DK172382B1 - Recombinant lymphotoxin derivatives - Google Patents

Description

in DK 172382 B1

The invention relates to recombinant lymphotoxin derivatives and antibodies thereto, as well as nucleic acids encoding the lymphotoxin derivatives, vectors comprising the nucleic acids, cells transformed with the vectors and a process comprising culturing the cells to form the lymphotoxin derivative.

Lymphotoxin was first identified as a biological factor with anticellular activity on neoplastic cell lines. An activity identified as lymphotoxin and derived from nine train-stimulated lymphocytes is associated with a spectrum of cytotoxic activities ranging from cytostasis of certain tumor cell lines to pronounced cytolysis of other transformed cells. However, lymphotoxin activity is characterized by little or no anticellular activity on tested primary cell cultures and normal cell lines. This putative distinguishing anti-cellular property of lymphotoxin led to in vivo studies suggesting that lymphotoxin may have potent antitumor activity.

Lymphotoxin is the term used for what has been described as a family of molecules. Lympho-toxin molecules have been identified as glycoproteins divided into 5 molecular weight classes, each in turn heterogeneous in charge. The human α- (molecular weight 250000-90000) and β- (molecular weight 25000-50000) classes are found to be overweight in most lymphocyte supernatants. The α-molecular weight class can be separated after loading into at least 7 subclasses, while the β-molecular weight class has been separated into 2 different subclasses 30 (G. Granger et al., in Mozes et al., ed., 1981, Cellular

Responses to Molecular Modulators, pages 287 - 310). Complex (molecular weights> 200000) and γ (molecular weights 10000 - 20000) lymphotoxin forms have also been identified. The different lymphotoxin forms and classes ad- differ in their stability and kinetics of occurrence in culture. Furthermore, various forms and classes of lymphotoxin molecules may also tend to aggregate or form multimers with the 5 complex class under low ionic strength conditions.

The lower molecular weight lymphotoxin classes have been reported to be relatively unstable and weakly cell lytic compared to the higher molecular weight classes (Hirserodt et al., 1980 Biochemical Characterization 10 of Lymphokines, pp. 279 - 283). The activity of the γ class has not been extensively studied because of its instability (G. Granger et al., 1978 "Cellular Immunology" 38: 388-402). The β-class has also been reported to be unstable (Walker et al., "J. of Immun." 116 [3]: 807 -15815) [March 1976].

It should be understood that the lymphokine terminology is not uniform. Currently, the names given to cell culture products are largely a function of the cells that are believed to produce the product and the behavior of the products in 20 biological tests. However, these products remain largely poorly characterized because many studies have been conducted with partially pure preparations and because the tests used to characterize the products are not molecular specific and in each case subject to considerable variation. The true identity of the various cytotoxic factors will remain unknown in the absence of a standard terminology based on clearly verifiable distinguishing properties, such as amino acid sequences or immune epitopes. Examples of 30 other names given to cytotoxic cell culture products include tumor necrosis factor, cytotoxic NK cell factor, hemorrhagic necrosis factor and macrophage cytotoxin or cytotoxic macrophage factor.

DK 172382 B1 In US Patent Application No. 608,316, filed May 7, 1984, and EP Publication No. 100,641 A, disclosed amino acid sequences for a human lymphotoxin isolated from the human lymphoblastoid cell line RPMI-1788.

5 EP Publication No. 132 125 A describes the recovery of a protein from a rabbit after stimulation of its reticuloendothelial system. The protein was reported to have antitumor activity and the N-terminal amino acid sequence Ser-Ala-Ser-Arg-Ala-Leu-Ser-Asp-Lys-Pro-10 Leu-Ala-His-Val-Val-Ala-Asn -Pro-Gln-Val-Glu-Gly-Gln-seu-Gln-Trp-Leu.

U.S. Patent Application No. 628,059, filed July 5, 1984, discloses purification and recombinant synthesis of a cytotoxic human polypeptide identified as tumor necrosis factor and with the N-terminal amino acid sequence Val-Arg-Ser-Ser-Ser-Arg -Thr-Pro-Ser-Asp-Lys-Pro-Val-Ala-His-Val-Val-Ala-Asn-Pro.

U.S. Patent No. 4,481,137 discloses the recovery of a 7000-9000 molecular weight substance called CBX3 from 20 BALL-1 cell culture, which suppresses the growth of tumor cells and has an Ala-Ala-N terminus.

According to Toth and Granger, "Mol. Immune." U. S.: 671-679 (1979), neither the removal of sialic acid from lymphotoxin-containing lymphocyte supernatants by neuraminodase treatment nor the addition of N-acetylglycosamine, galactose, lactose, mannose, α-methylmannoside, or fucose to the supernatants had no effect. in vitro lytic activity. Toth et al. thus concluded that simple sugars do not appear to play a role in the activity of their lymphotoxin. However, Toth et al. also, saccharides play an important role in the action of other lymphokines, and concluded that they could not exclude the involvement of crude complicated forms of oligosaccharides in the cytotoxic activity of lymphotoxin.

Later, Proctor, Klostergaard and Granger ("Clinical Research", 1982, 20. (1): 55A) reported that human lymphocytes when activated by PHA in the presence of tunicmycin (to inhibit the addition of N-linked carbohydrate moieties for lymphotoxin molecules), released biologically inert lymphotoxin. According to these authors, immunochemical studies revealed that while the carbohydrate moiety of lym-10 photoxin was not required for its transport and release of the activated lyophocyte to the supernatant, the carbohydrate was necessary to obtain effective target cell destruction because the carbohydrate was responsible for the appropriate lyro-photoxin molecule. conformation.

Other literature providing general background information for this invention includes Evans, "Cancer Immunol. Immunother." 12: 181-190 (1982); Lee et al., "Cell. Immune." 42: 166-118 (1979); The Week et al., Ed., (1980) Biochemical Characterization of Lymphokines, pp. 279-20312; Khan et al. Oath. (June 30, 1982) Human Lymphokines, pp. 459 - 477; Aggarwal et al., Presentation at the 3rd International Lymphokine Workshop in Haverford, PA., August 1 - 5, 1982; Ransom et al., "Cancer Research" 43: 5222-5227 (Nov. 1983); Kuli et al., "J. Immun." 126 (4) ϊ 25 1279 - 1283 (April 1981); J. Sawada et al., "Jpn. J. Exp.

Med. "42 * 263-267 (1976); G. Granger et al.," Cell. Immunol. "22: 388-402 (1978); J. Rundelle et al.," Immunopharmacology "2: 9-18 (1981); G. Granger et al.

"J. Lymphokine Res." i: 45-49 (1982); N. Ruddle et al., "Lymphokine Res." 2: 23-31 (1983); M. Mitsuhashi et al., GB Publication No. 2 106 117; H. Enomo-to, EP Publication Publication No. 87 A; B. Williamson et al., "P.N.A.S. USA" M: 5397-5401 (1983) and S. Wright et al., "J. Immunol. "126: 1516-1521 (1981).

DK 172382 B1 5

Lymphotoxi.net (or substances identified as lymphotoxin) previously obtained from lymphocyte culture are present in low concentrations of the order (0.05 - 2) X 10 6 units / l of supernatants of RPMI-1788 cell-5 clay or primary lymphocytes. The amounts harvested often vary considerably and primary lymphocytes are expensive. An economical method for the preparation of lymphotoxin is needed (Yamamoto et al., "J. of Biological Response Modifiers" jj: [1] 76-87 [1984).

10 Previous methods have also failed to produce lymphotoxin, which is homogeneous in amino acid sequence, an important feature of drug applications. Lymphotoxin derived from cell line culture exhibits amino-terminal heterogeneity, probably due to proteolytic processing (see above U.S. Patent Application no.

608 316). Cultures of primary lymphocytes, e.g. from adenoids or peripheral blood, must necessarily contain the cells of many donors for financial reasons. However, the products of these cells will reflect genetic variation among the donors, so that the resulting "lymphotoxin" may actually be a mixture of allelic species. It is clear that the quantities and identities of such alleles will be unknown from batch to batch.

There is a need for a process for producing lymphotoxin which is uniform in its amino acid sequence.

The prior methods are also limited to the preparation of lymphotoxin with primary amino acid sequences similar to those found in nature. Replacement, deletion or insertion of various amino acids into these sequences would require extensive and costly chemical modifications, if at all possible. Methods are needed for easy introduction of variations in amino acid sequences of lymphotoxin.

DK 172382 B1 6

Although the antitumor effects and apparent therapeutic value of lymphotoxin activity have been reported in the literature since 1968, lymphotoxin has not been studied by extensive clinical trials or commercialized due to the small amounts and heterogeneous nature of the lymphotoxin. which was available through the known methods. Methods are needed to economically prepare amounts of lymphotoxin sufficient for clinical studies.

Rabbit antisera have been described in the literature which are capable of neutralizing the cytolytic activity of various cytotoxins, including substances identified as lymphotoxin (Yamamoto et al. "Cell. Immun." IS: 403-1515 (1978)); Gately et al., "Cell. Immun." 27: 82-93 (1976); Hirserodt et al., "J of Immun." 119 (2): 374-380 (1977); Zacharchuk et al., PNAS USA "M * 6341-6345 (October 1983); Ruddle et al.," Lymphokine Research "2. (1) 23-31 (1983); Mannet et al.," Infection and Immunity "20 ϋ (1)! 156 - 164 (1981); Wallach et al., In E. De Maeyer et al.: The Biology of the Interferon System, pp. 293-302 (ed. September 1983) and Stone-Wolff et al., " J. Exp. Med. "159: 828-843 (March 1984). As this antiserum is polyclonal, it contains a plurality of 25 antibodies directed against the immunogenic lymphotoxin. Each or more of these antibodies act to neutralize" lymphotoxin "- In addition, the literature reports are commonplace is unclear as to the molecular identity of the drug responsible for lymphotoxin activity used as the immunogen. What is needed for diagnosis and immunoaffinity purification procedures is a monospecific antibody directed to a clearly and unambiguously identified lymphotoxin molecule.

DK 172382 B1 7

It is one of the objects of this invention to provide such an antibody.

It is a further object of the invention to provide methods for economically synthesizing a lymphotoxin information in a composition wherein the primary amino acid sequence of substantially all the lymphotoxin molecules is the same.

It is another object of the invention to provide predetermined variations in the amino acid sequence of a lyme photoxinform, more specifically amino acid deletions, insertions, substitutions or combinations thereof, to obtain lymphotoxin derivatives with cytotoxic activity.

Summary of the Invention These objects are achieved through the successful recombinant expression of protein with lymphotoxin activity. This lymphotoxin species, described in this specification by its activity and natural or variant amino acid sequence, is hereinafter referred to as lymphotoxin. Surprisingly, the DNA encoding lymphotoxin has been identified regardless of the small amounts of lymphotoxin expressed in homologous cells, and the uncertainty as to the time at which mRNA encoding lymphotoxin appears in homologous cells . Also surprisingly, 25 biologically active lymphotoxin has been expressed in recombinant cells that do not glycosylate the lymphotoxin (or would not be expected to do so in the same way as homologous cells), and the lymphotoxin thus expressed is recovered with a substantially uniform amino acid sequence, 30 without N-terminal enzymatic hydrolysis. DNA encoding lymphotoxin is expressed in cell cultures in copious amounts exceeding (0.1 - 1) x 1011 units per cell. liters of culture lysate.

DK 172382 B1 8

The lymphotoxin expressed by a recombinant host cell will depend on the DNA used to encode the lymphotoxin or its precursors, as well as the host cell of choice. The nucleic acid sequences used herein for lymphotoxin synthesis are novel. They are characterized by nucleotide sequences that differ from the native or natural sequence in one or more of the following ways: The DNA is free of introns, in the case of human lymphotoxin, the intron located between nucleotides 284 and 285 ( Fig. 2A); The DNA is free of nucleic acid which encodes other proteins in the organism from which the DNA originated; the nucleic acid encoding lymphotoxin is ligated into a vector; and / or the nucleic acid is capable of hybridizing to nucleic acid encoding lymphotoxin, however, provided that such hybridizing nucleic acid does not have the nucleotide sequence of natural DNA or RNA encoding lymphotoxin.

Mutant nucleic acids encoding lymphotoxin are the product of recombinant manipulations. Silent mutations in 5'-untranslated or -translated nucleic acid for glue photoxin are provided to increase expression levels in selected hosts, e.g. by reducing the likelihood of stem-and-loop mRNA structures in the 5 'regions of the nucleic acid, or by introducing host-preferred 25 codons instead of those found in natural nucleic acid isolates.

Mutations in the nucleic acids, which are expressed instead of being silent, allow the preparation of lymphotoxin derivatives with the amino acid sequence of native lymphotoxin or its primary sequence derivatives with amino acid sequences different from the native lymphotoxin. The lymphotoxin or lymphotoxin derivative is recovered as such or further processed by the host cell to obtain the desired lymphotoxin derivative.

DK 172382 B1 9

These nucleic acids or nucleic acids that hybridize therewith, or fragments thereof, may also be labeled and used in hybridization tests to identify or determine genetic material encoding lymphotoxin.

By methods of synthesis of lymphotoxin, DNA encoding lymphotoxin is ligated into a vector, the vector is used to transform host cells, host cells are grown, and lymphotoxin is extracted from the culture. This general method is used to synthesize lymphotoxin with the amino acid sequence of native lymphotoxin or to construct novel lymphotoxin derivatives, depending on the vector construct and host cell selected for transformation. The lymphotoxin species which can be synthesized according to this specification include leucyl amino-terminal lymphotoxin, histidyl-amino-terminal lymphotoxin, pre-molphotoxin and lymphotoxin derivatives, including (a) fusion proteins in which a heterologous protein or polypeptide is linked via a peptide bond. (B) lymphotoxin fragments, especially fragments of pre-photphotoxin, wherein any amino acid between -34 and +23 is the amino-terminal amino acid of the fragment, (c) lymphotoxin derivatives in which one or more amino acid residues are replaced, inserted or part-ether. , (d) methionyl or modified-methionyl- (such as formylmethionyl or other blocked methionyl species) amino-terminal derivatives and / or (e) unglycosylated or differently glycosylated species of all the aforementioned.

If a mammalian cell is transformed with nucleic acid encoding lymphotoxin operably ligated to a eukaryotic secretory leader (including the native secretory leader of lymphotoxin, or if nucleic acid encoding lymphotoxin is operably ligated in a vector to a SE-DK 172382 B1 cretoric leader from a prokaryotic organism or yeast recognized by the host cell to be transformed (usually the organism from which the leader sequence was obtained), and the host is transformed with the vector and cultured, then the non-amino-terminally methylated lymphotyme is usually recovered. from the culture.

If DNA encoding lymphotoxin is operably ligated into a vector without a secretory leader sequence and then used to transform a host cell, the lymphotoxin derivatives synthesized are usually substituted with an amino-terminal methionyl or modified methionyl residue. , such as formylmethionyl.

Methods are provided whereby in vitro mutagenesis of the nucleic acid encoding lymphotoxin leads to expression of lymphotoxin derivatives which have not been available so far.

First, N-terminal methionyl or modified methionyl-lymphotoxin is expressed by host cells transformed with lymphotoxin-coding nucleic acid, which is expressed directly, i.e. which is not operably linked to a secretory leader sequence.

Second, in vitro, site-specific, predetermined or random mutagenesis is used to introduce deletions, replacements and / or insertions into the nucleic acid encoding lymphotoxin. Lymphotoxin infusions are produced in this way. The lymphotoxin derivatives obtained by expression of mutant nucleic acid exhibit modified properties.

Finally, unglycosylated or variably glycosylated lymphotoxins are provided as novel lymphotoxin derivatives. Uglycosylated lymphotoxin is produced by prokaryotic expression of DNA that encodes the lymph-17x382 photoxin. In varying ways, glycosylated lymphotoxin derivatives are the product of recombinant culture in transformed higher eukaryotic, usually mammalian, cells.

The lymphotoxin produced here is purified from culture supernatants or lysates by immunoaffinity adsorption using insolubilized lymphotoxin neutralizing antibody. This antibody, most efficiently produced in monoclonal cell culture, is produced in mice by immunization with alum-adsorbed lymphotoxin.

The lymphotoxin derivative of the invention is combined for therapeutic use with physiologically harmless stabilizers and excipients and prepared in sterile dosage form, e.g. by lyophilization in dosing ampoules or storage in stabilized aqueous preparations. Alternatively, the lymphotoxin derivative is incorporated into a polymer matrix for implantation into tumors or surgical sites from which tumors have been excised, thereby producing a timed release of the lymphotoxin derivative at a localized high gradient concentration.

The present therapeutic compositions are administered at therapeutically effective doses by implantation, injection or infusion to animals, including humans carrying malignant tumors.

Brief Description of the Drawings 25 FIG. Figure 1A depicts a DNA sequence and its associated amino acid sequence, the DNA sequence encoding a lymphotoxin fragment.

FIG. 1B shows the construction of synthetic DNA encoding the fragment of FIG. 1A.

DK 172382 B1 12

FIG. Figure 2A shows the complete amino acid sequence of pre-photoxin, its code DNA plus 5 'and 3' flanking untranslated regions.

FIG. Figure 2B illustrates a method for constructing an expression vector for methionyl-leucyl-ara-terminal lymphotoxin and its amino-terminal methionyl-derivatives.

FIG. 3 shows a method for constructing an expression vector for methionyl-histidyl-amino-terminal lymphotoxin.

FIG. 4 depicts the amino acid sequences of the human, mouse and bovine lymphotoxin and mammalian lymphotoxin consensus residues.

FIG. 5A and 5B depict the construction of a plasmid encoding a fusion of lymphotoxin and a bacterial signal sequence.

Detailed description

For the purposes of this invention, lymphotoxin is defined as a biologically active polypeptide having a region showing substantial structural amino acid homology with at least a portion of that of FIG. 2A shows the lymphotoxin amino acid sequence. Biological activity is defined as preferably cytotoxic activity as defined below, immunological cross-reactivity with a cytotoxic lymphotoxin or the ability to compete with cytotoxic lymphotoxin on lymphotoxin cell surface receptors. In the latter two cases, the lymphotoxin need not be cytotoxic per se. Immunologically cross-reactive mutants are useful as immunogens for producing antilymphotoxin in animals, e.g. for the preparation of immunoassay reagents, with its non-cytotoxic competing mutants, use as labeled reagents in immunoassays of competitive type for biologically active lyrophotoxin.

Preferably, cytotoxic activity is defined as the preferential destruction or growth inhibition of tumor cells in vivo or in vitro compared to normal cells under the same conditions. Destruction of tumor cells by bright in vitro or in vivo necrosis is the preferred assay endpoint, although cytostasis or anti-proliferative activity is also used satisfactorily.

Suitable tests for detecting the anti-cellular activities of lymphotoxin are described in B. Aggarwal et al., 1984, MJ. Biol. Chem. "259 (1), 686-691, and E. Carswell et al., 1975," Proc. Natl. Acad. Sci. USA 72, 3666-3670.

Lymphotoxin-specific activity is defined in this specification with requirements by target cell lysis rather than by cytostasis.

A unit of lymphotoxin is defined as the amount required for 50% lysis of target cells seeded plate in each hole as further described in Example 1. However, other methods of determining cytotoxic activity are acceptable.

Significant structural homology generally means that more than ca. 60%, and usually more than approx. 70% of the amino acid residues in the polypeptide are the same or conservative substitutions for the corresponding residues in the sequence of FIG. 2A.

Not the entire sequence of a lymphotoxin polypeptide need be homologous to the sequence of FIG. 2A. Only one portion thereof need be homologous to any portion of the sequence of FIG. 2A, as long as the candidate exhibits the required biological activity. In general, homology should be detectable for ranges of from about 20 to about 100 amino acid residues, recognizing that there may occasionally be gaps to maximize homology.

Less homology is required for polypeptides to fall within the definition if the region of homology with the sequence of FIG. 2A is not in one of the lymphotoxin key regions, i. areas important for cytotoxic activity. The key regions of the sequence of FIG. 2A is believed to be about 162 - 171, 52 - 83 and 127 - 148.

Lymphotoxin is defined to specifically exclude human tumor necrosis factor or its natural animal analog (D. Pennica et al., "Nature" 312; December 20/27, 1984, pp. 724-729 and B. Aggarwal et al., " J. Biol. Chem. "260 (4): 2345-2354 [1985]).

"Structurally similar" refers to dominant properties of the amino acid side chains, such as basic, neutral or acidic, hydrophilic or hydrophobic, or the presence or absence of steric backfill. Replacement of one amino acid with a structurally similar one is generally known in the art as a conservative substitution.

A significant factor in establishing the identity of a polypeptide as lymphotoxin is the ability of antisera capable of substantially neutralizing the cytolytic activity of substantially homogeneous, lymphoblastoid (or natural) lymphotoxin, to also substantially neutralizing the cytolytic activity of the polypeptide in question. However, it will be appreciated that immunological identity and cytotoxic identity do not necessarily have the same extent. If a neutralizing antibody for the lymphotoxin of FIG. 2A is optionally directed to a site of the lymphotoxin which is merely adjacent to a region critical for the cytotoxic activity of the lymphotoxin, so that it acts as a neutralizing antibody by sterically inhibiting the lymphotoxin-active site, DK 172382 B1 15 does not need to bind a candidate protein. A candidate protein mutated in this harmless region may no longer bind the neutralizing antibody, but it would nonetheless be lymphotoxin for substantial homology and biological activity.

Lymphotoxin obtained by action of lymphoblastoid cell lines has been determined to have the following properties: a molecular weight of 20,000 or 25,000 depending on the degree of glycosylation and N-terminal heterogeneity; glycosylation 10 at Asn + 62 (Fig. 2A); a tendency to aggregate, especially to be organized into multimers; an isoelectric point of about 5.8; pH lability (loss of> 50% cytolytic activity when stored for 24 hours in ammonium hydrogen carbonate buffer at 10 ng / ml concentration with pH levels 15 of less than about 5 or greater than about 10); and significant losses in activity after incubation in aqueous solution for 5 minutes at 80 ° C. Two molecular weight species of lymphoblastoid lymphotoxin have been identified. 25,000 Since the nature of lymphoblastoid-lymphotoxin has an amino terminal 20 leucine residue. 25,000 polypeptides Since the species' primary amino acid sequence is called leucil amino-terminal lymphotoxin. 20,000 Since the nature of lymphoblastoid-lymphotoxin is characterized by an amino-terminal histidine residue and corresponding sequences are referred to as histidyl-amino-terminal lym-photoxin. It is important to note that these properties describe the native or wild-type human lymphotoxin obtained from lymphoblastoid cell cultures. Although the lymphotoxin as defined in this specification of claim does not include native glycosylated lymphotoxin, other related cytotoxic polypeptides may fall within the scope of the definition. Eg. For example, the glycosylation commonly associated with an animal lymphotoxin can be modified by expression in a heterologous recombinant eukaryotic host cell, whereby the modified lymphotoxin 35 is brought outside the molecular weights or isoelectric point determined for human lymphoblasts. Lympho-toxin. Lymphotoxin, which is completely unglycosylated, is produced in recombinant bacterial culture with its molecular weight, isoelectric point and other properties modified accordingly. In addition, post-translational processing of pre-elimphotoxin from a first animal species into a cell line derived from a second animal species may result in a different amino-terminal residue than is usually the case for the first animal species. Similarly, in this specification, the claimed mutagenic procedures may e.g. enable one to vary the amino acid sequence and N-terminus of lymphotoxin, thereby modifying the pH stability, the isoelectric point and the like.

The translated amino acid sequence of human lymphotoxin 15 is described in FIG. 2A. Note that this sequence includes a precursor of 34 residues which are believed to be removed during normal processing of the translated transcript in human cells (in this description with claims together with derivatives thereof termed "pre-molphotoxin"), resulting in the leucyl amino terminus. nature. The histidyl amino-terminal species is homologous to the leucyl-amino-terminal species, except for the first 23 amino acids of the leucyl-amino-terminal species are missing. All three species, viz. pre-elimphotoxin, leucyl amino-terminal lymphotoxin and histidyl-amino-terminal lymphotoxin, as well as their methionyl, modified-methionyl, mutant and uglycosylated forms are included in the scope of lymphotoxin. The unglycosylated leucyl and histidyl amino terminal species will have lower molecular weights than described above for the homologous species from lymphoblastoid cells.

Promlymphotoxin is a species of lymphotoxin which is included in the above definition. It is characterized by the presence of a signal (or leader J polypeptide) at the amino terminus of the molecule. Generally, the native signal polypeptide of lymphotoxin is proteolytically derived from lymphotoxin as part of the secretory process whereby the protein can be secreted from the cell. be microbial or mammalian (including the native residue of 34 residues), but it is preferably a signal homologous to the host cell. Some signal lymphotoxin fusions are not recognized or "processed" by the host cell into N-terminal Met-free Such fusions containing microbial signals are useful, for example, as lymphotoxin immunogens.

Note that the use of "capable of exerting" cytotoxic activity means that lymphotoxin includes convertible polypeptides, e.g. by enzymatic hydrolysis, from an inactive state analogous to a zymogen to a polypeptide fragment which exerts the desired biological activity. The language "capable of exerting" in vitro or in vivo cytotoxic activity is understood to include non-cytotoxic polypeptides which can be converted, e.g. by enzymatic hydrolysis, from an inactive state analogous to a zymogen to a polypeptide fragment which exerts the definitive biological activity. Typically, inactive precursors will be fusion proteins in which lymphotoxin is linked by a peptide bond at its carboxyl terminus to another protein or polypeptide. The sequence of this peptide bond or close is selected such that it is susceptible to proteolytic hydrolysis to release lymphotoxin, either in vivo or, as part of a production regulation, in vitro. Typical linking sequences are Lys-Lys or Arg-Lys. The non-lymphotoxin component of such prolymphotoxin is preferably a homologous protein to minimize the immunogenicity of the fusion. The homologous protein should be harmless and not bind to cell surfaces. The lymphotoxin thus formed will then exert the cytotoxic activity required by definition.

DK 172382 B1 18

Although lymphotoxin generally means human lymphotoxin, lymphotoxin from sources such as mice, pigs, horses or oxen is included in the definition of lymphotoxin, as long as it meets the above-described standards for homologous regions and biological activity. For example, bovine and mouse lymphotoxins have been shown to be strongly (about 80%) homologous to human lymphotoxin. Lymphotoxin is not species specific, e.g. is human lymphotoxin active on mouse tumors and neoplastic cell lines. Therefore, lymphotoxin from one species can be used for the therapy of another.

Lymphotoxin also includes multimeric forms. Lymphotoxin spontaneously aggregates into multimers, usually dimers or higher multimers. Multimers are cytotoxic and, accordingly, suitable for use in in vivo therapy. Lymphotoxin is expressed in recombinant hosts as monomer. However, lymphotoxin then tends to spontaneously form multimers. Homogeneous multimers or a mixture of different multimers are therapeutically useful.

Lymphotoxin derivatives include predetermined or targeted, i.e. site-specific mutations of the molecule of FIG. 2A or its fragments. Lymphotoxin derivatives are defined as polypeptides which otherwise meet the defined requirements for lymphotoxin properties, but are characterized by an amino acid sequence different from that of FIG. 2A, whether for deletion, replacement or residue insertion. The non-human lymphotoxins and alleles of human lymphotoxin described herein are to be considered as lymphotoxin derivatives as are 30 site-directed mutants without any natural counterpart. The purpose of mutagenesis is to construct DNA which encodes lymphotoxin as defined above, but which exhibits properties that modify the biological activity of natural lymphotoxin or facilitate the production of lymphotoxin. Eg. the lysine codon +89 is mutated to express a histidine residue instead of the lysine residue. The histidine residue +89 is no longer hydrolyzed by trypsin (which normally cleaves proteins by an Arg-X or Lys-X bond).

Protease resistance is expected to add greater biological half-life to the mutant than is the case for lymphotoxin with the sequence of FIG. 2A (or a fragment thereof). Other lymphotoxin-lysine or arginine residues may be mutated to histidine, e.g. lysine +28, lysine +19 or arginine +15.

As discussed above, certain regions of the lymphotoxin molecule exhibit substantial homology to a similarly active protein termed tumor necrosis factor. Amino acid residues in and immediately flanking these homologous regions are favored for mutagenesis aimed at identifying lymphotoxin derivatives exhibiting variant biological or cytotoxic activity. Such derivatives are produced by methods known per se, and then screened for the desired biological activity, e.g. increased cytotoxicity to the particular neoplasm being treated, or in the case of lymphotoxin derivatives intended for immunizing animals the ability to trigger a stronger immune response. Examples of such lymphotoxin derivatives are as follows: Ala +168 is mutated to a branched amino acid (Val, 25 Ile or Leu); a hydrophobic amino acid (e.g., Phe, Val,

Ile or Leu) is inserted between Thr +163 and Val +164; tyrosine is introduced in place of Thr +163; lysine is introduced instead of Ser +82; isoleucine, leucine, phenylalanine, valine or histidine are introduced in place of Ser +42; gluten-30 minutes, tryptophan, serine or histidine are introduced in place of Lys +84; Ser +82 is deleted; a hydrophobic di- or tripeptide is linked to Leu +171; aspartic acid or lysine is introduced in place of Thr +163; Ala-Lys is inserted between Glu +127 and Pro +128; lysine or glycine is introduced in place of Ser +70; tyrosine is introduced instead of Thr +69; Arginine or histidine is introduced in place of Lys +28; arginine or lysine is introduced instead of His +32; proline, serine, threonine, tyrosine or glutamic acid are introduced instead of Asp +36; tyrosine, methionine or glutamic acid 5 is introduced in place of Ser +38; threonine, tyrosine, histidine or lysine are introduced in place of Ser +61; aspartic acid, serine or tyrosine is introduced in place of Gly +124; arginine, lysine, tyrosine, thryptophane or proline are introduced instead of His +135; aspartic acid is introduced in place of Thr + 142; and lysine or threonine is introduced instead of Gin + 146.

A particularly desirable group of derivatives are those wherein the methionine residues +20, +120, and +133 in human lymphotoxin are deleted or, preferably, replaced by the corresponding residues found in the lymphotoxins of other species, as described elsewhere in this description with claims.

P.eks. Met +20, +120 and +133 are replaced by threonine, serine and valine respectively. These are the corresponding residues in bovine lymphotoxin. The replacement is produced in the manner described in Example 9, except that Met +133 is mutated to Val by a further mutagenesis step using M13 Mp8 phage according to methods known per se. This mutant animal-hybrid glue photoxin DNA is used in place of the leucyl amino-25 terminal DNA of Example 7 and is expressed as a fusion. According to known procedures, cyano bromide is used to cleave the STII signal from the hybrid lymphphotoxin and the mature leucyl amino terminal lymphotoxin derivative is recovered.

Other useful lymphotoxin derivatives are those in which tumor necrosis factor residues 30 are introduced in place of corresponding lymphotoxin residues to form hybrid tumor necrosis factor-lymphotoxin derivatives. A representative example is the introduction of the first 8, 9 or 10 residues of mature tumor necrosis factor (e.g., Val-Arg-Ser-Ser-Ser-DK 172382 B1 21

Arg-Thr-Pro-Ser-Asp-) instead of the first 27 residues of leucyl amino-terminal lymphotoxin. This derivative is more likely to be N-terminal demethionylated after direct expression in E. coli.

5 Although the mutation site is predetermined, it is unnecessary for the mutation itself to be predetermined. Eg. is performed to optimize the appearance of histidine +89 lymphotoxin mutant random mutagenesis by the codon of lyin +89, and the expressed lymphotoxin mutants are screened for the optimal combination of cytotoxic activity and protease resistance.

Lymphotoxin may also contain inserts, usually on the order of from 1 to about 10 amino acid residues, or deletions of from 1 to about 30 residues.

15 Replacements, deletions, inserts or any subcombination can be combined to reach a final construction. Insertions include amino or carboxyl terminal fusions, e.g. a hydrophobic extension added to the carboxyl terminus. Preferably, however, only replacement mutagenesis is performed. It is clear that the mutations in the coding DNA must not bring the sequence out of the reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Extracts of E. coli transformed with vectors containing DNA encoding lymphotoxin derivatives with a deletion of the last 16 carboxyl terminal amino acids or deletion of the first ca. 33 amino-terminal residues in leucyl-amino-terminal lymphotoxin showed no cytotoxic activity. However, the reasons for lack of activity 30 are unknown and could have been any of those listed in Example 1 below.

Not all mutations in the DNA encoding lymphotoxin will be expressed in the final product of recombinant cell culture. Eg. a predominant class of DNA substitution mutations is those DNAs in which a second secretory leader has been inserted in place of the secretory leader of FIG. 2A, either by deletions in the residue of the conductor 34 or by replacements that replace most or all of the native leader with a leader more likely to be recognized by the intended host. Eg. in constructing a prokaryotic expression vector, the secretory leader of FIG. 2A in favor of the leader of bacterial alkaline phosphatase or thermostable enterotoxin II, and for the yeast, the leader of FIG. 2A in favor of the yeast invertase, α-factor or acid phosphatase leader. However, this does not mean that the human secretory leader is not recognized by 15 hosts other than human cell lines. When the secretory leader is "recognized" by the host, the fusion protein consisting of lymphotoxin and the leader is usually cleaved by the leader peptide binding in the same event leading to secretion of the lymphotoxin. Thus, although a mutant DNA is used to transform the host, the resulting product may be either a linked or native lymphotoxin, depending on the efficiency of the host cell in processing the fusion.

Another predominant class of DNA mutants that are not expressed as lymphotoxin derivatives are nucleotide replacements made to enhance expression, primarily by avoiding stem loop structures in the transcribed mRNA (see parallel US patent application no. 303,687, which is considered to be incorporated by reference herein) or to provide codons which are more readily transcribed by the selected host, e.g. the well-known E. coli preference codons for E. coli expression.

The mutant nucleic acid is prepared by methods known per se (A. Hui et al., 1984, "The EMBO Journal" DK 172382 B1 23 2 (3): 623-629; J. Adelman et al. 1983, "DNA" 2 (3 ): 183- 193; GB Publication No. 2,130,119 A; G. Winter et al., 1982, "Nature" 299: 756-758; and R. Wallace et al., 1981 "Nucleic Acids Research" 9. ( 15): 3647-3656).

These methods include M13 phage mutagenesis, synthesis of the mutant-lymphotoxin gene as described in Example 1 and on or other methods which are or will be known in the art.

Nucleic acid encoding lymphotoxin is any DNA-10 or RNA sequence encoding a polypeptide that falls within the definition of lymphotoxin in this specification, with claims whether their nucleotides correspond to sequences found in nature, or not. In addition, to the extent described herein is included nucleic acid capable of hybridizing under at least low-stringency conditions to nucleic acid encoding lymphotoxin, even if the hybridizing nucleic acid does not encode a protein that otherwise meets the definition requirements for lymphotoxin. An example of the latter 20 would be a probe which, due to the short length of polypeptide it encodes, is unable to express a biologically active lymphotoxin. The nucleic acid encoding lymphotoxin or capable of hybridizing therewith is produced by organic synthesis, substantially as shown in Example 1, or obtained from natural sources by probing genomic or cDNA libraries as shown in the Examples.

The lymphotoxin derivative of the invention is prepared by a method which generally involves the transformation of a host with a vector bearing the nucleic acid encoding the desired lymphotoxin derivative. A vector is a replicable DNA construct. Vectors are used in this specification with claims to amplify DNA or to express DNA encoding lymphotoxin. An expression vector is a DNA construct in which a DNA sequence encoding lymphotoxin is operably linked to a suitable control sequence capable of producing expression of lymphotoxin in a suitable host. Such control sequences include a transcription promoter, an optional operator sequence for directing the transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences controlling the completion of transcription and translation.

The vector may be a plasmid, a virus, (including phage) or an integrable DNA fragment (i.e., integral into the host genome by recombination). Once transformed into a suitable host, the vector replicates and functions independently of the host genome or, in some cases, can be integrated into the genome itself. In the present description of claims, "plasmid" and "vector" are sometimes used as optional, as the plasmid is currently the most commonly used form of vector. However, all other forms of vectors which serve an equivalent function and are known or known in the art are suitable for use herein.

Suitable vectors will contain replicon and control sequences derived from species compatible with the intended expression host. Transformed host cells are 25 cells that have been transformed or transfected with lymphotoxin vectors constructed using recombinant DNA technique. Transformed host cells commonly express lymphotoxin. The expressed lymphotoxin will be deposited intracellularly or secreted into either the periplasmic compartment or the culture supernatant, depending on the host cell selected.

DNA regions are operably linked when they are functionally dependent on each other. Eg. is the DNA of a preceptor DK 172382 B1 or secretory leader operably linked to the DNA of a polypeptide if expressed as a preprotein participating in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is arranged to enable translation. Generally, operably connected means continuous in one and in the case of secretory conductors means continuous in one in the reading phase.

Suitable host cells are prokaryotes, yeasts or higher eukaryotic cells. Prokaryotes include Gram-negative or Gram-positive organisms, e.g. E. coli or Bacil li. Higher eukaryotic cells include established mammalian cell lines as described below. A preferred host cell is the phage-resistant E. coli W3110 (ATCC 27,325) strain described in the Examples, although other prokaryotes such as E. coli B, E. coli X1776 (ATCC 31537), E. coli 294 (ATCC 31 446), Pseudomonas species or Serratia marcescens are suitable.

Prokaryotic host vector systems are preferred for the expression of lymphotoxin. An abundance of suitable microbial vectors is available. Generally, a microbial vector will contain a replication origin recognized by the intended host, a promoter that will function in the host, and a phenotypic selection gene, e.g. a gene that encodes proteins that transmit antibiotic resistance or add an auxotrophic requirement. Similar designs will be made for other hosts. E.

Typically, 30 coli are transformed using pBR322, a plasmid derived from an E. coli species (Bolivar et al., 1977, "Gene" 2: 95). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells.

DK 172382 B1 26

Expression vectors may contain a promoter recognized by the host organism, but cloning vectors do not need this. The promoter is generally homologous to the intended host. Promoters most commonly used in recombinant DNA construction include the β-lactamase (penicillininase) and lactose promoter systems (Chang et al., 197 8, "Nature", 275: 615; and Goeddel et al., 1979, Nature 281: 544). a tryptophan (trp) promoter system (Goeddel et al., 1980, "Nucleic Acids Res. 8: 405710 and EP Publication No. 36,776) and the tac promoter [H. De Boer et al., "Proc. Nat'l. Acad. Sci. U.S.A." 80: 21-25 (1983)]. Although these are the most commonly used, other known microbial promoters are suitable. Details of their nucleotide sequences 15 have been published, enabling one of skill in the art to operably ligate them to DNA encoding lym-photoxin in plasmid vectors (Siebenlist et al., 1980, "Cell" 2Q. 269) and the DNA. , which encodes lymphotoxin. Presently, the preferred vector is a BR322 derivative containing the alkaline phosphatase promoter with the trp-Shine-Dalgarno sequence from E. coli. The promoter and the Shine-Dalgarno sequence are operably linked to the DNA encoding the lymphotoxin, ie. they are arranged to promote transcription of lymphotoxin mRNA from the DNA.

In addition to prokaryotes, eukaryotic microorganisms, such as yeast cultures, are transformed with lymphotoxin coding vectors. Saccharomyces cerevisiae or common baking yeast is the most commonly used among lower eukaryotic host microorganisms, although a number of strains are commonly available. Yeast vectors will generally contain a replication origin of the 2 µm yeast plasmid or autonomously replicating sequence (ARS), a promoter, DNA encoding lymphotoxin (including in particular human pre-photoxin), polyadenylation and transcriptase sequences, and transcriptase terminals. a selection gene. A suitable plasmid for lymphotoxin expression in yeast is YRp7 (Stinchcomb et al., 1979, "Nature", 282: 39; Kingsman et al., 1979, "Gene", 2; 141; Tschemper et al., 1980, "Gene" , £ 2: 157). This plasmid already contains the trp1 gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, e.g. ATCC No. 44075 or PEP4-1 (Jones, 1977, "Genetics", £ 5: 12).

The presence of the trpl lesion in the yeast host cell genome 10 then provides an efficient environment for detecting transformation by growth in the absence of tryptophan.

Suitable promoter sequences in yeast vectors include the promoters of metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., 1980, "J. Biol. Chem", 255: 2073) or other glycolytic enzymes (Hess et al., 1978, "Biochemistry", 12 , 4900) such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase and phosphoglucose isomerase. Suitable vectors and promoters for use in yeast expression are further described in EP Publication Publication no.

73 657.

Other promoters which have the additional advantage that the transcription is controlled by growth conditions are the promoter regions of alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degrading enzymes associated with nitrogen metabolism and aforementioned metallothionein and glyceral dehyd-3-phosphate dehydrogenase as well as enzymes. , there are 30 responsible for maltose and galactose utilization. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3 'of the lymphotoxin coding sequence to provide polyadenylation of the mRNA and termination.

In addition to microorganisms, cultures of cells derived from multicellular organisms can also be used as hosts. However, this is not preferred because excellent results have so far been obtained with lymphotoxin-expressing microorganisms. In principle, any higher eukaryotic cell culture is usable, whether from vertebrates or invertebrates. However, interest has been greatest in vertebrate cells, and proliferation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years [Tissue Culture, Academic Press, Kruse and Patterson, editors (1973)]. Examples of useful host cell lines are VERO and HeLa cells, Chinese hamster ovarian (CHO) cell lines, and WI38, BHK, COS-7 and MDCK cell lines. Expression vectors for such cells generally include (if necessary) a replication origin, a promoter located above the gene to be expressed, along with a ribosome binding site, RNA splice site (if intron-containing genomic DNA is used), a polyadenylation site and a transcription termination sequence. .

The transcription and translation control sequences of expression vectors to be used in transformation of vertebrate cells are often provided by viral sources. Eg. are commonly used promoters derived from polyoma, Adenovirus 2 and, most preferably, monkey virus 40 (SV40). The early and late promoter are particularly useful because both are readily obtained from the virus as a fragment, which also contains the SV40 viral origin of replication (Fiers et al., 1978, "Nature", 273: 113). Smaller or larger SV40 fragments may also be used, provided that the sequence of about 250 bp extending from the HindIII site towards the BglII site located in the viral origin of replication is included. Furthermore, it is also possible, and often desirable, to use the human genomic promoter, control, and / or signal sequences normally associated with lymphotoxin, provided such control sequences are compatible with the host cell systems.

A origin of replication can be provided either by constructing the vector to include an exogenous origin, such as e.g. may be derived from SV40 or other viral (e.g., polyoma, adenovirus, VSV or BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient. Lymphotoxin is prepared without an amino terminal methionyl residue by transformation of higher eukaryotic cells with the 15 human pre-elimphotoxin DNA.

In selecting a preferred host mammalian cell for transfection with vectors comprising DNA sequences encoding both lymphotoxin and dihydrofolate reductase (DHFR), it is appropriate to select the host of the type of DHFR protein used. If wild-type DHFR protein is used, it is preferred to select a host cell deficient in DHFR, which allows the DHFR coding sequence to be used as marker for successful transfection in selective medium lacking hypoxanthine, glycine and thymidine. A suitable host cell in this case is the DHFR-deficient Chinese hamster ovary (CHO) cell line prepared and propagated as described by Urlaub and Chasin, 1980, "Proc. Natl. Acad. Sci." (USA) 77: 4216.

30 On the other hand, if DNA encoding low binding affinity DHFR protein for methotrexate (MTX) is used as the controlling sequence, it is not necessary to use DHFR resistant cells. Since the mutant DK 172382 B1 DHFR is resistant to MTX, MTX-containing media can be used as a means of selection, provided that the host cells are MTX sensitive in themselves. Most eukaryotic cells capable of absorbing MTX 5 are found to be methotrexate sensitive. One such useful cell line is a CHO line, CHO-KI (ATCC No. CCL 61).

Transformed host cells are cells that have been transformed or transfected with lymphotoxin vectors constructed using recombinant DNA technology.

Transformed host cells generally express lym-photoxin. The expressed lymphotoxin is usually deposited intracellularly.

Lymphotoxin is recovered from recombinant culture in non-secreting cells by lysis of the cells and removal of particulate material by centrifugation or the like. Lymphotoxin secreting cells are separated from the culture supernatant by centrifugation. The contaminated lymphotoxin solution is then purified by the methods discussed above or by immunoaffinity as described in Example 4 below. The lymphotoxin is purified to levels suitable for pharmacological use and applied in conventional dosage forms, e.g. ampoules, or needles. Mixtures of lymphotoxin derivatives are used, e.g. a bank of cytotoxic mutant-lymphotoxin derivatives. Lymphotoxin is best lyophilized for long-term storage or it can be placed in aqueous solution with stabilizers and excipients, e.g. isotonic saline, and administered to patients as disclosed by B. Aggarwal et al., EP Patent Application No. 100,641.

Lymphotoxin preparations are administered to tumor-bearing animals. The route of administration is in accordance with known methods, e.g. intravenous, intraperitoneal, subcutaneous, intramuscular, intravenous infusion or injection of sterile lymphotoxin solutions or by timed delivery systems as described below. Lymphotoxin is administered intralesionally, ie. by direct injection into solid tumors. In cases of disseminated tumors, such as leukemia, the administration is preferably done intravenously or in the lymphatic system. Tumors of the abdominal organs such as ovarian cancer are advantageously treated by intraperitoneal infusion using peritoneal dialysis equipment and peritoneum compatible solutions. However, lymphotoxin is generally administered continuously by infusion, although bolus injection is acceptable.

Lymphotoxin is desirably administered from an implantable article to timed delivery. Examples of suitable systems for proteins with lymphotoxin dimers or 15-trimers molecular weight include copolymers of L-glutamic acid and γ-ethyl-L-glutamine (U. Sidman et al. 1983, "Biopolymers" 22 (1) * 547-556 ), poly (2-hydroxyethyl methacrylate) R. Langer et al., 1981, "J. Biomed. Mater. Res." 15: 167-277 and R. Langer, 1982, "Chem. Tech." 12 '98-105) or ethylene vinyl acetate (R. Langer et al.

ID). Lymphotoxin-containing objects are implanted at surgical sites from which tumors have been excised. Alternatively, lymphotoxin is encapsulated in semipermeable microcapsules or liposomes for injection into the tumor. This mode of administration is particularly useful for tumors that cannot be surgically excised, e.g. brain tumors.

The amount of lymphotoxin administered will e.g. depend on the route of administration, the tumor in question and the patient's condition. It will be necessary for the therapist to adjust the dosage and modify the route of administration as needed to obtain optimal cytotoxic activity against the target tumor as can be determined, e.g. by biopsy of the tumor or diagnostic tests for putative cancer markers, such as carcinoembryonic antigen, under DK 172382 B1 32, taking into account any recombinant toxicity encountered at elevated dosage. In general, doses of recombinant lymphotoxin in mice of about 50 to about 200 pg / kg body weight / day by intravenous administration 5 have been found to be substantially nontoxic and effective in vivo. It is clear that the dosing program will vary for different animals.

This description of claims discloses a method for obtaining lymphotoxin neutralizing antibody.

Neutralizing antibody is defined as antibody capable of binding lymphotoxin immunologically as defined herein in such a way that its activity in tests of cytostatic or cytolytic lymphotoxin activity such as the mouse L929 assay described below is substantially reduced. The fact that the antibody is capable of neutralizing lymphotoxin activity does not mean that the antibody must bind directly to the lymphotoxin active site or receptor binding site. The antibody can still substantially neutralize lymphotoxin activity if it is sterically bound to a region adjacent to the critical site, i.e. neighbor in the conformation sense and not necessarily neighbor in terms of amino acid sequence.

In attempting to produce a neutralizing monoclonal antibody to lymphotoxin, it was found difficult to immunize mice in such a way as to produce lymphotoxin neutralizing antibody in the animals. Neither immunization with lymphoblastoid-lymphotoxin nor with glutaraldehyde cross-linked lymphotoxin resulted in any detectable neutralizing antibody in the serum of immunized mice, although the mice did generate neutralizing anti-lymphotoxin antibody detectable by enzyme immunoassay. However, immunization with a lymphotoxin alum (aluminum hydroxide or alumina, Al2O3.3H2O) adsorption complex will produce neutralizing antibody, even in animals that had not produced the activity prior to immunization with the alum complex. The preparation of alum and its use in the production of antiserum is disclosed in C. Williams et al., 5 eds. 1967, Methods in Immunology and Immunochemistry I, pp. 197-229.

Spleens of spleen cells from animals producing neutralizing antibody have been made with mouse myeloma cells.

On average, from about 50 to about 10,100 clones must be screened to identify one that synthesizes neutralizing antibody. The method of screening the clones for the desired activity is routine and in the ordinary skill of the art and can be reproduced with minimal experimental effort.

The serum, plasma or IgG fractions of the immunized animal as well as immunoglobulins secreted by hybrids produced from the spleen or lymph cell of immunized animals are all satisfactory for the present use. In a preferred embodiment, the neutralizing antibody is substantially obtained free of other anti-lymphotoxin antibody in hybridoma culture.

The neutralizing antibody is immobilized by adsorption on surfaces, e.g. thermoplastic resins, such as polystyrene, or covalently bonded to matrices, such as cyano bromide-activated "Sepharose", are then used in immunoassays or in immunoaffinity purification. Since the antibody is a neutralizing antibody, it will most likely only adsorb or detect biologically active lymphotoxin or fragments thereof. The antibody is particularly useful in immunoradiometric ("sandwich") immunoassays in conjunction with a non-neutralizing monoclonal anti-lymphotoxin antibody or a polyclonal antiserum containing non-neutralizing anti-glue in DK 172382 B1 34 photoxin. The immunoassay is performed using either the neutralizing or the neutralizing antibody as the labeled component, which labeling is effective with a detectable substance such as a fluorescent, chemiluminescent or radioisotopic label in accordance with methods known in the art. art. For competitive type lymphotoxin immunoassays, lymphotoxin is labeled in the same way. Chloramine T radioiodination is suitable for both lymphotoxin and lymphotoxin antibody tracer preparation, or the method described in J. Klostergaard et al., "Mol. Immune." : 455 (1980).

To simplify the examples, certain frequently occurring methods will be denoted by short terms.

15 Plasmids are denoted by small letters with uppercase letters and / or numbers before or after. The starting plasmids of this specification with claims are commercially available, are publicly available on an unlimited basis, or can be constructed from such available plasmids in accordance with published procedures. In addition, other equivalent plasmids are known in the art and will be readily apparent to those skilled in the art.

"Degradation" of DNA refers to catalytic cleavage of the DNA with an enzyme that acts only at certain sites in the DNA. Such enzymes are called restriction enzymes, and the sites for which each is specific are called a restriction site. "Partial" degradation refers to incomplete degradation with a restriction enzyme, ie.

1, conditions which result in cleavage of some but not all of the sites of a given restriction endonuclease in a DNA substrate are selected. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements as determined by the enzyme suppliers were used. Restriction enzymes are generally denoted by abbreviations made up of a capital letter followed by other letters and then usually a number representing the microorganism from which each restriction enzyme was originally obtained. Generally, about 1 µg of plasmid or DNA fragment is used with about 1 unit of enzyme in about 20 µΐ of buffer solution. Suitable buffers and substrate amounts for certain restriction enzymes are specified by the manufacturer. Generally, incubation times of about 1 hour at 37 ° C are used, but may vary according to the supplier's instructions. After incubation, protein is removed by phenol and chloroform extraction and the degraded nucleic acid is recovered from the aqueous fraction by precipitation with ethanol. Degradation with a restriction enzyme is rarely followed by hydrolysis of the terminal 5 'phosphates with bacterial alkaline phosphatase to prevent two restriction cleaved ends of a DNA fragment from "circularizing" or forming a closed loop which would prevent insertion of another DNA fragment at the restriction site. Unless otherwise stated, degradation of plasmids is not followed by 5 'terminal dephosphorylation. Procedures and reagents for dephosphorylation are conventional (T. Maniatis et al., 1982, Molecular Cloning pp. 133-134).

"Extraction" or "isolation" of a given fragment of DNA from a restriction degradation means separation of the degradation mixture by polyacrylamide gel electrophoresis, identification of the fragment of interest by comparing its mobility to the mobility of marker DNA fragments with known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA. This procedure is generally known; see, e.g., R. Lawn et al., 1981, "Nucleic Acids DK 172382 B1 36

Res. "J): 6103-6114; and D. Goeddel et al., 1980," Nucleic Acids Res. "8.: 4057.

"Southern analysis" is a method whereby the presence of DNA sequences in a degradation mixture or DNA-containing composition is confirmed by hybridization to a known, labeled oligonucleotide or DNA fragment. For the purposes of this invention, Southern analysis, unless otherwise stated, shall mean separation of decomposition mixtures of 1% agarose, denaturation and transfer to nitrocellulose by the method described by E. Southern, 1975, "J. Mol. Biol. " ϋ: 503-517, and hybridization as described by T. Maniatis et al., 1978, "Cell" 15: 687-701.

"Transformation" means insertion of DNA into an organism such that the DNA is replicable, either as an extrachromosomal element or a chromosomal integrant.

Unless otherwise stated, the method used in this specification with claims for transformation of E. coli, the CaCl2 method of Mandel et al., 1970, is "J.

20 mol. Biol. ”51: 154.

"Ligation" refers to the method of forming phos-phodiester bonds between two double-stranded nucleic acid fragments (T. Maniatis et al., Id, p. 146). Unless otherwise stated, ligation may be carried out using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per day. 0.5 µg of approximately equimolar amounts of the DNA fragments to be ligated.

"Preparation" of DNA from transformants means isolation of plasmid DNA from microbial culture. Unless otherwise stated, the alkali / SDS method described by Maniatis et al., Id. p. 90, is used.

"Oligonucleotides" are short single or double stranded polydeoxynucleotides that are chemically synthesized by the method incorporated by reference in Example 1 and then purified on polyacrylamide gels.

5 All literature references are expressly incorporated into this description by the references.

EXAMPLE 1

Purification and sequencing of lymphotoxin

The human lymphoblastoid cell line RPMT-1788 (ATCC no.

10 CCl-156) were grown in 15 liter stirring flasks to a cell density of 4 x 10 5 cells per cell. ml using a serum-free culture medium (RPMI-1640). Lymphotoxin was induced 10-20 times (to 500-1000 lymphotoxin units / ml, as described below) over baseline levels by inclusion of 20 ng / ml phorbol myristate acetate in the serum-free RPMI-1649 medium. After 65 hours of culture, the cells were harvested by filtration and the lymphotoxin activity in the filtrate was absorbed into controlled pore glass (Electronucleonics) in a column (5 cm x 20 20 cm), equilibrated with 5 mM phosphate buffer (pH 7.4) and eluted with 50% ethylene glycol in 5 mM phosphate buffer (pH 7.4). 0.1 mM phenylmethylsulfonyl fluoride (PMSF), a protease inhibitor, and 1 mM sodium azide, for inhibiting microbial growth, were included in all buffers during the entire purification. The eluate from the glass beads contained 84000 units of lymphotoxin / mg protein. This was followed by chromatography on DEAE cellulose, chromatography on Lentil-Lectin "Sepharose" R and preparative native PAGE as described in B. Aggarwal et al., 1984, "J. Biol. Chem." 259 (1): 30 686-691. The homogeneity of the protein responsible for cytotoxic activity was determined by SDS-PAGE, reverse phase HPLC on a Lichrosorb RP-18 column, and by amino-terminal sequencing.

• DK 172382 B1 38

This lymphotoxin preparation contained more than 95% by weight of the leucyl amino terminal lymphotoxin with an approximate molecular weight of 25000 by SDS-PAGE. The theoretical molecular weight of the protein component of the N-terminal leucyl 5 is 18664 dalton; the remaining about 6500 daltons were attributed to a glycosyl side chain at Asn + 62 and perhaps other O-linked sugar residues. The tissue culture supernatant contained putative multimers of this kind (60000 Da by TSK-HPLC or 64000 Da by "Sephadex * G-100" chromatography).

The remaining 5% of the lymphotoxin mixture was the N-terminal histidyl species with a molecular weight of about 20000. Both species showed essentially the same cytolytic activity, at least within the limits of the variation contained in the mouse described below. ibroblastcellelyse test.

Tryptic degradation of the intact lymphotoxin molecules yielded only a few fragments. Histidyl amino terminal lymphotoxin was broken down into two fragments between amino acid positions 89 and 90, while the leucyl amino terminal tryptic degradation yielded four fragments split between positions 15 and 16, 19 and 20 and 89 and 90.

Micro-sequencing by the Edman degradation technique provided sequence information on the intact molecule and also on the 25 fragments formed by tryptic cleavage.

Additional sequence information was provided by fragments of lymphotoxin produced by degradation with carboxypeptidase P and chymotrypsin, acetic acid degradation and cyanobromide cleavage. Almost the entire sequence of the human Lym-30 photoxin was determined by this method. 156 consecutive residues were determined from the amino terminus. It was clear from this sequence information that the differences between the two lymphotoxin species were the presence of amino-terminal residues in the leucyl-amino-terminal species that were not found in the histidyl-amino-terminal species. The carboxyl terminal sequence beyond the first three residues was found to be difficult to determine due to certain 5 peptide bonds in this region and the hydrophobic nature of the residues.

A synthetic gene was designed which would encode the protein sequence to the extent determined by micro-sequencing. The redesign incorporated a general E. coli codon adaptation, ie. infrequently used E. coli codons were not used in this sequence. Human reference codons were used where no E. coli codon adaptation was obvious. The adaptation was chosen to aid in the expression in E. coli and also so that the synthetic gene would be useful as a probe to identify the natural DNA sequence from human cDNA or genomic libraries. The unique restriction sites XbaI, BamHI, HindIII and BglII were designed in the sequence to aid in the construction of the fragments and to allow further manipulation of the gene.

The 58 original oligomers designed for the synthetic lymphotoxin were synthesized by the solid-phase phosphite method of M. Matteucci et al., 1981, "J. Amer. Chem. Soc." 10313185-3190 and S. Beaucage et al., 1981, "Tet.

25 Letters "22 = 1859-1862. The size of these oligomers ranged from 16 bases to 20 bases and is shown in Fig. 1A. Overlaps between oligomers were 6 bases long and designed to be unique. The entire gene was assembled as shown. in Fig. 1B.

The gene was constructed in three separate pieces. The first, segment A, was 117 base pairs long and represented the 5 'coding region of the amino-terminal end of the leucyl amino-terminal species. Segment B represented the DNA encoding the center of the lymphotoxin molecule and was 145 base pairs long. Segment C, 217 base pairs long, was thought to encode all but 16 amino acid residues at the carboxyl terminal end of lymphotoxin. The oligomers required to synthesize each of the segments were purified by electrophoresis and then pooled. The relatively small size of each oligomer (i.e., 15-20 bases) was chosen to reduce errors in the synthesis.

Each group of oligomers was phosphorylated in a reaction mixture containing 20 mM "Tris" HCl (pH 7.5), 10 mM MgCl 2, 20 mM dithiothreitol, 0.5 mM ATP and 15 units of T4 polynucleotide kinase in one volume of 50 μΐ; about 50 pmol of each oligomer was contained in the reaction mixture. After 30 minutes at 37 ° C, the reaction mixture was heated to 65 ° C to disrupt kinase activity and then allowed to cool slowly to 20 ° C over 1 hour. The phosphorylated oligomers were then ligated by the addition of 10 units of T4 DNA ligase and the reaction allowed to proceed for 2 hours at 20 ° C. The DNA ligase was heat inactivated and then the ligated oligomers were degraded for 3 hours at 37 ° C with restriction endonucleases which recognized the calculated terminal sites (eg, XbaI and BamHI for segment A). Fragments for each segment were isolated by electrophoresis on a 7% polyacrylamide gel.

Twenty-five fragments of the correct mobility were identified for each segment by ethidium bromide staining and electroluted from the gel. pFIFtrp69 (D. Goeddel et al., 1980, "Nature" 287: 411-416 or Crea et al., EP Patent Application No. 0048970) was digested with XbaI and BamHI, and the large vector fragment isolated by 6% polyacrylamide gel electrophoresis . About 50 ng of segment A was ligated to the pFIFtrp69 fragment. Similarly, segment B was ligated into BamHI and HindiII digested pBR322 and segment C was ligated into HindIII and BglII digested 35 pLeIFA-125-1 (D. Goeddel et al., 1980, "Nuc. Acids Res. "DK 172382 B1 41 4057-4073). The ligation reaction mixtures were transformed into E. coli ATCC 31446 and the resulting recombinant plasmids were characterized by restriction endonuclease analysis and DNA sequencing by Ma-5xam and Gilbert's chemical degradation method. Five of six segment A clones contained the desired sequence. Four segment B and four segment C plasmids were isolated and all of these insertions had the correct sequences. Each segment was isolated by digestion with restriction endonucleases that recognized the terminal sites and then ligated to the plasmid vector pFIFtrp69 digested with XbaI and BglII. The resulting recombinant pismid, pLTXB1, was characterized by sequencing the inserted XbaI-BglI1 fragment containing the one in Figs. 1A showed 15 sequence.

To determine if the synthetic gene would really produce biologically active lymphotoxin, the E. coli pLTXB1 transformants were grown in minimal media under conditions that would derepress the trp promoter and allow expression of the synthetic lymphotoxin. Cultures were grown to an optical density of 1.0 at 550 nm and harvested by centrifugation. The cell pellet was suspended in 1/10 volume and then lysed by ultrasound treatment.

Lymphotoxin activity was determined by the modified cell lysis assay according to B. Spofford, 1974, "J. Immunol." 112 r 2111. Briefly, mouse L-929 fibroblast cells were grown in microtiter plates in the presence of actinomycin D. After 12-18 hours, 0.125 ml of sequentially diluted sample to be tested for lymphotoxin was added to each hole. After 18 hours, the plates were washed and the lymphotoxin-induced lysis of the cells was detected as adherent to the plates by staining the plates with a 1% solution of crystal violet in methanol / water (1: 4 volume ratio). The intensity of the staining was observed both visually and spectrophotometrically by the absorbance of 450 ran and 570 ran transmission using a Dyna-tech spectrophotometer. The cells seeded in a culture medium microtiter hole were set to 0% lysis, while 5 with 3 M guanidine hydrochloride solution constituted an end point of 100% lysis. One unit of lymphotoxin is defined as the amount required for 50% cell lysis out of 12000 cells seeded in each hole. Note that other tests of cytotoxic activity may also be used. See, e.g. B. Agio garwal et al. in "Thymic Hormones and Lymphokines", 1983, ed. A. Goldstein, Spring Symposium on Health Sciences, George Washington Univ. Medical Center (the A549 cell line referred to in this material is available from ATCC as CCL 185). Culture lysates showed 15 undetectable cytolytic activity in the mouse cell assay described above. Control lysates from γ-interferon-expressing cultures actually contained γ-interferon activity. This result indicated that the synthetic gene did not encode an active lymphotoxin. There were several 20 possible explanations for this. For example: (1) the E. coli organism degraded the lymphotoxin, (2) the lymphotoxin gene was not transcribed in E. coli, (3) the lymphotoxin message was not translated in E. coli, (4) the protein did not have the proper sequence due to of a protein sequence determination error or (5) the 16 residue carboxyl terminal sequence or a portion thereof was actually necessary for activity or for the proper configuration of the lymphotoxin molecule.

Example 2 Procedure for obtaining cDNA. encoding lymphotoxin RNA was isolated from a culture of a non-adherent cellular fraction of human peripheral blood lymphocytes 48 hours after induction with phorbol myristate acetate (10 ng / ml), staphylococ enterotoxin B (1 pg / ml) and thymosin α (S. Berger et al., 1979, "Biochemistry", U. S.: 5143-5149). This culture produced 400 units of lymphotoxin activity / ml supernatant. The mRNA was concentrated by adsorption to 5 immobilized obligo-dT, eluted, and cDNA prepared by reverse transcription (P. Gray et al., 1982, "Nature" 295: 503-508). Reverse transcriptase was used to make a cDNA copy of the mRNA by standard methods, another strand was prepared (also by standard methods)

10 by Klenow treatment, and the cDNA was treated with S-1 nuclease to remove the hairpin loop. To insert this cDNA into a vector, the ends were ligated to an adapter or linker to create 5 'and 3' restriction enzyme sites or, preferably, cohesive ends to a predetermined restriction enzyme site. The oligonucleotide 5'-HO-AATTCATGCGTTCTTACAG

GTAC GCAAGAATGTC-P 5 '

was used for this purpose. The oligonucleotide was ligated to the cDNA and the cDNA isolated again by polyacrylamide gel electrophoresis. Xgt10, a publicly available phage (or its essential equivalent, gtll available from ATCC) was digested with EcoRI and the linear fragment recovered (M. Wickens et al., 1978, "J. Biol. Chem." 253 ; 2483-2495). The linker reverse transcript and the Xgt10 degradation mixture were ligated and the ligation mixture used to transfect E. coli C-600 or another known host susceptible to λ phage infection. About 10,000 recombinant phages were seeded on a 15 cm plate and screened by a low-strand plaque hybridization method (T. Maniatis et al., 1978, "Cell" Li: 687-701 and P. Gray et al. ., "PNAS" £: 5842-5846) using a P-labeled probe made from segment A of FIG. 1A by the method of J. Taylor et al., 1976, "Biochem, Biophys. Acta" 442: 324-35 330, using calf thymus DNA primers (PL

in DK 172382 B1 44

Biochemicals). Double sets of nitrocellulose filters were hybridized by the low-stringency method with 5 x 10 7 counts / min of the probe in 20% formamide. The filters were washed twice in 0.3 M sodium chloride, 0.03 M sodium citrate and 5 0.1% sodium dodecyl sulfonate (SDS) at 37 ° C.

Two phages hybridized with the probe and were plaque cleaned. The purified phages hybridized with both the segment A probe and a probe made from segment B. The cDNA inserts in the two hybridizing phages, XLT1 and λΙ / Γ2, were subcloned into M13mp8 and sequenced by the dideoxy chain termination method ( A. Smith, 1980, "Methods in Enzymology" 5: 560-580). The insertion in λΙ / Γ2 was only about 600 bp and did not contain the entire 3 'code range for lymphotoxin. The insert in λΙ / ΓΙ contained the entire code range for 15 leucyl amino terminal lymphotoxin plus a 650 bp 3 'untranslated region (containing a consensus polyadenylation signal) and codons for 18 amino acids amine terminal for leucyl terminus. As this did not constitute the entire lymphotoxin coding region, a further 20 P-labeled probe was prepared from the cDNA insert in λΙιΤΙ, which was used to screen an additional 25,000 high-stringency Xgt10 phage recombinant (see T. Huynh et al. , 1984, in Practical Approaches in Biochemistry IRL Press, Oxford). Twelve further hybridizing phages were isolated and the sequence of the longest insert, from XLT11, is shown in FIG. 2A. The longest open reading frame was translated starting at the first ATG codon observed. The numbers above each line indicate amino acid position and the numbers below each line indicate nucleotide position.

The leucyl residue labeled "1" represents the first sequenced residue of leucyl amino terminal lymphotoxin (FIG.

1A) and is probably the first amino-terminal residue in the mature species of lymphotoxin. The first 34 residues represent a signal sequence. Residues 156 - 171 could not be determined by protein sequencing of lymphotoxin, but were instead attributed to the nucleotide sequence.

EXAMPLE 3 Construction of a Hybrid Synthetic Gene / Naturlia cDNA Expression Vector for Leucyl Aminothermal Lymphotoxin

This construction is shown in FIG. 2B. pLTXB1 (containing the inactive synthetic gene) was partially digested with Eco RI and Pst I, and a 685 bp fragment containing DNA encoding 125 N-terminal residues of lymphotoxin was recovered. A partial Pst I degradation was performed due to the presence of an additional Pst I site at the residue 10 (Fig. 1A). A 301 bp fragment containing DNA encoding the C-terminal 51 15 amino acids of lymphotoxin was isolated by digestion of the subcloned c DNA from XLT1 with EcoRI and PstI (these sites are shown above in Fig. 2A at the nucleo time position ions 554 and 855). These fragments were isolated by electrophoresis on 5% polyacrylamide and electroelution.

The fragments were ligated into pBR322 which had been digested with Eco RI and dephosphorylated with bacterial alkaline phosphatase to reduce background transforms. The resulting expression plasmid, pLTtrp1, was characterized for proper orientation and sequence by restriction endonuclease degradation and DNA sequencing. Leucyl amino terminal lymphotoxin was expressed by transformation of E. coli 31446 with pLTtrp1 and culturing the transformants in medium containing tetracycline at 37 ° C for 4-6 hours until an optical density of 1.0 was reached. The cell lysates contained cytotoxic activity. The leucyl amino terminal end of the expressed lymphotoxin species was found to be substituted with a blocked methionyl residue. It is believed that the product of this synthesis is formylmethionyl rather than the methionyl species.

EXAMPLE,! 5 Immunoaffinity Purification of Lymphotoxin

A mouse monoclonal cell line which secreted anti-lymphotoxin (Example 8) was grown in mice and purified from ascites fluid by ion exchange chromatography. Anionbytterelua-

ISLAND

The tetanus was coupled to cyano bromide-activated "Sepharose" at a concentration of 2 mg / ml resin. A 20 ml column was equilibrated sequentially with IBS (containing 0.05 M "Tris" HCl, pH 7.0, 0.15 M sodium chloride and 2 mM EDTA); then with elution buffer (containing 0.1 M acetic acid, pH 4.5, 150 mM sodium chloride); and finally with TBS. A precipitate obtained by precipitating an ultrasonic lysate of pLTtrp1 transformed E. coli (first cleared by centrifugation) with 40% saturated ammonium sulfate was suspended in 0.1 M "Tris" HCl, pH 7.4 and 5 mM EDTA and applied to the column at a rate of 1 column volume per unit.

20 hours. After extensive washing with TBS containing 0.05% "Tween-20, R, specifically bound material was eluted, red the elution buffer, the pH immediately adjusted to 7.8 with 0.1 volume of 1 M" Tris "HCl, pH 8.5, and stored at 4 ° C. The specific activity of this purified lymphotoxin was (2 - 10) x 10 7 units / mg as measured by the aforementioned mouse L-929 assay.

The eluate contained most of the activity applied to the column. The majority of the total eluate protein migrated as a single band under both reducing and non-reducing conditions by SDS-polyacrylamide gel interaction. The mobility of this band corresponds to a molecular weight of about 18000 which corresponds to the predicted molecular weight of 18664 for unglycosylated leucyl amino terminal lymphotoxin based on the deduced amino acid sequence. To further characterize its biological activities, the purified recombinant lymphotoxin was tested for cytolytic activity in vitro and antitumor activity in vivo.

EXAMPLE 5 In vivo biological activity of recombinant lymphotoxin

Recombinant and lymphoblastoid-lymphotoxin were tested by an in vivo tumor necrosis assay. MethA (a) sarcomas were cultured for 7-10 days in susceptible mice [BALB / C x C5781 / 6fl or CB6fl], and the tumors then directly injected with lymphotoxin of Example 4, lymphoblastoid lymphotoxin (prepared and purified as described above) or control samples. After 20-24 hours, the mice were sacrificed and the tumors were sampled and histologically assessed for the degree of necrosis. As shown in Table 1, both 20 recombinant and lymphoblastoid-lymphotoxin produced significant necrosis of MethA (a) sarcoma in vivo. Control samples did not induce necrosis of the MethA (a) sarcomas.

DK 172382 B1 48

TABLE JL

Necrosis of Meth (a) sarcoma in vivo with recombinant and natural lymphotoxin

Number of mice

Sarcoma necrosis Rating

Treatment +++ ± ± ± r.

Buffer 1 control 3

Lymphoblastoid-lymphotoxin, 4 25000 units

Lymphoblastoid Lymphotoxin, 4 - - - 10000 units

Recombinant Lymphotoxin, 14 2 2 - 200000 units

Recombinant Lymphotoxin, 3 - - 1 25000 units

Recombinant lymphotoxin, 3 - 1 10000 units

Buffer 2 control 9

Lymphoblastoid lymphotoxin was injected dissolved in buffer 1 (0.01 M "Tris" -HCl, 0.05 M (NHA) 2HCO3, pH 8.0), and re-5 combined lymphotoxin was injected dissolved in buffer 2 (0, 15 M NaCl, 0.1 M sodium acetate and 0.1 M "Tris" -HCl, pH 7.8).

The absence of carbohydrate on recombinant lymphotoxin does not appear to affect biological activity, as the specific activity of lymphotoxin produced by recombinant culture [(2 - 10) x 10 7 units / mg] is approximately the same as that reported for lymphoblastoid-lymphotoxin (4 x 107 units / mg).

The activity of recombinant lymphotoxin also showed a similar thermolability as natural lymphotoxin, ie. in-solution activation in aqueous solution after heating for 1 hour to 80 ° C.

EXAMPLE 6

Construction of an expression vector for methionyl-his-tidyl-amino-terminal lymphotoxin 10 Construction of a plasmid directing the expression in E. coli of methionyl-histidyl-amino-terminal lymphotoxin is outlined in FIG. 3. A synthetic oligonucleotide was inserted into the expression plasmid to encode a methionine start codon up to the histidyl codon in histidyl amine terminal lymphotoxin (residue 24 in Fig. 2A). This was accomplished by isolating a 4630 bp vector fragment from pLTtrspl by XbaI and Clal degradation, preparative 1% agarose gel electrophoresis, and electroelution.

A 570 bp Bam HI-Cla I fragment containing most of the 20 lymphotoxin code sequence was also isolated from pLTtrp1 in the same manner. Two synthetic oligonucleotides were synthesized by the aforementioned methods and mixed with the oligonucleotides 6, 7, 52 and 53 of FIG. 1A. About 50 pmol of each oligonucleotide was treated with 25 polynucleotide kinase as described in Example 1. The oligonucleotides were annealed and then ligated with a mixture of the 570 bp Bam HI-Clal fragment and the 4630 bp XbaI-Clal vector fragment. The ligation mixture was transformed into E. coli ATCC 31446, and recombinants were selected on the basis of resistance to tetracycline.

DK 172382 B1 50

Plasmid p20KLT was recovered from one of the transformants. The plasmid p20KLT was characterized by restriction enzyme and DNA sequence analysis.

Example 7 Preparation of cytotoxic lymphotoxin infusion variant

A plasmid containing DNA encoding a fusion of lymphotoxin with a bacterial protein was constructed by cloning a sequence encoding a bacterial signal sequence up to the structural gene for lymphotoxin. The sequence of the gene for the heat-stable Enterotoxin II (STII) in E. coli has been characterized (RN Picken et al., 1983, "Infection and Immunity" 42. pp. 269-275) and encodes a signal sequence of 23 amino acids. , which directs the secretion of STII to the periplasmic compartment of E. coli.

The plasmid pWM501 (Picken et al., 1983, "Infection and Immunity" 42. (1): 269-275) contains the gene for the heat-stable enterotoxin (STII). A portion of the DNA comprising the STII gene was recovered from pWM501 using the following steps. pWM501 was digested with Rsal, the 20 and 550 bp DNA fragment was isolated. This gene fragment was ligated to the phage M13mp8 (J. Messing et al. In the Third Cleveland Symposium on Macromolecules: Recombinant DNA, Ed. A. Walton, Elsevier, Amsterdam (1981), pp. 143-153) broken down with Smal. The 25 ligated DNA was used to transform E. coli JM101, a commercially available strain for use with the M13 phage. Clear plaques were mined. The double-stranded Ml3mp8-STII-Rsa derivative was isolated from an E. coli JM101 infected with this phage using 30 standard procedures (J. Messing et al., Supra). By application of the M13mp8 subcloning procedure just described, the fragment of about 550 base pairs containing the STII leader gene is now delineated by a number of different restriction endonuclease sites provided by the phage.

The M13mp8-STII-Rsa derivative was then digested with EcoRI and PstI, and a DNA fragment slightly larger than the 550 bp DNA fragment was isolated.

The Eco RI-Pstl fragment was subcloned into pBR322. This was accomplished by digesting pBR322 with EcoRI and PstI and isolating the vector. The isolated vector was ligated to the Eco RI-Pst I DNA fragment. This DNA mixture was used to transform E. coli ATCC 31446 and tetracycline resistant colonies were selected. A plasmid was isolated from a resistant E. coli colony and designated 15 pSTII partial.

pSTII partial was digested with MnII and BamHI and a 180 bp fragment containing the STII-Shine-Dalgarno sequence, STII signal sequence and the first 30 codons of the mature STII gene was isolated. 180 bp DNA fragment was ligated to a plasmid containing the trp promoter. One such plasmid, pHGH207-1, has been described previously (H. de Boer et al., 1982, in: Promoter: Structure and Function,

Eds R. Rodreguez et al. Chamberlin, Praeger Pub., New York, NY, pp. 462-481). A derivative of this plasmid, pHGH207-1 *, wherein the EcoRI site 5 'of the trp promoter had been converted to EcoRI * by filling with DNA polymerase I (DNA pol I) and joining the blunt ends by ligation (S Cabilly et al., 1984, "Proc. Natl. Acad. Sci. USA" 8.1: 3273-3277), were used in this example. The trp promoter-containing plasmid was digested with XbaI and treated with DNA pol I and all four dNTPs to fill the protruding sequence. The DNA preparation was then digested with BamHI and the vector-containing fragment was isolated. This vector fragment was then ligated to the above isolated 180 bp DNA fragment containing the STII signal. The ligation mixture was used to transform E. coli ATCC 31466 into ampicillin resistance.

5 A plasmid designated STII leader was isolated from an ampicillin resistant colony.

An M1 3 phage containing STII coding sequences was first constructed by ligating the 180 bp Xbal-BamHI fragment of pSTII leader into Xbal and BamHI digested M13mp10. The resulting 10 phage DNA, pSTII shuttle was characterized by restriction endonuclease analysis and nucleotide sequence determination. Lymphotoxin coding sequences were then introduced into this vector by ligating the 700 bp Hbal-EcoRI fragment of pLTtrp1 into SmaI-EcoRI degraded double-stranded pSTII shuttle DNA (RF); The narrow and Hpal sites are both blunt-ended and ligated together (resulting in the loss of both sites).

The resulting phage DNA, M13-STII-LT, was characterized and then utilized for mutagenesis as follows; primer 20 5 'p CAAATGCCTATGCACTGCCAGGCGTAGG, was kinase-treated and mixed with the template (M13-STII-LT) in the presence of league buffer and Xbal-EcoRI degraded M13mp10 RF DNA (to promote DNA synthesis initiation as reported by JP Adelman et al., 1983, "DNA" 2; 183-193). the mixture was heated to 95 ° C and then allowed to anneal at room temperature for 30 minutes and then placed on ice for 30 minutes. All four deoxynucleotide triphosphates were then added together with ATP, T4 DNA ligase and the large fragment (Klenow) of E. coli DNA polymerase I. The mixture was incubated for one hour at 14 ° C and then used to transfect competently. E. coli JM101, a commercially available strain, or any other M13 phage host. Correctly mutagenic phage were identified by hybridization o 9 screening using the P-radiolabelled primer as probe. The resulting phage SI-LT mut was characterized by DNA sequence analysis. Replicative DNA was prepared from this phage and used to isolate a 761 bp XbaI-EcoRI fragment containing DNA for the 5 STII signal sequence up to the coding sequence for leucyl amino terminal lymphotoxin. This DNA was ligated with the XbaI-BamHI digested p20KLT (the large 4285 bp vector fragment) and the 375 bp EcoRI-BamHI fragment of pBR322. The resulting plasmid, pST18LT, was characterized by restriction mapping and DNA sequencing. A similar construct was prepared which encoded a fusion of the STII signal amino-terminally to the histidine residue in histidyl-amino-terminal lymphotoxin. The resulting plasmids were transformed into E. coli ATCC 31466.

The plasmids pSTLT18 and pSTLT16 were recovered. They were confirmed to encode the STII fusion by restriction enzyme analysis and dideoxy sequence determination. E. coli transformed with plasmid pSTLT18 or pSTLT16 synthesizes STII signal sequence fusions with leucyl amino terminal and histidyl amino terminal lymphotoxin as determined by the calculated molecular weights by gel electrophoresis. The E. coli lysates containing these fusion proteins showed cytotoxic activity.

Example 8 Method of Preparation of Monoclonal Mouse Antibody. which is capable of neutralizing lymphotoxin

Purified lymphoblastoid-lymphotoxin obtained in Example 1 was dialyzed against phophate-buffered saline (PBS). 200 µg of lymphotoxin / ml was contained in the dialysate.

Glutaraldehyde was added to the dialysate to a concentration of 70 mM glutaraldehyde, the mixture was incubated for 2 hours at room temperature, added more glutane to bring its total added concentration up to 140 mM, the incubation continued for a further 6 hours. and the mixture was then dialyzed against PBS. 50 µg of the glutaraldehyde cross-linked lymphotoxin (hereinafter referred to as "polylymphotoxin") and 0.5 ml of "Freund's complete adjuvant" were injected subcutaneously into mice (strain BALB / c). After one week, the mice were gain-immunized with 50 µg polylymphotoxin and 0.5 ml "Freund's incomplete adjuvant" half intramuscularly and half in the peritoneal cavity. Serum was harvested after 7 days and tested for anti-lymphotoxin activity by an ELISA assay.

The ELISA test was conducted as follows: a buffered solution of purified lymphotoxin was placed in microtiter holes positioned to coat each of the holes by ca. 100 ng of lymphotoxin. The unadsorbed lymphotoxin solution was sucked up from the holes. 50 μΐ of appropriately diluted sample was combined with 100 μΐ PBS containing 5 mg / ml bovine serum albumin (PBS-BSA buffer) and added to 20 each well; incubated for 2 hours at room temperature, washed with PBS containing 0.05% "TweenR20", 100 μΐ horseradish peroxidase-labeled goat (anti-mouse) IgG in PBS-BSA buffer was added to each well, and the mixture was incubated for one hour. hour. Each hole was washed with PBS containing 0.05% 25 "TweenR20" and then citrate / phosphate buffer pH 5 containing 0.1 mg o-phenylenediamine / ml substrate solution and aqueous 30% H2O2 (in an amount of 4%). µΐ 30 volume% H2O2 per 10 ml of substrate solution) added to each hole. The holes were incubated for 30 min, the reaction stopped 30 with 50 μΐ 2.5 N sulfuric acid, and the absorbance measured at 492 nm. Holes showing absorbance greater than 1 were considered anti-lymphotoxin positive.

The samples were also tested for the ability to neutralize the cytolytic activity of lymphotoxin in the mouse L929-DK 172382 B1 55 assay. Serum harvested from immunized animals or hybrid supernatants was diluted as needed in RPMI-1640 medium containing 10% fetal bovine serum and about 100 lymphotoxin units / ml and seeded into microtiter holes containing the cultured L929 cells as is otherwise conventional in the cytolysis assay. In the controls, all cells were lysed. Neutralizing antibody was detected by the fact that the lymphotoxin did not lyse L929 cells.

Animals immunized with glutaraldehyde polymerized lymphotoxin produced antibodies active in the ELISA assay, but no serum neutralizing activity was detected.

A suspension containing 100 µg of lymphotoxin and 1 ml of a 1.64 w / v% suspension of aluminum hydroxide 15 [(Al (OH) 3]) was prepared and used to immunize the same mouse. The mouse was injected red 100 µΐ of the suspension intramuscularly and 400 μΐ intraperitoneally. After one week, the mouse was injected intravenously with 10 µg of unpolymerized and unadsorbed lymphoblastoid lymphotoxin in 100 20 μΐ PBS. neutralizing antibody.

The spleen from this animal was sampled. 3 x 10 7 spleen cells were fused with 5 x 10 7 mouse myoloma cells and seeded into microtiter holes containing HAT medium and about 3,000 peritoneal macrophages / microtiter holes according to the procedure described by S. Fazekas De St. Groth, 1980, "J. Immunol. Meth." 25! 1-21. Hybridomas from holes containing supernatants that were positive in the above ELISA assay were grown in 1 ml of DMEM medium with 20% fetal calf serum, 10% NCTC-135 medium, 5 x 10 6 S β-mercaptoethanol and HAT , distributed in microtiter holes in a static cell of one cell per hole and then cultured in DK 172382 B1 56 in a volume of 1 or 5 ml of the same medium, and the supernatant was then tested for neutralizing antibody. the ELISA-positive hybridomas from the aluminum hydroxide immunization 5 neutralizing antibody High-affinity lymphotoxin antibody is optionally selected from this group of hybridomas.

Example 9

Site-specific mutapenesis of lymphotoxin

The procedure of Example 3 is followed exactly in this Example except that segment 6 of the synthetic oligo nucleotide was modified to have the sequence 5'CTCAACTCTGCACCCA3 'and its complementary strand (segment 53) modified to have the sequence 3'AGACGTGGGTCGTCGT5'.

The modified oligonucleotides are annealed to the remaining oligonucleotides and ligated into the expression vector as described in Example 6. This vector contains a 2 bp replacement which changed the lysine codon +28 from lysine to histidine. The histidine mutant is expressed by transformation of E. coli ATCC 31446.

Other site-directed mutants are prepared in the same manner, preferably by selecting codons so as not to introduce an EcoRI restriction site which would require the use of a partial EcoRI restriction degradation in the degradation of pLTXB1 of Example 3. The mutations should also not introduce additional XbaI or Bam-HI sites in fragment A (see Fig. 1B), Bam HI or Hin-dIII sites in fragment B or HindIII or BglII sites in fragment C. Otherwise, partial degradation will be required. to assemble the pLTXB1 mutant properly; complete degradation would produce a deletion mutant for the replacement mutant that is the purpose in this case.

Example 10

Identification of aeonomic DNA. encoding mouse oo 5 bovine lymphotoxin: amino acid sequence of mouse and bovine glue photoxin

The mouse and bovine lymphotoxin genes were isolated from genomic λ libraries. The human lymphotoxin cDNA fragment (PvuII-EcoRI, 600 bp) was radiolabelled with 32P by notch translation and used as a probe to screen a mouse genomic DNAA library (mouse strain M600 genomic DNA in XCharon4A, T. Maniatis et al., Molecular Cloning, p. 31, 1982) and, independently thereof, an ox genomic DNA library (EP 88622A). Hybridization was performed at low stringency in 20% formamide (Gray and Goeddel "PNAS USA" 80; 5842-5846 [1983]) and filters were washed twice with an aqueous solution of 0.3 M sodium chloride, 0.03 M sodium citrate. and 0.1% SDS. Several phages hybridizing to the human lymphotoxin probe were plaque purified (T. Maaniatis et al., "Cell" 15: 687-701 [1978]). Phage DNA was prepared (T. Maniatis et al., "Cell" 15: 687-701

[1978]), digested with restriction endonucleases and analyzed by Southern hybridization. A 3500 bp Eco RI mouse DNA fragment and a 2200 bp Eco RI bovine DNA fragment were hybridized separately with the human lymphotoxin probe. These DNA fragments were subcloned into plasmid pBR322 and then sequenced by the dideoxy chain termination method (A.J.H. Smith, Methods in Enzymology £ 5 * 560-580 [1980]).

The derived protein sequence of mouse and bovine lymphotoxin 30 together with the sequence of human lymphotoxin for comparison is shown in FIG. 4th

DK 172382 B1 58

Example 11

Expression of lymphotoxin for years under the control of the ADH promoter

Plasmid pLTtrp1 is digested with XbaI to open plasmid 5 at the XbaI site, close to the lymphotoxin start codon. The Xabl cohesive ends are blunted with the Klenow fragment of E. coli DNA polymerase I with four dNTPs. An EcoRI adapter.

OH

5 '^ AATTCCCGGG 3' 3 'j-GGGCCC-P 5'

OH

are ligated to the blunt plasmid fragment, the protruding 5'-15 hydroxyl ends are phosphorylated using polynucleotide kinase, the ligation mixture is used to transform E. coli ATCC 31446, and by restriction analysis, a plasmid pLTtrpRI containing an additional Eco R to the lymphotoxin start codon. The plasmid pLTtrpRI is isolated, digested with Eco-RI, and the lymphotoxin-DNA-containing fragment Sp is recovered.

The plasmid pFRPn (EP 60 057) is digested with EcoRI, treated with alkaline phosphatase to prevent recirculation, ligated to the SP lymphotoxin fragment using T4 ligase, and the ligation mixture is then used to transform E. coli ATCC 31 446. Ampicil-lin resistant colonies yield 2 rows of plasmids with the SP insert in opposite orientations determined by restriction analysis on agarose electrophoresis gels. The plasmids are purified from E. coli transformants and used to transform yeast with the trp1 mutation (e.g., yeast strain RH218, unrestricted ATCC deposit # 44076) to the trp + - DK 172382 B1 59 phenotype. Plasmids oriented such that the start codon of segment SP is located up to alcohol dehydrogenase promoter fragments is found to transform the yeast for lymphotoxin expression. Lymphotoxin is recovered from extracts of the yeast transformants. Plasmid stability by large-scale fermentation can be improved by using an expression plasmid containing 2 μπι of replication origins instead of the pFRPn chromosomal replication origin (ars 1) and a compatible host strain (J. Beggs, 1978, 10 "Nature" 215l '104- 109).

Example 12

Expression of lvmphotoxin in mammalian cells λΒΤΐΙ (Example 2) is digested with EcoRI, and the lymphotoxin DNA-containing fragment (the reverse transcript) is recovered. The plasmid pEHER (EP 117 060A) is digested with EcoRI, treated with calf-intestinal alkaline phosphatase and ligated to the EcoRI-linked reverse transcript of XLT11. The resulting plasmids were grown on E. coli ATCC 31446 (EP 117 060A) and designated pE-20 HERLT I and pEHERLT II. They contained the lymphotoxin DNA in opposite orientations determined by restriction analysis on polyacrylamide gels. These plasmids are used to transfect and select CHO DHFR-DUX-B11, CHO 1 and Ltk cells.

Tissue culture cells are transfected by mixing 1 µg pEHERLT I or pEHERLT II prepared above with 10 µg rat carrier DNA in a volume of 250 µl, 0.25 M CaCl2, followed by the dropwise addition of 250 µl HEPES buffered saline (280 mM NaCl, 1.5 mM Na2 POi, 50 mM HEPES,

PH 7.1). After 30 minutes at room temperature, the solution is added to tissue culture cells growing in 60 mM pla-tissue tissue culture dishes. CHO 1, CHO is used

60 DK 172382 B1 DHFR-DUX-B11 and Ltk "cells. The dishes contain 3 ml of culture medium suitable for the host cell.

For CHO 1 DHFR DUX-Bll cells, the medium Ham F-12 medium (Gibco) is supplemented with 10% calf serum, 100 µg / ml penicillin, 100 µg / ml streptomycin and 2 pmM L-glutamine. For the Ltk "cell line, the Dulbecco-modified" Eagle's medium "(DMEM) medium is supplemented as above.

After 3-16 hours, the medium is removed and the cells washed with 20% glycerol in phosphate-buffered saline. Fresh medium 10 is added to each plate and the cells are incubated for two more days.

Selection of transfected host cells is performed by trypsinating the cells after two days of growth (which includes treating the cells with sterile trypsin 0.5 mg / ml 15 containing 0.2 mg / ml EDTA) and adding about 3 x 10 5 cells to 10 mm tissue culture plates with selective media. For dhfr "cells, the medium is a composition of (F-12 GIBCO) medium lacking glycine, hypoxanthine and thymidine (GHT medium). For DHFR + host cells, methotrex rexate (100-1000 nM) is added to the normal growth medium.

Controls are run using transfection conditions without any plasmid and with the plasmid pFD-11 (EP 117 060A) containing normal DHFR. Colonies derived from cells that take up and express the DHFR-25 plasmid are visible within 1-2 weeks. Transformants expressing mature lymphotoxin are identified.

in

Claims (35)

1. Lymphotoxin derivative with cytotoxic activity, characterized in that it comprises the one shown in FIG. 2A, wherein one or more amino acid residues have been (a) deleted or (b) replaced by one or other residues, or (c) one or more other amino acid residues have been inserted; however, the lymphotoxin derivative does not include human lymphotoxin having the one in FIG. 2A showed amino terminus sequence at Leu + 1 or His + 24. The lymphotoxin derivative of claim 1, which is a human lymphotoxin. The lymphotoxin derivative of claim 1, which is an animal lymphotoxin. The lymphotoxin derivative of claim 3, wherein the animal lymphotoxin is bovine. The lymphotoxin derivative of claim 1, wherein the residues -34 to -1 have been deleted and further comprising an insertion of at least one amino acid residue. The lymphotoxin derivative of claim 5, wherein the insert 20 is a fusion of a polypeptide with the carboxyl terminus of the lymphotoxin. The lymphotoxin derivative of claim 6, wherein the polypeptide is fused to lymphotoxin via a hydrolysis site for a proteolytic enzyme. The lymphotoxin derivative of claim 7, which derivative is cytolytically inactive prior to proteolytic hydrolysis. The lymphotoxin derivative of claim 1, which is a hybrid animal-human lymphotoxin. DK 172382 B1 The lymphotoxin derivative of claim 1 comprising a tumor necrosis factor fragment. The lymphotoxin derivative of claim 1 containing a single amino acid residue replacement. The lymphotoxin derivative according to claim 1 containing a cellular deletion of from 1 to ca. 30 amino acid residues. The lymphotoxin derivative of claim 1 containing a single amino acid residue insert. The lymphotoxin derivative of claim 1, wherein the replacement 10 is a replacement of a residue from the classes of neutral, acidic or basic amino acid residues with a residue which does not belong to the same class as the substituted amino acid. An antibody which neutralizes the cytolytic activity of a lymphotoxin derivative according to any one of the preceding claims and which is free of non-neutralizing antibodies. The antibody of claim 15, which is a monoclonal antibody. An antibody according to claim 15 or 16 labeled with a detectable substance. The antibody of claim 17, wherein the detectable substance is a fluorescent, chemiluminescent or radioisotopic label. The antibody of claim 15, which is immobilized on a surface or matrix. The antibody of claim 15, which neutralizes the cytolytic activity of a human lymphotoxin derivative. DK 172382 B1 A nucleic acid encoding a lymphotoxin derivative according to any one of claims 1-14. The nucleic acid of claim 21, which encodes a human lymphotoxin derivative. The nucleic acid of claim 21 or 22, which is c-DNA. The nucleic acid of claim 21 or 22, which is covalently labeled with a detectable substance. A replicable vector comprising a nucleic acid according to claim 21 or 22. The vector of claim 25, which is replicable in prokaryotes. The vector of claim 25, which is replicable in eukaryotes. The vector of claim 26, further comprising a bacterial promoter operably linked to the nucleic acid encoding the lymphotoxin derivative. The vector of claim 26, wherein the nucleic acid encodes a fusion of a bacterial secretory leader sequence and the lymphotoxin derivative. The vector of claim 25, which is pLTtrpl. The vector of claim 25, which is p20KLT. A heterologous cell transformed with a nucleic acid according to claim 21 or 22. A cell transformed with a vector according to claim 25. The cell of claim 33, which is a prokaryote. DK 172382 B1 A method comprising culturing a cell according to claim 33 or 34, letting the lymphotoxin derivative accumulate in the culture and extracting the lymphotoxin derivative from the culture.