DK1297170T3 - A process for stable chromosomal integration of multiple copies of the genes - Google Patents
A process for stable chromosomal integration of multiple copies of the genes Download PDFInfo
- Publication number
- DK1297170T3 DK1297170T3 DK01943190.7T DK01943190T DK1297170T3 DK 1297170 T3 DK1297170 T3 DK 1297170T3 DK 01943190 T DK01943190 T DK 01943190T DK 1297170 T3 DK1297170 T3 DK 1297170T3
- Authority
- DK
- Denmark
- Prior art keywords
- gene
- bacillus
- cell
- host cell
- dna
- Prior art date
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Description
DESCRIPTION
Field of the Invention [0001] The invention relates to a method for inserting genes into the chromosome of bacterial strains, and the resulting strains. In the biotech industry it is desirable to construct polypeptide production strains having several copies of a gene of interest stably chromosomally integrated, without leaving antibiotic resistance marker genes in the strains.
Background of the Invention [0002] In the industrial production of polypeptides it is of interest to achieve a product yield as high as possible. One way to increase the yield is to increase the copy number of a gene encoding a polypeptide of interest. This can be done by placing the gene on a high copy number plasmid, however plasmids are unstable and are often lost from the host cells if there is no selective pressure during the cultivation of the host cells. Another way to increase the copy number of the gene of interest is to integrate it into the host cell chromosome in multiple copies. It has previously been described how to integrate a gene into the chromosome by double homologous recombination without using antibiotic markers (Hone et al., Microbial Pathogenesis, 1988, 5: 407-418); integration of two genes has also been described (Joetgensen, S.T. et al., Biotechnology Techniques, Vol. 12, No.1, January 1998, 15-19; Novo Nordisk: WO 91/09129 and WO 94/14968). A problem with integrating several copies of a gene into the chromosome of a host cell is instability. Due to the sequence identity of the copies there is a high tendency for the them to recombine out of the chromosome again during cultivation of the host cell unless a selective marker or other essential DNA is included between the copies and selective pressure is applied during cultivation, especially if the genes are located in relative close vicinity of each other. It has been described how to integrate two genes closely spaced in anti-parallel tandem to achieve better stability (Novo Nordisk: WO 99/41358).
[0003] The present day public debate concerning the industrial use of recombinant DNA technology has raised some questions and concern about the use of antibiotic marker genes. Antibiotic marker genes are traditionally used as a means to select for strains carrying multiple copies of both the marker genes and an accompanying expression cassette coding for a polypeptide of industrial interest. In order to comply with the current demand for recombinant production host strains devoid of antibiotic markers, we have looked for possible alternatives to the present technology that will allow substitution of the antibiotic markers we use today with non-antibiotic marker genes. Thus in order to provide recombinant production strains devoid of antibiotic resistance markers, it remains of industrial interest to find new methods to stably integrate genes in multiple copies into host cell chromosomes.
Summary of the Invention [0004] The present invention solves the problem of integrating multiple copies of a gene of interest by homologous recombination into well defined chromosomal positions of a bacterial host strain which already comprises at least one copy of the gene of interest in a different position. This can be done by making a deletion of part of one or more conditionally essential gene(s) (hereafter called the "integration gene") in the host chromosome of a strain which already comprises at least one copy of a gene of interest, or by otherwise altering the gene(s) to render it non-functional; or by integrating at least one partial non-funtional conditionally essential gene into the host chromosome, so that the resulting strain has a deficiency (e.g. specific carbon-source utilization) or a growth requirement (e.g. amino acid auxotrophy) or is sensitive to a given stress. The next (i.e. second or third etc.) copy of the gene of interest is then introduced on a vector, on which the gene is flanked upstream by a partial fragment of the integration gene, and downstream is flanked by a fragment homologous to a DNA sequence downstream of the integration gene on the host chromosome. Thus, neither host chromosome nor the incoming vector contain a full version of the integration gene. In a non-limiting example the host chromosome may comprise the first two thirds of the integration gene and the vector the last two thirds, effectively establishing a sequence overlap of one third of the integration gene on the vector and the chromosome.
[0005] Expression of the full version of the integration gene will only occur if homologous recombination between vector and host chromosome takes place via the partial integration gene sequences, and this particular recombination event can be efficiently selected for, even against the background of homologous integration into the chromosome directed by the gene of interest into the identical gene(s) comprised on the chromosome already.
[0006] This strategy will enable directed gene integration by homologous recombination at predetermined loci, even though extended homology exists between the gene of interest on the incoming vector and other copies of this gene at other locations in the chromosome, and even though it is not feasible to identify the desired integrants based on the qualitative phenotype resulting from expression of the gene of interest, as this gene is already present in one or more copies in the host.
[0007] In a non-limiting example herein a Bacillus enzyme production strain is provided that comprises two anti-parallel copies (inverted orientation) of a gene encoding the commercially available amylase Termamyl® (Novo Nordisk, Denmark). A gene homologous to the dal gene of Bacillus subtilis, encoding a D-alanine racemase, was identified in the Bacillus production strain, it was sequenced and a partial deletion was made in the dal gene of the Bacillus two-copy Termamyl® strain. A vector was constructed to effect a stable non-tandem chromosomal insertion of a third Termamyl® gene copy adjacent to the dal locus, in the process effectively restoring the complete dal gene, according to the above strategy.
[0008] In another non-limiting example herein, an additional copy of the amylase encoding gene was introduced into the xylose isomerase operon of the Bacillus enzyme production strain which already comprised at least two copies of the amylase gene located elsewhere on the chromosome.
[0009] Also in a non-limiting example we demonstrate the method of the invention by integrating an additional amylase-encoding gene into the gluconat operon of the Bacillus enzyme production strain. Other non-limiting examples of integration into conditionally essential genes are given below.
[0010] Accordingly in a first aspect the invention relates to a method for constructing a baterial cell comprising at least two copies of a gene of interest stably integrated into the chromosome in different positions, the method comprising the steps of: 1. a) providing a host cell comprising at least one chromosomal copy of the gene of interest, and comprising one or more conditionally essential chromosomal gene(s) which has been altered to render the gene(s) non-funtional; 2. b) providing a DNA construct comprising: 1. i) an altered non-functional copy of the conditionally essential gene(s) of step a); and 2. ii) at least one copy of the gene of interest flanked on one side by i) and on the other side by a DNA fragment homologous to a host cell DNA sequence located on the host cell chromosome adjacent to the gene(s) of step a); wherein a first recombination between the altered copy of i) and the altered chromomosomal gene(s) of step a) restores the conditionally essential chromosomal gene(s) to functionality and renders the cell selectable; 3. c) introducing the DNA construct into the host cell and cultivating the cell under selective conditions that require a functional conditionally essential gene(s); and 4. d) selecting a host cell that grows under the selective conditions of the previous step ; wherein the at least one copy of the gene of interest has integrated into the host cell chromosome adjacent to the gene(s) of step a); and optionally 5. e) repeating steps a) to d) at least once using a different conditionally essential chromosomal gene(s) in step a) in each repeat.
[0011] The present invention provides a method for obtaining a bacterial host cell comprising at least two copies of a gene of interest stably integrated on the chromosome adjecent to conditionally essential loci.
[0012] Accordingly in a second aspect the invention relates to a bacterial host cell comprising at least two copies of a gene of interest stably integrated into the chromosome, which contains less than 500 exogenous basepairs per integrated gene of interest, where at least one copy is integrated adjacent to a conditionally essential gene encoding a D-alanine racemase; a conditionally essential gene that is required for the host cell to grow on minimal medium supplemented with only one specific main carbon-source; a conditionally essential gene of a xylose operon, a conditionally essential gene encoding a galactokinase (EC 2.7.1.6), an UTP-dependent pyrophosphorylase (EC 2.7.7.10), an UDP-glucose-dependent uridylyltransferase (EC 2.7.7.12), or an UDP-galactose epimerase (EC 5.1.2.3); a conditionally essential gene of a gluconate operon, a glycerol operon, or an arabinose operon; OR a conditionally essential gene which encodes one or more polypeptide(s) involved in amino acid synthesis; wherein the gene of interest is separated from the conditionally essential gene by no more than 500 basepairs and wherein the cell is obtained by any of the methods defined in the first aspect.
[0013] Any bacterial host cell as described herein for use in a method of the invention is intended to be encompassed by the scope of the invention.
[0014] As mentioned above, genetic tools of the invention are described herein, and it is intended that the scope of the invention comprises such constructs when present in or propagated in host cells as is common in the art.
[0015] In a final aspect the invention relates to a process for producing an enzyme of interest, comprising cultivating a cell as defined in any of the preceding aspects under conditions appropriate for producing the enzyme, and optionally purifying the enzyme.
Figures [0016]
Figure 1: Schematic representation of the B. licheniformis xylose isomerase region, PCR fragments, Deletion and Integration plasmids and strains.
Figure 2: Schematic representation of the B. licheniformis gluconat region, PCR fragments, Deletion and Integration plasmids and strains.
Figure 3: Schematic representation of the B. licheniformis D-alanine racemase encoding region, PCR fragments, Deletion and Integration plasmids and strains.
Definitions [0017] In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook et al., 1989") DNA Cloning: A Practical Approach, Volumes I and II /D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds (1985)); Transcription And Translation (B.D. Hames & S.J. Higgins, eds. (1984)); Animal Cell Culture (R.l. Freshney, ed. (1986)); Immobilized Cells And Enzymes (IRL Press, (1986)); B. Perbal, A Practical Guide To Molecular Cloning (1984).
[0018] A "polynucleotide" is a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases, the sequence of the polynucleotide is the actual sequence of the bases read from the 5' to the 3' end of the polymer. Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules.
[0019] A" nucleic acid molecule" or "nucleotide sequence" refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules") in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNAand RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary or quaternary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA(i.e., the strand having a sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular biological manipulation.
[0020] A DNA "coding sequence" or an "open reading frame (ORF)" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. The ORF "encodes" the polypeptide. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNAfrom eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
[0021] An expression vector is a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription. Such additional segments may include promoter and terminator sequences, and optionally one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both.
[0022] Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
[0023] A "secretory signal sequence" is a DNA sequence that encodes a polypeptide (a "secretory peptide" that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger polypeptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.
[0024] The term "promoter" is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5' non-coding regions of genes.
[0025] A chromosomal gene is rendered "non-functional" if the polypeptide that the gene encodes can no longer be expressed in a functional form. Such non-functionality of a gene can be induced by a wide variety of genetic manipulations or alterations as known in the art, some of which are described in Sambrook et al. vide supra. Partial deletions within the ORF of a gene will often render the gene non-functional, as will mutations e.g. substitutions, insertions, frameshifts etc.
[0026] "Operably linked", when referring to DNA segments, indicates that the segments are arranged so that they function in concert e.g. the transcription process takes place via the RNA-polymerase binding to the promoter segment and proceeding with the transcription through the coding segment until the polymerase stops when it encounters a transcription terminator segment.
[0027] "Heterologous" DNA in a host cell, in the present context refers to exogenous DNA not originating from the cell.
[0028] As used herein the term "nucleic acid construct" is intended to indicate any nucleic acid molecule of cDNA, genomic DNA, synthetic DNA or RNA origin. The term "construct" is intended to indicate a nucleic acid segment which may be single- or double-stranded, and which may be based on a complete or partial naturally occurring nucleotide sequence encoding a polypeptide of interest. The construct may optionally contain other nucleic acid segments.
[0029] The nucleic acid construct of the invention encoding the polypeptide of the invention may suitably be of genomic or cDNA origin, for instance obtained by preparing a genomic or cDNA library and screening for DNA sequences coding for all or part of the polypeptide by hybridization using synthetic oligonucleotide probes in accordance with standard techniques (cf. Sambrook et al., supra).
[0030] The nucleic acid construct of the invention encoding the polypeptide may also be prepared synthetically by established standard methods, e.g. the phosphoamidite method described by Beaucage and Caruthers, Tetrahedron Letters 22 (1981), 1859 - 1869, or the method described by Matthes et al., EMBO Journal 3 (1984), 801 - 805. According to the phosphoamidite method, oligonucleotides are synthesized, e.g. in an automatic DNA synthesizer, purified, annealed, ligated and cloned in suitable vectors.
[0031] Furthermore, the nucleic acid construct may be of mixed synthetic and genomic, mixed synthetic and cDNA or mixed genomic and cDNA origin prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate), the fragments corresponding to various parts of the entire nucleic acid construct, in accordance with standard techniques. The nucleic acid construct may also be prepared by polymerase chain reaction using specific primers, for instance as described in US 4,683,202 or Saiki et al., Science 239 (1988), 487 - 491.
[0032] The term nucleic acid construct may be synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences necessary for expression of a coding sequence of the present invention [0033] The term "control sequences" is defined herein to include all components that are necessary or advantageous for expression of the coding sequence of the nucleic acid sequence. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleic acid sequence encoding a polypeptide.
[0034] The control sequence may be an appropriate promoter sequence, a nucleic acid sequence that is recognized by a host cell for expression of the nucleic acid sequence. The promoter sequence contains transcription and translation control sequences that mediate the expression of the polypeptide. The promoter may be any nucleic acid sequence that shows transcriptional activity in the host cell of choice and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
[0035] The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.
The control sequence may also be a polyadenylation sequence, a sequence which is operably linked to the 3' terminus of the nucleic acid sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
[0036] The control sequence may also be a signal peptide-coding region, which codes for an amino acid sequence linked to the amino terminus of the polypeptide which can direct the expressed polypeptide into the cell's secretory pathway of the host cell. The 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide-coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide-coding region which is foreign to that portion of the coding sequence which encodes the secreted polypeptide. A foreign signal peptide-coding region may be required where the coding sequence does not normally contain a signal peptide-coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to obtain enhanced secretion of the polypeptide relative to the natural signal peptide coding region normally associated with the coding sequence. The signal peptide- coding region may be obtained from a glucoamylase or an amylase gene from an Aspergillus species, a lipase or proteinase gene from a Rhizomucor species, the gene for the alpha-factor from Saccharomyces cerevisiae, an amylase or a protease gene from a Bacillus species, or the calf preprochymosin gene. However, any signal peptide coding region capable of directing the expressed polypeptide into the secretory pathway of a host cell of choice may be used in the present invention.
[0037] The control sequence may also be a propeptide coding region, which codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding region may be obtained from the Bacillus subtilis alkaline protease gene (aprE), the Bacillus subtilis neutral protease gene (nprT), the Saccharomyces cerevisiae alpha-factor gene, or the Myceliophthora thermophilum laccase gene (WO 95/33836).
[0038] It may also be desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems would include the lac, tac, and trp operator systems. Other examples of regulatory sequences are those which allowfor gene amplification.
[0039] Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention, especially in a bacterial host cell, are the promoters obtained from the E. coli lac operon, the Streptomyces coelicolor agarase gene (dagA), the Bacillus subtilis levansucrase gene (sacB), the Bacillus subtilis alkaline protease gene, the Bacillus licheniformis alpha-amylase gene (amyL), the Bacillus stearothermophilus maltogenic amylase gene (amyM), the Bacillus amyloliquefaciens alpha-amylase gene (amyQ), the Bacillus amyloliquefaciens BAN AMYLASE GENE, the Bacillus licheniformis penicillinase gene (penP), the Bacillus subtilis xylA and xylB genes, and the prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978,
Proceedings of the National Academy of Sciences USA 75:3727-3731 ), as well as the tac promoter (DeBoer et al., 1983,
Proceedings of the National Academy of Sciences USA 80:21-25). Further promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; and in Sambrook etat., 1989, supra.
[0040] Also disclosed are recombinant expression vectors comprising a nucleic acid sequence of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleic acid and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleic acid sequence encoding the polypeptide at such sites. Alternatively, the nucleic acid sequence of the present invention may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression, and possibly secretion.
[0041] The recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleic acid sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids. The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring selfreplication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. The vector system may be a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon.
[0042] The vectors preferably contain one or more "selectable markers" which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide, antibiotic or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
[0043] A "conditionally essential gene" may function as a "non-antibiotic selectable marker". Non-limiting examples of bacterial conditionally essential selectable markers are the dal genes from Bacillus subtills or Bacillus llchenlformls, that are only essential when the bacterium is cultivated in the absence of D-alanine. Also the genes encoding enzymes involved in the turnover of UDP-galactose can function as conditionally essential markers in a cell when the cell is grown in the presence of galactose or grown in a medium which gives rise to the presence of galactose. Non-limiting examples of such genes are those from B. subtills or B. llchenlformls encoding UTP-dependent phosphorylase (EC 2.7.7.10), UDP-glucose-dependent uridylyltransferase (EC 2.7.7.12), or UDP-galactose epimerase (EC 5.1.3.2). Also a xylose isomerase gene such as xylA, of Bacilli can be used as selectable markers in cells grown in minimal medium with xylose as sole carbon source. The genes necessary for utilizing gluconate, gntK, and gntP can also be used as selectable markers in cells grown in minimal medium with gluconate as sole carbon source. Other non-limiting examples of conditionally essential genes are given below.
[0044] Antibiotic selectable markers confer antibiotic resistance to such antibiotics as ampicillin, kanamycin, chloramphenicol, erythromycin, tetracycline, neomycin, hygromycin or methotrexate.
[0045] Furthermore, selection may be accomplished by co-transformation, e.g., as described in WO 91/17243, where the selectable marker is on a separate vector.
[0046] The vectors preferably contain an element(s) that permits stable integration of the vector, or of a smaller part of the vector, into the host cell genome or autonomous replication of the vector in the cell independent of the genome of the cell.
[0047] The vectors, or smaller parts of the vectors, may be integrated into the host cell genome when introduced into a host cell. For chromosomal integration, the vector may rely on the nucleic acid sequence encoding the polypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination.
[0048] Alternatively, the vector may contain additional nucleic acid sequences for directing integration by homologous recombination into the genome of the host cell. The additional nucleic acid sequences enable the vector to be integrated into the host cell genome at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 1,500 base pairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be nonencoding or encoding nucleic acid sequences.
[0049] The copy number of a vector, an expression cassette, an amplification unit, a gene or indeed any defined nucleotide sequence is the number of identical copies that are present in a host cell at any time. A gene or another defined chromosomal nucleotide sequence may be present in one, two, or more copies on the chromosome. An autonomously replicating vector may be present in one, or several hundred copies per host cell.
[0050] For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, pACYC184, pUB110, pE194, pTA1060, and pAMB1. The origin of replication may be one having a mutation which makes its functioning temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75:1433).
The present invention also relates to recombinant bacterial host cells, comprising a nucleic acid sequence of the invention, which are advantageously used in the recombinant production of the polypeptides. The term "host cell" encompasses any progeny of a parent cell which is not identical to the parent cell due to mutations that occur during replication.
[0051] The cell is preferably transformed with a vector comprising a nucleic acid sequence of the invention followed by integration of the vector into the host chromosome. "Transformation" means introducing a vector comprising a nucleic acid sequence of the present invention into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector. Integration is generally considered to be an advantage as the nucleic acid sequence is more likely to be stably maintained in the cell. Integration of the vector into the host chromosome may occur by homologous or non-homologous recombination as described above.
[0052] The choice of a bacterial host cell will to a large extent depend upon the gene encoding the polypeptide and its source. Useful cells are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis; or a Streptomyces cell, e.g., Streptomyces Hvidans or Streptomyces murinus, or gram negative bacteria such as E. coli and Pseudomonas sp. In a preferred embodiment, the bacterial host cell is a Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus or Bacillus subtilis cell.
[0053] The transformation of a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168:111-115 ), by using competent cells (see, e.g., Young and Spizizin, 1961, Journal of Bacteriology 81:823-829, or Dubnar and Davidoff-Abelson, 1971, Journal of Molecular Biology 56:209-221), by electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6:742-751), or by conjugation (see, e.g., Koehler and Thorne, 1987, Journal of Bacteriology 169:5771-5278).
[0054] The transformed or transfected bacterial host cells described above are cultured in a suitable nutrient medium under conditions permitting the expression of the desired polypeptide, after which the resulting polypeptide is recovered from the cells, or the culture broth. The medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection). The media are prepared using procedures known in the art (see, e.g., references for bacteria and yeast; Bennett, J.W. and LaSure, L, editors, More Gene Manipulations in Fungi, Academic Press, CA, 1991).
[0055] If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it is recovered from cell lysates. The polypeptide are recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium sulphate, purification by a variety of chromatographic procedures, e.g. ion exchange chromatography, gelfiltration chromatography, affinity chromatography, or the like, dependent on the type of polypeptide in question.
[0056] The polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide.
[0057] The polypeptides may be purified by a variety of procedures known in the art including, but not limited to, chromatography {e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures {e.g., preparative isoelectric focusing (IEF), differential solubility {e.g., ammonium sulfate precipitation), or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCFI Publishers, New York, 1989).
Detailed description of the invention [0058] A method for constructing a bacterial cell comprising at least two copies of a gene of interest stably integrated into the chromosome in different positions according to the first aspect of the invention.
[0059] In the method of the invention it is envisioned that after the directed and selectable integration of the DNA construct into the chromosome of the host cell by the first homologous recombination, a second recombination can take place between a DNA fragment comprised in the construct and a homologous host cell DNA sequence located adjecent to the gene(s) of step b) of the method of the first aspect, where the DNA fragment of the construct is homologous to said host cell DNA sequence.
[0060] Accordingly a preferred embodiment of the invention relates to the method of the first aspect, wherein subsequent to the step of introducing the DNA construct and cultivating the cell under selective conditions, or subsequent to the step of selecting a host cell, a second recombination takes place between the DNA fragment and the homologous host cell DNA sequence.
[0061] A preferred embodiment of the invention relates to the method of the first aspect, wherein subsequent to step d) and prior to step e) a second recombination takes place between the DNA fragment and the homologous host cell DNA sequence.
[0062] Further it is envisioned that one might add a marker gene to the DNA construct, which could ease selection of first recombination integrants, where the marker gene would be excised from the host cell chromosome again by the second recombination as described above.
[0063] In a preferred embodiment the invention relates to the method of the first aspect, where the DNA construct further comprises at least one marker gene which is located in the construct such that it is recombined out of the chromosome by the second recombination; preferably the at least one marker gene confers resistance to an antibiotic, more preferably the antibiotic is chosen from the group consisting of chloramphenicol, kanamycin, ampicillin, erythromycin, spectinomycin and tetracycline; and most preferably a host cell is selected which grows under the selective conditions, and which does not contain the at least one marker gene in the chromosome.
[0064] The method of the invention can also be carried out by including a marker gene in that part of the DNA construct which remains integrated in the chromosome after the second recombination event. However as it is preferred not to have marker genes in the chromosome, an alternative way of removing the marker gene must be employed after the integration has been carried out. Specific restriction enzymes or resolvases that excise portions of DNA, if it is flanked on both sides by certain recognition sequences known as resolvase sites or res-sites, are well known in the art, see e.g. WO 96/23073 (Novo Nordisk A/S).
[0065] A preferred embodiment of the invention relates to the method of the first aspect, where the DNA construct further comprises at least one marker gene located between the altered copy and the DNA fragment, and wherein the at least one marker gene is flanked by nucleotide sequences that are recognized by a specific resolvase, preferably the nucleotide sequences are res; even more preferably the at least one marker gene is excised from the chromosome by the action of a resolvase enzyme subsequent to selecting a host cell that grows under the selective conditions.
[0066] The gene of interest may encode an enzyme that is naturally produced by the host cell, indeed one may simply want to increase the number of copies of a gene endogenous to the host cell.
[0067] Accordingly a preferred embodiment of the invention relates to the method of the first aspect, wherein the gene of interest originates from the host cell.
[0068] In another preferred embodiment the invention relates to the method of the first aspect, wherein the gene of interest encodes an enzyme, preferably an amylolytic enzyme, a lipolytic enzyme, a proteolytic enzyme, a cellulytic enzyme, an oxidoreductase or a plant cell-wall degrading enzyme, and more preferably an enzyme with an activity selected from the group consisting of aminopeptidase, amylase, amyloglucosidase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta-galactosidase, glucoamylase, glucose oxidase, glucosidase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinase, peroxidase, phytase, phenoloxidase, polyphenoloxidase, protease, ribonuclease, transferase, transglutaminase, or xylanase.
[0069] As mentioned above, the gene of interest may be endogenous to the host cell, however it may be advantageous if the production cell obtained by the method of the invention contains as little exogenous, foreign, or heterologous DNA as possible when the integration procedure is completed.
[0070] Consequently a preferred embodiment of the invention relates to the method of the first aspect, wherein the selected host cell that grows under the selective conditions comprises substantially no exogenous DNA, preferably less than 500 basepairs per
Integrated gene of interest, more preferably less than 300 bp, even more preferably less than 100 bp, still more preferably less than 50 bp, more preferably less than 25 bp per integrated gene of interest, or most preferably no exogenous DNA.
[0071] Yet a preferred embodiment of the invention relates to the method of the first aspect, wherein the selected host cell that grows under the selective conditions comprises DNA only of endogenous origin.
[0072] Another embodiment relates to the method, wherein the host cell selected in step e) of the first aspect comprises DNA only of endogenous origin.
[0073] Many ways exist in the art of rendering a gene non-functional by alteration or manipulation, such as partially deleting the gene or the promoter of the gene, or by introducing mutations in the gene or the promoter region of the gene.
[0074] A preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the host cell is altered by partially deleting the gene(s), or by introducing one or more mutations in the gene(s).
[0075] The present invention relies on rendering at least one conditionally essential chromosomal gene(s) in the bacterial host cell non-functional in a step, and in particular relies on a number of conditionally essential genes to be rendered non-functional. The gene(s) may be rendered non-functional by a partial deletion or a mutation as known in the art; specifically the gene(s) may be rendered non-functional through the use of a "Deletion plasmid(s)" as shown herein in non-limiting examples below. For each of the preferred embodiments relating to the altered chromosomal gene(s) of step b) of the method of the first aspect, the most preferred embodiment is shown by non-limiting examples herein and reference is made to the genetic tools constructed for that purpose, such as the PCR primer sequences used for constructing the "Deletion plasmid(s)".
Accordingly a preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the host cell that is altered encodes a D-alanine racemase, preferably the gene(s) is a dal homologue from a Bacillus cell, more preferably the gene is homologous to dal from Bacillus subtills, and most preferably the gene(s) is the dal gene of Bacillus llchenlformls.
[0076] Another preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered encodes a D-alanine racemase and is at least 75% identical, preferably 80% identical, or preferably 85% identical, more preferably 90% identical, or more preferably 95% and most preferably at least 97% identical to the dal sequence of Bacillus llchenlformls shown in positions 1303 to 2469 in SEQ ID 12.
[0077] The conditionally essential gene(s) may encode polypeptides involved in the utilization of specific carbon sources such as xylose or arabinose, in which case the bacterial host cell is unable to grow in a minimal medium supplemented with only that specific carbon source when the gene(s) are non-functional.
[0078] A preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered is one or more genes that are required for the host cell to grow on minimal medium supplemented with only one specific main carbon-source.
[0079] A preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered is of a xylose operon, preferably the gene(s) is homologous to the xylA gene from Bacillus subtills, and most preferably the gene(s) is homologous to one or more genes of the xylose isomerase operon of Bacillus llchenlformls.
[0080] A preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered encodes a galactokinase (EC 2.7.1.6), an UTP-dependent pyrophosphorylase (EC 2.7.7.10), an UDP-glucose-dependent uridylyltransferase (EC 2.7.7.12), or an UDP-galactose epimerase (EC 5.1.2.3), preferably the gene(s) encodes an UDP-galactose epimerase (EC 5.1.2.3), more preferably the gene(s) is homologous to galE of a Bacillus, and most preferably the gene is galE of Bacillus llchenlformls.
[0081] A preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered is one or more gene(s) of a gluconate operon, preferably the gene(s) encodes a gluconate kinase (EC 2.7.1.12) or a gluconate permease or both, more preferably the gene(s) is one or more genes homologous to the gntK or gntP genes from Bacillus subtills, and most preferably the gene(s) is the gntK or gntP gene from Bacillus licheniformis.
[0082] Another preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered is one or more gene(s) of a gluconate operon, preferably the gene(s) encodes a gluconate kinase (EC 2.7.1.12) or a gluconate permease or both and is at least 75% identical, preferably 85% identical, more preferably 95% and most preferably at least 97% identical to any of the gntKand gntP sequences of Bacillus Ucheniformis.
[0083] Another preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered is one or more gene(s) of a glycerol operon, preferably the gene(s) encodes a glycerol uptake facilitator (permease), a glycerol kinase, or a glycerol dehydrogenase, more preferably the gene(s) is one or more genes homologous to the glpP, glpF, glpK, and glpD genes from Bacillus subtilis, and most preferably the gene(s) is one or more genes of glpP, glpF, glpK and glpD genes from Bacillus Ucheniformis shown in SEQ ID No:26.
[0084] Still another preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered is one or more gene(s) of a glycerol operon, preferably the gene(s) encodes a glycerol uptake facilitator (permease), a glycerol kinase, or a glycerol dehydrogenase, and is at least 75% identical, preferably 85% identical, more preferably 95% and most preferably at least 97% identical to any of the glpP, glpF, glpK, and glpD sequences of Bacillus Ucheniformis shown in SEQ ID No:26.
[0085] One preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered is one or more gene(s) of an arabinose operon, preferably the gene(s) encodes an arabinose isomerase, more preferably the gene(s) is homologous to the araA gene from Bacillus subtilis, and most preferably the gene(s) is the araA gene from Bacillus Ucheniformis shown in SEQ ID No:38.
[0086] A preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell that is altered is one or more gene(s) of an arabinose operon, preferably the gene(s) encodes an arabinose isomerase, and is at least 75% identical, preferably 85% identical, more preferably 95% and most preferably at least 97% identical to the araA sequence of Bacillus Ucheniformis shown in SEQ ID No:38.
[0087] Other conditionally essential genes are well-described in the literature, for instance genes that are required for a cell to synthesize one or more amino acids, where a non-functional gene encoding a polypeptide required for synthesis of an amino acid renders the cell auxotrophic for that amino acid, and the cell can only grow if the amino acid is supplied to the growth medium. Restoration of the functionality of such a gene allows the cell to synthesise the amino acid on its own, and it becomes selectable against a background of auxotrophic cells.
[0088] Consequently, a preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell encodes one or more polypeptide(s) involved in amino acid synthesis, and the non-functionality of the gene(s) renders the cell auxotrophic for one or more amino acid(s), and wherein restoration of the functionality of the gene(s) renders the cell prototrophic for the amino acid(s).
[0089] A particularly preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell encodes one or more polypeptide(s) involved in lysine or methionine synthesis, more preferably the gene(s) is homologous to the metC or the lysA genes from Bacillus subtilis, and most preferably the gene(s) is the metC or the lysA gene from Bacillus Ucheniformis.
[0090] Another particularly preferred embodiment of the invention relates to the method of the first aspect, wherein the conditionally essential chromosomal gene(s) of the bacterial host cell is at least 75% identical, preferably 85% identical, more preferably 95% identical and most preferably at least 97% identical to the metC sequence of Bacillus Ucheniformis shown in SEQ ID No:42 or the lysA sequence of Bacillus Ucheniformis shown in SEQ ID No:48.
[0091] As described herein the method of the invention is very relevant for the biotech industry and a number of preferred organisms are very well known in this industry, especially Gram positive host cells, and certainly host cells of the Bacillus genus, specifically Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus Ucheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.
[0092] A preferred embodiment of the invention relates to the method of the first aspect, wherein the host cell is a Gram-positive bacterial cell, preferably a Bacillus cell, and most preferably a Bacillus cell chosen from the group consisting of Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.
[0093] Another preferred embodiment of the invention relates to the method of the first aspect, wherein the DNA construct is a plasmid.
[0094] The present invention provides a method for constructing a bacterial production host cell that is very useful to the biotech industry, such as, a bacterial host cell of the second aspect comprising at least two copies of a gene of interest stably integrated into the chromosome, which contains less than 500 exogenous basepairs per integrated gene of interest, where at least one copy is integrated adjacent to a conditionally essential gene encoding a D-alanine racemase; a conditionally essential gene that is required for the host cell to grow on minimal medium supplemented with only one specific main carbon-source; a conditionally essential gene of a xylose operon, a conditionally essential gene encoding a galactokinase (EC 2.7.1.6), an UTP-dependent pyrophosphorylase (EC 2.7.7.10), an UDP-glucose-dependent uridylyltransferase (EC 2.7.7.12), or an UDP-galactose epimerase (EC 5.1.2.3); a conditionally essential gene of a gluconate operon, a glycerol operon, or an arabinose operon; OR a conditionally essential gene which encodes one or more polypeptide(s) involved in amino acid synthesis; wherein the gene of interest is separated from the conditionally essential gene by no more than 500 basepairs and wherein the cell is obtained by any of the methods defined in the first aspect.
[0095] The method of the first aspect describes the integration of a gene of interest into the chromosome of a bacterial host cell, so that the gene of interest is integrated in a position that is adjecent to the conditionally essential locus. The exact relative positions of the gene of interest and the locus are not of major relevance for the method, however generally speaking it is of interest to minimize the distance in basepairs separating the two, both to achieve a more stable integration, but also to minimize the integration of superfluous DNA sequence into the host cell genome.
[0096] Accordingly a preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein the gene of interest is separated from the conditionally essential locus by no more than 500 basepairs, even more preferably no more than 250 basepairs, and most preferably no more than 100 basepairs.
[0097] As mentioned above, it is of interest to minimize the presence of integrated or superfluous DNA sequence in the host cell genome, especially DNA of exogenous origin, and the ideal host cell contains only DNA of endogenous origin such as multiple copies of an endogenous gene of interest integrated in different well defined chromosomal locations.
[0098] Consequently a preferred embodiment of the invention relates to the bacterial host cell of the second aspect, which contains less than 300 bp, even more preferably less than 100 bp, still more preferably less than 50 bp, more preferably less than 25 bp per integrated gene of interest, or most preferably no exogenous DNA.
[0099] Another preferred embodiment of the invention relates to the bacterial host cell of the second aspect, which contains only endogenous DNA.
[0100] Certain bacterial strains are preferred as host cells in the biotech industry as mentioned previously.
[0101] A preferred embodiment of the invention relates to the bacterial host cell of the second aspect, which is a Gram-positive bacterial cell, preferably a Bacillus cell, and most preferably a Bacillus cell chosen from the group consisting of Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.
[0102] Another preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein a copy of the gene of interest is integrated adjecent to a gene encoding a D-alanine racemase, preferably a gene homologous to the dal gene from Bacillus subtilis, more preferably a gene at least 75% identical to the dal sequence of Bacillus licheniformis shown in positions 1303 to 2469 in SEQ ID 12, even more preferably 80% identical, or even more preferably a gene at least 85% identical, still more preferably 90% identical, more preferably at least 95% identical, and most preferably at least 97% identical to the dal sequence of Bacillus licheniformis shown in positions 1303 to 2469 in SEQ ID 12.
[0103] A particularly preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein a copy of the gene of interest is integrated adjacent to a gene that is required for the host cell to grow on minimal medium supplemented with only one specific main carbon-source.
[0104] Yet another preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein a copy of the gene of interest is integrated adjecent to a gene of a xylose operon, preferably adjecent to genes homologous to the xylR or xylA genes from Bacillus subtilis, and most preferably adjecent to xylR or xylA from Bacillus licheniformis.
[0105] One more preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein a copy of the gene of interest is integrated adjecent to a gene encoding a galactokinase (EC 2.7.1.6), an UTP-dependent pyrophosphorylase (EC 2.7.7.10), an UDP-glucose-dependent uridylyltransferase (EC 2.7.7.12), or an UDP-galactose epimerase (EC 5.1.2.3), preferably adjecent to a gene encoding an UDP-galactose epimerase (EC 5.1.2.3), more preferably adjecent to a gene homologous to the galE gene from Bacillus subtilis, and most preferably adjecent to galE from Bacillus licheniformis.
[0106] An additional preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein a copy of the gene of interest is integrated adjecent to a gene of a gluconate operon, preferably adjecent to a gene that encodes a gluconate kinase (EC 2.7.1.12) or a gluconate permease, more preferably adjecent to a gene homologous to a Bacillus subtilis gene chosen from the group consisting of gntR, gntK, gntP, and gntZ, and most preferably adjecent to gnfR, gntK, gntR or gntZ from Bacillus licheniformis.
[0107] Yet an additional preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein a copy of the gene of interest is integrated adjacent to a gene of a glycerol operon, preferably the gene encodes a glycerol uptake facilitator (permease), a glycerol kinase, or a glycerol dehydrogenase, more preferably the gene is homologous to the glpR glpF, glpK, or glpD gene from Bacillus subtilis, and most preferably the gene is the glpP, glpF, glpK, or glpD gene from Bacillus licheniformis shown in SEQ ID No:26.
[0108] Another particularly preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein a copy of the gene of interest is integrated adjacent to a gene of an arabinose operon, preferably the gene encodes an arabinose isomerase, more preferably the gene is homologous to the araA gene from Bacillus subtilis, and most preferably the gene is the araA gene from Bacillus licheniformis shown in SEQ ID No:38.
[0109] Still a preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein a copy of the gene of interest is integrated adjacent to a gene which encodes one or more polypeptide(s) involved in amino acid synthesis, and the non-functionality of the gene(s) renders the cell auxotrophic for one or more amino acid(s), and wherein restoration of the functionality of the gene(s) renders the cell prototrophic for the amino acid(s); preferably the gene of interest is integrated adjacent to a gene which encodes one or more polypeptide(s) involved in lysine or methionine synthesis, more preferably the gene(s) is homologous to the metC or the lysA genes from Bacillus subtilis, and most preferably the gene(s) is the metC or the lysA gene from Bacillus licheniformis. Also preferably the gene of interest is integrated adjacent to a gene which is at least 75% identical, preferably 85% identical, more preferably 95% and most preferably at least 97% identical to the metC sequence of Bacillus licheniformis shown in SEQ ID No:42 or the lysA sequence of Bacillus licheniformis shown in SEQ ID No:48.
[0110] The bacterial host cell of the second aspect is especially interesting for the industrial production of polypeptides such as enzymes. A preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein the gene of interest encodes an enzyme, preferably an amylolytic enzyme, a lipolytic enzyme, a proteolytic enzyme, a cellulytic enzyme, an oxidoreductase or a plant cell-wall degrading enzyme, and more preferably an enzyme selected from the group consisting of aminopeptidase, amylase, amyloglucosidase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta-galactosidase, glucoamylase, glucose oxidase, glucosidase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinase, peroxidase, phytase, phenoloxidase, polyphenoloxidase, protease, ribonuclease, transferase, transglutaminase, or xylanase. Also preferably the gene of interest encodes an antimicrobial peptide, preferably an anti-fungal peptide or an antibacterial peptide; or the gene of interest encodes a peptide with biological activity in the human body, preferably a pharmaceutically active peptide, more preferably insulin/pro-insulin/pre-pro-insulin or variants thereof, growth hormone or variants thereof, or blood clotting factor VII or VIII or variants thereof.
[0111] A further preferred embodiment of the invention relates to the bacterial host cell of the second aspect, wherein no antibiotic markers are present.
[0112] The present invention teaches the construction of bacterial host cells that are suitable for use in the method of the first aspect, especially host cells wherein one, two or more conditionally essential genes are rendered non-functional. In non-limiting examples below is shown how the preferred conditionally essential genes of the invention are rendered non-functional through a partial deletion by using specific Deletion Plasmids of the invention.
[0113] A final aspect of the invention relates second to a process for producing an enzyme of interest, comprising cultivating a bacterial host cell of the second aspect under conditions appropriate for producing the enzyme, and optionally purifying the enzyme.
Examples Example 1 [0114] Bacillus licheniformis SJ4671 (WO 99/41358) comprises two stably integrated amyL gene copies in its chromosome, inserted in opposite relative orientations in the region of the B. licheniformis alpha-amylase gene, amyL. The following example describes the insertion into this strain of a third amyL gene copy bv selectable, directed integration into another defined region of the B. licheniformis chromosome resulting in a strain comprising three stable chromosomal copies of the amyL gene but which is devoid of foreign DNA.
Xylose isomerase deletion/integration outline (Figure 1) [0115] The sequence of the Bacillus lichenformis xylose isomerase region is available in GenBank/EMBL with accession number Z80222.
[0116] A plasmid denoted "Deletion plasmid" was constructed by cloning two PCR amplified fragments from the xylose isomerase region on a temperature-sensitive parent plasmid. The PCR fragments were denoted "A" and "B", wherein A comprises the xylR promoter and part of the xylR gene; and B comprises an internal fragment of xylA missing the promoter and the first 70 basepairs of the gene. A spectinomycin resistance gene flanked by resolvase (res) sites was introduced between fragments A and B on the plasmid. This spectinomycin resistance gene could later be removed by resolvase-mediated site-specific recombination.
[0117] The xylose isomerase deletion was transferred from the Deletion plasmid to the chromosome of a Bacillus target strain by double homologous recombination via fragments A and B, mediated by integration and excision of the temperature-sensitive plasmid. The resulting strain was denoted "Deletion strain". This strain is unable to grow on minimal media with xylose as sole carbon source.
[0118] An "Integration plasmid" was constructed for insertion of genes into the xylose isomerase region of the Deletion strain. We intended to PCR-amplify a fragment denoted "C" comprising the xylA promoter and about 1 kb of the xylA gene. However, as later described, only a smaller fragment denoted "D" comprising the xylA promoter and the first 250 basepairs of the xylA gene was succesfully amplified and cloned. The Integration plasmid comprises fragments A and D on a temperature-sensitive vector. An expression cassette was also cloned in the Integration plasmid between fragments A and D.
[0119] The temperature-sensitive Integration plasmid was transferred to the B. licheniformis Deletion strain and it integrated in the chromosome; subsequent excision of the temperature sensitive vector was ensured, and "Integration strains" could then be isolated which grow on minimal media with xylose as sole carbon source. Such Integration strains have restored the chromosomal xylA gene, by double homologous recombination via fragments A and D. In this process, the expression cassette has been integrated into the chromosome.
Plasmid constructs [0120] PCR amplifications were performed with Ready-To-Go PCR Beads from amersham pharmacia biotech as described in the manufacturers instructions, using an annealing temperature of 55°C.
Plasmids PSJ5128 and PSJ5129: [0121] The A fragment (xylR promoter and part of the xylR gene) was amplified from Bacillus licheniformis PL1980 chromosomal DNA using primers: #183235; [H/ndlll—Z80222 1242-1261—] (SEQ ID 1):
5'-GACTAAGCTTCT GCATAGT GAGAGAAGACG #183234: [EcoRI; Bg/ll; Λ/of I; iW/ul; Sa/I; Seal —Z80222 2137-2113—] (SEQ ID 2): 5’-
GACTGAATTCAGATCTGCGGCCGCACGCGTGTCGACAGTACTGAAATAGAGGAAAAAAT
AAGTTTTC
[0122] The PCR fragment was digested with EcoRI and H/ndlll and purified, then ligated to EcoRI and H/ndlll digested pUC19. The ligation mixture was transformed by electroporation into E. coli SJ2, and transformants were selected for ampicillin resistance (200 pg/ml). The PCR-fragments of three such ampicillin resistant transformants were sequenced and all were found to be correct. Two clones designated SJ5128 (SJ2/pSJ5128) and SJ5129 (SJ2/pSJ5129) were kept.
Plasmids PSJ5124. PSJ5125: [0123] The B fragment (an internal part of xylA, missing the promoter and the first 70 basepairs of the coding region), was amplified from B. licheniformis PL1980 chromosomal DNA using primers: #183230 [EcoRI —Z80222 3328-3306—] (SEQ ID 3):
5'-GACTGAATTCCGTATCCATTCCTGCGATATGAG #183227 [BamHI; Bg/ll —Z80222 2318-2342—] (SEQ ID 4):
5'-GACTGGAT CCAGAT CTT ATT ACAACCCT GAT GAATTT GT CG
[0124] The PCR fragment was digested with EcoRI and BamHI, and purified, then ligated to EcoRI + BamHI digested pUC19 and transformed by electroporation into E. coli SJ2. Transformants were selected for ampicillin resistance (200 pg/ml). Two clones were correct as confirmed by DNA sequencing, and were kept as SJ5124 (SJ2/pSJ5124) and SJ5125 (SJ2/pSJ5125).
Plasmid PSJ5130: [0125] The C fragment (comprising the xyiA promoter and about 1 kb of the xylA gene) was PCR amplified from B. licheniformis PL1980 chromosomal DNA using primers: #183230 (see above, SEQ ID 3) #183229 [BamHI; Bg/ll; Nhe\\ C/al; Sadl —Z80222 2131-2156—] (SEQ ID 5): 5'-
GACTGGATCCAGATCTGCTAGCATCGATCCGCGGCTATTTCCATTGAAAGCGATTAATT
G
[0126] The PCR fragment was digested with EcoRI and BamHI and purified, then ligated to EcoRI and BamHI digested pUC19 and transformed by electroporation, into E. coli SJ2. Transformants were selected for ampicillin resistance (200 pg/ml). One clone, comprising the full-length PCR fragment, was found to have a single basepair deletion in the promoter region, between the -35 and -10 sequences. This transformant was kept as SJ5130 (SJ2/pSJ5130).
Plasmid PSJ5131: [0127] This plasmid was constructed as pSJ5130, above, but turned out to contain a 400 basepair PCR fragment only (the D fragment), comprising the xylA promoter and the first 250 basepairs of the xylA coding sequence. DNAsequencing confirmed that the no sequence errors were present in the fragment. The transformant was kept as SJ5131 (SJ2/pSJ5131).
Plasmids PSJ5197. PSJ5198: [0128] These plasmids comprise the A (xylR) fragment on a temperature-sensitive, mobilizable vector. They were constructed by ligating the 0.9 kb Bgl\\-Hindl\\ fragment from pSJ5129 to the 5.4 kb Bgl\\-Hind\\\ fragment from pSJ2739, and transformingS. subtilis DN1885 competent cells with the ligation mix followed by selecting for erythromycin resistance (5 pg/ml). Two clones were kept, SJ5197 (DN1885/pSJ5197) and SJ5198 (DN1885/pSJ5198).
Plasmids PSJ5211. pSJ5212: [0129] These plasmids contain a res-spc-res cassette inserted next to the B fragment. They were constructed by ligating the 1.5 kb Bc/l-6amHI fragment from pSJ3358 into the BglW site of pSJ5124, and transforming the ligation mix into E. coli SJ2 and selecting for ampicillin resistance (200 pg/ml) and spectinomycin resistance (120 pg/ml) resistance. Two clones were kept, wherein the res-spc-res cassette was inserted in either of the possible orientations, SJ5211 (SJ2/pSJ5211) and SJ5212 (SJ2/pSJ5212).
The Deletion plasmid Plasmid PSJ5218: [0130] This plasmid contains the res-spc-res cassette flanked by the A and B fragments. It was constructed by ligating the 2.5 kb EcoRI-SamHI fragment from pSJ5211 to the 5.3 kb EcoR\-Bgl\\ fragment from pSJ5197, and transforming the ligation mix into B. subtilis DN1885 and selecting for erythromycin (5 pg/ml) and spectinomycin resistance (120 pg/ml) resistance at 30°C. One transformant, SJ5218 (DN1885/pSJ5218) was kept.
The Integration plasmids Plasmids PSJ5247. PSJ5248: [0131] These plasmids comprise the short 400 basepairs D fragment (PxylA-xylA) as well as the A fragment (xylR) on a temperature-sensitive, mobilizable vector. They were made by ligating the 0.4 kb Bgl\\-EcoR\ fragment from pSJ5131 to the 5.3 kb Bg/ll-EcoRI fragment from pSJ5197, and transforming the ligation mix into B. subtilis DN1885 and selecting for erythromycin resistance (5 pg/ml) at 30°C. Two transformants, SJ5247 (DN1885/pSJ5247) and SJ5248 (DN1885/pSJ5248) were kept.
Construction of strains with chromosomal xylA deletions.
[0132] The deletion plasmid pSJ5218 was transformed into competent cells of the B. subtilis conjugation donor strain PP289-5 (which contains a chromosomal da/-deletion, and plasmids pBC16 and pl_S20), transformants were selected for resistance to spectinomycin (120 pg/ml), erythromycin (5 pg/ml) and tetracycline (5 pg/ml) on plates with D-alanine (100 pg/ml) at 30°C. Two transformants were kept, SJ5219 and SJ5220.
[0133] The two-copy B. licheniformis alpha-amylase strain SJ4671, described in WO 99/41358 was used as recipient in conjugations.
[0134] Donor strains SJ5219 and SJ5220 ware grown overnight at 30°C on LBPSG plates (LB plates with phosphate (0.01 M K3PO4), glucose (0.4 %), and starch (0.5 %)) supplemented with D-alanine (100 pg/ml), spectinomycin (120 pg/ml), erythromycin (5 pg/ml) and tetracycline (5 pg/ml). The recipient strain was grown overnight on LBPSG plates.
[0135] An inoculation needle loopful of donor and recipient were mixed on the surface of a LBPSG plate with D-alanine (100 pg/ml), and incubated at 30°C for 5 hours. This plate was then replicated onto LBPSG with erythromycin (5 pg/ml) and spectinomycin (120 pg/ml), and incubation was at 30°C for 2 days. These four conjugations resulted in between 13 and 25 transconjugants.
[0136] Tetracycline-sensitive (indicating absence of pBC16) transconjugants were reisolated on LBPSG with erythromycin (5 pg/ml) and spectinomycin (120 pg/ml) at 50°C, incubated overnight, and single colonies from the 50°C plates were inoculated into 10 ml TY liquid cultures and incubated with shaking at 26°C for 3 days. Aliquots were then transferred into fresh 10 ml TY cultures and incubation proceeded overnight at 30°C. The cultures were plated on LBPSG with 120 pg/ml spectinomycin, after overnight incubation at 30°C these plates were replica plated onto spectinomycin and erythromycin, respectively, and erythromycin sensitive, spectinomycin resistant isolates were obtained from all strain conjugations.
[0137] The following strains, containing the chromosomal xylA promoter and the first 70 basepairs of the xylA coding sequence replaced by the res-spc-res cassette, were kept: SJ5231: SJ4671 recipient, SJ5219 donor. SJ5232: SJ4671 recipient, SJ5220 donor.
[0138] Strain phenotypes were assayed on TSS minimal medium agar plates, prepared as follows. 400 ml H2O and 10 g agar is autoclaved at 121°C for 20 minutes, and allowed to cool to 60°C. The following sterile solutions are added:
[0139] Bacillus licheniformis SJ4671 grows well on both glucose and xylose TSS plates, forming brownish coloured colonies.
[0140] The xylA deletion strains SJ5231-SJ5232 grow well on glucose TSS plates, but only a very thin, transparent growth is formed on the TSS xylose plates, even after prolonged incubation. These strains are clearly unable to use xylose as the sole carbon source.
Directed and selectable integration into the xyl region.
[0141] Integration plasmid pSJ5247 (containing the D and Afragments), and as a negative control pSJ5198 (containing only the A fragment) were transformed into competent cells of the B. subtilis conjugation donor strain PP289-5 (which contains a chromosomal da/-deletion, and plasmids pBC16 and pLS20), transformants were selected for resistance to erythromycin (5 pg/ml) and tetracycline (5 pg/ml) on plates with D-alanine (100 pg/ml) at 30°C. Transformants kept were: SJ5255: PP289-5/pSJ5198. SJ5257: PP289-5/pSJ5248.
[0142] Donor strains SJ5255 and SJ5257 were used in conjugations to recipient SJ5231. Selection of transconjugants was on erythromycin (5 pg/ml), at 30°C. Transconjugants were streaked on TSS plates with xylose, at 50°C. In parallel, SJ5221 was streaked as a xylose isomerase positive control strain (also at 50°C).
[0143] After overnight incubation, all strains had formed a very thin, transparent growth. The control, however, was better growing and colonies were brownish.
[0144] After another day of incubation at 50°C, some brownish colonies were coming up on the background of thin, transparent growth, in transconjugants derived from SJ5257, i.e. the strain containing the Integration plasmid with the PxylA-xylA fragment (D). These colonies were steadily growing, and further colonies were coming up, during subsequent days of continued incubation at 50°C.
[0145] No brownish colonies (and no further growth than the thin, transparent growth seen after the first overnight incubation) were observed from transconjugants derived from SJ5255 (the negative control, unable to restore the chromosomal xylA gene).
Directed integration of an alpha-amylase gene into the xyl region.
Construction of an amvL containing integration plasmid [0146] Plasmids pSJ5291 and pSJ5292 were constructed from the integration vector plasmid pSJ5247 by digestion of this plasmid with BglW, and insertion of the 1.9 kb amyL containing Bg/ll-Bc/l fragment from pSJ4457 (described in WO 99/41358). The ligation mixture was transformed into B. subtilis DN1885 and two transformants were kept as SJ5291 and SJ5292.
Construction of coniuaative donor strains, transfer to B. licheniformis hosts, and chromosomal integration [0147] Plasmids pSJ5291 and pSJ5292 were transformed into competent cells of the B. subtilis conjugation donor strain PP289-5 (which contains a chromosomal da/-deletion, and plasmids pBC16 and pl_S20), transformants were selected for resistance to erythromycin (5 pg/ml) and tetracycline (5 pg/ml) on plates with D-alanine (100 pg/ml) at 30°C.
[0148] Transformants kept were SJ5293 (PP289-5/pSJ5291) and SJ5294 (PP289-5/pSJ5292). These two strains were used as donors in conjugations to xylose isomerase deletion strains SJ5231 and SJ5232. Transconjugants were selected on LBPGA plates with erythromycin (5 pg/ml), and one or two tetracyclin-sensitive transconjugants from each conjugation were streaked on a TSS-xylose plate which was incubated at 50°C. After two days incubation, well-growing colonies were inoculated into liquid TY medium (10 ml) without antibiotics, and these cultures were incubated with shaking at 30°C. After overnight incubation, 100 pi from each culture were transferred into new 10 ml TY cultures, and incubation repeated. This procedure was repeated another two times, and in addition the cultures were plated on TSS-xylose plates at 30°C. After about a week, all plates were replicaplated onto TSS-xylose as well as LBPSG with erythromycin (5 pg/ml). The following day, putative Em-sensitive strains were restreaked on the same plate types. The following Em sensitive strains, which all growwell on TSS-xylose plates, were kept: SJ5308 (from conjugation donor SJ5293, host SJ5231) SJ5309 (from conjugation donor SJ5293, host SJ5231) SJ5310 (from conjugation donor SJ5293, host SJ5232) SJ5315 (from conjugation donor SJ5294, host SJ5231)
Southern analysis.
[0149] The two-copy amyL strain SJ4671, and strains SJ5308, SJ5309, SJ5310 and SJ5315, were grown overnight in TY-glucose, and chromosomal DNAwas extracted. The chromosomal DNAwas digested with H/ndlll, fragments separated by agarose gel electrophoresis, transferred to Immobilon-N® filters (Millipore®) and hybridised to a biotinylated probe based on Hindlll digested pSJ5292 (using NEBIot Photope Kit and Photope Detection Kit 6K).
[0150] In the two-copy strain, the two amyL gene copies reside on a -10 kb H/ndlll fragment. In addition, an -2.8 kb fragment is hybridizing, which is due to hybridization to the xyl region. In the four strains with insertions of a third amyL gene into the xylose gene region, the -2.8 kb fragment is missing and has been replaced by a fragment of -4.6 kb. This is entirely as expected upon integration of the amyL gene into the xylose gene region. The -10 kb fragment due to the two-copy insertion is retained.
In conclusion, the southern analysis shows that strains SJ5308. SJ5309, SJ5310 and SJ5315 have a correctly inserted third amyL gene copy in their chromosome.
Shake flask evaluation.
[0151] Strains with the amyL gene integrated in the xylose isomerase region, as well as several control strains, were inoculated into 100 ml BPX medium in shake flasks and incubated at 37°C with shaking at 300 rpm for 7 days.
Alpha-amylase activity in the culture broth was determinated by the Phadebas assay:
[0152] Aliquots from each shake flask were plated on amylase indicator plates. All colonies were amylase positive. Four single colonies from each of SJ4671, SJ5309 and SJ5315 were inoculated into fresh BPX shake flasks, which were cultured as above. Alpha-amylase activity in the culture broth was determinated by the Phadebas assay:
[0153] Under these shake flask conditions, the three copy amyL strains (bold) seem to produce about 50% more alpha-amylase than the two-copy strain.
Example 2 [0154] A strain of Bacillus licheniformis having two stably integrated amyL gene copies in its chromosome, inserted in opposite relative orientations in the region of the B. licheniformis alpha-amylase gene, amyL, has been described in WO 99/41358, as SJ4671. A third copy of the amyL gene was inserted in xylRA as described above [0155] This describes the insertion into this three-copy strain of a fourth amyL gene copy by selectable, directed integration into another region of the B. licheniformis chromosome.
Gluconat deletion/integration outline (Figure 2) [0156] The sequence region of the Bacillus lichenformis gluconate operon comprising the gntR, gntK, gntP, gntZ genes for utilization of gluconate is available in Genbank/EMBL with accession number D31631. The region can be schematically drawn as shown in figure 2.
[0157] A deletion was introduced by cloning, on a temperature-sensitive plasmid, the PCR amplified fragments denoted as "A" (containing part of the gntK and part of the gntP gene) and "B" (containing an internal fragment of gntZ). As a help in the selection of deletion strains, a kanamycine resistance gene flanked by resolvase sites was introduced between fragments "A" and "B", resulting in the plasmid denoted "Deletion plasmid" in figure 2. This kanamycine resistance gene could later be removed by resolvase-mediated site-specific recombination, as described in WO 96/23073.
[0158] The deletion was transferred to the chromosome of target strains by double homologous recombination via fragments "A" and "B", mediated by integration and excision of the temperature-sensitive plasmid. The result was the strain, labelled "Deletion strain" in figure 2. This strain is unable to grow on minimal media with gluconate as sole carbon source.
Plasmid constructs [0159] To construct an Integration plasmid to be used for gene insertions, the PCR fragment "C" was amplified. This fragment contained an internal fragment of gntP of about 1 Kb. The Integration plasmid consists of fragments "B" and "C" on a temperature-sensitive vector. The expression cassette destined for integration is cloned between "B" and "C". Upon transfer to the B. licheniformis Deletion strain and integration and excision of the temperature-sensitive vector, strains could be isolated which grew on minimal media with gluconate as sole carbon source. Such strains had restored the chromosomal gntP gene by double homologous recombination via fragments "B" and "C". In this process, the expression cassette was integrated into the chromosome resulting in the "Integration strain" of figure 2.
[0160] PCR amplifications were performed with Ready-To-Go PCR Beads from amersham pharmacia biotech as described in the manufacturers instructions, using an annealing temperature of 55°C.
The Deletion Plasmids PMOL1789 and PMOL179Q: [0161] The "B" fragment (containing the internal part of the gntZ) was amplified from chromosomal DNA from Bacillus licheniformis using primers #187338 [Ava\ ^D31631 4903-4922^] (SEQ ID 6):
5'-TATTT CCCGAGATT CT GTTAT CGACT CGCT C #187339 [Eag\ ^D31631 5553-5538^] (SEQ ID 7):
5'-GTTTT CGGCCGCTGTCCGTT CGT CTTT
[0162] The fragment was digested with Aval + Eag\, ligated to Aval + Eag\ digested pMOL1642, and the ligated plasmid was introduced, by transformation, into B. subtilis JA578 selecting for erythromycin resistance (5 pg/ml). The insert on three clones was sequenced, and all found to be correct. MOL1789 (JA578 (/ΌρΕ+)/ρΜΟΙ_1789) and MOL1790 (JA578/pMOL1790) were kept. The endpoint of the "B" fragment relative to gntZ is shown in fig. 2.
Plasmids pMOL1820 and PMOL1821: [0163] The "A" fragment (containing part of the gntK and part of the gntP gene), was amplified from chromosomal DNA of Bacillus licheniformis using primers #184733 [<—D31631 3738-3712^] (SEQ ID 8):
5'-GT GT GACGGAT AAGGCCGCCGTCATT G #184788 [<—D31631 3041-3068^] (SEQ ID 9):
5'-CTCTTGTCTCGGAGCCTGCATTTTGGGG
[0164] The fragment was digested with C/aI + EcoRI, ligated to EcoRI + C/al digested pMOL1789, and transformed, by transformation, into B. subtills PL1801 selecting for erythromycin resistance (5 pg/ml). The insert on three clones was sequenced, and all found to be correct. MOL1820 (JA578/pMOL1820) and MOL1821 (JA578/pMOL1821) were kept. The endpoint of the "A" fragment relative to gntZ is shown in fig. 2.
The Integration plasmids PMOL1912 and PMOL1913: [0165] These plasmids contain a short C-terminal part of gntK and the entire open reading frame of gntP (the "C" fragment) on a temperature-sensitive, mobilizable vector. They were made by ligating a 0.9 kb fragment amplified from chromosomal DNA of Bacillus licheniformis using primers: #B1656D07 [^D31631 3617-3642^] (SEQ ID 10):
5'-AGCATTATTCTTCGAAGTCGCATTGG #B1659F03 [Sg/IU-D31631 4637-4602^] (SEQ ID 11):
5'-TT AAGAT CTTTTTT AT ACAAAT AG GCTT AACAAT AAAGT AAAT CC
[0166] The fragment was digested with BglW + EcoRI, ligated to BglW + EcoRI digested pMOL1820, and the ligation mixture transformed, by transformation, into B. subtills PL1801 selecting for erythromycin resistance (5 pg/ml). The insert on three clones was sequenced, and all found to be correct. MOL1912 (PL1801/pMOL1789) and MOL1913 (PL1801/pMOL1913) were kept. The endpoint of the "C" fragment relative to gntZ is shown in fig. 2.
[0167] These plasmids were found to express functional GntP even if they do not have a promoter sequence directly upstream of the gntP gene. In order to enable directed integration in the gntP region by selecting for growth on gluconate it was necessary to delete part of the N- terminal sequence of the gntP gene on the integration plasmid pMOL1912.
Plasmids PMOL1972 and PMOL1973: [0168] These plasmids are Deletion derivatives of pMOL1912 which contain the entire gntP gene except for the first 158 bp coding for 53 amino acids of the N-terminal. The plasmid pMOL1912 was digested with Stu\ + EcoRV and re-ligated. The ligation mixture was transformed, by competence, into B. subtills PL1801 selecting for erythromycin resistance (5 pg/ml). The deletion was verified by restriction digest. MOL1972 (PL1801/pMOL1972) and MOL1973 (PL1801/pMOL1973) were kept.
[0169] These plasmids do not support growth on TSS gluconate plates when introduced as free plasmids in a gntP deleted background.
Construction of strains with chromosomal gntP deletions [0170] The Deletion plasmid pMOL1920 was transformed into competent cells of the 6. subtilis conjugation donor strain PP289-5 (which contains a chromosomal da/-deletion, and plasmids pBC16 and pl_S20), selecting resistance to kanamycine (10 pg/ml), erythromycin (5 pg/ml) and tetracycline (5 pg/ml) on plates with D-alanine (100 pg/ml) at 30°C. Two transformants were kept, MOL1822 and MOL1823.
The two-copy B. licheniformis alpha-amylase strain SJ4671, described in WO 99/41358 was used as recipient in conjugations.
[0171] Donor strains MOL1822 and MOL1823.were grown overnight at 30°C on LBPSG plates (LB plates with phosphate (0.01 Μ K3PO4), glucose (0.4 %), and starch (0.5 %)) supplemented with D-alanine (100 pg/ml), kanamycine (10 pg/ml), erythromycin (5 pg/ml) and tetracycline (5 pg/ml). The recipient strain was grown overnight on LBPSG plates. A loopful of donor and recipient were mixed on the surface of a LBPSG plate with D-alanine (100 pg/ml), and incubated at 30°C for 5 hours. This plate was then replicated onto LBPSG with erythromycin (5 pg/ml) and kanamycine (10 pg/ml), and incubation was at 30°C for 2 days. These four conjugations resulted in between 25 and 50 transconjugants.
[0172] Tetracycline-sensitive (indicating absence of pBC16) transconjugants were reisolated on LBPSG with erythromycin (5 pg/ml) and kanamycine (10 pg/ml) at 50°C, incubated overnight, and single colonies from the 50°C plates were inoculated into 10 ml TY liquid cultures and incubated with shaking at 26°C for 3 days, then aliquots were transferred into fresh 10 ml TY cultures and incubation continued overnight at 30°C. The cultures were then plated on LBPSG with 10 pg/ml kanamycine, after overnight incubation at 30°C these plates were replica plated onto kanamycine and erythromycin, respectively, and erythromycin sensitive, kanamycine resistant isolates were obtained from all strain combinations. The following strains, where part of the gntP gene coding for the C-terminal was replaced by the res-kana-res cassette, were kept: MOL1871: SJ4671 recipient, MOL1822 donor. MOL1872: SJ4671 recipient, MOL1823 donor.
[0173] Strain phenotypes were assayed on TSS minimal medium agar plates, prepared as follows: 400 ml H2O is added 10 g agar and is autoclaved at 121°C for 20 minutes, and allowed to cool to 60°C. The following sterile solutions are added:
[0174] Bacillus licheniformis SJ4671 grows well on both glucose and gluconate TSS plates, forming brownish coloured colonies. The gntP Deletion strains MOL1871 and MOL1872 grow well on glucose TSS plates, but only a very thin, transparent growth is formed on the TSS gluconate plates, even after prolonged incubation. These strains are clearly unable to use gluconate as the sole carbon source.
[0175] The same gntP deletion procedure is performed on the three copy strain SJ5309 described earlier to prepare for integration of a fourth copy of the amylase expression cassette.
Directed and selectable integration into the gnt region [0176] Integration plasmid pMOL1972 (containing the "B" and "C" fragments), and as a negative control pMOL1789 (containing only the "B" fragment), were transformed into competent cells of the B. subtilis conjugation donor strain PP289-5 (which contains a chromosomal da/-deletion, and plasmids pBC16 and pLS20), selecting resistance to erythromycin (5 pg/ml) and tetracycline (5 pg/ml) on plates with D-alanine (100 pg/ml) at 30°C. Transformants kept were: MOL1974: PP289-5/pMOL1972. MOL1975: PP289-5/pMOL1973.
[0177] Donor strains MOL1974 and MOL1975 were used in conjugations to recipient MOL1871 and MOL1872. Selection of transconjugants was on erythromycin (5 pg/ml), at 30°C. Transconjugants were streaked on TSS plates with gluconate, at 50°C. In parallel, SJ4671 was streaked as a gluconate positive control strain (also at 50°C).
[0178] After overnight incubation, all strains had formed a very thin, transparent growth. The control, however, was better growing and colonies were brownish. After another day of incubation at 50°C, some brownish colonies were coming up on the background of thin, transparent growth, in transconjugants derived from MOL1871 and MOL1872. These colonies were steadily growing, and further colonies appeared, during subsequent days of continued incubation at 50°C.
[0179] No colonies were observed from the gntP deleted strains MOL1871 and MOL1872.
Directed integration of an alpha-amylase gene into the gnt region
Construction of an amvL containing Integration plasmid.
[0180] The following is a construction plan for integrating an expression cassette with the alpha-amylase gene in the gnt region making use of the selection principle described above. The integration plasmid pMOL1972 is digested with BglW, and a 1.9 kb Bg/ll-Bc/l fragment containing amyL from pSJ4457 (described in WO 99/41358) is inserted by ligation. The ligation mixture is then transformed into B. subtilis DN1885 and transformants selected on LBPSG plates with erythromycin (5 pg/ml) are verified by restriction digestion of plasmid DNA.
Coniuaative donor strains, transfer to B. licheniformis. and chromosomal integration.
[0181] The Integration plasmid with the expression cassette is transformed into competent cells of the S. subtilis conjugation donor strain PP289-5 (which contains a chromosomal da/-deletion, and plasmids pBC16 and pl_S20), selecting resistance to erythromycin (5 pg/ml) and tetracycline (5 pg/ml) on plates with D-alanine (100 pg/ml) at 30°C.
[0182] Transformants comprising the Integration plasmid with the expression cassette are preserved and used as donors in conjugations with a gntP Deletion recipient of the three-copy strain SJ5309, which in turn was constructed as described for the Deletion strains MOL1871 and MOL1872 described above.
[0183] Transconjugants are selected on LBPGA plates with erythromycin (5 pg/ml), and one or two tetracyclin-sensitive transconjugants from each conjugation is streaked on a TSS-gluconate plate which is incubated at 50°C. After two days incubation, well-growing colonies are inoculated into liquid TY medium (10 ml) without antibiotics, and these cultures are incubated with shaking at 30°C. After overnight incubation, 100 pi from each culture is transferred into new 10 ml TY cultures, and incubated. This procedure is repeated twice, and in addition the cultures are plated on TSS-gluconate plates at 30°C.
[0184] After about a week, all plates are replica-plated onto TSS-gluconate as well as LBPSG with erythromycin (5 pg/ml) and incubated. The following day putative Em-sensitive strains are restreaked on the same plate types [0185] As for integration in the xylose region described earlier, Southern analysis and shake flask evaluation is performed to verify the site of integration in the gnt region of the alpha-amylase expression cassette and the increased yield from this four copy strain.
Example 3 [0186] Bacillus licheniformis SJ4671 (WO 99/41358) comprises two stably integrated amyL gene copies in its chromosome, inserted in opposite relative orientations in the region of the B. licheniformis alpha-amylase gene, amyL. The following example describes the insertion into this strain of a third amyL gene copy by selectable, directed integration into another region of the B. licheniformis chromosome. D-alanine racemase deletion/integration outline [0187] The DNA sequence of the Bacillus lichenformis D-alanine racemase region was determined in this work and is shown in positions 1303 to 2469 in SEQ ID 12. A plasmid denoted "Dal-Deletion plasmid" was constructed by cloning one 2281 bp PCR amplified fragment from the D-alanine racemase region of Bacillus lichenformis on a temperature-sensitive parent plasmid. The PCR 2281 bp fragment was denoted "A", wherein A comprises the sequence from 245 basepairs upstream of the ATG start codon of the dal gene to 867 basepairs downstream of the dal gene.
[0188] A deletion of 586 basepairs of the C-terminal part of the dal gene on the cloned fragment A was done resulting in a plasmid containing the fragments "B" and "C" as shown below. A spectinomycin resistance gene flanked by resolvase (res) sites was introduced between fragments "B" and "C" on the plasmid. This spectinomycin resistance gene could later be removed by resolvase-mediated site-specific recombination.
[0189] The D-alanine racemase deletion was transferred from the Dal-Deletion plasmid to the chromosome of a Bacillus target strain by double homologous recombination via fragments "B" and "C", mediated by integration and excision of the temperature-sensitive Dal-Deletion plasmid. The resulting strain was denoted "Dal-Deletion strain". This strain was unable to grow on media without D-alanine.
[0190] An Integration plasmid was constructed for insertion of genes into the D-alanine region of the Deletion strain. We intended to PCR-amplify a fragment denoted "D" comprising 1117 basepairs of the dal gene starting from 41 basepairs downstream of the ATG start codon. The promoter region was substituted with the T1 and T2 terminators from the 3'-terminal sequence of the Escherichia coli rrnB ribosome RNAoperon (EMBL/e09023: basepair 197-295).
[0191] The Integration plasmid comprises fragments D and C on a temperature-sensitive vector. An expression cassette destined for integration was cloned between the fragments D and C. Upon transfer to the B. licheniformis deletion strain, integration, and excision of the temperature-sensitive vector, strains could be isolated which grow on media without D-alanine. Such "Integration strains" have restored the chromosomal dal gene, by double homologous recombination via fragments D and C. In this process, the expression cassette was integrated into the chromosome.
Plasmid constructs [0192] PCR amplifications were performed with Ready-To-Go PCR Beads from amersham pharmacia biotech as described in the manufacturers instructions, using an annealing temperature of 55°C.
Plasmids PJA744: [0193] The A fragment (da/-region) was amplified from Bacillus licheniformis SJ4671 chromosomal DNA using primers: #148779; [Upstream of a Sph\ site in the dal region] (SEQ ID 14): 5'-GATGAACTTCTGATGGTTGC #148780: [BamHI < dal] (SEQ ID 15):
5'-AAAGGATCCCCCT GACT ACAT CTGGC
[0194] The PCR fragment was digested with Sph\ and BamHI and purified, then ligated to SphI and BamHI digested pPL2438. Transforming B. subtilis JA691 (repF+, dab) competent cells with the ligation mix followed by selecting for kanamycin resistance (10 pg/ml). Correct clones could complement the JA691 dal phenotype.
Plasmid PJA770: [0195] This plasmid contains a res-spc-res cassette inserted between the B and C fragments. It was constructed by ligating the 1.5 kb Bcll-BamHI fragment from pSJ3358 into the Bel I - Bel I sites of pJA744. Transforming B. subtills JA691 competent cells with the ligation mix followed by selecting for kanamycin resistance (10 pg/ml) and spectinomycin resistance (120 pg/ml). Orientation of the spectinomycin resistance gene was could be determined by cutting with Bdl and BamHI.
Dal Deletion plasmid Plasmid PJA851: [0196] A fragment (comprising the ermC gene and the replication origin of pE194) was PCR amplified from pSJ2739 plasmid DNA using primers: #170046 [A/ofl; < ermC gene and the replication origin of pE194>] (SEQ ID 16)
5'-AAAGCGGCCGCGAGACT GT GACGGAT GAATT GAAAAAGC #170047 [EcoRI; <— ermC gene and the replication origin of pE194—>] (SEQ ID 17):
5'-AAAGAATTCGTGAAATCAGCTGGACTAAAAGG
[0197] The PCR fragment was digested with EcoRI and Λ/ofl and purified, then ligated to EcoRI and A/ofl digested pJA770. Transforming B. subtills JA691 competent cells with the ligation mix followed by selecting for erythromycin resistance (5 pg/ml) and spectinomycin resistance (120 pg/ml).
Plasmid PJA748: [0198] A fragment (comprising the dal gene without the promotor region) was PCR amplified from Bacillus llchenlformls SJ4671 DNA using primers: #150506 [BamHI; < dal gene] (SEQ ID 18) 5'-AAAGGATCCCGCAAGCAAAGTTGTTTTTCCGC #150507 [Kpnl; <- dal gene] (SEQ ID 19):
5'-AAAGGTACCGAAAGACATGGGCCGAAATCG
[0199] The PCR fragment was digested with Kpn\ and BamHI and purified, then ligated to ΚρηI and BamHI digested pPL2438. Transforming B. subtills JA691 competent cells with the ligation mix followed by selecting for kanamycin resistance (10 pg/ml).
Plasmids PJA762: [0200] Afragment (comprising the T1 and T2 Terminators from the E.coll rrnB terminal sequence EMBL[e09023] from basepair 197 to 295) was PCR amplified from Escherichia coll SJ2 DNA using primers: #158089 JXpnl; < Ti and T2 Terminators of rrnB] (SEQ ID 20) 5'-AAAGGTACCGGTAATGACTCTCTAGCTTGAGG #158090 [C/al; < T-| and T2 Terminators oi rrnB] (SEQ ID 21):
5'-CAAAT CGAT CAT CACCGAAACGCGGCAGGCAGC
[0201] The PCR fragment was digested with Kpn\ and C/al and purified, then ligated to Kpn\ and C/al digested pJA748. Transforming B. subtilis JA691 competent cells with the ligation mix followed by selecting for kanamycin resistance (10 pg/ml).
Plasmids PJA767: [0202] A fragment (comprising the 0.7kbp DNA sequence downstream of dal (DFS)) was PCR amplified from B. Ilchenlformls SJ4671 (WO 99/41358) DNA using primers: #150508 [Hind\\\\ < DFS] (SEQ ID 22)
5'-ATT AAGCTT G ATATG ATT AT GAAT GG AAT G G #150509 [Nhe\\ < DFS] (SEQ ID 23):
5'-AAAGCTAGCATCCCCCTGACTACATCTGGC
[0203] The PCR fragment was digested with Hlnd\\\ and Nhe\ and purified, then ligated to Kpn\ and C/al digested pJA762. Transforming B. subtills JA691 competent cells with the ligation mix followed by selecting for kanamycin resistance (10 pg/ml).
Plasmid PJA776 [0204] This plasmid contains the amyL cassette flanked by the D and C fragments. It was constructed by ligating the 2.8 kb Hind\\\-Nhe\ fragment from pSJ4457 to the 4.2 kb SamFII-/-//ndlll fragment from pJA767, and transforming the ligation mix into B. subtilis JA691 competent cells followed by selecting for kanamycin resistance (10 pg/ml).
Dal Integration plasmid Plasmid PJA1020: [0205] This plasmid contains the amyL cassette flanked by the D and C fragments. Further the plasmid contains the plasmid pE194 replication origin, repF and the Emr-gene. It was constructed by ligating the 2.7kb EcoR\-Nhe\ fragment of pJA776 to the 3.8kb EcoR\-Nhe\ fragment of pJA851, and transforming the ligation mix into B. subtills JA691 competent cells followed by selecting for erythromycin resistance (5 pg/ml).
Construction of chromosomal dal deletions [0206] The Deletion plasmid pJA851 was transformed into competent cells of the B. subtills conjugation donor strain PP289-5 (which contains a chromosomal da/-deletion, and plasmids pBC16 and pl_S20), and transformants were selected for resistance to spectinomycin (120 pg/ml), erythromycin (5 pg/ml), and tetracycline (5 pg/ml) on plates with D-alanine (100 pg/ml) at 30°C. Transformants were kept as JA954 and used as donor in the following conjugation experiments.
[0207] The two-copy amyL B. licheniformis SJ4671 (WO 99/41358) was used as recipient in the following conjugation experiments.
[0208] Donor strain JA954 were grown overnight at 30°C on LBPSG plates (LB plates with phosphate (0.01 Μ K3PO4), glucose (0.4 %), and starch (0.5 %)) supplemented with D-alanine (100 pg/ml), spectinomycin (120 pg/ml), erythromycin (5 pg/ml) and tetracycline (5 pg/ml). The recipient strain SJ4671 was grown overnight on LBPSG plates.
[0209] Approx one loop of an inoculation needle of donor and recipient each were mixed on the surface of a LBPSG plate with D-alanine (100 pg/ml), and incubated at 30°C for 5 hours. This plate was then replicated onto LBPSG with erythromycin (5 pg/ml) and spectinomycin (120 pg/ml), and was incubated at 30°C for 2 days. These four conjugations resulted in 13 - 25 transconjugants.
[0210] Tetracycline-sensitive (indicating absence of pBC16) transconjugants were reisolated on LBPSG plates with erythromycin (5 pg/ml) and spectinomycin (120 pg/ml) at 50°C, and incubated overnight. Single colonies from the 50°C plates were inoculated into 10 ml TY liquid medium with D-alanine (100 pg/ml) and incubated with shaking at 26°C for 3 days, whereafter aliquots were transferred into fresh 10 ml TY cultures and incubation was continued overnight at 30°C. The cultures were plated on LBPSG with 120 pg/ml spectinomycin and D-alanine (100 pg/ml), after overnight incubation at 30°C these plates were replica plated onto LBPSG with/without D-alanine (100 pg/ml), spectinomycin and erythromycin, respectively.
[0211] D-Alanine autotrophic, erythromycin sensitive, and spectinomycin resistant isolates were obtained from all strain combinations. The following strain comprising the chromosomal dal promoter and the first 672 basepairs of the dal coding sequence replaced by the res-spc-res cassette, was kept: B. licheniformis JA967: SJ4671 recipient, JA954 donor.
[0212] Strain phenotypes were assayed on LBPG with 120pg spectinomycin supplemented with or without D-alanine (100 pg/ml) [0213] Bacillus licheniformis SJ4671 grows well on both plates with or without D-alanine. The dal deletion strain JA967 growth well on LBPG D-alanine plates, but not on LBPG plates without D-alanine. These strains are clearly unable to grow without adding D-alanine to the media.
The sequence of the B. licheniformis da/-region (SEQ ID 12): [0214] The da/-region (comprising the ydcC gene, a terminator, the dal gene and the sequence downstream of dal (DFS)) was PCR amplified from Bacillus licheniformis ATCC14580 chromosomal DNA using the primers: #145507 [< ydcC - dal - DFS >] (SEQ ID 24):
5'-GCGTACCGTTAAAGTCGAACAGCG #150509 [Nhe\\ < ydcC - dal - DFS >] (SEQ ID 25):
5'-AAAGCTAGCATCCCCCTGACTACATCTGGC
[0215] Sequencing of the D-alanine encoding sequence of Bacillus licheniformis that is shown in positions 1303-2469 of SEQ ID 12 and a subsequent homology search in the public databases revealed that the newly isolated dal gene has a sequence identity of only approx. 67% with the dal gene of Bacillus subtilis, no other D-alanine racemase encoding genes show a higher homolgoy to this new B. licheniformis dal gene.
Coniuaative donor strains, transfer to B. licheniformis. and chromosomal integration [0216] The Integration plasmid pJA1020 with the expression cassette is transformed into competent cells of the B. subtilis conjugation donor strain PP289-5 (which contains a chromosomal da/-deletion, and plasmids pBC16 and pLS20), selecting resistance to erythromycin (5 pg/ml) and tetracycline (5 pg/ml) on plates with D-alanine (100 pg/ml) at 30°C.
[0217] Transformants comprising the Integration plasmid with the expression cassette are preserved and used as donors in conjugations with a dal deletion recipient of the two-copy strain JA967 [0218] Transconjugants are selected on LBPGA plates with erythromycin (5 pg/ml), and one or two tetracyclin-sensitive transconjugants from each conjugation is streaked on LBPG plate which is incubated at 50°C. After two days incubation, wellgrowing colonies are inoculated into liquid TY medium (10 ml) without antibiotics, and these cultures are incubated with shaking at 30°C. After overnight incubation, 100 pi from each culture is transferred into new 10 ml TY cultures, and incubated. This procedure is repeated twice, and in addition the cultures are plated on LBPG plates at 30°C.
[0219] All plates are replica-plated onto LBPGS, LBPGS with spectinomycine (120 pg/ml) and LBPSG with erythromycin (5 pg/ml) and incubated. The following day putative Spectinomycin- and erythromycin-sensitive strains are restreaked on the same plate types [0220] As for integration in the xylose region described earlier, Southern analysis and shake flask evaluation is performed to verify the site of integration in the dal region of the alpha-amylase expression cassette and the increased yield from this three copy strain.
Example 4 [0221] In this work we did a homology study on the Bacillus subtills genome and a particular region of the B. Ilchenlformls chromosome (SEQ ID No:26), and we found that the B. licheniformis region contains the genes glpP, glpF, glpK and glpD. The size of the analyzed region is 5761 nucleotides, and the DNA sequence is shown in SEQ ID No: 26.
[0222] The glpP coding region extends from pos. 261 to pos. 818 in SEQ ID No: 26. A search of EMBL and Swiss-prot databases using the blast program revealed the closest homolog to be the B. subtills glpP gene (on the DNA level) and the B. subtills GlpP protein (on the protein level). The identity, on the DNA level, to the B. subtills glpP coding region was 72.4 % in an alignment constructed using the GAP program in the GCG program package (Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wise.). The identity of the deduced GlpP protein to the B. subtilis GlpP protein was 78.9 %.
[0223] The glpF coding region extends from pos. 1048 to pos. 1863 in SEQ ID No: 26. A search of EMBL ans Swiss-prot databases using the blast algorithm revealed the closest homolog to be the B. subtills glpF gene (on DNA level) and the B. subtills GlpF protein (on the protein level). The identity, on the DNA level, to the B. subtills glpF coding region was 72.8%. The identity of the deduced GlpF protein to the B. subtills GlpF protein was 79.3 %.
[0224] TheglpK coding region extends from pos. 1905 to pos. 3395 in SEQ ID No: 26. A search of EMBL and Swiss-prot databases using the blast program revealed the closest homolog to be the B. subtills glpK gene (on the DNA level) and the B. subtills GlpK protein (on the protein level). The identity, on the DNA level, to the B. subtills glpK coding region was 75.6 %. The identity of the deduced GlpK protein to the B. subtills GlpK protein was 85.9 %.
[0225] The glpD coding region extends from pos. 3542 to pos. 5209 in SEQ ID No: 26. A search of EMBL and Swiss-prot databases using the blast program revealed the closest homolog to be the B. subtills glpD gene (on the DNA level) and the B. subtilis GlpD protein (on the protein level). The identity, on the DNA level, to the B. subtilis glpD coding region was 72.9 %. The identity of the deduced GlpD protein to the B. subtilis GlpD protein was 81.9 %.
[0226] The B. licheniformis region in addition contains a part of the yhxB gene, with the coding region starting at pos. 5394 and extending beyond the end of the sequenced fragment shown in SEQ ID No: 26.
Use of the a/oDaene for directed chromosomal integration [0227] In analogy with the strategy of the previous examples, segments of the glpD gene and the downstream region were PCR amplified from chromosomal DNA of B. licheniformis, and combined to provide vectors useful for, in a first step, deletion of the 3' end of the glpD gene, and, in a second step, restoration of the glpD gene and the simultaneous insertion of an expression cassette for a gene of interest into the chromosome.
[0228] An internal fragment of the glpD gene, denoted 'glaD', was PCR amplified using the two primers below, according to standard PCR protocol also described elsewhere herein. (SEQ ID No: 27) 5'-GACTGAATTCGCAATTTGAAGTGAAAATGGTAGC, and (SEQ ID No: 28) 5'-GACTGGATCCAGATCTCATCTTTTCGGGAAATC.
[0229] The resulting fragment was purified and digested with EcoRI and BamHI, ligated to pUC19 digested with EcoRI and BamHI, and the ligation mixture transformed into E. coli SJ2 with selection for ampicillin resistance (200 pg/ml). A clone with the correct sequence was kept and denoted SJ5767 (SJ2/pSJ5767).
[0230] A fragment of DNA, derived from the B. licheniformis chromosome 55 to 555 basepairs downstream of the 3'-end of the glpD gene, was amplified using primers: (SEQ ID No: 29) 5'-GACTGAATTCAGATCTGCGGCCGCACGCGTAGTACTCCCGGCGTGAGGCTGTCTTG and (SEQ ID No: 30) 5'-GACTAAGCTTCAGTTACGCTCAAACACGTACG.
[0231] The resulting fragment was purified and digested with EcoRI and Hindlll, ligated to pUC19 digested with EcoRI and Hindlll, and the ligation mixture transformed into E. coli SJ2 selecting ampicillin resistance (200 pg/ml). A clone with the correct sequence was kept as SJ5789 (SJ2/pSJ5789).
[0232] The internal fragment of the glpD gene was then combined with a spectinomycin resistance gene, flanked by resolvase sites, by excision of a 1.5 kb Bcll-BamHI fragment from pSJ3358 and insertion of this into pSJ5767 which had been digested with Bglll. The ligation mixture was transformed into E. coli SJ2 selecting ampicillin (200 pg/ml) and spectinomycin (120 pg/ml) resistance. A clone with the correct sequence was kept and denoted SJ5779 (SJ2/pSJ5779).
[0233] To construct the final plasmid for deletion of the 3'-end of glpD in the B. licheniformis chromosome, pSJ5789 is digested with Hindlll and Bglll, and the 0.5 kb fragment is ligated to the 5.5 kb Hindlll-Bglll fragment of pSJ2739. The ligation mixture is transformed into B. subtilis DN1885, selecting for erythromycin resistance (5 pg/ml) at 30°C. The resulting plasmid is digested with EcoRI and Bglll, the 4.8 kb fragment is ligated to the 2.4 kb EcoRI-BamHI fragment excised from pSJ5779, and the ligation mixture is transformed into B. subtilis DN1885 selecting for erythromycin resistance (5 pg/ml) and spectinomycin resistance (120 pg/ml) at 30°C.
[0234] The deletion plasmid is transferred into B. licheniformis by use of the B. subtilis conjugation donor strain PP289-5, as described in previous examples, and the deletion is transferred to the chromosome using essentially the same procedures as described in previous examples.
[0235] The resulting glpD deletion strain is tested for growth on TSS minimal medium agar plates with glycerol as the sole carbon source.
[0236] The integration plasmid was designed to be able to repair the chromosomal glpD gene by homologous recombination, and carries a fragment containing the complete 3'-end of the glpD gene. It was useful to remove a Bglll site present within the glpD gene by site-specific mutation designed to retain the amino acid sequence of the GlpD protein. This mutation was introduced by PCR, as follows.
[0237] An internal fragment of the glpD gene was amplified using primers SEQ ID No.27 and SEQ ID No.28.
[0238] The 3-'end of the glpD gene was amplified using primers (SEQ ID No: 31) 5'-CCGAGATTTCCCGAAAAGATGAAATTTGGACTTCTGAATCCGGACTG, and (SEQ ID No: 32) 5'-GACTAAGCTTAGATCTGCTAGCATCGATTGATTATTAACGAAAATTCACC.
[0239] The two amplified fragments were mixed, and the mixture used as template for a PCR amplification using primers SEQ ID No:27 and SEQ ID No:32.
[0240] The resulting fragment was digested with EcoRI and Hindlll, ligated to EcoRI and Hindlll digested pUC19, and the ligation mixture transformed into E. coli SJ2 selecting ampicillin resistance (200 pg/ml). A clone with the correct sequence was identified and designated SJ5775 (SJ2/pSJ5775).
[0241] To construct the final integration vector plasmid, pSJ5789 is digested with Hindlll and Bglll, and the 0.5 kb fragment is ligated to the 5.5 kb Hindlll-Bglll fragment of pSJ2739. The ligation mixture is transformed into B. subtilis DN1885, selecting for erythromycin resistance (5 pg/ml) at 30°C. The resulting plasmid is digested with EcoRI and Bglll, ligated to the 1.5 kb Bglll-EcoRI fragment excised from pSJ5775, and the ligation mixture is transformed into B. subtilis DN1885 selecting for erythromycin resistance (5 pg/ml) at 30°C.
[0242] This integration vector plasmid has a number of restriction enzyme sites immediately downstream from the 3'-end of the glpD gene, into which an expression cassette is inserted.
[0243] The resulting integration plasmid is transferred into the B. licheniformis glpD deletion strain by use of the B. subtilis conjugation donor strain PP289-5, as described in previous examples.
[0244] Cells, in which the integration plasmid has integrated into the chromosome via the glpD sequences are isolated by their ability to grow on glycerol minimal media plates at 50°C. Such cells are used as a starting point for isolation of a strain, which by a second recombination event has lost the integrated plasmid, but has retained the repaired version of the glpD gene, together with the expression cassette on the chromosome.
[0245] The procedure for obtaining such a strain is equivalent to the procedure described in previous examples used to isolate strains with an expression cassette integrated at the xylose isomerase region of the chromosome.
Use of the g/oEKaenes for directed chromosomal integration.
[0246] In analogy with the strategy of the previous examples, segments of the glpF gene and the upstream glpP region were PCR amplified from chromosomal DNAof B. licheniformis, and combined to provide vectors useful for, in a first step, deletion of the promoter and 5' end of the glpF gene, and, in a second step, restoration of the promoter and glpF gene and the simultaneous insertion of an expression cassette for a gene of interest into the chromosome, upstream of the glpF promoter. Deletion of the glpF promoter is expected to abolish expression of the glpF gene and the downstream glpK gene. PCR amplifications were performed as previously described.
[0247] A DNA fragment containing the glpP gene was amplified using primers (SEQ ID No: 33) 5'-GACTAAGCTTGTGAAGGAGATGGAACATGAG, and (SEQ ID No: 34) 5'-
GACTGGATCCAGATCTGCGGCCGCACGCGTCGACAGTACTATTTTTAGTTCCAGTATTT TTTCC.
[0248] The resulting fragment was purified and digested with Hindlll and BamHI, ligated to Hindlll and BamHI digested pUC19, and the ligation mixture transformed into E. coli SJ2 selecting ampicillin resistance (200 pg/ml). A correct clone kept was SJ5753 (SJ2/pSJ5753).
[0249] A DNA fragment containing most of the glpF gene, but lacking the first 160 basepairs of the coding sequence, was amplified using primers (SEQ ID No: 35) 5'-GAGCTCTAGATCTTCGGCGGCATCAGCGGAGC, and (SEQ ID No: 36) 5'-GACTGAATTCCTTTTGCGCAATATGGAC.
[0250] The resulting fragment was digested with Xbal and EcoRI, ligated to Xbal and EcoRI digested pUC19, and the ligation mixture transformed into E. coli SJ2 selecting ampicillin resistance (200 pg/ml). A correct clone was kept as SJ5765 (SJ2/pSJ5765).
[0251] In order to construct a plasmid useful for the deletion of the promoter and 5'-end of the glpF gene, the glpP containing fragment is excised from pSJ5753 as a Hindlll-Bglll fragment, the glpF fragment is excised from pSJ5765 as a Bglll-EcoRI fragment, and these fragments ligated to the Hindlll-EcoRI fragment of pSJ2739. The ligation mixture is transformed into B. subtilis DN1885, selecting for erythromycin resistance (5 pg/ml) at 30°C.
[0252] The resulting plasmid is digested with Bglll, and ligated to a 1.5 kb Bdll-BamHI fragment from pSJ3358, containing a spectinomycin resistance gene flanked by resolvase recognition sites. The ligation mixture is transformed into B. subtilis DN1885 selecting erythromycin resistance (5 pg/ml) and spectinomycin resistance (120 pg/ml) at 30°C.
[0253] The deletion plasmid thus constructed is transferred into B. licheniformis by use of the B. subtilis conjugation donor strain PP289-5, as described in previous examples, and the deletion is transferred to the chromosome using essentially the same procedures as described in previous examples.
[0254] The resulting glpF deletion strain is tested for growth on TSS minimal medium agar plates with glycerol as the sole carbon source.
[0255] The integration plasmid is designed to be able to repair the glpFK gene region by homologous recombination, and carries the glpF promoter and intact glpF gene. This fragment is amplified from chromosomal B. licheniformis DNA using primers: (SEQ ID No: 36) and (SEQ ID No: 37) 5'-GAGCTCTAGATCTGCTAGCATCGATCCGCGGTTAAAATGTGAAAAATTATTGACAACG.
[0256] The resulting fragment is digested with Xbal and EcoRI, ligated to pUC19 digested with Xbal and EcoRI, and the ligation mixture transformed into E. coli SJ2 selecting ampicillin resistance (200 pg/ml). The amplified fragment is subsequently excised from this plasmid as a Bglll-EcoRI fragment, which is ligated to the glpP containing fragment which is excised from pSJ5753 as a Hindlll-Bglll fragment, and to the Hindlll-EcoRI fragment of pSJ2739. The ligation mixture is transformed into B. subtilis DN1885, selecting for erythromycin resistance (5 pg/ml) at 30°C. An expression cassette of interest is subsequently inserted into the linker region between the end of the glpP gene and the glpF promoter.
[0257] The resulting integration plasmid is transferred into the B. licheniformis glpF deletion strain by use of the B. subtilis conjugation donor strain PP289-5, as described in previous examples.
[0258] Colonies, in which the integration plasmid has integrated into the chromosome via the glpF sequences are isolated by their ability to grow on glycerol minimal media plates at 50°C. Such colonies are used as starting point for isolation of strains, which by a second recombination event has lost the integrated plasmid, but has retained the repaired version of the glpF gene, together with the expression cassette.
[0259] The procedure for obtaining such strains is equivalent to the previously described procedure to isolate strains with an expression cassette integrated at the xylose isomerase region of the chromosome.
Sequential use of aloD and aloFKfor chromosomal integration [0260] This procedure envisages use of a strain having both the glpD gene deletion, and the glpF gene deletion, as the starting strain, and takes advantage of the ability of a strain, which is unable to express the glpK gene product, to grow on minimal media supplemented with glycerol-3-phosphate, whereas the strain deficient in glpD is unable to grow on this substrate.
[0261] The procedure is then to first introduce the integration plasmid designed to repair the glpD gene, and to select for proper integration using growth on minimal media with glycerol-3-phosphate. This inserts a copy of the expression cassette next to the glpD gene.
[0262] In a second step, another copy of the expression cassette can be inserted between the glpP and glpF genes using the integration vector designed to repair the glpF gene, and selecting for proper integration using growth on minimal media with glycerol.
[0263] If the two expression cassettes are identical (or strongly homologous, or containing homologous regions), it may be advantageous to insert these expression cassettes into the vector plasmids in such an orientation, that they in the final strain would be integrated in opposite orientation relative to each other, thus preventing their loss from the strain by homologous recombination under conditions in which there is no selection for growth on glycerol.
Example 5 [0264] In this work we did a homology study on the Bacillus subtilis genome and a second particular region of the B. licheniformis chromosome (SEQ ID No: 38), and we found that the region contains the 3'-end of the abnA gene, and the 5'-end of the araA gene of B. licheniformis. The size of the analyzed region is 1500 nucleotides, and the DNA sequence is shown in SEQ ID No: 38.
[0265] The 3'-end of the abnA coding region extends from position 1 to position 592 in in SEQ ID No: 38. A search of EMBL and Swiss-prot databases using the blast program revealed the closest homolog to be the B. subtilis abnA gene (on the DNA level) and the B. subtilis AbnA protein (on the protein level). The identity, on the DNA level, to the corresponding B. subtilis abnA coding region was 68.9 %. The identity of the deduced AbnA protein fragment to the corresponding B. subtilis AbnA protein fragment was 75.8 %.
[0266] The 5'-end of the araA coding region extends from position 859 to position 1500 in SEQ ID No: 38. A search of EMBL and Swiss-prot databases using the blast program revealed the closest homolog to be the B. subtilis araA gene (on the DNA level) and Bacillus AraA proteins (on the protein level). The identity, on the DNA level, to the corresponding B. subtills araA coding region was 68.2 %. The identity of the deduced AraA protein fragment to the corresponding B. subtills AraA protein fragment was 62.6 %. The highest identity, scored in an alignment to a Bacillus stearothermophilus AraA protein fragment, was 68.4 %.
Use of the araA gene for directed chromosomal integration [0267] In analogy with the strategy of the previous examples, segments of the araA gene and the upstream abnA region were PCR amplified from chromosomal DNA of B. licheniformis, and combined to provide vectors useful for, in a first step, deletion of the promoter and 5' end of the araA gene, and, in a second step, restoration of the promoter and araA gene and the simultaneous insertion of an expression cassette for a gene of interest into the chromosome, upstream of the araA promoter. PCR amplifications were performed as previously described.
[0268] A fragment of the abnA gene upstream of araA was amplified using primers: (SEQ ID No: 39) 5'-GACTAAGCTTCATCCGGCGATCAGTTTAATGC, and (SEQ ID No: 40) 5’-
GACTGAATTCAGATCTGCGGCCGCACGCGTCGACAGTACTATTTTTTTTTGACA GATTTCAGAAC.
[0269] The resulting fragment was digested with Hindlll and EcoRI, ligated to Hindlll and EcoRI digested pUC19, the ligation mixture transformed into E. coli SJ2 selecting ampicillin resistance (200 pg/ml), and a correct transformant kept as SJ5751 (SJ2/pSJ5751).
[0270] A fragment containing an internal part of the araA gene was amplified using primers: (SEQ ID No: 41) 5'-GACTGGATCCAGATCTAGTCGAGTACAAAGCGGTGGC, and (SEQ ID No: 42) 5'-GACTGAATTCGACCAGCCAAGCTGAATCTGC.
[0271] The resulting fragment was digested with BamHI and EcoRI, ligated to BamHI and EcoRI digested pUC19, the ligation mixture transformed into E. coli SJ2 selecting ampicillin resistance (200 pg/ml), and a correct transformant kept as SJ5752 (SJ2/pSJ5760).
[0272] The abnA gene fragment was excised from pSJ5751 as a Hindlll-Bglll fragment, ligated to the 5.5 kb Hindlll-Bglll fragment of pSJ2739, and the ligation mixture transformed into B. subtilis DN1885, selecting for erythromycin resistance (5 pg/ml) at 30°C. A transformant kept was SJ5756 (DN1885/pSJ5756).
[0273] Plasmid pSJ5760 was digested with Bglll, and a 1.5 kb BamHI-Bcll fragment from pSJ3358, containing a spectinomycin resistance gene flanked by resolvase recognition sites, was inserted. A clone was kept as SJ5777 (SJ2/pSJ5777).
[0274] The final deletion plasmid was constructed by excision of the araA-res-spc-res fragment from pSJ5777 as a EcoRI-BamHI fragment, and ligation of this to the large EcoRI-Bglll fragment of pSJ5756. The ligation mixture was transformed into B. subtilis DN1885, selecting erythromycin resistance (5 pg/ml) and spectinomycin resistance (120 pg/ml) at 30°C. A correct transformant kept was SJ5803 (SJ2/pSJ5803).
[0275] The deletion plasmid pSJ5803 is transferred into B. licheniformis by use of the B. subtilis conjugation donor strain PP289-5, as described in previous examples, and the deletion is transferred to the chromosome using essentially the same procedures as described in previous examples.
[0276] The resulting araA deletion strain is tested for growth on TSS minimal medium agar plates with arabinose as the sole carbon source.
[0277] An integration vector plasmid is designed to be able to repair the araA gene region by homologous recombination, and carries the araA promoter and the 5'-end of the araA gene in addition to the abnA gene fragment of pSJ5756. The araA promoter fragment is amplified from chromosomal B. licheniformis DNA using primers synthesized based on the sequence given as SEQ ID No: 26. The plasmid is constructed, so that an expression cassette for a gene of interest can be inserted downstream from the abnA gene, but upstream of the araA promoter.
[0278] The resulting integration plasmid is transferred into the B. licheniformis araA deletion strain by use of the B. subtilis conjugation donor strain PP289-5, as described in previous examples. Colonies, in which the integration plasmid has integrated into the chromosome via the araA sequences are isolated by their ability to grow on arabinose minimal media plates at 50°C. Such colonies are used as starting point for isolation of strains, which by a second recombination event has lost the integrated plasmid, but has retained the repaired version of the araA gene, together with the expression cassette.
[0279] The procedure for obtaining such strains is equivalent to the previously described procedure to isolate strains with an expression cassette integrated at the xylose isomerase region of the chromosome.
Example 6 [0280] In this work we did a homology study on the Bacillus subtilis genome and a third particular region of the B. licheniformis chromosome (SEQ ID No:42), and we found that the B. licheniformis region contains the 3'-end of the ispA gene and the metC gene. The size of the analyzed region is 4078 nucleotides, and the DNA sequence is shown in SEQ ID No: 42.
[0281] The 3'-end of the ispA coding region extends from pos. 1 to pos. 647 in SEQ ID No: 42. A BLAST search of the EMBL and Swiss-prot databases using this particular sequence revealed the closest homologue (on the DNA level) to be the B. subtilis ispA gene and (on the protein level) the B. subtilis IspA protein. The identity, on the DNA level, to the corresponding B. subtilis ispA coding region was 72.6 % in an alignment constructed using the AlignX™ program in the Vector NTI™ 6.0 program package (Informax™, Inc.). The identity of the deduced IspA protein fragment to the corresponding B. subtilis IspA protein fragment was 82.3 %.
[0282] The metC coding region extends from pos. 1121 to pos. 3406 in SEQ ID No: 42. A BLAST search of EMBL and Swiss-prot databases using this particular sequence revealed the closest homologue to be the B. subtilis metC gene (on the DNA level) and the B. subtilis MetC protein (on the protein level). The identity, on the DNA level, to the B. subtilis metC coding region was 72.6 %. The identity of the deduced MetC protein to the B. subtilis MetC protein was 84.6 %.
Use of the mefCaene for directed chromosomal integration [0283] Segments of the metC gene and the downstream region were PCR amplified from chromosomal DNA of B. licheniformis, and combined to provide a vector useful for deletion of the 3' end of the metC gene.
[0284] A fragment of DNA, derived from the B. licheniformis chromosome, 4 to 671 basepairs downstream of the 3'-end of the metC gene, was amplified using primers: (SEQ ID No: 44) 5'-AAAAAACCCGAGTTTCACAAAAAATCCACTACAAACGCCGCC, and (SEQ ID No: 45) 5'-TTTTTTTTAAGCTTATGCCGCATGTTCCTTGCTGTTTTCAC.
[0285] The resulting fragment was digested with Aval and Hindlll, ligated to pMOL1887 digested with Aval and Hindlll, and the ligation mixture transformed into B. subtilis PL1801 with selection for erythromycin (5 pg/ml) and kanamycin (10 pg/ml) at 30°C. One clone was kept as CL057 (PL1801/pCLO57).
[0286] An internal fragment of the metC gene, derived from the B. licheniformis chromosome, 247 to 754 basepairs into the metC open reading frame, was amplified using primers: (SEQ ID No: 46) 5'-AAAAAAATCGATTCAGGGATATAAACGATCCG, and (SEQ ID No: 47) 5'-TTTTTTTTTTCCATCGCACTGGGATATCAGCTCTTCATAAGCATC.
[0287] The resulting fragment was digested with Clal and BstXI, ligated to pCL057 digested with Clal and BstXI, and the ligation mixture transformed into B. subtilis PL1801 with selection for erythromycin (5 pg/ml) and kanamycin (10 pg/ml) at 30°C. One clone was kept as CL058 (PL1801/pCLO58).
[0288] The resulting deletion plasmid pCL058 has a cassette consisting of the internal metC fragment followed by the kanamycin resistance gene flanked by resolvase sites, which finally is followed by the DNA fragment downstream of the metC gene. The deletion plasmid pCL058 was transferred to the conjugation donor strain PP1060-1, which is isogen to PP289-5 that previously has been described, except that the gene encoding green flourescent protein (GFP) has been integrated onto the chromosome. The resulting strain CL071 (PP1060-1/pCL058) was selected for erythromycin resistance at 30°C. The donor strain CL071 was mated with the B. licheniformis recipient SJ3047, selecting conjugants for erythromycin resistance and a dal+ phenotype at 30°C.
[0289] One conjugant CL074 was streaked on kanamycine (20 pg/ml) selecting for cells having plasmids integrated into the chromosome. Plating a resulting strain CL078 onto SMS-glucose minimal plates revealed that the plasmid had integrated in the internal part of the metC gene resulting in a requirement for methionine. CL078 was used as a starting point for isolation of strains, which by a second recombination event had lost the integrated plasmid, but had retained the deleted version of the metC gene.
[0290] Such a strain, denoted, CLO80 is appropriate to be used as a recipient for a plasmid carrying a cassette, which can be directed for integration at the metC locus essentially as described in previous examples, under conditions selective for an intact metC gene.
Example 7 [0291] In this work we did a homology study on the Bacillus subtilis genome and a fourth particular region of the B. licheniformis chromosome (SEQ ID No:48), and we found that the B. licheniformis region contains the 3'-end of the spoVAF gene and the lysA gene. The size of the analyzed region is 3952 nucleotides, and the DNA sequence is shown in SEQ ID No: 48.
[0292] The 3'-end of the spoVAF coding region extends from pos. 1 to pos. 310 in SEQ ID No: 42. The identity, on the DNA level to the B. subtilis spoVAF coding region was 62.7%. The identity of the deduced SpoVAF protein to the B. subtilis SpoVAF protein was 55.2%.
[0293] The lysA coding region extends from pos. 1048 to pos. 2367 in SEQ ID No: 48. A BLAST search of EMBL and Swiss-prot databases using this particular sequence revealed the closest homologue to be the B. subtilis lysA gene (on the DNA level) and the B. subtilis LysA protein (on the protein level). The identity, on the DNA level, to the B. subtilis lysA coding region was 73.0 %.
The identity of the deduced LysA protein to the B. subtilis LysA protein was 82.2 %.
Use of the IvsA gene for directed chromosomal integration [0294] In analogy with the strategy of the previous examples herein, segments of the lysA gene is PCR amplified from chromosomal DNAof B. licheniformis, and combined to provide vectors useful for, in a first step, partial deletion of the lysA gene, rendering a cell auxotrophic for lysine, and, in a second step, restoration of the lysA gene and the simultaneous insertion of an expression cassette for a gene of interest into the chromosome. Based on the strategies of the previous examples it is well within the skilled persons knowledge to determine the necessary primers and selective conditions for performing this procedure.
General Materials and Methods [0295] In vitro DNAwork, transformation of bacterial strains etc. were performed using standard methods of molecular biology (Maniatis, T, Fritsch, E. E, Sambrook, J. "Molecular Cloning. A laboratory manual". Cold Spring Harbor Laboratories, 1982 ; Ausubel, F. M., et al. (eds.) "Current Protocols in Molecular Biology". John Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. M. (eds.) "Molecular Biological Methods for Bacillus". John Wiley and Sons, 1990).
[0296] If not otherwise mentioned, enzymes for DNA manipulations were used according to the specifications of the suppliers. Media used (TY, BPXand LB agar) have been described in EP 0 506 780.
[0297] Amylase activity was determined with the PhadebasR Amylase Test from Pharmacia & Upjohn as described by the supplier.
[0298] The use of a resistance gene, e.g. spectinomycin resistance or kanamycin resistance, flanked by recognition sites for a site specific recombination enzyme (res sites recognized by Resolvase from plasmid pAMbetal) for easy deletion, has been described in US Patent 5,882,888. In the same patent are described plasmid pSJ3358, and strain B. subtilis PP289-5.
[0299] pUC19 is described in Yanisch-Perron, C., Vieira, J., Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103-119.
[0300] pE194 is described in Horinouchi, S., and Weisblum, B. (1982). Nucleotide sequence and functional map of pE194, a plasmid that specifies inducible resistance to macrolide, lincosamide, and streptogramin type B antibiotics. J. Bacteriol., 150, 804-814.
[0301] Plasmid pSJ2739 is described in US Patent 6,100,063. 0302] Plasmid pMOL1642 is shown in SEQ ID No:49 and the following table:
[0303] Strains Escherichia coll SJ2 and Bacillus subtills DN1885 are described in Diderichsen, B., Wedsted, U., Hedegaard, L.,
Jensen, B. R., Sjøholm, C. (1990). Cloning of aldB, which encodes acetolactate decarboxylase, an exoenzyme from Bacillus brevis. Journal of Bacteriology 172, 4315-4321.
[0304] Bacillus subtilis PL1801 is the B. subtilis DN1885 with disrupted apr and npr genes.
[0305] Bacillus licheniformis PL1980 is a strain of B. licheniformis, which was made unable to produce the alkaline protease by insertion of a chloramphenicol resistance gene into the alkaline protease gene.
[0306] Bacillus subtilis JA578 is a B. subtilis 168 spo, amyE with a repF expression cassette (SEQ ID No:50) inserted downstream of the dal gene (EMBLBSDAL, Accession# M16207) on the chromosome. The repF expression cassette shown in SEQ ID No:50 comprises the maltogenic amylase promoter PamyM (position 1-181 in SEQ ID No:50) from Bacillus Stearotermophilus (EMBL:BSAMYL02, Accession #M36539), a linker (position 182-211 in SEQ ID No:50) containing the RBS, fused to the the repF gene (position 212-808 in SEQ ID No:50) from the plasmid pE194 (EMBL:PPCG2, accession #J01755), with the RepF start-codon in position 212 and Stop-codon in position 809 of SEQ ID No:50.
SEQUENCE LISTING
[0307] <110> Novozymes A/S Jørgensen, Steen Troels Rasmussen, Michael Dolberg Andersen, Jens Tønne Olsen, Carsten <120> Multiple insertion of genes
<130> 10022.204-WO <150> DK PA 2000 00981 <151 >2000-06-23 <150> US 60/217,929 <151> 2000-07-13 <160> 50 <170> Patentln version 3.1
<210> 1 <211> 30 <212> DNA <213> Artificial Sequence: Primer #183235 <400> 1 gactaagctt ctgcatagtg agagaagacg 30
<210> 2 <211> 67 <212> DNA <213> Artificial Sequence: Primer #183234 <400>2 gactgaattc agatctgcgg ccgcacgcgt gtcgacagta ctgaaataga ggaaaaaata 60 agttttc 67
<210> 3 <211> 33 <212> DNA <213> Artificial Sequence: Primer #183230 <400>3 gactgaattc cgtatccatt cctgcgatat gag 33
<210> 4 <211 > 41 <212> DNA <213> Artificial Sequence: Primer #183227 <400>4 gactggatcc agatcttatt acaaccctga tgaatttgtc g 41
<210>5 <211> 60 <212> DNA <213> Artificial Sequence: Primer #183229 <400>5 gactggatcc agatctgcta gcatcgatcc gcggctattt ccattgaaag cgattaattg 60
<210> 6 <211 > 31 <212> DNA <213> Artificial Sequence: Primer #187338 <400>6 tatttcccga gattctgtta tcgactcgct c 31
<210>7 <211> 27 <212> DNA <213> Artificial Sequence: Primer #187339 <400>7 gttttcggcc gctgtccgtt cgtcttt 27
<210> 8 <211> 27 <212> DNA <213> Artificial sequence: Primer #184733 <400>8 gtgtgacgga taaggccgcc gtcattg 27
<210>9 <211> 28 <212> DNA <213> Artificial Sequence: Primer #184788 <400>9 ctcttgtctc ggagcctgca ttttgggg 28
<210> 10 <211> 26 <212> DNA <213> Artificial Sequence: Primer #B1656D07 <400> 10 agcattattc ttcgaagtcg cattgg 26
<210> 11 <211> 45 <212> DNA <213> Artificial Sequence: Primer #B1659F03 <400> 11 ttaagatctt ttttatacaa ataggcttaa caataaagta aatcc 45
<210> 12 <211 >3342 <212> DNA <213> Bacillus licheniformis <220> <221 > CDS <222> (1303)..(2469) <223> DNA sequence of the dal-gene encoding D-alanine racemase <220> <221 > misc_feature <222> (2685)..(2685) <223> Not determined with certainty <400> 12 gcgtaccgtt aaagtcgaac agcggtttct tcctttttac atccatggat taaaaagggg 60 ttgaaaaaag gtgagaaaaa gctttgtttt gcttttaacg gggctgcatg taatccttat 120 gctttctgcc tgcggccaaa aatcgcaaga agatgttgtg acggggctcg acaagaaggc 180 aaaagaatac acgtcctata aggcaaaagc gaaaatgacc attgaaacgg ggaatgaccc 240 gcaggagtac aacgtggaaa tctggcataa aaaaccttct ctttaccggg tctatttgga 300 aaacccgaaa aaagaccaga gccaggtgat cttgcgcaat gaaaacggcg tgtttgtttt 360 gactccgtcg ctgaataaaa gcttccgctt tcacagcgac tggcccaata acagcagcca 420 ggtatactta ttcgaatcgc tcgtaaagga tgtcaaaaat gatggggaag cttctttttc 480 cgcaaaggat tcaaaataca tttttgaaac gaaaacgaat tatcagcata atcagatgct 540 gccgactcag gaaatcgttt tccataaaaa gaccatggct ccttcatcgg ttaaagtgat 600 ggataccgac cgcaaaccga tggtaaaggt tgagtttaca agctttgaat tcgataagcc 660 gctcgataaa gactcttttg atgaaaagaa aaatatgacg ctgtctcaaa ttgacgtagc 720 gacaagcgct gacgtgtcag actctttcgc tgtcaaaacg ccgctcgatg tgcctcaggg 780 cgtgaaaaag cttgaagaga aagagatggc gactgaagac ggcaaacgga tcgtcatcac 840 atatggcggt gaaaaatcct ttacattgat tcaggaaaaa gcccgcgtcg ccaaaacatc 900 cacttccgta tccatgaacg gagagcccgt tgacctcggc ttcacggtcg gcgcactgac 960 ggataaatcg ttgtcatgga catatgacgg agtcgattac tttatctcat cagaagatct 1020 ttctcaagat gaacttctga tggttgcaaa aagcatgcag ggacagtctt cgaaatagac 1080 tgtgccgtat ccggcagcct gttttccgcc cggaagcgga aagcaggctt ttttatattt 1140 gcgtcgcaag cgtatgattt cgacagcttt tccgtaaaat gtataccgtg ccagcaattt 1200 ttcttttgtt cagggctgat gatcccgtgc aaaatttccc tttctccgaa ctttttagta 1260 tgatgggaag gacgagtgaa acaaggaaca ggaagtgtca tg atg age tta aaa 1314
Met Ser Leu Lys 1 cca ttc tat aga aag aca tgg gcc gaa ate gat tta aeg get tta aaa 1362 pro Phe Tyr Arg Lys Thr Trp Ala Glu Ile Asp Leu Thr Ala Leu Lys 5 10 15 20 gaa aac gtc cgc aat atg aag egg cac atc ggc gag cat gtc ege ctg 1410
Glu Asn Val Arg Asn Met Lys Arg His ile Gly Glu His val Arg Leu 25 30 35 atg gcc gtc gtt aaa gcg aat gcc tac gga cac ggg gat gea cag gta 1458
Met Ala val Val Lys Ala Asn Ala Tyr Gly His Gly Asp Ala Gin val 40 45 50 gcg aag gcg get ett gea gaa ggg gcg tee att ett get gtg get tta 1506
Ala Lys Ala Ala Leu Ala Glu Gly Ala ser Ile Leu Ala val Ala Leu 55 60 65 ttg gat gaa gcg ett teg ctg agg gcg cag ggg att gaa gaa ccg att 1554
Leu Asp Glu Ala Leu ser Leu Arg Ala Gin Gly Ile Glu Glu Pro Ile 70 75 80 ett gtc etc ggt gea gtg ccg acc gaa tat gea age att gcc gcg gaa 1602
Leu val Leu Gly Ala val Pro Thr Glu Tyr Ala Ser Ile Ala Ala Glu 85 90 95 100 aag cgc att ate gtg act ggc tac tee gtc ggc tgg ctg aaa gac gtg 1650
Lys Arg ile Ile Val Thr Gly Tyr Ser Val Gly Trp Leu Lys Asp val 105 110 115 etc ggt ttt ctg aat gag gee gaa get eet ett gaa tat cat ttg aag 1698
Leu Gly Phe Leu Asn Glu Ala Glu Ala Pro Leu Glu Tyr His Leu Lys 120 125 130 atc gac aeg ggc atg ggc cgc ett ggc tgc aaa aeg gaa gaa gag atc 1746
Ile Asp Thr Gly Met Gly Arg Leu Gly Cys Lys Thr Glu Glu Glu ile 135 140 145 aaa gaa atg atg gag atg acc gaa teg aac gat aag etc aat tgt aeg 1794
Lys Glu Met Met Glu Met Thr Glu ser Asn Asp Lys Leu Asn Cys Thr 150 155 160 ggc gtg tte act cat tte gcc aeg gcg gac gaa aag gac acc gat tat 1842
Gly Val Phe Thr His Phe Ala Thr Ala Asp Glu Lys Asp Thr Asp Tyr 165 170 175 180 tte aac atg cat ett gac cgc ttt aaa gag ctg' atc age ccc tte ccg 1890
Phe Asn Met His Leu Asp Arg Phe Lys Glu Leu Ile ser Pro Phe pro 185 190 195 ett gac egt ttg atg gtg cat teg tea aac age gcc gcg ggt ctg cgc 1938
Leu Asp Arg Leu Met Val His Ser Ser Asn Ser Ala Ala Gly Leu Arg 200 205 210 tte agg gaa cag eta ttt aat gcc gtc cgc tte ggc atc ggc atg tac 1986
Phe Arg Glu Gin Leu Phe Asn Ala val Arg phe Gly Ile Gly Met Tyr 215 220 225 ggt ttg gcg ccg tea acc gaa ata aaa gac gag ctg ccg ttt egt ctg 2034
Gly Leu Ala Pro ser Thr Glu ile Lys Asp Glu Leu Pro Phe Arg Leu 230 235 240 egg gaa gtg ttt teg ett cat acc gaa etc acc cat gtg aaa aaa att 2082
Arg Glu Val Phe Ser Leu His Thr Glu Leu Thr His val Lys Lys ile 245 250 255 260 aaa aaa ggc gag age gtc age tac gqg geg aca tat aca get cag ege 2130
Lys Lys Gly Glu ser Val Ser Tyr Gly Ala Thr Tyr Thr Ala Gin Arg 265 270 275 gac gaa tgg atc gqg aca gtc ccc gtc ggg tat gcc gac gga tgg ctg 2178
Asp Glu Trp ile Gly Thr val pro val Gly Tyr Ala Asp Gly Trp Leu 280 285 290 agg ege ctg gcc gga aeg gaa gtg ctg atc gac gga aaa ege caa aaa 2226
Arg Arg Leu Ala Gly Thr Glu Val Leu ile Asp Gly Lys Arg Gin Lys 295 300 305 ata gea ggg aga atc tgc atg gac cag tte atg att tee ett gcc gaa 2274
Ile Ala Gly Arg ile Cys Met Asp Gin Phe Met ile ser Leu Ala Glu 310 315 320 gaa tac eet gtc ggc aca aag gtt acc ttg atc gga aag caa aaa gac 2322
Glu Tyr Pro Val Gly Thr Lys val Thr Leu ile Gly Lys Gin Lys Asp 325 330 335 340 gaa tgg ate tea gtc gac gaa atc gcc caa aat ttg cag aeg atc aat 2370
Glu Trp ile Ser val Asp Glu ile Ala Gin Asn Leu Gin Thr ile Asn 345 350 355 tat gaa att acc tgt atg ata agt tea agg gtg ccc egt atg ttt ttg 2418
Tyr Glu Ile Thr Cys Met Ile Ser Ser Arg val Pro Arg Met Phe Leu 360 365 370 gaa aat ggg agt ata atg gaa ata agg aat ccg atc ttg eet gat caa 2466
Glu Asn Gly Ser Ile Met Glu ile Arg Asn Pro Ile Leu Pro Asp Gin 375 380 385 tee tgaaaattga tgaattagcg gaaaaacaac tttgcttgcg aaaagaataa 2519
Ser tgatatgatt atgaatggaa tggatagagt gttgtatccg taagtttggt ggaggtgtat 2579 gtttttgtct gaatccagcg caacaactga aatattgatt cgcttgccag aagetttagt 2639 ateagaaetg gatggtgtcg teatgegaga taaccgggag cagganatga aetgatttta 2699 ccaagccaca aaaatgtagg aaegegaaeg caaaaaatcg acaaattcgg ggaatcgatg 2759 agaageggtt atatggagat ggccaagatc caatttgaac atetettetg aggctcaatt 2819 tgeagagtat gaggetgaaa aeaeagtaga gcgcttacta ageggatgat aatcatttga 2879 ttgttaaacg cggcgatgtt tattttgctg acctatctcc tgttgttggc tcagaacaag 2939 gcggggtgcg cccggtttta gtgattcaaa acaacatcgg caatcgcttc agcccaactg 2999 ctattgttgc agccataaca gcccaaatac agaaagcaaa attacctacc cacgtcgaaa 3059 ttgatgcgaa aegetaeggt tttgaaagag actccgttat attgctcgaa caaattcgga 3119 cgattgacaa geaaagatta acggacaaaa tcacccatct egatgatgaa atgatggaaa 3179 aggtcaacga agccttacaa atcagtttgg cactcattga tttttaatat tgatgaaagt 3239 tgetegagge gaaagagcaa ctttttttgt gttcaaaaat aacaatacga tataatggta 3299 aetgttagte ctaaaaatgt tagccagatg tagtcagggg gat 3342
<210> 13 <211 > 389 <212> PRT <213> Bacillus licheniformis <220> <221 > misc_feature <222> (2685)..(2685) <223> Not determined with certainty <400> 13
Met Ser Leu Lys Pro Phe Tyr Arg Lys Thr Trp Ala Glu ile Asp Leu 15 10 15
Thr Ala Leu Lys Glu Asn val Arg Asn Met Lys Arg His Ile Gly Glu 20 25 30
His Val Arg Leu Met Ala val Val Lys Ala Asn Ala Tyr Gly His Gly 35 40 45
Asp Ala Gin val Ala Lys Ala Ala Leu Ala Glu Gly Ala ser ile Leu 50 55 60
Ala Val Ala Leu Leu Asp Glu Ala Leu Ser Leu Arg Ala Gin Gly Ile 65 70 75 80
Glu Glu Pro Ile Leu val Leu Gly Ala Val Pro Thr Glu Tyr Ala Ser 85 90 95
Ile Ala Ala Glu Lys Arg Ile Ile Val Thr Gly Tyr Ser val Gly Trp 100 105 110
Leu Lys Asp Val Leu Gly Phe Leu Asn Glu Ala Glu Ala Pro Leu Glu 115 120 125
Tyr His Leu Lys Ile Asp Thr Gly Met Gly Arg Leu Gly Cys Lys Thr 130 135 140
Glu Glu Glu Ile Lys Glu Met Met Glu Met Thr Glu Ser Asn Asp Lys 145 150 155 160
Leu Asn Cys Thr Gly Val Phe Thr His Phe Ala Thr Ala Asp Glu Lys 165 170 175
Asp Thr Asp Tyr Phe Asn Met His Leu Asp Arg Phe Lys Glu Leu Ile 180 185 190 ser Pro Phe Pro Leu Asp Arg Leu Met Val His Ser Ser Asn Ser Ala 195 200 205
Ala Gly Leu Arg Phe Arg Glu Gin Leu Phe Asn Ala Val Arg Phe Gly 210 215 220
Ile Gly Met Tyr Gly Leu Ala Pro Ser Thr Glu Ile Lys Asp Glu Leu 225 230 235 240
Pro Phe Arg Leu Arg Glu Val Phe Ser Leu His Thr Glu Leu Thr His 245 250 255
Val Lys Lys Ile Lys Lys Gly Glu Ser val ser Tyr Gly Ala Thr Tyr 260 265 270
Thr Ala Gin Arg Asp Glu Trp Ile Gly Thr val Pro val Gly Tyr Ala 275 280 285
Asp Gly Trp Leu Arg Arg Leu Ala Gly Thr Glu Val Leu Ile Asp Gly 290 295 300
Lys Arg Gin Lys Ile Ala Gly Arg ile cys Met Asp Gin Phe Met Ile 305 310 315 320
Ser Leu Ala Glu Glu Tyr Pro Val Gly Thr Lys val Thr Leu ile Gly 325 330 335
Lys Gin Lys Asp Glu Trp Ile ser val Asp Glu Ile Ala Gin Asn Leu 340 345 350
Gin Thr Ile Asn Tyr Glu Ile Thr Cys Met Ile Ser Ser Arg val Pro 355 360 365
Arg Met Phe Leu Glu Asn Gly ser Ile Met Glu Ile Arg Asn Pro Ile 370 375 380
Leu Pro Asp Gin Ser 385
<210> 14 <211> 20 <212> DNA <213> Artificial Sequence: Primer# 148779 <400> 14 gatgaacttc tgatggttgc 20
<210> 15 <211> 26 <212> DNA <213> Artificial Sequence: Primer# 148780 <400> 15 aaaggatccc cctgactaca tctggc 26
<210> 16 <211> 39 <212> DNA <213> Artificial Sequence: Primer# 170046 <400> 16 aaagcggccg cgagactgtg acggatgaat tgaaaaagc 39
<210> 17 <211> 32 <212> DNA <213> Artificial sequence: Primer# 170047 <400> 17 aaagaattcg tgaaatcagc tggactaaaa gg 32
<210> 18 <211> 32 <212> DNA <213> Artificial sequence: Primer# 150506 <400> 18 aaaggatccc gcaagcaaag ttgtttttcc gc 32
<210> 19 <211> 30 <212> DNA <213> Artificial sequence: Primer# 150507 <400> 19 aaaggtaccg aaagacatgg gccgaaatcg 30
<210> 20 <211> 32 <212> DNA <213> Artificial Sequence: Primer# 158089 <400> 20 aaaggtaccg gtaatgactc tctagcttga gg 32
<210> 21 <211> 33 <212> DNA <213> Artificial Sequence: Primer# 158090 <400> 21 caaatcgatc atcaccgaaa cgcggcaggc age 33 <210> 22 <211 > 31
<212> DNA <213> Artificial Sequence: Primer# 150508 <400> 22 attaagcttg atatgattat gaatggaatg g 31
<210> 23 <211> 30 <212> DNA <213> Artificial Sequence: Primer# 150509 <400> 23 aaagctagca tccccctgac tacatctggc 30
<210> 24 <211 > 24 <212> DNA <213> Artificial Sequence: Primer# 145507 <400> 24 gcgtaccgtt aaagtcgaac agcg 24
<210> 25 <211> 30 <212> DNA <213> Artificial Sequence: Primer# 150509 <400> 25 aaagctagca tccccctgac tacatctggc 30
<210> 26 <211> 5761 <212> DNA <213> Bacillus licheniformis <400> 26 accggggccg ggcgttttgt cggcaacgtc tgtatatttc agccttgaaa ggcccttgat 60 tccttcatgg atgatcgctt tcataaaaaa attcccccca ttcgagttgg ttgtgttaaa 120 ttatggacat gaatgaaggt aaatgtaaaa tgatttgccc ggggccgctt agaggccttc 180 tgttttataa aggattgcaa tgaggcggaa attccattag tgtaatacag aagcaagcta 240 gcaagtgaag gagatggaac atgagttttc acgatcaaaa tattttacct gcggtacgca 300 atatgaagca gttcgataca ttcctggaca gccctttttc atacggggtg ctgcttgaca 360 tccatcttgg acagctggga ggcgtgatca gcgcggcaag atcccatggg aaaaaaatgt 420 ttgttcacgt cgatctgatc caaggaatta agcatgatga atacggtgcg gaattcattt 480 gccaggaaat gaaaccggcg ggcattcttt ctacgagatc aagcgttatc gccaaagcaa 540 agcagaagaa agtgtatgcg atccagcgca tgtttttaat agacacaagc gccatgaaga 600 agagcattga attggtgaaa aagcacagac ccgactatat agaagtgctt cccggagtag 660 tgccggaatt gatcagggaa gtcaaagaaa taaccggcat tccgatcttt gcgggcgggt 720 ttatccgtac cgaaaaagac gtcgagcagg cgcttgcagc aggggcgtcc gcagtcacca 780 cctcagacac tgatttatgg aaaaaatact ggaactaaaa atttaaaatg tgaaaaatta 840 ttgacaacgc tttcactata cgatacgatc ttactaagtt aatacattgt gacggagacc 900 cggagaccac agcagttctt tactcagtat gatgtaaaga aagtttgctg tgttttttta 960 tggtctttta gacacagtgg agaaggtgaa cttatggcgt tcatctatta gaataatact 1020 tcataataga ttttaggagg gatagccttg acagcatttt ggggggaagt tatcggaacg 1080 atgctgctca tcgtctttgg agctggagtt tgtgcaggag ttaatttgaa aaaatcgctg 1140 tcccatcaat ccggatggat tgtgatcgtc ttcggctggg ggcttggcgt ggccatggcg 1200 gtatatgccg tcggcggcat cagcggagcg catttaaatc cggccgttac attggggctg 1260 gcatttgtcg gagattttcc ttgggaagaa gtgccttcat atattttggg acagatgatc 1320 ggcgcatttt taggagcggt gctcgttttt cttcactact tgccgcactg gaaagaaacc 1380 gaggatcaag gcgcgaagct tggagtattt tcgacaggtc cggcgattcc aaatacattt 1440 gcaaacctgt tcagtgaaac attggggact tttattctcg ttctcggact tttaacgatc 1500 ggtgcaaaca agtttactga cggactgaat cctcttgttg tcggatttct gatcgtggcg 1560 atcggtatct cgctcggcgg aacaacaggc tatgcgatta accctgcccg cgatctgggg 1620 ccgagaattg cccattttgt ccttccgatt gcaggcaaag ggagttcaaa ctggaagtac 1680 gcgtggatcc ctgttttagg accggcgctt ggcggttcat ttgcaggcgt tttttacaac 1740 gccgtattca aagggcatat cacaaacaca ttttggattg taagcgttat actagttgtg 1800 atattgttag gtttctatat tcatatgaaa aaacaagcag ttgatcaatc ggtcaacatt 1860 taaaaaaaag caatcttaac agacatataa gggggagttt caaaatggaa aagtacattt 1920 tgtctcttga tcaaggcacc acaagcacaa gggcgattgt tttcaacaaa gcaggcgaaa 1980 tcgtccatat tgcgcaaaag gaattccagc aatattttcc aaaccccggc tgggttgaac 2040 acaatgcaaa cgaaatctgg ggctctgttc tgtcggtgat cgcttcagcg ctttcagaat 2100 cggggatcga agccggacaa attgccggaa tcgggatcac aaaccagcgg gaaacgaccg 2160 tggtttggga taaacatacc ggcaaaccgg tctacaacgc gattgtgtgg cagtcccgcc 2220 aatcggctga gatatgccag gaattaaaag agaaaggcta tgaagagacg atcagagaaa 2280 aaacagggct tttaatcgat ccttattttt caggcacgaa agtgaaatgg atcctggatc 2340 atgtggaagg ggcaagggag aaagccgaaa acggcgacct tctcttcggt acgatcgatt 2400 cttggctgat ctggaaaatg tccggcggaa aagcgcatgt gacagattat tcaaacgcct 2460 caagaacatt gatgttcaac atctatgacc taaaatggga tgatgaactt ctcgatattc 2520 tcggcgtgcc gaaatcgatg gttccggaag tcaagccttc atcgcatgta tacgctgaaa 2580 cggtcgatta tcatttcttc ggcaaaaaca ttccgattgc aggtgcagcc ggcgaccagc 2640 aggcagcatt gttcgggcag gcttgctttg aagaaggaat ggttaagaac acgtatggaa 2700 caggctgctt tatgctgatg aacaccggcg agaaagcgat taaatcagag cacggcctgc 2760 tgacgacaat cgcttggggc atcgacggaa aggtggaata tgcgctggaa ggcagcgtct 2820 tcgtcgcggg ttccgctatt caatggctgc gtgatgggct gagaatgttt aaagacgcca 2880 aagaaagtga aaaatacgct gtaagagcag aatctgccga tggtgtttat gtggtccctg 2940 catttgtagg tttaggcacg ccttattggg acagcgatgt ccgcggcgct gtattcggac 3000 tgacccgggg tacgacgaaa gagcatttta tcagagcaac gcttgaagcg cttgcctatc 3060 aaacgaaaga cgtgctggac gcaatgaagg aagactccgg gatcccggtt aaaacgctga 3120 gagtcgacgg cggagctgtc aaaaacaact tcctgatgga ttttcagggc gacattttag 3180 atgtccctgt agaacgtcct gaaatcaatg aaacaacagc gcttggttca gcctatttag 3240 cgggccttgc tgtcggcttc tggagcgatc gttccgagat caaagaccag tggcagcttg 3300 acaaacgttt tgaaccgaaa atggaagaaa aagagcgtga gagcctgtac aacgggtgga 3360 agaaagctgt aaatgcagct agggctttta aataagctgc atgtatgtta caatctaatt 3420 aagttaatag aaacggttgg agaagaggag agaccgcaga caccaaagca gtatcagcgc 3480 tttggatgtt tgtggtctct ttttctattt tttaccgtga caacaaggga ggacatgaaa 3540 catggaatca ttattttcaa gccgtaaacg ggacgacatt ttacagaata tgacgaagca 3600 gaagtatgac gtgtttatta tcggcggagg tattactggg gctgggacgg cattggatgc 3660 cgcatcgcgc ggaatgaaaa cggcgctttg cgaaatgcag gactttgcag ccggaacgtc 3720 aagccgttcc acgaaacttg tacacggcgg gcttcgctat ttaaagcaat ttgaagtgaa 3780 aatggtagcc gaggtcggca aagagcgggc gatcgtctat gaaaacgggc cgcacgttac 3840 aacgcccgaa tggatgctgc ttccgatgca taagggaggg actttcggca aattcagcac 3900 ttcaatcgga ctgagggtgt acgactttrt ggcaggcgtc aaaaaagctg agcggaggag 3960 catgctgact gccgaagaaa cgcttcaaaa agagccgctc gtgaaaaaga acggcctgaa 4020 gggcggcggc tattatgtcg aataccggac ggatgatgcc agattgacga tcgaagtcat 4080 gaaagaagcc gttaaattcg gagccgaggc cgtcaattat gcaaaagtaa gcgattttat 4140 atatgaaaac ggcaaggtca ccggcgtggt cattgaagac gtcttcacga aaaaaacgta 4200 ccgcgtctac gcgaaaaaaa ttgtcaatgc cgcggggccg tgggtcgacc gtctgcggga 4260 aaaagaccat tcaaaagaag gcaaacacct tcagcataca aaaggcgtgc atcttgtttt 4320 tgatcaatcg gtctttcctt taaaacaagc cgtttatttt gatacgcctg acggccgcat 4380 ggtgttcgcc attccgagag acggaaaggc atatgtcggc acaacagaca ccgtctacaa 4440 cgagaatttg gaacaccctc gaatgacgac agcagacagg gattatgtca tcaatgcaat 4500 caactatatg ttccctgaac ttggaatcaa agccgaagat gtcgaatcaa gctgggctgg 4560 cctcagaccg ctgattcatg aagaaggaaa agacccgtcc gagatttccc gaaaagatga 4620 gatctggact tctgaatccg gactgatcac gatcgccggc ggaaagctga caggctacag 4680 aaaaatggct gagcatatcg tcgatcttgt cagagaccga ttaaaagaag agggcgacag 4740 agacttcggg ccttgcagaa caaaaacgat gccgatttca ggcggccata tcggcggctc 4800 caaaaatctg gaggctttta ttcaagcgaa agcagccgaa gggattgagg ccggactgtc 4860 cgaagagacg gccaaacaaa tcgccgcacg atacggttcg aacgcagacc gcctgtttga 4920 tcgtattcca tcgctgaaag atgaagcagc aaaacgccgc atccctgtcc atgtactagc 4980 agaaatggat tacgggatcg aggaagaaat ggcagccgtc ccggcagact tcttcgtccg 5040 cagaaccggt gcgctgttct ttgacatcaa ttgggtccgc acttacaaag agagccttac 5100 ggactacatg agcgagaagc tgaactggga tggcgaaacg aaggcccggc atgtcaaggc 5160 attggaagga ctactacacg atgctgttgt cccgctggaa agcaaatgat ttattaggtc 5220 aaataacctt ggtgaatttt cgttaataat caatcgaatg gcccggcgtg aggctgtctt 5280 gaacaggcag cctcattttt ttcatttggc atgctaaatt tggacaaagc ggcggtttgt 5340 cgatatgata aaagaaaagc tgcaattact tagctagaac attggaggta atcatgagct 5400 ggagaacgag ctatgaacgc tggagaaaca aagaaaactt agattccgaa ttaaaagcgc 5460 ttcttttgga agcggaagga aatgaaaaag aactagagga ttgcttttat aaaaaacttg 5520 agtttggtac agccggtatg cgcggtgaga tcggaccggg cccgaaccgc atgaacgttt 5580 atacggttcg caaagcatcg gcgggccttg ccgcatacat aggagcgaac ggcggcgaag 5640 caaaaaagcg cggcgttgtg atcgcgtacg attcccgcca caaatcgcct gaatttgcaa 5700 tggaagctgc taagacgctc gcagaaaacg gcgttcaaac gtacgtgttt gagcgtaact 5760 g 5761
<210> 27 <211 > 34 <212> DNA <213> Artificial Sequence: Primer <400> 27 gactgaattc gcaatttgaa gtgaaaatgg tage 34
<210> 28 <211> 33 <212> DNA <213> Artificial sequence: Primer <400> 28 gactggatcc agatctcatc ttttcgggaa atc 33
<210> 29 <211> 56 <212> DNA <213> Artificial Sequence: Primer <400> 29 gactgaattc agatctgcgg ccgcacgcgt agtactcccg gcgtgaggct gtcttg 56
<210> 30 <211> 32 <212> DNA <213> Artificial Sequence: Primer <400> 30 gactaagctt cagttacgct caaacacgta cg 32
<210> 31 <211> 47 <212> DNA <213> Artificial Sequence: Primer <400> 31 ccgagatttc ccgaaaagat gaaatttgga cttctgaatc cggactg 47
<210> 32 <211>50 <212> DNA <213> Artificial Sequence: Primer <400> 32 gactaagctt agatctgcta gcatcgattg attattaacg aaaattcacc 50
<210> 33 <211 > 31 <212> DNA <213> Artificial Sequence: Primer <400> 33 gactaagctt gtgaaggaga tggaacatga g 31
<210> 34 <211 > 64 <212> DNA <213> Artificial Sequence: Primer <400> 34 gactggatcc agatctgcgg ccgcacgcgt cgacagtact atttttagtt ccagtatttt 60 ttcc 64
<210> 35 <211> 32 <212> DNA <213> Artificial sequence: Primer <400> 35 gagctctaga tcttcggcgg catcagcgga gc 32
<210> 36 <211> 28 <212> DNA <213> Artificial sequence: Primer <400> 36 gactgaattc cttttgcgca atatggac 28
<210> 37 <211> 58 <212> DNA <213> Artificial sequence: Primer <400> 37 gagctctaga tctgctagca tcgatccgcg gttaaaatgt gaaaaattat tgacaacg 58
<210> 38 <211 > 1500 <212> DNA <213> Bacillus licheniformis <400> 38 atcagcgata gggctcgcat cgacagaccg gatttcatcc ggccaatggc gggatgacgg 60 gctggtcatc aggtcgacat ccggcgatca gtttaatgcc attgaccctg atctggtcat 120 tgacaaagac ggaaagccct ggctctcatt cggttccttc tggagcggca ttaagctgac 180 aaggcttgat aaaaacacga tgaaaccgac gggaagcctg tattcgatcg cctcaaggcc 240 gaataacgga ggagcggttg aagccccgaa cattacctac aaagacggct actattactt 300 atttgtctcg tttgacagct gctgcaaagg ggtggacagc acatataaaa tagcctatgg 360 ccgttcaacg agcattacgg gaccctatta tgataaaagc ggcaaaaata tgatgaacgg 420 cggagggacg atcctggact ccggcaatga ccgctggaaa gggccgggåc atcaggatgt 480 tctgaacaac tcgatccttg tcaggcatgc ttacgacgcg ctggacaatg gtgtatcaaa 540 gctgctcatc aatgacttgt actgggattc ccaaggatgg ccgacttatt aacagcagat 600 gacgggcggt ttccgcccgg ttttttttgt tctgaaatct gtcaaaaaaa aataaaaaac 660 ataccggaaa ttaaattgac agtttttttc ataatgatat aatgaagttg ttcgtacaaa 720 tatgtttttt atgttagttg tacgtacata taatcgcgat acagtttgag atcaaggtat 780 gatttatgtt tttttgtaag cgttttaata gtttgctatt ctacacagac accataaaga 840 cgaggaggag gaagctattt gattcaggca aagacgcatg tgttttggtt tgtgacaggc 900 agccagcatt tatatggcga agaggcggta caagaggtag aagagcattc caaaatgatc 960 tgcaacggat taaatgacgg agatttaagg tttcaagtcg agtacaaagc ggtggccact 1020 tcgctggacg gcgtcagaaa actgtttgaa gaggcgaacc gggacgatga gtgcgcaggc 1080 atcatcacct ggatgcatac gttttcaccg gccaaaatgt ggattcccgg cctttccgag 1140 ctgaataagc cgctgctcca ttttcatacc cagtttaacc gggacattcc gtgggataaa 1200 atcgacatgg atttcatgaa tattaatcag tctgcccacg gcgaccgcga atacggtttt 1260 atcggagcga gattgggcat tcctcgaaaa gtaatcgccg gatattggga agacagagaa 1320 gtaaagcgct cgatcgacaa atggatgagc gcagcggtcg catatattga aagccgccat 1380 atcaaagtcg cccgatttgg ggacaacatg cggaatgtgg cggtaacaga aggagataag 1440 attgaagcgc agattcagct tggctggtct gtcgacggat atggaatcgg cgatctcgtc 1500
<210> 39 <211> 32 <212> DNA <213> Artificial Sequence: Primer <400> 39 gactaagctt catccggcga tcagtttaat gc 32
<210> 40 <211> 65 <212> DNA <213> Artificial Sequence: Primer <400> 40 gactgaattc agatctgcgg ccgcacgcgt cgacagtact attttttttt gacagatttc 60 agaac 65
<210>41 <211> 37 <212> DNA <213> Artificial Sequence: Primer <400> 41 gactggatcc agatctagtc gagtacaaag cggtggc 37
<210> 42 <211 > 31 <212> DNA <213> Artificial Sequence: Primer <400> 42 gactgaattc gaccagccaa gctgaatctg c 31
<210> 43 <211 >4078 <212> DNA <213> Bacillus licheniformis <400> 43 tttccggcgt agcacccgaa gcgaacctat taatcgtcaa ggtgctcggc ggtgaagacg 60 gcagcgggga ttatgaatgg atcatcaacg ggatcaacta cgccgttgag caaaaagccg 120 acattatttc aatgtcgctc ggcggtcctg ccgacgttcc ggagttgaag gaagcggtga 180 caaacgccgt gaagagcgga gtgctcgtcg tctgcgccgc aggaaacgaa ggcgacggca 240
atgaccgtac agaggagtac tcataccctg ctgcatacaa cgaagtcatc gccgtcggat BOO ccgtgtcatt gacgcgtgag tcttccgaat tttcaaatgc gaacaaagaa attgaccttg 360 ttgcacctgg agaagaaatc ctctctacat tgcccgacca tcaatacgga aagctgacgg 420 gaacatcgat ggctacaccg cacgtcagcg gcgcgctcgc tctcatcaag tcagctgaag 480 aagaggcgtt taaacggaaa ctgacagaac ccgaactgta tgctcagtta atccgccgca 540 cccttcctct tgattactca aaagcgctga tcggcaacgg attcttatat ttgtcagcgc 600 cggaggtact ggcggaaaaa gccggcgaag caaaacttct ttccctttaa cagtctaaag 660 gaggctgccg acaatgtcgg cggccttttt catggccatg tataaagctg aatcttttta 720 attgcaagaa ttcaaaaatt attttgacta aaagatcgcg gcggtatata atctactaaa 780 caatttcatc gccgggaaca tggtaatcta acgaggttag attttaaaag ggaagtttgg 840 tgaaaatcca acgcggtccc gccactgtga atgaggaggt tatttcataa aacccactgt 900 ttctatatgg gaagggggaa ataaccgtcg attcatgagc caggagacct gcctgttctg 960 acgcaccata aacctacggt cgataggagg tgttcgagtt gacgtaacaa tcgctacgtt 1020 tatttctcgt tcgcaacatg ctgttttcag gcattcacct tctcattgtc cgaagtgtga 1080 gtgtcttttt ttattgaaca ctaaaaggag gagaccagac atgactaatg taaaaacgag 1140 cagcttgggc tttccaagaa tcggcttgaa cagagaatgg aaaaaatcgc ttgaggctta 1200 ttggaaagga aacacggacc gcgagacctt tttgaaagaa atggatgaac aatttttagc 1260 agcgctccag actcagcttg atcagcaaat cgatatcata ccggtttccg actttacaat 1320 gtacgaccat gttcttgaca cggcggtgat gttcaactgg attccagatc gattcaagga 1380 tataaacgat ccgttagata cttatttcgc aatggcgaga ggcacgaaag atgctgtatc 1440 gagtgaaatg acaaaatggt ttaatacaaa ctaccattat attgtgcctg aatatgaaaa 1500 aggtgcacaa taccgcgtga cgagaaacaa accgcttcaa gattaccaaa gagcaaaagc 1560 agcattggga acagaaacga agcccgtcat actcggcctt tacactttcg tagcccttgc 1620 aaaaggctat gaacaacagg atattaaaga tatttataac caaatgacac ctctttacat 1680 ccaggttttg aaagagcttg agcaggaagg cgtcaaatgg gtgcaaattg acgagcctgc 1740 tcttgtgacg gcttcacctg aagaagcggc tgctgtcaaa gaaatctatc agacgattac 1800 agaagaagtc tctgaactga aeatcettct gcaaacctac tttgactcgg ttgatgctta 1860 tgaagagctg atatcgtttc ctgtcgcagg aattggtctt gattttgttc atgataaagg 1920 gaaaaacttc gaacacctga aagcgcacgg ttttcctaaa gacaaagtcc ttgccgccgg 1980 cattttagac ggacgcaaca tttggaaagc caatctcgaa gagcgcctcg acctgacgct 2040 tgaactgatc cagagagcgg gtgttgacga agtctggatt cagccttcaa acagcctgct 2100 tcatgtccct gtcgcaaaac acccgggcga acatcttgcc gacgatctct tgaacggttt 2160 atctttcgca aaagagaaac ttctggagct tacactgctg aagaacggac ttgtttccgg 2220 aaaagcggcc atccaagcgg aaatcgatga agcgcacgga caccttcaag atctcaaaca 2280 gtacggtgca gcgacaaatt cggcctttgc cgaagaaaga ggcaagctga ctgaggaaga 2340 ctttaaacgc ccgacagctt ttgaagaaag gctgcggatt caaaatgact ctctcggact 2400 tcccctattg ccgacaacaa cgatcggcag cttcccgcag acggcggatg tgcggagcgc 2460 gcggcaaaaa tggcggaaaa aagaatggtc cgacgagcag tatgaagcat ttattcagga 2520 agaaacaaag aaatggattg atattcagga agatctcgga cttgacgttc tcgttcacgg 2580 agaattcgaa cggacagaca tggttgagta tttcggcgaa aagctcggag gattcgcctt 2640 tactaaatac gcctgggttc agtcatacgg ttcccgctgc gtccggccgc cggtcatcta 2700 cggagatgtc gagtttaaag agccgatgac ggtaaaagaa acggtttacg cccaatcctt 2760 gacctcgaag aaagtcaagg gcatgctgac agggcctgtt accattttaa actggtcctt 2820 tgcccgctat gacctgccga gaaaagagat cgccttccaa atcgcctgcg ccctccgcaa 2880 agaggttgaa gcgcttgaaa aagcaggaat tcaaatcatt caggtcgatg aacctgcctt 2940 gagagaaggc ctgccgctta aagaacggga ttgggacgag tatctcaaat gggctgcaga 3000 agcgttcaga ctgtccactt catctgtgga agatacgacg caaatccata cgcatatgtg 3060 ctacagcaac tttgaagata tcgtagacgc gatcgaagat cttgacgcag acgtcattac 3120 gatcgagcac agcagaagcc acggcggatt tcttgattat ctggaacagc acccttacct 3180 gaaagggctt ggtcttggcg tatatgatat tcacagccct cgcgtccctt ccagcgatga 3240 aatgctcacg atcatagaag acgcgctgaa agtctgcccg gctgatcgct tctgggtaaa 3300 ccctgactgc ggtttaaaaa cgagacagcc agaggaaacg atcgcagcgc ttaagaatat 3360 ggttgaagca gccaaacaag caagaggcaa actggctcag actgtttaat ttcacaaaaa 3420 atccactaca aacgccgcct gttcacacgg gcggctcttt tcatggctcc agcccttttt 3480 aggccaaaag aaccgttata caaggtatgt ccgcccaaaa aacattaaga cttttgattc 3540 attcgtacga tttccttccg tatccttttc ttttaacata tttgtagtag atgatggaag 3600 ggaaggaaaa tatgtagtga ttgacgatgg aatagcgtta gaacgaaaaa tcaagcgaaa 3660 aatatatcag gaagacattc actctcttca gctatacgta aaagatgtga atgccgccat 3720 tgatgagctg aggcaggaaa gttcttctat tttaaaagca caccaaacgt atatcaacgg 3780 atggcgcgga caggcgcgcg aaatgtatga cgcgcttttg gacgatctcg accgggcgga 3840 atcgcgcgtg tatgacaagc tgaggaccat taaagagcag gcggacgaag aaattgaacg 3900 gcttcagctg aaagccgagg agctgatatg acgatccggc tgaacatcaa tgatctgcac 3960 gccctcgccc gccaatttcg ttattcccac cagcgaatca gcgatttaat acgccttttg 4020 aaccgtcatt ttcatggttc ttttctccag cgtgaaaaca gcaaggaaca tgcggcat 4078
<210> 44 <211> 42 <212> DNA <213> Artificial Sequence: Primer <400> 44 aaaaaacccg agtttcacaa aaaatccact acaaacgccg cc 42
<210> 45 <211 > 41 <212> DNA <213> Artificial Sequence: Primer <400> 45 ttttttttaa gcttatgccg catgttcctt gctgttttca c 41
<210> 46 <211> 32 <212> DNA <213> Artificial Sequence: Primer <400> 46 aaaaaaatcg attcagggat ataaacgatc cg 32
<210> 47 <211> 45 <212> DNA <213> Artificial sequence: Primer <400> 47 tttttttttt ccatcgcact gggatatcag ctcttcataa gcatc 45
<210> 48 <211 >3952 <212> DNA <213> Bacillus licheniformis <400> 48 tttatacgtt tccctctcgg caatcggagc ctacacgaca ccaagctacg agctgagcct 60 ggcgaataaa atggtgaagc tgtttatgct gatattggtg gcgcttttta aagtggaggg 120 atttgtcatc ggattaacga tcttaactat agtgatgact tcgatcaggt cattgcgaac 180 gccttactta tggcctctcc tcccgttcaa tggaaaagcg ttttggcatg ttctcgtgcg 240 cacgtccgtt ccagggggaa aagtcaggcc gagcatcgtt catccgagaa accgctccag 300 acagccgtga agccggcatt cgaagaggct tttccccggg gaaaagcctc tttttcaata 360 atcgaattcc ggtctttgag taccgatgcc tttgtattca ttggcagaga tcgcgactgc 420 ccggaggctg cagatgttgt tctgtcttct gatcggatag acgacataca gcatttcgcg 480 gccgtacggg tcaatcgttg acgaatgaag gaaaacctca gttcctctcc gccaaaatct 540 cgtattcgcc ggagctgtaa taatctgccc ttcataaggc tcataaattc tctgttcata 600 atgcgcagcc ggctgataag gggcgtatac atcttcaggt gcatagccgg gagcgggggt 660 gtagggataa cgatttggat acatatgata acctctttcc cacttcgttt tttggttttc 720 atctttaaga ttatattcag gtaaatgcct atttgtatgg gcgaaaatct cagcttttcg 780 gctctttttt tattgaatgg acgttgtgta tgcctatttc tatcaagcgc tgttttctgt 840 tattctataa tcaatagaat ggattagttg tttagggaat catttccttt ataaatcaag 900 aaaatttgga caaatggtgg tttagttttt aaaacgaaat gttataatac aacataagaa 960 tcgcactatc atgaagccgg aagatgcatc gggcagcaac cggagcgccc cttgcacctt 1020 tgtcgataga gaaagaggga atgacaattg tttttacacg gtactagcag acaaaatgaa 1080 agagggcacc tcgaaatcgg cggtgtcgat gttctatcat tggcagaaag atacggaaca 1140 cctctttatg tatacgatgt cgcgctgatt agagagcgcg cccgaaaatt ccagaaggca 1200 ttcaaggaag ccggtttaaa agcgcaggta gcgtatgcaa gcaaggcgtt ttcatcggtt 1260 gccatgattc agcttgccga acaagagggg ctgtctctgg atgtggtatc gggaggagag 1320 cttttcactg cgatcaaagc agggttccca gctgagcgga ttcattttca cggaaacaat 1380 aagagccctg aagaactagc catggcgctg gagcatcaaa tcggctgcat cgtgctcgat 1440 aactttcacg agatcgccat tacagaagat ctttgcaagc gatcaggaca aactgtagac 1500 gttttgctca gaatcactcc gggagttgaa gcgcacacgc acgattatat tacgacgggg 1560 caggaagatt ccaaattcgg ttttgatctg cataatggac aggtcgaaca agccatcgaa 1620 caagtccgcc gctcgtctgc gtttaagctc ctcggcgtgc actgccacat cggttcgcaa 1680 atttttgata cggcaggatt tgtccttgca gcagacaaga ttttcgagaa gcttgcggaa 1740 tggcgggaga cttactcttt cattccggaa gtgctcaatc ttggcggggg cttcggcatc 1800 cgctatacaa aagacgacga geegettgca gctgatgttt atgttgaaaa aatcatcgag 1860 gcggtcaaag caaatgccga gcatttcggc tttgacatcc ctgagatttg gatcgaacca 1920 ggccggtctc tcgtcggtga tgcggggact acgctgtaca cgatcggttc tcaaaaagag 1980 gtgccgggca ttcgcaaata tgtagccatc gacggcggca tgagcgataa tatcaggccg 2040 gcgctttatg aggcaaaata tgaagcagcc gtcgccaaca ggatgaacga tgcttgtcat 2100 gataccgcat caatcgcagg aaaatgctgc gaaagcggag atatgctgat ttgggatttg 2160 gaaatccccg aagttcgcga cggagatgtg ctcgccgttt tctgcaccgg tgcgtacggc 2220 tacagcatgg ccaacaacta caaccgcatt ccgcgcccgg ccgtcgtctt tgtcgaggac 2280 ggggaagcgc agctcgtcat tcagagagag acgtatgagg atatcgtcaa gctggatctg 2340 ccgctgaaat cgaaagtcaa acaataaaaa aatggagatt ccctaagagg ggggtctcca 2400 tttttaattc aagcacgaaa aacacttccc ggtgatcggg aggtgttttt tgttaaaaag 2460 atcatgacat gcatagaaca gcgaccgggc tagttgtata taatattgtg aatttaacaa 2520 aaaatttaca aaggagatga taaaggcaat gaccagggtg aaaaggatga gatttgctga 2580 tttgttggat ttagaggcgg agtagatgaa accggccaaa gtatccctac tccaccgatt 2640 gctccagtgc ctgaagcaat gtgttgattg taacacagta aatcgtttta cagcaataaa 2700 catttttgtg aatattttat tgattttggc tgtgatctca ttcccatatt ctgctgcggc 2760 ccatggcgca acacagtccg gcgatcaata ttcaagcttt gaagaattgg agcggaatga 2820 agatccagct tcttaccgaa ttacggagaa gaacgcaaga gtgccgatgc tcatcatggc 2880 catccatgga ggcggcatcg aacccggaac gagcgaaatc gccaatgaag tgtccaaaaa 2940 ctattccctg tacttgtttg aagggctgaa atcatcaggc aatacggacc ttcacattac 3000 aagcacgcgt tttgacgagc cagcggcgct cgcaattact gcaagccacc agtatgtcat 3060 gtcgctccac ggctattaca gtgaagaccg cgatattaaa gtaggcggca cagaccgcgc 3120 taaaatcaga atattggttg atgagctgaa ccgctcgggg tttgccgctg aaatgctggg 3180 gacagatgac aagtatgccg gaacccatcc gaataacatc gccaacaagt cgctttccgg 3240 gctgagcatt cagcttgaaa tgagcacggg tttccgcaaa tctttattcg accggtttac 3300 actaaaagac agggcggcga cgcaaaacga aacgttttac cgatttacaa agctgctgac 3360 agattttatt catgaaaact atgaagaaga cggaggggat ttcccctctg caaaaataaa 3420 acaccccctt caagtgaaaa aaggaggtgt ttcggcggtt gtgttaaccg ttggactctg 3480 aggtgccgcc gccggtgaat acggaaacga tggcgttcca cagagacaca aagaagtcga 3540 tcagtttttg aagaaagttt tgtccttctt cagaatccaa gaatttcgtg attttatcct 3600 ttgctttgtc aagctggtct ccaacctggt tccagtcgat attaatattt ttcatgttat 3660 taaataaaga tataagagag tttttctgat cttctgtgag tgtcacgcca agttcggaag 3720 cagccgaatc aatcgttttc tccaattcct cttttgactc gggaactccg tttttcgaga 3780 tttcttcctt gactttggcc atcagcgctg acgcgttttc actgccgatt ttctcgccaa 3840 gctctgaagt ggtgacaagc tcttcattcg cgaccttttt cacatcttcg gaaatttttt 3900 cgcccgaagt cgtttcatac gctttcatca atccggttaa agcggctgtg cc 3952
<210> 49 <211 >6837 <212> DNA <213> Plasmid pMOL1642 <220> <221 > misc_feature <222> (669)..(669) <223> unknown <400> 49 gatcttcctt caggttatga ccatctgtgc cagttcgtaa tgtctggtca actttccgac 60 tctgagaaac ttctggaatc gctagagaat ttctggaatg ggattcagga gtggacagaa 120 cgacacggat atatagtgga tgtgtcaaaa cgcataccat tttgaacgat gacctctaat 180 aattgttaat catgttggag ctcagtgaga gcgaagcgaa cacttgattt tttaattttc 240 tatcttttat aggtcattag agtatactta tttgtcctat aaactattta gcagcataat 300 agatttattg aataggtcat ttaagttgag catattagag gaggaaaatc ttggagaaat 360 atttgaagaa cccgaggatc catgctgtcc agactgtccg ctgtgtaaaa aataggaata 420 aaggggggtt gttattattt tactgatatg taaaatataa tttgtataag aaaatgagag 480 ggagaggaaa catgaagaag attgcaattg cggcgattac agcgacaagc gtgctggctc 540 tcagcgcatg cagcggggga gattctgagg ttgttgcgga aacaaaagct ggaaatatta 600 caaaagaaga cctttatcaa acattaaaag acaatgccgg agcggacgca ctgaacatgc 660 ttgttcagna aaaagtactc gatgataaat acgatgtctc cgacaaagaa atcgacaaaa 720 agctgaacga gtacaaaaaa tcaatgggtg accagctcaa ccagctcatt gaccaaaaag 780 gcgaagactt cgtcaaagaa cagatcaaat acgaacttct gatgcaaaaa gccgcaaagg 840 ataacataaa agtaaccgat gatgacgtaa aagaatatta tgacggcctg aaaggcaaaa 900 tccacttaag ccacattctt gtgaaagaaa agaaaacggc tgaagaagtt gagaaaaagc 960 tgaaaaaagg cgaaaaattc gaagaccttg caaaagagta ttcggtaccc gggtctagag 1020 tcgacgcggc cgcaaccatt tgatcaaagc ttgcatgcct gcaggtcgat tcacaaaaaa 1080 taggcacacg aaaaacaagt taagggatgc agtttatgca tcccttaact tacttattaa 1140 ataatttata gctattgaaa agagataaga attgttcaaa gctaatattg tttaaatcgt 1200 caattcctgc atgttttaag gaattgttaa attgattttt tgtaaatatt ttcttgtatt 1260 ctttgttaac ccatttcata acgaaataat tatacttttg tttatctttg tgtgatattc 1320 ttgatttttt tctacttaat ctgataagtg agctattcac tttaggttta ggatgaaaat 1380 attctcttgg aaccatactt aatatagaaa tatcaacttc tgccattaaa agtaatgcca 1440 atgagcgttt tgtatttaat aatcttttag caaacccgta ttccacgatt aaataaatct 1500 cattagctat actatcaaaa acaattttgc gtattatatc cgtacttatg ttataaggta 1560 tattaccata tattttatag gattggtttt taggaaattt aaactgcaat atatccttgt 1620 ttaaaacttg gaaattatcg tgatcaacaa gtttattttc tgtagttttg cataatttat 1680 ggtctatttc aatggcagtt acgaaattac acctctttac taattcaagg gtaaaatggc 1740 cttttcctga gccgatttca aagatattat catgttcatt taatcttata tttgtcatta 1800 ttttatctat attatgtttt gaagtaataa agttttgact gtgttttata tttttctcgt 1860 tcattataac cctctttaat ttggttatat gaattttgct tattaacgat tcattataac 1920 cacttatttt ttgtttggtt gataatgaac tgtgctgatt acaaaaatac taaaaatgcc 1980 catatttttt cctccttata aaattagtat aattatagca cgagctctga taaatatgaa 2040 catgatgagt gatcgttaaa tttatactgc aatcggatgc gattattgaa taaaagatat 2100 gagagattta tctaatttct tttttcttgt aaaaaaagaa agttcttaaa ggttttatag 2160 ttttggtcgt agagcacacg gtttaacgac ttaattacga agtaaataag tctagtgtgt 2220 tagactttat gaaatctata tacgtttata tatatttatt atccggaggt gtagcatgtc 2280 tcattcaatt ttgagggttg ccagagttaa aggatcaagt aatacaaacg ggatacaaag 2340 acataatcaa agagagaata aaaactataa taataaagac ataaatcatg aggaaacata 2400 taaaaattat gatttgatta acgcacaaaa tataaagtat aaagataaaa ttgatgaaac 2460 gattgatgag aattattcag ggaaacgtaa aattcggtca gatgcaattc gacatgtgga 2520 cggactggtt acaagtgata aagatttctt tgatgattta agcggagaag aaatagaacg 2580 attttttaaa gatagcttgg agtttctaga aaatgaatac ggtaaggaaa atatgctgta 2640 tgcgactgtc catctggatg aaagagtccc acatatgcac tttggttttg tccctttaac 2700 agaggacggg agattgtctg caaaagaaca gttaggcaac aagaaagact ttactcaatt 2760 acaagataga tttaatgagt atgtgaatga gaaaggttat gaacttgaaa gaggcacgtc 2820 caaagaggtt acagaacgag aacataaagc gatggatcag tacaagaaag atactgtatt 2880 tcataaacag gaactgcaag aagttaagga tgagttacag aaggcaaata agcagttaca 2940 gagtggaata gagcatatga ggtctacgaa accctttgat tatgaaaatg agcgtacagg 3000 tttgttctct ggacgtgaag agactggtag aaagatatta actgctgatg aatttgaacg 3060 cctgcaagaa acaatctctt ctgcagaacg gattgttgat gattacgaaa atattaagag 3120 cacagactat tacacagaaa atcaagaatt aaaaaaacgt agagagagtt tgaaagaagt 3180 agtgaataca tggaaagagg ggtatcacga aaaaagtaaa gaggttaata aattaaagcg 3240 agagaatgat agtttgaatg agcagttgaa tgtatcagag aaatttcaag ctagtacagt 3300 gactttatat cgtgctgcga gggcgaattt ccctgggttt gagaaagggt ttaataggct 3360 taaagagaaa ttctttaatg attccaaatt tgagcgtgtg ggacagttta tggatgttgt 3420 acaggataat gtccagaagg tcgatagaaa gcgtgagaaa cagcgtacag acgatttaga 3480 gatgtagagg tacttttatg ccgagaaaac tttttgcgtg tgacagtcct taaaatatac 3540 ttagagcgta agcgaaagta gtagcgacag ctattaactt tcggtttcaa agctctagga 3600 tttttaatgg acgcagcgca tcacacgcaa aaaggaaatt ggaataaatg cgaaatttga 3660 gatgttaatt aaagaccttt ttgaggtctt tttttcttag atttttgggg ttatttaggg 3720 gagaaaacat aggggggtac tacgacctcc cccctaggtg tccattgtcc attgtccaaa 3780 caaataaata aatattgggt ttttaatgtt aaaaggttgt tttttatgtt aaagtgaaaa 3840 aaacagatgt tgggaggtac agtgatggtt gtagatagaa aagaagagaa aaaagttgct 3900 gttactttaa gacttacaac agaagaaaat gagatattaa atagaatcaa agaaaaatat 3960 aatattagca aatcagatgc aaccggtatt ctaataaaaa aatatgcaaa ggaggaatac 4020 ggtgcatttt aaacaaaaaa agatagacag cactggcatg ctgcctatct atgactaaat 4080 tttgttaagt gtattagcac cgttattata tcatgagcga aaatgtaata aaagaaactg 4140 aaaacaagaa aaattcaaga ggacgtaatt ggacatttgt tttatatcca gaatcagcaa 4200 aagccgagtg gttagagtat ttaaaagagt tacacattca atttgtagtg tctccattac 4260 atgataggga tactgataca gaaggtagga tgaaaaaaga gcattatcat attctagtga 4320 tgtatgaggg taataaatct tatgaacaga taaaaataat tacagaagaa ttgaatgcga 4380 ctattccgca gattgcagga agtgtgaaag gtcttgtgag atatatgctt cacatggacg 4440 atcctaataa atttaaatat caaaaagaag atatgatagt ttatggcggt gtagatgttg 4500 atgaattatt aaagaaaaca acaacagata gatataaatt aattaaagaa atgattgagt 4560 ttåttgatga acaaggaatc gtagaattta agagtttaat ggattatgca atgaagttta 4620 aatttgatga ttggttcccg cttttatgtg ataactcggc gtatgttatt caagaatata 4680 taaaatcaaa tcggtataaa tctgaccgat agattttgaa tttaggtgtc acaagacact 4740 cttttttcgc accagcgaaa actggtttaa gccgactgcg caaaagacat aatcgactct 4800 agaggatcct tttagtccag ctgatttcac tttttgcatt ctacaaactg cataactcat 4860 atgtaaatcg ctccttttta ggtggcacaa atgtgaggca ttttcgctct ttccggcaac 4920 cacttccaag taaagtataa cacactatac tttatattca taaagtgtgt gctctgcgag 4980 gctgtcggca gtgccgacca aaaccataaa acctttaaga cctttctttt ttttacgaga 5040 aaaaagaaac aaaaaaacct gccctctgcc acctcagcaa aggggggttt tgctctcgtg 5100 ctcgtttaaa aatcagcaag ggacaggtag tattttttga gaagatcact caaaaaatct 5160 ccacctttaa acccttgcca atttttattt tgtccgtttt gtctagctta ccgaaagcca 5220 gactcagcaa gaataaaatt tttattgtct ttcggttttc tagtgtaacg gacaaaacca 5280 ctcaaaataa aaaagataca agagaggtct ctcgtatctt ttattcagca atcgcgcccg 5340 attgctgaac agattaataa rgagccgcgg atatcgatgc cttgtcagag agattcctga 5400 agagcggcag gataaggtat ttagaatgat taatgtgctg atcttaattt tattgatctc 5460 atcattcatt gagatttcct ttacggtgta aagaaaaagg atagctgccg atcgtattga 5520 tccggcagct atccttttgt ttattagcat atccaagaag caccaataat aattaataag 5580 atgaacagca ccacaagcag cgcaaagccg ccagcgaaac ctcctgcata accgtcgccc 5640 atattgacac ctcctctgcc ccagtcgtta cattagtgta tgcacgaatg tcatgaaacg 5700 attaggctat cgtccaaaag aaaagaaccg cctgaaaaaa tgacggttct tttctcattt 5760 tctaaggttt tagtacagat aagctgcacc aacgatgatt aataaaatga acaacacgac 5820 caataaagca aaaccgcttg agtatcctcc gctcatgtta ttgacctcga attctgatca 5880 aatggttcag tgagagcgaa gcgaacactt gattttttaa ttttctatct tttataggtc 5940 attagagtat acttatttgt cctataaact atttagcagc ataatagatt tattgaatag 6000 gtcatttaag ttgagcatat tagaggagga aaatcttgga gaaatatttg aagaacccga 6060 acgcgtgagt agttcaacaa acgggccagt ttgttgaaga ttagatgcta taattgttat 6120 taaaaggatt gaaggatgct taggaagacg agrtattaat'agctgaataa gaacggtgct 6180 ctccaaatat tcttatttag aaaagcaaat ctaaaattat ctgaaaaggg aatgagaata 6240 gtgaatggac caataataat gactagagaa gaaagaatga agattgttca tgaaattaag 6300 gaacgaatat tggataaata tggggatgat gttaaggcta ttggtgttta tggctctctt 6360 ggtcgtcaga ctgatgggcc ctattcggat attgagatga tgtgtgtcat gtcaacagag 6420 gaagcagagt tcagccatga atggacaacc ggtgagtgga aggtggaagt gaattttgat 6480 agcgaagaga ttctactaga ttatgcatct caggtggaat cagattggcc gcttacacat 6540 ggtcaatttt tctctatttt gccgatttat gattcaggtg gatacttaga gaaagtgtat 6600 caaactgcta aatcggtaga agcccaaacg ttccacgatg cgatttgtgc ccttatcgta 6660 gaagagctgt ttgaatatgc aggcaaatgg cgtaatattc gtgtgcaagg accgacaaca 6720 tttctaccat ccttgactgt acaggtagca atggcaggtg ccatgttgat tggtctgcat 6780 catcgcatct gttatacgac gagcgcttcg gtcttaactg aagcagttaa gcaatca 6837
<210> 50 <211> 817 <212> DNA <213> Artificial sequence: repF expression cassette <400> 50 gaattccggc ccaacgatgg ctgatttccg ggttgacggc cggcggaacc aaggggtgat 60 cggtcggcgg aaatgaaggc ctgcggcgag tgcgggcctt ctgttttgag gattataatc 120 agagtatatt gaaagtttcg cgatcttttc gtataattgt tttaggcata gtgcaatcga 180 taagcttgaa ttcggaggcc gttattatat catgagcgaa aatgtaataa aagaaactga 240 aaacaagaaa aattcaagag gacgtaattg gacatttgtt ttatatccag aatcagcaaa 300 agccgagtgg ttagagtatt taaaagagtt acacattcaa tttgtagtgt ctccattaca 360 tgatagggat actgatacag aaggtaggat gaaaaaagag cattatcata ttctagtgat 420 gtatgagggt aataaatctt atgaacagat aaaaataatt acagaagaat tgaatgcgac 480 tattccgcag attgcaggaa gtgtgaaagg tcttgtgaga tatatgcttc acatggacga 540 tcctaataaa tttaaatatc aaaaagaaga tatgatagtt tatggcggtg tagatgttga 600 tgaattatta aagaaaacaa caacagatag atataaatta attaaagaaa tgattgagtt 660 tattgatgaa caaggaatcg tagaatttaa gagtttaatg gattatgcaa tgaagtttaa 720 atttgatgat tggttcccgc ttttatgtga taactcggcg tatgttattc aagaatatat 780 aaaatcaaat cggtataaat ctgaccgata gggatcc 817
REFERENCES CITED IN THE DESCRIPTION
This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.
Patent documents cited in the description • WQ9414568A [00021 • US4383202A [00311 • WQ9533836A [0037] . WO9117243A F004S1 • WQ9623073A [00641 [01571 • EP0506780A [0206] • US8100063A [0301] • DKPA200000981 [03071 • US-30217929B [0307]
Non-patent literature cited in the description • HONE et al.Microbial Pathogenesis, 1988, vol. 5. 407-418 [0002] • JOETGENSEN, S.T. et al.Biotechnology Techniques, 1998, vol. 12, 115-19 [6002] • SAMBROOKFRITSCHMANIATISMolecular Cloning: A Laboratory ManualCold Spring Harbor Laboratory
Pressl 9890000 [0017] • DNA Cloning: A Practical Approachl 9850000vol. I and II, [0017] • Nucleic Acid Hybridization 19850000 [0017] • Transcription And Translation19840000 [0017]. • Animal Cell Culturel 9860000 [0017] • Immobilized Cells And EnzymesIRL Pressl 9860000 [8017] • B. PERBALA Practical Guide To Molecular Cloningl 9840000 [0017] . BEAUCAGECARUTHERSTetrahedron Letters, 1981, vol. 22, 1859-1869 [00301 . MATTHES et al.EMBO Journal, 1984, vol. 3, 801-805.[00303. • SAIKI et al.Science, 1988, vol. 239, 487-491 [0031] • VILLA-KAMAROFF et al.Proceedings of the National Academy of Sciences USA, 1978, vol. 75, 3727-3731 [00381 • DEBOER et al.Proceedings of the National Academy of Sciences USA, 1983, vol. 80, 21-2510.030} • Useful proteins from recombinant bacteriaScientific American, 1980, vol. 242, 74-94 [6039] • EHRLICHProceedings of the National Academy of Sciences USA, 1978, vol. 75, 1433- [00501 • CHANGCOHENMolecular General Genetics, 1979, vol. 168, 111-115 [0053] . YOUNGSPIZIZINJournal of Bacteriology, 1961, vol. 81,823-829 [00531 • DUBNARDAVIDOFF-ABELSONJournal of Molecular Biology, 1971, vol. 56, 209-221 10053]. . SHIGEKAWADOWERBiotechniques, 1988, vol. 6, 742-751 F00531 . KOEHLERTHORNEJournal of Bacteriology, 1987, vol. 169, 5771-5278 .[0053]. • More Gene Manipulations in FungiAcademic Pressl 9910000 [0054] • Protein PurificationVCH Publishersl 9890000 [00571 • M AN I ATI S, T. FRITSCH, E. F.SAMBROOK, J.Molecular Cloning. A laboratory manualCold Spring Harbor Laboratoriesl 9820000 [0295] • Current Protocols in Molecular BiologyJohn Wiley and Sonsl 9950000 [0295] • Molecular Biological Methods for BacillusJohn Wiley and Sonsl 9900000 [0295] • YANISCH-PERRON, C.VIEIRA J.MESSING, J.Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectorsGene, 1985, vol. 33, 103-119.[0299.1 • HORINOUCHI, S.WEISBLUM, B.Nucleotide sequence and functional map of pE194, a plasmid that specifies inducible resistance to macrolide, lincosamide, and streptogramin type B antibioticsJ. Bacteriol., 1982, vol. 150, 804-814 [0300] . DIDERICHSEN, B.WEDSTED, U.HEDEGAARD, L.JENSEN, B. R.SJ0HOLM, C.CIoning of aldB, which encodes acetolactate decarboxylase, an exoenzyme from Bacillus brevisJournal of Bacteriology, 1990, vol. 172, 4315-4321 [03031
Claims (22)
1. A method of constructing a bacterial cell comprising at least two copies of a gene of interest stably integrated into the chromosome of different positions, the method comprising the steps of: a) providing a bacterial host cell comprising at least a chromosomal gene of interest, and which includes one or more conditionally essential chromosomal gene (s) that have been modified to make the gene (s) are non-functional (or any); b) providing a DNA construct comprising: i) a modified non-functional copy of the (de) conditionally essential chromosomal gene (s) in step a); and ii) at least one copy of the gene of interest flanked on one side of i) and, on the other hand, a DNA fragment homologous to a host cell DNA sequence located on the host cell chromosome next to the (de) contingent essential chromosomal gene (s) in step a); wherein a first recombination between the modified copy of i) and it (they) amended conditionally essential chromosomal gene (s) in step a) restore it (they) conditionally essential chromosomal gene (s) to funktionaiitet and makes the cell selectable; c) Introduction of the DNA construct into the host cell and culturing the cell under selective conditions that require it (they) functional conditionally essential gene (s); and d) selecting a host cell that grows under the selective conditions, according to the previous step; wherein the at least one copy of the gene of interest is integrated into the host cell chromosome adjacent to the gene (s) in step a); and optionally e) repeating steps a) to d) at least once using a different (e) conditionally essential (or any) chromosomally (e) gene (s) in step a) at each iteration, where it (the ) conditionally essential chromosomal gene (s) in the host cell, which has been changed, encoding a D-alanine racemase, or one or more genes which are required for the host cell can grow on a minimal medium supplemented with only one specific main carbon source, or is one or more gene (s) coding for one or more polypeptide (s) involved in amino acid synthesis and the gene (s) of non-functionality renders the cell auxotrophic for one or more amino acid (s), and wherein the recovery of geneis (the ) making the cell funktionaiitet prototrophic for the amino acid (s).
2. The method of claim 1, wherein after the step of introducing the DNA construct and culturing the cell under selective conditions, or after the step of selecting a host cell that is a second recombination between the DNA fragment of b) ii) and the homologous host cell DNA sequence.
3. A method according to any one of claims 1-2, wherein the gene of interest encodes an enzyme, preferably an amylolytic enzyme, a lipolytic enzyme, a proteolytic enzyme, a cellulytic enzyme, an oxidoreductase ora planiece! Ie-wall degrading enzyme, and more preferably an enzyme with an activity selected from the group consisting of aminopeptidase, amylase, amyloglucosidase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta-galactosidase, glucoamylase, glucose oxidase, glucosidase , haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinase, peroxidase, phytase, phenoloxidase, polyphenoloxidase, protease, ribonuclease, transferase, transglutaminase, or xylanase.
4. A method according to any one of claims 1-3, wherein the (de) conditionally essential chromosomal gene (s) of the host cell is modified by partial deletion of the gene (s), or by introducing one or more mutations in the gene (s)
5. A method according to any one of claims 1-4, wherein the (de) conditionally essential chromosomal gene (s) in the host cell, which is changed, is a valley homolog from a Bacillus cell, more preferably the gene is homologous to the valley of Bacillus subtilis, and most preferably, the gene (s) dal gene of Bacillus licheniformis.
6. The method of claim 1, wherein the (de) conditionally essential chromosomal gene (s) of the host cell, which has been modified is from a xylose operon, preferably, the gene (s) is homologous (e) to the xylA gene from Bacillus subtilis and most preferably, the gene (s) is homologous (s) for one or more genes of xylose isomerase operon of Bacillus licheniformis.
7. The method of claim 1, wherein the (de) conditionally essential chromosomal gene (s) of the host cell, which has been changed, encoding a galactokinase (EC 27.1.6), a UTP-dependent pyridin-ophosphorylase (EC 2.7.7.10) , a UDP-glucose-dependent uridylyltransferase (EC 2.7.7.12), or UDP-galactose epimerase (EC 5.1.2.3), preferably encoding gene (s) for a UDP-galactose epimerase (EC 5.1.2.3), more preferably, the gene (s) is homologous (e) the galE bya Bacillus, and most preferably, the galE gene of Bacillus licheniformis.
8. The method of claim 1, wherein the (de) conditionally essential chromosomal gene (s) of the host cell ,, which is altered, one or more gene (s) of a gluconate operon, preferably encoding gene (erene) for a gluconate kinase (EC 2.7.1.12), or a gluconate permease or both, more preferably, the gene (s) one or more genes that are homologous (e) to gntK- or gntP- genes from Bacillus subtilis, and most preferably, the gene (s) gntK- or gntP gene from Bacillus licheniformis.
9. The method of claim 1, wherein the (de) conditionally essential chromosomal gene (s) of the host cell that is altered, one or more gene (s) of a glycerol operon, preferably encoding gene (s) for a glycerol absorption-facilitator (permease), a glycerol kinase, or a glycerol dehydrogenase, more preferably, the gene (s) one or more genes which are homologous to glpP-, glpF-, glpK, glpD and genes from Bacillus subtilis and most preferably, the gene (s) one or more genes of glpP-, glpF-, glpK, glpD and genes from Bacillus licheniformis shown in SEQ ID No: 26th
10. The method of claim 1, wherein the (de) conditionally essential chromosomal gene (s) of the host cell that is altered, one or more gene (s) of an arabinose operon, preferably encoding gene (s) for an arabinose isomerase, more preferably, the gene (s) is homologous (e) to the araA gene from Bacillus subtilis, and most preferably, the gene (s) araA gene from Bacillus licheniformis shown in SEQ ID No: 38th
11. The method of any of claims 1-10, wherein the host cell is a gram-positive bacterial cell, preferably a Bacillus cell, most preferably a Bacillus cell chosen from the group consisting of Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii , Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.
12. The bacterial host cell comprising at least two copies of a gene of interest stably integrated into the chromosome containing less than 500 exogenous base pairs per integrated gene of interest, wherein at least one copy is integrated next to a conditional essential gene encoding a D-alanine racemase; a conditional essential gene, which is necessary for the host cell can grow on a minimal medium supplemented with only one specific main carbon source; a conditional essential gene of xylose operon, a conditionally essential gene encodes a galactokinase (EC 2.7.1.6), a UTP-dependent pyrophosphorylase (EC 2.7.7.10), UDP-glucose-dependent uridylyltransferase (EC 2.7. 7.12), or UDP-galactose epimerase (EC 5.1.2.3); a conditional essential gene of gluconate operon, a glycerol operon, or arabinose operon; Or a conditionally essential gene encodes one or more polypeptide (s) involved in amino acid synthesis; wherein the gene of interest is separated from the conditionally essential gene of no more than 500 base pairs, and wherein the cell obtained according to any of the methods defined in claims 1-11.
13. The cell of claim 12, wherein the gene of interest is separated from the conditionally essential locus of no more than 250 base pairs, and most preferably no more than 100 base pairs.
14. The cell of any of claims 12-13 which is a Gram-positive bacterial cell, preferably a Bacillus cell, most preferably a Bacillus cell chosen from the group consisting of Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus ientus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.
15. The cell of any of claims 12-14, wherein a copy of the gene of interest is integrated next to a gene that is homologous to or xylR- xylA gene from Bacillus subtilis, preferably next to or xylR xylA from Bacillus licheniformis .
16. The cell of any of claims 12-15, wherein a copy of the gene of interest is integrated next to a gene that is homologous to the galE gene from Bacillus subtilis, preferably next to the galE from Bacillus licheniformis.
17. The cell of any of claims 12-15, wherein a copy of the gene of interest is integrated next to a gene encoding a gluconate kinase (EC 2.7.1.12), or a gluconate permease, more preferably next to the a gene homologous to a Bacillus subtilis gene selected from the group consisting of gntR, gntK, gntP and gntZ, and most preferably adjacent to gntR, gntK, gntP or gntZ from Bacillus licheniformis.
18. The cell of any of claims 12-15, wherein a copy of the gene of interest is integrated next to a gene encoding a glycerol uptake facilitator (permease), a glycerol kinase, or a glycerol dehydrogenase, more preferably the gene is homologous to glpP-, glpF-, glpK, or the glpD gene of Bacillus subtilis, and most preferably, the gene glpP-, glpF-, glpK, or the glpD gene from Bacillus licheniformis shown in SEQ ID No: 26th
19. The cell of any of claims 12-15, wherein a copy of the gene of interest is integrated next to a gene that encodes an arabinose isomerase, preferably, the gene homologous to ara / 4 gene from Bacillus subtilis, and most preferably the gene is the araA gene from Bacillus licheniformis shown in SEQ ID No: 38th
20. The cell of any of claims 12-15, wherein a copy of the gene of interest is integrated next to a gene encoding one or more polypeptide (s) involved in lysine or methioninsyntese, more preferably, the gene (s) homologue (s) or to metC- / ys / A genes from Bacillus subtilis, and most preferably, the gene (s) or metC- lysA gene from Bacillus Hcheniformis.
21. The cell of any of claims 12-20, wherein the gene of interest encodes an enzyme, preferably an amylolytic enzyme, a lipolytic enzyme, a proteolytic enzyme, a cellulytic enzyme, an oxidoreductase or a plant cell-wall degrading enzyme, and more preferably an enzyme with an activity selected from the group consisting of aminopeptidase, amylase, amyloglucosidase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta-galactosidase, glucoamylase, glucose oxidase, glucosidase, haloperoxidase , hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinase, peroxidase, phytase, phenoloxidase, polyphenoloxidase, protease, ribonuclease, transferase, transglutaminase, or xylanase.
22. A process for producing an enzyme of interest comprising culturing a bacterial cell of claim 21 under conditions suitable for production of the enzyme and, optionally, purification of the enzyme.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DKPA200000981 | 2000-06-23 | ||
US21792900P | 2000-07-13 | 2000-07-13 | |
PCT/DK2001/000436 WO2002000907A1 (en) | 2000-06-23 | 2001-06-21 | Method for stable chromosomal multi-copy integration of genes |
Publications (1)
Publication Number | Publication Date |
---|---|
DK1297170T3 true DK1297170T3 (en) | 2016-03-14 |
Family
ID=34178321
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DK01943190.7T DK1297170T3 (en) | 2000-06-23 | 2001-06-21 | A process for stable chromosomal integration of multiple copies of the genes |
Country Status (2)
Country | Link |
---|---|
CN (1) | CN1322138C (en) |
DK (1) | DK1297170T3 (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106282219A (en) * | 2015-05-13 | 2017-01-04 | 青岛蔚蓝生物集团有限公司 | A kind of method converting wild type Bacillus clausii stable, efficient |
CN106191093B (en) * | 2016-09-18 | 2019-11-08 | 湖北工业大学 | The method of cellulose excision enzyme expression quantity under the conditions of enhancing B. amyloliquefaciens alkaline |
CN106191013B (en) * | 2016-09-27 | 2019-11-08 | 湖北工业大学 | The method that temperature, controlling pH cellulase are expressed in bacillus megaterium |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK594084A (en) * | 1984-12-12 | 1986-06-13 | Novo Industri As | PROCEDURE FOR STABILIZING EXTRA-CHROMOSOMAL ELEMENTS IN BACTERIA IN CULTURE |
PT981637E (en) * | 1997-03-14 | 2005-09-30 | Biogen Idec Inc | METHOD FOR INTEGRATING GENES IN SPECIFIC SITES IN MAMIFERO CELLS THROUGH RECOMBINATION APPROVAL AND VECTORS FOR THE REALIZATION OF THE SAME |
JP4350894B2 (en) * | 1998-02-12 | 2009-10-21 | ノボザイムス アクティーゼルスカブ | Prokaryotic cells containing two copies of a gene transcribed in different directions |
EP0972838B1 (en) * | 1998-07-15 | 2004-09-15 | Roche Diagnostics GmbH | Escherichia coli host/vector system based on antibiotic-free selection by complementation of an auxotrophy |
US6291245B1 (en) * | 1998-07-15 | 2001-09-18 | Roche Diagnostics Gmbh | Host-vector system |
-
2001
- 2001-06-21 DK DK01943190.7T patent/DK1297170T3/en active
- 2001-06-21 CN CNB01811587XA patent/CN1322138C/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN1437656A (en) | 2003-08-20 |
CN1322138C (en) | 2007-06-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6808896B2 (en) | Method for stable chromosomal multi-copy integration of genes | |
Schulz et al. | hrcA, the first gene of the Bacillus subtilis dnaK operon encodes a negative regulator of class I heat shock genes | |
EP1056873B1 (en) | Methods for producing a polypeptide in a bacillus cell | |
Zuber et al. | CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis | |
US8993304B2 (en) | Chloramphenicol resistance selection in Bacillus licheniformis | |
US8512982B2 (en) | Enhanced protein production in Bacillus | |
US5958728A (en) | Methods for producing polypeptides in mutants of bacillus cells | |
EP0941349B1 (en) | Methods for producing polypeptides in surfactin mutants of bacillus cells | |
EP1995319A1 (en) | Bacillus licheniformis mutant host cell | |
Antelmann et al. | A gene at 333 degrees on the Bacillus subtilis chromosome encodes the newly identified sigma B-dependent general stress protein GspA | |
Meijer et al. | Characterization of single strand origins of cryptic rolling-circle plasmids from Bacillus subtilis | |
Sprengel et al. | Translationally coupled initiation of protein synthesis in Bacillus subtilis | |
Shazand et al. | Similar organization of the nusA-infB operon in Bacillus subtilis and Escherichia coli | |
US6100063A (en) | Procaryotic cell comprising at least two copies of a gene | |
DK1297170T3 (en) | A process for stable chromosomal integration of multiple copies of the genes | |
WO1999041358A1 (en) | A prokaryotic cell comprising two copies of a gene transcribed in different directions | |
RU2114909C1 (en) | Dna fragment corresponding to replication start region isolated from plasmid of microorganism bacillus thuringiensis hd73, expression vector of crystalline protein toxin b thuringiensis, method of preparing an exogeneous crystalline protein toxin of b thuringiensis in b thuringiensis cells and an insecticide agent containing b thuringiensis bacteria | |
CN114981428A (en) | Selectable marker-free methods for modifying the genome of bacillus and compositions thereof | |
AU8312591A (en) | Hybrid alpha-amylase promoters |