a functional E-selectin ligand and both E-selectin and CLA-positive cells were detected in HSV-2 infected skin. HSV-2-specific T-cells were found to adhere to cells transfected with E-selectin. A higher proportion of HSV-specific CD8+ T-cells recovered from herpes lesions express CLA compared with blood, consistent with a role for CLA in skin homing. This is the first report of expression of tissue-specific adhesion-associated molecules by virus-specific CD8+ T-cells. The evaluation of vaccines for skin and mucosal pathogens should include study of the induction of appropriate tissue-specific homing molecules.

[0130] Fluorescent HLA tetramers were used to detect CD8+ cells specific for the HSV-2 virion proteins 22 (VP22) and 13/14 (VP13/14) and HSV-2-infected cell protein 0 (ICPO) As controls, T-cells specific for cytomegalovirus (CMV) tegument protein pp65, and the Epstein-Barr virus (EBV) protein BMLF-1, were aiso studied. The majority of memory HSV-2-specific T-ceiis in the biood expressed CLA, whiie CMV-and EBV-specific T-ceiis iacked CLA expression. Recurrent herpetic skin biopsies showed up-reguiated E-seiectin expression and contained a CLA-expressing dermai infiitrate iocaiiy enriched in HSV-specificCD8+ T-ceiis. These data suggest that homing receptor expression on memory T-ceiis may be programmed by the site of originai antigen encounter, promoting migration for immune surveiiiance or responses to reactivation of infection. Additionai studies indicated that circuiating CLA+ HSV-2-specific CD8+ T-ceiis have a preserved capacity for seif renewai and the characteristics of centrai memory T-ceiis.

Methods [0131] Subjects and specimens. Subjects were human ieukocyte antigen (HLA) typed. Subjects used for HSV-2 anai-yses were HSV-2 seropositive, HiV-1 seronegative, generaiiy heaithy, and not taking immune-suppressive medication. For subjects with a ciinicai history of genitai herpes, the first ciinicai episode had occurred at ieast six months prior to phiebotomy. No subject was experiencing a symptomatic recurrence of genitai herpes or receiving antivirai therapy at the time of phiebotomy. HSV-2-seropositive subjects fiiied out a questionnaire concerning their history of genitai herpes. Some subjects had daiiy HSV cuitures of muitipie genitai and peri-rectai sites on a daiiy basis for> 50 consecutive days to determine their rates of HSV shedding. PBMC were cryopreserved after Ficoii-Hypaque centrifugation. For CD62L, flow cytometry used freshly isolated PBMC. For two subjects, biopsies of peri-anal HSV-2 culture-positive lesions and forearm normal skin were performed. Portions were frozen in OCT (Sakura, Torrance, California). Subjects used for EBV and CMV analyses were healthy lab personnel known to be seropositive for these agents and to have appropriate HLA types. Protocols were IRB approved and conducted according to Declaration of Helsinki principles.

[0132] Cells and viruses. PBMC were re-stimulated with peptide, IL-2, and IL-7 in T-cell medium (TCM), or alternatively in TCM with 1.6 μg/ml phytohemagglutinin (PHA-P, Remel, Lenexa, KS) and 64 units/ml human natural IL-2 (Hemagen, Columbia, MD) beginning on day three. To test tetramer B7-RPR, peptide-stimulated cells (day 12) were stained with tetramer and FITC-conJugated anti-CD8a clone MHCD0801 (Caltag, Burlingame, California, sorted (FACSVantage, Becton Dickinson, San Jose, CA), rested overnight in TCM with 50 U/ml IL-2 (Chiron, Emeryville, California), cloned at 1 cell/well and expanded, and tested for cytotoxicity (see below). Skin-derived lymphocytes were expanded from biopsies in TCM with PHA-P and human natural IL-2 beginning on day three for 10-14 days. HSV-2 strain 333 and HSV-1 strain El 15 were grown and titrated in Vero cells.

[0133] HSV-2 CD8+ T-cell epitopes. HLA restriction was assigned by transfection/infection of Cos-7 cells with B*0702 cDNA/HSV-2, co-culture with 5491.2000.81, and measurement of IFN-γ secretion by ELISA. A library of Sau3a l-digested HSV-2 strain HG52 DNA was interrogated by co-transfection with HLA B*0702 cDNA using the Cos-7/IFN-y readout. The positive library "hit" encoded amino acids 306 to 825 of ICPO. Epitope localization was done by C-terminal truncation analysis with nested PCR-generated fragments originating at amino acid 306. Transfection/IFN-γ readout was used to narrow the epitope to amino acids 708-778. Algorithms predicted HLA B*0702 binding by amino acids 743-751.

[0134] Lymphocyte assays. Four-hour, triplicate cytotoxicity assays used 51 Cr release and an effectortarget ratio of 20:1 unless otherwise indicated. Target infection used a multiplicity of 10 for 18 hours; peptides were loaded for 90 minutes at 37 oC prior to washing. Spontaneous release was less than 25%. To measure adhesion, CHO or CHO-E cells were plated at 2 X 106/60 mm diameter dish. The next day, 1 X 106 peptide-stimulated (eight days) or 2 X 106 unstimulated PBMC were added. Dishes were rotated (50 RPM, one hour, 37 °C). Unbound cells and cells from a PBS wash were pooled to form the unbound fraction. Bound cells were collected with chilled PBS, 4 mM EDTA and vigorous pipetting. Microscopy confirmed removal of lymphocytes. Fractions were washed and processed for flow cytometry. Results are expressed as the proportion of CD8-high cells that bind tetramer in the bound fraction divided by the proportion of similar cells in the unbound fraction.

[0135] Tetramers. Phycoerythrin-labeled tetramers from the NIAID core facility at Emory University were HLA B*0702-RPR (HSV-2 protein VP22 amino acids 49-57) and HLA B*0702-APA (HSV-2 protein ICPO amino acids 743-751), and the previously described tetramer A*0201-GLA, which binds T-cells specific for HSV-2 protein VP13/14, amino acids 551-559. Tetramer A*0201-NLV, which binds T-cells specific for CMV pp65 595-603 (NLVPMVATV; SEQ ID NO: 13), was produced according to published methods. Briefly, HLA A*0201 heavy chain or β2-microglobulin were produced in E. coli. The heavy chain was truncated to contain the extracellular domain. A substrate sequence for BirA biotinylation was added at the COOH terminus. HLA complexes were folded using 30 mg of heavy chain, 25 mg of p2-microglobulin, and 10 mg of peptide. Biotinylatation used BirAat5mg/ml, 0.5 mM biotin, and5mM ATP for 16 hours at room temperature. Biotinylated complexes were purified by HPLC, and tetramers assembled by mixing biotinylated complexes with strepta-vidin-phycoerythrin at a 4:1 molar ratio. Tetramers A*0201-CLG, specific for EBV LMP2 426-434, and A2-VLE, specific for CMV IE-1 316-324 were produced similarly by Proimmune, Oxford, United Kingdom. Phycoerythrin-labeled tetramer A*0201-GLC, specific for EBV BMLF-1 280-288, has been described.

[0136] Flow cytometry. For detection of HSV- or EBV-specific T-cells, 1-5 X 10® cryopreserved, thawed PBMC, or ~ 2X10® cultured cells, were stained with 1 μg phycoerythrin-labeled tetramer in 50 μΙ TCM at 20°C for one hour: 20 μΙ anti-CD8a-Cychrome or 20 μΙ anti-CD8a-PerCP and 20 μΙ FITC-labeled anti-CLA mAb HECA-452or FITC-labeled anti-CD62L (Pharmingen, San Diego, California) were added for 30 minutes at 4°C, followed by washes and fixation. For CCR7, tetramer was followed by 2 μg anti-CCR7 clone 2H4 (Pharmingen), washes, and then FITC-labeled goat antimouse (Southern Biotechnologies, Birmingham, Alabama). For CMV-specific T-cells, 5x105 PBMC were incubated with 10μg/ml tetramer in 20μΙ PBS/20% FCS for 20 minutes at 37 OC. Cells were washed, incubated at 4 OC for 30 minutes with 20 μΙ anti-CD8-PerCP (Becton Dickinson) and anti-CLA-FITC, washed, and fixed. Cells were analyzed with a FACScan or FACScalibur (Becton Dickinson) and WinMDI 2.8 software (http://facs.scripps.edu). CD8+ T-cells were lymphocytes (forward/side scatter) intensely staining with anti-CD8a. Tetramer binding was expressed as the percentage of CD8a-high cells with bright (usually >102 fluorescence units) tetramer staining. CLA positivity was defined from the FL1 /cell number histogram for all lymphocytes at the junction between negative cells and a "tail" of FL1-brighter events, typically at 101.0 to 101.1 fluorescence units. Two-color analyses used FITC-conJugated anti-CD8a(Caltag, Burlingame, California) after the tetramer. Selected T-cell clones were stained with anti-TCR αβ-FITC (Becton Dickenson, San Jose, California) per the manufacturer’s directions. To document expression of E-selectin, CHO and CHO-E cells were stained with 10 μg/ml anti-CD62E (Becton Dickinson) or isotype control at 4°C for 30 minutes, washed, stained with 2 μΙ phy-coerythrin-labeled goat anti-mouse (Biomeda, Hayward, California) for 30 minutes at 4°C, washed, and fixed.

[0137] Immunohistochemistrv. Frozen, four μΜ sections were acetone-fixed, quenched (4:1 methanokhydrogen peroxide) and stained. Briefly, E-selectin was detected with anti-CD62E (see above) followed by isotype-specific peroxidase-conjugated secondary antibody and ABC peroxidase kit with 3,3’ diaminobenzidine substrate (Vector, Burlingame, CA). CLA was detected using biotin-conjugated mAb HECA-452 (PharMingen), anti-biotin mAb MB-9100 @ 1:200 (Vector) and detection as above. To control for nonspecific binding, staining was performed with isotype-matched primary antibodies specific for irrelevant antigens. Sections were counterstained with Mayer’s haematoxylin.

[0138] Statistics. Expression of surface antigens were compared between tetramer staining and non-staining CD8+ lymphocytes by Mann-Whitney test, two-tailed.

Results [0139] Detection of HSV-2-specific CD8+ T-cells in PBMC. Whether HSV-2-specific CD8+ T-cells In the blood would express a characteristic pattern of cell surface molecules involved in cell trafficking was examined by developing tools to identify HSV-specific T-cells. An HLA B’*0702 tetramer, B7-RPR, was folded with peptide VP22 49-57 from the HSV-2 UL49 open reading frame. This tetramer specifically stained the HLA B7-restricted T-cell clone 5491.2000.48 isolated from a cutaneous HSV-2 lesion (Fig 6). To confirm that this tetramer bound HSV-2-specific CTL, PBMC from a HSV-2 infected, B*0702 subject were stimulated with VP22 49-57, sorted on the basis of tetramer binding and CD8+ expression, and cloned by limiting dilution. Resultant clones had specific cytotoxicity (Fig. 6).

[0140] To obtain an additional marker of the HSV-2-specific CD8+ response, the fine specificity of CD8+ clone 5491.2000.81, also recovered from a HSV-2 skin lesion, was determined. The epitope was found to be amino acids 743-751 of the immediate early viral protein ICPO (Fig. 6). An HLA B*0702 tetramer, B7-APA, was constructed and specifically bound clone 5491.2000.81 (Fig. 6).

[0141] The frequency of CD8+T-cells for these HSV-2 epitopeswas then examined in PBMC from HSV-2 seropositive, HLA B*0702-expressing adults with symptomatic genital herpes for 0.5 to 29 years duration (Table 3). Six of 11 subjects had VP22 49-57-specific CD8+ cells in their PBMC. From 0.11% to 0.60% of CD8a-high lymphocytes stained with tetramer B7-RPR (Fig. 6). Control PBMC from control HSV-2 infected, HLA B*0702 (-) persons and HSV-uninfected, HLA B*0702 (+) persons had < 0.01% tetramer-positive CD8+ cells.

Table 3: Characteristics of the HSV-2-infected subjects.

(continued)

[0142] CLA expression bv circulating virus-specific memory CD8+ cells. CLA was expressed by 52.6% to 80.3% of circulating CD8a-high cells that stained with tetramer B7-RPR (mean ± SD, 66.0 ± 10.4) (Fig. 7). Only 2.0% to 14.8% oftetramer-negative CD8+ cells from these same subjects expressed CLA (mean ± SD, 6.0 ± 4.3). Fora HSV-2 epitope in protein VP13/14, 29.4% of CD8a-high cells staining with the previously described tetramer A2-GLA expressed CLA, in comparison to 1.5% of tetramer-negative CD8+ cells. In this small study, no association was observed between the proportion of VP22-specific CD8+ T-cells that expressed CLA (Fig. 7) and the severity of HSV-2 infection (Table 3).

[0143] CLA expression by H LA A*0201-restricted CD8+cells specific for either CMV or EBV was examined. For each virus, two independent epitopes were studied. Expression of CLA by EBV- and CMV-specific CD8+ cells was low, and generally similar to that oftetramer-negative CD8+ cells (examples in Fig. 7). A similar pattern was noted for each subject and each epitope (Table 4 summarizes the entire data set). For CMV, the mean ± SD for the expression of CLA by virus-specific and bystanderCD8+cells were 7.5% ± 5.1% and 7.7% ± 3.6%, respectively. For EBV, CLA was expressed by 5.2% ± 3.1% of EBV-specific cells and 5.4% ± 4.2% of other CD8+ cells, respectively.

Table 4: CLA expression bv EBV- and CMV-specific CD8^ T-cells in PBMC.

[0144] Proliferative capacity and phenotype of circulating HSV-2-specific CD8+ cells. The above data indicate that HSV-2-specific memory CD8+ T-cells express the skin-associated adhesion molecule, CLA, while still in the circulation. Circulating cells specific for VP22 49-57, VP13/14 551-559, or ICPO 743-751 were able to expand briskly in vitro in response to one re-stimulation with specific HSV-2 peptide (Fig.8). The proportions of VP22- and VP13/14-specific cells that expressed CLA were similar before and after their peptide-driven expansion (Figs. 7 and 8). The proportion of VP13/14-specific CD8+ T-cells expressing CLA was somewhat lower than the proportion of VP22-specific T-cells. This comparison could not be made for ICPO, as the cells were not abundant enough to identify in un-manipulated PBMC. The same peptide re-stimulation protocol did not induce CLA expression by EBV-specific cells. These results are consistent with a model in which lineages of CLA-expressing and CLA-negative HSV-2-specific cells can proliferate in vitro, although shifts in phenotype during the expansion of initially CLA-expressing and CLA-negative cells, or shorter-term fluctuations during progression through the cell cycle, cannot be ruled out.

[0145] It has been reported that circulating CD8+ cells can be divided into central memory cells expressing CD62L and CCR7 which can traffic to iynnph nodes, and effector memory ceiis, iacking CD62Land CCR7 but expressing cytoiytic moiecuies. Effector memory ceiis may have a reduced repiicative potentiai. Circuiating VP22-specific cells were >50% CD62L (+) for four of the five subjects studied (Table 5 and Fig. 9). CCR7 expression varied from 46% to 89%. VP22-specific cells were also >80% CD28 (+) from each donor, correlating with their ability to expand in vitro (Table 5). Each of these markers was more highly expressed by VP22-specific cells than by CD8a-high lymphocytes with other specificities (Table 5). Comparison between tetramer and non-tetramer staining CD8+ groups reached statistical significance (P=0.009) for CD28 expression, but not for CCR7 or CD62L for these small groups. These results are consistent with most HSV-2-specific CD8+ T-cells specific for VP13/14 49-57 having the central memory phenotype. The concept of central memory can be extended to include CD8+ T-cells that have acquired the ability to selectively home to sites of antigenic challenge.

Table 5: Phenotype of CD8a-hiqh cells in PBMC analyzed by binding of tetramer B7-RPR. which identifies cells specific for HSV-2 VP22 49-57.

[0146] CLA and CLA ligand expression by T-cells infiltrating genital HSV-2 lesions. To explore the possible role of CLA-associated E-selectin ligand in the migration of HSV-specific CD8+ T-cells to herpetic lesion, skin biopsy tissue was obtained from a HLA B*0702-expressing person. Because too few cells were available from skin biopsies for direct analysis, skin-infiltrating cells were expanded with PHA and IL-2, which provides a fairly uniform replication stimulus to most T and NK cells. HSV-2-specific T-cells were locally enriched among cells expanded from a HSV-2 culture-positive lesion obtained on the third day of symptoms compared to cells expanded from normal skin and cells in un-manipulated PBMC. 6.4% of CD8a-high cells from a HSV-2 biopsy were specific for VP22 amino acids 49-57 (Fig. 10), compared to 0.1% for normal skin and 0.21% from blood obtained the day of biopsy, representing a 60-fold local enrichment at the site of infection. 2.3% of lesion-infiltrating CD8a-high cells were specific for HSV-2 ICPO 743-751, while the level in normal skin was 0.06% and the level in blood was below the limit of detection. Circulating cells with this specificity were detectable after peptide re-stimulation (Fig. 8). Similar results for both T-cell specificities were obtained from a biopsy of a recurrent HSV-2 lesion obtained two months after the first; again, both local enrichment and almost universal (> 90%) CLA expression was noted. To rule out non-specific induction of CLA expression during replication of skin-derived T-cells in vitro, PBMC from four donors were expanded for 11 days with the culture conditions used for skin biopsies. CLA was expressed by 4.5 ± 2.3% of CD8a-high cells, similar to fresh PBMC.

[0147] CLA expression by HSV-2-specific T-cells derived from different sites was compared. HSV-2-specific cells in PBMC displayed a broad distribution of CLA expression including some CLA-negative cells (Fig. 7). HSV-specific cells from the herpetic lesion were uniformly CLA-positive (Fig.10). The tetramer-negative CD8+ lymphocytes from these cultures also displayed a higher level (~ 30%) of CLA expression than did similar cells from PBMC (Fig. 7).

[0148] Immunohistologic examination of a HSV-2 culture positive buttock lesion from subject 5491, obtained on day three of symptoms of recurrent genital herpes, showed that about 30% of small dermal mononuclear cells stained with anti-CLA antibody. E-selectin was strongly expressed in a dermal venular pattern (Fig. 10). In normal skin, E-selectin staining showed a less intense venular pattern, while CLA-positive cells were rarely observed. The presence of CLA and E-selectin in HSV-2-infected skin supports suggests that a CLA-associated E-selectin ligand, and E-selectin, may participate in leukocyte trafficking to recurrent HSV-2 lesions.

[0149] Binding of CLA-exoressing. HSV-SDecific cells to E-selectin. To determine if CLA expression by circulating HSV-2-specific CD8+ T-cells was associated with functional binding to E-selectin, PBMC from three HSV-2 infected, HLA B7 subjects were incubated with E-selectin-expressing CHO-E cells, which uniformly expressed E-selectin, or control CHO cells, which lacked expression. Measurement of the proportion of CD8a-high cells that were tetramer B7-RPR+ in the bound and unbound fractions indicated that T-cells specific for HSV-2 VP22 49-57 were enriched about 10-fold by CHO-E binding (Table 6). HSV-specific CD8+ T-cell lines generated in vitro by re-stimulation with the HSV-2 peptide (Fig. 9) were also tested. Again, HSV-2-specific cells detected with fluorescent HLA tetramers were selectively bound by CHO-E cells, but not control CHO cells.

Table 6: Binding of virus-specific CD8^ lymphocytes to E-selectin. Cells were analyzed by flow cytometry before or after one hour incubation with CHO ceiis expressing E-seiectin or controi CHO ceiis.

Discussion [0150] This is the first description oftheseiective expression of a putative tissue-specific homing moiecule by circuiating microbe-specific CD8+ T-ceiis. The ceii surface expression and functionai data in this exampie are consistent with a roie for a CLA-associated E-seiectin iigand in the trafficking of circuiating HSV-2-specific memory CD8+ T-ceiis to skin during recurrent genitai herpes. Because many patients with genitai herpes have iesions on keratinized epitheiiai surfaces of the externai genitaiia, perineum, back, or iegs, CLA expression by HSV-2-specific T-ceiis is anatomicaiiy appropriate.

[0151] In common with HSV-2, EBV and CMV undergo intermittent reactivations and are episodically shed in infectious form by most immunocompetent, infected individuals. In contrast to HSV-2, neither primary nor recurrent infection with EBV or CMV are associated with cutaneous infection. The most common site of EBV shedding is the oropharynx, while the most common sites of CMV shedding are uterine cervix, urine, and oropharynx. Reactivations of EBV and CMV in immunocompetent persons are usually asymptomatic. Reactivations of EBV and CMV are intermittent, brief, and anatomically unpredictable, complicating the assessment of the possible influence of reactivation status on homing receptor expression at the time of phlebotomy. Expression by CD8+ T-cells specificfor EBV and CMV was similarto the background level of 5-10% observed for circulating CD8+ lymphocytes.

[0152] HSV-specific CD8+ T-cells are functionally important in containing HSV-2 infection. Levels of CD8+ CTL correlate inversely with the severity of HSV-2 in HIV-HSV-2 co-infected men and correlate temporally with the local clearance of HSV-2 in lesions. CD8+ CTL are also important in the control of ganglionic infection, the maintenance of neuronal latency, and in protection against infectious challenge in murine models. HSV evades CD8+ T-cells by inhibiting TAP and degrading host mRNA. The tetramer-based measurements in this example reveal higher levels of circulating HSV-2-specific CD8+ T-cells than previously observed with limiting dilution CTL assays. In particular, high levels of VP22-specific CD8+ T-cells were detected. VP22 may be recognized efficiently due to its delivery into the class I antigen processing pathway prior to TAP inhibition, and without a requirement for endogenous synthesis, or due to its efficient intercellular spread, which can mediate CTL adjuvant activity.

[0153] In this example, HSV-2-specific T-cells were studied before and after trafficking from the circulation to HSV-2 infected skin. MelanA-specific CD8+ T-cells in PBMC from subjects with vitiligo express higher levels of CLA than do similar cells from normal subjects. In atopic subjects, proliferative responses to allergy-associated antigens are enriched among CLA+CD4+T-cells. Few reports have examined homing receptor expression by circulating virus-specific T-cells. Circulating memory rotavirus-specific CD4+ cells preferentially express the adhesion molecule A4B7 integrin. The data described herein indicate that memory CD8+ T-cells specific for the skin-tropic herpesvirus HSV-2 express CLA prior to leaving the circulation.

[0154] E-selectin expression is expressed at low basal levels in non-inflamed skin, and is increased in diverse skin inflammatory conditions. Apparent up-regulation of E-selectin in HSV-2-infected tissue was observed. This is not surprising, since IFN-γ, IL-1 β and TNF-a, which are up-regulated in HSV lesions, cooperate to increase E-selectin expression by endothelial cells. Additional work is required to document the magnitude and time course of up-regulation. Lymphocytes infiltrating the dermis commonly express CLA. The influx of HSV-2-specific CD4+ cells and of NK cells into recurrent HSV-2 lesions precedes the inflow of HSV-2-specific CD8+ T-cells. The proportion of HSV-2-specific CD8+ T-cells that express CLA appears to be higher in the skin than the biood (Fig. 10). The -50-80% of circuiating HSV-2-specific ceiis which express CLA (Fig. 7) may preferentiaiiy migrate to skin, or the iocai microenvironment may further promote CLA expression.

[0155] The finding that circuiating FiSV-2-specific memory ceiis express CLA impiies that expression of this antigen is up-reguiated during the priming of naive FiSV-2-specific CD8+ T-ceiis, or at a subsequent stage of conditioning. Expression of a(1,3)-fucosyitransferase Vii (FVii) is a probabie key reguiator of CLA expression, aithough controi over other giycosyitransferases and the primary poiypeptide backbone, PSGL-1 may aiso be important, in vivo, CLA is expressed by ceiis co-expressing CD45RA and CD45RO in skin-draining iymph nodes, consistent with up-reguiation during the priming of naive T-ceiis. in a murine modei, skin-homing-associated seiectin iigands are up-reguiated during cutaneous priming, it is rationai to hypothesize that inflammatory cytokines and iocai antigen presenting ceiis couid influence CLA expression during priming.

[0156] in this cross-sectionai study, the proportion of FiSV-2 VP22-specific CD8+ T-ceiis that expressed CLA was reiativeiy constant in the set of six subjects (Fig. 7). Two more FiLA B*0702-bearing persons who are HSV-2 seropositive but with no ciinicai history of genitai herpes have been studied. Staining of un-manipuiated PBMC with tetramer B7-RPR showed that 54.5% and 62.1% of tetramer-high, CD8a-high ceiis expressed CLA, simiiar to the six subjects shown in Fig. 7. No obvious segregation of CLA expression by HSV-2-speciflc CD8+ T-ceiis by the ciinicai or viroiogic (shedding) severity of HSV-2 infection was observed (Tabie 3, Fig. 7). Simiiariy, it is not yet known if CLA expression by HSV-2-specific ceiis in the periphery fluctuates temporaiiy in association with symptomatic or asymptomatic recurrences of HSV-2.

[0157] in summary, subjects with recurrent, symptomatic HSV-2 infection have readiiy detectabie circuiating VP22-specific CD8+ T-ceiis that express CLA. CLA is tightiy associated with functionai E-seiectin binding activity, which is an anatomicaiiy appropriate property for HSV-2-specific T-ceiis. HSV-specific CD8+ T-ceiis in PBMC expressed functionai E-seiectin binding activity. Neither CLA expression nor E-seiectin binding was noted for responses to CMV or EBV, two non skin-tropic herpesviruses. Accordingiy, the vaccines and immunotherapies for HSV disciosed herein wouid not oniy elicit specific T-cells, but also guide these T-cells to express appropriate homing molecules. More broadly, preventative and therapeutic T-cell based treatments can be optimized if the identity, mechanisms of action, and control mechanisms for homing molecules is understood and manipulated.

Example 2: Immunodominance amongst herpes simplex virus-specific CD8 T-cells expressing a tissue-specific homing receptor.

[0158] This Example shows a novel approach to create unbiased panels of CD8 cytotoxic T lymphocyte clones specific for herpes simplex virus type 2. Circulating herpes simplex virus type 2-specific cells were enriched and cloned after sorting for expression of the skin-homing receptor, cutaneous lymphocyte-associated antigen, bypassing re-stimulation with antigen. The specificity of every resultant cytotoxic clone was determined. Clonal frequencies were compared with each other and the total number of cytotoxic clones. For each subject, the specific CD8 cytotoxic T-lymphocyte response was dominated by T-cells specific for only a few peptides. Newly described antigens and epitopes in viral tegument, capsid, or scaffold proteins were immunodominant in some subjects. Clone enumeration analyses were confirmed in some subjects with bulk T-cell cultures using herpes simplex mutants and vaccinia recombinants. This example demonstrates that, during chronic infection with herpes simplex virus type 2, the CD8 T-cell response becomes quite focused, despite the presence of many potential antigenic peptides.

Methods [0159] Subjects and specimens. Subjects were human immunodeficiency virus type 1 (HIV-1) seronegative, HSV-2 seropositive, generally healthy, and not taking immune suppressive medication or anti-HSV therapy or experiencing symptomatic reactivations of HSV at the time of specimen collection. All subjects had documented HSV-2 infection for longer than one year. PBMC were isolated from peripheral blood by Ficoll centrifugation and cryopreserved. Some subjects completed daily sampling for the detection of HSV shedding as described. Cultures showing cytopathic effect were confirmed as HSV-2 by immunofluorescence. HLA typing used DNA or serologic methods.

Table 7: Subjects studied in Example 2.

(continued)

[0160] Cells, viruses, and antigens. Epstein Barr virus-transformed B cells (EBV-LCL) were cultured as described.

Veroand BSC40 cells were cultured in DMEM-awith 10% heat-inactivated PCS, L-glutamine, and penicillin-streptomycin. HSV-2-reactive, protein virion protein (VP)-16-specific CD4+ clone 1A.B.25.1 has been described. To enrich HSV-specific CTL, thawed PBMC were washed in TCM* (RPMI 1640 with 25 mM Hepes, 1% penicillin-streptomycin, 2 mM L-glutamine (Invitrogen, Carlsbad, CA), 10% heat-inactivated human serum (Serologicals Corporation, Norcross, GA), and 10 μg/ml ciprofloxacin. Cells (5 X 10®) were stained per the manufacturer’s directions with FITC-labeled anti-CLA and PE*-labeled anti-CD28 (pharmingen, San Diego, CA), and PE-Cy5*-labeled anti-CD8a (Caltag, Burlingame, CA). Cells were sorted (FacsVantage II, Becton Dickenson, San Jose, CA) gating on CD8^''9f' CD28+ lymphocytes with bright (> lOi ® fluorescence units) or negative (< 10^ 0 fluorescence units) staining for CLA. (NK) cells were excluded. For cloning, the cells were rested overnight in 200 μΙ TCM with 50 U/ml human IL-2 (Chiron), and cloned. Clones of interest were expanded using anti-CD3 mAb and IL-2. For bulk expansion, sorted CD8*’'9*’CD28‘^ CLA®"9htor CD8high CD28+ CLA^egative cells (~ 200-500 cells/well) were stimulated with PHA and IL-2 in 96-well U-bottom plates with same protocol used for cloning, combined into larger wells as needed, and tested after 14-20 days.

[0161] Recombinant vaccinia expressing immediate early protein ICP’* 27 of HSV-2 has been described. Vaccinia expressing full-length HSV-2 strain 333 open reading frame ULM? and UL49 were created by standard methods using vaccinia strain Western Reserve and targeting vector pSC11. Full-length HSV-2 genes were cloned for this purpose by PCR. Expression of HSV-2 proteins by recombinant vaccinia was confirmed in lymphocyte functional assays using protein-specific T-cell clones (see Kesults). Vaccinia stocks were made by infecting 75 cm^ monolayers of BSC-40 cells at MOI’* 1 for 2-3 days and sonicating scraped cells in 2.0 ml of their supernatant. Virus was titrated on BSC-40 cells. For lymphoproliferation assays, aliquots of vaccinia or HSV strains were UV irradiated (10 cm from GT-038 bulbs for 30 minutes) and used at 1:100 final concentration.

[0162] CTL assays used HSV-2 strain 333 and HSV-1 strain El 15. Viruses with disrupted or repaired UL47, the ORF encoding VP*13/14, were made by homologous recombination. A frag ment of HSV-2 DNA encoding amino acids 500-695 of VP13/14, the intergenic region, and the N-terminal portion of VP11/12 (gene UL46) was generated by PCR with primers GACGCTAGCCACGACCGTCTGGAGGTACT (SEQ ID NO: 14) and GACTCTAGAGCGACCGTTACCCT-GAAATA(SEQ ID NO: 15) {Nbe I andXba I sites underlined) and cloned after Nbe \IXba I digestion into similarly digested pcDNA3.1 (-) (Invitrogen). Afragment encoding the C-terminal portion of VP16 (gene UL48) was amplified with primers GACTCTAGAGACGAGGAAAGGGGTGGT (SEQ ID NO: 16) and GACAAGCTTCCGCTCCTCTGGGTACTTTA (SEQ ID NQ: 17) and cloned, afterXba \IHind III digestion, into the plasmid generated above digested withXbal//-//nd III. HSV-2 strain HG52 was used as template. A DNA fragment encoding enhanced green fluorescent protein and bacterial gaunosine phosphoribosyl transferasewith promoters was cloned into theXba I site of this second construct. The resultant targeting vector has the UL47 promoter and DNA encoding amino acids 1-499 ofVP13/14 deleted. DNA linearized with Nhe l/H/nd III, organic extracted, and alcohol precipitated was electroporated into Vero cells, followed by infection with HSV-2 HG52. Bulk product virus was plated on Vero cells. A green fluorescing plaque, de147, was triple-plaque purified. To rescue UL47, the HSV-2 HG52 BglW i fragment was linearized with BglW and electroporated into Vero cells, followed by infection with del 47. Bulk product virus was plated on HGPRT(-) STQ cells and revertants selected with 6-thioguanine. A resultant non-fluorescent plaque, 47rev, was triple plaque-purified. Southern blots used standard techniques, PCR- generated probes from UL46, UL47, and green fluorescent protein, and viral DNA prepared from infected Veto cells.

[0163] HSV-2 CDS T-cell epitope discovery. An expression cloning system based on genomic HSV-2 DNA libraries, as documented for epitopes in VP22, VP13/13, and ICPO, was used. In brief, the HLA restricting alleles of novel HSV-2-specific CD8 clones (above) were determined in CTL assays with panels of partially HLA class l-matched EBV-LCL as APC* .Confirmation of correct assignment of restricting alleles was obtained by transfection of Cos-7 cells with HLA class I cDNA and infection with HSV-2 as described. HLA B*5701, B*2705, and B*1402 cDNAs were obtained by RT-PCR using total RNA (Trizol, Invitrogen) from subjects’ EBV-LCL as starting material, using a specific primer for reverse transcription. The resultant cDNA, paired specific primers with distal restriction endonuclease sites, and a proof-reading thermostable DNA polymerase were used for PCR as described. PCR products were cloned into pcDNA3.0 (Invitrogen), fully sequenced, and compared to a database. HLA A*0101 cDNA in pcDNA3.1 was obtained from the 13‘^ IHWG Gene Bank.

[0164] To interrogate the HSV-2 genome for T-cell epitopes, Cos-7 cells were co-transfected with the relevant HLA class I heavy chain cDNA and a library of Sau3a l-digested HSV-2 strain HG52 DNA. This method uses ΙΡΝ-γ secretion to detect T-cell activation. Positive library pools were decoded in a reiterative process to yield single antigenic HSV-2 fragments. The positive library "hits" were sequenced (Big Dye 3.0, ABI, Foster City, CA) and compared (nBLAST) to HSV-2 HG52 to identify the antigenic region. In one case a fragment of HSV-2 gene UL7 encoding amino acids 50-192 was identified from the primary library. PCR-generated fragments encoding amino acids 50-150 and 150-192 were generated with appropriate primers, ligated to the pcDNA3.1-His vector predicted to yield an in-frame fusion protein product, and both fragments tested by co-transfection with HLA cDNA into Cos-7 as described. In a case in which a fragment of HSV-2 DNA predicted to contain portions of unique short open reading frame (US) 8 and US8.5 and all of US9 was identified from the primary library, full-length HSV-2 ORFs US8.5 and US9 PCR-cloned into pcDNA 3 and full-length HSV-2 US8 from strain HG52 cloned into pcDNA 3.1-His were tested separately by co-transfection with HLA cDNA as described. To help find candidate peptide epitopes, relevant regions of HSV-1 and HSV-2 predicted amino acid sequences were aligned. For each HSV-2-reactive T-cell clone, reactivity with HSV-1 in CTL assays was used to prioritize areas of HSV-2 peptide sequence for detailed workup. HLA binding motifs were then used to find peptides predicted to bind the relevant HLA class I molecule. Peptides were synthesized with free termini as described.

[0165] Lymphocyte functional assays. Cyotoxicity was tested in 4-hour ^'Cr release assays. Clones were screened in singlicate or duplicate using autologous EBV-LCL targets with or without infection with HSV-2. Bulk T-cell lines and established clones were tested in triplicate at effector to target ratios of 20:1 unless specified. Targets were infected with HSV-2 strains at MOI 10 or vaccinia at MOI 5 for 18-20 hours, or incubated with 1 μΜ peptide for 90 minutes at 37°C prior to washing. The congenic parent HSV-2 strain HG52 was used with UL47 mutants. Spontaneous release was usually less than 25%. Blocking mAb specific for HLA DR, HLA DP, or HLA DQ (clones L243, B7.21, or SPVL3, respectively) were used as 1 ;4 hybridoma supernatants; anti-HLA class I mAb (clone W6/32) was added at 10 μg/ml. ΙΡΝ-γ release was measured by ELISA after exposure of T-cell clones for 24 hours to APC; either to transfected Cos-7, as described, or to 2.5 X 10^ mock- or HSV-2 infected autologous B-cells in 96-well U-bottom plates in 200 μΙ RPMI 1640 with HEPES, pen-strep, L-glutamine, and 10% PCS. LCLwere pre-infected for 18 hours at MO110 and mAbW6/32 used during co-cultivation at 10 μg/mL Proliferation assays (triplicate) used ^H thymidine incorporation with 10^ cloned responder T-cells, 10^ autologous irradiated PBMC as APC per well, and UV-irradiated virus with addition of label 72 hours after setup and harvesting 18 hours later.

[0166] Flow cytometry. To validate the cloning of HLA B*2705 and B*1402 cDNA, expression was checked by transfection of Cos-7 cells and flow cytometry using allele-specific mAb (One Lambda) as described. T-cell clones were stained with PE or allophycocyanin-labeled tetrameric complexes of HLA B*0702 and VP22 49-57 (B7-RPR), HLAA*0201 and VP13/14 551-559 (A2-GLA), or HLA A*0201 and VP13/14 289-298 (A2-FLV), obtained from the Tetramer Facility of the National Institutes of Allergy and Infectious Diseases, followed by anti-CD8 FITC oranti-CD8-PE-Cy5 (Caltag) as described. T-cell clones were stained with directly labeled mAb specific for human CD4, CDBa, CD3, or a combination of CD16 and CD56, as previously described or with unlabeled murine mAb to human CD16 or CD56 (Pharmingen) followed by FITC-labeled goat anti-mouse IgG (Sigma) per the manufacturer’s directions.

Results [0167] Circulating HSV-2-SDecific CTL express CLA. Circulating CD8T-cells specific for HSV-2 epitopes in the viral tegument proteins VP13/14 and VP22 have been observed, and the non-structural protein ICPO, expresses CLA. VP13/14-specific T-cells were CD28+. To determine whether HSV-2-specific CTL were preferentially present in the CLA^ fraction of CD8+ PBMC, CD8+, CD28+ cells expressing either high or low levels of CLA were evaluated, sorted and polyclonally expanded, and subsequently tested for HSV-2-specific cytotoxicity. Virus-specific killing was only observed in the CLA^'S^ cells (Fig. 11). In contrast, CLA'°'" cells did not show detectable cytotoxicity at effector to target ratios of up to 40:1.

[0168] The expression of CLA by HSV-2-specific CD8 T-cells was also examined by direct cloning. CD8^, CD28+, CLA^'9^ cells were cloned with a non-specific mitogen shortiy after sorting from whoie PBMC. Among 10 consecutiveiy studied HSV-2 infected adults, HSV-2-specific CD8 CTL clones were derived from nine persons. Overall, 14.8% of clones derived from the CLA^'9^ fractions were HSV-2-specific, with a range from 0 to 31.5% within individual subjects and a mean of 10.5% (Table 8). The number of HSV-2-specific CTL clones recovered per subject ranged from 2 to 95. No HSV-2-specific clones were recovered from one person seronegative for HSV-1 and HSV-2.

Table 8: Clones derived from CD8+CD28+CLA^'g^ PBMC with HSV-2-SDecific CTL activity.

[0169] Data consistent with enrichment of HSV-2-specific CD8 T-cells in the CLA-positive fraction of PBMC were also obtained by directly staining of PBMC. PBMC from HLA B*0702-positive, HSV-2 infected persons were gated for CD8 and CLA expression and analyzed for binding of tetramer B7-RPR, which stains cells specific for an epitope in the HSV-2 tegument protein VP22. In one example (subject 5), 29.6% of circulating lymphocytes were CD8a^'9^, and 6.9% of these were CLA+. Among CD8a^'9^ CLA+ cells, 2.74% stained with tetramer B7-RPR (Fig. 12); CD8a^'9f' CLA-cells were only 0.02% tetramer-positive. Among six HLA B7 VHSV-2 infected persons, between 0.42% and 2.74% percent of CLA'i'gh CD8^'ig^' lymphocytes were positive for this single HSV-2 specificity. Much lower levels of tetramer staining were observed among CD8^''9^', CLA'™ lymphocytes (all < 0.05%). Taken together, the CTL activity in bulk and clonal CLA^''9h CD8 T cells, and the segregation of tetramer binding and CLA expression, were consistent with the observation that HSV-2-specific CD8 CTL of diverse specificity express CLA in persons with chronic HSV-2 infection.

[0170] Definition of HSV-2 CD8 T-cell antigens and epitopes. To determine patterns of dominance and complexity within the CD8 CTL response to HSV-2, the fine specificity of each available HSV-2-specific CD8 T-cell clone was determined. For subjects 1 and 2, from whom large numbers of CTL clones were detected (Table 8), an unselected subset of well-growing clones were selected for detailed work-up. For the other subjects, the fine specificities of all or most of the HSV-specific clones that successfully expanded in cell culture (90-100% of those detected in screening assays) were determined [0171] Clones restricted by HLA A*0201 orB*0702were initially checked for reactivity with epitopes in VP13/14, VP22, ICPO, or glycoprotein D2, and an A*0201-restricted epitope in glycoprotein gB2, amino acids 443-451, known to be restricted by these alleles. Several subjects yielded clones reactive with known epitopes in VP13/14, VP22, or ICPO (Table 9). However, known epitopes collectively accounted for only a small minority of the CTL clones.

Table 9: Fine specificity of HSV-2-specific CD8 CTL clones made from directly sorted CLA^'9^ PBMC.

(continued)

[0172] Epitope discovery for the remaining clones began with determination of their HLA restricting alleles. Clear evidence of HLA class I restriction was obtained, with a few exceptions (below). Only one or two restricting HLA class 1 alleles were detected per subject (Table 9), an early indicator that the dominant responses might be oligospecific. The HLA cDNAs for each restricting HLA alleles were made, and their cell-surface expression, as well as clonal T-cell restriction, were confirmed in a transfection/infection system. Expression cloning was then performed with a library of genomic HSV-2 DMA. This uses co-transfection of primate cells with the relevant HLA class I heavy chain cDNA and library DMA, and detection of T-cell activation by IFN-γ secretion. As HSV-2 DMA fragments encoding novel antigens were uncovered (Table 10), remaining HLA-appropriate clones were assayed for reactivity with the new, reactive HSV- 2 DMA fragments. As peptide epitopes became available (below), clones with suitable HLA restriction were re-tested with synthetic peptides to definitively assign fine specificity.

Table 10: HSV-2 DMA fragments stimulating lEN-y secretion by CD8 CTL clones with novel specificities derived by CLA-based sorting of PBMC.

(continued)

[0173] Six new epitopes were discovered in the course of studying 36 clones from five subjects. In four cases, the initial positive HSV-2 genomic DNA library fragments contained portions of a single known HSV-2 ORF (Table 10). This allowed definition of HSv-2 UL7, UL25, UL46, and US8 as T-cell antigens. For two clones, the initial positive genomic fragment contained portions of more than one known HSV-2 ORF. In the first example, CDS clone 8.2H1 (Table 10) reacted with an 1.35 kB genomic fragment containing part of genes US8, all of US9 and its promoter, and parts of US8.5 and US10 out of frame or backwards. US8, US8.5, and US9 were tested in isolation by co-transfection of single ORFs with HLA B*5701 cDNA. Only US8, which encodes membrane glycoprotein E, was active. In the second example, CD8 clone 5.1 E4 (Table 10) reacted with 316 base-pair fragment in-frame both the UL26 and internally overlapping UL26.5 ORFs.

[0174] The newly discovered antigens (Table 9) were each confirmed with synthetic peptides (Fig. 13). ForCDS clone 3.F8 (Table 10), truncation analysis at the genomic viral DNA level, followed by detection of T-cell activation in the Cos-7 co-transfection assay, reduced the antigenic region to amino acids 150-192. This was followed by evaluation of overlapping 13-mer peptides in CTL assays to find the epitope (amino acids 174-186, Fig. 13). For the other five clones (Table 10), sequencing data, HSV type-specific vs. type-common reactivity, and HLA peptide-binding motifs allowed more targeted syntheses of candidate nonamer peptide epitopes, which were successful in each case. Each blood-derived CD8 CTL clone recognized synthetic peptides at low concentrations, with 50% maximal responses detected near 1 nanomolar (Fig. 13).

[0175] Two of the newly described antigens were HSV-2 virion tegument proteins. Previously, strong recognition of tegument proteins was detected among CD8 CTL recovered from skin biopsies of healing HSV-2 genital lesions. Clone 6.E2 (Table 10) recognized VP11/12, the product of gene UL46. Clone 3.F8 (Table 10), and similar clones, recognized the predicted translation product of gene UL7. This protein is in the tegument, but is otherwise little-studied. Neither UL25 nor UL7 have previously been described as CD8 antigens. Two of the new HSV-2 CD8 antigens were capsid or capsid-associated proteins. The protein VP26, encoded by UL25, was recognized by CD8 CTL from two subjects. A protein in the capsid scaffold, encoded by UL26 or UL26.5, was also recognized by CD8 CTL. The scaffold is a precursor framework for virion capsid assembly that is degraded prior to formation of mature virions, although scaffold proteins persist in immature B capsids. This is the first description of CD8 T-cell reactivity with either a capsid or scaffold protein of HSV. The final two new CD8 epitopes were in HSV-2 envelope glycoproteins. Clone 2.2B9 (Table 10) reacted with an epitope in the C-terminal cytoplasmic domain of glycoprotein D. Clone 8.2H1 (Table 10) recognized a peptide in the C-terminal cytoplasmic domain of glycoprotein E. While CD8 responses to gD2 have been detected, this is the initial description of CD8 responses to gE of HSV. Peptide sequences can be derived from the predicted amino acid sequences of the relevant HSV-2 proteins as published in Genbank NC_001798.

[0176] Patterns of antigen and epitope immunodominance. Within individual subjects, clones reactive with one or two proteins tended to predominate (Table 9). Responses were detected to a maximum of three antigens per person. Several patterns were present. For subject 4, each clone reacted with single epitope in VP13/14; this expansion was earlier detected in this subject with direct tetramer staining of PBMC. For subject 1, all 34 clones reacted with either VP13/14 or a single immediate early protein, ICP27 (see below). The other two subjects (numbers 2 and 3) from whom large numbers of clones were obtained were both HLA B14 positive. Each predominantly recognized both tegument protein UL7 and capsid protein UL25 in the context of HLA B*1402. HLA B*1402-restricted responses seemed to dominate over responses restricted by any of the other available HLA class I alleles; in subject 3, a single, B*2705-restricted clone recognizing gD2 was detected as a minor response. Two-thirds of the clones from subject 5 recognized VP22 49-57; this expansion was also detectable with tetramer staining of PBMC (0.6% of CD8·’' cells). The total number of clones available from some subjects was low, precluding definitive conclusions about immunodominance, but it was again noted for subject 7 that all seven HSV-2-specific clones were HLA B*37-restricted, consistent with a relative oligoclonality among the numerically predominant responses.

[0177] Immunodominance can also be studied within populations. Some trends were observed from the data described herein. HLA A*0201 is the commonest HLA ciass i aiieie in most ethnic groups. Among six HLA A2-positive persons, reactivity was detected with VP13/14 in three. Ciones reactive with amino acids 551-559 were recovered from three persons, whiie ciones reactive with 289-298 were recovered from two. No subject yieided ciones reacted with gB2 443-451; responses to this peptide, if present, are predicted to be numericaiiy subdominant in most persons. Among three HLA B7-positive subjects, two had biood-derived ciones reactive with VP22 49-57 and one had an iCPO 743-751-reactive cione. Of note, some subjects with the appropriate HLA aiieies had nodetectabie responses to peptides restricted by these aiieies. For exampie, neither subjects 3 and 7, both HLA A2-positive, had A2-restricted responses among 23 independent ciones studied, and subject 9906 had no HLA B7-restricted ciones detected. Among other subjects, HLA A2 or HLA B7 compieteiy dominated the response.

[0178] The reiative immunogenicity of different structurai and kinetic ciasses of HSV-2 proteins can aiso be compared within the popuiation. Overaii, amongst 86 independent HSV-2-specific CD8 CTL ciones derived by sorting CLA-ex-pressing ceiisfrom the peripherai biood of seven subjects, 45 (52.3%) recognized tegument, 15(17%) recognized capsid, 3 (3%) recognized enveiope giycoprotein, and 2 (2%) recognized scaffoid proteins (Tabie 10). An additionai 11 (13%) recognized non-structurai immediate eariy proteins, either iCPO or iCP27 (beiow). The specificity of 10 ciones (12%) were not determined. Aii seven subjects who had anaiyses of fine specificity yieided tegument-specific ciones. Two subjects each had scaffoid, enveiope giycoprotein, or immediate-eariy protein-specific ciones, and one subject had capsid-specific responses. These data indicate that memory CD8 responses to HSV-2 tegument proteins are efficientiy maintained in chronicaiiy infected, immunocompetent persons.

[0179] immunodominance studies with buik CTL cuitures. it is possibie that iower-abundance CD8 CTL responses are not detected in the cionai frequency anaiyses presented above. Therefore, in seiected subjects, the specificity of CLA^ HSV-2-specific CTL was investigated using aiternate assay formats. As noted above (Fig. 11), HSV-specific cytotoxicity was preferentiaiiy present in cuitures derived from CD8^ CD28+ PBMC that aiso expressed CLA. One to two thousand sorted PBMC were expanded to a few miiiion ceiis over two weeks using PHA and iL-2; one additionai cycie of expansion of a portion of these ceiis with anti-CD3 yieided severai hundred miiiion ceiis in an additionai 10-14 days. These buik iymphocyte cuitures were tested with target ceiis expressing, orfaiiing to express, defined HSV-2 genes.

[0180] To isoiate responses to VP13/14, new reagents were created and first vaiidated. Wiid-type HSV-2, an HSV-2 mutant deieted for VP13/14 (de147), and a revertant virus with wiid-type UL47 re-inserted (47rev) were compared. VP13/14-specific ciones faiied to iyse del 47, but did recognize iysed 47rev (Fig. 14). The disruption strategy for UL47 risked disturbing expression of the proteins VP11/12 and VP16, which are encoded by the respective adjacent genes UL46 and UL48. Both of these proteins are known T-ceii antigens. VP11/12 and VP16-specific T-ceii ciones recognized the deietion and rescue viruses, confirming that disruption in de147 was isoiated to UL47. in addition, southern biots of restriction endonuciease-digested cytopiasmic DNA preparations from ceiis infected with HG52, 47dei, and rev47 gave the expected patterns with probes from the UL46and UL47 ORFsand eGFP. A recombinant vaccinia expressing VP13/14 (gene UL47) was aiso created and checked for protein expression with a T-ceii cione specific for VP13/14 551-559. Specific iysis was of autoiogous target ceiis was observed (Fig. 14), consistent with VP13/14 expression.

[0181] PBMC-derived buik effectors from subjects 1 and 4, both of whom yieided muitipie CD8 CTL ciones specific for VP13/14, were studied with these new reagents. For both subjects, deietion of UL47 (VP13/14) was associated with significantiy decreased iysis of HSV-2-infected ceiis (Fig. 11). Restoration of UL47 iead to a return of iysis to ieveis simiiar to that seen with parentai, wiid-type virus. Consistent with these findings, buik, non-cioned effectors seiected on the basis of homing receptor expression showed considerabie iysis of target ceiis infected with vaccinia-VP13/14. Autoiogous ceiis puised with a singie peptide, VP13/14 551-559, were highiy recognized by buik poiycionai CTL from subject 4, in agreement with the cionai anaiysis from this subject showing that each avaiiabie cione recognized this peptide (Tabie 9). Subject 1 aiso showed significant iysis of ceiis infected with vaccinia-iCP27, again consistent with their cionai anaiysis.

[0182] Type specificity of HSV-reactive CD8 CTL. Each HSV-2-reactive CD8 CTL cione was anaiyzed for recognition of HSV-1. Severai of the subjects were seropositive for both HSV-1 and HSV-2 (Tabie 7). Among the six new CD8 T-ceii epitopes (Tabie 10), oniy one, HSV-2 UL46 354-362, has the identicai sequence in the anaiogous HSV-1 protein. The two ciones from subject 6 recognizing this epitope kiiied both HSV-1 and HSV-2 infected ceiis. This subject was seropositive for both HSV-1 and HSV-2 (Tabie 7). Every cione tested among those recognizing the other five novei epitopes (Tabie 10), the previousiy described epitopes, and the iCP27-specific ciones from subject 1 were aii HSV-2 type-specific. Among the seven HLA B*37-restricted HSV-2-specific CD8 CTL ciones from subject 7, one had type-common cytotoxicity towards HSV-1. Amongst the nine preciseiy known HSV-2 CD8 epitopes and 86 HSV-2-reactive CD8 CTL ciones studied in this exampie, oniy one epitope and three ciones are type-common for both HSV-1 and HSV-2.

[0183] HLA DR-restriction by HSV-2-specific CD4+ CD8·^ CTL. A singie cione was detected from subject 2 (Tabie 9) that dispiayed iysis of aiiogeneic EBV-LCL that were mismatched at HLA A and B aiieies. Lysis by this atypicai cione, which recognized both HSV-1 and HSV-2, was strongiy inhibited by anti-HLA DR mAb but not anti-ciass i mAb (Fig. 15A-15C). The subject is homozygous for DRB1*01, and aiiogeneic ceiis mismatched at HLA ciass i but matched at DR were iysed after HSV-2 infection, in contrast to typicai CD8 ciones, secretion of iFN-γ in response to autoiogous infected EBV-LCL was weak, but was strongly enhanced, rather than inhibited, by anti-HLA class I. This clone displayed heterogeneous CD8a expression, but was uniformly CD4·^, CD3·^, and TCR αβ·^ and negative for CD16 and CD56 analyzed together (Fig. 15) or separately.

Disussion [0184] Newer technologies have revealed expansions of CD8 T-cells reactive with defined viral epitopes in individuals with chronic viral infections. However, it has been challenging to measure the relative contributions of peptide-specific T-cells in the context of the global anti-viral response. In the case of HSV-2, detailed knowledge of hierarchies of immunodominance is also of practical interest with regards to vaccine design. In this example, a novel one-step purification method was used, based on the expression of the skin homing receptor, CLA, to enrich HSV-2-specific CD8 T-cells from the peripheral blood of humans. HSV-2 is a member of the subfamily Alphaberpesvirinae, a group of pathogens with tropism for the skin. Employing this strategy, a striking concentration of the virus-specific CD8 CTL response to just a few dominant antigens and epitopes per subject was discovered.

[0185] TheHSV-2-specificCD8CTL, recognized antigens were recovered in diverse viral structural and kinetic classes. Clonal responses to tegument proteins VP13/14 and VP22 and immediate early protein ICPO, previously described for CD8 clones recovered from HSV-2-infected tissue, were confirmed in blood. Reactivity to two additional tegument proteins was found: the UL7 gene product and VP11/12. Clonal recognition of the immediate early protein ICP27 confirms work with CTL bulk effectors. In addition, responses to structural envelope, capsid, and scaffold proteins were observed. CD8 recognition of the envelope glycoprotein gD2 has previously been described, but this is the first description of CD8 responses to envelope glycoprotein gE2, a component of the HSV-encoded Fc receptor involved in immune evasion. This is also the initial description of CD8 T-cell reactivity with HSV capsid or scaffold proteins. The UL25 gene product, VP26, is a structural capsid protein present at low levels (about 40 copies) in mature virions. The protein products of the UL26 and co-linear UL26.5 genes are a complexfamily of polypeptides. They form a part of the capsid scaffold, and are thought to be excluded from mature virions. Taken together, these findings indicate that analyses of HSV CD8 T-cell antigens should include the entire viral proteome.

[0186] By producing panels of independently-derived HSV-2-specific CD8 CTL clones from several subjects, and determining their fine specificity, it was possible to determine the frequency distribution of the numerically predominant CTL precursors recognizing specific viral epitopes. In most subjects, only a few HSV peptides accounted for the majority of the circulating CTL precursors. This finding suggests that, in the chronic phase of infection, the numerically immunodominant memory CTL response to this genomically complex organism is quite focused on a small number of antigens and epitopes. For one subject, 10063, the immunodominant response was spread over four epitopes, but these occurred within two proteins (tegument VP13/14 and immediate early ICP27). Strikingly, two persons with the B*1402 allele, subjects 2 and 3, both displayed immunodominant B*1402-restricted responses to the same two epitopes in the protein products of the UL25 and UL7 genes. In this regard, HSV-2 may be similar to HIV-1, in which specific epitopes tend to be immunodominant in HLA B*1402-positive persons.

[0187] Circulating CD8 T-cells specific for HSV-2 epitopes in the viral tegument proteins VP13/14 and VP22, and an epitope in the viral immediate early protein ICPO, were earlier shown to preferentially express CLA. In contrast, CD8 T-cells specific for CMV or EBV, which do not infect skin, did not express CLA. This finding is now extended to HSV-2-specific CD8 T-cells of diverse fine specificity. Aggregate peptide, HLA restriction, and vaccinia data (Table 9) indicate that at least ten additional HLA class l-restricted HSV-2 CD8 epitopes are recognized by circulating CLA+ cells. CLA expression also co-segregated with HSV-2-specific cytotoxicity in assays with bulk effector cells (Fig. 11). While low levels of HSV-2-specific CTL may be still be present among CD8 cells that are not CLA·^, the data concerning antigenic specificity are believed to apply to the principle population of circulating HSV-2-specific CD8 T-cells.

[0188] CD28 expression was also used as a criteria for cell sorting. The expression of CD28 by virus-specific CD8 T-cells appears to vary between viruses and between epitopes and individuals. The successful recovery of HSV-2-specific CTL from almost every HSV-2-infected person studied is consistent with CD28 expression by circulating virus-reactive CD8 cells recognizing a variety of epitopes. Further research is required to determine if, within the CLA+ compartment, significant levels of CTL are present in within CD28- cells.

[0189] The factors influencing immunodominance in the human CD8 response to HSV-2 are largely unknown. In C57BL/6 mice, cells reactive with a single HSV epitope in glycoprotein B are numerically dominant, despite the presence of many peptides with appropriate MHC binding motifs, during primary and secondary responses. Immunization with this epitope protects against viral challenge. Endogenous synthesis of gB, rather than cross-presentation, is required for memory CD8 T-cell recognition. The HSV protein ICP47 is a powerful inhibitor of TAP in humans, but not mice. It has been hypothesized the CD8 response in humans is weighted towards recognition of proteins that are delivered into the cytoplasm upon virion entry, or are synthesized within infected cells very quickly after viral infection. In this scenario, T-cells recognize antigens that are processed and presented prior to TAP inhibition. Data with mutant viruses with incomplete replication cycles, metabolic inhibitors, and previously described CTL clones are consistent with this hypoth- esis. The expanding spectrum of HSV CD8 antigens reported herein need to be evaiuated for recognition of pre-formed versus endogenousiy synthesized protein. As treatment of APC with iFN-γ can overruie the immune evasion effects of iCP47 and vhs, and high ieveis of iPN-γ are present in HSV iesions, the concept that these genes moduiate the CD8 repertoire to HSV in humans may need to be re-evaiuated.

[0190] This exampie demonstrates that, in humans, whiie HLA genotype has an infiuence, it is not the most important factor in determining immunodominance. For exampie, within the group of HLA A*02-bearing persons, A*0201-restricted ciones were commoniy detected in some subjects, such as 1 and 4, but were not detected in subjects 3 or 5. Simiiariy, B*0702 was internaiiy dominant in subjects, but no B*07-restricted ciones were detected in the paneiof CTLfrom subject 7.

[0191] Using iFN-γ ELiSPOT, responses were detected to known A*0201- or B*0702-restricted epitopes in VP13/14 and VP22 in subjects who did not have ciones with these specificities recovered by CLA enrichment. The aigorithm starts with cytotoxicity as the indexcriteriaforseiection, which differs from ELiSPOT. Of note, every cione initiaiiy detected by CTL activity was a brisk secretor of iFN-y, a readout used during the expression cioning process.

[0192] in animai modeis, severai factors other than MHO hapiotype can infiuence immunodominance. These inciude the frequency of naive precursors, and competition for antigen processing or presentation between antigens, MHO aiieies, or T-ceiis. Prior antigenic experience can aiso profoundiy effect immunodominance. it has aiso been observed in human EBV infection that HLA hapiotypes at the non-restricting aiieie can infiuence the makeup of the CD8 response. EBV-specific responses that are typicaiiy immunodominant in persons with specific HLA aiieies are modified if these cionai responders are aiso fortuitousiy cross-reactive with seif HLA-restricted autodeterminants. Cionai cross-reactivity does occur between seif HLA pius HSV-2 peptide, and aiiogeneic HLA moiecuies pius presumed housekeeping peptides. The exampies and data mentioned above support the hypothesis that seif antigenic structures may aiso modify the CD8 response to HSV-2.

[0193] An atypicai, CD4+CD8^^™tii® T-ceii cione that was HSV-2-specific and restricted by HLA DR was detected in this study. This cione may represent an in vivo ceii popuiation, rather than a consequence of non-physiologic in vitro T-ceii expansion conditions, because the initiai ceii sorting criteria inciuded high CD8a selection. This is unlikely to have enriched for routine CD4+ CD8a- ceiis. Future sorting experiments will address the prevalence of this cell type in the population.

[0194] Comparison of these findings with HSV-2 to other studies of human pathogens is challenging. The algorithm of enrichment based on homing receptor expression, cloning, and exhaustive epitope determination has not previously been applied. While large expansions can be found with tetramers, the denominator, representing the entire virus-reactive population, is usually measured with an alternative method. Overlapping peptides covering the entire predicted protein sequence of viruses have been used to as an alternative method to interrogate circulating lymphocytes. Walker et al. used overlapping peptides and a set of known HLA-restricted peptides encoded by HCV, and IFN-y ELISPOT, to study CD8 responses in HCV infection. The overall correlation between HLA type and the detection of specific HLA-restricted responses was low. Similar to these findings, responses to single HCV epitopes were found to comprise 40-80% of the overall, integrated response against the peptide set covering the entire virus (Lauer et al., 2002, J. Virol. 76:6104-13). Different technologies were used, and the overall magnitude of the response to HCV is low. CD8 responses to peptides covering the entire HIV-1 genome were also studied with IFN-y ELISPOT. A median of 14 epitopes were recognized per subject, but data on within-subject immunodominance were not provided. A similar analysis using IFN-y intracellular cytokine cytometry and HIV-1 peptide pools showed that responses to individual proteins could be internally immunodominant in some subjects, but data were not provided to address dominance at the peptide level.

[0195] In this example, responses were analyzed to the level of viral peptide specificity. Microheterogeneity can be found in the predicted CDR3-encoded regions of TCR a and β V region cDNAs. Shifts in dominant TCR clonotypes have been documented within peptide-specific responses during the evolution of the CD8 response to EBV. Other analyses have found that dominance at the level of TCR sequences is relatively stable over time. Panels of independent human HSV-2-specific CD8 clones were derived from skin lesions after preliminary in vitro expansion that recognized the same viral peptide. Limited heterogeneity in TCV β cDNA sequences was observed, with no changes for some reactivities over intervals up to seven years.

[0196] The identification of immunodominant HSV-2 CD8 CTL antigens has practical applications. HSV-2 can cause serious infections of neonates and of immunocompromised hosts, may double the risk of HIV-1 acquisition, and causes painful skin lesions. A vaccine eliciting antibody and CD4 responses had only partial protective efficacy that was limited to HSV-1 and HSV-2 dually-seronegative women. Replication-competent or discontinuously replicating HSV-2 mutants, better suited for CD8 responses, have reached clinical trials for HSV prevention or immunotherapy and are also used for cancer therapy. Overall, the data disclosed herein indicate that, in the context of chronic viral infection, responses specific for a limited number of epitopes and antigens become immunodominant, and the specificity of the numerically immunodominant clones cannot be predicted from HLA typing. While vaccines elicit responses in a different context from wild-type infection, similar hierarchies and patterns of immunodominance may occur. Vaccines designed to elicit CD8 responses should therefore contain several epitopes for each population-prevalent HLA allele, ideally picked from analyses of immunodominant epitopes.

[0197] The clonal analysis found that CD8 CTL to HSV-2 in the circulating CLA^ compartment are largely type-specific for HSV-2. Earlier studies had estimated cross-reactivity to be about 50%. Prior HSV-1 infection reduces the severity of initial HSV-2 infections. The relative contributions of T-cells and antibodies to this effect are not known. The current findings will also allow a more systematic approach to define if the immunodominant CD8 T-cell response to HSV-2 differs between HSV-2 infected versus HSV-1/HSV-2 co-infected persons.

SEQUENCE LISTING

[0198]

<110> UNIVERSITY OF WASHINGTON

<120> RAPID, EFFICIENT PURIFICATION OF HSV-SPECIFIC T-LYMPHOCYTES AND HSV ANTIGENS IDENTIFIED VIA SAME <130> 30967.11WOU1 <150> 60/396,791 <151> 2002-07-18 <160> 17 <170> FastSEQ for Windows Version 4.0

<210> 1 <211> 9 <212> PRT <213> Herpes Simplex Virus 2 <400> 1

Asp Arg Leu Asp Asn Arg Leu Gin Leu 1 5

<210>2 <211> 9 <212> PRT <213> Herpes Simplex Virus 2 <400> 2

Gly Pro His Glu Thr He Thr Ala Leu 1 S

<210> 3 <211> 13 <212> PRT <213> Herpes Simplex Virus 2 <400> 3

His Ala Ser Pro Phe Glu Arg Val Arg Cys Leu Leu Leu 15 10

<210> 4 <211> 9 <212> PRT <213> Herpes Simplex Virus 2 <400> 4

Ala Ser Asp Ser Leu Asn Aan Glu Tyr 1 S

<210> 5 <211> 9 <212> PRT <213> Herpes Simplex 2 <400> 5

Arg Arg Ala Gin Met Ala Pro Lys Arg 1 5

<210> 6 <211> 9 <212> PRT <213> Herpes Simplex 2 <400> 6

Lys Ser Arg Arg Pro Leu Thr Thr Phe 1 5

<210> 7 <211 > 296 <212> PRT <213> Herpes Simplex Virus 2 <400> 7

Met Ala Asp Pro Thr Pro Ala Asp Glu Gly Thr Ala Ala Ala lie Leu IS 10 15

Lys Gin Ala lie Ala Gly Asp Arg Ser Leu Val Qlu Val Ala Glu Gly 20 25 30 lie Ser Asn Gin Ala Leu Leu Arg Met Ala Cys Qlu Val Arg Gin Val 35 40 45

Ser Asp Arg Gin Pro Arg Phe Thr Ala Thr Ser Val Leu Arg Val Asp 50 55 60

Val Thr Pro Arg Gly Arg Leu Arg Phe Val Leu Asp Gly Ser Ser Asp 65 70 75 80

Asp Ala Tyr Val Ala Ser Qlu Asp Tyr Phe Lys Arg Cys Gly Asp Gin 85 90 95

Pro Thr Tyr Arg Gly Phe Ala Val Val Val Leu Thr Ala Asn Glu Asp 100 105 110

His Val His Ser Leu Ala Val Pro Pro Leu Val Leu Leu His Arg Leu 115 120 125

Ser Leu Phe Arg Pro Thr Asp Leu Arg Asp Phe Qlu Leu Val Cys Leu 130 135 140

Leu Met Tyr Leu Glu Asn Cys Pro Arg Ser His Ala Thr Pro Ser Leu 145 150 155 160

Phe Val Lys Val Ser Ala Trp Leu Gly Val Val Ala Arg His Ala Ser 165 170 175

Pro Phe Qlu Arg Val Arg Cys Leu Leu Leu Arg Ser Cys His Trp He 180 185 190

Leu Asn Thr Leu Met Cys Met Ala Gly Val Lye Pro Phe Asp Asp Glu 195 ?00 205

Leu Val Leu Pro His Trp Tyr Met Ala His Tyr Leu Leu Ala Asn Asn 210 215 220

Pro Pro Pro Val Leu Ser Ala Leu Phe Cys Ala Thr Pro Gin Ser Ser 225 230 235 240

Ala Leu Gin Leu Pro Gly Pro val Pro Arg Thr Asp Cys Val Ala Tyr 245 250 255

Asn Pro Ala Gly Val Met Gly Ser Cys Trp Asn Ser Lys Asp Leu Arg 260 265 270

Ser Ala Leu Val Tyr Trp Trp Leu ser Qly Ser Pro Lys Arg Arg Thr 275 280 285

Ser Ser Leu Phe Tyr Arg Phe Cys 290 295

<210> 8 <211 > 585 <212> PRT <213> Herpes Simplex Virus 2 <400> 8

Met Asp Pro Tyr Tyr Pro Phe Asp Ala Leu Asp Val Trp Qiu His Arg 15 10 15

Arg Phe lie Val Ala Asp Ser Arg Ser Phe He Thr Pro Glu Phe Pro 20 25 30

Arg Asp Phe Trp Met Leu Pro Val Phe Asn He Pro Arg Glu Thr Ala 35 40 45

Ala Glu Arg Ala Ala Val Leu Gin Ala Gin Arg Thr Ala Ala Ala Ala 50 55 60

Ala Leu Glu Asn Ala Ala Leu Gin Ala Ala Glu Leu Pro Val Asp He 65 70 75 80

Glu Arg Arg He Arg Pro He Glu Gin Gin Val His His He Ala Asp 85 90 95

Ala Leu Glu Ala Leu Glu Thr Ala Ala Ala Ala Ala Glu Glu Ala Asp 100 105 110

Ala Ala Arg Asp Ala Glu Ala Arg Gly Glu Gly Ala Ala Asp Gly Ala 115 120 125

Ala Pro Ser Pro Thr Ala Gly Pro Ala Ala Ala Glu Met Glu Val Gin 130 135 140

He Val Arg Asn Asp Pro Pro Leu Arg Tyr Asp Thr Asn Leu Pro Val 145 150 155 160

Asp Leu Leu His Met Val Tyr Ala Gly Arg Gly Ala Ala Gly Ser Ser 165 170 175

Gly Val Val Phe Gly Thr Trp Tyr Arg Thr He Gin Glu Arg Thr He 180 185 190

Ala Asp Phe Pro Leu Thr Thr Arg Ser Ala Asp Phe Arg Asp Gly Arg 195 200 205

Met Ser Lys Thr Phe Met Thr Ala Leu Val Leu Ser Leu Gin Ser Cys 210 215 220

Gly Arg Leu Tyr Val Gly Gin Arg His Tyr Ser Ala Phe Glu Cys Ala 225 230 235 240

Val Leu Cys Leu Tyr Leu Leu Tyr Arg Thr Thr His Glu Ser ser Pro 245 250 255

Asp Arg Asp Arg Ala Pro Val Ala Phe Gly Asp Leu Leu Ala Arg Leu 260 265 270

Pro Arg Tyr Leu Ala Arg Leu Ala Ala Val He Gly Asp Glu Ser Gly 275 '280 285

Arg Pro Gin Tyr Arg Tyr Arg Asp Asp Lys Leu Pro Lys Ala Gin Phe 290 295 300

Ala Ala Ala Gly Gly Arg Tyr Glu His Gly Ala Leu Ala Thr His Val 305 310 315 320

Val He Ala Thr Leu Val Arg His Gly Val Leu Pro Ala Ala Pro Gly 325 330 335

Asp Val Pro Arg Asp Thr Ser Thr Arg Val Asn Pro Asp Asp Val Ala 340 345 350

His Arg Asp Asp Val Asn Arg Ala Ala Ala Ala Phe Leu Ala Arg Gly 355 360 365

His Asn Leu Phe Leu Trp Glu Asp Gin Thr Leu Leu Arg Ala Thr Ala 370 375 380

Asn Thr He Thr Ala Leu Ala val Leu Arg Arg Leu Leu Ala Asn Gly 385 390 395 400

Asn Val Tyr Ala Asp Arg Leu Asp Asn Arg Leu Gin Leu Gly Met Leu 405 410 415

He Pro Gly Ala Val Pro Ala Glu Ala He Ala Arg Gly Ala Ser Gly 420 425 430 lieu Αβρ Ser Gly Ala Ile Lys Ser Gly Asp Asn Asn Leu Glu Ala Leu 435 440 445

Cys Val Asn Tyr Val Leu Pro Leu Tyr Gin Ala Asp Pro Thr Val Olu 450 45S 460

Leu Thr Gin Leu Phe Pro Gly Leu Ala Ala Leu Cys Leu Asp Ala Gin 465 470 475 450

Ala Gly Arg Pro Leu Ala Ser Thr Arg Arg Val Val Asp Met Ser Ser 485 490 495

Gly Ala Arg Gin Ala Ala Leu Val Arg Leu Thr Ala Leu Glu Leu Ile 500 505 510

Asn Arg Thr Arg Thr Asn Thr Thr Pro Val Gly Glu Ile Ile Asn Ala 515 520 525

His Asp Ala Leu Gly Ile Gin Tyr Glu Gin Gly Pro Gly Leu Leu Ala 530 535 540

Gin Gin Ala Arg Ile Gly Leu Ala Ser Asn Thr Lys Arg Phe Ala Thr 545 550 555 560

Phe Asn Val Gly Ser Asp Tyr Asp Leu Leu Tyr Phe Leu Cys Leu Gly 565 570 575

Phe Ile Pro Gin Tyr Leu Ser Val Ala 580 585

<210> 9 <211 > 637 <212> PRT <213> Herpes Simplex Virus 2 <400> 9

Met Ala Ser Ala Glu Met Arg Glu Arg Leu Glu Ala Pro Leu Pro Asp 15 10 15

Arg Ala Val Pro Ile Tyr Val Ala Gly Phe Leu Ala Leu Tyr Asp Ser 20 25 30

Gly Asp Pro Gly Glu Leu Ala Leu Asp Pro Asp Thr Val Arg Ala Ala 35 40 45

Leu Pro Pro Glu Asn Pro Leu Pro Ile Asn Val Asp His Arg Ala Arg 50 55 60

Cys Glu Val Gly Arg Val Leu Ala Val Val Asn Asp Pro Arg Gly Pro 65 70 75 80

Phe Phe val Gly Leu Ile Ala Cys Val Gin Leu Glu Arg Val Leu Glu 85 90 95

Thr Ala Ala Ser Ala Ala Ile Phe Glu Arg Arg Gly Pro Ala Leu Ser 100 105 110

Arg Glu Glu Arg Leu Leu Tyr Leu Ile Thr Asn Tyr Leu Pro Ser Val 115 120 125

Ser Leu Ser Thr Lys Arg Arg Oly Asp Glu Val Pro Pro Asp Arg Thr 130 135 140

Leu Phe Ala His Val Ala Leu Cys Ala Ile Gly Arg Arg Leu Gly Thr 145 150 155 160

Ile Val Thr Tyr Asp Thr Ser Leu Asp Ala Ala Ile Ala Pro Phe Arg 165 170 175

His Leu Asp Pro Ala Thr Arg Glu Gly Val Arg Arg Glu Ala Ala Glu 180 185 190

Ala Glu Leu Ala Leu Ala Gly Arg Thr Trp Ala Pro Gly Val Glu Ala 195 200 205

Leu Thr His Thr Leu Leu Ser Thr Ala Val Asn Asn Met Met Leu Arg 210 215 220

Asp Arg Trp Ser Leu Val Ala Olu Arg Arg Arg Gin Ala Gly Ile Ala 225 230 23S 240

Gly His Thr Tyr Leu Gin Ala Ser Glu Lys Phe Lys Ile Trp Gly Ala 245 250 255

Glu Ser Ala Pro Ala Pro Glu Arg Gly Tyr Lys Thr Gly Ala Pro Gly 260 265 270

Ala Met Asp Thr Ser Pro Ala Ala Ser Val Pro Ala Pro Gin Val Ala 275 280 285

Val Arg Ala Arg Gin Val Ala Ser Ser Ser Ser Ser Ser Ser Phe Pro 290 295 300

Ala Pro Ala Asp Met Asn Pro Val Ser Ala Ser Gly Ala Pro Ala Pro 305 310 315 320

Pro Pro Pro Gly Asp Gly Ser Tyr Leu Trp Ile Pro Ala Ser His Tyr 325 330 335

Asn Gin Leu Val Thr Gly Gin Ser Ala Pro Arg His Pro Pro Leu Thr 340 345 350

Ala Cya Gly Leu Pro Ala Ala Gly Thr Val Ala Tyr Gly His Pro Gly 355 360 365

Ala Gly Pro Ser Pro His Tyr Pro Pro Pro Pro Ala His Pro Tyr Pro 370 375 380

Gly Met Leu Phe Ala Gly Pro Ser Pro Leu Glu Ala Gin Ile Ala Ala 385 390 395 400

Leu Val Gly Ala Ile Ala Ala Asp Arg Gin Ala Gly Gly Leu Pro Ala 405 410 415

Ala Ala Gly Asp His Gly Ile Arg Gly Ser Ala Lys Arg Arg Arg Hia 420 425 430

Glu Val Glu Qln Pro Glu Tyr Asp Cys Gly Arg Asp Glu Pro Asp Arg 435 440 445

Asp Phe Pro Tyr Tyr Pro Gly Glu Ala Arg Pro Glu Pro Arg Pro Val 450 455 460

Asp Ser Arg Arg Ala Ala Arg Gin Ala Ser Gly Pro His Glu Thr Ile 465 470 475 480

Thr Ala Leu Val Gly Ala Val Thr Ser Leu Gin Gin Glu Leu Ala His 485 490 495

Met Arg Ala Arg Thr His Ala Pro Tyr Gly Pro Tyr Pro Pro Val Qly 500 505 510

Pro Tyr His His Pro His Ala Asp Thr Glu Thr Pro Ala Qln Pro Pro 51Ξ 520 525

Arg Tyr Pro Ala Lys Ala val Tyr Leu Pro Pro Pro His Ile Ala Pro 530 535 540

Pro Qly Pro Pro Leu Ser Qly Ala Val Pro Pro Pro Ser Tyr Pro Pro 545 550 555 560

Val Ala Val Thr Pro Gly Pro Ala Pro Pro Leu His Gin Pro Ser Pro 565 570 575

Ala His Ala His Pro Pro Pro Pro Pro Pro Gly Pro Thr Pro Pro Pro 580 585 590

Ala Ala Ser Leu Pro Gin Pro Glu Ala Pro Gly Ala Glu Ala Gly Ala 595 600 605

Leu Val Asn Ala Ser Ser Ala Ala His Val Asn Val Asp Thr Ala Arg 610 615 620

Ala Ala Asp Leu Phe Val Ser Qln Met Met Gly Ser Arg 625 630 635

<210> 10 <211> 722 <212> PRT <213> Herpes Simplex Virus 2 <400> 10

Met Qln Arg Arg Ala Arg Gly Ala Ser Ser Leu Arg Leu Ala Arg Cys 15 10 15

Leu Thr Pro Ala Asn Leu Ile Arg Qly Ala Asn Ala Gly Val Pro Glu 20 25 30

Arg Arg Ile Phe Ala Qly Cya Leu Leu Pro Thr Pro Qlu Gly Leu Leu 35 40 45

Ser Ala Ala Val Gly Val Leu Arg Gin Arg Ala Asp Asp Leu Gin Pro 50 55 60

Ala Phe Leu Thr Gly Ala Asp Arg Ser Val Arg Leu Ala Ala Arg His 65 70 75 80

His ABii Thr Val Pro Glu Ser Leu Ile Val Asp Gly Leu Ala Ser Asp 85 90 95

Pro His Tyr Asp Tyr Ile Arg His Tyr Ala Ser Ala Ala Lys Gin Ala 100 105 110

Leu Gly Glu Val Qlu Leu Ser Gly Gly Gin Leu Ser Arg Ala Ile Leu 115 120 125

Ala Gin Tyr Trp Lys Tyr Leu Gin Thr Val Val Pro Ser Gly Leu Asp 130 135 140

Ile Pro Asp Asp Pro Ala Gly Asp Cys Asp Pro Ser Leu His Val Leu 145 ISO 155 160

Leu Arg Pro Thr Leu Leu Pro Lys Leu Leu Val Arg Ala Pro Phe Lys 165 170 175

Ser Gly Ala Ala Ala Ala Lys Tyr Ala Ala Ala Val Ala Gly Leu Arg 180 185 190

Asp Ala Ala His Arg Leu Qln Gin Tyr Met Phe Phe Met Arg Pro Ala 195 200 205

Asp Pro Ser Arg Pro Ser Thr Asp Thr Ala Leu Arg Leu Ser Glu Leu 210 215 220

Leu Ala Tyr Val Ser Val Leu Tyr His Trp Ala Ser Trp Met Lau Trp 225 230 235 240

Thr Ala Asp Lys Tyr Val Cys Arg Arg Leu Gly Pro Ala Asp Arg Arg 24S 250 255

Phe Val Ala Leu Ser Qly Ser Leu Glu Ala Pro Ala Glu Thr Phe Ala 260 265 270

Arg His Leu Asp Arg Gly Pro Ser Gly Thr Thr Gly Ser Met Gin Cys 275 280 285

Met Ala Leu Arg Ala Ala Val Ser Asp Val Leu Qly His Leu Thr Arg 290 295 300

Leu Ala His Leu Trp Glu Thr Gly Lys Arg Ser Gly Gly Thr Tyr Gly 305 310 315 320

Ile Val Asp Ala Ile Val Ser Thr Val Glu Val Leu Ser Ile Val His 325 330 335

His Hia Ala Qln Tyr Ile Ile Asn Ala Thr Leu Thr Gly Tyr Val val 340 345 350

Trp Ala Ser Asp Ser Leu Asn Asn Glu Tyr Leu Tlir Ala Ala Val Asp 355 360 365

Ser Gin Glu Arg Phe Cys Arg Thr Ala Ala Pro Leu Phe Pro Thr Met 370 375 380

Thr Ala Pro Ser Trp Ala Arg Met Glu Leu Ser Ile Lys Ser Trp Phe 385 390 395 400

Gly Ala Ala Leu Ala Pro Asp Leu Leu Arg Ser Gly Thr Pro Ser Pro 405 410 415

His Tyr Glu Ser Ile Leu Arg Leu Ala Ala Ser Gly Pro Pro Gly Gly 420 425 430

Arg Gly Ala Val Gly Gly Ser Cys Arg Asp Lys Ile Gin Arg Thr Arg 435 440 445

Arg Asp Asn Ala Pro Pro Pro Leu Pro Arg Ala Arg Pro His Ser Thr 450 455 460

Pro Ala Ala Pro Arg Arg Cys Arg Arg His Arg Glu Asp Leu Pro Glu 465 470 475 480

Pro Pro His Val Asp Ala Ala Asp Arg Gly Pro Glu Pro Cys Ala Gly 485 490 495

Arg Pro Ala Thr Tyr Tyr Thr His Met Ala Gly Ala Pro Pro Arg Leu 500 SOS 510

Pro Pro Arg Aen Pro Ala Pro Pro Qlu Qln Arg Pro Ala Ala Ala Ala SIS 520 525

Arg Pro Leu Ala Ala Gin Arg Qlu Ala Ala Gly val Tyr Asp Ala val 530 535 540

Arg Thr Trp Gly Pro Asp Ala Glu Ala Glu Pro Asp Gin Met Glu Asn 545 550 555 560

Thr Tyr Leu Leu Pro Asp Asp Asp Ala Ala Met pro Ala Gly Val Gly 565 570 575

Leu Gly Ala Thr Pro Ala Ala Asp Thr Thr Ala Ala Ala Ala Trp Pro 580 585 590

Ala Glu Ser His Ala Pro Arg Ala Pro Ser Glu Asp Ala Asp Ser lie 595 600 ¢05

Tyr Glu Ser Val Gly Glu Asp Gly Gly Arg Val Tyr Glu Glu lie Pro 610 615 620

Trp val Arg Val Tyr Glu Asn lie Cys Pro Arg Arg Arg Leu Ala Gly 625 630 63S ¢40

Gly Ala Ala Leu Pro Gly Asp Ala Pro Asp Ser Pro Tyr lie Glu Ala 645 650 655

Glu Asn Pro Leu Tyr Asp Trp Gly Gly Ser Ala Leu Phe Ser Pro Arg 660 665 670

Arg Ala Thr Arg Ala Pro Asp Pro Gly Leu Ser Leu Ser Pro Met Pro 675 680 685

Ala Arg Pro Arg Thr Asn Ala Leu Ala Asn Asp Gly pro Thr Asn Val 690 695 700

Ala Ala Leu Ser Ala Leu Leu Thr Lys Leu Lys Arg Gly Arg His Gin 70S 710 715 720

Ser His

<210> 11 <211> 393 <212> PRT <213> Herpes Simplex Virus 2 <400> 11

Met Gly Arg Leu Thr Ser Gly Val Oly Thr Ala Ala Leu Leu Val Val 15 10 IS

Ala Val Gly Leu Arg Val Val Cys Ala Lys Tyr Ala Leu Ala Asp Pro 20 25 30

Ser Leu Lys Met Ala Asp Pro Asn Arg Phe Arg Gly Lys Asn Leu Pro 35 40 45

Val Leu Asp Gin Leu Thr Asp Pro Pro Gly Val Lys Arg Val Tyr His 50 55 60 lie Gin Pro. Ser Leu Glu Asp Pro Phe Gin Pro Pro Ser He Pro He 65 70 75 80

Thr Val Tyr Tyr Ala Val Leu Glu Arg Ala Cys Arg Ser Val Leu Leu 85 90 95

His Ala Pro Ser Glu Ala Pro Gin He Val Arg Gly Ala Ser Asp Glu 100 lOS 110

Ala Arg Lys His Thr Tyr Asn Leu Thr He Ala Trp Tyr Arg Met Gly 115 120 125

Asp Asn Cys Ala He Pro He Thr Val Met Glu Tyr Thr Qlu Cys Pro 130 135 140

Tyr Asn Lys Ser Leu Gly Val Cys Pro He Arg Thr Qln Pro Arg Trp 145 150 155 160

Ser Tyr Tyr Asp Ser Phe Ser Ala Val Ser Glu Asp Asn Leu Gly Phe 165 170 175

Leu Met His Ala Pro Ala Phe Glu Thr Ala Gly Thr Tyr Leu Arg Leu ΙβΟ 1Θ5 190

Val Lys Ile Asn Asp Trp The Clu Ile Thr Gin Phe Ile Leu Glu His 195 200 205

Arg Ala Arg Ala Ser Gys Lys Tyr Ala Leu Pro Leu Arg ile Pro Pro 210 215 220

Ala Ala Cya Leu Thr Ser Lys Ala Tyr Gin Gin Gly Val Thr Val Asp 225 230 235 240

Ser Ile Gly Met Leu Pro Arg Phe Ile Pro Glu Asn Gin Arg Thr Val 245 250 255

Ala Leu Tyr Ser Leu Lys Ile Ala Gly Trp His Gly Pro Lys Pro Pro 260 265 270

Tyr Thr Ser Thr Leu Leu Pro Pro Glu Leu Ser Asp Thr Thr Asn Ala 275 280 285

Thr Gin Pro Glu Leu Val Pro Glu Asp Pro Glu Asp Ser Ala Leu Leu 290 295 300

Glu Asp Pro Ala Gly Thr Val Ser Ser Gin Ile Pro Pro Asn Trp His 305 310 315 320

Ile Pro Ser Ile Gin Asp Val Ala Pro His His Ala Pro Ala Ala Pro 325 330 335

Ser Asn Pro Gly Leu Ile Ile Gly Ala Leu Ala Oly Ser Thr Leu Ala 340 345 350

Val Leu Val Ile Gly Gly Ile Ala Phe Trp Val Arg Arg Arg Ala Gin 355 360 365

Met Ala Pro Lys Arg Leu Arg Leu Pro His Ile Arg Asp Asp Asp Ala 370 375 380

Pro Pro Ser His Gin Pro Leu Phe Tyr 385 390

<210> 12 <211> 545 <212> PRT <213> Herpes Simplex Virus 2 <400> 12

Met Ala Arg Gly Ala Gly Leu Val Phe Phe Val Gly Val Trp Val Val 15 10 15

Ser Cye Leu Ala Ala Ala Pro Arg Thr Ser Trp Lys Arg Val Thr Ser 20 25 30

Gly Glu Asp Val Val Leu Leu Pro Ala Pro Ala Glu Arg Thr Arg Ala 35 40 45

His Lys Leu Leu Trp Ala Ala Qlu Pro Leu Asp Ala Cys Gly Pro Leu 50 55 60

Arg Pro Ser Trp Val Ala Leu Trp Pro Pro Arg Arg Val Leu Glu Thr 65 70 75 80

Val Val, Asp Ala Ala Cys Met Arg Ala Pro Glu Pro Leu Ala Ile. Ala 85 90 95

Tyr Ser Pro Pro Phe Pro Ala Gly Asp Glu Gly Leu Tyr Ser Glu Leu 100 105 110

Ala Trp Arg Asp Arg Val Ala Val Val Asn Glu Ser Leu Val Ile Tyr lis 120 125

Gly Ala Leu Glu Thr Asp Ser Gly Leu Tyr Thr Leu Ser Val Val Gly 130 135 140

Leu Ser Asp Glu Ala Arg Gin Val Ala Ser Val Val Leu Val Val Glu 145 150 155 160

Pro Ala Pro val Pro Thr Pro Thr Pro Asp Asp Tyr Asp Glu Glu Asp 165 170 175

Asp Ala Gly Val Thr Asn Ala Arg Arg Ser Ala Phe Pro Pro Gin Pro 180 185 190

Pro Pro Arg Arg Pro Pro Val Ala Pro Pro Thr His Pro Arg val Ile 195 200 205

Pro Glu Val Ser His Val Arg Qly Val Thr Val His Met Qlu Thr Leu 210 215 220

Glu Ala Ile Leu Phe Ala Pro Gly Glu Thr Phe Gly Thr Asn Val Ser 225 230 235 240

Ile His Ala Ile Ala His Asp Asp Gly Pro Tyr Ala Met Asp Val Val 245 250 255

Trp Met Arg Phe Asp Val Pro Ser Ser Cys Ala Asp Met Arg Ile Tyr 260 265 270

Olu Ala Cys Leu Tyr His Pro Gin Leu Pro Glu Cys Leu Ser Pro Ala 275 280 285

Asp Ala Pro Cys Ala Val Ser Ser Trp Ala Tyr Arg Leu Ala Val Arg 290 295 300

Ser Tyr Ala Gly Cys Ser Arg Thr Thr Pro Pro Pro Arg Cys Phe Ala 305 310 315 320

Glu Ala Arg Met Glu Pro Val Pro Gly Leu Ala Trp Leu Ala Ser Thr 325 330 335

Val Asn Leu Glu Phe Gin His Ala Ser Pro Gin His Ala Gly Leu Tyr 340 345 350

Leu Cys Val Val Tyr Val Asp Asp Hia Ile His Ala Trp Gly Hia Met 355 360 365

Thr Ile Ser Thr Ala Ala Gin Tyr Arg Asn Ala Val Val Glu Gin His 370 375 380

Leu Pro Gin Arg Gin Pro Glu Pro Val Glu Pro Thr Arg Pro His Val 385 390 395 400

Arg Ala Pro His Pro Ala Pro Ser Ala Arg Gly Pro Leu Arg Leu Oly 405 410 415

Ala Val Leu Gly Ala Ala Leu Leu Leu Ala Ala Leu Gly Leu Ser Ala 420 425 430

Trp Ala Cys Met Thr Cys Trp Arg Arg Arg Ser Trp Arg Ala Val Lys 435 440 445

Ser Arg Ala Ser Ala Thr Gly Pro Thr Tyr Ile Arg Val Ala Asp Ser 450 455 460

Qlu Leu Tyr Ala Asp Trp Ser Ser Asp Ser Glu Gly Glu Arg Asp Gly 465 470 475 480

Ser Leu Τιηρ Gin Asp Pro Pro Qlu Arg Pro Asp Ser Pro Ser Thr Asn 485 490 495

Gly Ser Qly Phe Glu Ile Leu Ser Pro Thr Ala Pro Ser Val Tyr Pro 500 505 510

His Ser Glu Gly Arg Lys Ser Arg Arg Pro Leu Thr Thr Phe Gly Ser 515 520 525

Gly Ser Pro Gly Arg Arg His Ser Gin Ala Ser Tyr Pro Ser Val Leu 530 535 540

Trp 545,

<210> 13 <211> 9 <212> PRT <213> Cytomegalovirus <400> 13

Asn Leu Val Pro Met Val Ala Thr Val 1 S

<210> 14 <211 >29 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 14 gacgctagcc acgaccgtct ggaggtact 29

<210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 15 gactctagag cgaccgttac cctgaaata 29

<210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 16 gactctagag acgaggaaag gggtggt 27

<210> 17 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 gacaagcttc cgctcctctg ggtacttta 29

SEQUENCE LISTING

[0199] <110> University of Washington

<120> RAPID, EFFICIENT PURIFICATION OF HSV-SPECIFIC T-LYMPHOCYTES AND HSV ANTIGENS IDENTIFIED VIA SAME

<130> P50703EP3/KVC <150> EP08166335.3 <151> 2003-07-18 <150> EP03765758.2 <151> 2003-07-18 <150> US60/396,791 <151> 2002-07-18 <160> 17 <170> Patentin version 3.4

<210> 1 <211> 9 <212> PRT <213> Herpes Simplex virus 2 <400> 1

Asp Arg Leu Asp Asn Arg Leu Gin Leu 1 5

<210> 2 <211> 9 <212> PRT <213> Herpes Simplex virus 2 <400> 2

Gly Pro His Glu Thr lie Thr Ala Leu 1 5

<210> 3 <211> 13 <212> PRT <213> Herpes Simplex virus 2 <400> 3

His Ala Ser Pro Phe Glu Arg val Arg Cys Leu Leu Leu 1 5 10

<210> 4 <211> 9 <212> PRT <213> Herpes Simplex virus 2 <400> 4

Ala Ser Asp Ser Leu Asn Asn Glu Tyr 1 5

<210> 5 <211> 9 <212> PRT <213> Herpes Simplex virus 2 <400> 5

Arg Arg Ala Gin Met Ala Pro Lys Arg 1 5

<210> 6 <211> 9 <212> PRT <213> Herpes Simplex Virus 2 <400> 6

Lys Ser Arg Arg Pro Leu Thr Thr Phe 1 5

<210> 7 <211 >296 <212> PRT <213> Herpes Simplex Virus 2 <400> 7

Met Ala ASD Pro Thr Pro Ala Asp Glu Gly Thr Ala Ala Ala lie Leu 15 10 15

Lys Gin Ala lie Ala Gly Asp Arg ser Leu val Glu Val Ala Glu Gly 20 25 30 lie ser Asn Gin Ala Leu Leu Arg Met Ala Cys Glu val Arg Gin val 35 40 45

Ser Asp Aro Gin Pro Arg Phe Thr Ala Thr Ser Val Leu Arg val Asp 50 55 60

Val Thr Pro Ara Gly Arg Leu Arg Phe Val Leu Asp Gly Ser ser Asp 65 70 75 80

Asp Ala Tyr val Ala Ser Glu Asp Tyr Phe Lys Arg tys Gly Asp Gin 85 90 95

Pro Thr Tyr Ara Gly Phe Ala val Val val Leu Thr Ala Asn Glu Asp 100 105 110

His val His ser Leu Ala val Pro Pro Leu val Leu Leu His Arg Leu 115 120 125

Ser Leu Phe Aro Pro Thr Asp Leu Arg Asp Phe Glu Leu Val Cys Leu 130 135 140

Leu Met Tyr Leu Glu Asn Cys Pro Arg ser His Ala Thr Pro ser Leu 145 150 155 160

Phe val Lys val Ser Ala Trp Leu Gly val val Ala Arg His Ala ser 165 170 175

Pro Phe Glu Arg Va1 Arg Cys Leu Leu Leu Arg Ser cys His Trp He 180 185 190

Leu Asn Thr Leu Met cys Met Ala Gly val Lys Pro Phe Asp Asp Glu 195 200 205

Leu Val Leu Pro His Trp Tyr Met Ala His Tyr Leu Leu Ala Asn Asn 210 215 220

Pro Pro pro val Leu ser Ala Leu Phe Cys Ala Thr Pro Gin ser Ser 225 230 235 240

Ala Leu Gin Leu Pro Gly Pro val Pro Arg Thr Asp Cys Val Ala Tyr 245 250 255

Asn Pro Ala Gly val Met Gly ser Cys Trp Asn ser Lys Asp Leu Arg 260 265 270

Ser Ala Leu val Tyr Trp Trp Leu ser Gly ser Pro Lys Arg Arg Thr 275 280 285

Ser Ser Leu Phe Tyr Arg Phe Cys 290 295

<210> 8 <211 > 585 <212> PRT <213> Herpes Simplex Virus 2 <400> 8

Met Asp Pro Tyr xyr Pro Phe Asp Ala Leu Asp val xrp Glu His Arg 15 10 15

Arg Phe lie val Ala Asp ser Arg Ser Phe lie Xhr Pro Glu Phe Pro 20 25 30

Arg Asp Phe xrp Met Leu Pro val Phe Asn lie Pro Arg Glu xhr Ala 35 40 45

Ala Glu Arg Ala Ala Val Leu Gin Ala Gin Arg xhr Ala Ala Ala Ala 50 55 60

Ala Leu Glu Asn Ala Ala Leu Gin Ala Ala Glu Leu Pro val Asp lie 65 70 75 80

Glu Arg Arg lie Arg Pro lie Glu Gin Gin val His His lie Ala Asp 85 90 95

Ala Leu Glu Ala Leu Glu Xhr Ala Ala Ala Ala Ala Glu Glu Ala Asp 100 105 110

Ala Ala Arg Asp Ala Glu Ala Arg Gly Glu Gly Ala Ala Asp Gly Ala 115 120 125

Ala Pro ser Pro Thr Ala Gly Pro Ala Ala Ala Glu Met Glu val Gin 130 135 140 lie Val Arg Asn Asp Pro Pro Leu Arg Tyr Asp Thr Asn Leu Pro Val 145 150 155 160

Asp Leu Leu His Met Val Tyr Ala Gly Arg Gly Ala Ala Gly ser ser 165 170 175

Gly val Val Phe Gly Thr Trp Tyr Arg Thr lie Gin Glu Arg Thr lie 180 185 190

Ala Asp Phe Pro Leu Thr Thr Arg Ser Ala Asp Phe Arg Asp Gly Arg 195 200 205

Met Ser Lys Thr Phe Met Thr Ala Leu Val Leu Ser Leu Gin Ser Cys 210 215 220

Gly Arg Leu Tyr Val Gly Gin Arg His Tyr Ser Ala Phe Glu Cys Ala 225 230 y 235 240

Val Leu Cys Leu Tyr Leu Leu Tyr Arq Thr Thr His Glu Ser ser Pro 245 250 255

Asp Arg Asp Arg Ala Pro val Ala Phe Gly Asp Leu Leu Ala Arg Leu 260 265 270

Pro Arg Tyr Leu Ala Arg Leu Ala Ala val lie Gly Asp Glu Ser Gly 275 280 285

Arg Pro Gin Tyr Arg Tyr Arg asd asp Lys Leu Pro Lys Ala Gin Phe 290 295 300

Ala Ala Ala Gly Gly Arg Tyr Glu His Gly Ala Leu Ala Thr His val

305 310 I' 3^5 32Q

Val He Ala Thr Leu Val Arg His Gly vaT Leu Pro Ala Ala Pro Gly

Asp Val Pro Arg Asp Thr ser Thr Arg val Asn Pro Asp Asp Val Ala 340 345 350

His Arg Asp Asp val Asn Arg Ala Ala Ala Ala Phe Leu Ala Arg Gly 355 360 365

His Asn Leu Phe Leu Trp Glu asp Gin Thr Leu Leu Arg Ala Thr Ala 370 375 ^ 380

Asn Thr ile Thr Ala Leu Ala val Leu Arg Arg Leu Leu Ala Asn Gly 385 390 395 400

Asn Val Tyr Ala Asp Arg Leu Asp Asn Arg Leu Gin Leu Gly Met Leu 405 410 415

Ile ΡΓΟ Gly Ala val pro Ala Glu Ala ile Ala Arg Gly Ala ser Gly 420 425 430

Leu Asp ser Gly Ala ile Lys Ser Gly Asp Asn Asn Leu Glu Ala Leu 435 440 445

Cys Val Asn Tyr Val Leu Pro Leu Tyr Gin Ala Asp Pro Thr Val Glu 450 455 460

Leu Thr Gin Leu Phe pro Gly Leu Ala Ala Leu cys Leu Asp Ala Gin 465 470 475 480

Ala Gly Arg Pro Leu Ala Ser Thr Arg Arg val val Asp Met Ser Ser 485 490 495

Gly Ala Arg Gin Ala Ala Leu val Arg Leu Thr Ala Leu Glu Leu Ile 500 505 510

Asn Arg Thr Arg Thr Asn Thr Thr Pro val Gly Glu Ile Ile Asn Ala 515 520 525

His Asp Ala Leu Gly ile Gin Tyr Glu Gin Gly Pro Gly Leu Leu Ala 530 535 540

Gin Gin Ala Arg ile Gly Leu Ala Ser Asn Thr Lys Arg Phe Ala Thr 545 550 555 560

Phe Asn val Gly Ser Asp Tyr Asp Leu Leu Tyr Phe Leu cys Leu Gly 565 570 575

Phe Ile Pro Gin Tyr Leu Ser val Ala 580 585

<210> 9 <211> 637 <212> PRT <213> Herpes Simplex virus 2 <400> 9

Met Ala Ser Ala Glu Met Arg Glu Arg Leu Glu Ala Pro Leu Pro Asp I S 10 15

Arg Ala val Pro ile Tyr val Ala Gly Phe Leu Ala Leu Tyr Asp Ser 20 25 30

Gly Asp Pro Gly Glu Leu Ala Leu Asp Pro Asp Thr val Arg Ala Ala 35 40 45

Leu Pro Pro Glu Asn Pro Leu pro lie Asn Val Asp His Arg Ala Arg 50 55 60 CVS Glu val Gly Arg val Leu Ala Val val Asn Asp Pro Arg Gly Pro 65 70 75 80

Phe Phe val Gly Leu lie Ala Cys val Gin Leu Glu Arg val Leu Glu 85 90 95

Thr Ala Ala Ser Ala Ala lie Phe Glu Arg Arg Gly Pro Ala Leu ser 100 105 110

Arg Glu Glu Arg Leu Leu Tyr Leu lie Thr Asn Tyr Leu pro ser val 115 120 125

Ser Leu Ser Thr Lys Arg Arg Gly Asp Glu Val Pro Pro Asp Arg Thr 130 135 140

Leu Phe Ala His val Ala Leu cys Ala lie Gly Arg Arg Leu Gly Thr 145 150 155 160 lie Val Thr Tyr Aso Thr ser Leu Asp Ala Ala lie Ala Pro Phe Arg 165 170 175

His Leu Asp Pro Ala Thr Arg Glu Gly val Arg Arg Glu Ala Ala Glu 180 185 190

Ala Glu Leu Ala Leu Ala Gly Arg Thr Trp Ala Pro Gly Val Glu Ala 195 200 205

Leu Thr His Thr Leu Leu ser Thr Ala val Asn Asn Met Met Leu Arg 210 215 220

Asp Arg Trp Ser Leu Val Ala Glu Arg Arg Arg Gin Ala Gly lie Ala 225 230 235 240

Gly His Thr Tyr Leu Gin Ala Ser Glu Lys Phe Lys lie Trp Gly Ala 245 250 255

Glu Ser Ala Pro Ala Pro Glu Arg Gly Tyr Lys Thr Gly Ala Pro Gly 260 265 270

Ala Met Asp Thr ser Pro Ala Ala Ser Val Pro Ala Pro Gin val Ala 275 280 285 val Arg Ala Arg Gin Val Ala Ser Ser ser Ser Ser Ser Ser Phe Pro 290 295 300

Ala pro Ala Asp Met Asn Pro val Ser Ala Ser Gly Ala Pro Ala Pro 305 310 315

Pro pro pro Gly Asp Gly Ser Tyr Leu Trp He Pro Ala Ser His Tyr 325 330 335

Asn Gin Leu val Thr Gly Gin Ser Ala Pro Arg His Pro Pro Leu Thr 340 345 350

Ala Cys Gly Leu Pro Ala Ala Gly Thr val Ala Tyr Gly His Pro Gly 355 360 365

Ala Gly Pro Ser Pro His Tyr Pro Pro Pro Pro Ala His Pro Tyr Pro 370 375 380

Glv Met Leu Phe Ala Gly Pro Ser Pro Leu Glu Ala Gin lie Ala Ala 385 390 395 400

Leu Val Gly Ala He Ala Ala Asp Arg Gin Ala Gly Gly Leu Pro Ala 405 410 415

Ala Ala Gly Asp His Gly He Arg Gly Ser Ala Lys Arg Arg Arg His 420 425 430

Glu val Glu Gin Pro Glu Tyr Asp Cys Gly Arg Asp Glu Pro Asp Arg 435 440 445

Asp Phe Pro Tyr Tyr Pro Gly Glu Ala Arg Pro Glu Pro Arg Pro val 450 455 460

Asp ser Arg Arg Ala Ala Arg Gin Ala ser Gly Pro His Glu Thr lie 465 470 475 480

Thr Ala Leu val Gly Ala val Thr ser Leu Gin Gin Glu Leu Ala His 485 490 495

Met Arg Ala Arg Thr His Ala pro Tyr Gly Pro Tyr Pro Pro val Gly 500 505 510 pro Tyr His His Pro His Ala Asp Thr Glu Thr Pro Ala Gin pro Pro 515 520 525

Arg Tyr Pro Ala Lys Ala val Tyr Leu Pro Pro Pro His lie Ala Pro 530 535 540

Pro Gly Pro Pro Leu ser Gly Ala val Pro Pro Pro ser Tyr pro Pro 545 550 555 560 val Ala val Thr pro Gly Pro Ala Pro Pro Leu His Gin Pro ser Pro 565 570 575

Ala His Ala His Pro Pro Pro Pro Pro pro Gly Pro Thr pro Pro Pro 580 585 590

Ala Ala ser Leu pro Gin Pro Glu Ala pro Gly Ala Glu Ala Gly Ala 595 600 605

Leu val Asn Ala Ser Ser Ala Ala His val Asn Val Asp Thr Ala Arg 610 615 620

Ala Ala Asp Leu Phe val Ser Gin Met Met Gly ser Arg 625 630 635

<210> 10 <211> 722 <212> PRT <213> Herpes Simplex virus 2 <400> 10

Met Gin Arg Arg Ala Arg Gly Ala Ser Ser Leu Arg Leu Ala Arg Cys 1 a y ^ y

Leu Thr Pro Ala Asn Leu lie Arg Gly Ala Asn Ala Gly val pro Glu 20 25 30

Arq Arq lie Phe Ala Gly Cys Leu Leu Pro Thr Pro Glu Gly Leu Leu 35 40 45 ser Ala Ala val Gly Val Leu Arg Gin Arg Ala Asp Asp Leu Gin Pro 50 55 60

Ala Phe Leu Thr Gly Ala Asp Arg Ser val Arg Leu Ala Ala Arg His 65 70 75 80

His Asn Thr Val Pro Glu Ser Leu lie Val Asp Gly Leu Ala Ser Asp 85 90 95

Pro His Tyr Asp Tyr lie Arg His Tyr Ala ser Ala Ala Lys Gin Ala 100 105 110

Leu Gly Glu val Glu Leu Ser Gly Gly Gin Leu Ser Arg Ala He Leu 115 120 125

Ala Gin Tyr Trp Lys Tyr Leu Gin Thr val Val Pro Ser Gly Leu Asp 130 135 140 lie pro Asp Asp pro Ala Gly Asp cys Asp pro ser Leu His val Leu 145 150 155 160

Leu Arg Pro Thr Leu Leu pro Lys Leu Leu val Arg Ala Pro Phe Lys 165 170 175 ser Gly Ala Ala Ala Ala Lys Tyr Ala Ala Ala val Ala Gly Leu Arg 180 185 190

Asp Ala Ala His Arg Leu Gin Gin Tyr Met Phe Phe Met Arg Pro Ala 195 200 205

Asp Pro ser Arg pro Ser Thr Asp Thr Ala Leu Arg Leu ser Glu Leu 210 215 220

Leu Ala Tyr val Ser val Leu Tyr His Trp Ala ser Trp Met Leu Trp 225 230 ^ 235 240

Thr Ala Asp Lys Tyr val Cys Arg Arg Leu Gly Pro Ala Asp Arg Arg 245 ^ 250 255

Phe Val Ala Leu Ser Gly Ser Leu Glu Ala Pro Ala Glu Thr Phe Ala 260 265 270

Arg His Leu Asp Arg Gly Pro Ser Gly Thr Thr Gly Ser Met Gin Cys 275 280 285

Met Ala Leu Arg Ala Ala val ser Asp val Leu Gly His Leu Thr Arg 290 295 300

Leu Ala His Leu Trp Glu Thr Gly Lys Arg ser Gly Gly Thr Tyr Gly 305 310 / y 320

Ile val Asp Ala Ile val Ser Thr val Glu Val Leu Ser ile val His 325 330 335

His His Ala Gin Tyr Ile ile Asn Ala Thr Leu Thr Gly Tyr val val 340 345 350

Trp Ala Ser Asp ser Leu Asn Asn Glu Tyr Leu Thr Ala Ala val Asp 355 360 365

Ser Gin Glu Ara Phe Cys Arg Thr Ala Ala Pro Leu Phe Pro Thr Met 370 375 380

Thr Ala Pro Ser Trp Ala Arg Met Glu Leu ser ile Lys Ser Trp Phe 385 390 395 400

Gly Ala Ala Leu Ala Pro Asp Leu Leu Arg Ser Gly Thr Pro ser Pro 405 410 415

His Tyr Glu Ser Ile Leu Arg Leu Ala Ala ser Gly Pro Pro Gly Gly 420 425 430

Arg Gly Ala val Gly Gly ser cys Arg Asp Lys ile Gin Arg Thr Arg 435 440 445

Arg Asp Asn Ala Pro Pro Pro Leu Pro Arg Ala Arg Pro His Ser Thr 450 455 460

Pro Ala Ala Pro Arg Arg Cys Arg Arg His Arg Glu Asp Leu Pro Glu 465 470 475 480

Pro Pro His val Asp Ala Ala Asp Arg Gly Pro Glu Pro cys Ala Gly 485 490 495

Arg Pro Ala Thr Tyr Tyr Thr His Met Ala Gly Ala Pro pro Arg Leu 500 505 510

Pro Pro Arg Asn Pro Ala Pro Pro Glu Gin Arg Pro Ala Ala Ala Ala 515 520 525

Arg Pro Leu Ala Ala Gin Arg Glu Ala Ala Gly Val Tyr Asp Ala val 530 535 540

Arg Thr Trp Gly Pro Asp Ala Glu Ala Glu Pro Asp Gin Met Glu Asn 545 550 555 560

Thr Tyr Leu Leu Pro Asp Asp Asp Ala Ala Met Pro Ala Gly val Gly 565 570 575

Leu Gly Ala Thr Pro Ala Ala Asp Thr Thr Ala Ala Ala Ala Trp Pro 580 585 590

Ala Glu Ser His Ala Pro Arg Ala Pro Ser Glu Asp Ala Asp ser ile 595 600 605

Tyr Glu ser val Gly Glu Asp Gly Gly Arg val Tyr Glu Glu ile Pro 610 615 620

Trp Val Arg val Tyr Glu Asn ile Cys Pro Arg Arg Arg Leu Ala Gly 625 630 635 640

Gly Ala Ala Leu Pro Gly Asp Ala Pro Asp Ser Pro Tyr ile Glu Ala 645 650 655

Glu Asn Pro Leu Tyr Asp Trp Gly Gly Ser Ala Leu Phe ser Pro Arg 660 665 670

Arg Ala Thr Arg Ala Pro Asp Pro Gly Leu Ser Leu Ser Pro Met Pro 675 680 685

Ala Arg Pro Arg Thr Asn Ala Leu Ala Asn Asp Gly Pro Thr Asn val 690 695 700

Ala Ala Leu Ser Ala Leu Leu Thr Lys Leu Lys Arg Gly Arg His Gin 705 710 715 720 ser His

<210> 11 <211> 393 <212> PRT <213> Herpes Simplex Virus 2 <400> 11

Met Gly Arg Leu xhr ser Gly val Gly Thr Ala Ala Leu Leu val val 15 10 15

Ala Val Gly Leu Arg val val cys Ala Lys Tyr Ala Leu Ala Asp Pro 20 25 30

Ser Leu Lys Met Ala Asp Pro Asn Arg Phe Arg Gly Lys Asn Leu pro 35 40 45

Val Leu Asp Gin Leu Thr Asp Pro pro Gly val Lys Arg val Tyr His 50 55 60

Ile Gin Pro Ser Leu Glu Asp Pro Phe Gin Pro Pro ser Ile Pro ile 65 70 75 80

Thr val Tyr Tyr Ala Val Leu Glu Arg Ala Cys Arg Ser val Leu Leu 85 90 95

His Ala Pro ser Glu Ala pro Gin ile val Arg Gly Ala Ser Asp Glu 100 105 110

Ala Arg Lys His Thr Tyr Asn Leu Thr Ile Ala Trp Tyr Arg Met Gly 115 120 125

Asp Asn Cys Ala Ile Pro Ile Thr val Met Glu Tyr Thr Glu Cys Pro 130 135 140

Tyr Asn Lys Ser Leu Gly val Cys Pro Ile Arg Thr Gin Pro Arg Trp 145 150 155 160

Ser Tyr Tyr Asp Ser Phe Ser Ala val Ser Glu Asp Asn Leu Gly Phe 165 170 175

Leu Met His Ala Pro Ala Phe Glu Thr Ala Gly Thr Tyr Leu Arg Leu 180 185 190

Val Lys Ile Asn Asp Trp Thr Glu ile Thr Gin Phe Ile Leu Glu His 195 200 205

Arg Ala Arg Ala Ser Cys Lys Tyr Ala Leu Pro Leu Arg ile Pro Pro 210 215 220

Ala Ala Cys Leu Thr Ser Lys Ala Tyr Gin Gin Gly val Thr Val Asp 225 230 235 240

Ser Ile Gly wet Leu Pro Arq Phe ile Pro Glu Asn Gin Arg Thr Val 245 250 255

Ala Leu Tyr ser Leu Lys Ile Ala Gly Trp His Gly Pro Lys Pro Pro 260 265 270

Tyr Thr Ser Thr Leu Leu Pro Pro Glu Leu Ser Asp Thr Thr Asn Ala 275 280 285

Thr Gin Pro Glu Leu val Pro Glu Asp Pro Glu Asp Ser Ala Leu Leu 290 295 300

Glu Asp Pro Ala Gly Thr val ser ser Gin Ile Pro Pro Asn Trp His 305 310 315 320

Ile Pro Ser ile Gin Asp val Ala Pro His His Ala Pro Ala Ala Pro 325 330 335

Ser Asn Pro Gly Leu Ile Ile Gly Ala Leu Ala Gly Ser Thr Leu Ala 340 345 350

Val Leu Val Ile Gly Gly Ile Ala Phe Trp val Arg Arg Arg Ala Gin 355 360 365

Met Ala Pro Lys Arg Leu Arg Leu Pro His ile Arg Asp Asp Asp Ala 370 375 380

Pro Pro Ser His Gin Pro Leu Phe Tyr 385 390

<210> 12 <211> 545 <212> PRT <213> Herpes Simplex virus 2 <400> 12

Met Ala Arg Giy Ala GiV Leu val Phe Phe Va1 Gly Val Trp val val

Ser cys Leu Ala Ala Ala Pro Arg Thr Ser Trp Lys Arg val Thr Ser 20 25 30

Gly Glu Asp val val Leu Leu Pro Ala Pro Ala Glu Arg Thr Arg Ala 35 40 45

His Lys Leu Leu Trp Ala Ala Glu Pro Leu Asp Ala Cys Gly Pro Leu 50 55 60

Arg Pro Ser Trp val Ala Leu Trp pro Pro Arg Arg val Leu Glu Thr 65 70 75 80

Val val Asp Ala Ala cys Met Arg Ala Pro Glu Pro Leu Ala ile Ala 85 90 95

Tyr Ser Pro Pro Phe Pro Ala Gly Asp Glu Gly Leu Tyr Ser Glu Leu 100 105 110

Ala Trp Arg Asp Arg val Ala Val val Asn Glu Ser Leu val Ile Tyr 115 120 125

Gly Ala Leu Glu Thr Asp Ser Gly Leu Tyr Thr Leu Ser Val Val Gly 130 135 140

Leu Ser Asp Glu Ala Arg Gin val Ala Ser val val Leu val val Glu 145 150 155 160

Pro Ala Pro val Pro Thr Pro Thr Pro Asp Asp Tyr Asp Glu Glu Asp 165 170 175

Asp Ala Gly Val Thr Asn Ala Arg Arg Ser Ala Phe Pro Pro Gin Pro 180 185 190

Pro Pro Arg Arg Pro Pro val Ala Pro Pro Thr His Pro Arg val Ile 195 200 205

Pro Glu val ser His val Arg Gly Val Thr Val His Met Glu Thr Leu 210 215 220

Glu Ala Ile Leu Phe Ala pro Gly Glu Thr Phe Gly Thr Asn val ser 225 230 235 240

Ile His Ala Ile Ala His Asp Asp Gly Pro Tyr Ala Met Asp val val

Trp Met Arg Phe Asp val Pro ser ser cys Ala Asp Met Arg ile Tyr 260 265 270

Glu Ala Cys Leu Tyr His Pro Gin Leu Pro Glu Cys Leu Ser Pro Ala 275 280 285

Asp Ala pro Cys Ala val ser ser Trp Ala Tyr Arg Leu Ala val Arg 290 295 300 ser Tyr Ala Gly Cys Ser Arg Thr Thr Pro Pro Pro Arg Cys Phe Ala 305 310 315 320

Glu Ala Arg Met Glu Pro val Pro Gly Leu Ala Trp Leu Ala Ser Thr 325 330 335

Val Asn Leu Glu Phe Gin His Ala ser pro Gin His Ala Gly Leu Tyr 340 345 350

Leu cys val val Tyr val Asp Asp His ile His Ala Trp Gly His Met 355 360 365

Thr Ile ser Thr Ala Ala Gin Tyr Arg Asn Ala Val Val Glu Gin His 370 375 380

Leu Pro Gin Arg Gin Pro Glu Pro val Glu Pro Thr Arg Pro His val 385 390 395 400

Arg Ala Pro His Pro Ala Pro Ser Ala Arg Gly Pro Leu Arg Leu Gly 405 410 415

Ala val Leu Gly Ala Ala Leu Leu Leu Ala Ala Leu Gly Leu Ser Ala 420 425 430

Trp Ala Cys Met Thr Cys Trp Arg Arg Arg ser Trp Arg Ala val Lys 435 440 445

Ser Arg Ala Ser Ala Thr Gly Pro Thr Tyr ile Arg Val Ala Asp Ser 450 455 460

Glu Leu Tyr Ala Asp Trp Ser Ser Asp Ser Glu Gly Glu Arg Asp Gly 465 470 475 480 ser Leu Trp Gin Asp Pro Pro Glu Arg Pro Asp Ser Pro Ser Thr Asn 485 490 495

Giv Ser Giv Phe Glu ile Leu Ser Pro Thr Ala Pro Ser Val Tyr Pro 500 505 510

His Ser Glu Gly Arg Lys Ser Arg Arg Pro Leu Thr Thr Phe Gly Ser 515 520 525

Gly Ser Pro Gly Arg Arg His Ser Gin Ala ser Tyr Pro ser val Leu 530 535 540

Trp 545

<210> 13 <211> 9 <212> PRT <213> Herpes Simplex Virus 2 <400> 13

Asn Leu val Pro Met val Ala Thr val 1 5 <210> 14 <211> 29 <212> DNA <213> Artificial <220> <223> Primer <400> 14 gacgctagcc acgaccgtct ggaggtact 29 <210> 15 <211> 29 <212> DNA <213> Artificial <220> <223> Primer <400> 15 gactctagag cgaccgttac cctgaaata 29 <210> 16 <211> 27 <212> DNA <213> Artificial <220> <223> Primer <400> 16 gactctagag acgaggaaag gggtggt 27 <210> 17 <211> 29 <212> DNA <213> Artificial <220> <223> Primer <400> 17 gacaagcttc cgctcctctg ggtacttta 29

Claims (10)

A pharmaceutical composition comprising a fragment of a herpes simplex virus (HSV) Ul25 protein as shown in SEQ iD NO: 8, comprising amino acids DRLDNRLQL (SEQ iD NO: 1) and eliciting a cellular immune response to HSV-2. The pharmaceutical composition of claim 1, wherein the fragment has the sequence of amino acids 322 to 417 of SEQ ID NO: 8. The pharmaceutical composition of claim 1, wherein the fragment has the sequence DRLDNRLQL (SEQ ID NO: 1). Pharmaceutical composition according to any one of claims 1 to 3 for use in administering to a subject for the treatment or prevention of an HSV-2 infection. The pharmaceutical composition for use according to claim 4, wherein the treatment comprises killing HSV-2 infected cells. A polynucleotide encoding a polypeptide according to any one of claims 1 to 3. A pharmaceutical composition comprising the polynucleotide of claim 6. The pharmaceutical composition of claim 7 for use in administering to a subject for treating or preventing an HSV-2 infection. A pharmaceutical composition comprising a recombinant virus genetically modified to express a polypeptide according to any one of claims 1 to 3. A pharmaceutical composition according to any one of claims 1 to 4, 7 or 8, further comprising an adjuvant.